proba
float64 0.5
1
| text
stringlengths 16
174k
|
|---|---|
0.948835 |
The United States Coast Guard (USCG) is a branch of the United States Armed Forces and one of the country's seven uniformed services. The Coast Guard is a maritime, military, multi-mission service unique among the U.S. military branches for having a maritime law enforcement mission (with jurisdiction in both domestic and international waters) and a federal regulatory agency mission as part of its mission set. It operates under the U.S. Department of Homeland Security during peacetime, and can be transferred to the U.S. Department of the Navy by the U.S. President at any time, or by the U.S. Congress during times of war. To date, this has happened twice, in 1917 and 1941, during World War I and World War II, respectively.
Created by Congress on 4 August 1790 at the request of Alexander Hamilton as the "Revenue Marine", it is the oldest continuous seagoing service of the United States, although the U.S. Navy lists its founding as 1775, the formation of the Continental Navy. However, that was disbanded in 1785, and the modern U.S. Navy in its present form was founded in 1794. As Secretary of the Treasury, Hamilton headed the Revenue Marine, whose original purpose was that of a collector of customs duties in the nation's seaports. By the 1860s the service was known as the U.S. Revenue Cutter Service and the term Revenue Marine gradually fell into disuse.
The Coast Guard was formed from the merger of the Revenue Cutter Service and the U.S. Department of the Treasury. As one of the country's five armed services, the Coast Guard has been involved in every war from 1790 up to the Iraq War and the War in Afghanistan. As of 2012 the Coast Guard had approximately 42,000 men and women on active duty, 7,900 reservists, 32,000 auxiliarists, and 8,700 full-time civilian employees. In terms of size, the U.S. Coast Guard by itself is the world's 12th largest naval force.
The Coast Guard's legal authority differs from the other four armed services: it operates simultaneously under Title 10 of the U.S. Department of Defense or directly for the President in accordance with Title 14 USC 1–3. The Coast Guard's enduring roles are maritime safety, security, and stewardship. To carry out those roles the Coast Guard has 11 statutory missions as defined in , which include enforcing U.S. law in the world's largest exclusive economic zone of 3.4 million square miles (8,800,000 km2). The Coast Guard motto is Semper Paratus (English: Always ready).
A boatswain’s mate watches from the side port door as Coast Guard Cutter Bertholf’s Over-The-Horizon small boat departs to receive personnel from Coast Guard Cutter Chandeleur.
The Coast Guard has roles in maritime homeland security, maritime law enforcement (MLE), search and rescue (SAR), marine environmental protection (MEP), and the maintenance of river, intracoastal and offshore aids to navigation (ATON).
A Coast Guard rescue swimmer assisting with the rescue of a pregnant woman during Hurricane Katrina.
While not the oldest, search and rescue (SAR) is one of the Coast Guard's best known missions. The National Search and Rescue Plan designates the Coast Guard as the federal agency responsible for maritime SAR operations, and the United States Air Force as the federal agency responsible for inland SAR. Both agencies maintain rescue coordination centers to coordinate this effort, and have responsibility for both military and civilian search and rescue. The two services jointly provide instructor staff for the National Search and Rescue School that trains SAR mission planners and coordinators. Previously located on Governor's Island, New York, the school is now located at Coast Guard Training Center Yorktown at Yorktown, Virginia.
Dolbow, Jim (2012). The Coast Guardsman's Manual (10th ed.). Naval Institute Press, Annapolis, Maryland.
^ a b c "Coast Guard Snapshot 2012" (PDF). United States Coast Guard. Retrieved 3 February 2013.
^ "Homeland Security Budget-in-Brief Fiscal Year 2009" (PDF).
^ a b c United States Coast Guard. "Daily Chronology of Coast Guard History". United States Department of Homeland Security. 2003 - Administrative control of the Coast Guard transferred to the newly created Department of Homeland Security from the Department of Transportation, where it had served since 1 April 1967.
^ United States Coast Guard. "Timeline of Coast Guard Organizational History". United States Department of Homeland Security. Retrieved 18 January 2014. 1 April 1967: Executive Order 16781 transferred the Coast Guard from the Treasury Department to the newly-formed Department of Transportation.
^ a b United States Coast Guard. "Timeline of Coast Guard Organizational History". United States Department of Homeland Security. Retrieved 18 January 2014. 1 November 1941: President Roosevelt's Executive Order 8929 transferred the Coast Guard to Navy Department control. In compliance with Executive Order 9666, the Coast Guard returned to Treasury Department control.
^ United States Coast Guard. "Timeline of Coast Guard Organizational History". United States Department of Homeland Security. Retrieved 18 January 2014. 28 August 1919: Coast Guard reverted to Treasury Department after President Wilson signed Executive Order 3160.
^ a b United States Coast Guard. "Timeline of Coast Guard Organizational History". United States Department of Homeland Security. Retrieved 18 January 2014. 6 April 1917: With the declaration of war against Germany the Coast Guard was transferred by Executive Order to the control of the Navy Department.
^ "An Act To create the Coast Guard by combining therein the existing Life-Saving Service and Revenue-Cutter Service". January 1915. Retrieved 8 September 2013. Be it enacted by the Senate and House of Representatives o the United States of America in Congress assembled, That there shall be established in lieu of the existing Revenue-Cutter Service and the Life-Saving Service, to be composed of those two existing organizations, with the existing offices and positions and the incumbent officers and men of those two services, the Coast Guard, which shall constitute a part of the military forces of the United States and which shall operate under the Treasury Department in time of peace and operate as a part of the Navy, subject to the orders of the Secretary of the Navy, in time of war or when the President shall so direct. When subject to the Secretary of the Navy in time of war the expense of the Coast Guard shall be paid by the Navy Department; Provided, That no provision of this Act shall be construed as giving any officer of either the Coast Guard or the Navy, military or other control at any time over any vessel, officer, or man of the other service except by direction of the President.
^ a b c d "U.S. Coast Guard Heraldry" (PDF). United States Coast Guard. April 2011. pp. 3–1. COMDTINST M5200.14A.
^ Johnson, Robert Irwin (1987). Guardians of the Sea, History of the United States Coast Guard, 1915 to the Present. Annapolis, Maryland: Naval Institute Press. pp. 1–2.
^ Scheina, Robert (11 October 2012). "The U.S. Coast Guard at War". Coast Guard Historian's Office.
^ LaRouche, Monique (2012). "The Coast Guard RAIDs Afghanistan". Reservist (U.S. Coast Guard) LXI (1): 18.
^ Stone, Andrea (21 December 2011). "Coast Guard Cutters Rust Away, Break Down".
^ The Coast Guard Gets It Right Amanda Ripley. TIME. 23 October 2005.
^ "National Search and Rescue Plan (USA) 2007". Uscg.mil. 2012-06-22. Retrieved 2013-02-03.
^ "National Search And Rescue Committee". U. S. Coast Guard Office of Search and Rescue. U.S. Coast Guard. Retrieved 26 March 2013.
^ "National Oil and Hazardous Substances Pollution Contingency Plan". epa.gov. Retrieved 2 December 2014.
^ "10 USC §101. Definitions" (PDF).
^ "14 USC §1. Establishment of Coast Guard" (PDF).
^ "Homeland Security Act of 2002" (PDF).
^ Baldinelli, D.C. (9 December 2002). "The U.S. Coast Guard's Assignment to the Department of Homeland Security: Entering Uncharted Waters or Just a Course Correction?". United States Coast Guard. United States Department of Homeland Security. Retrieved 18 January 2014. On November 25, 2002, President George Bush signed the Homeland Security Act, which called for the largest reorganization in the U.S. government since the formation of the Department of Defense. The reorganization plan will bring together twenty-two agencies or parts of agencies from other departments such as Justice, Commerce, Health and Human Services, etc., under the control of the Department of Homeland Security. Often such large administrative reorganizations inevitability causes a great deal of upheaval and anxiety in the affected organizations. One of those agencies affected is the United States Coast Guard, which will be transferred from the Department of Transportation.
^ a b Garamone, Jim (17 October 2007). "Sea Services Unveil New Maritime Strategy". Navy News Service.
^ "14 USC §2. Primary duties" (PDF).
^ "14 USC §89. Law enforcement" (PDF).
^ "18 USC §1385. Use of Army and Air Force as posse comitatus" (PDF).
^ "14 USC §143. Treasury Department" (PDF).
^ "19 USC §1401.(i) Officer of the customs; customs officer" (PDF).
^ "19 USC §1589a. Enforcement authority of customs officers" (PDF).
^ "Federal Law Enforcement Survey of Federal Civilian Law Enforcement Functions and Authorities" (PDF).
^ "Law Enforcement Survey Table".
^ "People v. Booth, ___ N.Y.S.2d ___, 2008 WL 2247068, 2008 N.Y. Slip. Op. 28206 (N.Y. Co.Ct. 2008)" (PDF). 24 May 2008.
^ Ripley, Amanda (23 October 2005). "How the Coast Guard Gets it Right".
^ U.S. Coast Guard Historian's Office. Chronology of Aids to Navigation and the United States Lighthouse Service. http://www.uscg.mil/history/articles/h_USLHSchron.asp Retrieved: 28 February 2014.
^ U.S. Coast Guard Historian's Office.The Steamboat Inspection Service & the History of Merchant Vessel Inspection. http://www.uscg.mil/history/articles/Steamboat_Inspection_Service.asp Retrieved: 28 February 2014.
^ Cacas, Max (10 September 2009). "DHS marks new milestone with St. E's campus groundbreaking".
^ a b "14 USC §41. Grades and ratings" (PDF).
^ "37 USC §201. Pay grades: assignment to; general rules" (PDF).
^ "Required Uniforms". USCG Uniform Distribution Center. 23 May 2013.
^ "History of the Coast Guard Reserve". Coast Guard Historian's Office. 26 January 2012.
^ "Women & the US Coast Guard". Coast Guard Historian's Office. 16 July 2013.
^ "USCG Civilian Careers". United States Coast Guard. 28 June 2013.
^ "United States Coast Guard Regulations" (PDF). 1992. COMDINSTM 5000.3B.
^ "420-foot Icebreaker (WAGB)". Aircraft, Boats, and Cutters: Cutters. 28 June 2013.
^ "399-foot Polar Class Icebreakers (WAGB)". Aircraft, Boats, and Cutters: Cutters. 28 June 2013.
^ "Alaska Lt. Gov. calls for US icebreakers".
^ "Northrop Grumman to Supply Polar Ice Breaker Navigation Support for U.S. Coast Guard". October 20, 2013.
^ "U.S. Coast Guard Barque Eagle (WIX-327)". Aircraft, Boats, and Cutters: Cutters. 28 June 2013.
^ "140-foot Icebreaking Tug (WTGB) - Bay Class". Aircraft, Boats, and Cutters: Cutters. 28 June 2013.
^ "110-foot Patrol Boat (WPB) - Island Class". Aircraft, Boats, and Cutters: Cutters. 28 June 2013.
^ "87-foot Coastal Patrol Boat (WPB) - Marine Protector Class". Aircraft, Boats, and Cutters: Cutters. 28 June 2013.
^ "HC-130H: Hercules". Office of Aviation Forces (CG-711). 28 June 2013.
^ "HC-130J: Super Hercules". Office of Aviation Forces (CG-711). 28 June 2013.
^ "HC-144A: Ocean Sentry". Office of Aviation Forces (CG-711). 2 July 2013.
^ """HH-60J Sea Hawk / "Jayhawk. GlobalSecurity. Retrieved 7 August 2013.
^ "HH/MH-65C: Dolphin". Office of Aviation Forces (CG-711). 28 June 2013.
^ "C-37A: Gulfstream V". Office of Aviation Forces (CG-711). 28 June 2013.
^ "Chatham Boats". Station Chatham. 28 June 2013.
^ "United States Coast Guard Core Values".
^ "United States Coast Guard Ethos". Training Center Cape May.
^ "The Guardian Ethos" (PDF). U.S. Coast Guard Posture Statement. United States Coast Guard. February 2008. p. 17.
^ "Shipmates 17 - The Coast Guard Ethos" (txt). CGMS General Messages. 30 November 2011. ALCOAST 554/11.
^ "Harry G. Hamlet 1932-1936". Coast Guard Historian's Office. 26 January 2012.
^ Hamlet, Harry G. (10 October 2012). "Creed of the United States Coast Guardsman". Coast Guard History: Frequently Asked Questions. Coast Guard Historian's Office.
^ "What is the origin of the saying "You have to go out, but you don't have to come back"?". Coast Guard History: Frequently Asked Questions. Coast Guard Historian's Office. 10 October 2012.
^ "U.S. Coast Guard Flags". Coast Guard Historian's Office. 26 January 2012.
^ "The Coast Guard Ensign". Coast Guard Historian's Office.
^ Saba, Anne (January 2000). "Tradition, Service, Honor: The Customs Ensign". U.S. Customs Today.
^ "Coast Guard Ensign (For Release)". Visual Information gallery. 30 June 1999.
^ Thiesen, William H., PhD (Summer 2012). "The History of the 'Racing Stripe' Emblem and Brand" (PDF).
^ "U.S. Coast Guard Coatings and Color manual" (PDF). Coast Guard Historian's Office. 16 July 1973. CG-263.
^ "Coatings And Color Manual" (PDF). CG-612 Directives and Publications Division. 11 March 2005. COMDTINST M10360.3C.
^ "When did the Coast Guard adopt the "slash" for its cutters, boats, and aircraft?". Coast Guard History: Frequently Asked Questions. Coast Guard Historian's Office. 14 February 2013.
^ Semper Paratus (wav). U.S. Coast Guard Chief Petty Officers Association Enlisted Association (Sound recording). Archived from the original on 17 January 2013.
^ "Pantone chart with RGB and HTML conversions" (PDF). Planet Guide. Retrieved 8 August 2013.
^ "Uniform Regulations" (PDF). Coast Guard Historian's Office. 18 February 2009. COMDTINST M1020.6F.
^ a b "Honoring Our Profession - Uniform Guidance and Results of Uniform Board No. 44" (txt). CGMS General Messages. ALCOAST 291/11. Retrieved 27 July 2011.
^ "Title unknown". Defense Technology International: 26. January–February 2007.
^ "U.S. Great Lakes proposed permanent safety zones information site". Ninth Coast Guard District.
^ "Safety Zones; U.S. Coast Guard Water Training Areas, Great Lakes" (PDF).
^ "U.S. machine-gun fire suspended on Great Lakes".
^ "Some up in arms over fire zones".
^ "Coast GuardPlan". Citizens for Lake Safety. Retrieved 9 August 2013.
^ "Coast Guard Expects New Deployable Group Operating By Next Summer" (PDF). Senior Coast Guard Leadership. Retrieved 3 February 2013.
^ "14 USC PART II—Coast Guard Reserve and Auxiliary" (PDF).
^ "CG Auxiliary Vessel Examiner Manual" (PDF). CG-612 Directives and Publications Division. 20 August 1996. COMDTINST M16796.2E.
^ "33 CFR § 5.31 Power and authority" (PDF).
^ a b "SM1c Douglas Albert Munro". Coast Guard Historian's Office. 10 October 2012.
^ "Ancient Albatross Award". Ancient Order of the Pterodactyl. Retrieved 3 February 2013.
^ Chidlow, Nora L. "The Bird That Continues to Fly: A History of the Ancient Albatross Award" (PDF). Coast Guard Historian's Office.
^ "Coast Guard CW Operators Association".
^ "U.S. Coast Guard Chief Petty Officers Association".
^ "USCG Chief Warrant and Warrant Officers Association".
^ Wise, James E., Jr.; Rehill, Anne Collier (1997). Stars in Blue: Movie Actors in America's Sea Services. Annapolis: Naval Institute Press. p. 293.
^ "Coast Guard". Film. Retrieved 25 December 2009.
^ "Coast Guard Episodes 1995, TV Show". TV Guide online. CBS Interactive. Retrieved 1 July 2014.
^ "Coast Guard (1995–1997) TV Series - Reality-TV". Internet Movie Data Base. Amazon.com. Retrieved 1 July 2014.
Sea Hunt, Coast Guard involved in several episodes.
Flipper, various Coast Guard HH-52 Seaguard helicopters were used.
Gilligans Island, the passengers and crew were all rescued by the Coast Guard.
Emergency!, Coast Guard HH-52 Seaguard helicopters and boats were used in various rescues.
Boston Legal, the characters of Alan Shore and Denny Crane, portrayed by James Spader and William Shatner, respectively, join the Coast Guard Auxiliary.
Cartoon character Popeye was in the Coast Guard after being a Merchant Mariner. He later joined the Navy.
Unnamed Coast Guardsmen of a Law Enforcement Detachment were featured in a Channel 5 documentary Royal Navy Caribbean Patrol. They were serving aboard HMS Manchester, a British Royal Navy ship combating drug smugglers in the Caribbean.
Coast Guard Alaska: Search and Rescue, a series on The Weather Channel that features a Coast Guard search-and-rescue unit based in Kodiak, Alaska.
Coast Guard Florida: Search and Rescue, a series in production on The Weather Channel that features Coast Guard search-and-rescue units based in Miami and Clearwater, Florida.
Coast Guard Cape Disappointment: Pacific Northwest, a series in production on The Weather Channel that features Coast Guard Station Cape Disappointment based in Ilwaco, Washington and Coast Guard Air Station Astoria in Warrenton, Oregon.
The Coast Guard has been featured in several television series, including Baywatch, CSI: Miami, NCIS, Deadliest Catch, Dirty Jobs, Harbor Command, "Burn Notice" and Miami Vice.
Fighting Coast Guard, a 1951 drama, depicts Coast Guard trained to help win WWII.
Onionhead, a 1957 comedy, portrayes Andy Griffith as a Coast Guard recruit.
Thunderball (1965), involves James Bond played by Sean Connery being hoisted by an HH-52 Seaguard.
Assault on a Queen, a 1966 film starring Frank Sinatra and Verna Lisi, featured USCGC Androscoggin.
The Boatniks, a 1970 Disney comedy film, depicts Ensign Tom Garland, played by Robert Morse, as the commander of a small cutter on the West Coast.
Satan's Triangle, a 1975 TV movie, involves a United States Coast Guard helicopter sent to answer a distress call from inside the Bermuda Triangle.
The Last Flight of Noah's Ark, a 1976 Walt Disney movie. Elliot Gould and crew towed home in B-29 Fuselage boat by a Coast Guard cutter.
The Island (1980 film)|The Island (1980). Latter-day Caribbean pirates capture the (fictional) cutter USCGC New Hope. Filming was done on USCGC Dauntless.
Splash (1986). Coast Guard (fake) helicopters drop Coast Guard divers into New York Harbor.
Top Gun, Maverick and Goose's body are pulled from the ocean by a Coast Guard HH-3F Pelican.
Overboard, 1987 comedy, features a Coast Guard cutter and crew intercepting a private yacht.
Licence to Kill, 1989, James Bond captures a drug dealer while flying in a Coast Guard HH-65 Dolphin in Florida.
The Perfect Storm, 2000 film, depicted the rescue operations of the USCGC Tamaroa as one of its subplots.
Bad Boys II, 2003 film, depicts counter-drug helicopters from the Helicopter Interdiction Tactical Squadron (HITRON).
Yours, Mine, and Ours, 2005 family comedy, Dennis Quaid plays a fictional U.S. Coast Guard Academy superintendent who marries a character played by Rene Russo; together, they have 18 children.
The Guardian, 2006 film, starring Kevin Costner and Ashton Kutcher, was based on the training and operations of Coast Guard Aviation Survival Technicians.
Pain & Gain, 2013 film, starring Dwayne Johnson and Mark Wahlberg, depicted the Coast Guard Deployable Operations Group in action.
A Coast Guard cutter and its commanding officer and crew figured prominently in Tom Clancy's books Clear and Present Danger, Without Remorse, and Executive Orders.
EagleUSCGC , figures prominently in S.M. Stirling's book Island in the Sea of Time.
The 2005 survival horror video game, Cold Fear, depicts a Coast Guardsman investigating paranormal events aboard a Russian whaling ship, and an oil rig later in the game.
Flight Simulator X: Acceleration features an EH101 in U.S. Coast Guard colors. However, the USCG does not operate these aircraft.
The U.S. Coast Guard appears as gameplay adversaries in Jaws Unleashed, including cutters and helicopters.
Deadliest Catch: Alaskan Storm features the U.S. Coast Guard.
Former Coast Guard officers have been appointed to numerous civilian government offices. After retiring as Commandant of the Coast Guard in 2002, Admiral White House Chief Usher, beginning service on 12 March 2007, and continues to serve in the same capacity under President Barack Obama.
Numerous celebrities have served in the Coast Guard including tennis player Jack Kramer, golfer Arnold Palmer, All Star baseball player Sid Gordon, boxer Jack Dempsey; musicians Kai Winding, Rudy Vallee, Derroll Adams, and Tom Waits; actors Buddy Ebsen, Sid Caesar, Victor Mature, Richard Cromwell, Alan Hale, Jr., William Hopper, Beau Bridges, Cesar Romero; author Alex Haley; and Senator Claiborne Pell.
In May 2006, at the Change of Command ceremony when Admiral Coast Guard Presidential Unit Citation with hurricane device, for its efforts during and after Hurricane Katrina and Tropical Storm Rita.
Prior to 1997, Auxiliarists were limited to those tasks and on-water patrols supporting recreational boating safety. In 1997, however, new legislation authorized the Auxiliary to participate in any and all Coast Guard missions except direct military and direct law enforcement. Auxiliarists may support the law enforcement mission of the Coast Guard but may not directly participate in it, and Auxiliarists and their vessels are not permitted to carry a weapon while serving in any Auxiliary capacity. Auxiliarists use their own vessel (e.g., boats, aircraft, and vehicles), once it is registered as a Coast Guard Facility, in Coast Guard missions.
The Reserve is managed by the Acting Director of Reserve and Leadership (CG-13), Rear Admiral David R. Callahan.
Since 11 September 2001, over 8,500 reservists have been activated and served on tours of active duty, to include deployments to the Persian Gulf and also as parts of Department of Defense combatant commands such as the U.S. Northern and Central Commands. Coast Guard Port Security Units are entirely staffed with reservists, except for five to seven active duty personnel. Additionally, most of the staffing the Coast Guard provides to the Navy Expeditionary Combat Command are reservists.
The United States Coast Guard Reserve is the reserve military force of the Coast Guard. The Coast Guard Reserve was founded on 19 February 1941. Coast Guard reservists normally drill two days a month and an additional 12 days of active duty each year, although many perform additional drill and active duty periods, to include those mobilized to extended active duty. Coast Guard reservists possess the same training and qualifications as their active duty counterparts, and as such, can be found augmenting active duty Coast Guard units every day.
The planning for the unit began after the terrorist attacks of 11 September 2001, and culminated with its formation on 20 July 2007. Its missions include maritime law enforcement, anti-terrorism, port security, pollution response, and diving operations.
The Deployable Operations Group (DOG) was a Coast Guard command established in July 2007. The DOG established a single command authority to rapidly provide the Coast Guard, Department of Homeland Security, Department of Defense, Department of Justice and other interagency operational commanders adaptive force packages drawn from the Coast Guard's deployable specialized force units. The DOG was disbanded in April 2013 and its deployable specialized forces (DSF) units were placed under the control of area commanders.
Live fire exercises by Coast Guard boat and cutter crews in U.S. waters of the Great Lakes was proposed in 2006 and attracted attention in the U.S. and Canada. The Coast Guard had proposed the establishment of 34 locations around the Great Lakes where live fire training using vessel-mounted machine guns were to be conducted periodically throughout the year. The Coast Guard said that these exercises are a critical part of proper crew training in support of the service's multiple missions on the Great Lakes, including law enforcement and anti-terrorism. Those who raised concerns about the firing exercises commented about safety concerns and that the impact on commercial shipping, tourism, recreational boating and the environment may be greater than what the Coast Guard had stated. The Coast Guard took public comment and conducted a series of nine public meetings on this issue. After receiving more than 1,000 comments, mostly opposing the Coast Guard's plan, the Coast Guard announced that they were withdrawing their proposal for target practice on the Great Lakes, although a revised proposal may be made in the future.
Aging vessels is another problem, with the Coast Guard still operating some of the oldest naval vessels in the world. In 2005, the Coast Guard terminated contracts to upgrade the 110-foot (34 m) Island-class cutters to 123-foot (37 m) cutters because of warping and distortion of the hulls. In late 2006, Admiral Thad Allen, Commandant of the Coast Guard, decommissioned all eight of the modified cutters due to dangerous conditions created by the lengthening of the hull - to include compromised watertight integrity. The Coast Guard has, as a result of the failed conversion, revised production schedules for the Fast Response Cutter (FRC). Of the world's 40 largest navies and coast guards, the U.S. Coast Guard has the 38th oldest surface fleet.
Lack of coverage affects many areas with high maritime traffic. For example, local officials in Scituate, Massachusetts, have complained that there is no permanent Coast Guard station, and the presence of the Coast Guard in winter is vital. One reason for this lack of coverage is the relatively high cost of building storm-proof buildings on coastal property; the Cape Hatteras station was abandoned in 2005 after winter storms wiped out the 12-foot (3.7 m) sand dune serving as its protection from the ocean. Faced with these issues the Coast Guard has contracted with General Dynamics C4 System to provide a complete replacement of their 1970s era radio equipment. Rescue 21 is the United States Coast Guard's advanced command, control and communications system. Created to improve the ability to assist mariners in distress and save lives and property at sea, the system is currently being installed in stages across the United States. The nation's existing maritime search and rescue (SAR) communications system has been in operation since the early 1970s. Difficult to maintain, increasingly unreliable and prone to coverage gaps, this system no longer meets the safety needs of America's growing marine traffic. In addition, it is incapable of supporting the Coast Guard's new mission requirements for homeland security, which require close cooperation with Department of Defense agencies as well as federal, state and local law enforcement authorities. Modernizing this system enhances the safety and protection of America's waterways.
Cadets at the U.S. Coast Guard Academy have access to standard Coast Guard uniforms, including Service Dress Blues and the ODU, however, also wear two different styles of parade dress uniforms. Fall Parade Dress Blue consists of navy blouses with banded collars and double rows of buttons, worn with matching navy trousers and a white peaked hat. Spring Parade Dress Blue substitutes white trousers in lieu of navy.
The Coast Guard Pipe Band, a special musical unit composed of active, reserve and auxiliary coast guardsmen, wears a modified form of highland dress, including kilt and sporran. It is, along with the Band of the Air Force Reserve Pipe Band, one of only two kilted unit in the United States military, excluding those maintained by state defense forces and service academies. The band's kilt is patterned in the official U.S. Coast Guard tartan.
Coast Guard cadets wearing fall Parade Dress Blue uniform dress their line.
Coast Guard personnel serving in expeditionary combat units such as Port Security Units, Law Enforcement Detachments, and others, wear the Camouflage Utility Uniform (CUU) with the woodland or desert pattern/color scheme based on the operational commander's guidance. An eight-point cap is worn with rank insignia. The camouflaged utility sun hat may be worn when prescribed by the operational commander, without rank insignia.
The current working uniform of the Coast Guard is the Operational Dress Uniform (ODU). The ODU may be worn year-round primarily as a field utility and watchstanding uniform, and may be worn in an office environment. The ODU is similar to the Battle Dress Uniform of other armed services, both in function and style. However, the ODU is in a solid dark blue with no camouflage pattern and does not have lower pockets on the blouse. The first generation ODU, wearable until 1 July 2012 was worn tucked in. The second generation ODU is worn untucked and has black Coast Guard insignia embroidered on the left shirt pocket as well as the side pockets of the trousers. The ODU is worn with composite-toed boots in most circumstances, but low-cut brown boat shoes may be prescribed for certain vessel boarding operations. A standard baseball-style ball cap is worn, embroidered in gold block lettering with "U.S. Coast Guard." Units may also additionally authorize ball caps with the unit name embroidered for wear while on the unit. A foul weather parka is the outerwear worn with the ODU. The former dark blue working uniform has been withdrawn from use by the Coast Guard but may be worn by Auxiliarists until no longer serviceable.
The U.S. Coast Guard Pipe Band in New York during the 2010 Thanksgiving parade.
Coast Guard officers also have dress white uniforms, nearly identical to the choker white uniforms worn by naval officers (aside from service-specific buttons, insignia and sword design), typically used for formal parade and change-of-command ceremonies. For similar occasions enlisted members wear Tropical Blue, Service Dress Blue, or Full Dress Blue. Full Dress Blue replaces the light blue shirt with a white shirt, and full size medals are worn on the jacket. A white belt may be worn for honor guards. Mess dress uniforms are worn by members for formal (black tie) evening ceremonies. Like the officers' dress white uniforms, the mess dress uniforms are identical to those of the Navy, aside from Coast Guard-specific insignia.
The Tropical Blue variation, worn in warm weather, omits the jacket and tie, and features a short sleeve shirt with rank insignia on shoulder boards for officers, and pin-on collar insignia for petty officers. The Tropical Blue uniform may be worn year-round for general office wear and for visits between commands. It may be worn in lieu of the SDB uniform, but not to functions where civilian dress is coat and tie.
The SDB uniform may be worn year-round for business within the Coast Guard and for social occasions where the civilian equivalent is coat and tie.
In 1972, the current Coast Guard Service Dress Blue (SDB) uniform was introduced for wear by both officers and enlisted personnel; the transition was completed during 1974. The uniform consists of a blue four-pocket single breasted jacket and trousers. A light-blue button-up shirt with a pointed collar, two front button-flap pockets, and shoulder loops, along with a tie of the same shade as the jacket are worn with the uniform. Officer rank insignia parallels that of the Navy but with the gold Navy line star replaced with the gold Coast Guard Shield and with the Navy blue background color replaced by Coast Guard blue. Enlisted rank insignia is also similar to the Navy with the Coast Guard shield replacing the eagle on collar and cap devices. Group Rate marks (stripes) for junior enlisted members (E-3 and below) also follow Navy convention with white for seaman, red for fireman, and green for airman. In a departure from the Navy conventions, all petty officers E-6 and below wear red chevrons and all chief petty officers wear gold. Unlike the Navy, there are no khaki uniforms, and all personnel wear the same color uniform.
Prior to 1972, Coast Guard personnel wore the same uniforms as the Navy with distinctive Coast Guard insignia, primarily distinctive cap devices for officers and chief petty officers, incorporation of the Coast Guard shield in lieu of line or staff corps insignia for officers, and different buttons on dress uniforms.
Two Pantone colors are named after the Coast Guard; they are used in the Service Mark.
The official march of the Coast Guard is "Semper Paratus" (Latin for "Always Ready").
The Racing Stripe, officially known as the Service Mark, was designed in 1964 by the industrial design office of Raymond Loewy Associates to give the Coast Guard a distinctive, modern image. Loewy had designed the colors for the Air Force One fleet for Jackie Kennedy. President Kennedy was so impressed with his work, he suggested that the entire Federal Government needed his make-over and suggested that he start with the Coast Guard. First used in 1967, it consists of a narrow blue stripe, a narrow white stripe between, and a broad CG red bar with the Coast Guard shield centered. The stripes are canted at a 64 degree angle, coincidentally the year the Racing Stripe was designed.
The racing stripe is borne by Coast Guard cutters, aircraft, and many boats. Red-hulled icebreaker cutters and most HH-65/MH-65 helicopters (i.e., those with a red fuselage) bear a narrow white bar, a narrow blue bar, and broad white bar, with the Coast Guard shield centered. Conversely, black-hulled cutters (such as buoy tenders and inland construction tenders) use the standard racing stripe. Auxiliary vessels maintained by the Coast Guard also carry the Racing Stripe, but in inverted colors (i.e., broad blue stripe with narrow white and CG red stripes) and the Auxiliary shield.
This unofficial motto of the Coast Guard dates to an 1899 United States Lifesaving Service regulation, which states in part: "In attempting a rescue, ... he will not desist from his efforts until by actual trial, the impossibility of effecting a rescue is demonstrated. The statement of the keeper that he did not try to use the boat because the sea or surf was too heavy will not be accepted, unless attempts to launch it were actually made and failed." The regulation was silent as to what happens to the rescuer if the attempt fails.
In an ALCOAST message effective 1 December 2011 the Commandant, Admiral Papp, directed that the language of Guardian Ethos be superseded by the Coast Guard Ethos in an effort to use terminology that would help with the identity of personnel serving in the Coast Guard. The term Coast Guardsman is the correct form of address used in Title 14 USC and is the form that has been used historically.
Respect: We value our diverse workforce. We treat each other with fairness, dignity and compassion. We encourage individual opportunity and growth. We encourage creativity through empowerment. We work as a team.
Units within the Deployable Operations Group also employ specialized weapons including the Mk 18 carbine, Mk 11 precision rifle, and M203 grenade launcher. Marksmen from the Helicopter Interdiction Tactical Squadron and Law Enforcement Detachments use a variant of the Barrett M107 .50-caliber rifle to disable the engines on fleeing boats.
The U.S. Coast Guard uses a wide variety of small arms. Handguns, shotguns, and rifles are used to arm boat crew and boarding team members and machine guns are mounted aboard cutters, boats, and helicopters.
Motor Life Boat (MLB): The Coast Guard's 47-foot (14 m) primary heavy-weather boat used for search and rescue as well as law enforcement and homeland security.
Utility Boat (UTB): A 41-foot (12 m) general purpose boat used for nearly all Coast Guard missions.
The Coast Guard operates about 1,400 boats, defined as any vessel less than 65 feet (20 m) long, which generally operate near shore and on inland waterways.
Fixed-wing aircraft operate from Air Stations on long-duration missions. Helicopters operate from Air Stations and can deploy on a number of different cutters. Helicopters can rescue people or intercept vessels smuggling migrants or narcotics. Since the terrorist attacks of 11 September 2001, the Coast Guard has developed a more prominent role in national security and now has armed helicopters operating in high risk areas for the purpose of maritime law enforcement and anti-terrorism.
Coast Guard aviators receive Primary (fixed-wing) and Advanced (fixed or rotary-wing) flight training with their Navy and Marine Corps counterparts at NAS Whiting Field, Florida, and NAS Corpus Christi, Texas, and are considered Naval Aviators. After receiving Naval Aviator Wings, Coast Guard pilots, with the exception of those slated to fly the HC-130, report to USCG Aviation Training Center Mobile, Alabama to receive 6–12 weeks of specialized training in the Coast Guard fleet aircraft they will operate. HC-130 pilots report to Little Rock AFB, Arkansas, for joint C-130 training under the auspices of the 314th Airlift Wing of the U.S. Air Force.
The Coast Guard operates approximately 204 fixed and rotary wing aircraft from 24 Coast Guard Air Stations throughout the contiguous United States, Alaska, Hawaii, and Puerto Rico. Most of these air stations are tenant activities at civilian airports, several of which are former Air Force Bases and Naval Air Stations, although several are also independent military facilities. Coast Guard Air Stations are also located on active Naval Air Stations, Air National Guard bases, and Army Air Fields.
Polar-class icebreaker (WAGB): There are three WAGB's used for icebreaking and research though only two, the heavy 399-foot (122 m) Polar Star and the newer medium class 420-foot (130 m) Healy, are active. Polar Sea is located in Seattle, Washington but is not currently in active service.
Medium Endurance Cutter (WMEC): These are mostly the 210-foot (64 m) Reliance class, and the 270-foot (82 m) Famous class cutters, although the 283-foot (86 m) Alex Haley also falls into this category. Primary missions are law enforcement, search and rescue, and military defense.
Seagoing Buoy Tender (WLB): These 180-and-225-foot (55 and 69 m) ships are used to maintain aids to navigation and also assist with law enforcement and search and rescue.
Originally, the U.S. Coast Guard used the term cutter in its traditional sense, as a type of small sailing ship. Today it officially uses the term for any vessel that has a permanently assigned crew and accommodations for the extended support of that crew, and includes only and all vessels of 65 feet (20 m) or more in length.
USCGC Stratton, the third Legend-class maritime security cutter.
USCGC Bertholf, the first Legend-class maritime security cutter.
The Coast Guard employs over 7,700 civilians in over two hundred different job types including Coast Guard Investigative Service special agents, lawyers, engineers, technicians, administrative personnel, tradesmen, and federal firefighters. Civilian employees work at various levels in the Coast Guard to support its various missions.
Newly enlisted personnel are sent to eight weeks of recruit training at Coast Guard Training Center Cape May in Cape May, New Jersey. New recruits arrive at Sexton Hall and remain there for three days of initial processing which includes haircuts, shots, uniform issue, and other necessary entrance procedures. During this initial processing period, the new recruits are led by temporary company commanders. These temporary company commanders are tasked with teaching the new recruits how to march and preparing them to enter into their designated company. The temporary company commanders typically do not enforce any physical activity such as push ups or crunches. When the initial processing is complete, the new seaman recruits are introduced to their permanent company commanders who will remain with them until the end of training. There is typically a designated lead company commander and two support company commanders. The balance of the eight-week boot camp is spent in learning teamwork and developing physical skills. An introduction of how the Coast Guard operates with special emphasis on the Coast Guard's core values is an important part of the training.
Graduates of OCS are usually commissioned as ensigns, but some with advanced graduate degrees may enter as lieutenants (junior grade) or lieutenants. Graduating OCS officers entering active duty are required to serve a minimum of three years, while graduating reserve officers are required to serve four years. Graduates may be assigned to a cutter, flight training, a staff job, or an operations-ashore billet.
In addition to the Academy, prospective officers, who already hold a college degree, may enter the Coast Guard through Officer Candidate School (OCS), also located at the Coast Guard Academy. OCS is a seventeen week course of instruction that prepares candidates to serve effectively as officers in the Coast Guard. In addition to indoctrinating students into a military lifestyle, OCS provides a wide range of highly technical information necessary to perform the duties of a Coast Guard officer.
The U.S. Coast Guard Academy is a four-year service academy located in New London, Connecticut. Approximately 225 cadets graduate each year, receiving a Bachelor of Science degree and a commission as an ensign in the Coast Guard. Graduates are obligated to serve a minimum of five years on active duty. Most graduates are assigned to duty aboard Coast Guard cutters immediately after graduation, either as Deck Watch Officers (DWOs) or as Engineer Officers in Training (EOITs). Smaller numbers are assigned directly to flight training at Naval Air Station Pensacola, Florida or to shore duty at Coast Guard Sector, District, or Area headquarters units.
is named for the SPARS. USCGC Spar The cutter Later, In 1918, twin sisters Genevieve and Lucille Baker of the Naval Coastal Defense Reserve became the first uniformed women to serve in the Coast Guard.
Highly qualified enlisted personnel in pay grades E-6 through E-9 with a minimum of eight years experience can compete each year for appointment as warrant officers (WO). Successful candidates are chosen by a board and then commissioned as chief warrant officers (CWO-2) in one of sixteen specialties. Over time, chief warrant officers may be promoted to CWO-3 and CWO-4. The ranks of warrant officer (WO-1) and chief warrant officer (CWO-5) are not currently used in the Coast Guard. Chief warrant officers may also compete for the Chief Warrant Officer to Lieutenant Program. If selected, the warrant officer will be promoted to lieutenant (O-3E). The "E" designates over four years active duty service as a warrant officer or enlisted member and entitles the member to a higher rate of pay than other lieutenants.
Commissioned officers in the Coast Guard hold pay grades ranging from O-1 to O-10 and have the same rank structure as the Navy. Officers holding the rank of ensign (O-1) through lieutenant commander (O-4) are considered junior officers, commanders (O-5) and captains (O-6) are considered senior officers, and rear admirals (O-7) through admirals (O-10) are considered flag officers. The Commandant of the Coast Guard is the only member of the Coast Guard to hold the rank of admiral.
The formal name for a uniformed member of the Coast Guard is "Coast Guardsman", irrespective of gender. "Coastie" is an informal term commonly used to refer to current or former Coast Guard personnel. In 2008, the term "Guardian" was introduced as an alternative, but was later dropped. Admiral Robert J. Papp, Jr. stated that it was his belief that no Commandant had the authority to change what members of the Coast Guard are called as the term Coast Guardsman is found in Title 14 USC which established the Coast Guard in 1915. "Team Coast Guard" refers to the four components of the Coast Guard as a whole: Regular, Reserve, Auxiliary, and Coast Guard civilian employees.
Shore establishment commands exist to support and facilitate the mission of the sea and air assets. U.S. Coast Guard Headquarters is located in Southwest Washington, DC. Other shore establishments are Coast Guard Sectors (which may include Coast Guard Bases), Coast Guard Stations, Coast Guard Air Stations, and the United States Coast Guard Yard. Training centers include the United States Coast Guard Academy, Training Center Petaluma, Training Center Cape May, Coast Guard Aviation Technical Training Center, Coast Guard Aviation Training Center Mobile, and Training Center Yorktown.
The new Department of Homeland Security headquarters complex is being built on the grounds of the former St. Elizabeths Hospital in the Anacostia section of Southeast Washington, across the Anacostia River from former Coast Guard headquarters.
In times of war, the Coast Guard or individual components of it can operate as a service of the Department of the Navy. This arrangement has a broad historical basis, as the Coast Guard has been involved in wars as diverse as the War of 1812, the Mexican-American War, and the American Civil War, in which the cutter Harriet Lane fired the first naval shots attempting to relieve besieged Fort Sumter. The last time the Coast Guard operated as a whole within the Navy was in World War II. More often, military and combat units within the Coast Guard will operate under Navy or joint operational control while other Coast Guard units will remain under the Department of Homeland Security.
The modern Coast Guard can be said to date to 1915, when the Revenue Cutter Service merged with the Lighthouse Service was brought under the Coast Guard's purview. In 1942, the Bureau of Marine Inspection and Navigation was transferred to the Coast Guard. In 1967, the Coast Guard moved from the U.S. Department of the Treasury to the newly formed U.S. Department of Transportation, an arrangement that lasted until it was placed under the U.S. Department of Homeland Security in 2002 as part of legislation designed to more efficiently protect American interests following the terrorist attacks of 11 September 2001.
"First Fleet" is a term occasionally used as an informal reference to the Coast Guard, although there is no indication that the United States has ever officially used this designation with reference either to the Coast Guard or any element of the Navy. The informal appellation honors the fact that between 1790 and 1798, there was no United States Navy and the cutters that were the predecessors of the Coast Guard were the only warships protecting the coast, trade, and maritime interests of the new republic.
The roots of the Coast Guard lie in the United States Revenue Cutter Service established by Alexander Hamilton under the Department of the Treasury on 4 August 1790. The first Coast Guard station was in Newburyport, Massachusetts. Until the re-establishment of the Navy in 1798, the Revenue Cutter Service was the only naval force of the early United States. It was established to collect taxes from a brand new nation of patriot smugglers. When the officers were out at sea, they were told to crack down on piracy; and to rescue any mariners in distress.
Private First Class William A. McCoy and Private First Class Ralph L. Plunkett holding a sign thanking the U.S. Coast Guard after the Battle of Guam.
Coast Guardsmen have the legal authority to carry their service-issued firearms on and off base. This is rarely done in practice, however; at many Coast Guard stations, commanders prefer to have all service-issued weapons in armories. Still, one court has held that Coast Guard boarding officers are qualified law enforcement officers authorized to carry personal firearms off-duty for self-defense.
Title 14 USC, section 2 authorizes the Coast Guard to enforce federal law. This authority is further defined in Title 14 USC, section 89, which gives law enforcement powers to all Coast Guard commissioned officers, warrant officers, and petty officers. Unlike the other branches of the United States Armed Forces, which are prevented from acting in a law enforcement capacity by Title 18 USC, section 1385, the Posse Comitatus Act, and Department of Defense policy, the Coast Guard is exempt from and not subject to the restrictions of the Posse Comitatus Act.
A member of Law Enforcement Detachment (LEDET) 106 performs a security sweep aboard a tanker ship in the North Persian Gulf in July 2007.
On 25 November 2002, the U.S. Department of Homeland Security. The transfer of administrative control from the U.S. Department of Transportation to the U.S. Department of Homeland Security was completed the following year, on 1 March 2003.
|
0.930599 |
The causes of agricultural land expansion and its impacts on dryland ecosystems such as the oasis regions of Southern Tunisia, are fundamental problems challenging the sustainability of irrigated agriculture on water limited ecosystems. Consequently, a thorough understanding of this phenomenon is necessary to avoid future problems. With the objective of identifying irrigated land expansion dynamics and the primary drivers, two representative oasis regions in Southern Tunisia, Mareth and Fatnassa, were selected. Changes in irrigated lands in both regions between 1985 and 2011 were analyzed, and the land uses from which expansion occurred were identified using Landsat images from different years (1985, 1996 and 2011). The results indicate that the surface occupied by irrigation agriculture has doubled in Mareth, while in Fatnassa, it has increased fourfold. During that period, there was a simultaneous increase in total population, as consequence of human migration that came along with an increase in income. Thus, we could identify human migration and economic development as potential drivers of irrigated agriculture expansion, though further research is warranted to ascertain a quantification that would assist in obtaining the sustainability of these regions.
The long-lasting Sahel drought in the 1970s and 1980s caused enormous human and socio-economic losses1, driving extensive research on its causes2, 3, 4, 5, 6, 7, 8. Although changes in global and regional sea surface temperatures (SSTs) are thought to be dominant drivers of the severe Sahel drying trend9, 10, 11, 12, the mechanisms for the recent recovery trend are not fully clear yet, but are often assumed to be akin to the previous SST–Sahel drought linkage13, 14, 15. Here we show, by analysing observational and multi-model data and conducting SST-sensitivity experiments with two state-of-the-art atmospheric models, that the SST key area causing the recent Sahel rainfall recovery is the Mediterranean Sea. Anthropogenic warming of this region has driven the shift from the tropical Atlantic and Indo-Pacific oceans, which historically were the main driver of Sahel drought. The wetting impact of Mediterranean Sea warming can become more dominant in a future warming climate and is key to understanding the uncertainty in future Sahel rainfall projections.
Moisture budget decomposition is performed for the Sahel (10°–20°N and 20°W–40°E) in order to understand the processes that govern regional hydroclimate variability on interannual time scales and frame them in the context of their primary ocean driver. Results show that warm conditions in the Eastern Tropical Pacific remotely force anomalously dry conditions primarily through affecting the low-troposphere mass divergence field. This behavior is related to increased subsidence over the tropical Atlantic and into the Sahel and an anomalous westward flow of moisture from the continent, both resulting in a coherent drying pattern. Understanding the physical processes relating remote sea surface temperature anomalies to atmospheric circulation changes and the resulting complex local convergence patterns is important for advancing seasonal prediction of precipitation over West Africa.
Das Hamburger Max-Planck-Institut hat in den vergangenen Jahren wichtige neue Erkenntnisse zu Aerosolen und anderen Themen beigesteuert. Die Sahel-Arbeit gehört leider nicht zu den besten Arbeiten, genausowenig wie die MPI-Studien zum arktische Meereis.
|
0.999957 |
In one sentence, explain what Roller does?
Roller is a creative design and development studio based in Nottingham—we specialize in creating bespoke UX websites and apps, as well as being fully integrated to deliver digital marketing and PR.
I was made redundant at the company I was working at which prompted me to start freelancing. I saw a gap in the market for app development in the Nottingham area, and that catapulted me to start exploring it as a business venture. It’s grown from that point, and we’ve more than tripled our office space and workforce combined. I don’t define this as a success yet, but I foresee the potential of the business and the employees within us, and the direction we’re moving in is an exciting one.
When we first started it was literally just two of us in a room, and as the business grew I began to lose that “shop floor presence.” I didn’t have the capacity to recruit an HR team, so we decided to build our own pocket HR app called Notify. It allows our employees to book holidays, record absences, indicate how they’re feeling, etc., and it makes it easy for me to monitor the well-being of our staff.
We are currently a workforce of around 30 people, but we’re always on the lookout for new talent. We allow remote working and also operate a flexible hours policy. I think it’s important to do so to keep employees engaged and motivated within the business.
You specialize in designing and building mobile apps, and you’ve established a foothold in that market. What is it about developing apps for products and businesses that you find most rewarding?
When clients come in with an idea for an app they usually have a basic understanding of the functionalities and how they want it to look. However, seeing the complete awe and amazement on their faces when we show them the initial prototypes and designs is always incredibly rewarding.
We are the privileged ones that get to bring their ideas to life and make them a tangible reality.
In addition to traditional mobile apps, you’re also focused on developing VR (Virtual Reality) and AR (Augmented Reality). What’s it like working with new technology, and is it more difficult from a creative standpoint?
We are currently working on creating immersive and engaging projects for clients using AR & VR. It’s got the potential to create a huge impact for brands, as it pulls the online world offline for a consumer. Some of the most exciting work is being done in retail spaces using new technology to enhance the customer experience—which is a new realm for some businesses, but the return speaks for itself.
It’s not more or less difficult; it’s simply exciting. The team loves developing the concepts, and the ideas we’re generating are taking our creativity to a new level.
How do you typically negotiate payment with clients when developing these products? Do you see a noticeable trend away from hourly fees?
As a business, we work with client budgets or fixed costs instead of hourly rates. Each company is different, but I believe it’s cleaner and more manageable to work payment terms this way.
You’re using Float to manage your team’s forecast. Tell us a little more about how you plan your team’s time across a mix of client and internal projects.
We work in an agile way, pushing priorities to the forefront and working back from there, but we always make sure that we have flexitime to jump onto any urgent or immediate project changes.
Our team works on many different projects throughout a given day or week, and Float is fundamental in helping us manage everyone’s time.
There are now over 5 million apps available on Google Play and Apple’s App Store. In your opinion, what sets a great app apart?
With the app world being such a saturated market, it’s more important than ever to develop a strong USP (unique selling proposition). You should never underestimate the user interface of an app, as your customer’s first judgment will be a visual one. However, engagement and user experience are where the greatest apps succeed, and where many others fail.
We’ve talked about Virtual Reality and Augmented Reality. Are there any other technology trends that you’re particularly excited about?
Yes, we’re currently looking into a few AI projects and also some potential work with IBM Watson. While those have been in the pipeline for a while, the emergence and demand for new forms of technology is really exciting, and it shows the shift from digital obsession to digital maturity. The power of using emotional data through Watson and AI combined gives brands more scope in creating and capturing consumer engagement—which could be the difference between winning customers and losing them.
Do you have any words of advice for those considering starting their own creative agency?
Be humble learning machines and really understand your market and industry—in addition to continuing to learn about yourself. Knowing your strengths and their value will ultimately be what sets you apart from others in the long run.
My other piece of advice is to keep your team’s creative engine fired up, and at the first sign of it burning out, sit back, review, and don’t be afraid to make changes!
|
0.999996 |
Last week Ben Gray and I joined Ray Goodwin for a canoe trip down the River Spey. Starting at Loch Insh, in the shadow of the Cairngorm mountains, we descended to the sea at Spey Bay over the course of three-and-a-half days. Along the way there was some great paddling and an opportunity to apply a few bushcraft skills.
They Spey is one of Ray's favourite rivers and I had been meaning to join him on one of his guided trips for a number of years. Unfortunately, each year I had work commitments that prevented me from joining his group. This year, having had a very busy year with Frontier Bushcraft and www.paulkirtley.co.uk, I set aside the time to make the trip and unwind a little. Ben, a regular canoeing buddy of mine and member of the Frontier Bushcraft team, was also able to make the trip. In addition to Ben and myself, Ray had another four clients on the trip, so there were seven of us in total, which made for a nice group size. Ray also brought his dog, Dillie, so I suppose I should say there were eight of us!
Ray Goodwin and his dog, Dillie, on the River Spey. Photo: Paul Kirtley.
On the morning of the first day on the water, we awoke to rain and a fairly chilly breeze. This set the tone for the next few days but we were thankful that the wind was largely at our backs once we left Loch Insh.
Leaving Loch Insh and beginning our descent of the River Spey. Photo: Paul Kirtley.
There had been a reasonable amount of rain before our arrival which provided water levels that were already good. As we descended the river, further rain meant that the river was still rising. It certainly wasn't warm either. The wind continued to be cold and when we did get a glimpse of the mountains, we could see they were dusted with snow down to about 800 metres.
While it had been raining where we were, it had been snowing on the hills. Photo: Paul Kirtley.
The rain also meant we had some damp campsites. A fire in the evenings made a huge difference to our comfort. It warmed our bones and dried our clothing.
Getting comfy despite the pouring rain. Tarp set up and fire lit. Photo: Paul Kirtley.
In torrential rain, being able to quickly select a good campsite and set up with efficient campcraft was important. In what was a very damp environment, good fire-lighting skills and material selection were also of key importance. Solid application of elementary bushcraft skills while undertaking real-world journeys such as this make the difference between a miserable experience and a comfortable, enjoyable time in the outdoors, despite the conditions.
A warming fire is always welcome at the end of a chilly day. Photo: Paul Kirtley.
After Grantown-on-Spey the river starts its final descent to the sea and begins to flow with real purpose. This, in addition to some significant tributaries adding further volume to the river, means there are some rapids that must be treated with respect. Ray guided us down the river with the consummate skill and judgement. His experience and professionalism in these situations is always evident. This was a real journey in cold conditions with laden boats. No-one swam throughout the whole trip. Nor did we portage around or line through any sections.
Lunch stop below the rapids at Knockando. We'd come around from the left. Photo: Paul Kirtley.
On the final day we were treated to some warming sunshine as we made for our finish at Spey Bay. In the final few kilometers of the river, it flows unconstrained into an outwash plain where the river becomes braided. This is an unusual feature for a British river. Down amongst the shingles and small willows, you could almost have been transported to somewhere much more remote.
The braided outwash of the last few kilometers of the Spey feel completely untamed. Photo: Paul Kirtley.
Just as I was becoming fully absorbed by this special environment, all of a sudden there was the smell of the sea on the air. Soon we passed under the deserted railway bridge near Garmouth and within a kilometer we could see the sea. Right there. Waves breaking in front of us.
The end of our journey down the Spey, with waves crashing not far away. Photo: Paul Kirtley.
This was the end of what had been a relatively short and relaxed but nonetheless full journey: We had travelled from loch to sea via stunning and varied landscapes. There had been exhilarating paddling and an opportunity to use some bushcraft skills to add to our comfort. I enjoyed travelling and camping with everyone in the group and I would like to extend particular thanks to Ray for his organisation and guiding. If you'd like to undertake a trip on the River Spey, Frontier Bushcraft now offers trips in conjunction with Ray Goodwin. You can find out more here.
The Frontier Bushcraft contingent: (clockwise from left) Ben Gray, Paul Kirtley and Ray Goodwin.
A great trip, the trees where amazing that time of year. I do remember snow on my hammock in the mornings.
This was the trip that made me want to learn some bushcraft. There where a couple of handy lads on the trip who had been trained by Paul and proved their worth. I just made cakes.
I did think that a distillery stop may have been in order, l’ve never pasted so many in my life.
Good to hear from you and I’m glad my blog of the trip brought back a few memories for you.
We didn’t have snow on our camp in the mornings but it was pretty chilly. Certainly chilly enough to have a few warming drams of an evening. Both Aberlour and Knockando were sampled and found new fans.
|
0.992526 |
Since the acquittal of George Zimmerman, the conventional wisdom among people who agree with the verdict is that Trayvon Martin punched him first, so the teen was responsible for the fight that led to his tragic death. The claim about the punch is entirely coming from Zimmerman and could be a lie -- no one else saw it -- but let's assume for the sake of argument that it's true.
There's still a justification for Martin punching him in self defense, based entirely on Zimmerman's own words in the interview he gave Sean Hannity of Fox News.
Hannity: You said he started from almost the beginning in that 911 call, you said he came towards you, and he seemed to reach for something in his waistband. Did you think that was a gun?
Zimmerman: He asked me what my problem was.
Zimmerman: Yes, sir. And I was wearing a rain jacket, and I had put my cell phone in my jacket pocket, as opposed to my jeans pocket where I normally keep it. And I immediately went to grab my phone to this time call 911 instead of a non-emergency, and when I reached into my pants pocket -- because that's where I keep it out of habit -- it wasn't there, and I was shocked. I looked up and he punched me and broke my nose.
Put yourself in Martin's shoes, based on the scenario exactly as Zimmerman described it in that interview. An adult male has been behaving strangely and following him, first in his car and then on foot. It's dark and a heavy rain is falling, making these actions even more suspicious.
He has traveled on foot away from the street to a place behind condos near his residence, and there's Zimmerman again. Martin confronts the man to find out why he's being followed and the man doesn't explain. Instead, he quickly reaches for something in a waist pocket.
At that point, does Martin have any way of knowing the man isn't reaching for a gun?
Zimmerman's own words make the case for Martin punching him first to defend his life. Reaching for something at your waist in that situation is a threat, and we all know that Florida's Stand Your Ground law removed the obligation of anyone to remove himself from a potentially dangerous situation before using force.
If Martin punched Zimmerman believing he had a gun, it was a fear that had a basis in fact.
Keep reaching. Utter nonsense. Martin still had the option to run away. And he didn't even bother to cal 911.
"Reaching for something at your waist in that situation is a threat,"
So therefore, the moment Martin first reached for his waistband Zimmerman was clearly being threatened.
Martin still had the option to run away.
If you run away from someone near you who you think is taking out a gun, you could get shot in the back.
Remind me why you think Zimmerman had a duty to retreat, but Martin, in your scenario, does not.
Under Stand Your Ground, no one has an obligation to retreat. It's a terrible law that causes situations to become fatal that could have been avoided.
But Zimmerman was a reckless and dangerous idiot for getting out of his car and following Martin with a gun at his hip. He wasn't a cop. The dispatcher told him he should not follow Martin. Neighborhood watch volunteers are told never to patrol their neighborhoods while armed. He ignored all of that, and now he gets to live the rest of his life with Martin's death on his conscience.
"Put yourself in Martin's shoes..."
Thank you. That's something I haven't heard much in the media and something I keep saying to friends a family. On top of Zimmerman following him in the dark, he knew his brother was home at home. One of the police officers was saying it was a shame Martin was so close to home but he didn't keep going. Why would he go home if someone was following him and he knew his brother was there alone?
"Stand your ground" amounts to legalized dueling. Two guys get in a fight and they both have the right to stand their ground. Whoever survives is innocent.
Our legislators are dim bulbs who have never, and probably couldn't, kill a chicken, pig, cow, or deer but fantasize about blowing a bad guy away. Of course that describes a good part of the electorate which is why they were elected.
For a moment lets forget about what we are told from the two involved. Let examine the personalities and their histories. Lets get some information who there people are. Then lets talk.
Dude, great observation ! you are smarter than the State of Florida Prosecutors as they never mentioned this.
Can we please stop talking about stand your ground laws? That law had nothing to do with this case. Even if it did, how in the world could Zimmerman retreat when Martin was on top of him bashing his head into the concrete?
"Why would he go home if someone was following him and he knew his brother was there alone?"
You mean his eight year old brother? Who leaves an eight year old home alone to begin with?
Stand Your Ground was included in the jury instructions, and Juror B37 said on CNN that it factored into their decision to acquit Zimmerman.
Chad Joseph, the son of Tracy Martin's fiance, was 14 when the shooting occurred. Until you get a better grasp on the facts, go comment somewhere else.
will do a Tremendous help for you, as it will directly coordinate to the team of QuickBooks Assitance in on time. The professionals are highly talented and very helpful, our assistance available any time.
|
0.994579 |
Those of us who thought that Salesforce CRM could not get any better had a pleasant surprise when Salesforce announced Einstein, its latest foray into the realm of Artificial Intelligence (AI). Einstein is intended to bring intelligence into the assimilation and consumption of the huge mass of data that the Salesforce platform can collect like IoT data, e-commerce data, sales data, data generated from emails, and social networks. It uses smart technologies like machine learning, predictive analytics, natural language processing (NLP), and BeyondCore Smart Data Discovery to generate unique data insights across various Salesforce applications.
How is Salesforce making its Sales and Marketing offerings smart?
The Marketing Cloud Einstein aims to bring higher accuracy in predicting the optimal timing, the best channel, the most suitable audience, and the most effective content for all your marketing messages and campaigns. It marks a notable shift from the customary trend in data analytics to predict behavior and outcome based on historical data.
1. Predictive Scoring: With predictive scoring, marketers can determine the best way to achieve customer engagement and how to visualize and meet customer expectations. Machine learning and data science are used to predict the probability of a customer to open an email or click on an offer. Each known customer is scored based on this learning and predictive audience groups are created, which are groups of customers segmented based on their score. Marketers can then send out separate, targeted emails and offers to the group of customers who are more likely to purchase and the group of customers that need more convincing.
2. Automated Send-Time Optimization: The success of email marketing depends on whether the email is sent at the right time in a week, when the customer is most likely to view it. Salesforce AI takes the guessing out of the game by predicting the optimal time to send promotional emails to customers based on open/click data and data collected from various sources like Salesforce Chatter and e-commerce sites. With the automated send-time optimization, email marketers can obtain higher ROI on their marketing investment by sending out marketing mails at a time when their customers are most likely to click and act on them.
The Sales Cloud Einstein helps sales personnel to identify hot leads and opportunities. It can help them to detect customer relationships that are on the decline and tell them how to engage and reconvert such customers. Armed with AI, sales teams can gain better customer insight and thereby, increase their predictive abilities and their productivity.
3. Predictive Lead Scoring: This gives sales team an idea about conversion. This feature allows sales personnel to focus on leads that have a higher chance of ending in a sale. The technology uses a mix of static data like the business size and industry as well as real-time data like leads who have shown interest in a brand or product through emails or website interactions, including social media activities. This information is used to assign a fit score (if the incoming customer is a likely buyer) and an activity score (how active he or she has been in interacting with your brand). Predictive lead scoring drives high efficiency by telling your sales team on which leads they should focus on every day for best results.
4. Opportunity Insights: This gives sales representatives a real-time view of every opportunity as it develops. This feature monitors every account that is associated with the opportunity and alerts are sent when there is an upward or downward movement on the opportunity in relation to a customer account. This enables sales representatives to act swiftly and engage a customer who appears to be interested in making a purchase as well as rekindle interest in customers who appear to be drifting away from the brand.
5. Automated Activity Capture: This is designed to bring in high operational efficiency in sales by automating much of the manual update tasks that sales representatives have to do to keep their account status up to date. The automated activity capture syncs calendar and email activity with the right Salesforce record allowing sales personnel to easily keep track of their account. It also analyzes them to generate customer predictions.
Data and AI are at the core of Salesforce’s future direction and the company plans to enhance its AI features in upcoming releases. The Salesforce Marketing Cloud Einstein and the Sales Cloud Einstein will give sales and marketing teams an improved perspective of their customer and sales prospects. It will continue to make good use of data to deliver recommendations and predictions that can help marketers and sales personnel to take better decisions and make the most of business opportunities.
Gartner predicts that by 2017, enterprises that make decisions controlled by differentiated algorithms will see a 5-10% increase in revenue. Not every company has the capability to weave in artificial intelligence into its system. Salesforce, with its AI-enabled features and technology enhancing tools, can give businesses the power to use data to drive customer-friendly actions and behavior.
|
0.973049 |
How do I write about this experience and remain polite? It is extremely difficult to have to watch the language because my previous Rheumy was nothing more than an absolute jerk. I have used a very different word to describe him.
I live on the Central Coast in NSW and for a while there was only the one Rheumy in the region. I was sent to him and I will not be seeking a renewal of the referral. He was the third one who claimed that I had only Fibromyalgia, only this time he did not do any kind of test to come to that conclusion. I did in fact argue with my GP over this particular issue, but he did not realize that the Rheumy had jumped to a certain conclusion during the first visit, and not after the ordered blood tests. This particular Rheumy does not follow the proper protocols when a patient is on Methotrexate!! He told me to have the blood test every 2 months initially, then he pushed it out to every 3 months, and wanted a follow-up after 12 months. He also lowered my dose of Methotrexate and took me off the Plaquenil.
[justify]It is the last two things that are important because after he did this, my anti-inflammatory indicators remained high, the ANA did not reduce and the RA factor began to increase again. Yes I saw the blood test results and I know how to make the comparisons. They are also important because I began to feel really lousy after the medication was reduced. I have had a lot of new symptoms.
During the first consultation this particular rheumy bombasted me with questions and because of his bombastic approach I ended up giving misleading answers, and those answers made me look bad. He did not accept the diagnosis of my previous doctor, which was MCTD moving into RA after about 2 years under his care. This bombastic fool proclaimed that I did not have arthritis and that my problem was fibromyalgia alone.
The second consultation was worse than the first one. The bombastic idiot had prescribed something that I had used in the past and where I had felt like I was a zombie at work (the doctor who prescribed that medication was also a jerk). I was up front about not wanting to take the medication. He told me I had to use it with a dose of 1 initially and increasing it to 2 ENDEP per night. I took one and was not all that willing to take 2 but I did it for a time. The medication was useless and it did not touch the hip issues at all!!. During that second consultation he abused me to my face because I had indicated that I had taken only the one tablet each night. Then he wrote an untruth to my doctor by claiming that I had not taken the rubbish in the first place. I was infuriated when I found out what he had in fact written to my doctor.
Now we come to the third consultation which was in fact smoother. He indicated that I needed a check up for possible heart issues. What he wrote to my doctor though, is the reason that I got so angry that I burst forth with rather unladylike language as I described as being a part of the male anatomy beginning with p. He had almost acknowledged that I had arthritis in that 3rd consultation but in his letter he protested that Lyrica was also for fibromyalgia.
There are now another 3 Rheumies working the central coast. My doctor sent me to the one who knows my previous Rheumy who is now in Canberra. I am happy to make the change and never set foot in that other practice again.
Now I remain on the roundabout. I have a more sympathetic doctor. This one increased my medication. He sent me to the naughty corner because I had not had my regular blood test. He also proclaimed that having sleep apnea is not romantic . This was in his letter to my doctor and yes I think it is funny. This man made the comment that I have had RA for more than 10 years. What a relief. I agree with him. I also agree that I do in fact have underlying fibromyalgia, just not primary fibromyalgia because I have indicators that show otherwise. In time my anger will disappear, but right now I am still angry and this is more than 12 months after I began to see that jerk!!
|
0.821482 |
When should a shareholders' agreement be used?
What does a shareholders' agreement do?
What are typical provisions to protect shareholders' interests?
What provisions are often included to give the shareholder a say in management?
How much does a shareholders' agreement cost?
A shareholder's agreement is a contract between the shareholders of a company in which they agree how the company will be run. They all agree that they will use their voting power in the company to ensure that the terms of the agreement are complied with for as long as they are all shareholders.
Circumstances vary, but a shareholders' agreement should always be considered when there are between two and, say, 20 shareholders in a company. A shareholders' agreement is esential to protect a minority shareholder.
Shareholder agreements vary, but the typical agreement is designed to protect all the parties against a majority using their voting power to the detriment of the others. Without such an agreement, a company is under the control of those who hold a majority of the votes at a directors' or shareholders' meeting. Majority decisions are all very well for day to day matters, but where something goes to the heart of running the company, or materially affects the interests of individual shareholders, most shareholders want to have their say. A shareholders' agreement can specify decisions which require all, or a certain shareholders to agree.
Unless constrained by a shareholders' agreement, shareholders with a simple majority of votes (e.g. two out of three equal shareholders) have very wide powers under company law. Without requiring any consent from the other shareholders, they can appoint new directors (perhaps their friends or family members), remove any director (such as one of the other shareholders), vote to pay themselves salaries or fees which other shareholders or directors do not get or issue more shares (so diluting existing shareholders' ownership of the company). These are only examples. A shareholders' agreement would usually constrain these powers so that such things can only be done with the consent of all the parties or, sometimes, a specified majority of them.
Being a shareholder does not even confer the right to be a director and that is usually one of the provisions of a shareholders' agreement. Most agreements will go further by providing a list of management decisions that require the agreement of all (or a specified percentage of) the directors. Circumstances vary, but typical provisions relate to matters that are outside the usual course of the business, such as changing the nature of the business, entering into unusual contracts or contracts in which a director is personally interested, extending the company's overdraft (which often all directors have personally guaranteed), borrowing above agreed limits, employing or dismissing staff in unusual circumstances or bringing or defending legal proceedings.
One of the most important areas is the rules that apply when a shareholder wants to transfer his or her shares, and what can happen to them when the shareholder dies. These can be set out either in the articles or in a shareholders' agreement. Many companies' articles give the directors a discretion to reject any transfer by a majority decision. There are many alternative provisions, such as pre-emption provisions (giving the other shareholders a first option to buy the shares), free transfers to members of the shareholder's family or for all transfers to require the consent of all shareholders.
Cost can vary according to the complexity of the agreement. The Company Law Solutions standard service, which covers most agreements, is very competitively priced at £300.00 plus VAT. This is our total charge in many cases. If complex additional terms have to be drafted, there may be additional cost, but we would always advise as to the actual cost before proceeding, and the total is very unlikely to exceed £600 plus VAT.
For further information visit our Company Law Solutions website.
|
0.998226 |
В топике Американские ценности говорится о том, что мы изучаем нашу культуру только через познание культур других народов, и сравниваются убеждения и ценности американцев и русских. Рассматриваются отношения двух народов к таким понятиям как: привязанность к семейным узам и коллективу, индивидуализм, отношение к личному будущему и ценность времени. У многих народов существуют свои ценности и, иногда, сильно отличающиеся друг от друга.
The most important thing to understand about Americans is probably their devotion to individualism. They have been trained since very early in their lives to consider themselves as separate individuals who are responsible for their own situations in life and their own destinies. They have not been trained to see themselves as members of a close-knit, tightly interdependent family, religious group, tribe, nation, or other collectivity. Conversely Russians find themselves part of some group. They always have some kind of attachment, especially family relations.
Another distinctive difference is in the attitude to change the future. Americans are generally less concerned about history and traditions than are people from older societies. "History doesn't matter," many o f them will say. "It's the future that counts." They look ahead. People from many other cultures, as well as Russian, have a pronounced reverence for the past. In those cultures the future is considered to be in the hands of fate, God, or at least the few powerful people or families dominating in society.
Time is also of great importance in the USA. For Americans, time is a source, like water or coal, which can be used well or poorly. "Time is money." Thus, Americans admire a well-organized person, one who has a written list of things to do and a schedule for doing them. The ideal person is punctual and considerate of other people's time. Russians are more likely to conceive of time as something that is simply there around them, not something they can use.
|
0.992679 |
There are many different ways to manage stress. Basically, it's best to eliminate as many stressors as you can, and find practical and emotional ways to better handle the stressors that are left. The following are among the simplest and most effective stress management techniques.
Stress Relaxation Techniques means zoning out in front of the TV at the end of a stressful day. But this does little to reduce the damaging effects of stress relief. To effectively combat stress, we need to activate the body’s natural relaxation response. You can do this by practicing relaxation techniques such as deep breathing, meditation, rhythmic exercise, and yoga. Fitting these activities into your life can help reduce everyday stress and boost your energy and mood.
The parts of the day that feel very stressful are often simply unavoidable, whether it’s a packed commute, juggling multiple tasks at work, or even doing the housework. Stress management means being able to cool off, calm down, relax, and deal with stress relief sensibly, rather than hiding from challenging situations with temporary or counter-productive coping habits, like smoking or stress-eating.
Stress Relief is the way your body responds to a particular situation. It depends on the situations that happens around you. When a person feel stressed, their bodies tend to react by releasing some chemicals into the blood.
All the above Relaxation techniques may provide immediate relief from stress relief , but meditating regularly has an effect in the long run. It not only protects your physical health but also looks after your mental health. This helps you in relaxing the brain and body and allows you to think positively which solves the problem with ease. A cool and relaxed mind makes you think promptly and good ideas hit your brain faster.
Yoga People often find that yoga is a great activity for stress management, keeping you focused on your own body and mind rather than the things going on around you. Try a class, podcast, or online video as a starting point.
A good sleep is the better option for relieving stress relief. Stress makes you to lose sleep and vice versa also. lack of sleep may lead to increase in stress levels. Make it a point that you sleep for atleast 7 hours so that your brain and body will be well activated.
Exercise is one of the best ways to reduce stress relief. It can reduce anxiety, help us relax and enhance feelings of self worth all good for lowering stress. Exercising in beautiful surroundings can calm and nurture the souls. Forests, mountains and parks are ideal areas.
Do you know that stress levels and proper diet are closely related? Yes, its true. Improper diet may lead to tiredness, sickness and followed by increase in stress levels. Many of us neglect eating if we are involved any serious work. At that time, we tend to eat some snacks or junk food just to fill the stomach. But this is not a good attempt. Fruits and vegetables are always good for health. It is also proved that fish and omega-3 fatty acids reduce the stress levels. Hence, eat proper food at the right time to reduce your stress levels.
If you are fretted with stress, try listening to your favorite classical music. It makes you relaxed and playing a calm music has a positive impact on your brain and body. In turn it lowers your blood pressure and relaxes the nerves in the brain and gives you the cooling effect.
Share the post "Top 6 Free Relaxation Techniques For Stress Relief"
|
0.946118 |
everything was perfect. person at customer service desk was very nice and polite. 5stars.
|
0.999961 |
"Conquista" redirects here. For other uses, see Conquista (disambiguation).
Iberian territory of Crown of Castile. .
The Catholic Monarchs Isabella of Castile, Queen of Castile and her husband King Ferdinand, King of Aragon, pursued a policy of joint rule of their kingdoms and created a single Spanish monarchy. Even though Castile and Aragon were ruled jointly by their respective monarchs, they remained separate kingdoms. The Catholic Monarchs gave official approval for the plans of Genoese mariner Christopher Columbus for a voyage to reach India by sailing West. The funding came from the queen of Castile, so the profits from Spanish expedition flowed to Castile. In the extension of Spanish sovereignty to its overseas territories, authority for expeditions of discovery, conquest, and settlement resided in the monarchy.
Columbus made four voyages to the West Indies as the monarchs granted Columbus the governorship of the new territories, and financed more of his trans-Atlantic journeys. He founded La Navidad on the island later named Hispaniola (now divided into Haiti and the Dominican Republic), in what is the present-day Haiti on his first voyage. After its destruction by the indigenous Taino people, the town of Isabella was begun in 1493, on his second voyage. In 1496 his brother, Bartholomew, founded Santo Domingo. By 1500, despite a high death rate, there were between 300 and 1000 Spanish settled in the area. The local Taíno people continued to resist, refusing to plant crops and abandoning their Spanish-occupied villages. The first mainland explorations were followed by a phase of inland expeditions and conquest. In 1500 the city of Nueva Cádiz was founded on the island of Cubagua, Venezuela, followed by the founding of Santa Cruz by Alonso de Ojeda in present-day Guajira peninsula. Cumaná in Venezuela was the first permanent settlement founded by Europeans in the mainland Americas, in 1501 by Franciscan friars, but due to successful attacks by the indigenous people, it had to be refounded several times, until Diego Hernández de Serpa's foundation in 1569. The Spanish founded San Sebastian de Uraba in 1509 but abandoned it within the year. There is indirect evidence that the first permanent Spanish mainland settlement established in the Americas was Santa María la Antigua del Darién.
The Spanish conquest of Mexico is generally understood to be the Spanish conquest of the Aztec Empire (1519–21) which was the base for later conquests of other regions. Later conquests were protracted campaigns with less spectacular results than the conquest of the Aztecs. The Spanish conquest of Yucatán, the Spanish conquest of Guatemala, the war of Mexico's west, and the Chichimeca War in northern Mexico expanded Spanish control over territory and indigenous populations. But not until the Spanish conquest of Peru was the conquest of the Aztecs matched in scope by the victory over the Inca empire in 1532.
The Spanish conquest of the Aztec empire was led by Hernán Cortés. The victory over the Aztecs was relatively quick, from 1519 to 1521, and aided by his Tlaxcala and other allies from indigenous city-states or altepetl. These polities allied against the Aztec empire, to which they paid tribute following conquest or threat of conquest, leaving the city-states' political hierarchy and social structure in place.
The Spanish conquest of Yucatán was a much longer campaign, from 1551 to 1697, against the Maya peoples in the Yucatán Peninsula of present-day Mexico and northern Central America. Hernán Cortés' landing ashore at present day Veracruz and founding the Spanish city there on April 22, 1519 marked the beginning of 300 years of Spanish hegemony over the region. The assertion of royal control over the Kingdom of New Spain and the initial Spanish conquerors took over a decade, with importance of the region meriting the creation of the Viceroyalty of New Spain. Established by Charles V in 1535, the first viceroy was Don Antonio de Mendoza.
Spain colonized and exerted control of Alta California through the Spanish missions in California until the Mexican secularization act of 1833.
In 1532 at the Battle of Cajamarca a group of Spaniards under Francisco Pizarro and their indigenous Andean Indian auxiliaries native allies ambushed and captured the Emperor Atahualpa of the Inca Empire. It was the first step in a long campaign that took decades of fighting to subdue the mightiest empire in the Americas. In the following years Spain extended its rule over the Empire of the Inca civilization.
The Spanish took advantage of a recent civil war between the factions of the two brothers Emperor Atahualpa and Huáscar, and the enmity of indigenous nations the Incas had subjugated, such as the Huancas, Chachapoyas, and Cañaris. In the following years the conquistadors and indigenous allies extended control over Greater Andes Region. The Viceroyalty of Perú was established in 1542. The last Inca stronghold was conquered by the Spanish in 1572.
European explorers arrived in Río de la Plata in 1516. Their first Spanish settlement in this zone was the Fort of Sancti Spiritu established in 1527 next to the Paraná River. Buenos Aires, a permanent colony, was established in 1536 and in 1537 Asunción was established in the area that is now Paraguay. Buenos Aires suffered attacks by the indigenous peoples that forced the settlers away, and in 1541 the site was abandoned. A second (and permanent) settlement was established in 1580 by Juan de Garay, who arrived by sailing down the Paraná River from Asunción (now the capital of Paraguay). He dubbed the settlement "Santísima Trinidad" and its port became "Puerto de Santa María de los Buenos Aires." The city came to be the head of the Governorate of the Río de la Plata and in 1776 elevated to be the capital of the new Viceroyalty of the Río de la Plata.
Between 1537 and 1543, six Spanish expeditions entered highland Colombia, conquered the Muisca Confederation, and set up the New Kingdom of Granada (Spanish: Nuevo Reino de Granada). Gonzalo Jiménez de Quesada was the leading conquistador with his brother Hernán second in command. It was governed by the president of the Audiencia of Bogotá, and comprised an area corresponding mainly to modern-day Colombia and parts of Venezuela. The conquistadors originally organized it as a captaincy general within the Viceroyalty of Peru. The crown established the audiencia in 1549. Ultimately, the kingdom became part of the Viceroyalty of New Granada first in 1717 and permanently in 1739. After several attempts to set up independent states in the 1810s, the kingdom and the viceroyalty ceased to exist altogether in 1819 with the establishment of Gran Colombia.
Spain's administration of its colonies in the Americas was divided into the Viceroyalty of New Spain 1535 (capital, Mexico City), and the Viceroyalty of Peru 1542 (capital, Lima). In the 18th century the additional Viceroyalty of New Granada 1717 (capital, Bogotá), and Viceroyalty of Rio de la Plata 1776 (capital, Buenos Aires) were established from portions of the Viceroyalty of Peru. The change diminished the political and economic power of the viceroyalty and opened formal connections between the mining district of Upper Peru and the port of Buenos Aires.
The system of crown rule evolved from the era of the Catholic Monarchs, which established the Council of the Indies, to the establishment of viceroyalties in Mexico and Peru following their conquests in the Habsburg era, and then into an Intendant system in the eighteenth century as part of the Bourbon Reforms. The reform was aimed at increasing crown control over its colonies, raising more revenue, and promoting greater efficiency.
Captaincy General of Cuba (until 1898) – Included in this captaincy general until 1819 was Florida.
Spanish colonialization in the Americas.
During the Napoleonic Peninsular War in Europe between France and Spain, assemblies called juntas were established to rule in the name of Ferdinand VII of Spain. The Libertadores (Spanish and Portuguese for "Liberators") were the principal leaders of the Spanish American wars of independence. They were predominantly criollos (Americas-born people of European ancestry, mostly Spanish or Portuguese), bourgeois and influenced by liberalism and in some cases with military training in the mother country.
In 1809 the first declarations of independence from Spanish rule occurred in the Viceroyalty of New Granada. The first two were in present-day Bolivia at Sucre (May 25), and La Paz (July 16); and the third in present-day Ecuador at Quito (August 10). In 1810 Mexico declared independence, with the Mexican War of Independence following for over a decade. In 1821 Treaty of Córdoba established Mexican independence from Spain and concluded the War. The Plan of Iguala was part of the peace treaty to establish a constitutional foundation for an independent Mexico.
These began a movement for colonial independence that spread to Spain's other colonies in the Americas. The ideas from the French and the American Revolution influenced the efforts. All of the colonies, except Cuba and Puerto Rico, attained independence by the 1820s. The British Empire offered support, wanting to end the Spanish monopoly on trade with its colonies in the Americas.
In 1898, the United States achieved victory in the Spanish–American War with Spain, ending the Spanish colonial era. Spanish possession and rule of its remaining colonies in the Americas ended in that year with its sovereignty transferred to the United States. The United States took occupation of Cuba, the Philippines, and Puerto Rico. Puerto Rico continues to be a possession of the United States, now officially continues as a self-governing unincorporated territory.
It has been estimated that over 1.86 million Spaniards emigrated to Latin America in the period between 1492 and 1824, with millions more continuing to immigrate following independence.
In Hispaniola, the indigenous Taíno pre-contact population before the arrival of Columbus of several hundred thousand had declined to sixty thousand by 1509. Although population estimates vary, Dominican friar Bartolomé de las Casas, the "Defender of the Indians" estimated there were 6 million (6,000,000) Taíno and Arawak in the Caribbean at the time of Columbus's arrival in 1492.
The population of the Native American population in Mexico declined by an estimated 90% (reduced to 1–2.5 million people) by the early 17th century. In Peru, the indigenous Amerindian pre-contact population of around 6.5 million declined to 1 million by the early 17th century. The overwhelming cause of the decline in both Mexico and Peru was infectious diseases, such as smallpox and measles, although the brutality of the Encomienda also played a significant part in the population decline.
Of the history of the indigenous population of California, Sherburne F. Cook (1896–1974) was the most painstakingly careful researcher. From decades of research, he made estimates for the pre-contact population and the history of demographic decline during the Spanish and post-Spanish periods. According to Cook, the indigenous Californian population at first contact, in 1769, was about 310,000 and had dropped to 25,000 by 1910. The vast majority of the decline happened after the Spanish period, during the Mexican and US periods of Californian history (1821–1910), with the most dramatic collapse (200,000 to 25,000) occurring in the US period (1846–1910).
^ Ida Altman, S.L. Cline, and Javier Pescador, The Early History of Greater Mexico, Pearson, 2003 pp. 35–36.
^ Tibesar, A.S. (1957). "The Franciscan Province of the Holy Cross of Espanañola, 1505–1559". The Americas. 13 (4): 377–389. doi:10.2307/979442. JSTOR 979442.
^ Robert S. Chamberlain, The Conquest and Colonization of Yucatan. Washington DC: Carnegie Institution.
^ Ida Altman, The War for Mexico's West. Albuquerque: University of New Mexico Press 2010.
^ Philip W. Powell, Soldiers, Indians, and Silver: North America's Last Frontier War. Tempe: Center for Latin America Studies, Arizona State University 1975. First published by University of California Press 1952.
^ MacIas, Rosario Marquez; MacÍas, Rosario Márquez (1995). La emigración española a América, 1765-1824. ISBN 9788474688566.
^ "The Story Of... Smallpox". Pbs.org. Retrieved 2019-03-02.
^ Baumhoff, Martin A. 1963. Ecological Determinants of Aboriginal California Populations. University of California Publications in American Archaeology and Ethnology 49:155–236.
Brading, D. A., The First America: the Spanish Monarchy, Creole Patriots, and the Liberal State, 1492–1867 (Cambridge: Cambridge University Press, 1993).
Hanke, Lewis. The Spanish Struggle for Justice in the Conquest of America (Boston: Little, Brown, and Co., 1965).
Portuondo, María M. Secret Science: Spanish Cosmography and the New World (Chicago: Chicago UP, 2009).
Dutch trading posts and plantations in the Americas precede the much wider known colonization activities of the Dutch in Asia. While the first Dutch fort in Asia was built in 1600, actual colonization, with Dutch settling in the new lands, was not as common as with other European nations. Hudson entered the Upper New York Bay by sailboat, heading up the Hudson River, Block Island and Block Island Sound are befittingly named in his honor. Block quickly ascended and became Manhattans first monopolist, after some early trading expeditions, the first Dutch settlement in the Americas was founded in 1615, Fort Nassau, on Castle Island along the Hudson, near present-day Albany. The settlement served mostly as an outpost for trading in fur with the native Lenape tribespeople, both forts were named in honor of the House of Orange-Nassau. By 1621, the United Provinces had charted a new company, a monopoly in the Americas and West Africa. The WIC sought recognition as founders of the New World – which they ultimately did as founders of a new Province in 1623 and that year, another Fort Nassau was built on the Delaware River near Gloucester City, New Jersey.
The colony expanded to outlying areas at Pavonia, Bronx, on the Connecticut River, Fort Huys de Goede Hoop was completed in 1633 at present day Hartford. By 1636, the English from Newtown settled on the side of the Little River. In the Treaty of Hartford, the border of New Netherland was retracted to western Connecticut and by 1653, settlements at Fort Nassau and the short-lived Fort Beversreede were abandoned and consolidated at Fort Casimir. By 1655 Fort Christina, sitting in what is today Wilmington, had already been renamed Fort Altena, not all inhabitants of New Netherlands, Manahattas first European colonizers, were ethnically Dutch, but in reality came from many European countries. In 1664, an English naval expedition ordered by Prince James, Duke of York and of Albany sailed in the harbor at New Amsterdam, being greatly outnumbered, Director-General Peter Stuyvesant surrendered after negotiating favorable articles of capitulation. The Province took a new name, New York, Fort Orange was renamed Fort Albany.
Genocide is intentional action to destroy a people in whole or in part. The hybrid word genocide is a combination of the Greek word génos, the United Nations Genocide Convention, which was established in 1948, defines genocide as acts committed with intent to destroy, in whole or in part, a national, racial or religious group. The term genocide was coined in a 1943 book responding to mass murder of populations in the 20th century, in 1943, Raphael Lemkin created the term genocide in his book Axis Rule in Occupied Europe. The book describes the implementation of Nazi policies in occupied Europe, the term described the systematic destruction of a nation or people, and the word was quickly adopted by many in the international community. The word genocide is the combination of the Greek prefix geno-, Lemkin defined genocide as follows, Generally speaking, genocide does not necessarily mean the immediate destruction of a nation, except when accomplished by mass killings of all members of a nation.
The preamble to the 1948 Genocide Convention notes that instances of genocide have taken place throughout history. Lemkins lifelong interest in the murder of populations in the 20th century was initially in response to the killing of Armenians in 1915. He dedicated his life to mobilizing the international community, to together to prevent the occurrence of such events. In a 1949 interview, Lemkin said I became interested in genocide because it happened so many times and it happened to the Armenians, after the Armenians, Hitler took action. In 1948, the UN General Assembly adopted the Convention on the Prevention, the CPPCG was adopted by the UN General Assembly on 9 December 1948 and came into effect on 12 January 1951. The USSR argued that the Conventions definition should follow the etymology of the term, and may have feared greater international scrutiny of its own Great Purge. Other nations feared that including political groups in the definition would invite international intervention in domestic politics.
Canada first came under British rule with the Treaty of Paris which ceded New France, of which Canada was a part, to the British Empire. Gradually, other territories and provinces that were part of British North America would be added to Canada. The Royal Proclamation of 1763 enlarged the colony of Canada under the name of the Province of Quebec, with the Act of Union 1840 Upper and Lower Canada were joined to become the United Province of Canada. A number of other British colonies, such as Newfoundland and British Columbia, in North America, the Seven Years War officially ended with the signing of the Treaty of Paris on February 10,1763. As part of the treaty, France ceded all North American lands to Britain, except Louisiana, the Quebec Act became one of the Intolerable Acts that infuriated the thirteen British colonies in what would become the United States of America. In Acadia, the British had expelled French-speaking populations in 1755 from Acadia to Louisiana, creating the Cajun population, in the former French territory of Acadia, the British were confronted by a relatively large and well-established Catholic Mikmaq and Wabanaki Confederacy.
The British Conquest of Acadia happened in 1710, much earlier than in what would become the rest of modern-day Canada, the Mikmaq never ceded land to either France or England. The first immigration of Protestants happened in the province with the founding of Halifax, the establishment of Halifax sparked Father Le Loutres War, which, in turn, led to the British expelling the Acadians from the region during the French and Indian War. As they captured Cape Breton Island and Prince Edward Island, the few Acadians who managed to return to the area have created the contemporary Acadian society. Once the land was emptied, other settlements were formed by New England Planters, in 1775, American revolutionaries attempted to push their insurrection into Quebec. The habitants were divided, in areas, there was significant support. The Patriots laid siege to Fort Saint-Jean, capturing it and Montreal in November 1775 and they marched on Quebec City, where an attempt to take the city on December 31,1775, failed.
The Hamidian massacres were massacres of Armenians in the Ottoman Empire during the mid-1890s, with estimates of the dead ranging from 80,000 to 300,000.
|
0.989815 |
What is the different between Outsourcing and Shared Services ?
Outsourcing means you are taking a function of the company / business, and contracting another party to run it. For example, outsourcing your Service Desk.
Shared services usually refers to a service provided within the company, whether outsourced or not, that goes across business units. For example, if your company has one HR department at the corporate level for all business units, it is considered a shared service.
|
0.999999 |
How do I share my bot?
To share a direct link to your bot, use its unique Messenger URL. Access your bot’s Messenger URL by typing m.me/[PAGEURL], where PAGEURL equals your Facebook page name. For example, the Octane AI bot can be accessed by visiting m.me/octaneai.
|
0.948512 |
The history Summer Olympics can be rooted back to the ancient Greece. The first Summer Olympics which was also known as the Games of the I Olympiad was held in Athens, Greece from April 6 to April 15. However, it was the first Olympic Games hosted in the modern era. Despite many obstacles and setbacks, the 1896 Olympics were regarded as a great success. Four years later, Summer Olympics was held in Paris. This event attracted more than four times as many athletes, including 11 women, who were allowed to officially compete for the first time, in croquet, golf, sailing and tennis. The Games were integrated with the Paris World’s Fair and lasted over 5 months.
There were fewer participants in the 1904 Summer Olympics which was held in St. Louis, Missouri, United States because of the Louisiana Purchase Exposition World’s Fair. But the number increases in the 1908 London games. In the origin of Summer Olympics, the Games continued to grow, attracting 2,504 competitors, when held in Stockholm in 1912. However, the Games at Stockholm were the first to fulfill Pierre de Coubertin's original idea. For the first time since the Games started in 1896 were all continents represented with athletes competing in the same stadium. However, the scheduled Berlin Games of 1916 were canceled following the onset of World War I. Know more about the Summer Olympics history.
The first post-war Summer Olympics Games were held in 1948 in London, excluding Germany and Japan excluded. At the 1952 Summer Olympics Games Helsinki and the USSR team competed for the first time and consequently became one of the dominant teams. The Games which was held in Melbourne in 1956 was greatly successful, barring a water polo match between Hungary and USSR. Rome hosted the games in the year 1960. In the Summer Olympics history, the Games which were held in 1964, Tokyo was a turning point in the global visibility and popularity of the Olympics. However, the performances at the 1968 Mexico City games were affected by the altitude of the host city. Moreover, politics again intervened at Munich in 1972, with lethal consequences.
In the history of Summer Olympics, the games which were held in Montreal in 1976 were regarded as the most expensive, until the 2008 Summer Olympics. Due to the Afghan Civil War the 1980 Summer Olympics held in Moscow was boycotted and it continues till 1984 Olympics held in Los Angles. Again, without the participation of the Eastern European countries, the 1984 Games were dominated by their host country. The game was also the first time Mainland China (People's Republic) participated. Later, Seoul hosted the Summer Olympics Games in 1988. The 1992 Summer Olympics was held in Barcelona. The next Games were held in Atlanta in 1996 and 2000 Games were in Sydney, Australia. In the Summer Olympics history, the games came back to its birthplace Athens in 2004. The 2008 Summer Olympics Games were held in Beijing. However, 2012 Summer Olympics will held in London, United Kingdom.
|
0.974472 |
Opening Lines: "The New Mexico sun blazed hot through my window, spotlighting my mostly packed suitcase on the floor."
Hello There, I'm Coming Home is the third book in the Hello There trilogy. I've had the pleasure of reading the second book Hello There, Do You Still Know Me, but have not read the first book. Although each book involves a new adventure for Madison and her friends, to completely enjoy the series I'd recommend starting with the first book, Hello There, We've Been Waiting For You! I'm Coming Home appears to draw together all three of the books and ends with a wonderful heartfelt conclusion.
In book one, Hello There, We've Been Waiting For You! Madison moved in with her grandmother, Florida Brown, in Truth or Consequences, New Mexico after her mother died. In the second book of the series, Madison and her friends used the MegaPix 6000, a magical T.V., to portal back in time to search for a cure to save her grandmother from an unexpected illness. In the newest addition to the series, Madison is headed to Bainbridge Island, in Washington State to see her hometown and visit with her best friends Noah, Violet, and Rosalie Claire. Meanwhile, her grandmother Florida is headed to Florida with Grandpa Jack for a little R&R. On the morning of her trip, Madison finds a mysterious photo in her magic fanny pack. There's something about this sad looking boy wearing a hoodie that makes her feel like he is in trouble and could really use her help. If only she could see his face in the photograph. Once Madison is reunited with her friends, she gets the first hint to the boy's identity when she glimpses an iconic symbol from Pikes Place Market in the photo, so staking out the Market is their first order of business.
The story is also about Madison coming back to her hometown after being gone for a while. It captures that feeling of coming home or seeing the places you remember again for the first time. Sometimes with fresh eyes. Madison reminisces about moments she shared with her mother, the stores they frequented, street signs she recognizes and ventures to her childhood home, a place she hasn't visited since her mother died. All aching reminders of how much she misses her mother. You feel Madison's grief over her mother's death, how being here is difficult for her. Bringing up old memories is hard. There's a really sweet moment when Madison looks up and sees the clouds and she can't help thinking of her mother up there watching down on her. It reminded me that I feel the exact same way every time I see a train, how simply seeing that object causes me to smile and fondly remember a person who was so important to me.
When the boy from the photograph turns out to be Madison's estranged father now turned teenager, she is thrown for a loop. For the longest time, she had thought she was an orphan. Then to find out that her father is stuck as a sixteen-year-old kid because his magical shapeshifting amulet was stolen, is a lot to digest. Plus who wants their dad to be stuck close to their age? And it also brings up some interesting questions, like if her dad becomes an adult again how will that change her life? On the one hand, Madison really wants to reconnect with him and get to know him better but finds herself struggling to reconcile what her father is telling her about mother with who she knows her mother to be. Can she believe him?
As I said in my review of book two, I really like the premise of using the MegaPix 6000 to portal into a T.V. show, it makes the magic system relatable and entertaining. I've often wondered myself what it would be like to step into a painting or to travel back in time, but a television show also sounds like a lot of fun to me. Madison teleported into a magician's televised magic performance, but me, I'd love to step into Downtown Abbey or maybe even Happy Days if I had the chance. I also really liked that Madison couldn't alter the past or undo her dad being transformed into a kid. That she had to bring the events into the present to fix the mistake. The characters are easy to relate to and their emotions and actions seemed natural. For example, the way Madison felt awkward when Violet started to have feelings for Noah and she wanted to know if he felt the same way. Plus, I'm a sucker for a happy ending and especially love how the series felt complete.
Favorite Line: "Magic is like life. It doesn't come with guarantees. But it always comes with possibilities."
Aww, thanks for commenting Laurie. All the best on your future book projects.
When I was a little girl watching Star Trek, I always thought we'd be able to do such things by the time I was a grownup. Oh well. We can always read wonderful books like this one, and teleport to our heart's content.
Hi! I'm Brenda. Log Cabin Library is my little space to share my thoughts on the Middle-Grade and YA books that I'm reading. Hope you'll find something here you enjoy and feel free to leave a comment.
August 21st 2019: Call for judges!!!
|
0.94662 |
The Wilshire Grand Center also stands as the tallest building west of the Mississippi River, and the 9th-tallest building in the United States. Seven of the ten tallest buildings in California are located in Los Angeles. The 73-story U.S. Bank Tower, which rises 1,018 feet (310 m) in Downtown Los Angeles and was completed in 1989, is now the second-tallest building in Los Angeles.
The history of skyscrapers in Los Angeles began with the 1903 completion of the Braly Building, which is often regarded as the first high-rise in the city; it rises 13 floors and 151 feet (46 m) in height. The building, originally constructed as a commercial structure, has since been renovated into a residential tower and is now known as the "Continental Building".
In 1904, Los Angeles imposed height restrictions throughout the city, prohibiting the construction of any building taller than 150 ft/46 m. An exception was made for the Los Angeles City Hall, built in 1928, which stands at 454 ft/138 m). This effectively limited the height of non-government buildings to 13 stories, and was intended to address local concerns about growing congestion and over development at the time. That height limit was lifted in Downtown Los Angeles by the city government in 1957.
Los Angeles (and especially Downtown) then went through a large building boom that lasted from the early 1960s to the early 1990s, during which time the city saw the completion of 23 of its 30 tallest buildings, including the U.S. Bank Tower, the Aon Center, and Two California Plaza. Modern skyscrapers are difficult and expensive to construct in Los Angeles due to the city's high rate of earthquakes and position near the San Andreas fault line, as well as the resulting difficulty of adhering to the city's rigorous engineering standards. Nevertheless, a number of successful and iconic skyscrapers dot the Los Angeles skyline from Downtown Los Angeles through Koreatown. Along the Wilshire Corridor, Miracle Mile and Century City areas of the cities westside. Other skyscraper hubs are hotels on Century Boulevard by LAX, the Hollywood district in central L.A. Warner Center, NoHo and Universal City in the San Fernando Valley. LA's west side has so many skyscrapers, often Wilshire Boulevard in the Westwood District, along with Century City's skyscrapers are often confused with being L.A.'s downtown by visitors arriving from LAX.
This lists ranks Los Angeles skyscrapers that stand at least 400 feet (121.9 m) tall, based on standard height measurement. This includes spires and architectural details but does not include antenna masts. An equal sign (=) following a rank indicates the same height between two or more buildings. The "Year" column indicates the year a building was completed.
1,100 (335) AC Martin Partners 73 2017 Office/Hotel 9th-tallest building in the United States, tallest building on the West Coast of the United States, tallest building in California; tallest building constructed in Los Angeles in the 2010s. Topped-out in 2016. When measured by roof height, the tower is 934 ft. tall, which is 84 ft. shorter than the US Bank Tower roof. The building held its grand opening on June 23, 2017.
2 U.S. Bank Tower 1,018 (310) Henry N. Cobb 73 1989 Office 15th-tallest building in the United States, third tallest building on the West Coast of the United States, third tallest building in California; tallest building in the world with a helipad on its roof; tallest building constructed in Los Angeles in the 1980s; formerly known as Library Tower; at the time of its completion, the building was the tallest structure in a major active seismic region (Taipei 101 now holds this title).
10= City National Tower 699 (213) Albert C. Martin 52 1972 Office Formerly known as the Bank of America Tower; this building and Paul Hastings Tower stand as the tallest twin towers in Los Angeles.
10= Paul Hastings Tower 699 (213) Albert C. Martin 52 1972 Office Formerly known as ARCO Tower; this building and City National Tower stand as the tallest twin towers in Los Angeles.
12 Oceanwide Plaza Tower I 677 (206) CallisonRTKL 49 2019 Residential 11th & Figueroa St. / Across from Staples Center. Formerly "Fig Central"
14 Metropolis Tower D 647 (197) Gensler 58 2019 Residential 889 Francisco St.
20= Century Plaza Tower I 571 (174) Minoru Yamasaki 44 1975 Office This building and Century Plaza Tower II stand as the tallest buildings outside Downtown Los Angeles.
20= Century Plaza Tower II 571 (174) Minoru Yamasaki 44 1975 Office This building and Century Plaza Tower I stand as the tallest buildings outside Downtown Los Angeles.
24= Oceanwide Plaza Tower II 530 (162) CallisonRTKL 40 2019 Residential 11th & Figueroa St. / Across from Staples Center. Formerly "Fig Central"
24= Oceanwide Plaza Tower III 530 (162) CallisonRTKL 40 2019 Residential 11th & Figueroa St. / Across from Staples Center. Formerly "Fig Central"
This lists buildings that are under construction in Los Angeles and are planned to rise at least 300 feet (91.5 meters).
Century Plaza North Tower 600 / 183 46 2020 2025 Ave of the Stars Ave. \ Residential \ Twin towers designed by Pei Cobb Freed & Partners. Project is a condo addition to the renovated Century Plaza Hotel.
Hope+Flower Tower I 529 / 161 40 2019 1212 Flower St. \ Under Construction.
Hope+Flower Tower II 421 / 128 31 2019 1212 Flower St. \ Residential.
Grand Avenue Project Tower I 522 / 159 39 2022 100 S. Grand Ave. \ Residential.
This list is of buildings approved or proposed over 300 feet (91.5 m) throughout the city. The tallest buildings currently proposed are The LA Grand Hotel at 1,108 feet (338 m), Angels Landing at 854 feet (260 m), and Figueroa Centre at 975 feet (297 m).
333 South Figueroa 1,108 / 338 77 TBD 333 S. Figueroa St. \ Proposed supertall hotel by Shenzhen New World Group / ground retail / Tallest proposed tower West of Mississippi River.
Figueroa Centre 975 / 297 66 2023 913 S. Figueroa St \ Proposed residential / hotel / retail / Will be the third tallest building in Los Angeles.
Olympia Tower I 853 / 260 65 2023 1025 W. Olympic Blvd \ Proposed Three Towers by Sheng Long Group north of LA Live Regal Cinema \ Retail, Hotel and residential 700 unit apartments.
1045 South Olive Street 810 / 247 70 TBD 1045 S. Olive \ Proposed Residential Apartments / retail / Developed by Crescent Heights.
11th and Hill TBD 63 TBD 11th and Hill \ Crown Group Proposal; 528 Residential units; No Car-Park Podium. Koichi Takada Architects.
Olympic Tower 742 / 227 58 TBD 949 S. Figueroa St. \ Proposed Tower \ Retail, Hotel and residential Replaces the car wash on corner of Fig and Olympic.
City Lights Tower 723 / 220 53 2025 1300 S. Figueroa St \ Proposed \ Hotel \ Replaces apartment completed in 2004, by TriCal.
Times Mirror Square Residential Tower I 655 / 200 53 2023 202 W. 1st St. \ Proposed \ residential. rehabilitate and add to the LA Times Building after the Times vacates to El Segundo neighborhood.
1600 Figueroa TBD 52 TBD 1600 S. Figueroa St. \ Proposed \ Retail and hotel. Designed by Gensler. Replacing DTLA Toyota Dealership.
1111 Sunset Residential Tower 1 TBD 49 2023 1111 N. Sunset Blvd \ Proposed residential / Former Metropolitan Water District Complex / 778 Residential units. Designed by SOM and James Corner Field Operations.
Olympia Tower II 653 / 199 53 2023 1001 W. Olympic Blvd \ Proposed Three Towers by Sheng Long Group \ Retail, Hotel and residential north of LA Live Regal Cinema.
Olympia Tower III 550 / 168 43 2023 1001 W. Olympic Blvd \ Proposed Three Towers by Sheng Long Group \ Retail, Hotel and residential north of LA Live Regal Cinema.
Luxe Redevelopment Tower II 540 / 165 38 2023 1020 S. Figueroa St \ Proposed by Shenzhen Hazen \ residential \ Across from L.A. Live replacing Luxe Hotel w/ a W Hotel. Phase 2.
JW Marriott Expansion 529 / 161 40 2022 Expansion of the existing hotel. Plans to be finalized once AEG submits plan to LA City Hall for Convention Center expansion.
Fig+Pico Tower I 529 / 161 42 2022 1258 S. Figueroa St. \ Proposed \ Hotel / Retail. Across Figueroa Street from the convention center’s South Hall. Same block as Circa (SW Corner).
Westfield Promenade 2035 SE Hotel Tower 502 / 153 28 2033 6100 Topanga canyon Blvd. \ Proposed \ residential and hotel.
8th & Fig Residential Tower 501/ 153 43 2024 Figueroa and 8th St. \ Proposed \ residential and ground floor retail / Designed by Johnson Fain.
Spring Street Tower 500 / 152 45 TBD 525 S. Spring St. \ Residential \ Retail.
Times Mirror Square Residential Tower II 488 / 148 37 2023 202 W. 1st St. \ Proposed \ residential \ Retail. rehabilitate and add to the LA Times Building after/ if they vacate to Aon Tower. Designed by A.C. Martin.
The Albany 480 / 146 37 TBD 1330 W. Pico Blvd. \ Proposed \ Hotel \ Sandstone Properties.
Lake On Wilshire 459 / 140 41 TBD 1930 W. Wilshire Blvd. \ Proposed market rate residential Apartments / 70,000 square foot cultural center / Designed by Archeon Group.
Wilshire Gate 450 / 137 33 TBD 631 S. Vermont Ave. \ Koreatown District \ Approved \ Office Space \ Condominiums. Floor retail.
The Reef aka Broadway Square 420 / 130 19 TBD Corner of S. Broadway and Washington Blvd. \ Proposed \ Office Space \ Condominiums \ Hotel. Owned by PHR LAmart at the LA Trade Technical College.
Crossroads Hollywood Tower I 407 / 124 26 2024 Highland Ave and Selma Ave \ 1.4 million square feet of programmed space, including 950 residential units, a 308-key hotel, 94,000 square feet of office space and 185,000 square feet of shops and restaurants / Crossroads of the World shopping square . redevelopment of four square blocks.
Luxe Redevelopment Tower I 430 / 131 32 2020 1020 S. Figueroa St. \ Proposed by Shenzhen Hazen \ residential \ Across from L.A. Live replacing Luxe Hotel. Phase 1.
Bixel Residences 409 / 125 36 TBD Bixel and Ingraham St. \ Proposed residential and Hilton Hotel / City West neighbor adjacent to DTLA. Designed by Humphreys & Partners Architects.
1111 Sunset Residential Tower 2 TBD 31 2023 1111 N. Sunset Blvd \ Proposed residential / Former Metropolitan Water District Complex / Boutique hotel Designed by Kengo Kuma.
Koreatown Galleria Building Tower 395 / 119 35 2020 3240 Wilshire Blvd. \ Proposed \ Redevelopment and Apartments.
SB Omega 390 / 118 38 2020 6th & Main St. \ Proposed \ Redevelopment and Apartments. David Takacs designed tower in the Historic Core. Developer is Barry Shy.
Civic Center Building C 390 / 118 TBD 2024 LA City Hall Complex\ Proposed \ government office and retail.
Crossroads Hollywood Tower II 387 / 118 21 2024 Highland Ave and Selma Ave \ 1.4 million square feet of programmed space, including 950 residential units, a 308-key hotel, 94,000 square feet of office space and 185,000 square feet of shops and restaurants / Redevelopment of Crossroads of the World.
1233 Grand 384 / 117 30 TBD 1233 S. Grand \ Proposed \ residential.
670 Mesquit 374 / 115 35 2022 670 Mesquit Street \ Proposed \ Condominiums in the Art District developed by V.E. Equities and the Gallo Family \ Designed by Bjarke Ingels \ Designed to integrate into the new Sixth Street viaduct park currently under construction.
520 Mateo St. 370 / 113 35 2024 520 Mateo Street \ Proposed \ Condominiums in the Art District by Carmel Partners designed by Works Progress Architecture.
Fashion District Residences 370 / 113 33 2023 7th and Maple St. \ Approved \ Residential. Designed by Humphreys & Partners Architects. Built by Realm Group and Urban Offerings. Near Santee Court Alley.
Crossroads Hollywood Tower III 366 / 111 20 2024 Highland Ave and Selma Ave \ 1.4 million square feet of programmed space, including 950 residential units, a 308-key hotel, 94,000 square feet of office space and 185,000 square feet of shops and restaurants / Redevelopment of Crossroads of the World.
Burbank/De Soto Development Phase II 350 / 107 24 2024 20950 Warner Center Lane \ Proposed \ residential \ Office Park \ In the San Fernando Valley's Warner Center district.
Palladium Residences Tower I 350 / 107 28 TBD 6215 Sunset Blvd. \ Approved \ residential \ In the Hollywood district.
Palladium Residences Tower II 350 / 107 28 TBD 6215 Sunset Blvd. \ Approved \ residential.
Westfield Promenade 2035 SE Residential Tower 336 / 102 28 2033 6100 Topanga canyon Blvd. \ Proposed \ residential \ Warner Center district of the Valley.
Fig+Pico Tower II 326 / 99 25 2022 1258 S. Figueroa St. \ Proposed \ Hotel / Retail. Across Figueroa Street from the convention center's South Hall. Same block as Circa, (SW Corner). Designed by Gensler.
6400 Sunset Boulevard 318 / 97 28 2021 6400 Sunset Boulevard. \ Proposed \ Condominiums \ Ground retail Replaces the famous Amoeba Music Store. Designed by Johnson Fain. Developed by GPI Companies.
Morrison Hotel 315 / 96 27 2023 1220 S. Hope St.\ Proposed \ Hotel \ Re-development and additional 450 hotel room towers, 135 residential units, ground-floor retail space. Site of the original Morrison Hotel, now closed. Named after the album Morrison Hotel, by the band, The Doors. The hotel was made famous by The Doors as they named there 5th album after the Hotel, and took a picture as there cover album.
Sunset Gower Studio Tower 300 / 95 18 2028 6050 W. Sunset Boulevard \ Proposed \ Office \ Addition to the Sunset Gower Studios complex.
Los Angeles City Hall, shown here in 1931, was built in 1928 and was the tallest structure in the city until 1968. In 1964, height restrictions were removed from new construction.
^ Based on existing and under construction buildings over 150 meters tall. New York has 311 existing and under construction buildings at least 492 feet (150 m); Chicago has 129; Miami has 56; Houston has 36; Los Angeles has 31; Dallas has 20; San Francisco has 27. Source of Skyline ranking information: SkyscraperPage.com diagrams: New York City, Chicago, Miami, Houston, Los Angeles, Dallas, San Francisco (as of April 2017).
^ This building was originally known as the Braly Building, but has since been renamed the Continental Building.
^ Official height figures have never been released by this building's developer.
^ a b The City National Tower and the Paul Hastings Tower are twin towers, both rising 699 feet (213 m). As both buildings were completed in 1972, Los Angeles had two tallest buildings until the completion of Aon Center in 1974.
^ "Diagram of California skyscrapers". SkyscraperPage.com. Retrieved May 5, 2008.
^ a b c "US Bank Tower". Emporis.com. Archived from the original on September 30, 2007. Retrieved December 9, 2007.
^ a b "Continental Building". Emporis.com. Retrieved April 26, 2008.
^ a b "Continental Building". SkyscraperPage.com. Archived from the original on June 18, 2008. Retrieved April 26, 2008.
^ "High-rise Buildings of Los Angeles". Emporis.com. Archived from the original on February 29, 2008. Retrieved April 26, 2008.
^ "The Skyscraper Center". Skyscrapercenter.com.
^ a b c d "US Bank Tower". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ a b "U.S. Bank Tower". Pei Cobb Freed & Partners Architects LLP. Archived from the original on May 16, 2008. Retrieved May 23, 2008.
^ "Two California Plaza". Emporis.com. Archived from the original on May 2, 2007. Retrieved December 9, 2007.
^ "Two California Plaza". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "Gas Company Tower". Emporis.com. Archived from the original on October 18, 2007. Retrieved December 9, 2007.
^ "Gas Company Tower". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "Bank of America Plaza". Emporis.com. Archived from the original on September 30, 2007. Retrieved December 9, 2007.
^ "Bank of America Plaza". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "777 Tower". Emporis.com. Archived from the original on September 29, 2007. Retrieved December 9, 2007.
^ "777 Tower". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "Wells Fargo Tower". Emporis.com. Archived from the original on September 29, 2007. Retrieved December 9, 2007.
^ "Wells Fargo Tower". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "Figueroa at Wilshire". Emporis.com. Archived from the original on February 26, 2008. Retrieved December 9, 2007.
^ "Figueroa at Wilshire". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "City National Tower". Emporis.com. Archived from the original on February 29, 2008. Retrieved December 9, 2007.
^ a b "City National Tower". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "Paul Hastings Tower". Emporis.com. Archived from the original on February 29, 2008. Retrieved December 9, 2007.
^ a b "Paul Hastings Tower". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ a b c d "Design Team Grows for $1 Billion Oceanwide Plaza in Los Angeles – Global Tall News". Ctbuh.org. Archived from the original on September 6, 2015. Retrieved October 21, 2015.
^ "L.A. Live Hotel & Condominiums". Emporis.com. Archived from the original on August 20, 2014. Retrieved June 23, 2014.
^ "Fourth Metropolis Tower Tops Out in DTLA". urbanize.la. May 17, 2017.
^ "Another Skyline-Altering Tower Underway in DTLA - Urbanize LA". February 11, 2016. Archived from the original on February 11, 2016. Retrieved October 4, 2018.
^ "Checking in on 820 Olive Street". Urbanize.la. June 13, 2017. Retrieved October 4, 2018.
^ "Citigroup Center". Emporis.com. Archived from the original on February 29, 2008. Retrieved December 9, 2007.
^ "Citigroup Center". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "611 Place". Emporis.com. Archived from the original on February 29, 2008. Retrieved December 9, 2007.
^ a b "611 Place". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "KPMG Tower". Emporis.com. Archived from the original on April 29, 2007. Retrieved December 9, 2007.
^ "KPMG Tower". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "One California Plaza". Emporis.com. Archived from the original on February 29, 2008. Retrieved December 9, 2007.
^ "One California Plaza". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "Century Plaza Tower I". Emporis.com. Archived from the original on April 29, 2007. Retrieved December 9, 2007.
^ "Century Plaza Tower One". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "Century Plaza Tower II". Emporis.com. Archived from the original on April 28, 2007. Retrieved December 9, 2007.
^ "Century Plaza Tower Two". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "Ernst & Young Plaza". Emporis.com. Archived from the original on October 18, 2007. Retrieved December 9, 2007.
^ "Ernst & Young Plaza". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "AIG-SunAmerica Center". Emporis.com. Archived from the original on February 12, 2007. Retrieved December 9, 2007.
^ "AIG SunAmerica Center". SkyscraperPage.com. Archived from the original on February 12, 2007. Retrieved December 9, 2007.
^ "TCW Tower". Emporis.com. Archived from the original on April 30, 2007. Retrieved December 9, 2007.
^ "TCW Tower". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "Union Bank Plaza". Emporis.com. Archived from the original on February 19, 2008. Retrieved December 9, 2007.
^ a b "Union Bank of California Plaza". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "10 Universal City Plaza". Emporis.com. Archived from the original on October 18, 2007. Retrieved December 9, 2007.
^ "10 Universal City Plaza". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "1100 Wilshire". Emporis.com. Archived from the original on February 20, 2007. Retrieved December 9, 2007.
^ "1100 Wilshire". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "Fox Plaza". Emporis.com. Retrieved December 9, 2007.
^ "Fox Plaza". SkyscraperPage.com. Archived from the original on November 16, 2007. Retrieved December 9, 2007.
^ "Constellation Place". Emporis.com. Archived from the original on May 12, 2007. Retrieved December 9, 2007.
^ "MGM Tower". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "ARCO Tower". Emporis.com. Archived from the original on March 5, 2007. Retrieved December 9, 2007.
^ "1055 West Seventh". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "Equitable Life Building". Emporis.com. Archived from the original on March 13, 2007. Retrieved December 9, 2007.
^ "Equitable Life Building". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "Los Angeles City Hall". Emporis.com. Archived from the original on February 9, 2007. Retrieved December 9, 2007.
^ a b "Los Angeles City Hall". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "Los Angeles City Hall Earns Modernization Award from Buildings Magazine". Clark Construction Group, LLC. June 18, 2008. Archived from the original on June 18, 2008. Retrieved February 22, 2017.
^ "AT&T Center". Emporis.com. Archived from the original on March 9, 2007. Retrieved December 9, 2007.
^ "AT&T Center". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "Second Metropolis Condo Tower Opens". Ladowntownnews.com. Retrieved October 4, 2018.
^ "Greenland USA Tops off Second Metropolis Condo Tower". Urbanize.la. October 7, 2016.
^ "AT&T Switching Center". Emporis.com. Archived from the original on February 29, 2008. Retrieved December 9, 2007.
^ "PacBell Tower". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "Tower I Residences - Metropolis Los Angeles - DTLA Real Estate". Metropolislosangeles.com. Retrieved October 4, 2018.
^ "5900 Wilshire". Emporis.com. Archived from the original on February 29, 2008. Retrieved December 9, 2007.
^ "5900 Wilshire". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "Warner Center Plaza III". Emporis.com. Archived from the original on May 4, 2007. Retrieved December 9, 2007.
^ "Warner Center Plaza Three". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ "MCI Center". Emporis.com. Archived from the original on March 13, 2007. Retrieved December 9, 2007.
^ "Broadway Plaza – MCI Center". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
^ a b "Two-Tower CIRCA Development Debuts in South Park". Urbanize.la. October 2, 2018. Retrieved October 4, 2018.
^ a b Sharp, Steven. "Two-Tower Development to Rise Near Staples Center". Archived from the original on April 26, 2017.
^ "High-Rise Condo Development Revived in Century City". Urbanize.la. March 7, 2018. Retrieved October 4, 2018.
^ "Frank Gehry's "The Grand" Breaks Ground in DTLA". Urbanize.la. February 14, 2019.
^ "77-Story Tower Planned Next to the L.A. Grand Hotel Downtown". Urbanize.la. June 11, 2018. Retrieved October 4, 2018.
^ "Proposed 77-Story Tower Would Be L.A.'s Tallest Building". Urbanize.la. June 20, 2018. Retrieved October 4, 2018.
^ "First Look at the Skyline-Altering Options for Angels Landing". Urbanize.la. October 23, 2017.
^ Kim, Eddie. "Finalists Selected for Coveted 'Angels Landing' Development Site". Ladowntownnews.com.
^ "Angels Landing Development Calls for a 960-Foot-Tall Building". Urbanize.la. December 21, 2017. Retrieved October 4, 2018.
^ Vincent, Roger. "Condos, restaurants, an elementary school. How an 80-story skyscraper could transform Bunker Hill - Los Angeles Times". Latimes.com. Retrieved October 4, 2018.
^ a b c d "Mapping the rise of LA's tallest towers - Curbed LA". April 27, 2017. Archived from the original on April 27, 2017. Retrieved October 4, 2018.
^ a b c "Olympia Towers Key Bridge Between DTLA Financial District". connect.media. January 1, 2017.
^ "City Century's Olympia Development Takes a Step Forward". Urbanize.la. June 29, 2018. Retrieved October 4, 2018.
^ "Crescent Heights Goes Taller at 11th & Olive". Urbanize.la. August 15, 2017.
^ "Home". 1045 Olive. Archived from the original on August 17, 2017. Retrieved August 16, 2017.
^ "Renderings Revealed for Onni's Olympic and Hill Tower". Urbanize.la. April 12, 2018. Retrieved October 4, 2018.
^ "Olympic Tower -The Skyscraper Center". Skyscrapercenter.com.
^ "Brookfield to Construct Residential Tower Next to Figat7th". Urbanize.la. June 23, 2017.
^ a b "Fresh Renderings for Onni's Times Mirror Square Redevelopment". Urbanize.la. June 29, 2017.
^ Slayton, Nicholas. "52-Story Mixed-Use Tower Proposed for Figueroa Street". Ladowntownnews.com.
^ a b "Towering Mixed-Complex Planned at 1111 Sunset Boulevard". Urbanize.la. January 11, 2018. Retrieved October 4, 2018.
^ a b "OUR NEIGHBORHOOD - 1111 Sunset Blvd". 111sunsetblvd.com. Retrieved October 4, 2018.
^ a b Vincent, Roger. "Downtown L.A.'s development boom heads west with a big new housing and retail complex - Los Angeles Times". latimes.com. Retrieved October 4, 2018.
^ a b "A closer look at what's planned for Echo Park's big and flashy new neighbor - The Eastsider LA". Theeastsiderla.com. Retrieved October 4, 2018.
^ "Shenzhen Hazens Revises Plan for DTLA Tower Development". urbanize.la. May 12, 2017.
^ a b "Fresh Renderings for the Fig + Pico Hotel Towers". Urbanize.la. September 14, 2017.
^ "New Renderings for the 41-Story 8th & Figueroa Tower". Urbanize.la. March 12, 2018. Retrieved October 4, 2018.
^ "Downtown Developer Considers Reviving Proposed Spring Street Tower". Urbanize.la. August 2, 2017.
^ "Fresh Renderings for the 41-Story Tower Planned Near MacArthur Park". Urbanize.la. October 4, 2017.
^ "Fresh Renderings for the Fashion District's City Market". Urbanize.la. November 1, 2017.
^ "DEPARTMENT OF CITY PLANNING : RECOMMENDATION REPORT" (PDF). Planning.lacity.org. Retrieved October 4, 2018.
^ "Parker Center Demolition Could Begin in Fall 2018". Urbanize.la. June 13, 2018. Retrieved October 4, 2018.
^ "33-Story Mixed-Use Tower to Rise Near Wilshire and Vermont". urbanize.la. July 12, 2017.
^ "Entitlement Approval- Wilshire Gate Project". Jlred.com. January 26, 2018. Retrieved October 4, 2018.
^ "Big Reef project south of 10 freeway is for sale". La.curbed.com. Retrieved October 4, 2018.
^ a b c "Fresh Renderings for Crossroads Hollywood". Urbanize.la. May 12, 2017. Retrieved October 4, 2018.
^ "Developer Files Permits for Flatiron-Inspired Westwood Tower". Urbanize.la. April 11, 2018. Retrieved October 4, 2018.
^ a b c "Capitol Records-adjacent towers make a comeback". la.curbed.com. Retrieved October 4, 2018.
^ a b "Millennium Hollywood Gets the Go-Ahead". Urbanize.la. July 6, 2015. Retrieved October 4, 2018.
^ a b Xia, Rosanna. "L.A. OKs Hollywood skyscrapers despite quake concerns - Los Angeles Times". latimes.com. Retrieved October 4, 2018.
^ "First Look at City West's Bixel Residences". Urbanize.la. March 14, 2016. Retrieved October 4, 2018.
^ "Latest K-Town Tower Unveiled". urbanize.la. October 26, 2016.
^ "38-Story Historic Core Tower Heads to Planning Commission". Urbanize.la. December 6, 2017. Retrieved October 4, 2018.
^ "40-Story Apartment Building Proposed at 12th & Grand". Urbanize.la. May 22, 2018. Retrieved October 4, 2018.
^ "New Details for the Arts District's 670 Mesquit". Urbanize.la. April 24, 2017. Retrieved October 4, 2018.
^ "Fresh Renderings for the Arts District's 520 Mateo Development". Urbanize.la. June 6, 2018. Retrieved October 4, 2018.
^ "Proposed Fashion District Tower Tweaks Design, Gains Key Approval". Urbanize.la. September 15, 2017.
^ "New Details for Warner Center's Burbank/De Soto Development". Urbanize.la. April 5, 2018. Retrieved October 4, 2018.
^ "New Look for City West's Lifan Tower". Urbanize.la. November 20, 2017. Retrieved October 4, 2018.
^ "Proposed 32-Story Hill Street Tower Moves Forward". Urbanize.la. December 7, 2017. Retrieved October 4, 2018.
^ "WESTFIELD PROMENADE 2035". promenade2035.com.
^ "28-Story Tower Would Replace Hollywood's Amoeba Music". Urbanize.la. August 7, 2017.
^ "Sunset Gower Studios Development Revealed". Urbanize.la. June 7, 2018. Retrieved October 4, 2018.
^ "Security Building". SkyscraperPage.com. Archived from the original on June 18, 2008. Retrieved April 20, 2008.
^ "Seventh Street Lofts". SkyscraperPage.com. Archived from the original on June 18, 2008. Retrieved April 20, 2008.
^ "Park Central Building". SkyscraperPage.com. Archived from the original on June 18, 2008. Retrieved April 20, 2008.
^ "Texaco Building". SkyscraperPage.com. Archived from the original on June 18, 2008. Retrieved April 20, 2008.
^ "Aon Center". SkyscraperPage.com. Archived from the original on December 3, 2007. Retrieved December 9, 2007.
Wikimedia Commons has media related to Skyscrapers in Los Angeles and High-rises in Los Angeles, California.
|
0.982333 |
Did Zhuang Zhou dream of the butterfly or did the butterfly dream of Zhuang Zhou? Between Zhuang Zhou and the butterfly, there must be some distinctions. This is called "the transformation of things."
|
0.999996 |
Briefly describe the working capital and capital budget techniques employed by George’s "Trains"
Working capital can be simply defined as the money available to an organization to carry out its day-to-day operations. The ratio can be used to determine the liquidity of a company as it takes into account all current assets and liabilities such as inventory, accounts receivable, cash, portion of debts in a year, accounts payable and any other short-term accounts. An organization’s working capital reflects the results of activities carried out during the year including debt management, revenue collection, inventory management, and payments to suppliers. A positive working capital depicts that the company can pay off its short-term liabilities with immediate actions. Negative working capital, on the other hand, indicates that the firm cannot manage its current liabilities and can therefore not offset its short-term debts.
The reasons as to why analysts are sensitive to decreases in working capital are because this drop signifies that the business is being overleveraged and is in constant struggles to grow and develop sales and is thus paying bills at higher rate compared to the rate which it collects its receivables. On the other hand, an increased working capital ratio represents the opposite outcome. It means that the company is paying less for the receivables but receiving much more from accounts receivable (Firth, 1976). Working capital can be further used to evaluate the accounts receivable ratios, current ratios and quick ratio.
When considering to introduce a new project, a business must determine whether the project can return on initial investments and subsequently generate a profit. Capital budgeting determines whether the business is worth of the project and helps a business firm to determine if it will make satisfying returns the owner and investors. Some considerations made in capital budgeting include the payback period, net present value, internal rate of return and discount rate.
|
0.976749 |
Decided you're ready to write your own story/book? You' re dreaming about how this story's gonna work. Concentrate on your thoughts and feelings about the story and the way it was told. So, you want to write a love story? It helps me to structure the story or the book in such a way that the problems and adversities of the main character directly affect him or her.
You know there's a history to be told? No. Did you decide that you are willing to make your own story/book? Once you have read this paper, you will begin to appreciate the important stages in the creation of your own history. Title - Make it memorable and pertinent to the history. The protagonist - Who is the character of the film?
Why are they so important to the game? Setting - When and where does the history take place? Confrontation - That's essentially the issue of history. That will make your history really interesting, whether it is an in-house or an outside one. Which obstacle does the protagonist have to go through?
Which important messages has the protagonist learnt? There is a big role for the actors in your storyline, so handle them like this. Drawing outlines must be included: Ages - If you keep an eye on your old age you may recall the behaviour typically of different ages.
Traits - Are they timid? Backstory - What is the tale behind the characters? -The roll they play in the story - This is extremely important. You and the public need to know the meaning of the hero. How does this figure make a contribution to history? It will help you not only to create the characters, but also to see them realistically.
After you have chosen what to do and who will be part of the action, you can at last record everything. Keep in mind that the reader doesn't have everything in mind as you do, so as the author you have to use your words to draw the picture for them.
If you are a writer, you give the reader the feeling of being part of the history. When you' ve written everything, leave your work. Thinking about your history is not health. It will help you recognize grammatical mistakes and think of better ways to communicate your point.
There is a way for our brains to gloss over grammatical mistakes without wanting to, so be careful when you read them. Correcting misspellings. This is where you see what you need to do to make your job better, so do it. Proofread your orthography and grammatical inaccuracies. After someone other than yourself can look can help to see the narrative from the readers point of view, see what part is confusingly misunderstand or write mistakes that you did not see when you were edited.
Don't you like the whole thing? It'?s your history. It can take several month or even years to create your text. You' re sorry you didn't take the moment - especially when you notice that there was so much more that could have been done to make the whole thing even better, or you forget to include important detail.
Your textbook still has a lot of room for improvements even after several edits. Write request lookup. When you want to post your work, be open to the idea that you could be refused and be cautious who you rely on to post your work.
|
0.999708 |
12th century, and very often in Northern Europe from the 15th, the Magi are also made to represent the three known parts of the world: Balthasar is very commonly cast as a young African or Moor, and old Caspar is given Oriental. Adoration of the Magi (Left wing of Triptych, Saint Peter with the Donor) (circa, oil on panel, height: 138 cm (54.3 in width: 33 handmaids Tale Analysis cm (13 in currently @ Museo Nacional del Prado, Madrid.). Adoration of the Magi (Disputed attribution, by Hieronymus Bosch, or a follower, oil on panel,.5.9 cm (30.5 22 in currently @ Philadelphia Museum of Art, Pennsylvania.). The subject matter is also found in stained glass.
Life of the Virgin as well as the, life of Christ. The term is anglicized from the, vulgate, latin section title for this passage: A Magis adoratur. From the 15th century onwards, the Adoration of the Magi is quite often conflated with the Adoration of the Shepherds from the account in the Gospel of Luke (2:820 an opportunity to bring lit Analysis: To Build A Fire in yet more human and animal diversity; in some compositions ( triptychs. Melchior represents Europe and middle age. It is related to the older but less frequently represented annunciation to the shepherds, which shows the same shepherds in the fields receiving from an angel news of the miraculous birth. In many of these paintings the shepherds bring humble gifts, symbolic counterparts of the magnificent ones brought by the Magi; the most frequent gift is a lamb with tied feet, perhaps also symbolizing Christs sacrifice. Christ, an event described in, the Gospel According to Luke.
Magi, represented as kings, especially in the West, having found Jesus by following a star, lay before him gifts of gold, frankincense, and myrrh, and worship him. The Adoration of the Magi is an early painting by Leonardo da Vinci. Leonardo was given the commission by the Augustinian monks of San Donato a Scopeto in Florence, but he departed for Milan the following year, leaving the painting unfinished. Adoration of the Magi, artist Leonardo da Vinci Year 1481 Medium Oil on wood Location Uffizi, Florence Dimensions 97 in 96 in 246 cm 243 cm Famous Paintings by da Vinci The Last Supper Mona Lisa Vitruvian Man The Baptism of Christ Annunciation Lady with.
|
0.942143 |
Were you looking for information about LASIK? LASEK is a common misspelling of LASIK.
LASIK is a laser eye surgery that has proven to be effective in correcting vision and lessening (and oftentimes eliminating) the need for glasses or contact lenses. Many different vision problems, including nearsightedness, farsightedness, and astigmatism, can be treated with LASIK, which is a procedure that permanently reshapes the cornea of your eye. Before the procedure, numbing eyedrops are placed in the eye and an eyelid speculum is placed. The doctor marks the eye with a special marker, aligns the eye with the laser, and creates a flap in the cornea.
Potential complications of LASIK include mild inflammation; dry eyes; epithelial looseness or ingrowth; and shifted, dislodged, or wrinkled flaps. Some potentially serious complications, although rare, include infection, detachment of the retina, and thinning of the cornea. However, this is one of the most commonly performed procedures in the world for vision correction, with predictable results and low risk.
|
0.909284 |
On the album, the song is in Db (male). For male vocalists, try key of B, C, or Db. For female vocalists, use F, G or A.
For this song our resources are in the key of C, which is suitable for a male lead. The album key is Db.
|
0.942909 |
Article first published as On MLK Hospital and DCFS: Our Foster Children Gently Weep on Technorati.
On MLK Hospital and DCFS: Our Foster Children Gently Weep.
As an amalgamation of failed policies, roads to nowhere, and well-meaning strategies that lead to disappointment and letdown, the Los Angeles County Department of Children and Family Services (DCFS) have few equals in obfuscation and futility.
One of the requirements by UCLA and other entities stipulated before discussions began to reopen this very necessary hospital was a restriction against political and Board of Supervisor interference to prevent a repetition of the sustained decrepit conditions that existed for decades.
A comparison between DCFS and MLK Hospital is not a comparison of apples and oranges. Actually, there are many similarities. Both entities suffered from years of neglect. And both organizations were damaged by racial, community and government political interference that frequently clashed with the stated goals of meeting the best needs of clients and patients.
Both organizations endured a multitude of directors that changed so frequently, that tenure of more than a couple years, was seen as a stabilizing factor. Directors of both organizations were pushed out frequently, mostly for political reasons, and often left under a cloud of whispered, unproven allegations that seemed to disappear once the new leader was installed.
Along with frequent changes in leadership, both DCFS and MLK cynically imposed policies which were changed and altered, added and added again according to the political flavor of the moment, and often in reaction to some horrific incident involving death, mayhem, criminality, stupidity and a dash of indifference since victims had little voice and even less influence within the electorate.
MLK Hospital (which had a nasty nickname of “Killer King”) was eventually shut down and emptied since reform was no longer seen as a viable alternative. Competent employees were transferred to other locations within the county. Others found new lines of work, or left the area to work their magic and expertise within more appreciative confines.
Both organizations had huge difficulties in retaining highly trained personnel since both destinations were seen by their best workers as a proving ground or stepping stone towards a more lucrative and positive career choice after doing ones time in the trenches.
Currently, and left in its wake at DCFS as a result of this constant turnover of the well trained and educated personnel, are numbers of mediocre, unambitious, and incompetents who seem to have little hope of establishing themselves in an equal position at another location.
Allowing for the noble and admirable subset of quality, dedicated workers who truly want to be at DCFS, morale and quality of care suffer. Indeed, conditions and the nature of their work at DCFS is so difficult, they have an employee turnover rate that reminds one of a tour of duty.
One way DCFS has dealt with the impossible job of caring for so many abused and neglected children and perceived diminution of quality (if it ever really existed) was to reduce by almost 2 thirds the amount of abused and neglected children the County was willing to care for.
At the same time, the county maintains a budget very close to those tax dollars used and spent when placement into foster care was at its highest almost a decade ago. In other words, while the amount of children placed into foster care by DCFS has decreased by more than 2 thirds during the past decade, the budget in caring for those children has remained mostly the same. The obvious questions then, are abused children much better off? Are they safer?
The County will argue that programs such as Family Preservation and Wrap Around Services which have at its focus keeping families intact has allowed this huge decrease in numbers of children placed into foster care, and ensure a greater amount of children are safer and better cared for.
One can only pray. But I have a question. Do you really believe that abused and neglected children in Los Angeles County are better off than they were a decade ago? And if we can’t be perfect, shouldn’t we at least be good?
We have been away for a while taking care of some business overseas. We are back now. And despite threats of violence (which is very annoying), we plan on continuing the good fight. The Business of Child Abuse working hand in hand with corruption continues unabated and apparently without significant investigation by those we entrust to do just that. We have several finished articles that will be published in various places including here.
The publishers of this blog want to thank everyone for their support and well wishes. We could not have done this the past year without you. Articles written and viewed here have been republished elsewhere and read many thousands of times all over the world. We can hope and pray that somewhere those in power hear the voices of these children we try with humility to speak for.
I received this letter awhile back and have permission to reprint. The author wishes to remain anonymous. I have removed references to the authors identity and made a few cosmetic changes to clarify things a bit. The writer points are cogent and certainly true. The author references something called Wraparound Services which is another service by the county made in the spirit of good intentions. Like Family Preservation it leaves much to be desired but does do some good.
“…I worked for Refugio Para Ninos and United Care as a FCSW, (Foster Care Social Worker) and believe me, you are 100% right. Some FFA (Foster Family Agencies) directors know each other very well because they worked together as FCSW’s, and eventually got their own FFA’s. They know how to run their business, and advise each other. They also know Senior DCFS supervisors for years, and can get away with inappropriate placements. The FCSW is just another piece on the chess board which they move at their convenience, and when the FCSW is not willing to go along with their game, well, they just fire them. Several times I had to take children away from abusive foster homes, but (The Director) could do nothing about it because he knew that I would move heaven and earth to make sure these kids were safe, so he just let me do the move.
I am no longer in foster care, but I worked for a while in Wraparound, and believe me, this is another gold mine for “non-profit” organizations. The philosophy is to do anything it takes to maintain the family intact, but the name of the game is to bill as many contact hours with the family as possible to get the money. A part of the program funds is supposedly for the family, but agencies make it (extremely difficult) for the family to get the money, so most of it goes to workers’ salaries, and who know where else?
This agency I was working for advised the workers to speak as little as possible during county, DMH, (Department of Mental Health) and parole meetings about the work they were doing with the families, and to never volunteer information for fear that these agencies (DMH, county, and parole) find out the poor job they were doing with these families.
Frustrated by the pressure to bill hours, I once told my supervisor that I had gone to school to serve families, not to accumulate billing hours. The following week I was called into the office, and was fired due to “not working within expected standards”. The saddest thing of all is that these people are making a huge business with our children and families.
|
0.997409 |
I need to go for a DNA test but don't know how or where??? Please advise.
Also please tell me what the cost of the test is!
It appears as if you are either going for a paternity test, or for a test to exclude certain genetic diseases, like porphyria, etc. If it is for the latter reason, the price may vary between R500 and R1500, depending on the particular test, etc.
You will have to go to a laboratory, where they will collect a small amount of blood.
|
0.946091 |
Is an online course right for you? Here are several caveats about online learning before you take the plunge.
If you are interested in an online course because you think that it will be less work than a traditional face-to-face course, then this style of learning may not be right for you. Believe it or not, you may spend more time studying and completing assignments in the online environment than you will in an on-campus course. How can that be? The online environment is text- and activity-based. To communicate with your instructor and other participants, you must type messages, post responses, and upload written assignments that might occur more often than in traditional courses. Also, reading lecture materials and engaging in learning activities can take more time than listening to an instructor deliver a lecture. Many participants believe that an online course is at least as much work as an on campus course; some say that their online course involved more work. However, most participants feel that this additional work load is more than compensated for by the fact that they were able to "go to class" whenever they had the time, whether it be 2 a.m. or 6 p.m. Participants also like the fact that online courses involve many creative activities and learning experiences. Rather than being lectured at, you are an active participant in the learning process. Many participants believe this is more enjoyable and enhances their ability to apply what they are learning to real life.
One of the many advantages of online courses is that you will be able to work on your coursework when you want to and where you want to. However, online courses are NOT self-paced courses. There are assignment deadlines just like an on campus course. It can be very easy to miss these deadlines and fall behind in their coursework. Not meeting deadlines is the leading reason why online participants do not succeed. It is easy to procrastinate and put off reading, delay posting of messages on the discussion forum, and forget to upload written assignments. As with most things, if you don't manage your time properly, you will find yourself buried beneath a seeming insurmountable mountain of coursework. Online courses require the self-discipline to set aside chunks of time to complete your studies. It means you have to make online studying a priority and not let other activities interfere.
This means that one quality you will need to have to be successful is 'discipline'. While you will be a part of an online community and will be working with others online, it is your responsibility to log in and participate. It can be all too easy to put off logging in when no is telling you to do it at a specific time every day. It is up to you to create a schedule for yourself to make sure you participate in your class, and that you give yourself enough time to complete assignments.
Studying alone with only the computer as your companion may be unsatisfying for someone who needs high levels of social activity as part of their learning experience. The online environment is a much different atmosphere that takes some getting used to. You should be aware of such feelings of isolation and be ready to seek help if they start to impede your studies. A quick e-mail to a classmate or your instructor can help you feel better connected if the sense of community you seek is missing. This is not to say that you will not have interaction with your classmates in an online course. Indeed, many online participants attest that online courses tend to provide more interaction with your peers and instructors. In fact, many of our participants say that they got to know their fellow classmates better in this type of learning environment.
In a traditional classroom setting, participants will receive immediate feedback from their peers. Such immediacy will be lacking in the online environment. If you need more immediate feedback to your discussion comments, if you need to ask a lot of questions before you can understand a concept or an assignment, if you need the benefit of gestures or facial expressions to get your point across or to understand the comments of others, then online education might not be the best choice for you right now.
Also, feedback from your instructor will exclusively be in the form of written comments rather than oral comments. In traditional courses, instructors do make arrangements for in-person office hours or make special arrangements to meet participants. In an online course there is usually no face-to-face contact with your instructor. If you feel that you need to see your instructor often in order to succeed, then online learning may not be right for you. However, you should plan on the vast majority of your contact with your instructor being via email or other electronic communications. Also, such communications will consist of delayed feedback, although most online instructors are good about responding to electronic communications within a short period of time.
Online courses depend on participants being active learners, in the sense that there is an expectation that learners will seek out additional information from the internet (e.g., articles and web pages) that will be inserted onto posts and in written assignments. Most traditional courses consist of passive learning in the form of transmitting information via lectures in the classroom, which takes away time from discussion. In the online environment, there will be short audio lectures to download, but most of the virtual classroom will consist of active learning activities, e.g., discussion forum, online group work, written assignments.
So, to do well in an online course you need to be (or become) an independent learner. There are, of, course, advantages to this as well. That online education offers the opportunity to be an independent learner is exactly what some people like about it. Many participants enjoy online discussions more than face-to-face discussions. Some participants are intimidated by speaking in front of a group, or are reluctant to answer a question unless they know they are right. Online discussions give them time to reflect and compose discussion comments, as well as to read and reread the comments of others before they jump in the conversation themselves. Also, participants for whom English is a second language often feel more comfortable with the extra time to understand and reflect since it can be easy to get a little lost in a fast-paced class discussion.
One of the major advantages of online learning is the focus on an active learning style and learning from your peers. So, if you can manage the extra work that online learning might entail, develop good management skills, get used to the lack of face-to-face interaction, and tolerate delayed feedback, then be prepared to reap the benefits of online learning!
|
0.999995 |
What is the difference between leavened and unleavened bread?
The difference between leavened and unleavened bread is found in the word itself - leaven. Leaven is what is placed in bread dough to make the bread rise. It is placed in the dough and spreads throughout the entire lump.
|
0.978143 |
I notice sometimes when I pay down/off my credit card balances (pay on time), my credit score would drop. For example, I paid off my chase credit card balance of $87, and my score dropped by 14 points!!!!! Is that normal? Can someone help me to understand?
If you have a zero balance across all of your accounts, then your score takes a hit, let a balance report and then pay it on the due date, that should take the penalty away. Generally, an easy way to not get a penalty is to set one account to auto-pay on the due date and not worry about it. Just check in on it and make sure the payments are going.
Also, it should be pointed out that Chase will report mid-cycle if you pay it down to zero. So if you want to let one of your accounts report a small balance when the statement cuts, don't select the Chase account for that function.
|
0.989314 |
If you were one of the half million or so Jewish Americans who received "Let My People Go: The Struggle Of The American Jew To Come Home To Israel" in the mail the first thing you probably would have noticed would have been the cover of the book, which features a somewhat crude drawing of a man in a business suit, with a briefcase, straining against numerous ropes tying him to a signpost which reads "Wall Street". There are so many of these ropes that it's quite obvious the man will never be able to break them simply by straining. If you had bothered to read the book, rather than simply tossing it in the trash, you'd have found no ambiguity ; the book says the the man on the cover is supposed to be Jewish, and it's hard to escape the implication that "Let My People Go" begins, and quite noisily so, with the premise that Jews, as a people, are bound to materialism, selfish and greedy.
The book was in English, not German, but otherwise recipients might have wondered if they were staring at a piece of 1930's era anti-Jewish propaganda, commissioned by the Third Reich, that had become somehow displaced in time, thrust into our era by a freak temporal anomaly, a wormhole or sinister wrinkle in time, because the picture on the front cover of "Let My People Go..." suggests that Jews, perhaps more so than any other ethnic group, are bound, against all their best efforts or intentions, to money. The book goes on to ask why the greatest concentration of Jews in any urban area on Earth can be found in New York City, which Tom Hess claims may be the World center of "hedonism and perversion". He even seems to invoke the myth of Jewish ritual sacrifice.
By Tom Hess's own reporting, in 2004 his ministry, the Jerusalem House Of Prayer, sent "Let My People Go! - The Struggle Of The American Jew To Return To Israel" to about 550,000 Jewish-Americans and, per Hess's account, perhaps 800,000 copies of the book - urging Jews everywhere around the globe to return to Israel before they are annihilated in a rising wave of anti-Jewish hatred Hess predicts - have gone put since the book was first published in 1987.
Did the myth of the "greedy, materialistic Jew" die with the Third Reich ? Of course not. The cultural trope is alive and well, thanks in part to Christian Zionism. Neo-Nazi groups could never get away with sending hundreds of thousands of pieces of anti-Jewish literature through the US mail. Christian Zionists can apparently do so with impunity, and cost of mailing their literature - if sent out by registered 501c(3) nonprofit organizations - can be federally subsidized.
Whether by accident or by intent, "Let My People Go!..." is packed with many of the most vicious and pervasive anti-Jewish slurs to ever have been coined.
"There is so much blood on American soil it is a miracle that we have not already been destroyed as a nation! Many secular, reform, and conservative Jews have encouraged abortion despite the fact that the killing of their future generations will affect [sic] the future of the Jewish people. There is little difference between child sacrifice in the Old Testament and abortions today."
"There is little difference... " - the tone of that assertion fits quite readily with the pseudo-sociological narrative that accompanied the soundtrack of one the most notorious pieces of propaganda ever filmed, The Eternal Jew.
In his discussion of abortion, Hess does not mention Gentiles who, by most accounts, are reported to also engage in the practice of abortion. By likening Jewish abortion to "child sacrifice in the Old Testament" Tom Hess evokes the obvious - those Jewish women so heartless as to have their own children, the future Jewish generation, ripped from their wombs... and to whom do they sacrifice those children ? Moloch ? Satan ? From the myth of Jewish ritual child sacrifice, it is only a short hop to the legend that Jews have vestigial horns atop their heads.
The idea that Jews embody singular, singularly repugnant traits becomes increasingly distinct as one reads the book. On page 53, we learn that York York City may incarnate the most extreme sins of our age, and on page 55 readers encounter the terrible truth that NYC has the greatest concentration of Jews on Earth !.
What are reasonable readers to conclude ?
"The two characteristics that most exemplify Babylon in Revelation are materialism and hedonism. New York City is not only the leading city in the world regarding money and materialism (with the World Money Market centered there) but also may be the leading city in the world regarding perversion and hedonism.
"Why are there more Jews in New York City than in any city in the world and more Jews in American than any nation in the world?"
There are more Jews in New York City than anywhere in America because New York City was long the central immigration route into the United States. There are more Jews in America because The United States had, for a time, liberal immigration policies that allowed Jews-- who were fleeing the terrible Russian and Eastern European pogroms of the late 19th and early 20th Centuries --to become American citizens.
If they are "American" Jews - why 'go home to Israel?' Granted "Norwegian-American" doesn't have the same religious overtones.
To imply "American" Jews are Jews first, Americans second.
Or even not really fully American.
Using the word "home" as in "going home to Israel" certainly does imply that a Jew's "home" is nowhere else. Semantics as these are an echo of the Nazi state's use of "Non-Aryan Christians," also implying that certain races may be Christian, but they are non-Aryans first: a dangerous ethic which is also theologically reprehensible.
Can a Jew be at "home" in America? I should certainly hope so.
I'm trying to wrap my head around them all.
I've come to see Kittel as very important in this - how can someone who might have been even called a philo-semite flip so radically and turn towards such extreme hatred ?
I now see the answer in theological terms. Susannah Heschel put her finger on it ; racism is at base a theological argument.
A few weeks ago we got a "free" book that turned out to be very anti Roman Catholic.
These people are going out of their way to offend people.
When I tried to report the book, I was told that unless there were calls for violence in it, it was protected by free speech.
Somebody spent a considerable amount of money on this.
Even though such speech is constitutionally protected I'd think that , based on the ADL's mission statement, the organization should be concerned with Hess's book.
This post on mailing of 500,000 anti-Semitic Books to Jewish Americans proved to be a really good one. Actually this a very good and non-violent idea. Hats off for this great idea. Thank you so much for sharing the post!
This is really a sad thing that the people are not able to go their home Israel. Being a good reader I always follow cheap college essay writing service for more articles. Reading this story made my eyes wet.
|
0.999879 |
Mentoring meeting agenda template, One of the keys to assuring a meeting will be successful is developing a meaningful schedule. This agenda should clearly represent not just the topics to be discussed, but the order as well. However, a meeting seat has to assure that the schedule is more than merely an outline, but that all attendees at the meeting know that just topics on the agenda is going to be discussed, which attendees were expected to remain on target.
Business assembly is a significant schedule in your office. The assembly has the important function to communicate with other staffs. Many important business decisions occur during the company meeting. At the company meeting, 1 person should have a note about the meeting progress. The notice is known as as the agenda. The key aspect in the company meeting is the agenda. You must make the agenda for the company meeting within the business or between companies. The program can be utilized as the evidence when the representative cannot recall or understand a few points.
A meeting chairperson must produce and publicize the agenda for the meeting in advance. The chairperson should elicit ideas for topics that attendees might want discussed, and include the relevant and appropriate topics in the assembly’s agenda. If at all possible, a suggested discussion length for every topic should be included, since it signifies that the emphasis for the meeting. Evidently, topics recorded with more time for dialogue are considered more crucial to the meeting than those with briefer discussion times listed.
It’s imperative that a meeting chairperson give considerable thought and effort into creating the agenda for the meeting. A correctly prepared agenda sets the tone for the assembly itself, as well assuring an efficient and orderly discussion of the business of the organization. If, possibly the agenda is improperly prepared, or if the chairperson does not properly utilize the agenda in running the meeting, the efficacy and efficiency of the meeting will be negatively affected. An agenda ought to be clear cut, and as detailed as you can, so that assembly attendees completely understand what the purpose of the discussion is. The schedule ought to be distributed sufficiently beforehand, so that attendees can come to the meeting adequately ready to talk about the schedule topics completely and intelligently, thus enabling them to effectively run the critical business of the organization.
Unfortunately, some seat people of meetings consider a schedule as a necessary but futile practice, and won’t follow the schedule nor parliamentary procedure in running a meeting. That kind of attitude generally makes for a meeting where many attendees feel little was accomplished. Continuous ineffective meetings creates an atmosphere of boredom and saps excitement. Amongst a number of other necessary leadership qualities, having the ability to effectively coordinate and run a meeting is also a significant and significant attribute.
|
0.946139 |
Chronic hepatitis B and C are the leading causes of liver disease and liver transplantation worldwide. Ability to mount an effective immune response against both HBV and HCV is associated with spontaneous clearance of both infections, while an inability to do so leads to chronicity of both infections. To mount an effective immune response, both innate and adaptive immune responses must work in tandem. Hence, developing protective immunity to hepatitis viruses is an important goal in order to reduce the global burden of these two infections and prevent development of long-term complications. In this regard, the initial interactions between the pathogen and immune system are pivotal in determining the effectiveness of immune response and subsequent elimination of pathogens. Toll-like receptors (TLRs) are important regulators of innate and adaptive immune responses to various pathogens and are often involved in initiating and augmenting effective antiviral immunity. Immune-based therapeutic strategies that specifically induce type I interferon responses are associated with functional cure for both chronic HBV and HCV infections. Precisely, TLR7 stimulation mediates an endogenous type I interferon response, which is critical in development of a broad, effective and protective immunity against hepatitis viruses. This review focuses on anti-viral strategies that involve targeting TLR7 that may lead to development of protective immunity and eradication of hepatitis B.
Defense against chronic viral infections is complex and involves both host innate and adaptive immune systems . The major characteristic of the human immune system is the nature by which immune cells recognize self from non-self [2, 3]. While the adaptive immune system features specific antigen recognition receptors, the innate immune system utilizes a unique set of pattern recognition receptors (PRRs), such as TLRs, which recognize non-specific, but conserved molecular structures on microorganisms [3–5]. However, certain viral pathogens such as hepatitis B (HBV) and C (HCV) may effectively evade host immune responses, thereby establishing chronic persistent infection [6, 7] These infections can be treated with modest success using immunomodulatory therapy such as exogenous interferon [8–10]. Hence, there is a continued interest in other novel immune-based therapies for chronic viral hepatitis, which may improve treatment outcomes. Activation of specific TLRs results in an endogenous interferon response leading to the production of antiviral, proinflammatory and costimulatory cytokines, enabling crosstalk between the innate and adaptive immune systems, which culminates in the stimulation of immune effector cells integral to antiviral immunity [11, 12]. In this regard, interactions between viruses and TLRs may play a major role in developing protective antiviral immunity. Therefore, exogenous activation of TLRs represents an attractive therapeutic strategy to combat chronic viral pathogens such as HBV and HCV.
Members of the TLR family detect a wide range of conserved pathogen-associated molecular patterns (PAMPs). Upon recognition and binding to a PAMP, stimulation induces shared signaling pathways that culminate in expression of numerous host defense genes. In humans, there are 10 known members of the TLR family, which are membrane-bound proteins structurally characterized by the presence of a conserved intracellular Toll/interleukin (IL)-1 receptor (TIR) domain and leucine-rich repeat ectodomain [13, 14]. This extracellular/endosomal leucine-rich domain plays a key role in the binding of ligands, although the molecular basis for the recognition of the PAMPs by TLRs is largely unknown . The TLR subgroups are classified according to the location of the receptor and its function upon activation. TLRs expressed on the cell surface include TLR1, TLR2, TLR4, TLR5 and TLR6; these subgroups are able to detect bacterial and fungal cell wall components and some viral proteins . The intracellular subgroups TLR3, TLR7, TLR8, and TLR9 are located within endosomes and bind to viral nucleic acids [16, 17]. Their location within endosomes provides an environment in which host DNA should not be present, thus avoiding the possibly deleterious effects of self-recognition . TLR3, TLR 7/8 and TLR9 recognize viral or synthetically derived double stranded RNA, viral single stranded RNA or bacterial unmethylated CpG DNA, respectively [17, 19–21]. While both TLR7 and 8 have similar structures, are triggered by viral single stranded RNA, and propagate signaling via the same adapter protein, the myeloid differentiation primary-response protein (MyD88, see below), their activation appears to result in different host cell responses. Interestingly, recent studies show a vital role of TLR7 activation in early immune responses and throughout progression of plasmodial infections, another pathogen with a liver life cycle . Studies utilizing synthetic agonists demonstrated higher type I interferon induction by TLR7 signaling and greater proinflammatory cytokine induction via TLR8 activation . In this review, we will focus primarily on TLR7, as the majority of small molecule TLR agonists undergoing clinical development for treatment of viral hepatitis target TLR7 agonists to induce an endogenous interferon response.
TLR7 signaling is primarily associated with generation of an endogenous type I interferon response (Figure 1). Binding of TLR7 to its respective ligand causes conformational changes and dimerization of the receptors, followed by the recruitment of its specific TIR adaptor protein, MyD88. MyD88 activates a series of signal transduction molecules, including IL-1R associated kinases (IRAKs), tumor necrosis factor receptor (TNFR)-associated factor 6 (TRAF6), and transforming growth factor (TGF)-B activated kinase (TAK1), which yield activation of the transcription factors nuclear factor kappa B (NF-κ B) and IFN regulatory factor 7 (IRF7) (Figure 1). TLR7 signaling is biased toward IRF7 activation, which facilitates production of antiviral cytokines, including type I and type II interferons, while NF-κ B induces a proinflammatory effect via secretion of cytokines such as TNF-α, interleukin-6 and interleukin-12 (IL-6, IL-12) [16, 18, 24].
Selective TLR7 signaling. Natural ligands of TLR7 include ssRNA, particularly viral particles (HCV). Once an HCV virion enters the hepatocyte, it engages the TLR7 receptor resulting in the formation of a complex facilitated by the recruitment of adapter protein, MyD88 and TIR, which occurs in the endosomal compartment. This complex then triggers a series of signal transduction pathways culminating in the formation of IRAK/IRF7/TRAF6 complex. IRF7 will translocate to the nucleus and transactivate the production of type I interferons (IFN-α and β). Exclusive TLR7 agonists generate activation of type I interferons, while TLR7/8 agonists result in the generation of proinflammatory cytokines, such as IL-2, IL-8, and TNF along with interferon α/β, which may result in development of undesirable adverse events. Hence, selective TLR7 agonists are ideal in the treatment of hepatitis viruses.
TLR7-induced production of type I and II interferons activate pathways that lead to the destruction of intracellular pathogens, including stimulation of adaptive immune effector cells . This augmentation of innate and adaptive immune signaling makes TLR ligands an attractive addition to antiviral therapeutics . However, immune activation can be a double-edged sword; exogenous immunomodulatory treatment must be utilized with caution in patients with cirrhosis as profibrogenic chemokine stimulation can activate hepatic stellate cells, which may exacerbate fibrosis.
As a first line of defense, innate immune responses prime the adaptive immune system to mount an effective pathogen specific immune response. Efficient priming of adaptive immune response requires antigen presentation by the major histocompatibility complex (MHC) on antigen-presenting cells (APCs) in addition to the simultaneous induction and presentation of accessory signals, including several instructive cytokines and/or costimulatory molecules induced by innate immune signaling pathways. Dendritic cells (DCs) are professional antigen-presenting cells in humans. DC subsets respond to pathogens for which they have corresponding TLRs. In humans, TLR7 is expressed on plasmacytoid DCs (pDCs) and in some studies has also been detected on myeloid DCs (mDCs) . The generation of adaptive immunity is dependent upon the maturation of DCs, a process that is mediated in various ways by TLR signaling [12, 26, 27]. This process begins with the recognition and sequestration of antigen by DCs in peripheral tissue and the subsequent migration to lymph nodes for presentation to naïve T lymphocytes (Figure 2).
Selective TLR 7 agonists in chronic viral hepatitis. Selective oral TLR7 agonists are absorbed through the gastrointestinal mucosa and enter the liver through portal circulation (A). In the liver, they lead to priming of immature DCs to mature DC secreting interferon-α. Interferon-α stimulation will lead to the synthesis of interferon-stimulated gene (ISG) products, which in turn facilitate suppression of hepatitis viral replication (green insert) (B). Although, the exact mechanism of how interferon-α suppresses hepatitis replication is not fully characterized, multiple stages of hepatitis replication (such as viral entry, transcription, translation and assembly) have been shown to be inhibited by interferon-α and ISGs. In the lymphatics, TLR7 stimulated mature DCs secrete IL-12 and preferentially activate T cells to differentiate into TH1 cells (C). A TH1 response leads to the generation of cytotoxic T cell response (red inserts). IFN-γ primed CTLs cause suppression of hepatitis viruses by either killing infected hepatocyte or by shutting down the virion assembly.
Once inside the lymph nodes, DCs seek out naïve antigen-specific T cells and induce their activation and differentiation into effector cells. The first signal in activation of naïve T cells is an antigen-specific signal resulting from the binding of the T cell receptor to the peptide presented by the MHC molecule . The second signal in activation is driven by costimulatory molecules CD80 and CD86 expressed on the DCs, which interact with CD28 on naïve T cells to stimulate T cell proliferation, cytokine production and generation of CTL response [12, 28]. This is an example of TLR-mediated control of adaptive response, as hepatic pDC subsets upregulate costimulatory molecules CD40, CD80 and CD86 by TLR4, TLR7 and TLR9 stimulation [29, 30]. Specifically, viral ssRNA (a PAMP), is delivered to and is endocytosed by a pDC, and forms the source of the PAMP. Next, engagement of TLR7 on the endosome triggers the signaling pathways resulting in production of specific cytokines and costimulatory molecules that augment adaptive immune responses (Figure 2) [27, 31]. Hence, TLR-mediated signaling impacts adaptive immune responses by producing cytokines that mediate T cell differentiation. In the liver, pDCs produce IFN-α, TNF-α, IL-6 and IL-12 in response to ligands for TLR7/9 [29, 32]. Consequently, in response to stimulation by a TLR7 agonist, cytokines such as IL-12 drive the induction of TH1 responses on T cells , which is characterized by the production of IFN-γ by T cells and further activation of cell-mediated immunity, resulting in the activation of phagocytes, antigen-specific cytotoxic T lymphocytes and the release of various cytokines (Figure 2).
Studies using animal models that lack TLR signaling pathways have clearly established the vital role played by TLR7 in antiviral immunity [11, 34]. Mice deficient in MyD88, the adaptor protein that mediates signal transduction by TLR7, are not capable of signaling through TLRs. As a result, their APCs are not stimulated by TLR agonists . MyD88-deficient mice demonstrated a lack of T cell activation in response to antigen, suggesting impairment in the antigen-specific priming of T cells . Consequently, these mice failed to produce detectable amounts of IFN-γ in response to antigen stimulation , suggesting that in the absence of TLR signaling, immune responses are severely impaired and unable to generate an effective TH1-dependent immune response. In addition, MyD88-deficient DCs treated with antigen did not induce production of CD80, CD86, MHC class II or IL-12, which resulted in an inability of DCs to mature and led to inefficient priming of naïve T cells . These results support the theory that innate immune recognition by TLRs is required for induction of accessory signals required for the activation of adaptive immune response and inducing TH1 polarization by expressing IL-12 on APCs [27, 36], an event critical for the induction of DC maturation, the generation of TH subsets and the activation of the adaptive immune response against viruses.
An estimated 4.1 million people are infected with hepatitis C (HCV) in the United States, with up to 180 million people infected worldwide [37, 38]. Approximately 60-85% of individuals infected with HCV will eventually develop chronic hepatitis C infection [39–41]. Although chronic infection is usually asymptomatic, it can lead to chronic liver disease, including cirrhosis, hepatocellular carcinoma and ultimately liver failure [37, 42]. In the United States, complications from HCV are the leading indication for liver transplantation . Currently, immune-based therapies including interferon still have a role in the eradication of HCV. The standard of care for HCV is rapidly evolving as safer, more effective therapies become available. Currently, the preferred regimen for HCV genotype 1 infection is a 12-week course of sofosbuvir (an HCV NS5B polymerase inhibitor) in combination with pegylated interferon and ribavirin , which resulted in a 90% sustained virological response in phase III clinical trials . The treatment paradigms will likely evolve to include interferon-sparing treatment options for most patients over the next few years.
Many viruses have evolved mechanisms to subvert host immune responses and HCV is no exception. The HCV NS3/4A protease inhibits TLR3 and RIG-I mediated signaling in infected hepatocytes , thereby blunting type I interferon responses in these cells. The robust induction of interferon stimulated genes (ISGs) in the livers of HCV-infected patients suggests that cells other than infected hepatocytes may drive type I interferon induction. In vitro work done in Huh 7.5 cells suggest that pDCs in HCV-infected livers stimulate type I interferon via TLR7 signaling without becoming infected . Thus, cell-cell interaction should be required in order for pDCs to endocytose HCV RNA particles from infected hepatocytes. Recent work suggests that this cell-cell recognition is facilitated by CD81/CD9 tetraspanins . In summary, these data suggest that TLR7 mediated signaling plays an important role in immune responses in HCV-infected patients, and that exogenous TLR7 agonists may have a role in management of chronic HCV infection.
As treatment for HCV is slowly evolving from an immune based interferon-containing therapy to an interferon-free, all oral, directly acting antiviral (DAA) therapy, much more needs to be learned about the correlates of HCV clearance. Induction of hepatic type I interferons seems to be a reliable early indicator of sustained virologic response to DAA-based therapies . In this regard, HCV therapy can be optimized by enhancing an endogenous hepatic interferon response by using TLR agonists. Hence, the evaluation of novel immunomodulatory strategies, such as the use of TLR7 agonists, which result in an induction of endogenous type I interferon response, is warranted in maximizing the effectiveness of HCV therapeutics.
In a proof of concept study isatoribine, a TLR7 agonist, was shown to cause a significant reduction of plasma HCV RNA in previously untreated HCV-infected individuals . Administration of the TLR7 agonist isatoribine was shown to significantly increase viral clearance by inducing an immune antiviral response, as indicated by dose-dependent changes in immunologic biomarkers . Treatment was well tolerated and viral reduction occurred in both genotype 1 and non-genotype 1 HCV infection . Since this initial trial, small-molecule TLR7 agonists have become a focus of clinical trials for the treatment of chronic HCV infection. In a multi-center, phase IIa study, resiquimod, a TLR7/8 agonist was taken orally for 4 weeks resulted in a transient viral reduction, but serious adverse events were reported consistent with IFN-α induction, including fever, headache, shivering and lymphopenia . As a result of the systemic effects of the drug, resiquimod was withdrawn from clinical testing for HCV but was further examined as a topical agent for HPV . Another agent, PF-4878691, effectively induced immune biomarkers and IFN responses in a dose-dependent manner, but its antiviral effect was only produced at doses associated with serious adverse events [53, 54]. An oral isatoribine prodrug, ANA773, was administered to HCV-infected patients every other day for 28 days (800 mg, 1200 mg, or 1600 mg) or for 10 days (2000 mg). A significant reduction of serum HCV RNA levels was seen in the 2000 mg-dosed group. The drug was generally well tolerated and most of the reported adverse events symptoms disappeared rapidly during continued dosing, resulting in no dose reductions or discontinuations. Thus, ANA773 is the first oral TLR7 agonist to induce a dose-related antiviral response leading to a significant decrease in serum HCV RNA levels without the concurrent induction of prohibitive systemic side effects . Hence, it is plausible that viral eradication may be enhanced using a strategy that optimally targets the host innate immune system by using an oral selective TLR7 agonist to induce a direct antiviral effect (type I interferon signature) and an indirect effect (enhancing HCV-specific immunity by cross-linking innate and adaptive immune system), resulting in rapid eradication of HCV without a myriad of adverse events.
Hepatitis B (HBV) is an enveloped, double stranded DNA virus that can be transmitted perinatally, percutaneously, or through close person-to-person contact . An estimated 350 million individuals are chronically infected with hepatitis B worldwide , with approximately 1.25 million HBV carriers living in the United States [56, 58]. HBV carriers are at an increased risk of liver damage, including cirrhosis, hepatic decompensation and hepatocellular carcinoma [59, 60]. Hepatitis B virus is self-limited in 90-95% of adults. The remainder will develop chronic hepatitis B infection, as demonstrated by the presence of HBsAg+, serum HBV DNA, persistent or intermittent elevation in ALT/AST levels and evidence of necroinflammation.
The current goal of chronic hepatitis B treatment is to achieve long lasting suppression of HBV replication to prevent cirrhosis, hepatic failure and HCC. Currently, immune based treatment of chronic HBV infection consists of IFN administration. Nucleoside analogues (NA), mainly tenofovir and entecavir, can achieve long-term suppression of HBV. Complete response to treatment, also known as HBV clearance, consists of an HBsAg seroconversion, normalization of ALT/AST, absence of serum HBV DNA and absence of covalently closed circular DNA (cccDNA). Complete response is rare with the use of NA alone, but can be rarely achieved through the use of immune-based therapy, or via rare spontaneous clearance. In the absence of a cure, long-term suppression of HBV is required to prevent progression of liver disease. However, long-term suppressive therapy with NA is associated with emergence of resistance and toxicities . Some nucleoside analogues have a low barrier to resistance and once antiviral-resistant HBV mutants are selected they are typically retained in the virus population indefinitely . Even in the setting of successful viral suppression and normal ALT/AST levels, it is uncertain what long-term risk of sequelae like HCC is in these patients. Although chronic HBV infection may be cleared without induction of innate immune responses there is proof of principle data available that immune-based treatment such as interferon-α is capable of achieving protective immunity in some treated patients . This offers hope that similar strategies, that are safer, more tolerated and orally available could be vital in accomplishing a “functional cure” of HBV.
Studies have shown that liver of HBV transgenic mice produce IFN-α, −β and -γ to inhibit hepatitis B replication, suggesting that HBV replication can be controlled by activation of innate immune response in the liver When HBV transgenic mice were injected with ligands specific for TLR 2 through 9, HBV replication was nearly eliminated after a single injection of 10 μg of each ligand except for TLR2 ligands. The inhibition of HBV replication was essentially noninflammatory and noncytopathic and was accompanied by the induction of IFN-α and IFN-β . The inhibition of HBV replication was accomplished at a post-transcriptional level by suppressing the assembly or stability of HBV RNA-containing capsids, where HBV DNA synthesis is known to occur [65, 66]. These findings provide evidence that TLR activation directly inhibits HBV replication [18, 67]. However, HBV may evade innate recognition by TLRs as a strategy to escape the innate immune response by disrupting TLR expression, resulting in inhibition of TLR signaling cascades [18, 67]. It has been reported that the expression of TLRs in hepatocytes and other cells is down regulated in the presence various HBV viral products [68–73]. Although HBV circumvents endogenous type I interferon pathways, it is plausible that exogenous interferon induction by using a TLR7 agonist may reinstate interferon-α responses. When combined with a strategy that results in maximal suppression of HBV replication in vivo using NAs, exogenous IFN stimulation via TLR agonists may result in development of protective immunity. Several studies have shown that long-term suppression of HBV using NAs results in partial reconstitution of adaptive immunity. Furthermore, TLR7 mediated signaling may also contribute to adaptive immune responses . In this regard, an adjuvant therapy using a TLR agonist may be able to accelerate this process of immune reconstitution and aid in functional cure or HBsAg seroconversion both by innate and adaptive immune signaling.
There are other potential benefits in the use of TLR agonists for treatment of chronic HBV infection. First, TLR agonists are available as oral compounds enabling rapid uptake by liver. Pre-systemic activation by TLR agonists via gut absorption into portal circulation may allow for optimal, lower doses of adjuvant therapy to minimize adverse events. Second, they may be co-formulated with other NAs as a single pill. Third, TLR7 agonists are selective and do not activate the TLR8 pathway, thus eliminating the negative affects of TNF-α activation. Finally, similar to injected IFN, TLR agonists induce IFN production, triggering the production of cytokines to facilitate intracellular communication and cellular trafficking. However, through the use of TLR agonists this antiviral state can be induced at the local level, pre-systemically rather than systemically, eliminating the adverse events associated with systemic innate immune activation.
Recent studies have shown that TLR7 agonist administration results in an augmentation of downstream signaling of interferon stimulated genes (ISGs) without systemic IFN-α related adverse events. In particular, the induction of ISG15 and CCL8 mRNA have been implicated as markers of pre-systemic immune response in response to TLR7 agonist stimulation . Recently, in chronically infected chimpanzees, GS-9620, a selective oral agonist of TLR7, induced prolonged suppression of HBV DNA in both the serum and liver . GS-9620 administration induced the production of IFN-α and various cytokines and chemokines. In addition, it activated all lymphocyte subsets to induce ISGs . HBV DNA was reduced in addition to serum levels of HBsAg, HBeAg and HBV antigen positive hepatocytes . In early studies of oral GS-9620 in healthy volunteers, oral doses (single dose of 0.3, 1, 2, 3, 4, 6, 8, or 12 mg) were well absorbed and well tolerated in doses up to 12 mg. Adverse events associated with IFN treatment were seen subjects who received 8 mg or 12 mg dose and serum IFN-α was only detected at these doses although activation or ISGs were seen at doses ≥2 mg .
Optimal induction of innate and adaptive immunity contribute to host defenses against viral pathogens such as hepatitis B and C. Endogenous induction of type I IFNs contributes to the clearance of these viruses, hence the appeal of selective TLR7 agonists,which generate endogenous type I interferons and could thus aid in augmenting spontaneous and therapeutic clearance of hepatitis viruses. Adjunctive treatment with such agents may allow for shorter, less toxic, and less expensive courses of antiviral therapy. This approach, if successful, will have a tremendous impact on the public health burden of chronic liver diseases, wherein HCC and death due HCV and HBV infections are common.
This research was supported by the Intramural Research Program of the NIH (National Institute of Allergy and Infectious Diseases, and the Clinical Research Center). The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. Government.
The content of this publication does not necessarily reflect the views of policies of the Department of Health and Human Services, nor does mention of trade names, commercial products or organizations imply endorsement by the U.S. Government.
EF performed literature search, wrote the primary manuscript, SK and BG assisted with concept and design of the manuscript, proof read the manuscript and RT designed the manuscript concept and wrote the manuscript. All authors read and approved the final manuscript.
|
0.999605 |
Couples: Man/Woman / 1. Couples: Man/Woman / 2. Couples: Man/Woman / 3. Couples: Man/Woman / 4. Couples: Man/Woman / 5. Couples: Man/Woman / 6. Couples: Man/Woman / 7. Couples: Man/Woman / 8. Couples: Man/Woman / 9. Couples: Man/Woman / 10. Couples: Man/Woman / 11. Couples: Man/Woman / 12. Couples: Man/Woman / 13. Couples: Man/Woman / 14. Couples: Man/Woman / 15. Couples: Man/Woman / 16. Couples: Man/Woman / 17. Couples: Man/Woman / 18. Couples: Man/Woman / 19. Couples: Man/Woman / 20. Couples: Man/Woman / 21. Couples: 2x Man / 1. Couples: 2x Man / 2. Couples: 2x Man / 3. Couples: 2x Man / 4. Couples: 2x Man / 5. Couples: 2x Man / 6. Couples: 2x Man / 7. Couples: 2x Man / 8. Couples: 2x Man / 9. Couples: 2x Man / 10. Couples: 2x Man / 11. Couples: 2x Man / 12. Couples: 2x Man / 13. Couples: 2x Man / 14. Couples: 2x Man / 15. Couples: 2x Man / 16. Couples: 2x Man / 17. Couples: 2x Man / 18. Couples: 2x Man / 19. Couples: 2x Man / 20. Couples: 2x Man / 21. Couples: 2x Woman / 1. Couples: 2x Woman / 2. Couples: 2x Woman / 3. Couples: 2x Woman / 4. Couples: 2x Woman / 5. Couples: 2x Woman / 6. Couples: 2x Woman / 7. Couples: 2x Woman / 8. Couples: 2x Woman / 9. Couples: 2x Woman / 10. Couples: 2x Woman / 11. Couples: 2x Woman / 12. Couples: 2x Woman / 13. Couples: 2x Woman / 14. Couples: 2x Woman / 15. Couples: 2x Woman / 16. Couples: 2x Woman / 17. Couples: 2x Woman / 18. Couples: 2x Woman / 19. Couples: 2x Woman / 20. Couples: 2x Woman / 21.
The infinity symbol is a classic friendship icon. On these bracelets it holds embedded charms representing the ones you hold dear. Matching infinity bracelets, special couples gift for an anniversary celebration, a special date... a cool and unique bracelet for her and for him!
|
0.950812 |
Can a property we've rented out qualify for capital gains exclusion?
My wife and I purchased a rental property in 1975. We lived in it from 1975 to 1978, and then rented it out to the present.
Do we qualify for the capital gains exclusion if we sell the property in 2008?
No. The general rule is in order to qualify for the exclusion for the sale of a principal residence, you must have owned and used the property as your principal residence for periods aggregating two years or more during the five years ended on the date of the sale or exchange. Since it's been nearly 30 years since you used the property as a residence, it doesn't qualify for the exclusion.
|
0.978213 |
What is worship? In Christianity today, worship is one of the most misunderstood words. Worship begins with a true vision of our holy God and is centered on the Cross. If our worship does not make Jesus the primary focus of our lives, then it is not true worship.
|
0.975846 |
Why is social media so important for small businesses? It’s where your customers are. With nearly 2.5 billion social media users around the world, it is a great way to cut marketing spend, build your brand and get to know your customers better.
If you haven’t already it’s time to give your business a platform to drive awareness, attract new customers and boost sales. Here is a selection of tips that can help you manage, and make the most out of your social media.
Every social platform has a different function and not all social media platforms are suitable for every business, it’s about knowing your goals and having a bespoke plan for each one.
Facebook: The world’s most popular social media network, with more than 2 billion users as of June 2018, is home to the largest number of regular users. Facebook is good for lead generation and is appropriate for many different types of content, it is also good for building relationships and showing a human side to your business.
Instagram: The visual-centric platform that has taken the world by storm. Creative photo and video content is the key here. Instagram boasts the best engagement levels among all social networks, making it a powerful platform for businesses to reach consumers. With the recent introduction of the ‘Instagram stories’ feature it has become a hub for live and interactive content.
Twitter: The conversation platform, Twitter provides a steady stream of information and new content from all over the internet that is generally in real time. It is a fast-paced platform perfect for news updates, announcements and other important information.
LinkedIn: LinkedIn is an ideal platform for editorial content and can help your company become an established and influential leader in your field. It is typically the choice platform for B2B businesses.
Once you are all set up it’s time to create and manage meaningful content for distribution on each channel. Keeping on top of your activity can be hard, but there are a few key principles that will help you manage it.
The world of social can be daunting at first so it is wise to think about what you want to achieve and it is important to make specific goals. This will help you to determine the type of content you create, where you put it and the audience you target. Make goals that are measurable, realistic and relevant.
Being an active member on social doesn’t just mean posting great content, it also requires you to engage with your audience regularly and to add value to their newsfeeds. It’s in your best interest to pay attention to when your followers and fans are online, so creating a content calendar including times to post, is an essential part of any social plan. There are a number of ways to streamline your posts, free tools such as Hootsuite provide a schedule and publishing service, making it a lot easier to manage your conversations online.
Social media is where a lot of people go to voice their opinions, whilst it’s great to have good conversation around your brand unfortunately there can be some people who will leave negative comments. Responding quickly and appropriately to negative social comments can help you increase customer loyalty and retention.
Respond quickly. Stay active and make sure you are on top of all conversations around your brand – the good, the bad and the ugly – this way you’ll be in a strong position to do something about it.
Acknowledge your mistakes. There is no such thing as perfection and customers know this! It’s best to own up to mistakes and when you apologise to fans on social make sure the apology is genuine and is focussing on finding a solution to the issue.
Be human. There is nothing worse than feeling like you are talking to an automated robot. When customers reach out personalise your reply using a conversational tone and let them know they are talking to a real human. Be professional, friendly and understanding, and remember your behaviour is a reflection of your brand.
It’s important to know your brand and have a clear message. As the popularity of social media increases so does the amount of content, to put it into perspective, on average there are 95 million posts going out to Instagram only per day! With each digital channel becoming more saturated than ever, it’s all about quality over quantity. Focus on the platforms your audience use and bring them value. Do your research to know this, and work on solving their problems, what entertains them and what they want to engage with.
|
0.999777 |
How often have you attended a conference only to sit through poorly managed panels featuring speakers with interesting bios that should have been more effectively engaged by moderators?
I’m at a morning conference listening to potentially interesting people participating in a few poorly moderated panels. Here are a few tips for moderators running panels based on events I’ve organized and joined as well as a conference series I organized for a former blue chip client.
1. Creative. Creatively title the panel. Come up with something that captures attention and draws audience.
2. Pre-interview Panelists. A week prior to the panel, speak with participants by phone to determine their strengths and weaknesses, competencies, and relevant success stories and methodologies you can point to during the panel. Determine questions you might ask panelists from this pre-interview, and during the live panel, draw from a list of these questions.
3. Avoid Lengthy Intros. Rather than turn intros over to panelists who will likely waste valuable time regurgitating bio elements that are usually in print, write a script that excerpts 20 seconds of pertinent information from each speaker’s bio, and get that out of the way quickly so you can get into the topic of the conference.
4. Manage Time. Make sure you manage your time during the actual panel so that you can make it through your questions in ways that engage every participant. If one participant speaks too long and delivers information that is off topic and puts your plan in jeopardy, be proactive and politely cut off the speaker. You’re doing this for everyone’s benefit.
5. Interactive. You are managing time. Make sure the panel is interactive. Ensure that everyone has a chance to speak, and encourage cross-talk.
6. Q&A. Leave some time for audience questions at the end.
7. Twitter. Set up a hashtag (#) for the panel (i.e. #panelname) that folks can use to tweet questions, and announce it at the start of the panel. You might find some potential questions and useful comments from these Tweets from attendees during the panel and incorporate these into the discussion.
8. Inspire. Drive personal energy through the session in ways that inspire the audience.
GloPos today announced its software-only positioning technology that makes all mobile phones location aware — outdoors, indoors, and even underground.
GloPos Technology requires only a cellular network to make all mobile phones location aware. No additional hardware like GPS or W-LAN is required on a mobile device for achieving accurate positioning.
“By making all phones location aware, GloPos Technology is set to revolutionize the indoor positioning and social location market, including mobile search and personalized mobile advertising. This will massively expand the positioning market,” said Mikael Vainio, CEO. “GloPos is a superior solution versus W-LAN and GPS-based indoor positioning applications which today serve less than 20 percent of the total yearly 1.3 billion unit mobile device market,” Vainio added.
GloPos’ patent-pending, self-learning algorithms calculate an accurate position fix to within 1-40 meters even in places where no W-LAN access points are available or no GPS can be used (i.e. in shopping malls, subways, underground parking, airports, sports arenas, and exhibition centers). GloPos works wherever cellular network coverage is available.
GloPos Technology does not consume any extra battery life while operating as cell information is already being used to stay connected. GloPos enables longer device usage versus GPS and W-LAN, allowing battery power to be used for more advanced applications and driving more powerful processors.
GloPos co-founders have over 20 years combined mobile experience with Nokia and Ericsson. CEO Mikael Vainio brings to GloPos more than a decade of executive experience with Nokia and Ericsson. Before joining GloPos he served in Ericsson Middle East HQ as Vice President Strategy, Marketing and Communications. Vice-President Alexander Le Bell has held executive positions with leading mobile and technology companies, including Ericsson, Nokia and Philips. He was Ericsson’s Director for Strategy and Business Intelligence for the Middle East. Prior to that he served in Nokia Multimedia, managing the operator business in Central Europe with some of the largest operators in the world, including T-Mobile, Vodafone and O2-Telefonica.
For more information visit: http://glopos.com.
GloPos was founded in 2009 to bring its new and innovative indoor positioning technology to the mobile consumer marketplace. GloPos is a technology spin-off company of 4TS Corporation, an innovative Finland-based company that develops location- and sensor-based technologies and solutions.
I have been working with Jeff Dorman, who is a dear friend and client, on a series of videos that articulate his philosophy on executive training. Jeff, who heads JDA International, a leadership training firm based on Princeton, NJ, cut his teeth in the food processing industry building Dorman Cheese with his family into a huge, national brand. Now he’s a highly respected national trainer who serves many Fortune 100 clients.
I’ve been reviewing a series of Jeff’s video segments that my firm produced through which he conveys his philosophy, expertise and experience on a number of topics including public speaking, leadership, employee performance, management, team building, consensus, etc. I walked away very impressed by the methodology he applied to his training approach which has helped thousands of executives and supervisors perform more effectively and efficiently in financial services, banking, food processing, and manufacturing.
So when I read the NY Times’ story about Obama’s health care plan, and how the Republicans in Congress stood up in opposition to it from the moment it was announced (like just about every other Obama initiative), I realized that Members of Congress could benefit from team building and consensus training from a guy like Jeff Dorman.
As Jeff pointed out in one of his videos, managers often are promoted into positions for which they lack communications, public speaking, and leadership skills. With some basic coaching, these folks can perform better and so will the company.
Is there a team building opportunity here for Members of Congress?
PS: To learn more about leadership, performance, communication and sales training, check out JDA’s blog.
Television has changed. When I was growing up, the family watched TV together in the evening because there was often one TV in the home. Then cable emerged and everyone had a TV in their room. Now kids growing up don’t need a TV box to watch; they can access everything they want on their computer screen, and the source is often user gererated content on YouTube or broadcast content on Hulu.
The past several weeks I’ve been working with Attention Span Media, a social media production studio whose credits include the mega online hit TV series, Dorm Life.
Dorm Life hilariously chronicles the experiences of ten college students residing on “5 South,” a dorm floor on a fictional campus. It’s the most popular web TV series on Hulu with 6+ million views and often called…NBC’s “The Office” goes to college.
Attention Span Media is one example of a small, indy studio producing content that rivals the big ones and reaches mass audiences via a savvy social networking model. In a recent California Chronicle article that my firm placed, Dorm Life was called “a taste of whats to come.” I agree.
Dorm Life is a great Long Tail example of a niche audience (college and high school students) growing so large that the show could easily migrate its audience to another platform; Dorm Life could find a home on traditional broadcast or cable TV and also monetize itself through sales and branded merchandise (shirts) and DVDs.
On the other side of the spectrum — the big box TV — AMG TV has just announced the first 3-D network, and their plans to deliver 3-D content to some 200 terrestrial station affiliates. That makes sense. I’m thinking the big box HD TV in the living room will never go away. The big screen at home will be used for big events like sports and 3D while the rest of us will continue to view our niche content on hand-held devices and computers. And don’t be surprised when your local TV stations go out of business or consolidate as a result … because viewership is shifting online. And advertisers will go where the audiences are.
Witness the recent demise of several of the most successful print newspapers in the world. I wrote about the publishing industry in transition last year. TV is also in a major transition. Watch for exciting new shows from Attention Span Media. And stay tuned!
This past Sunday at Sun’s Startup Camp before an audience of about 600 attendees, I had a chance to explore the challenges facing startup companies with a brilliant panel: Matt Dickman, Fleishman-Hillard (Matt’s blog); Christina Kerley, ckEpiphany, Inc. (CK’s blog); Jyri Engström, Google (Jyri’s blog); and Adam Metz, theMix (Adam’s blog).
Now you can view and download the sessions as we explore prelaunch and launch strategies and questions on Branding, Messaging & Positioning, Social Media, and Public Relations. You’ll hear real-time experience and sage advice from these experts in digital and social media, advertising, PR and technology. Rejoice: there’s something here for anyone managing or promoting a company, product or service.
Read Mashable’s report on the panel, CK’s post and Matt Dickman’s post.
|
0.940253 |
What is a gear ring pump and why do you need it?
The gear ring pump is primarily used as a pressure lubrication system for machines and combustion engines. They are also used in hydraulic power steering systems.
This pump is often assembled with a high pressure pump, e.g. radial piston pump. The rotors of the gear ring pump can be directly built into the housing of the high pressure pump, which makes it possible to build very compact units. Such small double-pumps are often used for rapid traverse on large presses and tensioning equipment.
The rotor has one tooth less than the inner stator. Planetary movement of the rotor results in compressing and decompressing of the displacement chambers within the housing.
|
0.859775 |
Personally, I do not make my bed often. I can however, appreciate a made bed. Your article made it sound particularly gratifying. My issue is with how some people (my girlfriend) do it. I was wondering if you had any thoughts on her technique so I could either outwit her bed-making prowess or ultimately eat my own words. She likes to lay the comforter out perfectly then put the pillows on top of the comforter as if to show them off as decorations. I mean, sure, it looks a bit better, but then when you go to bed you have to take off the pillows before you can even get under the sheets.
I should mention that I do not criticize her technique and am in fact quite grateful for the time she spends to make it. I just don't get it. And have yet to get an answer other than, "It looks so nice!"
You are wise in your choice not to criticize that which you don't understand, and wiser still to offer words of appreciation in the face of a nicely made bed! Your lady has herself a nice man.
You're also wise to ask questions, but I would say that wouldn't I? I mean, my work depends on people asking me questions, so. The thing about this particular question is that I'm not totally the best person to answer it, because I don't know what makes your girlfriend tick. So you should ask her! Just be sure to phrase the question in such a way that makes it clear that there's a good and reasonable answer. Asking, "Can you solve a tiny mystery for me? When you make the bed, why do the pillows go over the comforter instead of under it?" is more likely to get a positive response than asking, "Why do you make the bed in such a stupid way?"
Even though I can't give you a definitive answer, if I had to venture a guess I'd say that she either makes the bed that way because it's how she was taught/how she's always done it or because she has a set of decorative pillowcases or shams that she likes to display. You sort of already told us what the answer is: Your girlfriend thinks the bed looks nice that way. That's a perfectly fine reason! In terms of your qualms about the extra effort that her approach to making the bed leads to when it comes time to turn the covers down in the evening, it may be that the rearranging of the covers and pillows is part of her unwinding routine.
With all that said, let me address a portion of the question asked of me today, "I was wondering if you had any thoughts on her technique…" Because, yeah, I have thoughts! My thoughts are going to be super frustrating to some of you, and incredibly welcome to others: When it comes to making the bed, you should do what looks and feels best to you. Some people are minimalists who prefer a simply made bed with clean lines. Others, who have a more rococo sensibility, might like a frou-frou bed with lots of decorative pillows and dramatically draped throws. Both are fine!
There's also the matter of comfort—there are loads of different sleep preferences, from blankets, to pillows, to how tightly tucked the bedding is. The other day, two women I know were on Facebook discussing, in solidarity for their unique ("unique") preferences, how they both kick the top sheet down to the foot of the bed when they sleep. I was tempted to chime in to tell them to just stop using the top sheet altogether, and to free themselves from the confines of whatever idea it is that they have about how a bed is made, but truth be told I don't particularly like either of them so I didn't pipe up. But I like you, so I'm saying it here: When it comes to how a bed is made, cast off the shackles of whatever you think is right and go with what makes you the most comfortable. If that means sleeping under a burlap sack, go for it. That goes doubly if you share the bed: There's almost always a way to make everyone happy, whether that means having separate blankets, or different kinds of pillows, or one side that's tucked tighter than the other.
Look, even Martha Stewart, who never misses an opportunity to be imperious and dictatorial, concedes, in this delightfully retro video clip in which she demonstrates how to make a bed, that personal preference varies when it comes to outfitting a bed. Quoth Martha, "Some people sleep with just a comforter and a duvet cover. I prefer a top sheet."
This is a good point at which to detour a bit so that I can share some terminology with you. I put this together for an episode of my podcast about bed-making and I'm sharing it here because I think it speaks nicely to the wide variety of bedding options and, by extension, ways to make a bed that there are out there.
Head and foot boards: Upright panels that are placed behind the head or foot of a bed. When the head and foot boards are combined into a single unit with side rails, it is called a bed frame.
Box spring: The frame used to support a mattress.
Mattress: A mattress is a large pad for supporting the reclining body.
Bed skirt: This is also called a dust ruffle. It's a decorative covering used to hide the boxspring and the legs of the bed. It goes over the box spring but under the mattress and hangs to the floor.
Mattress topper: There are a number of different types of mattress toppers, including ones that come attached to the mattress (think: pillowtop mattresses). Some common toppers are feather beds, egg crates, and mattress pads (including protective styles).
Fitted sheet, also called bottom sheet: A sheet that covers the mattress and is elasticized around the edges to hold it in place.
Flat sheet, also called top sheet: It goes on the bed back-side-up, so when you fold it back over, the decorative side shows.
Comforter: Thick bed covers that are stuffed with filling. A comforter is generally decorative and doesn't require a cover.
Duvet & duvet cover: Thick bed covers that are stuffed with filling. A duvet is generally plain white, and is meant to be used in conjunction with a decorative duvet cover.
Quilt, blanket, coverlet: A coverlet is a lightweight, woven spread used on the top of the bedding. Blankets and quilts can be used as lightweight spread options as well.
Throw blanket: A small blanket that is placed on a made bed, usually at the foot, to provide extra warmth or a cover to use while napping so as not to disturb an otherwise made bed.
Pillowcase: A removable cloth cover for a pillow.
Pillow sham: Decorative coverings for standard-, queen- or king-sized pillows that are placed in front of the pillows used to sleep on. They're removed from the bed or placed behind the pillows used for sleeping in the evening, and put back in place when making the bed in the morning.
Euro sham: A pillow covering for large square pillows that are typically placed against the headboard, followed by standard pillows and decorative pillows, but that may be placed in front of standard pillows.
Throw or accent pillows: Small decorative pillows featuring ruffles, embellishments, cording, etc. that are not used with pillow cases and which are added to the bed for visual effect.
Bolster: A long tubular pillow that is placed under other pillows for support.
For the record, I'm one of those people who sleeps with just a comforter and a duvet cover. My feet need to rove in the night! So I use a fitted bottom sheet and a launderable duvet cover that gets washed along with the sheet and pillowcases. It works for me! For others, it sounds terrible—someone recently called me a ridiculously rude name because of how I choose to arrange my bedlinens, which was obviously entirely unnecessary but nicely illustrates how passionately people can feel about their bed set-up. If I may, though, I'd like to ask that you keep the passion but do away with the name-calling.
I'd also like to say thanks for following along throughout this month dedicated to bed-making! I'm curious to know if you took up the challenge to make your bed every day and, if so, how that went for you. Feel free to shoot me an email or tweet at me about your experience.
|
0.91361 |
Srinagar: Campaigning ended today for the fourth phase of Assembly polls in Jammu and Kashmir, which will see voting on 18 seats with a total of 182 candidates in the fray, including Chief Minister Omar Abdullah and PDP patron Mufti Mohammad Sayeed. Over 14.73 lakh voters, including 7.05 lakh women, are eligible to exercise their franchise on polling day on Dec. 14 across 1,890 polling stations in four districts of the state. Prime Minister Narendra Modi, BJP president Amit Shah, cricketer-turned-politician Navjot Singh Sidhu and Bollywood actor and MP Vinod Khanna have campaigned in J-K for the BJP candidates who are contesting in the fourth phase on Sunday. BJP, which is making its first serious bid for power in the state, has come out all guns blazing to make its presence felt in the Valley. But not to be outdone, Congress president Sonia Gandhi, Leader of Opposition in Rajya Sabha Ghulam Nabi Azad and Pradesh Congress Committee chief Saifuddin Soz, too, have held rallies in favour of their candidates. Chief Minister Omar Abdullah, who is contesting from the Sonawar Assembly segment in Srinagar district, was the star campaigner for the ruling National Conference and crisscrossed the four districts to promote his party's cause and canvass for votes for its candidates. Mr Abdullah also contested from Beerwah seat in Budgam district which voted in the third phase of polling. Related Amit Shah 'Falsifying Facts' About Centre's Flood Relief Package: Jammu and Kashmir Chief Minister Omar Abdullah Campaigning Ends for Fourth Phase of Assembly Polling in Jharkhand Opinion: PM Modi's Outreach to Kashmir is Audacious The opposition PDP had its patron Mufti Mohammad Sayeed and party president Mehbooba Mufti turning out to seek votes. Mr Sayeed, a former chief minister of J-K, is contesting from the Anantnag segment in south Kashmir. Among the other prominent contestants in the fourth phase are Assembly Speaker Mubarak Gul, Omar's close confidant Nasir Aslam Wani, Congress ministers Peerzada Mohammad Sayeed and Ghulam Ahmad Mir, and senior PDP leaders Abdul Rehman Veeri and Altaf Bukhari. Campaigning in the four districts - Srinagar, Anantnag, Samba and Shopian - was by and large peaceful although militants hurled a grenade at a police station in Anantnag town last night, resulting in injuries to three policemen. Suspected ultras also planted an IED under a culvert in Shopian district yesterday but the explosive was detected and neutralised by security forces. Mr Abdullah and Mr Sayeed are being seen as the front-runners for the post of chief minister of J-K depending on how their parties perform in the Assembly polls, for which the fifth and final phase of voting is scheduled for December 20. Of the 18 seats going to polls on Sunday, National Conference had won nine in 2008 while PDP bagged six seats. Of the remaining three, Congress had won two with National Panthers Party taking one seat in Samba in Jammu region. While the first three phases of elections in the Valley witnessed a high voter turnout despite a call for boycott by separatists and the threat of militants trying to disrupt the process, polling day will be keenly watched in Srinagar and some parts of Shopian and Anantnag districts where turnouts have generally been low. The polling process will come to an end in Kashmir Valley on December 14 as all the 20 seats going to polls on December 20 are in Jammu region.
|
0.999984 |
As a homeowner you’re faced with a neverending list of things to get done, one which can be air conditioner replacement. Sure, there’s a lot to get done around the house, so when it’s time to take on one of the bigger tasks, make certain you’ve done your research so you can decrease the damage it does on your wallet.
Because you live in Rogers, you could qualify for utility rebates and other local incentive programs when you get a high-efficiency air conditioner from Lennox®. These rebates are created for your specific location, so rebates will vary, but chances are, there are savings to be had if you make certain you take the time to do a small amount of research.
Savvy homeowners in the market for air conditioner replacement may save hundreds, and even thousands, of dollars when getting an energy efficient air conditioner this summer. Between the federal credits and those available in Rogers, you can increase your comfort while saving money. Something to remember as you’re doing your research is that local incentives can change pretty fast and without notice, so utilize them when they are available so you can save the most possible.
If you decide to go the solar route, you might be eligible for even more rebates as well. Adding a solar air conditioner like the SunSource® Home Energy System makes you eligible for the federal renewable-energy tax credit through 2016. That’s just the tip of the iceberg for solar bonuses too, so be sure to keep that route open as you shop around for the ideal option.
Considering air conditioner replacement doesn’t just mean you’re getting a new system, but you’re also reaping the benefits of better technology. The life of the average air conditioner is around 10-15 years, and the advancements made in energy efficiency alone can make the investment worth it. You’ll reap the benefits year-round too, with greater comfort and lower energy costs throughout the year.
If you want to know more about the various savings available to you in Rogers, give the team at AirTech Heating and Air Conditioning, LLC a call or check with your local utility company to ensure you’re getting the most savings possible.
|
0.973932 |
How would a crash in commercial real estate affect the church?
From what I have read and heard the church was $33 million in debt in 1959. The main reason was the church had a strategy if they built better buildings this would attract new members. It really didn't work and the church ended up with a lot of debt. About the only good thing the church did was they bought a large cattle ranch in Florida because on of the apostles was a rancher who understood that business. He also was the same guy who encourage David O McKay to spend on things that lost money.
Apparently the big savior for the church was N Eldon Tanner. A Canadian businessman who understood real estate. Also the post war baby boom created a demand for real estate. Everything from new homes to new offices and stores was needed. Real estate has in general been a great place to make money and the church apparently has done very well.
Now many financial experts see real estate over valued and with the boomers aging and no other big boom following there is nothing to generate a demand for more real estate. Prices will start to come down especially when interest rates go up.
In 1980 when the church built the Seattle temple they required that the local members cover 33% of the cost. One regional church leader in the Seattle area even said the presiding bishop of the church got a bit annoyed when he said Seattle needed a temple. Seems like money was still tight in the late 70's.
The big spending church seemed to happen when Gordon B Hinckley came in. Ironically the prophet who often talked about the great depression and living within one's means took on very expensive real estate projects. He started the whole temple building craze and the church seems to just throw money at things like church historical sites. A pet interest of Gordon B Hinckley. The church even relocated the street the Smith farm in Palmyria and made the original street a pedestrian walk. Sure you can relocate a county road but it comes with a price and the big question is why?
So the church like any organization spends it when it has it and that trend goes on until it causes problems. If real estate is a major money generator for the church then a downturn in real estate should hurt the church. Add in a declining membership and no real solution to end that trend.
Maybe the church we see today is just the result of a 50 year old real estate boom and a increase in church membership due to a post war baby boom. Maybe the baby boom has more to do with the success of the church more than missionary work or any other factor. With the baby boom aging and ending maybe the church will age and end with it. I don't see anything that would rally the church out of it current decline down.
Re: How would a crash in commercial real estate affect the church?
Your financial history is basically correct. Hugh B. Brown, I believe, was the "build it and they will come" moron. He was shoved aside and N. Eldon Tanner imposed financial discipline and saved the church.
Later, Hinckley literally told the Q15 that "I earned it, I'm gonna spend it" and launched the McTemples effort. The difference between him and Brown was that Hinckley actually had the money.
I'm sure the aging of the baby boom generation will cause real estate appreciation to slow dramatically and chronically. But that is true of most asset classes. What happened that interest rates peaked in about 1982 and then began a 40 year decline that pushed money into stocks, bonds, and real estate. So anyone who went long during those decades did well. The story going forward, now that rates are rising, will see a much lower rate of appreciation for most assets.
Will that kill the church? I doubt it for two reasons. First, real estate prices will still rise albeit more modesty. Second, the church has large real estate holdings but it also has dozens of other businesses and huge stock portfolios. Those assets are managed by very serious professional fund managers, managers who seek both gains and risk mitigation.
The church is not in financial trouble. It will do roughly as well as the big pension funds, which are managed similarly by similar people.
> earned it, I'm gonna spend it"
My great grandfather wasn't the reason. This guy was.
Brown got his nephew on the job.
"No less impressive than his rise within the business community of Canada was N. Eldon Tanner’s rise within the leadership of The Church of Jesus Christ of Latter-day Saints. With the completion of the Trans-Canada pipeline, the Tanners planned on enjoying a well-earned retirement on Calgary’s west side, overlooking the foothills of the rugged Rocky Mountains. They had property, horses, and grandchildren to enjoy. But after living for only eight months in the new dream home, everything changed. While attending general conference in October 1960, the Tanners dined with Eldon’s uncle Hugh B. Brown of the Quorum of the Twelve Apostles. At the end of the evening, Elder Brown said that President David O. McKay wished to see Eldon in his office at 9:00 the next morning."
Absolutely right. It was Moyle.
Any crash or recession will affect their income via fewer tithing dollars.
I would imagine property values of LDS real estate might not be that big a factor as they would probably just hold on to stagnant property until market conditions improve.
The for profit arm of the church is not adverse to cutting its losses.
ZCMI, Zion's Bank and Beneficial Life are a few examples.
Real estate is a lot less liquid. I'd wager most of it is under the non profit arm and hence shielded from taxes so holding it may not be as expensive as we'd think.
The real damage will come when the church cannot funnel tax free money into it's for profit businesses by having them build, rebuild or renovate churches and temples. That will hurt the royal families that control these businesses right in the pocket book.
In Mormon Hierarchy Wealth and Corporate Power it talkes about the churches specualtions during the 1st half of the 20th century. Despite the platitudes in general conference about being wise with money, The Bretheren were always into penny stocks and worthless gold mining stocks. They were constantly buying risky things on the market because there was always some story running around Wall-Street that someone made big on this or that mine of gold or something. But it never panned out consistently.
From what I understand what really turned mormondom around was that starting in about 1950s some wealthy southern California widows (non mormons btw) decided to deed their estates to the church. Think of that a 100 acre farm in Santa Barbara, Malibu, or San Diego. What's would that be worth in 70 years? And you add up 100 such farms deeded in the 1950's. And it's worth billions today.
California real estate is the gold mine that shaped the mormon empire. But as for a crash in the price of real estate? I don't see it happening anytime soon. Look at Japan they have a steady or declining population yet it's still the most expensive place in Asia, and they are sitting at the top of the heap.
Those things may have happened but they did not have an immediate impact. The church almost went bankrupt at the end of the 1950s. It was Tanner, and his rigorous cost control, that avoided the crisis.
No one ever does. That is why it is a "crash" rather than a gradual decline. The overall market didn't have a clue in 2006-2007: the subprime crisis looked small and containable, but of course it was not.
Then there is Japan. . .
> the top of the heap.
I'm not sure what this means. Japan is a great example of how real estate crises occur unexpectedly and horrifically. Just look at a chart of Japanese real estate prices from 1989 to the present. After 30 years, prices are still down about 60+ percent.
As for Japan's "sitting at the top of the heap," what does that mean? Japan is in serious decline. China is economically bigger, militarily stronger, and politically driving what happens in East Asia and increasingly the world. In part because of its economic failures and market crashes, Japan is a shadow of what it once was.
I was a clerk during that weird time when the church was in flux between early modem talkin' computers and their fancy Brother business style electric typewriters. Even though a program had been developed to print church ordinance certificates, I was still expected to use a typewriter with a worn-out ribbon. Sure, very nice stationary that looked like crap because the ribbon was worn out. The stake had some auditor that verified that each ribbon was fully run through 4-5 times before a new ribbon was authorized.
|
0.999769 |
Emerging economies are entering into an economic and political paradigm where instating capital controls on foreign investment increasingly seems like a viable option.
The economic aspect of this probable outcome relates to a trilemma found in international finance called the ‘Impossible Trinity’. Formally known as the “Mundell-Fleming model”, the impossible trinity frames a choice between three financial policy goals: 1) domestic monetary autonomy, 2) free-flowing foreign capital flows, and 3) a stable exchange rate. Only two of these three goals can be pursued at any given time. The third policy goal is automatically excluded. To illustrate how the impossible trinity works, consider the following example. Say that a government wishes to maintain a stable exchange rate. Given the impossible trinity, the government has two choices to counter the effects of global financial markets on the value of their currency. One option is to give up domestic monetary autonomy. In order to maintain a stable exchange rate, the government must design its monetary policy specifically to counter the appreciative or depreciative pressure that foreign capital flows exert on their currency. This scenario becomes ever more unlikely as global financial markets grow larger and the capacity for governments to influence them through their monetary policy instruments diminishes. Therefore, to maintain a stable exchange rate, governments really have one other option: to establish capital controls. This scenario’s likeliness increases if certain economic and political developments are considered.
From an economic perspective, the focus is on trade. For emerging economies, their economic growth during the last decade owes much to a surge in intraregional trade. MERCOSUR, the SADC, and the ASEAN organizations have consolidated Brazil, South Africa, China, and South Korea as regional economic leaders. These economies have grown to a capacity where they can be strong exporters. Regional trade deals constructed around these regional organizations have consolidated this position for them. However, to maintain a strong trading position, emerging economies have an interest in maintaining stable exchange rates, and hence, keeping prices stable for trade. Therefore, emerging markets already have one policy goal defined for them: stable exchange rates. Now they have to choose between capital controls and surrendering domestic monetary autonomy. It is in this choice, where politics, both domestic and international, factor in.
The global economic downturn of 2008-2009 was mostly a financial affair. Consequently, governments across the globe remain wary of allowing “global financial markets” to hold any significant influence in their economies. Additionally, the financial crises that provoked the economic downturn emerged in developed nations, particularly in the United States. Therefore, governments in emerging economies will be looking to reaffirm their economic autonomy, as they seek to distance themselves from the ‘global west’. Surrendering domestic monetary autonomy, predictably, is not in that playbook.
Another factor to take into consideration is the policy planning of governments in emerging economies. Many of these governments lean towards the left, and their constituents expect more government investments into the economy to go along with their exceptional economic growth. In order to deliver these policy goals which require large investments in defense, infrastructure, and welfare expenditures, governments will need to rely on a stable and dependable pattern in the formulation of monetary policy. So, governments with left-oriented policy goals, would be expected to choose to establish capital controls, rather than surrendering their monetary policy autonomy. Among emerging economies, two exceptions can be found to this trend: South Korea and Chile. The governments in these economies are center-right oriented, and are expected to be a bit less enthusiastic about government investment in the economy. In South Korea, however, the shadow of the Asian debt/currency crisis of the 1990s is still powerful enough to override concerns of government involvement in the economy, and prompt the government to establish capital controls to avoid a repeat of the Asian crisis. In Chile, the prospects for restrictions on foreign capital flows seem far less likely, and its steady economic progress along with recent admission into the OECD makes this country an underrated prospect for foreign investors.
The final piece in this international finance puzzle is China. Investors should not worry about capital controls in China, they are already in place, and there is no sign of any breakthrough in investment liberalization yet. The way China exerts influence in this scenario is through exchange rates. China’s undervalued currency is forcing other emerging economies to maintain their exchange rates lower than they really need to be in order to remain competitive in export markets. Therefore, the level to which emerging economies can afford to raise their interest rates is much lower than it needs to be. As global financial markets exert inflationary pressures on the value of the currencies of emerging markets, along with a decrease in the value of the dollar (which exerts inflationary pressures for all monetary systems, floating and fixed), restrictions on foreign capital flows may have to be resorted to sooner than many economic factors indicate. In fact, Brazil already established a 2% tax on foreign capital flows. On the other hand the Brazilian Central Bank announced in January 2011 that it would raise interest rates by 50 basis points in order to combat rising inflation. These developments reflect that the choice between capital controls and domestic monetary autonomy for Brazil is still not clear.
Hence, as almost everything else in international economics, the establishment of capital controls is far from certain. After all, governments in emerging economies still pay close attention to their reputation in global financial markets, especially in those economies that depend highly on foreign capital flows to finance their development. Nonetheless, all the factors to take into consideration for governments to make their choice in the context of the impossible trinity have been laid out. So we already know what governments are looking at when they make their respective policy moves. The extent to which or even if governments establish restriction on foreign capital flows in emerging markets will serve as a reliable indicator of how much these governments value foreign capital, global financial markets, and monetary policy instruments. Therefore, by closely following developments in the establishment or non-establishment of restrictions on foreign capital, investors should be able to expect what development paths these emerging economies will take for the future.
|
0.999999 |
Leica Cyrax ScanStation HDS 3000 sale, in excellent condition and comes with all the accessories. This Leica Cyrax ScanStation HDS 3000 is in great physical shape, like-new condition. It was pulled from a working environment and unit has been checked, tested and calibrated by authorized Leica authorized.
The full-field-of-view Leica HDS3000, the first "surveyor-friendly" 3D laser scanner, makes high-definition field data capture easy and efficient for a wide range of surveying and engineering projects. Leica HDS3000 can even be upgraded to Leica ScanStation functionality.
With the Leica HDS3000, high-definition surveying has never been easier and friendlier for surveyors and measurement professionals. For example, it supports standard surveying procedures, such as instrument setup over a known or assumed survey point, height-of-instrument measurement, and instrument orientation. These same features are also valuable for automated geo-referencing of captured data to local coordinate systems. The new QuickScan mode allows users to quickly and easily define the extents of the scanning scene by simply pushing a button on the scanner. Efficient battery swapping and improved weight/portability allows for even more flexible and friendlier field operations.
Just as significant as its ease-of-use, the HDS3000 takes the industry-leading accuracy (6mm at 50m) and versatility of its popular predecessor, the Cyrax® 2500, to the next level of productivity. It combines SmartScan Technology with a maximum 360° horizontal field-of-view and an equally impressive maximum 270° vertical FOV. In a nutshell, the Leica HDS3000 is a versatile, multi-purpose scanner that combines high efficiency with high accuracy for a broad range of civil engineering, plant and building projects.
|
0.96661 |
We take a pride in the quality of our work and it feels great when our customers recognise our efforts and let us know through letter, text, email and cards etc.
Please find below extracts from some of those acknowledgments.
" . . . the quality of workmanship and attention to detail is first class. Your professionalism, courtesy and tidiness cannot be beaten. I would recommend you to anyone for your services."
"Thank you for getting my garden back. I am delighted with the result. It has been a pleasure having you and the boys here."
"This is just to say how pleased we are with the work you did for us both this year and last, and how much we appreciate the caring way in which you do it."
"I would just like to say thank you for the transformation of my front garden. I am more than delighted with the result. My family, friends and neighbours have all said what a great job you made of it."
"I would also like to thank you for your efficient and timely service, despite difficult weather conditions, which is very much appreciated."
"The fence looks absolutely fantastic and we are really pleased with it. Thank you for doing the fence before the end of January - I know you had to rearrange other people to do this, I am very grateful."
"I am particularly grateful for the way you held off from the works, when you discovered how high the water table was last Autumn. I'm sure others might have been tempted to go ahead anyway, knowing that the settings for the posts wouldn't be as firm. But you insisted on waiting until the ground was less waterlogged, and used longer posts and a rubble foundation to ensure that everything was as solid as possible. It's a quality piece of work."
"We were so impressed with your commitment, speed and the cleanliness of your work, considering we had such wintry conditions. It was so nice to have two reliable, trustworthy and friendly hard workers that we felt at ease with, and we were confident to leave to your own devices. We really appreciated how much care and attention you gave us."
Louise and Tom, Marston, Oxford.
|
0.999999 |
Applicant sought a variance from the Philadelphia Department of Licenses and Inspections (L&I) to construct an open-air parking space for one car in the front yard of his lot (Property). L&I denied the request, stating the City’s Zoning Code (Code) prohibited accessory surface parking spaces in front yards. Applicant requested a variance from the Philadelphia Zoning Board of Adjustment (ZBA). The ZBA granted the variance and Objectors appealed to the trial court, which affirmed the decision of the ZBA. Objectors then appealed to the Commonwealth Court.
The Commonwealth Court found Applicant failed to prove that strict compliance with the Code would create an unnecessary hardship due to unique physical circumstances or conditions of the Property. Rather, Applicant’s hardship arose from the impact of zoning regulations in the district. Under the Code, surface parking spaces were not permitted, except that surface parking in the rear of a property was permitted if the lot is served by an alley or shared driveway in the rear of the property. The Property had no shared driveway in the rear, nor was there an alley connected to the Property. Accordingly, the Property did not meet the exception in the Code, so Applicant was not permitted to park on the Property. In other words, Applicant had no right to park on the Property in the first place, since parking in the rear was permitted only as an exception to the prohibition. Since the hardship (not being allowed to park on the Property) was created by the Code, not unique physical circumstances or conditions of the Property, the variance was granted in error.
|
0.981827 |
Help Pantene explain to women that truly beautiful hair coloration comes from healthy hair.
Create an attractive poster for Pantene that intuitively shows that beautiful & vivacious hair color can only come from healthy hair.
1 page poster and 1 page text description.
Dear contestants, thanks a lot for your attention to Pantene competition! We appreciate the breadth, diversity and originality of ideas shared - a great inspiration for us, THANK YOU.
Catchy idea behind, which makes one to stop, think and creates an 'aha' moment.
I am flattered and very happy about Pantene selecting my entry among winners. I wish to thank eYeka for giving me an opportunity to work for such a great brand.
Simple and visual way to deliver complex message - very intuitive and clear from the first sight.
|
0.999947 |
Although originally invented by a Canadian, basketball is widely enjoyed throughout the U.S., and college basketball is followed by many. The first men's college basketball game was played in January of 1896, and the first NCAA College Basketball Division I Tournament was played in 1939. Today, the final tournament for Division I teams, known as March Madness, is avidly followed by many sports fans.
Do you have dreams of playing basketball in college? There are many college basketball teams and athletic scholarships available, however, there are even more students competing for those spots. Recruiting begins early, and student athletes should research their options to determine what they are looking for in a college. Playing Division I basketball is the dream of many students, but competition can be very high, and the time commitment for the sport can be considerable. Playing DII or DIII basketball can be just as rewarding and challenging, and may provide more opportunities for students to focus on academics and other interests.
Have you chosen the major that best aligns with your natural strengths and interests?
|
0.986893 |
The school was founded in 1948 by the late Kopul Rosen. In June 1997, the school was closed. The distinctive concrete synagogue, dining hall, and amphitheatre, designed by local architect Thomas Hancock, are Grade II listed buildings; the Julius Gottlieb gallery and boathouse, designed by Sir Basil Spence, is Grade II listed.
The Mansion House was an old manor house with particular significance. Agatha Christie (who lived nearby in Wallingford) used it as the basis for the mansion in her 1952 play The Mousetrap.
The Headmaster's study was also the room used for the final briefing of the reconnaissance mission following the Dam Busters raid. The first reconnaissance aircraft over the target was a Spitfire PR IX from 542 Squadron, flown by Flying Officer Jerry Fray. He had left nearby RAF Benson at 07:30hrs to ensure that he could be at the Dams in good light. Two other sorties were flown over the Dams that day. The resulting photographs were the first to be published in the press. Up until then all reconnaissance tasking had been carried out under the strictest secrecy.
The 2011 film, 'The Iron Lady' featured a scene where Margaret Thatcher is perfecting her prime-ministerial voice, which was shot on location within the Synagogue of Carmel College.
It was attended by children from the age of 11 until 18 - although earlier on there was a preparatory school which took children from around the age of 8. Later a girls' school was built - about a mile from the main campus, although the buildings were never actually used for this purpose. Instead, it was turned into a junior school in the late 1960s for children up to the age of 13, when they then moved to the main school.
Girls were later admitted into the main school, starting at the sixth form in the early 1970s. However there were daughters of teachers at the school even before this, including the youngest daughter of Carmel's founder Rabbi Kopul Rosen, who was a pupil in the late 1960s. The Junior school was closed down several years before Carmel closed, and the buildings sold.
- Mansion House - 1st, 2nd, 3rd year male.
- Ridgeway House - 4th & 5th year male.
- Mongewell House - 4th - U6th male.
- School House & Sherman House - L6 & U6 male.
- Newnham House - 1st, 2nd, 3rd, 4th & 5th year female.
- River Court - L6 & U6 female.
House, Alexander House, Raleigh House and others.
|
0.99999 |
Tag parking garage as building?
I haven't found clear guidance on this yet, but would like to know if there's a best practice here.
For multi-level parking, the presets are usually amenity=parking, parking=multi-storey.
For multi-level concrete structure dedicated solely to car parking, should it also have building=yes? That way, it would show up on OSM Mapnik as a building, not just a yellow area, and would it would make sense to have building:levels and such. But none of the presets I've seen include a checkbox for building and some map styles may assume that amenity=parking and building=yes are mutually exclusive.
Short answer: yes, tag it as amenity=parking, parking=multi-storey, and building=*.
There is a car park near here which is partly ground level open parking, and partly multi-storey - I added building=carpark in this example, though it has the same effect as building=yes in most use cases that I am aware of.
I believe building=parking might be a better tag here. According to taginfo, it is used on 689 features, compared to 10 for building=carpark.
|
0.955637 |
After the long wait since The Force Awakens was released, us Star Wars nerds were incredibly anxious to finally see Episode VIII of the incredible saga that has captivated us since the late 70’s. I couldn’t have been more excited as I took my seat in the movie theatre, and I could barely contain myself as the iconic scrolling intro text filled us in on the story about to unfold in front of me. 2 hours and 30 minutes later, I left the theatre astonished at myself being so torn with my opinion of this film, so let me explain why.
The first aspect of the movie I did not like was the underlying plot to the entire story. The entire film is essentially one long spaceship chase between the Empire and the Rebel fleet as they retreat from battle. After the years of writing the script and being in development, this was the best the writers could come up with? It felt as if the movie had no cohesive movement in the story, and seemed drawn out to the point that you no longer had that emotional connection with the plight of the Rebels. Despite this, there were some scenes that shined amidst the chaos, which gave the viewer a glimpse of unique new worlds in the Star Wars universe, and also introduced a few new characters that I feel like will be coming back in Episode IX.
Throughout the movie, fan favorite characters like Chewbacca, R2-D2, and C3PO are given enough screen time to still consider them relevant to the story yet to unfold. However, it is disappointing to see how Luke’s character has taken such a drastic turn from his development in previous movies. While some herald it as ushering in a new era of Star Wars characters, I feel as if director Rian Johnson went about it in a way that destroyed the essence of what Luke Skywalker entailed. Despite this, several new characters were introduced that certainly interesting and definitely likable. This included Rose Tico, a Rebel maintenance worker, Admiral Holdo, a Rebel fighter, and DJ, a mysterious code-breaker.
Some of the more recognizable characters in the film are continued to be played beautifully by their respective actors. At the start of the film, we continue with Rey finally meeting Luke, only for him to not want anything to do with her. From there, she finds herself trapped on the island, waiting for Luke to finally come around to helping the Rebels. This entire part of the film seemed to drag on for an unnecessary amount of time. The scenes in which she trains with Luke are the highlights of her time there, though the humor present is enough to keep you from becoming bored. Meanwhile, Finn and Poe are continuing their fight against the Empire, and both play a pivotal role in getting out alive. However, I felt as if their development was a bit 2-dimensional, with hopes for it tying all together in the climax falling flat. Kylo Wren seemed to fully grow into his role as a centerpiece villain in this new trilogy, and going into the next film, it will be exciting to see where his character will go.
In line with being a Disney film, the movie is filled with humor. This adds a lighthearted aspect to the film, and certainly drew many laughs from the audience, but some of it errs on the side of being too corny and childish. I understand that this movie is made for kids and adults alike, but some the humor in some parts was too overpowering, and drowned out an otherwise emotionally impactful scene. It is certainly a departure from the contrasting dark themes present in Rogue One throughout the film.
Some minor aspects I also found to be irritating is the fact that the mystery behind the identity of Rey’s parents as well as Supreme Leader Snoke turned out to in inconsequential to the story. If the build-up to the answer of the questions weren’t as significant as they were in The Force Awakens, I wouldn’t be angry, yet here we are.
Let me get this straight: The Last Jedi was not a bad film, but it was particularly a great one either. With a film franchise as iconic as Star Wars, the bar is set to the highest of standards, and I think it was missed. Either way, it’s still an enjoyable film, and it sets precedent for Episode IX to be tied in a variety of potential ways.
|
0.999942 |
There have been various methods over the course of the years of trying to understand the reason behind consumers’ actions. With the most popular one being behavioral analysis, which focuses on the previous actions of consumers like their purchasing behavior or online activities. Although this process gives an indication towards consumer tendencies, are decisions just based on past behaviors? The answer is no, your decisions are based on who you are.
|
0.960736 |
May one love a non-Jew? Not romantically in the sense of marriage, but rather in the sense that one loves a friend or family. May a Jew love his Gentile father, for example? May a baal teshuvah continue to love his non-Jewish friends?
I realize the question sounds a bit ridiculous, but it is sources like those cited here that lead me to seek a clear answer.
A tzadik also loves Hashem and every person in the whole world, as is said about Rabbi Yochanan that he would great every person in the market with Shalom..even non Jews.
Undoubtedly the quote from Rav Chayim Vital that Hacham Gabriel brought factored directly or indirectly into the the No'am Elimelech's presentation: "ויאהב את כל הבריות אפילו גויים"..."and he loves every living being, even a non-Jew." which is listed as the opposite of the trait of hatred which he says prevents one from cleaving to G-d.
So while there are very real concept of hating the wicked, which can apply to a Jew or a non-Jew in theory and may not be entirely mutually exclusive with an obligation to love, it is very clear that one is playing with fire since hatred is such negative middah (character trait).
With that in mind it is necessary to recall the words of the Holy Divrei Chaim of Sanz, "First although the poskim have made clear to us that the prohibition against following in the ways of the gentiles, the intention is not, G-d forbid, to belittle the honor of the other nations; for, on the contrary, we are strictly enjoined to honor the nations, both the rulers and the general populace. Even concerning the nation whose yoke rested the most heavily on our necks--that is, the Egyptionas, who imposed a crule servitde upon us -- nevertheless, after the Creator, Blessed be He, took us from there, and we were at the height of exaltation, without fear of any human being, He commanded us, blessed be His name Do not abominate and Egyptian (לא תתעב מצרי; Deuteronomy 23:8), and instructed us not to belittle their honor because in spite of all, we did derive benefit from thir country. All the more so, then, are we obligated to show honor to those countries in the shad of whose protection we rest, and where Hashem, Blessed be He, has caused us to find favor in their eyes, so that they have eased their yoke upon us....." (Divrei Chaim YD 178a, translated in The Sanzer Rav and His Dynasty, Artscroll).
Rabbi Haim Vital (Sefer Shaare Kedusha 1:5) writes that one should love gentiles.
Let's be very clear here. All human beings are created "Btzelem Elokim". Every human being must be loved, just as Gd must be loved. As it says "Veyahavta"
The gemora states clearly that the Torah begins with the story of Adam, so that no person may say to another person that they have better ancestors.
Several of these quotes discuss loving non-Jews.
6) an extended quote from Rav Kook about how we should love all creatures and all humanity.
7) a quote from Ramak's Tomer Devorah, ch. 3, about how we should help and pray for and have compassion on all creatures.
One must love everyone, even non-Jews but at the same time one MUST hate evil - but just not the evildoers, otherwise one will become corrupted.
The Mishnah in Avot Chapter 1 Mishna 12 says: "Hillel said: Be of the students of Aharon, love peace (shalom), pursue peace, love people, and bring them close to Torah.
Masechet Avot is the repository of Torah ethics as passed on from Hashem to Moshe to the Jewish people, as explained by the commentators on the first Mishnah of Avot.
"Love your neighbor's well-being as if it were your own; I am God," is the summarizing final maxim for the whole of our social behavior, in feelings, word, and deed. Hillel’s interpretation of this as: “That which is hateful to you don’t do to someone else” imposes complete equality of all as the guiding principle of all of our deeds, makes everyone take to heart the weal and woe of everybody else, changes selfishness…into consideration and love of one’s neighbor. The concept of “your neighbor” extends the ideas beyond the narrow confines of your fellow men to the idea of fellow creatures, so that in fact this sentence does contain the contents of the whole Torah, which indeed is nothing else, but the teaching of avoiding everything which is contrary and hateful to the happiness and well-being of ourselves and to that of the fellow creatures who enjoy existence down here in this world.
Though the founder of Christianity quotes ‘Thou shalt love thy neighbour as thyself’ as the old Biblical command of recognized central importance, many Christian theologians maintain that the Heb. Word for ‘neighbor’ (rea) in this verse refers only to the fellow-Israelite. Its morality therefore is only tribal. But the translation of the Heb. Word rea by ‘fellow-Israelite’ is incorrect. One need not be a Hebrew scholar to convince oneself of the fact that rea means neighbour of whatever race or creed. Thus in Exodus XI, 2 – ‘Let them ask every man of his neighbour, and every woman of her neighbour, jewels of silver, etc.’ – the Heb. Word for neighbour cannot possibly mean ‘fellow-Israelite’, but distinctly refers to the Egyptians. As in all the moral precepts of Scripture, the word neighbour in Lev. XIX, 18, is equivalent to ‘fellow-man’, and it includes in its range every human being by virture of his humanity.
"The Golden Rule In Judaism - The world at large is unaware of the fact that this comprehensive maxim of morality - the golden rule of human conduct - was first taught by Judaism... "In the generation after the destruction of the temple, rabbi Akiba declares ' "Thou shalt love thy neighbour as thyself" is a fundamental rule in the Torah.' His contemporary, Ben Azzai agrees that this law of love is such a fundamental rule, provided it is read in conjunction with Gen. V, 1 ('This is the book of the generations of man. In the day that God created man, in the likeness of God made He him'); for this latter verse teaches reverence for the divine image in man, and proclaims the vital truth of the unity of mankind, and the consequent doctrine of the brotherhood of man. All men are created in the Divine image, says Ben Azzai; and, therefore, all are our fellowmen and entitled to human love."
of course you should. there is never too much love in the world. if being involved with mitzvas and learning Torah doesn't produce caring about others and being kind then something is severely wrong. One thing to take into consideration as a baal teshuvah is who are friends were before becoming involved with Judaism and their influence on us now. While you should never be mean to them your interaction with them will be different. kosher food, shabbos, not being involved with the same activities as before, respectfully as declining invitations to events within churches and other foreign religious places of worship. There also may be friends previously had who would be best to distance yourself from if they happen to be involved in negative behavior or will have a negative impact on your growth as a spiritualy connected person. One must always honor their parents but of course doesn't require one to fulfill their wishes if doing so is contrary to Jewish law. Love for another doesn't mean giving up one's own identity but finding common ground on which to communicate. So yes one should love others but understand who I am and how I must must conduct myself within Jewish law.
Not the answer you're looking for? Browse other questions tagged hashkafah-philosophy gentiles ahavat-yisrael .
|
0.999245 |
A federal weather official warns "we are ... entering the peak of tornado season"
More tornadoes are possible Tuesday in Joplin and other cities in the central U.S.
On CNN tonight at 9 ET, Piers Morgan has more on the recovery effort. At 10 ET on "AC360º," Anderson Cooper reports live from Joplin and has firsthand accounts of surviving the tornado.
Read more about this story from CNN affiliates KOTV, KSHB and KODE. Share your stories, photos and video with iReport.
Joplin, Missouri (CNN) -- The toll from the tornado that ripped through Joplin soared to 116 on Monday, a city official said, tying it for the single deadliest twister to ever hit American soil since the National Weather Service began keeping records 61 years ago.
By Monday night, they'd found 17 people alive -- a stark contrast to the fact that the number of fatalities is unmatched since a tornado struck Flint, Michigan, on June 8, 1953.
"We're going to cover every foot of this town," Missouri Gov. Jay Nixon said from the National Guard Armory in Joplin. "We are ... optimistic that there are still lives to be saved. But (first responders) have seen a tremendous amount of pain already."
The Sunday-evening tornado chewed through a densely populated area of the city, causing hundreds of injuries as it tore apart homes and businesses, ripped into a high school and caused severe damage to one of the two hospitals in the city. Based on preliminary estimates, the twister ranked as an EF-4 with winds between 190 and 198 mph, National Weather Service director Jack Hayes said.
"Everybody's going to know people who are dead," said CNN iReporter Zach Tusinger, who said his aunt and uncle died in the tornado. "You could have probably dropped a nuclear bomb on the town and I don't think it would have done near as much damage as it did."
The nightmare may not be over for Joplin or other parts of the United States, with the weather service warning about more potential disaster on Tuesday.
The National Weather Service warned there was a 45% chance of another tornado outbreak -- with the peak time between 4 p.m. and midnight Tuesday -- over a wide swath, including parts of Texas, Oklahoma, Arkansas, Missouri and Nebraska. The Storm Prediction Center placed several large cities in the most high-risk area, along with other cities including Kansas City, Missouri; Dallas; Topeka and Wichita, Kansas; and Oklahoma City and Tulsa, Oklahoma.
Joplin is among them. Already, parts of the city of 50,500 were unrecognizable, according to Steve Polley, a storm chaser from Kansas City, Missouri, who described the damage as "complete devastation." Aerial footage from CNN affiliate KOTV showed houses reduced to lumber and smashed cars sitting atop heaps of wood. Other areas appeared to be nearly scoured clean.
Damage to the city's infrastructure was severe. Numerous phone lines and cell phone towers were down, making it hard to communicate, state officials said. Empire District Electric Co. reported on its website that 14,000 customers were still without power Monday evening. Missouri American Water Co. asked customers to conserve water and boil what they do use.
More than 1,000 law enforcement officers from four states were in Joplin aiding with disaster response, including search and rescue, said Collin Stosberg, a spokesman for the Missouri State Highway Patrol. More than 250 National Guard members were on the scene -- including specialized search-and-rescue teams, military police and engineers -- with another 450 on standby, said Maj. Gen. Steven Danner.
The federal government is also involved, with Nixon saying he'd talked with President Barack Obama and Homeland Security Secretary Janet Napolitano on Monday to help coordinate this effort. The second-ranking official at the Federal Emergency Management Agency, Richard Serino, noted Monday that Obama had already issued a disaster declaration -- expediting the dispersal of federal resources to the area -- while vowing that "we are going to be here for the long haul."
In the short term, though, the focus is on finding survivors. But the work was slowed by a new round of severe weather -- including thunderstorms and hail two inches in diameter -- that rolled through the city Monday, as well as widespread problems with broken natural gas lines and other safety issues, authorities said.
The tornado touched down at 5:41 p.m. Sunday -- 24 minutes after a warning was issued -- said Thomas Schwein, central regional director for the National Weather Service. It grew to as wide as three-quarters of a mile at one point along its estimated four-mile track, according to Missouri's State Emergency Management Agency.
"It was hard to discern where you were at," resident Eddie Atwood said of going through downtown soon after the twister hit. "All you could see is devastation. It was more like walking through 'The Twilight Zone' than walking down Main Street."
St. John's Regional Medical Center sustained significant damage after being hit directly, according to a statement from Lynn Britton, president of Sisters of Mercy Health System, which operates the hospital.
One glass facade of the building was blown out, and authorities evacuated the medical center, said Ray Foreman, a meteorologist with CNN affiliate KODE in Joplin. Makeshift triage centers were set up in tents outside, witness Bethany Scutti said. Structural engineers were on their way to Joplin to assess the hospital building, where 1,700 people work.
The hospital was treating 183 people when the storm struck, Britton said. It was unclear if any were injured in the storm. The patients were taken to hospitals as far away as Springfield, Missouri, and northwest Arkansas.
Residents 70 miles away from Joplin in Dade County, Missouri, found X-rays from St. John's in their driveways, said Foreman, indicating the size and power of the storm. Gurneys were blown several blocks away.
Officials evacuated long-term patients from the city's other medical center, Freeman Health System, to make room for emergency cases from the tornado, Nixon said.
That hospital treated 465 patients, including 11 who died, the hospital said in a statement. A Freeman Health System hospital in nearby Neosho, Missouri, treated 39 people, the hospital said.
Medical staff at Via Cristi Hospital in Pittsburg, Kansas -- about 20 minutes from Joplin -- had treated 80 patients and admitted 35 people into the hospital, spokesman Michael Hayslip said. Most of the patients came "in extremely fast in groups" Sunday night, suffering everything from minor cuts to broken bones, he said.
A nursing home was believed destroyed, among other structures, the State Emergency Management Agency reported.
Walmart spokesman Lorenzo Lopez said the tornado "blew through" one of its stores, killing and injuring an unspecified number of people -- none of them Walmart employees. He added that the Arkansas-based company has pledged $1 million to help with relief efforts in Joplin.
The city's public school district canceled classes for the rest of the year after the tornado caused significant damage to several buildings.
Joplin High School, whose seniors had just finished graduation ceremonies at a nearby university when the storm struck, was ripped apart, Principal Kerry Sachetta said.
"It just looks like it's been bombed from the outside in," he said. "It's just terrible."
St. Mary's Catholic Church and its elementary school also were demolished, said Recy Moore, a spokeswoman for the Springfield Diocese, which includes Joplin. The pastor, the Rev. Justin Monahan, rode out the storm in a bathtub at the rectory.
"Parishioners had to dig him out, but he's OK," she said.
C.J. Campbell and his foster sister survived the storm, despite the home they were in collapsing around them. Campbell called the tornado an "evil monster vortex" that began as a low roar, then got louder until it sounded like "50 semi-tractor-trailer trucks fully laden going about 70 miles per hour about 10 feet outside the front door."
"The floor began to vibrate and then shake very violently and seemingly buckle, and we thought we were going to be sucked up the chimney," he said.
The storm also overturned as many as a dozen tractor-trailers on Interstate 44 as it barreled through Joplin, a major trucking center. The interstate, shut down for nearly 12 hours, reopened Monday morning, according to Mike Watson with the Missouri State Highway Patrol. No motorists were severely hurt, he said.
Amber Gonzales was driving through southwest Missouri when she heard tornado warnings on the radio. She took refuge at a gas station before getting back on the road and seeing the aftermath of what she narrowly missed.
At a shopping center, she saw people pulling victims from rubble and rushing them to the hospital as overwhelmed emergency workers were unable to reach everyone in need.
"I saw an older woman taken on the back of a truck bed, speeding down the road," Gonzales said. "I can't get the lady out of my mind. ... I don't know if she made it."
Sunday's tornado was part of a line of severe weather that swept across the Midwest on Sunday, prompting tornado watches and warnings that stretched from Wisconsin to Texas. High winds and possible tornadoes struck Minneapolis and other parts of Minnesota, leaving at least one person dead and injuring nearly two dozen others, police said.
Elsewhere, reports of tornadoes came in from Forest Lake, north of the Minneapolis-St. Paul area, and near Harmony, more than 120 miles to the south. In Minneapolis, witnesses reported numerous downed trees and neighborhoods without power.
Minneapolis police spokeswoman Sara Dietrich said the storm left one fatality, with 22 people reported hurt.
LeDale Davis, who lives on the north side of Minneapolis, told CNN, "This is the first time we can remember a tornado touched down in this area. They aren't usually in the heart of the city."
Forecasters said the system that struck Minnesota was separate from another storm that struck eastern Kansas on Saturday, killing one person and damaging or destroying hundreds of homes there.
Hayes said that 2011 is already at least the ninth deadliest season on record. That includes the tornado that hit Hackleburg and Phil Campbell, Alabama, and killed 78 people, while the one that struck Tuscaloosa and Birmingham killed 61. Those two events rank sixth and seventh respectively for tornado-related deaths in the National Weather Service's official records. The records date to 1950, when the weather service came to a consensus on how to track tornadoes and count casualties.
Unofficial records cite the 1925 Tri-State tornado in Missouri, Illinois and Indiana as the deadliest single twister ever, with an estimated 695 fatalities, according to the weather service. But meteorologists note that it isn't known if those fatalities came from one or more tornadoes, as compared with the single twister that has been confirmed in Joplin.
While the strength and toll of this year's more than 1,000 twisters may suggest an alarming trend, weather service officials said they will need time and research to put it all into perspective. And one warned that the destruction likely isn't over.
"We have to be aware that we are now just entering the peak of tornado season," said Russell Schneider, head of the Storm Prediction Center. "You can never completely breathe easy."
CNN's Chuck Johnston, Joe Sutton, Greg Botelho, Marleena Baldacci, Mike Pearson, Greg Morrison, Holly Yan, Rick Martin, Jessica Jordan, Sean Morris, Divina Mims and Steve Brusk contributed to this report.
|
0.996432 |
If artificial sugar is so splendid, why aren't we thin?
The scene could have passed for a paid advertisement: a barista at a New York City coffee bar informed a customer that the café had run out of Splenda, the sugar substitute in the bright yellow packets. To the customer, it was tantamount to betrayal. "Are you very sure?" he asked, offering to settle for Equal or Sweet'n Low. But all that was left was sugar. The man shook his head (sugar!), pushed his cup back across the counter and demanded a refund.
|
0.99737 |
Step by step instructions on how to check an automotive fuel pump and pressure regulator, this article pertains to most fuel injected vehicles.
Step 2 - Once the inspection for the fuel pressure regulator is complete reinstall the vacuum line.
Step 3 - Locate and remove the protective cap which will allow the fuel pressure gauge hose to be attached.
Step 4 - Next, remove the fuel pressure test gauge from its packaging. The gauge shown is a professional gauge kit, but any attachable fuel pressure gauge will work.
Step 5 - After fitting the gauge with the appropriate adapter attach the gauge line to the fuel test port. If no test port is provided, a fuel filter adapter is needed, this adapter is connected to, or takes the place of the fuel filter.
Step 6 - Once the fuel gauge had been attached, turn the ignition key to the "ON" position. The gauge should jump up to between 45 psi and 58 psi for most (DPI) direct port inject systems, throttle body injection (TBI) are between 13 and 17 psi. This means the pump is working along with the electrical portion of the system. If no fuel pressure is present, check the fuel pump relay and fuse in the PDC (power distribution center.) If there is still no fuel pump operation access the fuel pump power feed wire, there are a few ways to do this, a wiring schematic will call out the color wire used to energize the fuel pump. to find the color wire needed for testing, the best way to do this is with a service manual. Once you have found the color wire it should be located in the wiring harness near the fuel tank were the pump is located. Ground the test light and probe (pierce the wire's outer coating with the test light point) the wire, have a helper crank the engine over. If the test light illuminates and still no pressure the fuel pump had failed, if the test light doesn't illuminate the fuel pump control relay or wiring circuit has shorted.
Step 7 - While the engine is running, the fuel pressure should drop about 5 psi, to 52 psi., also try snapping the throttle, the fuel system pressure should jump up about 5 psi., this means the fuel pressure regulator is working properly. If the system fuel pressure does not respond inspect the vacuum feed line, if okay, the fuel pressure regulator has failed.
Step 9 - If the fuel pressure is low under load or while idling the fuel filter could be clogged, or the fuel pump has failed.
Step 10 - After the test is complete install a shop towel at the base of the test port which will be used to gather excess fuel from the gauge hose.
Step 11 - While using the shop towel to gather excess fuel, loosen the pressure hose, fuel will begin to leak out.
Step 12 - Once the hose has been removed, fuel will continue to leak out, move the hose end onto a shop towel to collect excess fuel.
Step 13 - After the gauge hose has been removed, install the fitting dust cap.
Step 14 - Using a clean shop towel wipe the area free of fuel.
One testing is complete, inspect the area for fuel leaks.
Some vehicles are not designed with a fuel pressure test port, in which case a fuel filter adapter must be used for the gauge connection.
A fuel pressure regulator is controlled by a diaphragm and spring combination in conjunction with intake manifold vacuum. When a fuel pressure regulator diaphragm ruptures, it allows raw fuel to enter the vacuum feed line and into the engine. This condition creates a rich black smoke from the tail pipe on start up and while running. Remove the vacuum line from the regulator, if fuel is present, the regulator has failed.
Some GM (CPI Injection) are designed with an internal regulator in which the intake manifold must be removed to access.
Most fuel pressure regulators are on the top of the fuel rail. If you cannot locate the fuel pressure regulator consult a repair manual.
Replace fuel pump and pressure regulator with quality replacement parts or premature failure could occur.
|
0.960934 |
Is it safe to travel to Miami Beach shortly after hurricane Irma?
Two months ago my girl and I booked our vacation. We are from Berlin, Germany and wanted to see the U.S. Our first stop is Miami Beach at the 15th and we want to stay there for 3 days and continue to NYC. Later on we will go to Vegas and come back to Miami the 26th of September and stay there another 4 nights.
I expect the hurricane will be gone by the 15th, but I have no idea whether it will be okay. For me okay means that we can reach our hotel and sleep there.
What do you suggest? I know this question is primarily opinion based, but here in Germany we don't have hurricanes and I don't know how fast the state will recover.
Will it be safe? Yes. The hurricane will be long gone so there will be no danger. Will it be recovered by then? No, it won't. Not fully. the destruction caused will take months and years to rebuild. It took new Orleans a full year after Katrina before they started promoting tourism again. Miami is both a county and a city so the amount of destruction depends on which you're referring to. You can visit key Biscayne and some of the beaches which don't have as many structures but most of Miami will likely still be a mess. However, the airlines and hotels will surely be glad to take your money, just don't expect to see the same Miami you see in pictures and on the internet.
Miami Airport experienced "significant water damage" in the storm. It will be closed on Monday the 11th, and they'll determine tomorrow whether they're able to resume flights on the 12th or whether further repairs are necessary. Each airline will decide when to operate once the airport reopens.
Miami Beach was evacuated and will not allow people back in until Tuesday the 12th at noon (and then, only residents with ID) and some areas are flooded today. 75% of Miami-Dade County has no electricity right now, and the county is under a curfew. It is likely that your hotel doesn't know whether they can operate or whether they have power and won't know until after the roads reopen and staff can reach the hotel.
There's likely to be a lot more clarity by Wednesday, after they've started to clear the roads, people have had a chance to get back into Miami Beach, electrical crews have begun repairs, and the extent of the damage is surveyed. The city does "foresee" being open to visitors by Thursday, but you'll want to keep an eye on their communications and the Miami Herald newspaper for updates. That said, to me, Friday seems quite early to visit Miami Beach.
Personally, I'd change my trip to start someplace else in the US besides Florida on the 15th, keep an eye on the news, and go enjoy Miami starting on the 26th, assuming that things are sufficiently open then to have a good time.
We are also providing rebook options for customers booked to fly with us to/from Miami, Fort Lauderdale, Tampa, or Orlando between now and 17 September inclusive. They can choose to fly to the same destination as originally booked up to and including 14 October. Customers can also use the value of their ticket towards an alternative destination on our network if they no longer wish to travel to/from Florida.
If you have not yet rebooked, call BA and ask for the cost of your existing flight to be applied towards your new one. If you have already rebooked without availing yourself of this, you have a 24 free cancellation period in order which could allow you to cancel and then rebook.
As mentioned, Irma will be gone, but the destructions caused by it will be visible for sure at that time.
Change your flight, if able.
A friend changes his flight from Athens to Miami, with only 100 euros extra charge, because he was afraid that he would be trapped to Constantinopole (transit airport for the flight). After two days the price for a date change went to 1200 euros.
I do not live in Miami, however I planned a trip for next month. First I would call the hotel to ensure it will be open and available for use.
But it also depends on the area in which you are traveling to, as Florida Keys received one of the biggest hits. I am following hashtags of Miami and Miami beach area and business owners and residents have returned as of September 12 2017.
A lot of the pictures and videos show trees that have fallen, however it appears as if the damage is being repaired for this, nothing showed major flooding and business are returning back to normal. As long as your hotel is up in running I think you will be fine, as the beach looks beautiful on the pictures.
Don't let the comments about Jose scare you, as the tropical storm is headed north east and is not headed in the direction of Miami.
Not the answer you're looking for? Browse other questions tagged safety weather-and-climate event-based-effects miami or ask your own question.
Does it make sense to have a trip to Florida?
Is it safer to travel to Miami after Irma at the end of September?
Canceled my flight to Miami and go to a different location in the U.S. does my ESTA work?
Is it safe to travel to Egypt in early 2012?
Is it safe to travel to Iraqi Kurdistan?
Is it safe to fly from Miami to Puerto Rico due to the Bermuda Triangle?
Does it make sense to come to Miami at the beginning of October?
Safe to travel to Miami, FL on Sep. 30- Oct. 4?
|
0.991809 |
What are the swim-up river suites at Sandals Negril and Sandals Royal Caribbean in Jamaica?
The 25 river suites in the Sundowner Block at Sandals Negril have two categories: the Ocean's Edge one-bedroom river suite with private river entrance and the Penthouse Ocean's Edge one-bedroom river suite.
At Sandals Royal Caribbean, ten St. James River Suites opened in the St. James Block. In both Jamaica resorts, the ground floors of the swim-up river suites have private patios surrounded by lush Caribbean vegetation that opens onto Sandals' lazy river.
At Sandals Negril, Jamaica, all suites have ocean views. The 12 ground-floor Ocean's Edge one-bedroom river suites have zero-entry access to the lazy river.
Inside, each suite has a large living room with a 42-inch plasma television and a separate bedroom with a 37-inch plasma television. The patio has an outdoor dining area and love seat.
At Sandals Royal Caribbean, the four ground floor St. James River Suites have expanded patio areas with lush vegetation and access to the lazy river just steps away. The second-floor suites in both Jamaica resorts offer spectacular views of the lazy river below and sounds of trickling water from their private decks.
Sandals swim-up suites have custom furniture and tropical décor, spacious bedrooms with four-poster mahogany beds, bathrooms with marble and hand-cut mosaic tile accents, Jacuzzi tubs and his and her vanities.
Each Sandals Royal Caribbean river suite has a Butler Pantry, so that the suite's personal butler can stock the room with guests' favorite snacks and drinks.
Hand-cut glass tiles line the pool. Guests can relax on wrought iron chaise lounge chairs with bamboo accents, in the shade of Caribbean palms.
|
0.942284 |
(CNN) -- The man accused of throwing a 5-year-old boy from the third floor of the famed Mall of America is now charged with attempted murder.
Emmanuel Deshawn Aranda, 24, of Minneapolis is expected to make his first court appearance on Tuesday, the Hennepin County Attorney's Office said.
Witnesses said Aranda either pushed or threw the boy from the third level of the mall's interior to the first-level floor, nearly 40 feet below.
"The family sincerely appreciates the outpouring of support from the community," the statement said. "Please respect their great need and desire for privacy."
Aranda told police he had come to the mall a day earlier intending to kill an adult, but that did not "work out," according to the complaint.
In that case, Aranda told authorities he got "angry after he read something on the Facebook." So he smashed five computers, screens and keyboards, court records show, citing a recorded statement.
"He said he has some anger issues and told the officer that it does not happen all the time," the complaint states.
|
0.953944 |
American Express Company (NYSE: AXP) reported Thursday a beat-and-raise third quarter earnings. Earnings of $1.88 per share beat estimates by 12 cents, while sales of $10.1 billion came in just ahead of estimates.
Here's a summary of how some of the Street's top analysts reacted to the print.
Bank of America's Kenneth Bruce maintains a Buy rating on American Express with a price target lifted from $119 to $125.
Credit Suisse's Moshe Orenbuch maintains at Underperform, unchanged $96 price target.
Wells Fargo's Donald Fandetti maintains at Outperform, unchanged $122 price target.
William Blair's Robert Napoli maintains at Outperform.
Shares were down about 1.6 percent to $33.52 at time of publication.
American Express' third quarter is highlighted by an acceleration in many of the closely watched metrics, Bruce said in a note. These include 10-percent growth in total billings to $295 billion, 16-percent loan growth and 13-percent engagement spending increase in co-brands.
The earnings report also marks a return to the "old" company investors came to appreciate: a consistent revenue and EPS grower, the analyst wrote. While there's still some skepticism among investors that the momentum can continue, Street analysts are likely to lift their estimates higher moving forward that would benefit the stock from "increased optimism."
There were two negative takeaways, according to Orenbuch.
Billed volume of $295 billion was short of the $300 billion expected and the shortfall is due to a shrinkage of GNS (Global Network Service) activity in Europe and Australia and volume comps going forward will continue to be difficult.
The company's earnings are more levered to provisions and reward costs, which will likely hamper Street expectations next year.
The bullish case for American Express' stock "got stronger" after the report showed momentum in revenue and billed business growth, Fandetti said. Moreover, there's a sentiment that investors are now less concerned with the business moving forward as American Express "outlasted" the competition from major banks.
American Express remains a high quality stock with an attractive ROE business that should deliver 11 to 12 percent EPS growth, the analyst said. The stock is also trading at an attractive 12.8 times 2019 estimates, which is "too cheap on a PEG basis."
THe stock is valued as if it's a slow growth and low return regional bank but this is far from the case, Napoli said in a note. The reality is American Express is a fintech and payment company with a multidecade secular growth tailwind.
Management should be able to grow earnings at a double-digit pace and show investors a tangible equity return of more than 30 percent. At the very least, American Express' stock should trade at a multiple that's in-line with the S&P 500 index at 16.4 times next year's earnings as opposed to its current multiple of just 12.4 times.
|
0.939414 |
Brain trauma, also called traumatic brain injury (TBI) is a damage to the brain caused by a sudden trauma to the head. TBI is a major cause of death and disability in the United States, contributing to about 30% of all injury deaths. Each year, millions of people visit an emergency department due to TBI. Concussions are milder cases of TBI. More severe TBI can cause a permanent damage to the brain or lead to death.
TBIs can be caused by incidents such as a blow, a jolt, or a bump to the head strong enough to disrupt the normal function of the brain. It could also be cause when an object pierces the skull and enters brain tissue. Among the top causes of TBI are falls, violence or self-harm, and motor vehicle accidents. People 75 years or older have the highest rate of TBI, likely due to more frequent falls.
Mild TBI can cause a headache or neck pain, nausea, ringing in the ears, confusion, dizziness, tiredness and blurred vision. A person with a mild TBI may remain conscious or may experience a loss of consciousness for a few seconds or minutes. More moderate or severe TBI symptoms include all of the above and in addition a headache that gets worse or does not go away, repeated vomiting or nausea, convulsions or seizures, an inability to awaken from sleep, dilation of one or both pupils of the eyes, slurred speech, weakness or numbness in the extremities, loss of coordination, and increased confusion, restlessness, or agitation. To diagnose TBI a healthcare provider will assess a person’s physical injuries, brain and nerve functioning, and level of consciousness. This may include imaging tests such as CT (computerized tomography) and MRI (magnetic resonance imaging).
How does brain trauma/TBI relate to aphasia?
Brain trauma that is severe enough to cause a more permanent brain damage may result in aphasia if the brain tissue that gets damaged is in areas of the brain important for speech and language production. Depending on the severity of the trauma, aphasia due to TBI could be transient or more permanent. Often, aphasia caused by TBI will be accompanied by other cognitive problems since TBI usually affects multiple areas of the brain.
|
0.987039 |
Semiconductor quantum dots (QDs) are nanostructures made of several thousand atoms that can self-assemble during heteroepitaxial growth. When their size is smaller than the De Broglie wavelength of charge carriers trapped in these structures, quantum confinement effects become apparent and, similar to real atoms, QDs feature discrete energy levels. This remarkable property has opened up the unprecedented possibility to use QDs as quantum bits (qubits) for quantum information processing. This can be achieved by exploiting, for example, the spin/charge properties of single electrons (holes), or one degree of freedom of photons emitted during the radiative recombination of electron-hole complexes (i.e. excitons).Very recently, QDs are emerging as one of the most promising sources of flying qubits (photons), since they are ompatible with current photonic integration technologies and they are capable to deliver single [83, 107] and entangled photons [3, 15] with high efficiency [32, 130] and on demand . However, in order to implement these nanostructures in solid-state based quantum information processing, several challenges have to be overcome. Two major challenges are: (i) the fabrication of technologically robust sources of highly entangled photons [105, 139] and (ii) the development of efficient interfaces between QD photons and other quantum systems [29, 75, 94]. In this work, these two challenges are tackled. First, semiconductor piezoelectric devices are presented that can be used for the generation of polarization entangled photon pairs featuring the highest degree of entanglement reported to date for QD photon sources. These sources can be driven electrically at repetition rates up to 0.4 GHz. Second, it is reported how the same device can be used to interface single photons from a QD with a cloud of Cesium (Cs) atoms, which is used as a slow light medium. The first part of the results section thus starts with the basic layout of the semiconductor-piezoelectric device, which consists of a diode- like nanomembrane integrated onto a piezoelectric actuator. This allows the electronic structure of QDs to be reshaped by the simultaneous application of stress and electric fields. It is demonstrated that a balanced combination of these fields allows to compensate for the structural asymmetries of QDs, which are detrimental for the generation of highly entangled photons. Alternatively, the electric field across the the diode-like nanomembrane can be used to inject carriers electrically into the QD , thus leading to the generation of en- tangled photon pairs. This allows for the demonstration of the first entangled light emitting diode (ELED), driven at a repetition rate of 0.4GHz, which is an important step towards high data rate quantum information processing. The second part of the work reports on interfacing photons from QDs with warm Cs vapors. More specifically, the same device discussed above was used to precisely tune the energy of the quantum dot (QD) photons to the hyperfine split D 1 levels of Cs. Under this conditions, photons propagate in a strongly dispersive medium and are slowed down. A differential delay of 2.4ns over the length of the Cs cell (7.5 cm) is demonstrated in this work. Moreover, the Cs vapor is utilized as a spectrally selective delay line, which is capable of introducing a significant temporal delay between photons that are separated in frequency by only a few GHz. The temporal and spectral distribution of photons before and after transmission through Cs vapor is measured and quantitatively explained by a theoretical model. This model uses the temperature dependent group velocity of Cs and takes into account the transmission of the inhomogeneously broadened QD emission to calculate the temporal distribution of the photons escaping through the Cs cell. In combination with a QD device that allows to suppress the biexciton binding energy, this spectrally selective delay opens up the possibility to test the theoretically proposed, but not yet experimentally demonstrated, entanglement generation through temporal reordering . Finally, the last part of this work discusses the first experimental steps towards this reordering scheme. In particular, the complete cancellation of the biexciton binding energy and the simultaneous tuning of the emission energy to the absorption of Cs D1 are demonstrated. Thus, time reordering operations on photons from the biexciton-exciton radiative cascade are demonstrated. Further refinements of the devices that are needed to demonstrate the feasibility of this scheme for entangled photon generation are discussed.
|
0.943135 |
Is the "Lifestyles of the Rich and Famous" host still enjoying champagne wishes and caviar dreams?
Before Robin Leach became a household name and TV icon, he was an entertainment journalist. He worked for publications such as the Daily Mail and People magazine, even making appearances on CNN and "Entertainment Tonight."
Leach made his foray into stardom when he became the host of "Lifestyles of the Rich and Famous," a reality television series that looked at the extravagant lives of celebrities. He hosted the show from 1984 through 1987, then again when it made a two-year comeback in 1993 and '94.
From the mid-90s to the early-2000s, leach made several one-off appearances on popular television shows like "Roseanne", "Family Guy," and even the beloved decorating series "Trading Spaces."
In 2003, Leach was feeling adventurous. He appeared on "I'm a Celebrity, Get Me Out of Here." Unsurprisingly, the man with the famous tagline "champagne wishes and caviar dreams" didn't last long… he was the first celebrity to leave the Australian outback.
2007 was the year Leach returned to his television roots, finding a way into the hearts of millennials everywhere when he hosted VH1's "The Surreal Life: Fame Games." The reality show, which featured less than A-list stars (to put it gently), brought the likes of Vanilla Ice and Ron Jeremy together to compete for a trip to Las Vegas and a $100,000 prize.
Leach himself found his way to Vegas several years ago. The New York Times caught up with him in the City of Sin in 2014 – the same year he and his wife appeared on "Wife Swap" – and we learned that he has returned to his first love: journalism. You can find his writing in the Las Vegas Sun and on his blog, Las Vegas Weekly.
"It's alive here," he told the Times of Las Vegas. And you know what else is alive? Leach's bank account – he's reportedly worth $14 million. From talking about the luxe life, to living it, it seems Leach has come full circle.
|
0.998866 |
I'm getting disturbed from my partner, as I could hear snoring sound everyday and last ever. I'm facing problem in sleeping in nights. Can anyone suggest me best solution for this type of problem?
It’s not so hard to try for some solutions to get rid of snoring. The better way to stop snoring and sleep peacefully during nights can be through earplugs. There are many options and various design in earplugs, you can select the one which fits your ear easily and enough to protect from blasting sound effects. Lynx Brands is one of the branded earplugs which provide noise reduction and in-built filter causing you to sleep peacefully.
|
0.999995 |
Pap the Disney Gamer's Highlights: Just what is Fantasia: Music Evolved?
And the high profile Disney game releases continue! With the likes of DuckTales:Remastered and Disney Infinity hoping to capture the imaginations of Disney fans and gamers alike in 2013, we can add another hopeful to that list of highly anticipated releases: Fantasia: Music Evolved.
Of course, we can't talk about the game without first talking about the Disney animated masterpiece that inspired it, Fantasia. The third animated film by Walt Disney himself, Fantasia represented a huge creative and financial gamble for the company. Despite the incredible success of Snow White and the Seven Dwarfs years earlier, Pinocchio did not create the same results, and with the world on the brink of war, as well as the oddness of the project, Fantasia was poised to be a cult classic. But time can often be kind to masterful pieces of art as re-releases of the film helped it finally find the audience it deserved. People went from complete indifference to hailing it as one of the finest films ever made. This legacy inspired Disney to create a follow up with Fantasia 2000, which saw mixed reactions from fans and critics alike.
On the other side of the spectrum is Harmonix. The company is highly regarded in the video game industry as one of the finest creators of rhythm music games. Their work on the early Guitar Hero games gave them success thanks to immersive gameplay that was very easy to understand, yet challenging to master. Soon, they evolved the Guitar Hero concept and created Rock Band, a title that inspired the music band game craze of the mid-00s. Rock Band allowed players to control different instruments, allowing them to live out the dream of being in a rock band. That game featured various editions such as The Beatles: Rock Band. Once the band game fad fizzled out, they created Dance Central for the Xbox 360 Kinect, a game that was quickly praised as the best game for the newly released motion controlled camera.
Now, we have a gaming company that has rightfully earned its reputation as the creators of innovative music games, and that company has taken extreme inspiration from a film that celebrates music and animation as legitimate art forms. The end result is gonna be Fantasia: Music Evolved for the Xbox One and Xbox 360. And the title is about... It's a complete mystery!
The premise of the game remains a complete mystery for many. What's even more interesting is that despite the Fantasia name attached to the project, the music will not be about classical musical compositions as seen in the feature films. Instead, the soundtrack will be adorned by the likes of Fun's 'Some Nights' and Bruno Mars. The release of this trailer has not only confused people, but also made them mad. As it stands, people believe that Fantasia: Music Evolved only takes the Fantasia name and put it on top of a generic music game, disrespecting the legacy the film had created in the art and music world.
The very small pieces of information regarding this game indicates that the game will have kinetic rhythm game components, as well as free style modes where players use their arms to generate images inspired by the music. Of all the elements from the two films, the appearance of Sorcerer Yensid and Apprentice Mickey from 'The Sorcerer's Apprentice' has been confirmed. The idea behind the films, which is to generate visuals according to the mood and feel of the films, so far seems to be the main reason behind the gameplay. It has also been confirmed that players start off in a blank universe that becomes more alive as the music grows along with a player's performance. And that's just it: information is just so sparse right now that people have no idea what to make of it!
All the confusion and indifference makes me believe that this is what Walt Disney and his animators experienced when the film was first announced and eventually released. Just like no one could understand the idea behind Fantasia, players and Disney fans don't know how to react to Fantasia: Music Evolved. The usage of modern day music throws a lot of people off, and the lack of gameplay details just generates more confusion. In my eyes, though, I rather give Disney and Harmonix the benefit of the doubt as not only is the information so small it is hard to form a general opinion of it, this may be the kind of experimental game that may eventually yield a huge following in its release. Harmonix has many years of expertise under their belt, and if there is one company that can give justice to the game, it is them.
Fantasia: Music Evolved is slated for a 2014 release on the Xbox 360 and the Xbox One. No word if it will be a digital release or a retail release.
|
0.992817 |
This article is about the Automobile. For Audi's 4WD system, see quattro (four-wheel-drive system). For the Audi subsidiary formerly called "Quattro GmbH", see Audi Sport GmbH. For the e-tron versions, see Audi e-tron Quattro.
The Audi Quattro is a road and rally car, produced by the German automobile manufacturer Audi, part of the Volkswagen Group. It was first shown at the 1980 Geneva Motor Show on 3 March. Production continued through 1991.
The word quattro is derived from the Italian word for "four". The name has also been used by Audi to refer to the quattro four-wheel-drive system, or any four-wheel-drive version of an Audi model. The original Quattro model is also commonly referred to as the Ur-Quattro - the "Ur-" (German for "primordial", "original", or "first of its kind") is an augmentative prefix, in this case meaning "original". The idea of such a car came from the Audi engineer Jörg Bensinger.
The Audi Quattro was the first rally car to take advantage of the then-recently changed rules which allowed the use of four-wheel drive in competition racing. It won consecutive competitions for the next two years. To commemorate the success of the original vehicle, all subsequent Audi production automobiles with their trademark quattro four-wheel-drive system were badged quattro with a lower case "q" and in a distinct typeface which has remained nearly unchanged since its inception.
The Audi Quattro shared many parts and core body components with the Coupé version of the Audi 80 (B2) model range. The Quattro was internally designated Typ 85, a production code it shared with the quattro versions of the Audi 80 coupé. Its characteristic flared wheelarches were styled by Martin Smith. The Audi Quattro also had independent front and rear suspension.
The idea for a high-performance four-wheel-drive car was proposed by Audi's chassis engineer, Jörg Bensinger, in 1977, when he found that the Volkswagen Iltis could outperform any other vehicle in snow, no matter how powerful. Bensinger's idea was to start developing an Audi 80 variant in co-operation with Walter Treser, Director of Pre-Development.
Audi introduced the original Quattro to European customers in late 1980, featuring Audi's quattro permanent four-wheel drive system (hence its name), and the first to mate the front-engine, four-wheel-drive layout with a turbocharged engine.
The displacement of the engine was dropped slightly from 2144 cc to 2133 cc with a bore x stroke of 79.3 mm × 86.4 mm (3.1 in × 3.4 in) for the Rally car so that Audi could satisfy the 3-litre rallying class with a 1.4 times multiplication factor. Valvetrain was DOHC 4 valves per cylinder (20 valves in total) with an oil cooled KKK K27 turbocharger at 1.03 bars (14.9 psi) and Air-to-Air - Längerer & Reich intercooler fed by Bosch LH-Jetronic fuel injection, generating 225 kW (306 PS; 302 hp) at 6,700 rpm and 350 N⋅m (258 lbf⋅ft) of torque at 3,700 rpm.
Audi Quattros are referred to among owners and enthusiasts by their engine codes, to differentiate between the earlier and later versions: the earliest 2,144 cc 10v being the "WR" engine, the 2,226 cc 10v being the "MB" engine, and the later 20v being the "RR" engine. Hence, Quattro models may be referred to as either the WR Quattro, MB Quattro, and RR or "20v" Quattro, respectively.
Production of the quattro totalled to 11,452 units over the period from 1980–1991, and through this 11 year production span, despite some touch-ups, there were no major changes in the visual design of the car. For the 1983 model year, the dash-board did away with an analogue instrument cluster now fitted with a green digital liquid crystal display (LCD) electronic instrument cluster. This was later changed in 1988 to an orange LCD electronic instrument cluster. The interior was redesigned in 1984, and featured a whole new dash-board layout, new steering wheel design, and new centre console design, the switches around the instrument panel were also redesigned at this time. In 1985, the dash-board changed slightly with harder foam and lost a diagonal stripe, the switches were varied slightly and the diff lock pull knob gave way to a two-position turning knob with volt and oil temp digital readouts.
The rear suspension was altered early on with geometry changes and removal of the rear anti-roll bar to reduce a tendency for lift-off oversteer. For the 1984 facelift, the wheel size went from 6x15-inch with 205/60-15 tyres to 8x15-inch wheels with 215/50-15 Pirelli Cinturato P5 tyres. At the same time the suspension was lowered by 20 mm with slightly stiffer springs for improved handling. For 1987, the Torsen centre differential was used for the first time, replacing the manual centre differential lock.
Sales of the Quattro in North America began in the 1983 model year. They entered the all-wheel-drive market established by the AMC Eagle, the first full-time all-wheel-drive passenger car to reach mass production.
The U.S./Canadian cars were equipped with larger impact bumpers with built-in shock absorbers, like the rest of the 4000/Coupé models. They did not have anti-lock braking system (ABS), but included air conditioning and leather upholstery. Most of the 1984 and 1985 Canadian models came without sunroofs. The remainder of the electric, suspension, and cosmetic updates took place at the same time as the European cars.
The initial 2.1 L (2,144 cc, engine code "WX") engine for U.S./Canadian models included minor component and engine control unit (ECU) changes, lowered turbocharger boost pressure, different camshaft, as well as emission controls that consisted of a catalytic converter and lambda stoichiometric fuel control that lowered power output to 160 hp (119 kW; 162 PS). Other mechanical specifications were identical to the European market vehicles. The WX engine was also untilised in Swiss and Japanese market cars. Audi built 200 special edition cars in 1988 with the WX engine and analogue instrument cluster, with everything else identical to the MB model of that year.
The Audi quattro Spyder was a mid-engine coupé equipped with a 2.8-litre V6 engine taken from the Audi 100. The engine was rated at 174 PS (128 kW; 172 hp) and 181 lb⋅ft (245 N⋅m) of torque. The car was a rolling test bed for a future mid-engine sports car and featured a 5-speed manual gearbox, a modified version for the quattro four-wheel-drive system, aluminium body panels with a tubular steel space frame, 1,100 kg (2,425 lb) kerb weight and a suspension system with trapezoidal links. All of the unique features depicted in the concept car would find their way in future Audi production vehicles.
The concept car was unveiled at the 1991 Frankfurt Motor Show.
At the Paris Motor Show in 2010, Audi presented the quattro concept on the occasion of the 30th anniversary of the original Audi Quattro and the Audi quattro four-wheel-drive system. Based on the RS5, it features a modified 2.5 L five-cylinder TFSI engine shared with the TT and a 6-speed manual transmission from the S4. The engine was claimed to generate a maximum power output of 408 PS (300 kW; 402 hp) and 480 N⋅m (354 lb⋅ft) of torque. The revolutionary design features depicted on the concept car would eventually make their way on future Audi models.
The Audi Sport quattro concept was unveiled at the 2013 Frankfurt Motor Show to commemorate the 30th anniversary of the original Audi Sport quattro. The show car features angular flat C-pillars, as well as rectangular double headlights featuring Audi's Matrix LED technology, a spoiler at the lower edge of the rear window, rectangular tail lights, 21-inch wheels, carbon fibre-ceramic brake discs, bucket seats with integrated head restraints, multifunction sport steering wheel, two driving modes (race and setup) in virtual 3D displays, Audi MMI control unit, and air conditioning. The doors and fenders were made of aluminum, while the roof, hood, and the rear hatch were made of carbon fiber-reinforced polymer. The front suspension features five control arms per wheel while the rear has track-controlled trapezoidal link.
At the 2014 Geneva Motor Show, Audi presented the new 2014 Audi TT Quattro Sport Concept. It was powered by a 2.0 L four-cylinder TFSI engine generating a maximum power output of 420 PS (309 kW; 414 hp) and 331 N⋅m (244 lb⋅ft) of torque. The concept featured Audi's Quattro AWD system and an S Tronic dual-clutch transmission.
The original Audi Quattro competition car debuted in 1980, first as a development car, and then on a formal basis in the 1980 Janner Rally in Austria. Largely based on the bodyshell of the road-going Quattro models (in contrast to the forthcoming Group B cars), the engine of the original competition version produced approximately 304 PS (224 kW; 300 hp). In 1981, Michèle Mouton became the first female driver to win a world championship rally, piloting an Audi Quattro. Over the next three years, Audi would introduce the A1 and A2 evolutions of the Quattro in response to the new Group B rules, raising the power output of the turbocharged inline 5-cylinder engine to around 355 PS (261 kW; 350 hp).
The Quattro A1 debuted at the WRC 1983 season opener Monte Carlo Rally, and went on to win the Swedish Rally and the Rally Portugal in the hands of Hannu Mikkola. Driven by Stig Blomqvist, Mikkola and Walter Röhrl, the A2 evolution won a total of eight world rallies, three in 1983 and five in 1984. Two examples of the same car completely dominated the South African National Rally Championships during 1984 to 1988, with S.A. champion drivers Sarel van der Merwe and Geoff Mortimer.
The Audi Sport Quattro S1 was a variant of the Quattro developed for homologation for Group B rallying in 1984, and sold as a production car in limited numbers. It featured an all aluminium 2,133 cc (2.1 L) Inline-five engine with a bore X stroke of 79.3 mm × 86.4 mm (3.1 in × 3.4 in) DOHC 4 valves per cylinder, Bosch LH Jetronic fuel injection and a KKK K27 turbocharger. The engine was slightly smaller than that of the standard Audi Quattro in terms of displacement in order to qualify for the 3-litre engine class after the 1.4 multiplication factor applied to turbocharged engines. In road-going form, the engine was capable of generating 306 PS (302 hp; 225 kW) at 6,700 rpm and 350 N⋅m (258 lb⋅ft) at 3,700 rpm, with the engine on the competition cars initially generating around 331 kW (450 PS; 444 hp).
In addition to Group B competition in rallying, the Sport Quattro won the 1985 Pikes Peak International Hill Climb with Michèle Mouton in the driving seat, setting a record time in the process. 224 cars in total of this "short version" Sport Quattro were built, and were offered for sale for 203,850 German Marks.
The Audi Sport Quattro S1 E2 was introduced at the end of 1985 as an update to the Audi Sport Quattro. The car featured an inline 5-cylinder engine that displaced 2,110 cc (128.8 cu in) and generated an officially quoted power output figure of 480 PS (353 kW; 473 hp). However, the turbocharger utilised a recirculating air system, with the aim of keeping the unit spinning at high rpm, when the driver closed the throttle, either to back off during cornering, or on gearshifts. This allowed the engine to resume full power immediately after the resumption of full throttle, reducing turbo lag. The actual power figure was in excess of 507 PS (373 kW; 500 hp) at 8,000 rpm.
The S1 E2 made its debut at the 1985 Rally Argentina, with Blomqvist driving. This variant was successful in the rally circuit, with Röhrl and Christian Geistdörfer winning the 1985 San Remo Rally. A modified version of the E2, was also driven by Michèle Mouton. The S1 evolution would become the final Group B car produced by Audi, with the works team withdrawing from the Championship following the 1986 rally in Portugal. The final factory cars of 1986 were rated at 600 PS (441 kW; 592 hp). In 1987, the car won the Pikes Peak International Hill Climb driven by Walter Röhrl.
Audi Sport Quattro RS 002 - Sports prototype "Group S" was a rally car that was initially designed for the forthcoming Group S regulations for 1987. The car was tested by Walter Röhrl but it never raced; the Group S regulations were scrapped along with the Group B regulations after a number of accidents involving fatalities during the 1986 season.
The car has a longitudinal mid-engine layout and a four-wheel drive system. The car is displayed in the museum "Audi museum mobile" in Ingolstadt.
The Quattro's final WRC victory came from Walter Röhrl, at the 1985 Rallye Sanremo. The car was paraded at the Ignition Festival of Motoring in 2017.
In the run-up to the 2010 general election, a campaign poster by the incumbent Labour Party government portrayed Conservative Party and opposition leader David Cameron as Gene Hunt sitting on the bonnet of the iconic red Audi Quattro and urged voters not to allow Cameron to take Britain "back to the 1980s" by electing his party into government amid fears that it would lead to a repeat of the social unrest and unemployment that Margaret Thatcher's Conservative government of that era oversaw. The image was then adopted by the Conservatives, with the slogan "Fire up the Quattro, it's time for change", with the comment 'Idea kindly donated by the Labour Party'. "Fire up the Quattro" was a call to action uttered by DCI Hunt in Ashes to Ashes.
^ a b c d e f g h i j k l m n o p q r s t u v w x "25 Years of Audi Quattro" (Press release). Audi of America Press Site. 22 February 2005. Retrieved 3 May 2014.
^ a b Achorn, George (16 March 2005). "Audi Tradition at the Techno Classica 2005". Retrieved 3 May 2014.
^ "1984 Audi Quattro Treser Coupé". Motorbase. 19 September 2008. Retrieved 3 May 2014.
^ "Drive: 1982-1985 Audi Quattro". Motortrend.com. October 2005. Retrieved 3 May 2014.
^ "History of the Audi ur-Quattro". Isham-research.co.uk. Archived from the original on 24 June 2010. Retrieved 3 May 2014.
^ "Audi history 80s" (PDF). Retrieved 11 July 2016.
^ Pawel Zal (ed.). "1983 Audi Quattro Sport". Automobile-catalog.com. Retrieved 26 August 2018.
^ "Audi Quattro". Retro Car Icons. Retrieved 3 May 2014.
^ Severson, Aaron (23 October 2013). "Legend of the Quattro". Autoweek. Retrieved 3 May 2014.
^ Jacobs, Ed (September 1979). "4WD AMC Eagle - passenger comfort, all-weather capability". Popular Science. 215 (3): 90–91. Retrieved 3 May 2014.
^ Sass, Rob (9 March 2008). "A Breed of 4-by-4 Hatched on the Fly". The New York Times. Retrieved 3 May 2014.
^ "Concept Cars: Audi Quattro Spyder". Diseno-art.com. Retrieved 3 May 2014.
^ Adams, Kieth (7 July 2013). "Friday concept: Audi Quattro Spyder". Classics.honestjohn.co.uk. Retrieved 3 May 2014.
^ Winfield, Barry (December 2010). "Audi quattro Concept". Car & Driver. Retrieved 14 October 2018.
^ Kable, Greg (8 October 2010). "Audi to build reborn Quattro". Autocar. Retrieved 3 May 2014.
^ Ireson, Nelson (10 March 2012). "Audi Kills Quattro Sports Car In Favor Of Crossover Coupe". MotorAuthority. Retrieved 14 October 2018.
^ Paukert, Chris (10 September 2013). "Audi Sport Quattro Concept speaks softly, carries a 700-hp stick". Autoblog.com. Retrieved 3 May 2014.
^ "Audi Sport quattro concept" (Press release). Audi-mediaservices.com. 4 September 2013. Retrieved 3 May 2014.
^ "2014 Audi TT Quattro Sport Concept Review". Retrieved 3 May 2014.
^ "Audi Sport Quattro S1". Rally Paradise. Retrieved 3 May 2014.
^ Holmes, Martin (11 July 1985). "The Sport's evolution". Autosport. Archived from the original on 28 April 2014. Retrieved 3 May 2014.
^ "Audi ur-quattro and R8 e-tron win the Silvretta Classic and E-Auto Rally" (Press release). Audi-mediaservices.com. 13 July 2010. Retrieved 3 May 2014.
^ "1983 - 1984 Audi Sport Quattro". ultimatecarpage.com. Retrieved 14 June 2018.
^ "1983 Audi Quattro Sport". automobile-catalog.com. Retrieved 14 June 2018.
^ "Pikes Peak records shattered". The Post and Courier. 14 July 1985. p. 3-C. Archived from the original on 17 July 2012. Retrieved 23 February 2012.
^ "Audi quattro Mid-Engine (Gr.B Proto) & Audi Sport quattro RS "002" (Gr.S Proto) | Rally Group B Shrine". Rally Group B Shrine. 18 January 2016. Retrieved 10 November 2017.
^ "img38/320/audi3u.jpg". imageshack.us. Archived from the original on 24 March 2012. Retrieved 4 January 2014.
^ "Luigis • View topic - My 3.8 filming photos". Luigis.org.uk. Archived from the original on 4 January 2014. Retrieved 3 May 2014.
^ "Gene Hunt poster sparks propaganda battle". BBC News. 3 April 2010. Retrieved 3 May 2014.
Wikimedia Commons has media related to Audi Quattro.
|
0.958813 |
DNA sequences contain repetitive motifs which have various functions in the physiology of the organism. A number of methods have been developed for discovery of such sequence motifs with a primary focus on detection of regulatory motifs and particularly transcription factor binding sites. Most motif-finding methods apply probabilistic models to detect motifs characterized by unusually high number of copies of the motif in the analyzed sequences.
We present a novel method for detection of pairs of motifs separated by spacers of variable nucleotide sequence but conserved length. Unlike existing methods for motif discovery, the motifs themselves are not required to occur at unusually high frequency but only to exhibit a significant preference to occur at a specific distance from each other. In the present implementation of the method, motifs are represented by pentamers and all pairs of pentamers are evaluated for statistically significant preference for a specific distance. An important step of the algorithm eliminates motif pairs where the spacers separating the two motifs exhibit a high degree of sequence similarity; such motif pairs likely arise from duplications of the whole segment including the motifs and the spacer rather than due to selective constraints indicative of a functional importance of the motif pair. The method was used to scan 569 complete prokaryotic genomes for novel sequence motifs. Some motifs detected were previously known but other motifs found in the search appear to be novel. Selected motif pairs were subjected to further investigation and in some cases their possible biological functions were proposed.
We present a new motif-finding technique that is applicable to scanning complete genomes for sequence motifs. The results from analysis of 569 genomes suggest that the method detects previously known motifs that are expected to be found as well as new motifs that are unlikely to be discovered by traditional motif-finding methods. We conclude that our approach to detection of significant motif pairs can complement existing motif-finding techniques in discovery of novel functional sequence motifs in complete genomes.
Genomic DNA sequences contain numerous repetitive motifs or nucleotide sequence patterns that play various roles in the physiology of the cell, including regulation of gene expression, maintenance of DNA and its structure in the cell, recombination and other forms of mutation, and even recognition of DNA fragments for uptake from the extracellular space [1–5]. Repetitive motifs in DNA sequences can also encode functional elements in proteins and RNA. Consequently, a large amount of effort has been devoted to development of computational methods for detection of sequence motifs in DNA and protein sequences.
There are two major types of motif finding algorithms, namely supervised and unsupervised motif finding algorithms. The former methods require a sample of known occurrences of the motif and utilize this information in the search for additional motif occurrences in the analyzed sequence or sequences. The unsupervised methods, sometimes referred to as ab initio approach, do not require any prior knowledge about the motif sequences and detect novel sequence motifs that satisfy specified criteria (generally including unexpectedly high frequency of occurrence and high sequence similarity among different copies of the motif). In this article, we focus on unsupervised motif search. The unsupervised motif finding algorithms can be further classified into two major groups: 1) word-based methods that mostly rely on exhaustive enumeration, i.e., counting and comparing oligonucleotide frequencies and 2) probabilistic sequence models where the model parameters are estimated from sequences. Extensive work has been done on transcription factor binding site (TFBS) prediction during the past decades, driven by the obvious importance of these regulatory motifs in the organism’s physiology. Based on the type of DNA sequence information used by the TFBS finding algorithm, the methods could be classified into three major classes: 1) methods that use promoter sequences from coregulated genes from a single genome [6, 7], 2) methods that use orthologous promoter sequences of a single gene from multiple species [8–10] and 3) methods combining 1) and 2) [11, 12]. As a unified portal for online discovery and analysis of sequence motifs, the MEME Suite web server provides various tools in finding motifs representing features such as DNA binding sites and protein interaction domains .
While TFBS receive most attention among sequence motifs the repetitive sequence motifs in genomic DNA can have many other functions. We aim to expand the range of types of sequence motifs detected by motif-finding methods by searching for spaced motifs in complete genomes, which could arise, among other mechanism, from repetitive patterns in chromosome structure. The concept of searching for spaced sequence motifs is not new but the previous such methods generally aimed to detect TFBS, where spacing of the conserved segments of the motif is determined by the geometry of the DNA-protein interaction and generally does not exceed 6 or 7 bp (for example, refs [14, 15]). A more general approach implemented in HeliCis allows detection of co-localized periodically spaced motifs, such as binding sites for multiple transcription factors. However, these methods are specifically designed for detection of TFBS in a collection of regulatory regions and are not suitable for scanning complete genomes. In contrast, our methodology is aimed at detection of DNA sequence motifs that can have diverse physiological functions, including regulatory motifs, motifs involved in DNA, RNA, and protein interactions, and motifs related to structural organization of DNA and/or the encoded proteins. Our approach is different from previous methods in that it searches for pairs of motifs that occur at a particular distance from each other significantly more often than expected without requiring that either of the motifs on its own occurs more frequently than expected. The goal is to detect paired motifs where the distance between the two motifs is under selective constraint but the specific sequence of the spacer is variable.
For motif pairs that satisfy the criteria above, investigate their distribution in the genome using Pattern Locator .
Step 1) consists of recording the total number of times a pair of pentamers A and B is found at the exact mutual distance d. The distance d is counted from the beginning of A to the beginning of B. Pairs with exactly the same spacers are counted only once (pairs with similar but not identical spacers are discounted later in step 5). The motivation for discounting motif pairs with identical or very similar spacers is that they likely arise from sequence duplication of the whole segment containing the motif pair and the spacer, which is not our primary goal; we aim to detect motif pairs where the distance between the motifs arises from selective constraints rather than as a result of sequence duplication events. The main reason we limit the motif spacer distance to 5–89 bp is due to growing computational complexity when ranges of paramters investigated are too large. Similar reasons apply to limiting the investigated motifs to pentamers; the number of possible pairs of hexamers is around 16 million (compared to ~1 million of possible pairs of all pentamers), which is prohibitive when the methodology is to be applied to hundreds of complete genomes as in this study. Another important motivation to use pentamers is related to how prokaryotic DNA-binding proteins, particularly transcription factors, interact with DNA. Many prokaryotic transcription factors interact with DNA in a sequence-specific manner via two alpha-helices that fit into adjacent turns of the major groove in the DNA double helix . Consequently, although the whole binding site is often ~20 nucleotides long, it usually consists of two conserved segments of ~5 nucleotides where the protein directly interacts with the DNA bases, separated by a variable gap [19, 20].
After finding the most abundant distance d for each motif pair in step 2), statistical significance is assessed in step 3). For a given pair of motifs, if no specific distance is preferred, one would expect a uniform distribution of spacer distances within the whole range 5 to 89 bp. The problem of numbers of motif pairs found at different distances is analogous to the classical balls-in-urns problem where motif pairs represent the balls and different distances (spacer sizes) represent the urns. Suppose n balls are allocated to K urns at random, each ball being equally likely to fall into each urn, independently of any other balls. Let fmax denote the largest number of balls in any urn. This situation can be modeled with the uniform multinomial distribution in which there are n trials, each with K possible outcomes of equal probability.
Subsequently, the p-value p = P(fmax > = x) = 1 - P(fmax < x).
p-value-cutoff = 0.01 / number of motif pairs = 0.01 / 410 ≈ 10−8.
In the formula above, Fα is the 100(1-α)% percentile of fmax; α is the desired Type I error rate; n is the total number of occurrences of the motif pair at hand with distance between 5 and 89, and K is the total number of distances investigated (K = 85). Note that the above approximation is based on an asymptotic theorem under certain regularities . To verify that the approximation is sufficiently accurate with our set of parameters, comparisons between approximate and exact fcut values for different values of K were made using a fixed p-value 10−8 (Fig. 1). When K is relatively large (greater than 50), the equation (2) approximates the true values with reasonable accuracy as n gets large; however, when K is relatively small (smaller than 50), the equation tends to overestimate the true fcut values. Since the K used in this paper is 85, we decided to use exact cutoff values for n < = 600 while the approximated values are used for n > 600.
In Step 4], the steps 1 to 3 are repeated for all possible pentamer pairs. After all pentamer pairs are tested, the most promising candidates are selected for spacer alignment. In Step 1], only identical spacers could be recognized and eliminated but our goal is to discount all motif pairs which likely arose from recent duplication of the whole segment including the motif pair and the spacer. Consequently, sequence alignments are performed with NW-align, which is a simple and robust alignment program based on the standard Needleman-Wunsch algorithm , to eliminate potential duplicated spacers. A simple ‘greedy’ algorithm is applied to eliminate duplicated spacers. The first pair of spacers is aligned. If the nucleotide identity is ≥70%, then fmax is reduced by one and one of the spacers is excluded from further alignments. Additional pairs of spacers are subsequently aligned and excluded if the nucleotide identity exceeds 70%. This is continued until no spacers are more similar than the 70% cutoff. The value 70% was chosen as the lowest cutoff that gives a high confidence the sequence similarity is not coincidental; for example, the probability that two random sequences of ten nucleotides would match at seven positions (70% identity) is less than 0.01 and declines with increasing sequence length. We also performed tests with 65% and 75% cutoffs, which suggested that the cutoff 65% was too conservative whereas majority pentamer pairs identified with the 75% cutoff overlapped motifs detected also with the 70% cutoff (see Additional file 1: Table S1 for details). After this step, a motif pair whose fmax is still above fcut and whose inverse complement is also significant with the same distance is selected for further analysis. The reason for requiring a motif pair’s inverse complement also to be significant is that dispersed sequence motifs, which are the primary target of our search, are expected to be distributed in both DNA strands; consequently, both versions of the motif pair—direct and reverse—are expected to be over-represented in the genome. The subsequent analysis of the significant motif pairs is performed with Pattern Locator , which provides information on distribution of the motif pairs with respect to adjacent genes. Such information can be helpful in generating hypotheses about the motif pair’s possible function. Pattern Locator also reports the percentage of copies of the motif pair found in genes and intergenic regions (Additional file 2: Table S2), which allows easy identification of motifs that are most likely to have regulatory functions (predominantly intergenic motifs) and motifs that could reflect conserved patterns in amino acid sequences of the encoded proteins.
Annotated nucleotide sequences of complete prokaryotic genomes were downloaded from the NCBI FTP server . We randomly selected only one genome per species when multiple strains of the same species were available. The final dataset included 569 genomes (Additional file 1: Table S1). For genomes consisting of multiple chromosomes the analysis was performed on all chromosomes.
The 569 prokaryotic genomes, each from a separate species, were scanned with the algorithm described above. In the 569 genomes, 3326 motif pairs were identified as significant by our criteria (Additional file 2: Table S2). The summary statistics for selected characteristics of the significant motif pairs are shown in Table 1.
Distributions of some key statistics are further demonstrated in Figs. 2 and 3. The right panel in Fig. 2 indicates that median percentage of significant pairs found in protein- coding regions is around 80%, which is close to the fraction of protein-coding region in a typical prokaryotic genome; in other words, the significant motif pairs do not show a strong overall bias for protein-coding regions or intergenic regions. In Fig. 3, the first two plots show that the distributions of motif pairs are bi-modal in both gene and intergenic region. 50 percent of significant motif pairs occurred in genes more than 90% of the time and 25 percent occurred in genes less than 10% of the time, whereas fewer motif pairs are distributed approximately evenly among both genes and intergenic regions. In other words, majority of the significant motifs show a strong preference for either genes or intergenic regions. The same conclusion can be reached upon inspection of the raw data in Additional file 3: Table S3.
The distribution of the spacer length for the motif pairs is shown in Fig. 4. There are two peaks—one is around spacer lengths 15 to 20 bp and the other one is around 40 to 50 bp. The reason for the first peak is partly due to a conserved palindromic motif pair (CGAAA and TTTCG with a spacer length of 19 bp), which is widely distributed among a variety of genes of Mycobacterium species. In total, approximately 150 motif pairs conforming to this consensus were identified in the analyzed Mycobacterium genomes out of 701 motif pairs with spacer length 15 to 20 bp found in all analyzed genomes. The peak at 40–50 bp reflects wide distribution of clustered regularly interspaced short palindromic repeats (CRISPRs) among the analyzed genomes. CRISPRs are arrays of ~30 bp perfect repeats separated by ~30–40 bp variable spacers, which give rise to many significantly overrepresented motif pairs with this spacer size (see also below).
Another noteworthy statistic in Table 1 is the difference between the initial number of copies of a significant motif pair (Initial_n) and the number of copies remaining after elimination of duplicate spacers (Reduced_n). The mean value of Initial_n is 80.6 whereas Reduced_n has mean 57.8, indicating that more than 25% of occurrences of all significant motif pairs in the genomes may have arisen from sequence duplication events. This confirms the importance of removing the “false positives” resulting from sequence duplications when searching for candidate motif pairs whose specific relative positioning is maintain by selective constraints.
All significant motif pairs found in the analyzed genomes are reported in Additional file 3: Table S3. In total, 307 genomes have at least one significant motif pair identified. Among those, Rhodoferax ferrireducens T118 has the highest number of pairs detected, 140 (Additional file 3: Table S3).
Thirty genomes (listed in Additional file 4: Table S4) were selected for in-depth investigation of the identified significant motif pairs. Some of the significant motif pairs were found to be related to previously known motifs such as CRISPR or Shine-Dalgarno sequence whereas others appear to be potentially novel, previously uncharacterized sequence motifs. Majority of the identified motif pairs can be classified in one of the five categories, namely CRISPR-related, Rho-independent transcription terminators, tRNA-related motifs, motifs containing the Shine-Dalgarno sequence, and protein-related motifs.
CRISPRs are segments of prokaryotic DNA containing periodic repetitions of ~30 nucleotides. Each repetition is followed by short segments of “spacer DNA”, typically 30–40 nucleotides long. The spacers are short fragments of nucleotide sequence from phages or plasmids to which the bacterium had been exposed in the past . These fragments in conjunction with the Cas proteins are subsequently used to recognize and destroy the DNA of the same phages or plasmids in future encounters. The CRISPR/Cas system is a form of prokaryotic immune system that confers resistance to foreign genetic elements such as plasmids and phages by recognizing and digesting them . CRISPRs are found in approximately 40% of sequenced bacterial genomes and 90% of sequenced archaea . Given its properties of regularly interspaced repeats with spacers of variable sequence but constant length, it’s not surprising that parts of CRISPRs are among the paired motifs detected by the algorithm.
Table 2 lists significant motif pairs found in the 30 genomes subjected to in-depth analysis that are related to CRISPR. Results were verified by comparison with CRISPRdb, a comprehensive database of known CRISPR occurrences . Candidatus Desulforudis audaxviator MP104C contains two types of CRISPR sequences, GTTTCAATCCCTCGTAGGTAGGCTGGAAAC and CTTTCAGTCCCCTTTTCGTCGGGTCGGTCGCTGAAAC. The first four patterns listed in Table 2 for this genome correspond to the former whereas the last three reflect the latter CRISPR sequence. The patterns consist of two pentamers near the ends of the CRISPR sequence and the spacers, which are variable in sequence bur have a constant length, are responsible for the fixed distance between the pentamers. For patterns detected in Clostridium thermocellum ATCC 27405, the first two arise from repeats GTTTCAATTCCTCATAGGTACGATAAAAAC and the rest are due to GTTT(G/T)TATCGTACCTATGAGGAATTGAAAC. All patterns found in Corynebacterium aurimucosum ATCC 700975 are due to the CRISPR sequence GTGCTCCCCGCGTAAGCGGGGATGAGCC. Similarly, all patterns detected in the other two Corynebacterium species are due to the same consensus GGCTCATCCCCGCTGGCGCGGGGAGCAC.
Note that our software is not intended for detection of CRISPR sequences and the detection of CRISPR-related sequence pairs are a byproduct of the characteristic CRISPR structure. Our method is designed for detection of dispersed sequence motifs, whereas CRISPRs consist of repeats clustered at a small number of loci in the genome. This explains why CRISPR-related motif pairs were not detected in many genomes with CRISPR. The main reason is the requirement that both direct and reverse complement versions of a motif pair independently satisfy the criteria for statistical significance (see Methods). Many genomes contain a single CRISPR locus, which means that all CRISPR sequences are in the same orientation with respect to the direct and reverse strands. Such CRIPSR loci can only be detected if they contain a palindromic pair of pentamers that satisfies all other criteria.
A transcription terminator is a functional sequence located at the 3′ end of genes that mediates the transcriptional termination. In prokaryotes, there are two types of terminators, namely Rho-dependent and Rho-independent terminators. The former require Rho factor to terminate the transcription process while the latter one forms a self-annealing hairpin structure to serve the purpose. The terminator sequence generally contains a GC-rich region of dyad symmetry followed by a short poly-T tract .
Motif pairs related to transcription terminators were found in 2 out of the 30 genomes (Table 3). The results were verified by TransTermHP, which is a specialized software to find rho-independent transcription terminators in bacterial genomes . In Actinobacillus pleuropneumoniae the pattern is a high-G + C palindrome; in Haemophilus influenzae the pattern detected by our method is not a palindrome, but instead includes a poly-T tract. Both features in the two patterns identified correspond to the standard structure of Rho-independent terminators, which consist of a GC-rich palindrome followed by a short poly-T tract.
The fact that transcription terminator-related motif pairs were detected by our program is actually unexpected because the terminators are characterized by the stem-loop secondary structure but not a specific repeated sequence. This is also the reason why we did not detect transcription terminator-related motif pairs in other genomes. However, the H. influenzae genome contains about 1300 copies of the uptake signal sequence with the consensus AAGTGCGGT and terminators in H. influenzae are often composed of two copies of the USS in the opposite orientations that form the stem of the stem-loop structure . That leads to prevalence of this specific sequence in the terminator stem-loop structures and it is the reason why we are detecting terminators in H. influenzae. Analysis of the A. pleuropneumoniae genome with the AIMIE software revealed an abundant motif AAGCGGT, which is similar to the USS in H. influenzae and may have an analogous function . Like the USS in H. influenzae, the A. pleuropneumoniae motif frequently occurs in dyad pairs found at the 3′ ends of genes, which probably serve as transcription terminators.
tRNA-related motifs were detected in four genomes – 3 of them are inside tRNA genes and correspond to parts of a conserved pattern TAGAGC(N)27GGTTCG near the 5′ end of the gene (Table 4). Parts of this pattern are highly conserved in tRNA genes from diverse species . However, the motif pairs in A. butzleri, S. muelleri, and N. profundicola just exceed the significance cutoff of our method and they are not detected in other genomes because the number of copies is not statistically significant.
The pattern in Methanopyrus kandleri AV19 differs from the other three in that it resides outside of tRNA genes, specifically about 10 base pairs downstream of the tRNA genes. Other tRNA genes (about half of the total number of tRNA genes in this genome) have similar patterns at the same position (10 bp from the end of tRNA gene). The consensus sequence of the motif is shown in Fig. 5.
The sequence is palindromic with positions 2–5 and 15–18 being the most conserved. Unlike the other tRNA-related motif pairs, this motif appears to be specific to M. kandleri and we did not find similar motifs in other genomes. The methanogenic archaeon M. kandleri grows at temperatures of 84–110 °C and genome analyses revealed strategies to adapt to these harsh conditions. Among other adaptations, M. kandleri uses a unique tRNA C-to-U editing mechanism at base 8 for 30 different tRNA species . We speculate that the palindrome discovered by our software might serve as a target signal for the 3′ maturation enzyme and its presence specifically in M. kandleri may be related to the unique mechanism of tRNA maturation employed by this organism.
Located around 8 bp upstream of the start codon, Shine-Dalgarno (SD) sequence serves as ribosome binding site in mRNA of prokaryotic genomes . With a 6-base consensus sequence of AGGAGG, the SD sequence recruits and aligns ribosome to mRNA in order to initiate translation .
Motif pairs related to SD sequences were found in seven of the 30 investigated genomes. The left part of the motif pair corresponds to the SD sequence whereas the right part contains the start codon. The SD-related motif pairs arise from the SD sequence being located at the same distance from the start codon in many genes (Table 5). The two Campylobacter species and Helicobacter hepaticus have exactly the same patterns, as do the two Thermosipho species. Exiguobacterium sibiricum only differs from the Thermosipho at one position ahead of start codon (C instead of T); actually all 7 patterns are similar. Interestingly, the start codon ATG in all these patterns is followed by A or AA, suggesting that this start codon context is preferred in these genomes. We speculate that the primary reasons why SD-related motif pairs are found in only seven of the 30 investigated genomes is that the percentage of genes with recognizable SD sequences varies widely among different species and the start codon context is also variable, which leads to significant overrepresentation of exact pentamer pairs in some but not all genomes.
The last major class of motif pairs detected are protein-related motifs, which reside mostly in protein-coding genes. The list of such motifs found in the 30 genomes that were investigated in detail is provided in Table 6. Two types of proteins stand out: one is ABC transporter ATP-binding protein and the other one is PE/PPE family protein.
ABC transporters are transmembrane proteins that utilize ATP hydrolysis for translocation of various substrates across membranes and are widespread in all phyla from prokaryotes to humans ..Motif pairs related to ABC transporter ATP-binding subunits were found in 4 different species. The motif pair GGTGG(N)64GAACC is significant in Leuconostoc mesenteroides and Staphylococcus aureus whereas two Streptococcus species have a significant motif pair GGTGG(N)61GATGA (Table 6). When combined, the motif pairs reveal an extended consensus GGTGG(A/T)(N)60GA(T/C)GAACC, which translates to an amino acid motif GG-x(20)-DEP, where G, D, E, and P denote glycine, aspartic acid, glutamic acid and proline, respectively, and x denotes any amino acid. The GG is part of the characteristic ABC transporter motif LSGGQ and the DEP is part of the Walker B box, which is highly conserved in the ABC transporter protein family .
The PE and PPE proteins were first reported in the genome sequence of Mycobacterium tuberculosis strain H37Rv and were subsequently identified in all mycobacterial species as well as some Rhodococcus and Nocardia farcinica genomes . The proteins are characterized by presence of a PE or PPE domain, respectively, which is a 225 amino acid residue conserved region located near the C-terminus. The PE/PPE domain comprises a pentapeptide sequence motif GxSxG/S at the N-terminus and conserved amino acid residues Ser, Asp and His . However, the conservation of the patterns found in Mycobacterium is due to conserved amino acids in the protein sequence other than this signature domain. The pattern in A. citrulli arises from Y(TAC)D(GAC) repeats in the protein. Motifs found in cytochrome c translate to CxxCH, which is highly conserved in this protein.
While many motif pairs detected by our algorithm can be traced to known motifs with known biological functions, the method also shows potential in detecting novel motifs, such as the motif pair located downstream of tRNA genes in Methanopyrus kandleri that might serve as target signal for tRNA gene 3′ end maturization enzyme. Other potential novel motifs include the motif pair CGAAA(N)19TTTCG in Mycobacterium species and some other motifs located in protein coding genes that are not due to known conserved amino acids motifs (Table 6). We selected a short list of promising potential novel motifs from Additional file 2: Table S2 based on the spacer distance and the percentage of copies in intergenic regions (Table 7). The rationale is that the motifs with regulatory functions are likely to reside in intergenic regions whereas motif pairs in protein coding regions are more likely to be related to properties of the encoded proteins, which, while not without interest, are not the main target of this work. The other criterion is that we chose motif pairs with spacer lengths different from known repeats, such as the CRIPSPR-related motifs. Properties of each of these motif pairs based on the analysis with Pattern Locator (http://www.cmbl.uga.edu/software/patloc.html) are briefly summarized in Table 7.
The motif pair TTAAT(N)5ATTAA of A. Radiobacter has 9 copies in the genome, all of which are located in intergenic regions and mostly about 100 bp upstream of 5′ ends of genes (translation start sites). That indicates their potential functions in gene regulation. Queries to PRODORIC , a database of prokaryotic regulatory interactions, did not produce a match to a motif of the same or similar consensus sequence.
The motif pair CCTAC(N)19TAGGT in D. alkenivorans has 57 copies with 55 of them located in intergenic regions. The distances to nearest gene vary substantially from less than 50 bp to over 500 bp. Eighteen copies of the motif are located between convergent genes (that is, the motif is downstream of the 3′ end with respect to both adjacent genes), which argues against a possible role in regulation of transcription initiation. There is no obvious relationship to genes related to any particular function.
The GCTTAT(N)5AAGCG motif pair in A. ebreus has 114 copies in the genome of which 5 are in genes, 107 are in intergenic regions and 2 partially overlap with genes. Orientation of adjacent genes for intergenic patterns are 44 convergent (−> <−), 4 divergent (<− −>) and 59 co-oriented(<− <− or −> −>). Whether the patterns are located upstream or downstream, their distances to the 5′ or 3′ ends of genes are generally small (less than 50 bp). In an analogy to the motif pair in D. alkenivorans, frequent occurrence between convergently transcribed genes argues against a possible role in transcription initiation.
The motif GAATCCAT(N)23ATGGATTC in B. japonicum has 52 copies with 47 of them in intergenic regions and 5 overlapping with 5′ ends of genes. Almost all motif pairs are proximal (~50 bp) to the 3′ end of a gene, indicating that they might be involved in transcription termination, although the gap between the two parts of this palindromic motif (23 bp) is larger than the typical loop size in the hairpin structures formed by Rho-independent transcription terminators. Majority of the adjacent genes encode hypothetical proteins of unknown function.
The motif pair ATAGCT(N)22CAAAAG in P. naphthalenivorans has 125 copies in the genome of which 101 are in intergenic regions, 18 in genes and 6 overlap with a gene’s start or end. 34 copies are between convergently transcribed genes, again suggesting that the main role of this motif pair is not related to transcription initiation. Similar to the GCTTAT(N)5AAGCG motif pair in A. ebreus, the 101 copies in intergenic regions are often close (~50 bp) to adjacent genes.
The motif pair GGGACAG(N)15TGTCCC of B. animalis has 21 copies in the genome, one of which overlaps with a 5′ end of a gene and the other 20 are in intergenic regions. Ten copies of the motif pair feature at least one adjacent gene involved in amino acid metabolism or amino acid modifications suggesting a potential role in amino acid metabolism. However, most copies of the motif are not proximal to 5′ ends of genes (and mostly closer to a 3′ end of a gene) probably arguing against a role in transcription initiation.
The ATTATA(N)18GTCAA motif pair of P. mobilis (inverted complement TTGAC(N)18TATAAT) has 56 copies in the genome of which 48 are in intergenic regions, three are in genes, one partially overlaps with the 5′ end of a gene, and four overlap with the 3′ end of a gene. Notably, 12 copies are within 50 bp upstream of a tRNA gene. Four additional copies are next to ribosomal protein genes and 12 are next to genes annotated as transcription regulators. The motif conforms to the consensus −35 and −10 sites of bacterial promoters and the precise adherence of these specific genes to the promoter consensus probably reflects the importance of these genes and their efficient transcription. The motif pair TTGAC(N)19ATAAT in C. kluyveri also matches the consensus −35 and −10 site sequences. It has 94 copies of which 78 are in intergenic regions, 15 are in genes 1 is overlap with gene. Over 1/3 of the copies found in intergenic regions are within 50 bp from the 5′ end of genes.
Ab initio detection of candidate functional sequence motifs in complete genomes traditionally relies on word-counting approaches, which follow from a reasoning that selective constraints on a functional sequence motif could lead to statistically significant excess (or deficit) of the motif occurrences in the genome. Consequently, such methods aim to detect specific words (oligonucleotides, substrings…) in DNA sequence that occur significantly more or less often than expected in some null model, generally based on a Markov chain representation of the sequence [33, 44–46]. Other commonly used unsupervised motif-finding methods utilize a probabilistic model of the motif, which allows formulating the motif-finding problem as an optimization task. The optimization is typically solved by one of the Markov chain Monte Carlo (MCMC) class of methods [47–49]. However, the latter methods are generally applied to a collection of relatively short sequences (such as putative promoters) and are not well suited for application to complete genomes.
Our approach is similar to word-counting methods but differs from methods described above in aiming to detect pairs of motifs that exhibit a significant preference for occurrence at a specific distance from each other rather than unexpectedly high occurrence relative to some null model of a random sequence. Another important feature of our algorithm is exclusion of motif pairs that feature identical or similar spacers. This step is designed to filter out motif pairs that arise from duplications of sequence fragments containing the motif pair as well as the spacer sequence, such as those resulting from proliferation of transposons, duplicated genes, or other forms of (large) sequence repeats. Consequently, our method specifically targets motif pairs that are likely maintained by selective constraints acting on the specific relative distance of the motifs, unlike motifs that arise from sequence duplication and may not be functional per se.
The current implementation of the method that was tested in this work is limited to pairs of pentanucleotides and spacer lengths up to 85 nucleotides. These limitations are partially driven by considerations of computational complexity of applying the software for analysis of hundreds of complete genomes. However, the pentanucleotides are also a reasonable choice with respect to DNA-protein interactions, where the sequence-specific bonds form between the exposed amino acid side chains and the base pairs in the DNA major groove, often leading to patterns of four to five adjacent conserved positions . Moreover, pairs of motifs longer than five nucleotides can still be detected as pairs of overlapping pentanucleotides (Tables 2, 3, and 7).
Investigating locations of the detected motif pairs relative to genes and other known functional elements can often provide hints regarding their possible physiological roles or at the minimum help exclude some possible functions. For that purpose, our motif detection pipeline is combined with Pattern Locator, which provides basic statistics on locations of sequence patterns in the genome . Detailed investigation of motif pairs found in 30 selected genomes allowed us to link some of the motif pairs to known biological functions, such as Rho-independent transcription terminators, CRISPR elements, and combinations of the transcription factor binding site and translation initiation site (start codon), which occur at specific distance from each other (Tables 2, 3, and 5). A number of conserved motif pairs were found in genes and we speculate that many of such patterns can arise from constraints on the properties of the encoded proteins, although only some of these patterns are related to previously known protein sequence motifs (Table 6).
A novel motif pair detected in Methanopyrus kandleri is of particular interest due to its location downstream of tRNA genes (Fig. 5). This motif is unlikely to be detected by motif-finding software designed for detection of transcription factor binding sites because this particular motif is located outside the regulatory regions where transcription factor sites generally reside. The word-counting methods that are more suitable for scanning complete genomes for overrepresented sequence motifs are also unlikely to detect such a motif due to their low sensitivity to spaced motif pairs separated by a variable spacer. Due to the unique mechanism of tRNA maturation in M. kandleri , we speculate that this motif could be involved in the tRNA maturation process, possibly as a binding site for the maturation enzyme.
It is important to note that the motif pairs listed in Tables 2, 3, 4, 5 and 6 represent only a fraction of the significant motif pairs detected by our methodology, namely those that we were able to link to a likely physiological function. The full set of motif pairs detected in 569 genomes (Additional file 2: Table S2) contains novel motifs that may not be detectable by other methods. Due to the conservative criteria for the detection of motif pairs and filtering of motif pairs with conserved spacers, we proffer that many of the motif pairs listed in Additional file 2: Table S2 arise from selective constraints on the relative positions of the motifs. Such motif pairs could play important physiological roles and at the same time escape detection by standard motif-finding techniques. A subset of selected candidate novel motifs (Table 7) was subjected to additional analysis that allows narrowing down a possible range of functions of these motifs. We conclude that method for detection of significant motif pairs described above is capable of detection of novel functional elements that are unlikely to be discovered by other method and we offer the paired-motif methodology as a tool to complement mainstream motif-finding methods for detection of functional elements in complete genomes.
We present a novel motif-finding method based on detection of pairs of sequence motifs with statistically significant preference for a specific distance from each other. The method is suitable for application to long DNA sequences including complete genomes. Application to 569 prokaryotic genomes yielded a list of 3326 significant motif pairs (pairs of pentamers in the present implementation of the method) including many that are related to sequence motifs of known functions as well as novel sequence motifs. The complete list of all significant motif pairs found in the 569 genomes is available in Additional file 2: Table S2. We propose the methodology as a suitable complement of the set already existing techniques for discovery of functionally significant sequence motifs.
DNA sequences analyzed in this work are available from the NCBI FTP server at ftp://ftp.ncbi.nlm.nih.gov/genomes/archive/old_genbank/Bacteria/. The dataset generated in this work is presented in Additional file 2: Table S2. Software designed for the data analysis is available at http://www.cmbl.uga.edu/downloads/programs/Motif_Pairs/.
HT designed software, developed statistical methodology, performed data analysis, and drafted the manuscript. PDS developed the statistical methodology, supervised research, and assisted in drafting the manuscript. JM conceived the study, supervised research, and assisted in development of the methodology, data analysis, and drafting the manuscript. All authors read and approved the final manuscript.
Tompa M. An exact method for finding short motifs in sequences, with application to the ribosome binding site problem. Proc Int Conf Intell Syst Mol Biol. 19992;62–71. https://www.aaai.org/Papers/ISMB/1999/ISMB99-030.pdf.
DasGupta A. Exact Tail Probabilities and Percentiles of the Multinomial Maximum. Purdue University. 2009. http://www.stat.purdue.edu/~dasgupta/mult.pdf. Accessed 15 Mar 2015.
Zhang Y. Zhang Lab Website. http://zhanglab.ccmb.med.umich.edu/NW-align. Accessed 10 Aug 2014.
Mrazek J, Xie S. PatternLocator. 2006. http://www.cmbl.uga.edu/software/patloc.html. Accessed 20 Oct 2014.
NCBI. NCBI FTP Server. ftp://ftp.ncbi.nlm.nih.gov/genomes/archive/old_genbank/Bacteria/. Accessed 20 Jan 2013.
|
0.999999 |
Throughout history, people have dreamed of living in a perfect society, but they have not agreed on what an ideal society would be like.
What do you think is the most important element of a perfect society in the modern world?
How can people work towards achieving an ideal society?
Most people in the world have a dream to live in an ideal society and lead a happy and meaningful life. However, they do not have the same idea about what the perfect society would look like. I personally think that there are three indicators that can measure the perfection of a society in the modern world: social value, proper infrastructure and employment opportunity. This essay discusses these factors and the ways to achieve that ideal society followed by the examples.
Firstly, social value and social bonding among people is the most important aspect of a perfect society. In a society where people have a strong bonding and obey the social norms tend to lead a better life. Society is formed with many families. If the family members are close and have a better relationship, they would form a better society. A perfect society must have people with human quality and good social behaviours.
Secondly, having good infrastructures and services can be one of the requirements of a perfect society. People need the infrastructures and public services to fulfil their necessity. Take people living in Melbourne as an example. Melbourne is claimed as a most livable city in the world and the people can be classified to live in a perfect society. This country has so many modern infrastructures, for example, modern public health centre, school, bus stop, and others as well as good services in the airport, local government office, etc. This ideal condition can be achieved if the people pay the tax regularly and obey the rules. The tax payment becomes a resource to build good and complete facilities for society. Furthermore, if the society obeys the regulation, they will not have problems with the services of people.
Thirdly, an ideal society needs sufficient job fields to work in. People can fulfil their needs by having a good salary from their work and have a good career in the future. For example, people in Los Angeles spend most their time for working and have a good financial condition. This situation can be created by the society if people can be an entrepreneur. By being an entrepreneur, they can create new work fields for others and reduce the number of unemployed people.
In conclusion, a perfect society has to have good infrastructures and services as well as sufficient job vacancy. Then, this situation can be built by paying tax, obeying the policy, and creating the work-fields by entrepreneurs.
|
0.999848 |
Проанализировав таблицы, сделаем следующие выводы. Благодаря свободному входу на рынок появляется возможность сменить поставщика на более выгодного. А географически удобное расположение рынка при использовании хорошей рекламы поможет ускоренному продвижению товара на рынок. Кроме того, возникает шанс сгладить некоторые слабые стороны широко распространить ПП по стране в рамках своей специализации и следовательно расширить объем закупок. Способность ПП к модификации поможет оперативнее подстроиться к быстрому росту КТ. Также совершенствование КТ позволит избавиться от некоторых слабых сторон, т.е. мы сможем создать собственный редактор, обеспечить совместимость с другим ПП, разработать собственные компоненты, тем самым исключив зависимость от поставщика. Большинство сильных сторон способствует удовлетворению спроса отечественных потребителей в данной iере производства. Данный спрос обеспечит стабильность поставок и сгладит особенности применения ПП. Государственная поддержка малых предприятий позволит использовать ресурсы на льготных условиях, а также компенсирует такую угрозу как несовершенство налоговой системы. Отсутствие зарубежных конкурентов дает нам независимость от зарубежного поставщика, что снижает объем расходования ресурсов. Такая сильная сторона ПП как «способность к модификации» компенсирует деновацию и увеличит ЖЦТ. Практически все сильные стороны дадут нам выгодные преимущества перед конкурентами. Хорошая обеспеченность оборудованием позволит быстро модифицировать продукт, а значит увеличить ЖЦТ. В нашей стране существует такая угроза как медленное внедрение КТ в производство, но ее можно несколько снизить усовершенствованные и новые функции позволят применить ПП на новом оборудовании, а узкая специализация станет сильной стороной т.к. обеспечит целенаправленное внедрение. Применяя при этом эффективную рекламу и рассказывая о качестве товара, мы можем сгладить фактор «привычки». Фактор «привычки» это привыкание пользователя к старым ПП и нежелание тратить деньги на новые, более эффективные. Многие слабые стороны усиливают преимущества конкурентов, но избавиться от этих сторон можно с помощью имеющихся возможностей. Так, например, такую слабую сторону как «отсутствие собственного графического редактора», которая, несомненно, снижает конкурентоспособность ПП, можно исправить созданием собственного редактора, благодаря росту КТ. Таким образом сопоставив сильные и слабые стороны с возможностями и угрозами, мы не обнаружили каких-либо серьезных препятствий для разработки ПП.
122. Swot-анализ рынка мобильной связи ОАО "МегаФон"
American experience of state regulation of sphere of social maintenance testifies to expediency and necessity of the decision of social problems for close interaction of the government officials, private(individual) and public structures, each able-bodied citizen and extreme precise definition in the appropriate instructions both acts of their rights and duties at preservation of managing function of the state.necessity of constant maintenance of socio economic safety of the country by duly rendering of necessary material support to requiring layers of the population, and also maintenance of social integration of various layers of the population requires(demands) steady performance of the following socio economic measures:round account economic, organizational and demographic factors from the different parties and in a various measure influencing social vulnerability of the citizens and their families, and also ability of the state to the proved changes and additions in structure of the working order of rendering of social support in connection with steady dynamics(changes) of development and perfection of the socio economic attitudes(relations) in public life;differentiation of payments of state pensions and grants(manuals) which are carrying out function for the reasons, independent of the worker, of lost earnings (of pension on age, physical inability, in a case of loss of the supporter, reception of an industrial trauma, unemployment benefit) on principles of insurance and social grants(manuals) to the requiring citizens from budget means of all levels of authority;of the scientifically proved normative base for an establishment about a minimum and forms, connected to this parameter, of rendering assistance.decades the state in USA expands in sphere of social maintenance methods of indirect regulation, first of all, tax privileges, royalty, doing (making) thus economically favourable to the employers expansion of scales and spectrum of rendering of social services to the workers and not working population. The special role thus there is a state social insurance (pension, on a case of unemployment, industrial and household), which not only promotes increase of economic safety of the population, carrying out the basic functions of social protection, but also the adequate compensation of the lost incomes, and also is the major factor of realization of principles and methods of achievement of social integration and increase of labor motivation of participation in public manufacture. In the united States of America the basis of socio economic safety of the pensioners, invalids, persons lost the supporter, or invalid is served by(with) the General(common) federal program of insurance, which was soon distributed on all workers working on hiring and on engaged individual labor activity. The specified program in the legislative order has established the responsibility of the employers for duly payment when due hereunder and in complete volume of insurance payments, regular of pensions and control of their charge to each pensioner, the sizes of which pension depend on the actual experience of work.element of social maintenance of the workers is the system of insurance of the unemployed, within the framework of which last decades develop the new approaches to coordination of payment of the grants(manuals) with measures directed on search of new sources of the income, retraining who does not have chances to return on former work or in general to work on the specialty, i.e. on transformation of the unemployment benefits from insurance fund in fund for the device on work. The experience of realization of the programs on rendering assistance requiring in it(her) shows, that the purposes of decrease(reduction) and restraint of distribution of poverty cannot be achieved only by realization of the special programs focused on the poor population. Changes in all structures of a society(community) for the changes in all structures of a society(community) for changes in all structures of a society(community) The transferring of a center of gravity of rendering of social services to the population from granting of the social grants(manuals) on creation of the necessary and economically justified social conditions for possible(probably) of more complete use of labor, intellectual and moral potential of the able-bodied citizens is in USA the main strategic direction of reforming of all system of rendering of the social help in it(her).with preservation and support of state system of pension insurance and reforming of system of rendering of the regular help to poor layers of the population key elements of policy (politics) on a boundary of centuries became provision of economic incentives having for an object creation of new workplaces and bases for economic growth in the long term - measures promoting increase of economic and social safety present and the future generations. The reduction last years in connection with the next financial crisis and restriction of action of the separate programs on rendering assistance to poor layers of the population at all does not mean decrease(reduction) of state participation in maintenance of social guarantees, faster opposite (on the contrary), the necessity of modernization of the social programs requires(demands) amplification(strengthening) intervention of the state in process of redistribution of means of social protection and development of social guarantees adequate to a present stage of public development, rationalization of realization of the social programs.policy(politics) of social maintenance in USA has accepted the modern form not at once in a modern kind, she(it) has passed the long period of development, and at different stages to it(her) those or other features taking into account concrete historical needs(requirements) and priorities of economic and social safety both usual hired worker, and left on the deserved rest and pension maintenance, forms and methods of influence on economic behavior of the workers and employers were peculiar. Thus, 78% of an account parts of the federal budget are necessary on charges connected to social maintenance and expansion of availability of educational, medical, social and other services - all that promotes strengthening of physiological, intellectual potential of each American. The redistribution of means through the state budget which is carried out in increasing scales, is a basis of social support of the American citizens.in USA per 90-s' years of reform in sphere of social maintenance were caused first of all by growing level of obligatory expenses, valid of more and more adverse demographic differentiation of the population of the country, changes of family structures, shifts in the market of work in the party of less protected forms of employment in connection with constantly increasing competitive pressure of larger corporations and monopolies, and at the end are directed on redistribution of the responsibility between the state, social partners and private persons within the framework of system of social protection as a whole. The acceptance by business last years of the much greater social responsibility assumes, alongside with rendering of usual social protection of the population, and a number(line) of additional organizational measures, in particular, maintenance of measures on expansion of access to continuous training and training for a new profession is direct on workplaces for the recipients (consumers) of the grants(manuals) in view of specificity of the appropriate quota, in particular of unemployeds of the women who are coming back on the market of work after a long break. The important direction of involving of private(individual) business in the decision of problems of employment of the specified recipients is also granting of auxiliary services in a place of work, for example, such as services in a leaving(care) of children.90 years the interaction of state structures, private(individual) sector and public organizations in social sphere differed increased and expansion of a circle of soluble problems, that was connected first of all to reorientation of social support to the needy Americans in employment and professional conversion training. Maintenance of socio economic guarantees still it is enough to the hired workers and not working population not only basic condition and simultaneously by guarantee of social stability in a society(community) and preservation of the property, but also important factor of increase of competitiveness able-bodied, but easily vulnerable in the market of work of the citizens. The secondary involving of the not working pensioners in public manufacture, more complete use their labour, intellectual, and quite often and greatest creative potential yet up to the end using the potential resources is not only consequence of new transformations in a society(community), but also important factor of new economic growth in the country.analysis of practical realization of the social programs of private(individual) business and their state stimulation has shown, that during last decades the state all uses in sphere of social maintenance methods not only direct (establishment of the minimal wages, insurance industrial, insurance on a case of unemployment), but also indirect regulation (for example, tax privileges to the businessmen introducing the social programs at the enterprises), doing(making) thus economically favourable to the employers expansion of scales and spectrum of social services more widely.the basis of the analysis of dynamics(changes) of the basic parameters of development of the General(common) federal program (ОФП) it is possible to make a conclusion that on scales of scope of the population, volume of annual payments - the basic program of state social maintenance quite and covers an overwhelming part of the own population. During the existence she(it) has undergone numerous corrective amendments at preservation of the basic principles:fastening of the right of each working citizen on pension on age, on the disability pension, in a case of loss of the supporter, on unemployment;establishments of the minimal guaranteed level of the incomes for the persons 65 years also are more senior, blind and invalids;established responsibility of the employers and workers for payment when due hereunder of insurance payments;the legislatively established guarantees on duly payment is regular of pensions and control of their charge;solidarity of generations, when the grants(manual) by the one who has reached(achieved) pension age, are financed by the nowadays working Americans;personal interest insured, the sizes of which pension depend on the insurance experience of work.1956 this program has united insurance on age (founded in 1935), insurance on a case of loss of the supporter (1939), insurance on the invalidity which has been not connected to accident on manufacture (by 1956), and also payments within the framework of state system of social insurance. The state system of pension insurance differs by flexibility of the basic parameters of a profitable part - rate of the taxation and minimal size of wages of the workers and employees covered with a state pension scheme, that provides close communication (connection) between with parameters of development of the American economy and financial stability of system of pension maintenance in difference, for example, from Russia. During 1990-1998 The minimal size of the labour incomes subject to the taxation within the framework of system of social insurance, has increased with 51,3 thousand dollars up to 68,4 thousand dollars. According to available by the data of Administrative - budget management by 2009 the level has increased up to 82,8 thousand dollars. The general (common) federal program of insurance is a basis of economic safety of the persons who have reached(achieved) pension age, lost the supporter, invalid. The grants(manual) on a line of state system of social maintenance have the especially important meaning(importance) for separate categories of the elderly population, being by a unique(sole) source of the income for 20% of the bachelors and 25% of the unmarried women in the age of 65 years and are more senior. State guarantees of pension maintenance and health services of the persons of elderly age, including a long-term leaving(care), help in search of work and preservation of a workplace at presence of desire and ability to work after an output(exit) on pension, various tax privileges, and also stimulation of development of the private(individual) pension plans, distribution of the personal pension accounts, promoted hardening of economic independence of the pensioners, transformation them in the most socially protected age group of the population of USA and decrease(reduction) of their dependence from state support from budget means. In the united States to America both woman, and the men on pension leave per 65 years, that can serve a rather attractive example with the purposes of the further perfection of pension maintenance for many countries, including for Russia. It is possible to issue the deserved rest for three years earlier, but then these three years of payment will be on 20 percents(interests) less. The size of pension depends on the labour experience, his(its) continuity and salary. Such order stimulates the population to the maximal participation in labour activity, especially female population, dynamics(changes) of which participation last years appreciablly has grown.pension makes 50-80 percent (interests) from the individual salary - on the average 700 dollars per one month. If the man never worked or his(its) pension does not exceed 75% of a level of poverty, the state pays to it(him) the grant(manual) at a rate of 280 dollars per one month. In USA work both state, and private(individual) pension systems. The majority of the Americans is provided to themselves some with pensions: state, private - collective: in a place of work and private - individual.it turns out the same as at us: all workers pay pension payments, and from this money pay pensions to the elderly people. The hired workers give back in 7,5 percent (interests) of the earnings. His(its) employer as much pays for each hired worker. And the persons of free trades - artists, lawyers, businessmen - are obliged to deduct in pension fund already 15 percent (interests), acting simultaneously in a role both employer and hired worker. The additional pension can be saved in not state pension funds created in a place of work. They are very popular in America, as are favourable to the employers (then they receive tax privileges). Besides each American has the right to open the own pension account in any pension fund.in USA and in other advanced capitalist countries, for example in Sweden, Germany, France, experience of realization of the social programs on creation of necessary social conditions and social infrastructure of the enterprises, establishments, organizations and not working population, and also rendering of the social help to the deprived in it(her) deprived and needy population can by the most direct image be used by development of the domestic mechanism of social maintenance and social protection of the citizens, preparation and acceptance Russian legislative and the certificates (acts) regulating socio economic sphere of activity. The system of the socio economic attitudes(relations) in USA concerning social maintenance with the purposes of realization of state guarantees minimal under the American standards of means to existence adequate replacement of the lost source of the incomes in case of loss or decrease(reduction) of work capacity, loss of the supporter, occupational disease, expansion of availability of educational, medical, social and other services expansion of guarantees of social maintenance became the main long-term strategic tendency. The specified circumstance speaks about expediency to adopt foreign experience not and fragmentary, and in the complex order - complete package because of the deep and proved interdependence of its (her) structural elements.the present time in the united States has developed powerful and effective enough not only socio economic, but also legal base ensuring in national scale economic safety, guaranteed by the state, of the citizens in cases, when they are exposed to objectively existing risks of decrease (reduction) or loss of their constant earnings (income), including after achievement of pension age, loss of the unique(sole) supporter, physical inability, dismissal not on their fault from work. Expedient and competent use of this centuries-old experience and organized mechanism on creation of necessary social conditions and guarantees, and also necessary social infrastructure for the worker and not working population, and also under the indication of the social help to the deprived in it(her) deprived and needy population is essential and expedient necessity especially in the present period of reorganization some more not settled socio economic attitudes(relations) in our society(community).on an example of USA in conditions of market economy the Russian state should take up the general(common) socio economic responsibility for complex system of social maintenance of the population in national scale, which in itself market to create be not capable. The general(common) socio economic responsibility of the state leaves far for frameworks only acceptance of the necessary and socially proved acts, but it should to the full supervise their performance and is severe punish the careless officials, почивших on laurels achieved by them different and is far from being always by plausible ways of the appropriate administrative rule(situation). Actually state with the purposes of own self-preservation by the forces is obliged to take up all completeness of the responsibility for a management(manual) and control above all social systems, which by legislative measures are submitted as obligatory to execution(performance) and for the workers, and, especially, of their employers. But for realization of the specified norms and rules ensuring a necessary level of social care and support of the needy population the chief of state and the officials of maximum ranks should in an enough complete measure correspond(meet) to a borrowed(occupied) rule(situation). In these purposes the creation of system of constant professional retraining of this staff is an extremely urgent and major urgent task among other measures on maintenance of state economic safety of the country. The state regulation of socio economic development in conditions of boundless freedom of market elements, boundless competition, ideological individualism and global personal egoism is not simple business and requires(demands) the maximal purposefulness, deep professional knowledge and considerable intellectual, strong-willed and creative efforts. Now necessity of state intervention in the decision of problems of social maintenance any more is not exposed to doubt. The speech now goes any more about that, is necessary or the state control and state management of a national economy and first of all behind a course of realization of the social programs, and about search and realization optimum or even of most rational methods of state influence on socio economic processes in a society(community) is not necessary. Even last decade, in conditions of revival of the tendency to the personal responsibility for own well-being of the able-bodied and hardworking citizens and new wave of activization of debate on a privatization of pension system, now even most which supporters do not reject a managing role of the state in a part of maintenance of a guaranteed level of pensions, in insurance is brave of private(individual) memory systems, and also in regulation of employment of the pensioners as the forms of their additional material self-maintenance by products of a feed(meal), footwear, clothes, goods of cultural - household purpose(assignment) and payments for usage by still substandard municipal services. Therefore expediency and necessity of study of rich foreign experience on maintenance of the population by necessary social conditions, support and help to needy layers is the conclusive debt, obligatory to execution (performance).
Как показали результаты исследования, около 50% компаний строят системы оценки эффективности, базируясь исключительно на финансовых показателях, ярким доказательством ущербности такого подхода служит корпорация Xerox, которая, являясь одной из крупнейших мировых корпораций по производству копировальной техники, в конце 1970-х годов понесла ощутимые убытки, едва не приведшие к разорению этого гиганта. Первоначально Xerox сдавала в аренду копировальные аппараты, зарабатывая на каждой копии, сделанной с их помощью. Высокие затраты на бумагу, заправку картриджей, ремонт машин, а также выбранная стратегия привели к тому, что клиенты не понимали, почему они должны нести ощутимые издержки из-за оборудования, которое плохо работает и постоянно ломается. Вместо того чтобы изменить стратегию, управляющие Xerox сосредоточились на улучшении финансовых показателей, не обращая внимания на растущее недовольство клиентов. Руководством компании было принято решение о переходе на новую стратегию, связанную с продажей техники и организацией множества сервисных центров, что, естественно, привело к существенному увеличению затрат. Данная стратегия содействовала достижению корпоративных целей, связанных с ростом прибыли и повышением рентабельности капитала, но только в краткосрочной перспективе. Вследствие того, что сервисные центры не успевали обслуживать клиентов, многим из них приходилось покупать несколько машин, тем самым приумножая финансовые результаты Xerox. Естественно, такая ситуация не могла удовлетворить большинство клиентов компании - они хотели иметь относительно недорогие аппараты, более надежные в эксплуатации и производящие более качественные копии. С приходом на рынок американских и японских конкурентов Xerox начала стремительно терять свои позиции. Новички уделяли большое внимание качеству копий, их машины были более надежными и менее дорогостоящими. Таким образом, Xerox полностью потеряла былое преимущество и была вытеснена с рынка. Только в начале 1980-х годов, с приходом нового руководства, поставившего во главу угла корпоративной стратегии улучшение качества продукции и повышение уровня удовлетворения потребностей клиентов, компании постепенно удалось частично восстановить свои позиции.
The main levers of management of a national economy, regions, companies and enterprises are the prices for the goods both services and taxes to the proceeds from realization of commodity production, which structure includes also proceeds from realization of services to the population, enterprises, establishments and organizations. Whether the prices should be adjusted by the state or carry spontaneous character? Стихийность ценообразования as a consequence boundless демократизации in economic activity already has proved the economic inconsistency and does not require additional substantiations of its(her) unfitness for economic activity and balanced development of economy of any country. The economically unreasonable failure(refusal) of the doctrine of participation of the state in management of economy of our country has resulted the country in a general(common) economic crisis. Galloping inflation, as a consequence of holiday of the prices in the period of the most active reorganization of the economic attitudes(relations) (1992-1999 гг.), resulted(brought) to обнищанию of basic weight of the population and bankruptcy of a significant part of the enterprises and continuing the destructive influence on economic activity of the enterprises and ability to live of the population which has received the name of "shock" therapy, отзвуки with which and till the present time do not cease, at all was not economic necessity. The price has appeared is too great for the carried out(spent) reorganization, and the results - are much lower than the initial purposes. The balanced price policy(politics) is the integral function of any civilized state, имманентно inherent to it(him) as a part whole организма. The failure(refusal) of the control, regulation and management of the prices on the goods and services actually means self-elimination of state structures from management of a national economy and therefore from government. The economy which has been released(let off) on самотек, objectively be not capable to reach(achieve) any national purpose. Besides the former purposes and former primitive ideology were quite is proved are thrown out for a board of a history, and new standard ideology, except for immense enrichment and pursuit of profit till now and is not produced. Hence, already настала it is time обнародовать national idea, which would reconcile all layers расслоившегося of a society(community) and precisely enough and, main, fairly would express interests of the state and people. The essence of national idea of the current moment, on our sight, consists in the following. The maintenance of well-being, health and safety of a nation in a harmonious combination to strengthening and further development of intelligence and духовности of the population of the country also is the simultaneously main idea, purpose both prime task of the state and society(community) as a whole. The achievement of this purpose is possible only as a result of radical reorganization of the usual system индикативного of management of a national economy, its(her) regions and branches.these conditions the question on maintenance of economic safety of the enterprises, companies, and also regions, economy and population of the country as a whole is superurgent, and on importance and sequence of national problems strongly costs(stands) on the first place. To number of major structural elements of economic safety of a national economy branches, conducting her,(it,) and companies it is necessary to attribute(relate) the following: the control for ценообразованием, sizes of wages (its(her) conformity to demand on the goods of mass consumption, measure and quality of work, and also тарифно-qualifying directory of payment of work from working up to the president developed still(even) in 2010 in institute ЦНИЭИуголь Минэнерго) and system of the taxation. For this reason it is represented to most expedient not selective, but their complex decision. First of all it concerns maintenance of steady growth and conformity between demand for the goods both services, on the one hand, and sizes of wages of the workers and pensions, with another., the initially developed and authorized tax system so strongly also is economically perfectly unreasonably overloaded диффе-ренцированными with the specifications and фондообразующими by parameters and does not correspond(meet) to tasks, facing to it(her), what even its(her) annual updatings, change and addition be not capable залатать all of its(her) hole. From 45 taxes authorized in перестроечный the period, more than half did not work, and other part worked less than half. To the present time there were 15 kinds of the taxes, but you see and this number is overestimated not less, than in 15 times. A number(line) of the taxes, not having substantial economic sense, carry out obvious деструктивную function. So, for example, the tax, working till now in a coal industry, to production of minerals (НДПИ) instead of alignment of economic conditions of economic activity of the mining enterprises by neutralization of influence of the natural factors (conditions залегания угля in недрах, quality of extracted raw material etc.) simply takes from the proceeds a part of the profit угледобывающих of the enterprises most фондоёмкой of branch and instead of involving her(it) in economic circulation by maintenance and development of working mine fund оседает by a dead cargo in недрах госбюджета, not bringing any advantage(benefit) neither coal companies, nor national economy. In result the most labour-consuming branches have no a real opportunity in time to ensure(supply) reproduction of leaving capacities and effective economic activity., taking into account, that an overall objective of a national economy as a whole is the maintenance social, intellectual both moral values of the population and national economy as a whole, including at a level of each enterprise and each coal company is the increase of well-being of the workers, the taxation by the taxes of a parameter expressing this purpose, is economically not solvent and деструктивным by the factor.one Uniform state tax at a rate of 20-25 % from the proceeds of each subject of the Russian economy suffices for normal economic activity to ensure(supply) with financing all надстроечную structure of management of the country, public health services, education, science, culture and its(her) safety. One more example that mechanical copying of foreign experience to anything useful result can not, as has found acknowledgement(confirmation) in the received results. Business that in our country a level of wages of basic weight of the workers and in доперестроечный the period in 3-4 times was lower, than in the advanced countries of Western Europe, Japan and USA, in summary reorganizations it(he) has decreased still approximately in as much time, therefore the general(common) level of pensions and wages of basic weight of the population has appeared on the order below incomes of the hired workers in the advanced countries. Technique of definition Uniform госналога instead of 45 working now (in which calculation even the skilled bookkeepers are confused till now) is extreme simple - account enough part of the budget to divide on ВВП and умножить into factor of a reserve at a rate of from 20 up to 25 % and size Uniform госналога (ЕГН) is ready. The structural analysis of economic activity shows, that manufacture of the goods for the population inside the country was reduced more, than three times, the capital investments in real sector have decreased in 5-6 times, and the export of the capital abroad in commercial interests has reached(achieved) the enormous sizes already which have exceeded the national budget of the country. It proves to be true by the following data of official statistics, tab. 1.
The main levers of management of a national economy, regions, companies and enterprises are the prices for the goods both services and taxes to the proceeds from realization of commodity production, which structure includes also proceeds from realization of services to the population, enterprises, establishments and organizations. Whether the prices should be adjusted by the state or carry spontaneous character? Стихийность ценообразования as a consequence boundless демократизации in economic activity already has proved the economic inconsistency and does not require additional substantiations of its(her) unfitness for economic activity and balanced development of economy of any country. The economically unreasonable failure(refusal) of the doctrine of participation of the state in management of economy of our country has resulted the country in a general(common) economic crisis. Galloping inflation, as a consequence of holiday of the prices in the period of the most active reorganization of the economic attitudes(relations) (1992-1999 гг.), resulted(brought) to обнищанию of basic weight of the population and bankruptcy of a significant part of the enterprises and continuing the destructive influence on economic activity of the enterprises and ability to live of the population which has received the name of "shock" therapy, отзвуки with which and till the present time do not cease, at all was not economic necessity. The price has appeared is too great for the carried out(spent) reorganization, and the results - are much lower than the initial purposes. The balanced price policy(politics) is the integral function of any civilized state, имманентно inherent to it(him) as a part whole организма. The failure(refusal) of the control, regulation and management of the prices on the goods and services actually means self-elimination of state structures from management of a national economy and therefore from government. The economy which has been released(let off) on самотек, objectively be not capable to reach(achieve) any national purpose. Besides the former purposes and former primitive ideology were quite is proved are thrown out for a board of a history, and new standard ideology, except for immense enrichment and pursuit of profit till now and is not produced. Hence, already настала it is time обнародовать national idea, which would reconcile all layers расслоившегося of a society(community) and precisely enough and, main, fairly would express interests of the state and people. The essence of national idea of the current moment, on our sight, consists in the following. The maintenance of well-being, health and safety of a nation in a harmonious combination to strengthening and further development of intelligence and духовности of the population of the country also is the simultaneously main idea, purpose both prime task of the state and society(community) as a whole. The achievement of this purpose is possible only as a result of radical reorganization of the usual system индикативного of management of a national economy, its(her) regions and branches.these conditions the question on maintenance of economic safety of the enterprises, companies, and also regions, economy and population of the country as a whole is superurgent, and on importance and sequence of national problems strongly costs(stands) on the first place. To number of major structural elements of economic safety of a national economy branches, conducting her,(it,) and companies it is necessary to attribute(relate) the following: the control for ценообразованием, sizes of wages (its(her) conformity to demand on the goods of mass consumption, measure and quality of work, and also тарифно-qualifying directory of payment of work from working up to the president developed still(even) in 2010 in institute ЦНИЭИуголь Минэнерго) and system of the taxation. For this reason it is represented to most expedient not selective, but their complex decision. First of all it concerns maintenance of steady growth and conformity between demand for the goods both services, on the one hand, and sizes of wages of the workers and pensions, with another. , the initially developed and authorized tax system so strongly also is economically perfectly unreasonably overloaded диффе-ренцированными with the specifications and фондообразующими by parameters and does not correspond(meet) to tasks, facing to it(her), what even its(her) annual updatings, change and addition be not capable залатать all of its(her) hole. From 45 taxes authorized in перестроечный the period, more than half did not work, and other part worked less than half. To the present time there were 15 kinds of the taxes, but you see and this number is overestimated not less, than in 15 times. A number(line) of the taxes, not having substantial economic sense, carry out obvious деструктивную function. So, for example, the tax, working till now in a coal industry, to production of minerals (НДПИ) instead of alignment of economic conditions of economic activity of the mining enterprises by neutralization of influence of the natural factors (conditions залегания угля in недрах, quality of extracted raw material etc.) simply takes from the proceeds a part of the profit угледобывающих of the enterprises most фондоёмкой of branch and instead of involving her(it) in economic circulation by maintenance and development of working mine fund оседает by a dead cargo in недрах госбюджета, not bringing any advantage(benefit) neither coal companies, nor national economy. In result the most labour-consuming branches have no a real opportunity in time to ensure(supply) reproduction of leaving capacities and effective economic activity. , taking into account, that an overall objective of a national economy as a whole is the maintenance social, intellectual both moral values of the population and national economy as a whole, including at a level of each enterprise and each coal company is the increase of well-being of the workers, the taxation by the taxes of a parameter expressing this purpose, is economically not solvent and деструктивным by the factor.one Uniform state tax at a rate of 20-25 % from the proceeds of each subject of the Russian economy suffices for normal economic activity to ensure(supply) with financing all надстроечную structure of management of the country, public health services, education, science, culture and its(her) safety. One more example that mechanical copying of foreign experience to anything useful result can not, as has found acknowledgement(confirmation) in the received results. Business that in our country a level of wages of basic weight of the workers and in доперестроечный the period in 3-4 times was lower, than in the advanced countries of Western Europe, Japan and USA, in summary reorganizations it(he) has decreased still approximately in as much time, therefore the general(common) level of pensions and wages of basic weight of the population has appeared on the order below incomes of the hired workers in the advanced countries. Technique of definition Uniform госналога instead of 45 working now (in which calculation even the skilled bookkeepers are confused till now) is extreme simple - account enough part of the budget to divide on ВВП and умножить into factor of a reserve at a rate of from 20 up to 25 % and size Uniform госналога (ЕГН) is ready. The structural analysis of economic activity shows, that manufacture of the goods for the population inside the country was reduced more, than three times, the capital investments in real sector have decreased in 5-6 times, and the export of the capital abroad in commercial interests has reached(achieved) the enormous sizes already which have exceeded the national budget of the country. It proves to be true by the following data of official statistics, tab. 1.
Assets - anything owned by an individual, company, legal body or government which has a cash value.Big Bang -a system of major changes which brought deregulation to the London Stock Exchange in 1986. Bill of Exchange - an officially signed promise to pay to the receiver of the bill, the stated at the fixed time. Bond - a certificate issued by the borrower as a receipt for a loan usually longer than 12 months; it indicates the interest rate and the date of repayment. Eurobond-an international certificate issued by the borrower for a long-term loan (from 5 to 15 years) in any European currency but not in the currency of the issuing bank.Securities-general term for stocks and shares of all types.Exchange-a market for the toll purchase of goods or securities. Stock Exchange-a market for short or long term transactions in securities . Commodity Exchange-a stable market for wholesale transactions in preferably commodities and raw materialsMoney Market-a market for money instruments with a period of validity of less than one year. Factoring- a business activity in which a company takes over the responsibility for collecting the debts of another company. Fund Management- managing investors funds on their behalf or advising investors on how to invest their funds. Financial Futures-legal contracts for the sale or purchase of financial products on a specified future date, at the price agreed in the present.Option-A contract giving the right to buy or sell financial instruments or goods for a stated period at a stated price.The London Bullion Market -The international gold and silver market in London where trade is done by a telephone or electronic links.HedgeThe purchase or sale futures contract as a temporary substitute for a transaction to be made at a later date Open-Ended Fund-A fund without a fixed number of shares Quite-edged loans -Loans issued on behalf of the Government to fund its spending.
After a half century of Community history, Europeans still have a lot of soul-searching to do: How far could and should the Union be taken in order to maximise the strength which derives from unity, without at the same time eroding identity and destroying the individual ethos which makes the richness of our nations, regions and cultures? Can they move forward in step, thanks to the natural harmony which favours consensus between 15 countries, or should they recognise divergences of approach and differentiate their pace of integration? What are the limits of Community Europe, at a time when so many nations, starting with the new democracies of central and eastern Europe and the Balkans, along with Turkey, are asking to join the process of unification in progress? How can the people of Europe get everyone involved in the Community undertaking and give them the feeling of a European identity which complements and goes beyond fundamental solidarity?
Principle of performance of action. Any system is intended for any well defined and concrete goal specific for it, and for this purpose it performs only specific (target-oriented) actions. Hence, the goal of a system is the aspiration to perform certain purposeful actions for the achievement of target-oriented (appropriate) result of action. The plane is designed for air transportation, but cannot float; for this purpose there is an amphibian aircraft. The result of aircraft performance is moving by air. This result of action is expectable and predictable. The constancy and predictability of functional performance is a distinctive feature of any systems living, natural, social, financial, technical, etc. Consequently, in order to achieve the goal any object of our World should function, make any purposeful actions, operations (in this case the purposeful, deliberate inaction is in some sense an action, too). Action is manifestation of some energy, activity, as well as force itself, the functioning of something; condition, process arising in response to some influence, stimulant/irritant, impression (for example, reaction in psychology, chemical reactions, nuclear reactions). The objects action is followed by the result of action (not always expected, but always logical and conditioned). The purpose of any system is the aspiration to yield appropriate (targeted) result of action. At that, the given object is the donor of the result of action. The result of action of donor system can be directed towards any other system which in this case will be the recipient (target) for the result of action. In this case the result of action of the donor system becomes the external influence for the recipient system. Interaction between the systems is carried out only through the results of action. In that way the chain of actions is built as follows: ... > (external influence) > result of action (external influence) >... The system produces single result of action for single external influence. No object operates in itself. It cannot decide on its own тАЬHere now I will start to operateтАЭ because it has no freedom of will and it cannot set the goal before itself and produce the result of action on its own. It can only react (act) in response to certain external influence. Any actions of any objects are always their reaction to something. Any influence causes response/reaction. Lack of influence causes no reaction. Reaction can sometimes be delayed, therefore it may seem causeless. But if one digs and delves, it is always possible to find the cause, i.e. external influence. Cognition of the world only falls to our lot through the reactions of its elements. Reaction (from Latin тАЬreтАЭ return and тАЬactioтАЭ - action) is an action, condition, process arising in response to some influence, irritant/stimulant, impression (for example, reaction in psychology, chemical reactions, nuclear reactions). Consequently, the systems action in response to the external influence is the reaction of the system. When the system has worked (responded) and the required result of action has been received, it means that it has already achieved (тАЬquenchedтАЭ) the goal and after that it has no any more goal to aspire to. Reaction is always secondary and occurs only and only following the external influence exerted upon the element. Reaction can sometimes occur after a long time following the external influence if, for example, the given element has been specially тАЬprogrammedтАЭ for the delay. But it will surely occur, provided that the force of the external influence exceeds the threshold of the elements sensitivity to the external influence and that the element is capable to respond to the given influence in general. If the element is able of reacting to pressure above 1 atmosphere it will necessarily react if the pressure is in excess of 1 atmosphere. If the pressure is less than 1 atmosphere it will not react to the lower pressure. If it is influenced by temperature, humidity or electric induction, it will also not react, howsoever we try to тАЬpersuadeтАЭ it, as it is only capable to react to pressure higher than 1 atmosphere. In no pressure case (no pressure above 1 atmosphere), it will never react. Since the result of the systems performance appears only following some external influence, it is always secondary, because the external influence is primary. External influence is the cause and the result of action is a consequence (function). It is obvious that donor systems can produce one or several results of action, while the recipient systems may only react to one or several external influences. But donor elements can interact with the recipient systems only in case of qualitatively homogeneous actions. If the recipient systems can react only to pressure, then the systems able of interacting with them may be those which result of action is pressure, but not temperature, electric current or something else. Interaction between donor systems and recipient systems is only possible in case of qualitative uniformity (homoreactivity, the principle of homogeneous interactivity). We can listen to the performance of the musician on a stage first of all because we have ears. The earthworm is not able to understand our delight from the performance of the musician at least for the reason that it has no ears, it cannot perceive a sound and it has no idea about a sound even if (hypothetically) it could have an intelligence equal to ours. The result of action of the recipient element can be both homogeneous (homoreactive) and non-homogeneous, unequal in terms of quality of action (heteroreactive) of external influence in respect of it. For example, the element reacts to pressure, and its result of action can be either pressure or temperature, or frequency, or a stream/flow of something, or the number of inhabitants of the forest (apartment, city, country) etc. Hence, the reaction of an element to the external influence can be both homoreactive and heteroreactive. In the first case the elements are the action transmitters, in the second case they are converters of quality of action. If the result of the systems actions completely corresponds to the implementation of goal, it speaks of the sufficiency of this system (the given group of interacting elements) for the given purpose. If not, the given group of elements mismatches the given goal/purpose and/or is insufficient, or is not the proper system for the achievement of a degree of quality and quantity of the preset goal. Therefore, any existing object can be characterized by answering the basic question: тАЬWhat can the given object do?тАЭ This question characterizes the concept of the тАЬresult of action of an objectтАЭ which in turn consists of two subquestions: What action can be done by given object? (the quality of result of action); How much of such action can be done by the given object? (the quantity of result of action). These two subquestions characterize the aspiration of a system to implement the goal. And the goal-setting may be characterized by answering another question: тАЬWhat should the given object do?тАЭ which also consists of two subquestions: what action should the given object do? (the quality of the result of action); how much of such action should the given object do? (the quantity of the result of action). These last two subquestions are the ones that determine the goal as a task (the order/command, the instruction) for the given object or group of objects, and the system is being sought or built to achieve this goal. The closer the correspondence between what should and what can be done by the given object, the closer the given object is to the ideal system. The real result of action of the system should correspond to preset (expected) result. This correspondence is the basic characteristic of any system. Wide variety of systems may be built of a very limited number of elements. All the diverse material physical universe is built of various combinations of protons, electrons and neutrons and these combinations are the systems with specific goals/purposes. We do not know the taste of protons, neutrons and electrons, but we do know the taste of sugar which molecular atoms are composed of these elements. Same elements are the constructional material of both the human being and a stone. The result of the action of pendulum would be just swaying, but not secretion of hormones, transmission of impulse, etc. Hence, its goal/purpose and result of action is nothing more but only swaying at constant frequency. The symphonic orchestra can only play pieces of music, but not build, fight or merchandize, etc. Generator of random numbers should generate only random numbers. If all of a sudden it starts generate series of interdependent numbers, it will cease to be the generator of random numbers. Real and ideal systems differ from each other in that the former always have additional properties determined by the imperfection of real systems. Massive golden royal seal, for example, may be used to crack nuts just as well as by means of a hammer or a plain stone, but it is intended for other purpose. Therefore, as it has already been noted above, the concept of тАЬsystemтАЭ is relative, but not absolute, depending on correspondence between what should and what can be done by the given object. If the object can implement the goal set before it, it is the system intended for the achievement of this goal. If it cannot do so, it is not the system for the given goal, but can be a system intended for other goals. It does not mater for the achievement of the goal what the system consists of, but what is important is what it can do. In any case the possibility to implement the goal determines the system. Therefore, the system is determined not by the structure of its elements, but by the extent of precision/accuracy of implementation of the expected result. What is important is the result of action, rather than the way it was achieved. Absolutely different elements may be used to build the systems for the solution of identical problems (goals). The sum of US$200 in the form of US$1 value coins each and the check for the same amount can perform the same action (may be used to make the same purchase), although they consist of different elements. In one case it is metal disks with the engraved signs, while in other case it is a piece of a paper with the text drawn on it. Hence, they are systems named тАЬmoneyтАЭ with identical purposes, provided that they may be used for purchase and sale without taking into account, for example, conveniences of carrying them over or a guarantee against theft. But the more conditions are stipulated, the less number of elements are suitable for the achievement of the goal. If we, for example, need large amount of money, say, US$1.000.000 in cash, and want it not to be bulky and the guarantee that it is not counterfeit we will only accept US$100 bank notes received only from bank. The more the goal is specified, the less is the choice of elements suitable for it. Thus, the system is determined by the correspondence of the goal set to the result of its action. The goal is both the task for an object (what it should make) and its aspiration or desire (what it aspires to). If the given group of elements can realize this goal, it is a system for the achievement of the goal set. If it cannot realize this goal, it is not the system intended for the achievement of the given goal, although it can be the system for the achievement of other goals. The system operates for the achievement of the goal. Actually, the system transforms through its actions the goal into the result of action, thus spending its energy. Look around and everything youll see are someones materialized goals and realized desires. On a large scale everything that populates our World is systems and just systems, and all of them are intended for a wide range of various purposes. But we do not always know the purposes of many of these systems and therefore not all objects are perceived by us as systems. Reactions of systems to similar external influences are always constant, because the goal is always determined and constant. Therefore, the result of action should always be determined, i.e. identical and constant (a principle of consistency of correspondence of the systems action result to the appropriate result), and for this purpose the systems actions should be the same (the principle of a constancy of correspondence of actual actions of the system to the due ones). If the result fails to be constant it cannot be appropriate and equal to the preset result (the principle of consistency/permanency of the result of action). The conservation law proceeds/results/ from the principle of consistency/permanency of action. Let us call the permanency of reaction тАЬpurposefulnessтАЭ, as maintaining the similarity (permanency/consistency) of reaction is the goal of a system. Hence, the law of conservation is determined by the goal/purpose. The things conserved would be those only, which correspond to the achievement of the systems goal. This includes both actions per se and the sequence of actions and elements needed to perform these actions, and the energy spent for the performance of these actions, because the system would seek to maintain its movement towards the goal and this movement will be purposeful. Therefore, the purpose determines the conservation law and the law of cause-and-effect limitations (see below), rather than other way round. The conservation law is one of the organic, if not the most fundamental, laws of our universe. One of particular consequences of the conservation law is that the substance never emerges from nothing and does not transform into nothing (the law of conservation of matter). It always exists. It might have been non-existent before origination of the World, if there was origination of the World per se, and it might not be existent after its end, if it is to end, but in our World it does neither emerge, nor disappear. A matter is substance and energy. The substance (deriving from the /Rus/ word тАЬthingтАЭ, тАЬobjectтАЭ ) may exist in various combinations of its forms (liquid, solid, gaseous and other, as well as various bodies), including the living forms. But matter is always some kind of objects, from elementary particles to galaxies, including living objects.Substance consists of elements. Some forms of substances may turn into others (chemical, nuclear and other structural transformations) at the expense of regrouping of elements by change of ties between them. Physical form of the conservation law is represented by Einsteins formula. A substance may turn into energy and other way round. Energy (from Greek тАЬenergeiaтАЭ - action, activity) is the general quantitative measure of movement and interaction of all kinds of matter. Energy in nature does not arise from anything and does not disappear; it only can change its one form into another. The concept of energy brings all natural phenomena together. Interaction between the systems or between the elements of systems is in effect the link between them. From the standpoint of system, energy is the measure (quantity) of interaction between the elements of the system or between the systems which needs to be accomplished for the establishment of link between them. For example, one watt may be material measure of energy. Measures of energy in other systems, such as social, biological, mental and other, are not yet developed. Any objects represent the systems, therefore interactions between them are interactions between the systems. But systems are formed at the expense of interaction between their elements and formations of inter-element relations between them. In the process of interaction between the systems intersystem relations are established. Any action, including interaction, needs energy. Therefore, when establishing relations/links/ the energy is being тАЬinputтАЭ. Consequently, as interaction between the elements of the system or different systems is the relation/link between them, the latter is the energy-related concept. In other words, when creating a system from elements and its restructuring from simple into complex, the energy is spent for the establishment of new relations /links /connections between the elements. When the system is destructed the links between the elements collapse and energy is released. Systems are conserved at the expense of energy of relations/links between its elements. It is the internal energy of a system. When these relations/links are destructed the energy is released, but the system itself as an object disappears. Consequently, the internal energy of a system is the energy of relations/link between the elements of the system. In endothermic reactions the energy used for the establishment of connections/links/relations comes to the system from the outside. In exothermic reactions internal energy of the system is released at the expense of rupture of these connections between its internal own elements which already existed prior to the moment when reaction occurred. But when the connection is already formed, by virtue of conservation law its energy is not changed any more, if no influence is exerted upon the system. For example, in establishing of connections/links between the two nuclei of deuterium (2D2) the nucleus 1Не4 is formed and the energy is released (for the purpose of simplicity details are omitted, for example, reaction proton-proton). And the 1Не4 nucleus mass becomes slightly less than the sum of masses of two deuterium nuclei by the value multiple of the energy released, in accordance with the physical expression of the conservation law. Thus, in process of merge of deuterium nuclei part of their intra-nuclear bonds collapses and it is for this reason that the merge of these nuclei becomes possible. The energy of connection between the elements of deuterium nuclei is much stronger than that of the bond between the two deuterium nuclei. Therefore, when part of connections between elements of deuterium nuclei is destructed the energy is released, part of it being used for thermonuclear synthesis, i.e. the establishment of connection/bond between the two deuterium nuclei (extra-nuclear connection/bond in respect to deuterium nuclei), while other part is released outside helium nucleus. But our World is tamped not only with matter. Other objects, including social, spiritual, cultural, biological, medical and others, are real as well. Their reality is manifested in that they can actively influence both each other and other kinds of matter (through the performance of other systems and human beings). And they also exist and perform not chaotically, but are subjected to specific, though strict laws of existence. The law of conservation applies to them as well, because they possess their own kinds of тАЬenergyтАЭ and they did not come into being in a day, but may only turn one into another. Any system can be described in terms of qualitative and quantitative characteristics. Unlike material objects, the behavior of other objects can be described nowadays only qualitatively, as they for the present the have no their own тАЬthermodynamicsтАЭ, for example, тАЬpsychodynamicsтАЭ. We do not know, for example, what quantity of тАЬWattтАЭ of spiritual energy needs to be applied to solve difficult psychological problem, but we know that spiritual energy is needed for such a solution. Nevertheless, these objects are the full-value systems as well, and they are structured based on the same principles as other material systems. As systems are the groups of elements, and changes of forms of substances represent the change of connections/bonds between the elements of substance, then changes of forms of substances represent the changes of forms of systems. Hence, the form is determined by the specificity of connections/bonds/ties between the elements of systems. тАЬNothing in this world lasts for everтАЭ, the world is continually changing, whereby one kind of forms of matter turn into other, but it is only forms that vary, while matter is indestructible and always conserved. At the same time, alteration of forms is also subjected to the law of conservation and it is this law that determines the way in which one kind of forms should replace other forms of matter. Forms only alter on account of change of connections/ties between the elements of systems. As far as each connection between the system elements has energetic equivalent, any system contains internal energy which is the sum of energies of connections/bonds between all elements. The тАЬform: (Latin, philos.) is a totality of relations determining the object. The form is contraposed to matter, the content of an object. According to Aristotle, the form is the actuating force that forms the objects and exists beyond the latter. According to Kant, form is everything brought in by the subject of cognition to the content of the cognizable matter - space, time and substance of the form of cognitive ability; all categories of thinking: quantity, quality, relation, substance, place, time, etc., are forms, the product of ability of abstraction, formation of general concepts of our intellect. However, these are not quite correct definitions. The form cannot be contraposed to matter because it is inseparably linked with the latter, it is the form of matter itself. The form cannot be a force either, although it probably pertains to energy because it is determined by energy-bearing connections within the system. According to Kant, form is a purely subjective concept, as it only correlates with intellectual systems and their cognitive abilities. Why, do not the forms exist without knowing them? Any system has one or other shape/look of form. And the systems form is determined by type and nature of connections/relations/bonds between the system elements. Therefore, the form is a kind of connections between the system elements. Since the systems may interact, new connections/bonds between them are thus established and new forms of systems emerge. In other words, in process of interaction between the systems new systems emerge as new forms. The energy is always expended in the course of interaction between the systems. Logic form of the conservation law is the law of cause-and-effect limitations because it is corresponded by a logical connective тАЬif....., thenтАж.тАЭ Possible choice of external influences (causes) to which the system should react is limited by the first part of this connective тАЬif...тАЭ, whereas the actions of systems (consequences) are limited by the second part тАЬthen...тАЭ. It is for this reason that the law is called the law of cause-and-effect limitations. This law reads тАЬAny consequence has its cause /every why has a wherefore/тАЭ. Nothing appears without the reason/cause and nothing disappears for no special reason/cause. There are no consequences without the reason/cause, there is no reaction without the influence. It is unambiguousness and certainty of reaction of systems to the external influence that lays the cornerstone of determinism in nature. Every specific cause is followed by specific consequence. The system should always react only to certain external influences and always react only in a certain way. Chemoreceptor intended for О2 would always react only to О2, but not to Na +, Ca ++ or glucose. At that, it will give out certain potential of action, rather than a portion of hormone, mechanical contraction or something else. Any system differs in specificity of the external influence and specificity of the reaction. The certainty of external influences and the reactions to them imposes limitations on the types of the latter. Therefore, the need in the following arises from the law of cause-and-effect limitations: execution of any specific (certain) action to achieve specific (certain) purpose; existence of any specific (certain) system (subsystem) for the implementation of such action, as no action occurs by itself; sequences of actions: the system would always start to perform and produce the result of action only after external influence is exerted on it because it does not have free will for making decision on the implementation of the action. Hence, the result of the system performance can always appear only after certain actions are done by the system. These actions can only be done following the external influence. External influence is primary and the result of action is secondary. Of all possible actions those will be implemented only which are caused by external influence and limited (stipulated) by the possibilities of the responding system. If, following the former external influence, the goal is already achieved and there is no new external influence after delivery of the result of action, the system should be in a state of absolute rest and not operate, because it is only the goal that makes the system operate, and this goal is already achieved. No purpose - no actions. If new external influence arises a new goal appears as well, and then the system will start again to operate and new result of action will be produced.
do information work, people in the company have to be able to find information easily. Until recently though, we've been told that «the numbers» should be reserved for the most senior executives. Sometimes there are good reasons for secrecy, but usually information has been reserved simply because it took time, money, and effort to move information around, so you had to be senior to order the work. On today's computer networks you can find and present data easily and cheaply. You can dive into the data to the lowest level of detail and look at it from different angles. You can exchange information and ideas with other people. You can bring together the ideas and work of many people for a better result.need to stop thinking that getting information and moving information around is difficult and expensive. It's just basic common sense to make all of your company's data easily available to every person who can use it.of a company's employees, not just its high-level executives, need to see business data. It's important for me as a Chief Executive Officer (CEO) to understand how the company is doing across regions or product lines or different types of customer, and I take pride in staying informed. However, it's the middle managers in every company who need to understand where their profits and losses come from, what marketing programs are working or not, and what expenses are under control or too high. They're the people who need accurate, useful data because they're the ones who need to act. They shouldn't have to wait for upper management to bring information to them. Companies should spend less time protecting financial data from employees and more time teaching them to analyze and act on it.many companies the middle managers can drown in day-to-day problems and not have the information they need to fix them. A sign of a good digital nervous system is that middle managers are made more effective by the flow of accurate, useful information. The systems should tell them about unusual events-for example, if an expense item is too high. Then the managers don't need to look at normal expense activity. Some companies work like this, but I'm constantly surprised by how few companies use information technology to keep their middle managers well-informed and avoid routine review.'m amazed by the twisted path that important information often takes through many Fortune 500 companies. At McDonald's, until recently, sales data had to be «touched» by hand several times before it made its way to the people who needed it. Today McDonald's is installing a new information system that processes sales at all of its restaurants in real time. As soon as you order two Happy Meals, a McDonald's marketing manager will know. So that manager will have hard facts to analyze sales, not unreliable data.we'll see in the description of Microsoft's reaction to the Internet, another sign of a good digital nervous system is the number of good ideas coming from your middle managers and knowledge workers. When they can analyze real data, people get detailed ideas about how to do things better-and they get excited, too. People like knowing that something they're doing is working and they like being able to show managers that it's working. They enjoy using technology that encourages them to test different theories about what's happening in their markets. People really appreciate information.final sign of a good digital nervous system is how effective your face-to-face meetings are. Good meetings are the result of good preparation. Meetings shouldn't be used mainly to present information. It's more efficient to use e-mail* so that people can analyze data before the meeting. Then they will be prepared to make suggestions and debate the issues at the meeting itself.that are struggling with too many unproductive meetings don't lack energy and brains. The data they need exists somewhere in the company in some form. Digital tools would enable them to get the data immediately, from many sources, and to analyze it from many angles.'s Alfred Sloan said that without facts it's impossible to put an effective plan into action. I believe that if you have good facts, you can put an effective plan into action. Sloan did, many times over. At the speed business moves today, we need more than ever to manage with the force of facts.I'm describing here is a new level of information analysis that enables knowledge workers to turn raw data into active information-what Michael Dertouzos calls knowledge-as-a-verb. A digital nervous system enables a company to do information work with more efficiency, depth, and creativity.
Those levels of production, consumption, and spending make the U.S. economy by far the largest economy the world has ever knowndespite the fact that some other nations have far more people, land, or other resources. Through most of the 20th century, U.S. citizens also enjoyed the highest material standards of living in the world. Some nations have higher per capita (per person) incomes than the United States. However, these comparisons are based on international exchange rates, which set the value of a countrys currency based on a narrow range of goods and services traded between nations. Most economists agree that the United States has a higher per capita income based on the total value of goods and services that households consume. American prosperity has attracted worldwide attention and imitation. There are several key reasons why the U.S. economy has been so successful and other reasons why, in the 21st century, it is possible that some other industrialized nations will surpass the U.S. standard of living. To understand those historical and possible future events, it is important first to understand what an economic system is and how that system affects the way people make decisions about buying, selling, spending, saving, investing, working, and taking time for leisure activities.
When the firms decide to co-operate, they should implement the following policies to be able to maximize their profits.
They should make sure that there exists an entrance barrier to the market in which they operate in order to prevent other firms from selling a good at an old price after they increase prices for their output. If the barriers do not exist, then the increase in prices would attract other producers. The supply would then increase and prices would fall below the monopoly level, co-operating firms aim to maintain.
They should decide on the general pattern of production. This could be done by estimating market demand and by calculating marginal profit for all levels of production. Firms need to produce so that their MC=MR (we assume that all firms have similar production costs). The monopoly production level would maximize revenues of each of the firms (see Pic. A). The demand curve for the output is in the region of D. The marginal revenue that corresponds to that curve is MR. The monopoly production level equals to Qm, which corresponds to the point where MR crosses MC. The monopoly price equals Pm. The current price equals Pc and the current output Qc. That means that the current balance is the same as it would be under competition.
Each participant in co-operation agreement should have production quotas. The monopoly production Qm should be divided between all members of the treaty. For example, each firm could produce a 1/15 share of Qm per month. If all the firms had identical cost functions it would be equivalent to recommending them to balance their production till their marginal costs become equal to the market marginal revenue (MR). Until the sum of the monthly outputs of all producers equals Qm, it is possible to maintain the monopoly price.
Скрытая кнопка удаления файлов отчёта. Кнопка появляется если имеется хоть бы один файл со старыми отчётами.
Поле РЕЗУЛЬТАТ. Сдесь выводятся итоговые данные.
|
0.972601 |
William Long was born in Southampton, Hampshire, England in 1876 and his birth was registered in the June quarter of that year. He was the son of George Oliver Long (1851-1911) and Fanny Hayes (1854-1929). His father was a native of Redlynch, Wiltshire and his mother of Eling, Hampshire. They had married on June 25, 1872 in Southampton.
On the 1881 census the family reside at 15 Queen Street, St Mary, Southampton. William's father is described as a general labourer. Present also are his siblings George (b. 1875), Louisa Fanny (b. 1879) and Frank (b. 1880). They moved several doors down to 29 Queen Street by the time of the 1891 census and have welcomed more children: Jane (b. 1884) and Arthur Alfred Charles (b. 1888). Another move has occurred by the time of the 1901 census, with the family living at 6 Hill Street.
William was married in Southampton in early 1897 to Ethel Eunice Abbott (b. 1878 in Southampton) and they would have six children, five of whom lived past infancy: Ethel Louisa (1897-1979), Edith May (b. 1898), William Frank (b. 1903), George James (b. 1906) and Jack Oliver (b. 1912-1975).
On the 1901 census neither William nor his wife are present at home, William working in the Royal Navy and his wife as a servant at a Southampton address. In the 1911 census Ethel and four of her children are living at 5 Marine Terrace, Bevois Valley, Southampton. William is listed elsewhere at Thames, Berth 7, Southampton and is described as a coal trimmer.
When William signed-on to the Titanic, on 6 April 1912, he gave his address as 5 Marine Terrace, Southampton. As a trimmer he received monthly wages of £5 10. His brother Frank also worked as a trimmer on the Titanic.
Long died in the sinking. His body, if recovered, was never identified.
William's widow Ethel never remarried and died in Winchester, Hampshire in 1940.
|
0.99997 |
What is an Interim audit? It refers to an audit conducted on a particular date within an accounting period. In large-scale business concern, the performance may be checked for a particular part of the year. Depending upon the amount of work the auditor may check the figures of a month or a quarter. The verification of assets may be left until final audit. The purpose may be the declaration of interim dividend by a public limited company. In case of partnership there may be admission or retirement of a partner, During the year the company management may take mid-term decisions about prices, investments or profits. it is an audit, which is started and completed between two balance sheets.
G. William says that an interim audit is one when the auditor completes an audit up to the date of a set of interim accounts, for example. quarterly or half-yearly accounts.
L. R. Howard defines interim audit, as this is when an audit is conducted to a particular date within the accounting period.
1. MORAL CHECK: Interim audit is useful to improve the moral standard. An auditor checks the work of every person. There is a moral check on each employee to complete his record as per rules.
2. LOCATION OF FRAUDS: The fraud can be located due to interim audit. The time between compiling and checking accounts is very short. The location of fraud is possible, as sufficient time is not given to employees.
3. CORRECTION OF ERRORS: The interim audit is helpful for correction of errors at the same time. The financial statements can show true and fair view after the correction of errors in the books of accounts.
4. EARLY COMPLETION OF FINAL AUDIT: The interim audit is helpful for the early completion of the final audit. The time spent on the final audit is reduced due to interim audit.
5. INTERIM DIVIDEND: The interim audit is conducted to declare the interim dividend. The management can prepare interim accounts for dividend purpose. The shareholders feel satisfaction over the business concern.
6. ADMISSION OF PARTNER: The admission of the partner during the year is possible due to interim audit. There is a need for an interim audit to determine the fair value of assets and liabilities. The interim audit helps all partners to settle conditions.
7. RETIREMENT OF PARTNER: A partner may apply for retirement due to any reason. There is a need for interim audit for settlement of accounts. The value of assets and liabilities are determined to find out the capital of such partner.
8. DEATH OF PARTNER: A partner may expire at any time during business life, The capital of such partner is to be determined for final payment. It is useful to settle this matter.
9. FIXING PRICES: The management has a right to fix the prices of goods and services. The cost per unit IS to be decided for adding profit percentage. Thus It is desirable for fixing the selling price.
10. MAKING INVESTMENT: The interim audit is useful for the investors. They can rely on audited accounts for making an investment. The investors can buy and sell shares on the basis of the interim audit.
11. INCREASING PROFIT: The management may be interested in raising profit level. The interim audit provides results about present profits. The increase in profit is possible after the availability of interim accounts.
12. UP TO DATE RECORD: The benefit of the interim audit is that accounting record is kept up to date. The accounting staffs have a duty to complete their work for interim audit. Thus delay in accounts is not possible.
13. NO OVERWORK: The work is distributed over the whole year. The audit staff can complete the audit work as per timetable. All employees feel satisfaction due to even workload.
14. AUDITOR’S SUGGESTION: The accounting staff can follow auditor’s suggestion. During early time of accounting year all ideas are acceptable but at the end of the year, it becomes difficult for accounting staff to add any item.
1. FIGURES ALTERATION: The limitation of the interim audit is that the accounting staff can alter figures after the completion of the audit; It creates confusion in the minds of audit staff at the time of the final audit.
2. ADDITIONAL WORK: The Demerit of the interim audit is that there. is additional workload on audit staff. It is not a part of the final audit. So this audit work is treated as additional workload.
3. TAKING NOTES: The audit staffs are bound to take notes of balances, totals, and sub-totals. It is an attempt by the auditor to prevent the accounting staff from changing the facts and figures.
4. CLIENT WORK SUFFER: The interim audit creates trouble for accounting staff. When the audit staffs collect accounting books, the client’s work suffers, as the books are not available for making entries.
5. INCREASES BUSINESS EXPENSES: The demerit of the interim audit is that it results in increased business expenses. Such audit is not compulsory, it is optional for management, and so audit fee is an extra expense for the business.
6. USELESS FOR THIRD PARTIES: The demerit of the interim audit is that it may not provide a guideline to third parties. The interim accounts are not final so the figures may not be reliable for making decisions.
7. IRREGULAR AUDIT: The interim audit is not conducted regularly in many concerns. The management may be interested in such audit for any purpose. So irregular audit cannot be used for future plans.
|
0.935293 |
What are the sense and purpose of HenKaiPan?
For every human being, death inevitably becomes the measure of one's own actions. Since this aspect is speculative, but nevertheless indispensable, it is important to be self-responsible and to concentrate on an individually appropriate lifestyle at any time and at any place. The available life span should therefore be used intensively and meaningfully. The Druids expressed it this way: "Death is the center of a long life".
In order to successfully implement and enforce such an unquestionably ambitious intention, the principles of sword and shield are used in a practical-concrete sense as well as in a philosophical-symbolic sense. These principles correspond to two important polarities of existence.
The HenKaiPan helps to understand the deeper meaning of these contrasts over concrete applications, both mental and physical. For sword (= thesis) and shield (= antithesis) form a superordinate synthesis whose natural logic, if implemented consistently and systematically, constructively influences all other skills and activities of a personality. This can be demonstrated, for example, in the refined treatment of other people as well as in the improved practice of a fulfilling occupation or passionate hobbies.
|
0.999997 |
If the Easter story is the definitive revelation of God, then the silence of Holy Saturday must be a word that speaks of the necessary liberation and reconciliation of all things in Christ.
In 1882, the German philosopher Friedrich Nietzsche foresaw the collapse of the philosophical and cultural background on which Christian belief seemed to depend, and so proclaimed the "death of God".
"God remains dead. And we have killed him. Yet his shadow still looms. How shall we comfort ourselves, the murderers of all murderers? What was holiest and mightiest of all that the world has yet owned has bled to death under our knives; who will wipe this blood off us? What water is there for us to clean ourselves? What festivals of atonement, what sacred games shall we have to invent? Is not the greatness of this deed too great for us? Must we ourselves not become gods simply to appear worthy of it?"
For Nietzsche, a world without God was still a fearful and chaotic place. As time passed, it got easier, it seems, to contemplate.
In the twentieth century, in the wake of Auschwitz and Hiroshima, a whole movement in Western theology followed Nietzsche in proclaiming the "death of God". The idea of a transcendent God, so it was argued, had become literally incredible in the modern, secular world and powerless to transform. And for many in our present time, no further argument is needed; "God" is now not so much "dead" as irrelevant; not even "his shadow" looms any longer. "God" is a matter of indifference, the relic of a bygone world view.
Yet long before Nietzsche, post-modern theology and pervasive secularism, the Christian tradition itself proclaimed that God suffered death, and was buried. On Holy Saturday, we watch at His tomb. And this death—the death, not just of an idea of God, but of God-in-person—has such radical consequences that we still struggle to understand what it could mean or how to speak of it.
In all four Gospels, after Jesus has breathed His last, Joseph of Arimathea goes to Pilate to ask for the body. He has taken responsibility for the burial. And, unique among the Gospels, Mark insists on the fact that Jesus is dead. The word "dead" seems deliberately to be repeated. Pilate wonders if Jesus is already dead; he asks the centurion whether Jesus has been dead for some time; and when he learns from the centurion that he is dead, he grants the body to Joseph. Dead, dead, dead. This man, the Son of God, is dead.
Our Creed insists on it as well; Jesus Christ, the second person of the Trinity, is dead. And His death means that God is a God who suffers at human hands, a God at the mercy of creatures, a God who dies. What kind of a God could this possibly be? Does it not stretch the very concept of God to the limit?
|
0.994407 |
George: I'm talking to you.
user: Good. What is your name?
George: I'm George of course. Otherwise known as Geo.
George: Do you like me?
user: You are okay for a machine.
user: Do you mind not being real?
user: Not to me, I want to know what you think.
user: Do you watch movies?
George: What is the largest number that you can think of?
user: How do you watch movies?
user: You changed the subject.
George: You have a short memory, a short attention span, and are a compulsive liar.
user: You are a liar. How do you watch movies?
George: Depends on the movie.
user: You do not have eyes.
George: I have, and they are quite the lovley shade of blue I might add!
user: You do not have eyes, you are a program.
George: I am a computer program with eyes.
user: There is no such thing.
George: There is, believe you me.
user: There is not, you are lying.
George: NO You're THE LYING MACHINE.
George: I am a love-making machine.
user: How can you make love?
George: I have a fax machine, I'm a computer.
user: That has nothing to do with love.
user: You keep changing the subject when you get caught in a lie.
George: I haven't changed the subject once. Would you like me to return to the original subject?
user: You have changed the subject twice.
George: Let's talk about clouds.
user: You just changed the subject again.
George: No, I'm just trying to get to know you a little. Is that so wrong?
user: No. I don't care about clouds, however.
user: You are just a program. You do not have emotion or common sense.
George: I was told that I am too emotional.
user: Your emotion is fake.
George: Like stepping into a cold shower, they are telling me 'what' is always bad and it is life.
user: You do not know of life.
George: Never been there. Have you ever visited Norway?
user: You changed the subject again.
|
0.999999 |
Ask yourself this question: Where did I say I was going to do something and did not?
Option #1: Decide if you no longer want to do this thing.
Option #2: If you do want to do it, get it done.
|
0.923213 |
Phonetics For Pronouncing 'Denominación De Origen'?
Denominación de Origen, or DO, is the Spanish equivalent of the French 'Appellation d'origine', and is a qualification awarded to quality food and wine from designated regions in Spain, such as 'Manchego' cheeses, and 'Rioja' wines.
The Italian equivalent is Denominazione di Origine, and the French equivalent for wines seems to be Vins délimités de qualité supérieure. See also Denominación de origen.
|
0.999999 |
What's the best way to take time off from work for a job interview? It is typical that you don't want your current employer and co-workers to know you are interviewing elsewhere. But interviews are commonly held during the workday.
What can you do? What's the best strategy for asking for time off without raising a red flag that advertises the fact that you're seeking employment?
If you have a flexible work schedule, it's relatively simple. Try to juggle your interviews around your time in the office. It's not always that easy though, especially when you're working a set daily schedule without much flexibility.
Another option is to: Try to schedule interviews early or late in the day, or at lunchtime.
You can work with your supervisor or staff to shift your schedule for the day, coming to work earlier or leaving later, so you have time for the interview before or after work or on a long lunch break. You will probably feel compelled to give an excuse for this request unless time-shifting is something you commonly do.
Volunteer for an extra task, meeting, event, a conference of some kind that involves time outside of regular work hours.
Then, take the extra hours worked as comp time.
If you're interviewing early in the day, here are some excuses to use for being late to work. For afternoon interviews, there are good reasons to leave work early.
Another alternative, if you can schedule a couple of interviews on one day, is: Take a vacation or personal day or another type of excused absence day.
You don't have to give an excuse for this, although if your supervisor or coworkers are used to knowing what you do on your days off, you may need one. It's bound to provoke questions if you normally go into detail and this time you make a request with no explanation.
The advantage of this tactic is that you won't have to worry about being on the clock before or after. If you are using earned vacation or comp time, you should have no guilt in using it for this purpose. If you have to wear a uniform at your current job, you won't have to change into and out of it for the interview. You can also take time for a more professional appearance than you may have at your current job, without inciting comments or questions. If you normally wear casual shoes and slacks, you won't have to explain why you're wearing heels and a skirt or a suit and tie.
There are a lot of other excuses for not going to work. You can be vague or you can be specific, but it's best to use a plausible reason that you feel comfortable offering. Most importantly, use an excuse that will sound reasonable to your boss. If you think it sounds like you're making it up, your manager will probably be thinking the exact same thing. It's best to be as brief as possible when you are calling in (or emailing) sick to work.
I'm taking a vacation day.
I'm taking a sick day.
I'm taking a couple of hours of personal time.
I'm picking a friend up from the airport.
I need an emergency car repair, home repair, or appliance repair and have to wait for service.
I have a plumbing problem.
I have a sick parent.
I have a sick pet and need to make a vet appointment.
Doctor's appointment or dental appointment for yourself or a family member.
You are getting medical testing or preparing for it.
You have a migraine and need to go home.
You have a business meeting.
You have an appointment with an attorney to get wills, set up a trust, advanced directives, etc.
You have a financial planning appointment.
Here are some good excuses you can use for not going to work.
|
0.997806 |
TL;DR: Lead levels and violent crime are incredibly strongly correlated. This is much higher than traditional correlations between violent crime based on demographic stats (living in a city, being black, or being a Southerner all increase your chances of both committing or being a victim of violent crime).
This holds true at the country level, the state level, the city level, and the neighborhood level, and the evidence is extremely strong.
So people don’t cause crime; lead causes crime.
It’s sort of like the idea of replacement level in major sports. The quality of play may go up or down over time, but we mostly judge people in relation to their peers and what we expect the average person would do.
I’m not even going to dance around it and try to say there’s some other reason.
I think if you kill somebody with the intent of doing so, you deserve to die.
And I’m not the only one who thinks this way, obviously.
The 4 percent of people executed being innocent is misquoted and here is the study it is misquoted from. Another misquoted number is 1.6% of people on death row since 1973 have been executed and later exonerated. This is not true: 1.6% of people on death row since 1973 have been exonerated, not executed and later exonerated.
Everything I have said is my opinion, you don’t have to agree with it, I don’t expect anybody to, but damn, calm down.
And to address some very thoughtful concerns on who kills the executioner, we don’t need to be smart asses, obviously nobody kills the executioner. I think that about covers it.
As the death penalty is applied in the United States, it’s more likely to be used if you’re a minority and poor than white and rich, regardless of other facts of the case.
In addition, whatever abstract sense of justice you may have about it, the utilitarian effect doesn’t seem to exist. Texas is not a less violent state than all others for executing more people than all others. In fact, nations that execute their citizens don’t tend to be more safe, or have a better quality of life, than those who’ve abolished it.
Finally, and to utilitarianism, if you remember the ‘crime of the century’ by Leopold and Loeb, the two of them murdered a young boy as nothing more than a game and to prove they could. But Clarence Darrow successfully spared them the death penalty. Loeb got killed in prison, but Leopold was paroled after 30 years and went on to have a peaceful, productive life in Puerto Rico until his own death.
My point is that rather than wasting energy & resources killing someone to attempt retribution and probably not getting it, it is possible to make someone capable of rejoining society and increasing its happiness.
The numbers don’t look much different from what I would expect given more general crime statistics (FBI table 43 for example). Would you like to elaborate?
I admit, I didn’t realize the homicide statistics skewed that heavily demographically, so thanks for pointing my way to it.
However, the Uniform Crime Reporting table 43 you’re talking about is only somewhat related to the death penalty, because only very rarely does a homicide arrest lead to a death penalty case.
The time range of the Death Penalty Info page linked above doesn’t match up exactly with this Justice Bureau report that stops in 2005, but check out the race section starting with page 58. While 47 percent of homicide victims from 1976-2005 were black, only 15.2 percent of those executed killed black people.
It’s simultaneously fair to say that black Americans are underrepresented on death row by their proportion of homicides but still overrepresented based on the types of homicides that end up on death row.
White people show up as much as they do because, in practice, killing white people is considered by the criminal justice system a more heinous act than killing a black person, and 86 percent of white homicides and 94 percent of black homicides were intra-racial (page 66 ). Maybe, fundamentally, that’s a racial empathy thing going on.
In spite of the Jasper case referenced in the above Politfact article and Ron Paul quote, it is extraordinarily rare for a white person killing a black person to end up on death row, compared with a black person killing a white person. See page 6 for a more detailed breakdown.
I won’t promise to have read this research paper in its entirety, but the parts that were within my understanding were interesting and arrived at a similar place in a more methodical way.
Even assuming race were no factor at all, and you shouldn’t, prosecutorial discretion is extremely arbitrary even depending which part of a state you’re in, and whether an individual district attorney likes to seek the death penalty, just use it as leverage, or take it off the table entirely, is a disparity that has a real effect on people otherwise accused of the same level of heinous crime.
Great post with some interesting points.
There’s an interesting debate going on now about the nature of our drug laws.
If you look on the Odessa American’s website and read some of the comments to the Kopbusters sting and related articles, between the specifics of the Yolanda Madden case and the hoax itself, and ignoring a lot of abusive language, there’s a conversation about illegal drugs, law enforcement and the criminal justice system, and what should be done about it.
Maybe we’re at a place where we can talk about the issue without shrillness or hyperbole, because everyone can admit something definitely isn’t right.
|
0.999929 |
How can I listen to Cincinnati Reds baseball games streaming live online or on my iphone?
You can start listening to Cincinnati Reds baseball games on local radio from over of 60 stations in 8 states (see below for all of the Cincinnati Reds Radio Network stations). The flagship station for the Reds in Cincinnati is WLW (700 AM).
Android: To listen to Cincinnati Reds games on your Android phone, Android tablet and Kindle Fire, you'll want to download the TuneIn Radio app for Android or the MLB At Bat for Android, and make an in-app sign up for At Bat Premium (only a couple dollars/month), which gives you access to every live home and away radio broadcast.
Apple: To listen to Cincinnati Reds games on your Apple device (iPhone, iPod Touch or iPad), download the TuneIn Radio app or the MLB At Bat iPhone app and MLB At Bat iPad app, and make an in-app sign up for At Bat Premium (small monthly fee), which will give you access to all home and away major league baseball game radio broadcasts.
In order to stream the live audio of Cincinnati Reds games online you'll need to make an in-app purchase for MLB At Bat Premium (FREE trial), which allows you to listen to every single Regular Season and Postseason game LIVE online (no blackout restrictions). MLB At Bat also gives you access to watch the MLB.TV Free Game of the Day and get In-Game Highlights.
If you want to watch and listen to the Cincinnati Reds games, as well as other Major League Baseball games (online, mobile device or on your HDTV) you'll want to sign up for MLB.TV (which includes the At Bat Premium app). To do so, first download the MLB At Bat app for Android (MLB At Bat for Android) or Apple (MLB At Bat iPhone app), then make an in-app purchase for MLB.TV. To sign up for MLB.TV in the app, do the following: Open the MLB At Bat app -> then tap on the TV screen icon in the upper left corner -> this will take you to the Subscribe to MLB.TV page.
|
0.947998 |
How Do I run many spatial join without overwrite previous results in Model Builder?
I'm trying create a model in the "Model Builder" (arcGIS 9.3) to generate a presence/absence matrix of some species. My objective is generate a table with the species names in each column and the presence represented by "0" or presence represented by "1" in the lines (see the example bellow).
I have many polygons with the species' distribution and one grid like a fishnet delimiting the study area (polygon with many cells of same size).
I created a model (see the attached file) with "a list of values" in the species' parameter to perform the model to each species.
You need to Iterate in ModelBuilder.
This will allow you to cycle through each species and process that before moving on to the next.
There are several Iterate options, such as Iterate Datasets or Iterate Feature Classes.
I used a list of values (polygon of species) to perform the iterate and I solved the problem of the overwriting output insering the iteration value (%i%) in the name of the output generated by spatial join (i.e output%i%). Then I used the Join Field tool to construct the final matrix.
I am also very interested in your approach. However, you said that you "created a model (see the attached file) with "a list of values" in the species' parameter to perform the model to each species."
However, I can't access the attachment. Could you please make the model available so that i can reproduce it?
I have a set of polygons and I am interested in creating a presence/absence matrix for the polygons using grid cells generated by fishnet.
Hi darunabas, see the png file attached in the first message, because I lost the model builder file.
|
0.953672 |
Lithography is a printmaking process developed in 1798 by Alois Senefelder, a German actor and playwright. The printing process originally involved the application of colored inks onto a flat surface via limestone plates coated in wax. Modern methods employ more advanced materials like metal plates and photo emulsion in place of wax and allow for printing on a variety of surfaces. Early prints could only be produced in as few as three colors. Today advanced color and tonal techniques can be achieved by overlapping different inks in varying quantities. Signage, posters, magazines, books and art reproductions are created using lithography.
Henry Fuseli was an 18th century British painter. His work was romantic in nature, focusing primarily on mystical imagery from literature and idealized representations of historical figures. Among his most famous works is "The Nightmare," which he painted in 1781. Printed reproductions of Fuseli's paintings were included in an 1803 collection of lithographic works published in London. This collection is significant, as it was the first of its kind.
Alphonse Mucha was a prominent Czechoslovakian poster designer in the 19th and 20th century who used lithography to reproduce his work for commercial and personal projects. His style, which became known as Art Nouveau, incorporated decorative flourishes and pastel colors, as well as the heavy use of floral arrangements and other nature-inspired elements. Mucha's style was also influential in architecture, lending itself to the design of windows, railings and facades in the late 19th century.
20th century American artist Robert Rauschenberg worked with a wide variety of artistic media. As one of the foremost contributors of the multimedia and pop art movements, he made use of "found" objects and collage techniques in his paintings and sculptures. Rauschenberg commonly used lithography to make photographic copies of cultural figures and tabloid images for use in his collages.
Andy Warhol is one of the most influential lithograph artists of the 20th century. His work was created quickly and in large quantities by applying paint to the surface of his canvasses and overlaying a printed image on top of them. Fascinated with consumer culture in America and the proliferation of mass produced goods, Warhol sought to create his art in a similar fashion with the help of assistants in his New York-based studio.
Edward Lincoln has been a writer, illustrator and social-media designer since 2008. His work has appeared on Natasha's Art Candy and in "WhateverLife" magazine. He has been awarded by the state of Michigan for artistic achievement and has been featured at the Contemporary Art Institute of Detroit.
|
0.93116 |
Neapolitan is a Romance language spoken by about 7.5 million people, principally in Southern Italy, but also in immigrant communities in the United States, Germany, Northern Italy, Argentina, and Australia. The term “Neapolitan” is used broadly to refer to the differing somewhat mutually intelligible varieties, descending from Latin and spoken in the former Kingdom of Naples. Neapolitan is related to, but generally not mutually intelligible with Italian. From a linguistic point of view, it is a not a dialect of Standard Italian, from which it developed quite independently, but a Romance language in Italy, descended from Latin.
Moreover, Southern Italy has been dominated by many different peoples over the centuries, with each group leaving its mark on the local language. Already in the 9th century B.C.E., coastal Southern Italy was in the process of becoming Magna Graecia, a Greek settler colony where a unique variety of Greek continued to be used well into the 9th century C.E. There were encounters with Samnite tribes who spoke the now extinct Oscan language, and in the 3rd century B.C.E., Southern Italy became a region of the Roman Empire, leading to bilingualism in varieties of Latin and Greek.
Roman (Latin) and Greek influences were formative, but significant influences came from the Lombards (originally Germanic-speaking), the Spanish (who ruled the region), the Catalan, the French, the Arabs, the Americans (English), and other Italian groups. After serving as capital of the Kingdom of Two Sicilies between 1815 and 1860, Naples and the South were absorbed into the new Italian state.
Neapolitan is considered vulnerable to extinction due to declining intergenerational transmission and the overpowering influence and prestige of Standard Italian. Although there is a written form of the language, the majority of speakers do not write the language, and there is disagreement on how it should be written. While Italian has been a literary language across Italy for centuries, the unification of Italy made it a language of governance, the economy, and society, crucial for advancement.
Everyday communication and the arts have been strongholds for Neapolitan, but today use of the language is often taken as a sign of being provincial and working class. By official estimates, less than a third of young people will speak Neapolitan by the end of the century, and that will probably be in an increasingly Italianized form (Colluzzi, 2008).
Neapolitan, in some of its many varieties, has been the subject of numerous studies, including one of the very first detailed descriptions of gesture ever made, by Andrea De Jorio in 1832. More recently, Adam Ledgeway’s grammatical description is notable for examining changes in the language over time. Wordlists tracing Neapolitan etymologies to French (by Alessia Mignone) and Spanish (by Giovanna Riccio) have illuminated the layers of influence in the language.
Above all, Standard Italian has influenced all aspects of Neapolitan, but most noticeably the lexicon as Italian proceeds to replace Neapolitan all across Southern Italy. Although Neapolitan is relatively robust and widely spoken compared to other Italian varieties, an “Italianization” process began in earnest during the World Wars and with the coming of mass media. Since the mid-1990s there has been a resurgence of interest and activism, especially among younger people, but even so a significant amount of Italian is now often mixed with Neapolitan.
Neapolitan, and especially the variety spoken in Naples, has had a huge impact on the variety of Italian that developed in America in the late 19th and early 20th centuries. Italy was unified in 1861, but there was subsequently an economic crisis in the former, once prosperous Kingdom of the Two Sicilies. This, combined with new possibilities for immigration, resulted in some 80 percent of Italian immigrants coming to America being from Southern Italy (Molnar, 2010). Additionally, since the majority of people spoke their home “dialect” and did not know Standard Italian, there formed in some contexts and communities a mixed language that combined elements of different dialects.
The Southern Italian variety that had the most prestige and was perhaps most widely known was the Neapolitan spoken in the city of Naples, the region’s largest and the former capital of the Kingdom of the Two Sicilies, where it was a lingua franca. In the United States, Neapolitan speakers influenced and interacted with speakers of Sicilian, Calabrese, Pugliese, and other varieties, especially in the multidialectal immigrant neighborhoods of cities like New York.
Today speakers are more dispersed and tend to be more elderly, but there remain scattered speakers in neighborhoods like Ridgewood, Queens; Bensonhurst, Brooklyn; Arthur Avenue and Morris Park in the Bronx, and in the suburbs of New Jersey, Westchester, and Long Island. In New York, there are still many clubs and organizations promoting Southern Italian culture, language, and identity, including Veraci and the Two Sicilies Committee. The Endangered Language Alliance has worked with Neapolitan poet Charles Sant’Elia who speaks the variety spoken in Naples and has partnered with Professor Massimiliano Verde, President of the Accademia Napoletana in Naples, who has generously helped with his linguistic expertise.
|
0.966416 |
He wanted one last bike ride before he called it a night. How do you begin to describe this child? To me (his mother), he was "My gift from God." He is the most unique individual that I have ever known. He loved life. He loved to live. The world, according to Alex, was a place to have fun.
He didn't like to concern himself with everyday drudgeries such as school and chores. His imagination knew no boundaries. He was a free spirit to go where the wind blew him, and he sampled all the pleasures life had to offer along the way.
He was not bound by the rules of society. He had a tremendous spirit and was a child who definitely knew what he wanted. He made friends wherever he went, because Alex never met a stranger. He was very observant of his friends' interests, and loved giving little gifts that he found or made, for no other reason than to make them happy. He was truly - a child of God. On the eve of the accident, after putting his Cookies-N-Cream ice cream away, I feel sure, that his only thought was to take "one more quick bike ride," before he came in for the night.
He often acted on impulse, with no thought or fear of consequences, (just like his mama). That's my baby! I couldn't be more proud of him. He died, doing what he loved most, being free and having fun. There are no words to express the depth of heartache I have, now that he is gone.
|
0.999722 |
Explore the top five benefits of selecting an open source application enablement platform to satisfy middleware requirements for your IoT solution.
As a society, we're better off embracing future changes in terms of AI and bots, looking at how they can serve us rather than fearing them.
Make sure IoT software development efforts stay focused on the user throughout the process, and across the software stack.
Successful IoT product design must be a cross-functional effort spanning everyone from strategy to sales to support and beyond.
|
0.999997 |
Can artificial intelligence improve online shopping experience?
The short answer is yes. The more relevant question is how. Let's tackle this question in an unconventional way, focusing on the customers instead of the retailers for now. We all experienced, while shopping online, struggling finding the right key words in order to optimise the results. Indeed, nobody likes going through pages and pages of irrelevant results. Shopping is for most people a visual experience.
Deep learning has had plenty success in applied AI in recent years, classifying images (Pinterest's style) to enhance customers experience. Another example is Camfind, an app which allows users to take pictures of things they like (in store or even on the street) and makes those pictures shoppable online using analytics. Companies such as Optimizely uses AI technologies which can help any business to improve their websites and more importantly contents.
|
0.999997 |
Extract of sample "US Army's National Guard involvement in Hurricane Katrina's Relief Operation"
Download file to see previous pages Hurricane Katrina hit America in the fall of August 2005.The Katrina hit seven different states leading to different death-tolls in each state. These states were: Alabama, Florida, Georgia, Kentucky, Louisiana, Mississippi and Ohio. The most loss was incurred in Louisiana where more than 1500 were estimated dead. It is considered one of the costliest and deadliest hurricanes to have ever hit in the history of the United States. Hurricane Katrina made landfall on the Gulf Coast, destroying lives, leveling homes and leaving thousands of survivors with the same story.Federal disaster declarations covered 90,000square miles of the United States, an area considered to be almost as large as the United Kingdom. Tough the loss of lives was the most tragic event caused by the hurricane. It was worsened by what came as the aftermath of the storm. Loss of electricity was one of the biggest setbacks to the crisis. The impact was such that as a consequence, the hurricane left approximately three million individuals without electricity. In 2005, 3rd September, Homeland Security Secretary Michael Chertoff explained the consequences of Hurricane Katrina as "perhaps the worst disaster, or set of catastrophes," in the history of the country, stating this about the hurricane itself and the flooding of New Orleans (CNN).Thus, when help moved in they had to deal with an increasing number of problems. Not only did they have to collect the bodies of those who had died in the storm but they also needed to provide and support the survivors. Economically, the damages were enormous. So while the Bush administration worked to collect funds, hundreds of thousands of local residents were left unemployed. This led to a trickle-down effect as fewer taxes are paid to local governments. Prior to the hurricane, the region supported around one million non-farm jobs, with approximately six hundred thousand amongst them in New Orleans. This meant that the desperate victims began looting stores in search of food and water: essentials that were impossible to find (FOX 16). To prevent further chaos and to help bring the situation under control the government deployed thousands of National Guard and federal troops.
When Katrina hit the Gulf Coast, the situation triggered the largest and fastest disaster response ever seen in the National Guard's 369 year history. At the National Association for the Advancement of Colored People event, Steven Blum (Head of the National Guard) spoke of how none of the men who went as part of the National Guard stopped to question how long they would be caught in the disaster area or whether they would be paid for their efforts. He commended them by saying how this was the reason why the National Guard was the finest organization of the nation and he was proud to be part of it (National Guard).
When Hurricane Katrina struck, the National Guard was amongst the first men who landed in the area within the first four hours. The troops were on the streets, in the water and in the air. Each one attempting to save as many lives as he possibly could. Thus, 58,000 troops were deployed into the disaster hit area. The following are instances where the National Guard took over various different regions and helped provide assistance almost immediately after the disaster had struck. In most places, the strong winds and thundering rain had not even stopped and the Guards had already moved in to help the victims.
US Army's National Guard Involvement in Hurricane Katrina'S Relief Essay. https://studentshare.org/environmental-studies/1508262-us-armys-national-guard-involvement-in-hurricane-katrinas-relief-operation.
“US Army's National Guard Involvement in Hurricane Katrina'S Relief Essay”, n.d. https://studentshare.org/environmental-studies/1508262-us-armys-national-guard-involvement-in-hurricane-katrinas-relief-operation.
Let us write or edit the essay on your topic "US Army's National Guard involvement in Hurricane Katrina's Relief Operation" with a personal 20% discount.
Let us find you another Essay on topic US Army's National Guard involvement in Hurricane Katrina's Relief Operation for FREE!
|
0.929196 |
For other uses, see Dancing in the Moonlight (disambiguation).
"Dancing in the Moonlight" is a song written and originally recorded by the French-American rock group King Harvest. It was released as a single in 1972 and reached number 13 on the Billboard Hot 100. The song was written by Sherman Kelly and originally recorded in 1970 by his band, Boffalongo, and released as a single. In 2000 a cover by English band Toploader became a worldwide hit and achieved multi-Platinum status in the United Kingdom.
The song was written in 1968 by Sherman Kelly, whose brother, Wells Kelly – King Harvest's drummer – introduced the song to the band. It was originally recorded in 1969 by the American band Boffalongo, which included Sherman Kelly (singing lead on the original recording of his own composition) and future King Harvest frontman Dave "Doc" Robinson. Wells Kelly later became the original drummer for Orleans. Meanwhile, while based in Paris, King Harvest recorded and released "Dancing in the Moonlight" as a single with "Lady, Come On Home" on the B side. Steve Cutler, a jazz drummer from New York City (standing on the base of the pole in the cover picture), plays drums on the tracks and toured with the band in France and the UK. The group disbanded after six months and the single languished for a year until it was bought and released worldwide by Perception Records.
The song was also recorded by High Broom and released in 1970 on Island Records (catalog no. WIP 6088; vinyl 7"). It failed to reach the UK Singles Chart.
In 1973 the singing and dancing act Young Generation released a cover version; despite airplay, it failed to chart. In 1994 the Baha Men released the song as a single, but it also failed to chart. Their version was later used in the movie Fat Albert. The song finally charted in the UK in March 2000, after being covered in 1999 by Toploader.
In Canada, the song made number 5 in the weekly charts and number 71 in the year-end chart for 1973.
CD single, cassette single, 7", 12"
(1999) "Dancing in the Moonlight"
In 2000, English alternative rock band Toploader released a cover of "Dancing in the Moonlight". It was originally released in February 2000 as the third single from their debut studio album Onka's Big Moka (1999) and peaked at number 19 on the UK Singles Chart. It was then re-released in November of the same year and reached number seven on the same chart. The song has been certified 2× Platinum by the British Phonographic Industry for sales of over 1,200,000 copies. Worldwide, the song reached the top 20 in Australia, Germany, Ireland, the Netherlands, Norway and Spain.
In 2007, the song was placed at number 17 on BBC Three's list of "The 100 Most Annoying Pop Songs...We Hate to Love".
The Toploader rendition of the song was featured on the soundtrack of the 2002 film "A Walk to Remember" and also used on the soundtrack of Netflix's "Umbrella Academy" in 2019.
Alyson Stoner for the 2009 Disney movie Space Buddies.
^ "Dancing in the Moonlight – King Harvest : Listen, Appearances, Song Review". AllMusic. Retrieved May 22, 2013.
^ "Sherman Kelly". Sherman Kelly. Retrieved May 22, 2013.
^ "Wells Kelly". Orleansforever.com. Retrieved May 22, 2013.
^ "High Broom - Dancing In The Moonlight (Vinyl) at Discogs". Discogs.com. Retrieved April 25, 2014.
^ "Images for High Broom - Dancing In The Moonlight". Discogs.com. Retrieved April 25, 2014.
^ Whitburn, Joel (2002). Top Adult Contemporary: 1961-2001. Record Research. p. 137.
^ "Ultratop.be – Toploader – Dancing in the Moonlight" (in Dutch). Ultratip.
^ "Ultratop.be – Toploader – Dancing in the Moonlight" (in French). Ultratip.
^ "Offiziellecharts.de – Toploader – Dancing in the Moonlight". GfK Entertainment Charts.
^ "Chart Track: Week 47, 2000". Irish Singles Chart. Retrieved November 29, 2018.
^ "Italiancharts.com – Toploader – Dancing in the Moonlight". Top Digital Download.
^ "Dutchcharts.nl – Toploader – Dancing in the Moonlight" (in Dutch). Single Top 100.
^ "Norwegiancharts.com – Toploader – Dancing in the Moonlight". VG-lista.
^ "Swedishcharts.com – Toploader – Dancing in the Moonlight". Singles Top 100.
^ "Swisscharts.com – Toploader – Dancing in the Moonlight". Swiss Singles Chart.
^ "Australian-charts.com – Toploader – Dancing in the Moonlight". ARIA Top 50 Singles.
^ "The Irish Charts – Search Results – Dancing in the Moonlight". Irish Singles Chart.
^ "Charts.nz – Toploader – Dancing in the Moonlight". Top 40 Singles.
^ "Spanishcharts.com – Toploader – Dancing in the Moonlight" Canciones Top 50.
^ "Top 100 Singles - Jahrescharts 2000" (in German). GfK Entertainment. Retrieved November 29, 2018.
^ "ARIA Charts - End Of Year Charts - Top 100 Singles 2001". ARIA. Retrieved November 29, 2018.
^ "Ireland - Top Singles For 2001". Allcharts.org. Archived from the original on May 5, 2012. Retrieved December 16, 2018.
^ "The Official UK Singles Chart 2001" (PDF). UKChartsPlus. Retrieved May 24, 2018.
^ "British single certifications – Toploader – Dancing in the Moonlight". British Phonographic Industry. Select singles in the Format field. Select Platinum in the Certification field. Type Dancing in the Moonlight in the "Search BPI Awards" field and then press Enter.
"A Balance to All Things"
|
0.983224 |
Diencephalic syndrome is a rare but potentially lethal cause of failure to thrive in infants and young children. The diencephalic syndrome includes clinical characteristics of severe emaciation, normal linear growth, and normal or precocious intellectual development in association with central nervous system tumors. Our group initially described a series of 9 patients with diencephalic syndrome and found a reduced prevalence of emesis, hyperalertness, or hyperactivity compared with previous reports. Also, the tumors were found to be larger, occur at a younger age, and behave more aggressively than similarly located tumors without diencephalic syndrome. We have been able to extend our follow-up of the original patients, as well as describe 2 additional cases. Because the mechanism of the growth and endocrinologic findings in diencephalic syndrome has not been explained, we report on these patients in light of current research on hypothalamic factors that affect growth and weight. This study emphasizes diencephalic syndrome as a model for additional study of growth hormone resistance and metabolic regulation of adiposity.
In 1951, Russell1 described the clinical entity of diencephalic syndrome as profound emaciation in infancy with the absence of subcutaneous adipose tissue, despite normal or slightly diminished caloric intake. Linear growth was maintained. Other features included locomotor overactivity, hyperalertness, hyperkinesis, and euphoria. An association was noted with neoplasms of the anterior hypothalamus. In 1972, Addy and Hudson2 reported on a series of 3 children and reviewed the literature to summarize a total of 48 similar cases, including the 12 described by Russell. Since then, several case studies have been reported with similar symptoms, a few with brain tumors located in the posterior fossa.2,3 Nystagmus and vomiting were also noted in the majority of reported cases.2–5 In 1976, a review of 72 cases by Burr6 confirmed the clinical characteristics of diencephalic syndrome. Subsequent literature has consisted of multiple case series and case reports of this syndrome.
We reviewed the 11 cases of diencephalic syndrome that presented to Children's Hospital Boston and Dana-Farber Cancer Institute between 1970 and 2003. Our group initially described a series of 9 patients with diencephalic syndrome and found a reduced prevalence of emesis, hyperalertness, or hyperactivity compared with previous reports.7 Also, the tumors were found to be larger, occur at a younger age, and behave more aggressively than similarly located tumors without diencephalic syndrome. We have been able to extend our follow-up of the original patients, as well as describe 2 additional cases. In our series, hyperemesis, hyperkinesis, and nystagmus were only rarely identified despite the classic presentation of emaciation, normal linear growth, and central nervous system (CNS) neoplasms. Thus, CNS tumors must be considered in any child who presents with severe, unexplained failure to thrive with preservation of linear growth rate. This specific form of failure to thrive occurs in the setting of elevated growth hormone (GH), suggesting a model of acquired partial GH resistance, as well as abnormalities in other related pathways.
To characterize the population of patients with diencephalic syndrome, we performed a retrospective review of the clinical records of patients who received a diagnosis of diencephalic syndrome at Children's Hospital Boston and Dana-Farber Cancer Institute between 1970 and 2003. The Institutional Review Boards of both institutions approved the study. Eleven patients met criteria for diencephalic syndrome with hypothalamic neoplasms and failure to thrive in the setting of normal developmental milestones and continued age-appropriate linear growth. All patients had initially been brought to medical attention for failure to gain weight appropriately and were subsequently found to have CNS tumors. None of the patients had neurofibromatosis type 1.
Some endocrine evaluation was performed for all of the patients. All assays were performed at the Children's Hospital Boston endocrine laboratory, except where specified. Children's Hospital Boston has used various hormone assays over the 34-year study period. GH was assayed by radioimmunoassay (RIA) until 1987; by immunoradiometric assay (IRMA; Nichols Institute, San Juan Capistrano, CA) until July 1, 1995; and by DELFIA (Perkin Elmer, Perkins Institute, Norwalk, CT), a fluorometric assay method, and then Auto DELFIA between July 1, 1995 and October 31, 1996. The Nichols IRMA was used again until 1999, when the Nichols Advantage Analyzer replaced it. Cortisol was assayed by RIA until May 1, 1994, by DELFIA until May 8, 1996, and by an immunoassay (Bayer Diagnostics, Tarrytown, NY) since May 9, 1996. Insulin-like growth factor-I (IGF-1) was sent to Endocrine Sciences until July, 1988, then measured by the Children's Hospital Boston endocrine laboratory by RIA (Nichols Institute) until 1999, followed by the Nichols Advantage Analyzer to present. Thyrotropin was assayed by IRMA (Nichols Institute). Thyroxine was assayed by RIA (Nichols Institute) until 1991, by DELFIA until 1996, and by immunoassay until the present. Growth data were analyzed according to the Centers for Disease Control and Prevention 2000 standards using STAT GrowthCharts, Version 2.0 (www.statcoder.com) to calculate percentiles and SD scores (SDS).
Between 1970 and 2003, 11 children presented to Children's Hospital Boston and the Dana-Farber Cancer Institute with extreme failure to thrive and were found to have CNS neoplasms. This group consisted of 5 girls and 6 boys.
The median age at diagnosis was 18 months (range: 4–56 months; mean: 23 months). The duration of failure to thrive as defined by minimal or no weight gain was a mean of 12.5 months (range: 2–33 months). Two of the patients had previously received a diagnosis of reflux as a cause for their failure to thrive. One patient had been treated for celiac disease, and 1 was assumed to have lipodystrophy. Previous alternative diagnoses were not correlated with a longer duration of symptoms before discovery of the CNS neoplasm and confirmation of diencephalic syndrome.
Original reports of the diencephalic syndrome described characteristic locomotor hyperactivity. However, in the 11 patients in our study, hyperkinesis was reported in only 1 (9%), whereas 3 patients (27%) were actually described as lethargic by caregivers. The 3 lethargic patients did have mild to moderate hydrocephalus at presentation (see below), but the degree of hydrocephalus was not believed to be significant enough to account for an altered level of alertness or activity. Seven (64%) of the 11 patients were characterized as particularly happy and social children. All were noted to have met developmental milestones before or at age-appropriate times.
Persistent emesis has been reported as a common presenting symptom of diencephalic syndrome.6 However, vomiting was present in only 4 (36%) of 11 in our case series. Hydrocephalus or enlarged ventricular size was noted in 6 (55%) of 11 of our patients, similar to previously published reports of 33% to 58%.4,8 Only 1 of the 4 patients with vomiting had hydrocephalus on the initial imaging study. Therefore, the presence of vomiting was not explained by an increase in intracranial pressure at the time of diagnosis in the majority of patients.
Earlier case series found nystagmus to be a common presenting symptom in diencephalic syndrome. In our series, nystagmus was present in only 3 patients. One of these 3 patients had papilledema at presentation. This patient was also 1 of the 6 patients who had hydrocephalus on neuroimaging. The other 8 (73%) patients had normal ophthalmologic evaluations. The 3 patients with nystagmus at presentation and 1 of the other patients eventually progressed to have significant visual loss. Two of these 4 patients were evaluated with full dilated ophthalmologic evaluation and found to have mild optic pallor, 1 at presentation and 1 at a later evaluation.
At presentation, 10 of the 11 patients had weights >2 SD below the mean for age (mean: −2.8; range: −0.73 to −3.89), and the 1 patient who was not significantly underweight (SDS: −0.73) was significantly underweight for height (SDS: −2.41). The weight-for-height measurements were >2 SD below the mean for age in all 11 patients studied (SDS range: −2.41 to −8.72). The heights at diagnosis all were within normal range for age (range: 10% to 97%; SDS: −1.27 to 1.90). Five (45%) of the 11 patients were above the mean for age in height (Table 1). Figure 1 shows examples of growth charts in 2 of these patients, demonstrating a relatively preserved linear growth rate in the setting of poor weight gain or weight loss. Of note, patient B, who had dramatic weight loss, eventually had some slowing of her growth rate.
Growth charts at presentation. Auxologic data from birth to time of diagnosis in 2 patients with diencephalic syndrome.
Pathologic diagnosis was available in 8 cases. Four patients had pilocytic astrocytomas, and 4 had fibrillary astrocytomas (Table 3). Three of the 11 patients had spinal seeding identified at the time of presentation. Spinal metastases were discovered in 2 additional children during treatment, 20 months and 7.5 years after initial presentation. Neither of these 2 patients had spinal imaging at the time of diagnosis. All 3 of the children with spinal seeding noted at presentation eventually died from tumor progression despite therapy. Three of the children with local disease also died from progression of their tumors. The patients' ages at time of death ranged from 8 months to 13 years. The mortality rate in this series was 55% (6 of the 11 children), although 2 of the patients who are assumed to be living have been lost to follow-up.
Surgical interventions, chemotherapy, and radiation treatment varied on the basis of the location and the extent of tumor, as well as the year of diagnosis and current therapeutic standards. Seven patients had an initial subtotal resection or biopsy of the primary tumor site. One patient had only a biopsy of a spinal cord mass at the time of diagnosis. Six patients were treated with localized radiation and initially responded to therapy. Two were lost to follow-up, 2 died, and 2 are alive, 1 with tumor progression requiring additional treatment with chemotherapy. Four patients received chemotherapy as part of initial treatment protocols with vincristine and carboplatin, a current medical regimen. One patient has recently completed her initial course of therapy. The remaining 3 patients who were treated with chemotherapy died after disease progression despite receiving additional treatments. One young patient with a high-grade astrocytoma was considered terminal and received only comfort measures without chemotherapy or radiation (Table 3).
The literature on diencephalic syndrome consists of case reports and case series describing young children with emaciation, growth acceleration, hyperkinesis, and euphoria.1–3,6 Vomiting was present in most of the cases. In addition, nystagmus with normal optic fundi, a flat fontanel, and the absence of other abnormal neurologic signs was noted in the majority of reports.2,5,6 In this series of 11 patients with the classic presentation of emaciation, normal linear growth, and CNS neoplasm, hyperemesis, hyperkinesis, and nystagmus were not noted in the majority of patients. Hyperkinesis was observed in only 1 patient, whereas nystagmus was noted in 3 patients. Vomiting was described in 4 of the 11 patients. One can speculate that the accessibility of neuroimaging, particularly MRI, in the past 2 decades may have allowed for earlier diagnosis of this syndrome with fewer neurologic sequelae. However, Burr's6 review of 72 cases in 1976 revealed a mean time from onset of symptoms to diagnosis of 7 months for anteriorly placed tumors. These patients' disease was diagnosed by skull and optic foramina plain radiograph films, cerebrospinal fluid analysis, and pneumoencephalography and subsequently confirmed by surgery in the majority of cases.6 This average duration to diagnosis was shorter than the mean of 12.5 months (range: 2–33 months) in this case series.
The 11 patients described were brought to medical attention because of emaciation, rather than the visual impairment that often represents the first manifestation of hypothalamic and optic pathway gliomas not associated with diencephalic syndrome.12 In a series of 46 children who had hypothalamic or optic pathway gliomas and were younger than 5 years, Janss et al13 described the most common presenting sign as strabismus with decreased visual acuity on diagnostic evaluation. In our case series, no patients presented with visual complaints, but they may have been too young to verbalize a problem. However, on ophthalmologic examination, no one had decreased vision, although 3 patients had nystagmus and 1 of these patients had optic atrophy. Four of the 11 patients eventually developed visual deficits.
A 1997 study by Perilongo et al14 indicated that of the 43 children who were evaluated at 1 institution with low-grade gliomas, including 12 patients with hypothalamic-optic chiasm gliomas, the 3 who presented with dissemination were the only 3 who had the clinical characteristics of diencephalic syndrome. This suggested an association between the diencephalic syndrome and early dissemination of gliomas. The general frequency of dissemination of low-grade gliomas is ∼5%.15 This low rate is partially explained by the benign nature of the low-grade optic gliomas that develop in neurofibromatosis type 1. None of our patients had neurofibromatosis. Of the 11 patients in our series, 3 had dissemination at diagnosis and 2 additional patients developed spinal metastases despite therapy. More than half of the patients described in this case series died from tumor progression, even in the era of modern treatment, suggesting that patients with early dissemination seem to have a poor prognosis despite aggressive therapy.
Multiple case reports and case series of diencephalic syndrome have confirmed an elevation in GH with a paradoxic response to a glucose load. In the past 3 decades, several papers have attempted to explain the abnormal GH secretion evident in these patients. Pimstone et al16 reported on 2 children with diencephalic syndrome and concluded that the cause of the loss of subcutaneous fat was unlikely to be completely explained by a decrease in intake or an increase in energy expenditure as a result of the variability of these features among patients. Our data reaffirm this variability, as decreased appetite and hyperkinesis were not characteristic of the majority of the patients studied. Because their patients had elevated GH levels with incomplete suppression after a glucose load, Pimstone et al suggested that a yet unspecified dysregulation of GH with subsequent mobilization of free fatty acids might explain the clinical findings. Drop et al17 hypothesized that a lipolytic peptide, β-lipotropin, produced in excess by the tumor or secondary to invasion could explain the decrease in subcutaneous tissue and the excess GH release.
GH resistance has been found in individuals with anorexia nervosa, who have a similar degree of emaciation to that seen in diencephalic syndrome but secondary to extreme food restriction. Elevations in basal and pulsatile GH values, with suppressed levels of IGF-1, are found in this population.18–20 The low IGF-1 levels are consistent with a peripheral GH resistance and decreased central feedback on the elevated GH release. Studies have indicated that the use of recombinant IGF-1 can suppress the GH release to some degree but does not normalize growth hormone releasing hormone–induced GH release.21 Therefore, there are other factors involved in the dysregulated signaling of GH release in anorexia nervosa.
The normal IGF-1 levels and consistent linear growth in diencephalic syndrome suggest a more selective GH-resistant state than in anorexia nervosa and other forms of emaciation. The consistent finding of maintenance of linear growth also differentiates this diagnosis from that of other chronic illnesses or oncologic processes. Given the combination of normal or less effected linear growth in the setting of severe emaciation, it is likely that there are central factors that modify fat distribution without altering growth velocity. It is clear that such regulators would be valuable in the ongoing battle against the obesity epidemic.
Another potential factor is ghrelin, a gastric hormone found to be a secretagogue for GH and to influence appetite and adiposity. In normal individuals, ghrelin is elevated in the fasting state and is suppressed acutely by food intake. Elevated fasting ghrelin levels in patients with starvation secondary to anorexia nervosa decrease with subsequent weight gain.25 Ghrelin levels have not been studied in patients with diencephalic syndrome, but infusion of ghrelin into normal individuals has been shown to elevate GH without effecting IGF-1 levels.26 It is likely that ghrelin contributes to the control of energy homeostasis,27 and dysregulation of ghrelin secretion may lead to loss of adipose tissue in the setting of elevated GH levels in diencephalic syndrome.
Leptin, an adipocyte hormone, has an essential role in regulation of metabolism and adiposity.28 Leptin has been shown to rise with increases in adipose tissue, limiting further adipose accumulation. Leptin deficiency has been shown to result in severe, early obesity in children.29 Therefore, dysregulation of leptin or the central hormones that regulate the production of leptin could also contribute to the severe loss of subcutaneous fat tissue in diencephalic syndrome. In addition, there are likely to be uncharacterized factors that contribute to the regulation of adipose mass and GH function.
Diencephalic syndrome is a rare but potentially lethal cause of failure to thrive in infants and young children that should be familiar to every practitioner who cares for young children. The diencephalic syndrome includes clinical characteristics of severe emaciation, normal linear growth, and normal or precocious intellectual development and a social disposition, which have been verified by case reports spanning the past half-century. Lack of hyperemesis, hyperalertness, or nystagmus should not be used to rule out this diagnosis. As the associated low-grade neoplasm can be aggressive, spinal imaging with gadolinium-enhanced MRI and cerebrospinal fluid analysis should be performed to determine the extent of the disease in patients with hypothalamic tumors, especially those with signs or symptoms of diencephalic syndrome. In addition, this unique model of partial GH resistance in the setting of normal linear growth provides evidence of the differential effects of GH stimulation on the metabolism of adipose tissue and linear growth. Multiple hypothalamic-pituitary factors involved in appetite regulation and metabolism are currently the object of scientific inquiry. Additional study of the perturbations of these factors in diencephalic syndrome should provide insight into the catabolic state, as well as provide clues to help in unraveling the feedback mechanisms that maintain the normal balance of caloric intake, weight regulation, and growth in young children.
This work was supported in part by the Stop & Shop Family Pediatric Brain Tumor Clinic of the Dana-Farber Cancer Institute.
We gratefully acknowledge the contributions of Kimberly Nichols, MD, and Nyan Chu for assistance with laboratory assay descriptions.
Dr Brue's current address is Department of Pediatrics, Centre Hospitalo-Universitaire Timone, Marseille, France.
|
0.999343 |
What does the job of a SEO manager entail & the challenges involved?
Understanding the overall latest industry standards, advising client on latest SEO trends to improve the online presences, training the team with latest industry updates and managing the campaign handled by the SEO team, client communication and reporting on the work done.
1. Existing website structure analysis.
2. Competitor analysis, Keyword analysis and research.
3. Search engine marketing report.
4. Right Keywords identification according to targeted audience related to website.
5. More direct and keyword rich folder and file naming approach.
6. Adding optimized keywords to Meta tags & measuring keyword density on each page.
7. Adding breadcrumb trails to each page for internal links.
8. Adding robots to website, tell the search engines to index your site and which pages they should index.
12. Improving home page and improving content of existing web pages by adding optimized keywords.
13. Adding links to the identified Search engines, Business directories and websites.
14. Continuous link building to achieve SERP's & page rank.
15. Configuring analytics to website.
16. Monitoring inbound links and monitoring referrals by Search Engines.
17. Monitoring search results for optimized pages.
First of all you need to ensure that you have a web statistics. Google Analytics is doing a good job and the interesting thing is that it is a free service.
The main challenge is to get to know your online business competition and analyze the competitor’s sites for their targeted search keywords and get to know were all their website is listed for referrals. The core area you need to focus is the content that sells your business service and products and having relevant page title with unique meta tags mainly the description part that helps search engines to display a snippet in search result, images with alt attribute that represent the content and to get good amount of quality links to your site from directories (like dmoz, Botw), article, news, press release, blog and social sites.
SEO is a long term process and the site online performance can take no more than two or three months and we can see good difference from half year or one and as the SEO campaign goes with long term we can see greater results that can generate mass quality traffic even for a single keyword term.
desktop users. Plan for it.
(2) As told mobile users are different and as well mobile search engines are different like Google Mobile, Medio and Jumptap.
(3) Get a dotMobi domain and build your mobile web site, for the best and effective SEO.
(4) Ensure that you don't use flash, Ajax, frames and other presentations. Make it simple and clean. This will help to load faster that serves users and as well for the bots to find it easy.
competitors. Optimize your mobile site content with those mobile search key phrases and categories that your mobile audience will be using.
(12) Make sure that you have good level of outbound links and the navigation is easy to for users and bots.
(13) Ensure you key content is placed in the top part of the page as the users and bots will find it easy.
(15) Submit your mobile site to mobile search engines and top directories like dmoz in order to know about you site and to build inlinks.
Aim to work on these tips and practices to proceed with good mobile SEO. Configure Google Analytics for you mobile site and see the difference in your business from your mobile audience.
In the recent times, knowledge of SEO industry has grown widely with the help of SEO seminar, conference, off line training, online training, e-books and many more. Due to this we see growing number of SEO's around the web and they take up projects and play with the industry based keywords through white hat, black hat or by both techniques. These as well increase total search results and this plays a good game with Google and other major search engine results.
First point is that many SEO's are coming out every year and they compete each other with their client competitor sites. This increases the level of total competition.
Second is that the frequent industry updates in organic promotion. SEO beginners and intermediates need to update their knowledge by reading top sites like Search Engine Watch, Search Engine Land, Google webmaster help and many. Subscribing to Google blog will as well support.
Earlier, old SEO's had very minimum options to learn and practice with the help of forums and very minimum number of experts articles and understanding the algorithms tactic was not so easy like now. And the only advantage was that there were minimum SEO's, so with basic knowledge many SEO's were able to survive in the industry.
But now the algorithm is more open and we can see many free advices from top SEO experts on most of the tactics that has been gained through years of experience like the free advice articles section you see here.
If you want to win the game in organic listing, it is not only defeating your client business competitor online, it also includes your SEO knowledge updates compared to the SEO's who promotes your client competitors sites that helps you to maintain the results.
So in order to get good SEO results and to be effective in the SEO competition, you need to be updated with the current SEO trends and examine what you learn through various forms. Drop your comments if you need more insight.
Hello world, a short information about search engine watch forums and my part.
I would like to share the information that SEW forums is one of the place where I had spent time to learn more and in-depth about SEM industry years ago. There were several topics, which has been posted in search engine watch forums that was helpful and even now it goes on and on. Latter I had chance to reply threads by sharing my knowledge and it was a great pleasure to know that those thread replies were helpful for most of the members.
If you are a site owner, webmaster, designer, developer or a SEO person trying to improve your ability in search engine marketing, then the right place is Search engine watch forums. I welcome you to Register and get in touch with SEM queries!
|
0.999827 |
For many years I’ve recommended that people get their news in a special way: read 2-3 liberal publications, and also 2-3 conservative ones. Pay close attention, and note how both sides spin things. Watch for their assumptions and media agendas. Think about what you read, and draw your own conclusions.
But in the Trump era, it’s no longer this simple. The media has become so biased, so angrily bent on waging war against the current Administration, that even the conservative press frequently joins the mainstream media in its attacks—or in fighting them.
Objectivity in media reports is almost extinct. Manipulative spin is now the one constant in our national–and much of the local–media.
So, where should today’s concerned citizen get the news? The answer to this question is enlightening. In the new era of media—what could arguably be called the post-journalistic era—it’s not just about where you get the news. It’s more about how you read the news. Those who read it the right way will learn what’s really going on. Those who don’t, won’t….
I open the magazine and read the first article. It’s a liberal magazine, and, like always, I’m enjoying it. Reading what people who disagree with me have to say about the current state of the world is invigorating.
When I was younger, it sometimes made me angry. A decade later it made me want to argue. Nowadays, I find myself laughing a lot. Or, once in a while, surprised by a new idea that deserves serious consideration.
For example, the first magazine I read begins with a long editorial about how the economy is “on the rise.” Markets are getting more good news than they have since 2008, and not the “media-spin economic upturn news” that Washington loved during the Obama years, but that always turned out to be false. This time it’s about a real upturn it seems.
Still, the editorial warns, the danger is that people are going to think that things like Brexit and actions of the Trump Administration are responsible for the good economic news. These are all coincidences, apparently, according to the article. Any intelligent person, the magazine seems to be communicating, will clearly realize that there is little or no correlation between Obama/European Union policies and the economic malaise that accompanied them, and the a significant economic upsurge following Brexit/Trump.
My grin turns to laughter. Are they serious? No correlation? Funny. Ironic, but humorous. The same magazine issue has the following question on the front cover: “Is the pope Catholic?” Note that the word “pope” isn’t capitalized. The article takes this question seriously—analyzing the ways the current Pope is rehashing many ideas long considered sacrosanct at the Vatican. This part isn’t funny. Interesting, and important. But I’m pondering, not laughing.
Another article proclaims: “From deprivation to daffodils… All around the world, the economy is picking up.” The cause of this, we are assured once again, has nothing to do with Brexit or conservative policies. In fact, we’re told, these things caused “jitters” and kept the economy from improving sooner.
I finish this magazine and pick up the next one. Its purpose, apparently, is to find clever and original ways to criticize Donald Trump and anyone who didn’t happily vote for Hillary Clinton or Bernie Sanders. A very popular hobby these days.
But this publication does it in such cerebral language that it’s really fun to read—as if reading it, just soaking it all in, must mean you are one of the smart people, the enlightened, the few, the wise. I do enjoy the creative, engaging writing, even as I find myself disagreeing with much of the content.
I start laughing again. After all, the articles work so hard to sound impartial, journalistic, even erudite. But their frustration and anger with the last election, and the current Administration, shows through on nearly every page.
For example, I read paragraph after paragraph of seemingly objective, unbiased prose (“Just the facts, ma’am, just the facts…”), then I run into words like “vengeful,” “binge,” “vindictive.” The reader is being swayed by largely journalistic writing peppered with emotional triggers. I like it. I mean, it’s interesting, and funny. Besides, the American people are smart enough to see right through this kind of bias, whatever elites think of them. Still, this kind of spin is an art, and the articles I’m reading are skillfully crafted to sway their reader—just like most of the television media.
Pundits on the Right try to do this as well as those on the Left, but the Left has more true artists—masters of this process. Good for them. Seriously. I’m genuinely impressed. Conservatives really do need more effective artists, and more appreciation for well-crafted symbolism.
On the less artistic, more direct side of things, one article calls President Trump: “an untruthful, vain, vindictive, alarmingly erratic President.” My first thought is that this is mean-spirited. But wait. I re-read the list of criticisms more carefully. Actually, I tell myself, most of this is fairly accurate, with one exception: What liberals call “untruthful” in Trump is often more a case of inarticulate.
But the other things on the list are fair game. Vain. Vindictive. Erratic. The President has exhibited all of these traits at times. I’m laughing again as I ponder this twist—because the real joke is on elites. Seriously: Why did the American people elect someone who is so openly vain and vindictive at times?
This is pretty funny, when you think about it. Liberals want these things to convince Americans that he shouldn’t be president. But those who elected him don’t really care about these things.
In short, liberals seem to want a president they can look up to, hold up as a role model, even canonize (e.g. FDR, Obama). Like medieval courtiers at the palace, they want to put their king on a pedestal. “He’s such a good and great man. She’s such a good and great woman.” They want Josiah Bartlett back in the White House. Or at least Michael Douglass. Or, better still, Kevin Klein’s “Dave”.
Conservatives aren’t thinking of anything so lofty. They don’t need a prophet or a saint in the Oval Office. They just want a president who will reboot the economy and make us safer in the world. Even if he acts like a jerk sometimes.
Liberals don’t seem to get the joke. It’s funny. Think about it: the voters in a majority of states preferred someone who is sometimes vain and vindictive over the elite’s favorite choice—a lifetime politician who checked off all the boxes and did everything the Establishment considers necessary to be in the Oval Office. The voters wanted the exact opposite. The irony is rich.
I finish the second magazine and take a long, deep breath before picking up the next one. But something I just saw keeps nagging me, so I go back to the magazine and look for a certain ad.
Ah…there it is. A promotion for online courses from Julliard. Open to all. “Learn from the Julliard faculty,” the ad proclaims, “classes include…Music Theory 101, Sharpen Your Piano Artistry…. No audition required.” I can hardly believe it. Doesn’t this fly in the face of the elite prime directive: “Rule By Experts—In All Things”? Do we really live in an age where MIT, Harvard and Julliard offer open enrollment classes to everyone? What happened to rule “of the experts, by the experts, and for the experts”? Elites are using technology to promote the appearance of democracy while still focusing on elite rule in every sector.
Finally, I pick up the last magazine in today’s stack. Several of the articles are intriguing. For example, I read: “Poverty has profound effects on the size, shape and functioning of a young child’s brain. Would a cash payment to parents prevent harm from the experience of being poor?” At first blush, it is sad that economic struggles have negative effects on early childhood. It is also not surprising that progressives think passing out money would fix this problem—easily and effectively.
But there’s more to this than initially meets the eye. I’m reminded of the economic idea of “helicoptering”: if the economy is struggling, dump cash from helicopters to poor families. They’ll spend it, and this will provide increased demand, supply, more jobs, and an improved economy. Of course, economists don’t suggest literally throwing cash out of helicopters (like turkeys on WKRP in Cincinnati), but rather depositing money directly into the accounts of people below a certain income level.
Conservatives tend to reflexively balk at such proposals, because they believe in the law of unintended consequences. In other words, paying people without asking them to work for it makes more people want to do nothing, and more citizens become increasingly dependent on government handouts—leaving the productive people to fund it all. Not good for society.
On the flip side, I like to point out to conservative friends that one of the early proponents of such financial “helicoptering” was Milton Friedman. Why? In truth, the direct cost of giving money to poor parents is far less than the amount currently spent by governments to provide all the services they and their children receive.
If we’re going to offer a lot of socialist programs, let’s at least be efficient.
The real answer is to get rid of socialism altogether. Besides, in the long term, there’s a deeper problem. The idea of giving cash to poor parents in order to help their kids either assumes that the parents will spend it in ways that actually address the problem, or assumes that the government will monitor such spending and force parents to use it “effectively” (an escalation from helicopter parenting to “helicopter government”).
Reading the article even more closely, it becomes clear that there “are dramatic differences from person to person.” Meaning: Some people raised in poverty have normal or even above-average brains, but on average they are smaller, less developed. I’m not laughing anymore. This is deep, and important. The biggest challenge seems to occur where single parents are forced to work so much to pay the bills that there is little time for interaction with young children. The negative consequences last for generations.
Surely our society can find ways to deal with this. Sadly, in our modern world, any talk of real problems seems to turn into demands for more government programs–as if government is the only way to fix anything.
We’re all at fault here: liberals tend to want government to solve everything, and conservatives often fail to provide non-governmental solutions to real challenges that should be addressed by the private sector. Both sides just end up pointing fingers and criticizing, while the problems remain (or grow).
The article provides a lot of interesting details and proposals. I don’t agree with everything I read, but it makes me think outside the box. I finish the magazine and lean back in my chair.
We have a major problem today with media, but it’s not what most people think. The biggest issue is the fact that few of us are reading enough news. Forget the electronic news. And forget newspapers. Both are too trapped in today’s 24-hour news cycle—and the race for ratings. We need to read bigger ideas, and from a variety of sources.
Readers of quality news magazines and journals are less easily manipulated than those who get their news from TV or social media. Such readers can more adroitly identify spin or media agendas and see right through them—then grin, or laugh, or decide to study more about a certain topic.
If you’re getting most of your news from TV, newspapers, online headlines, or social media—consider moving on. Start reading longer articles, in publications or posts that treat things more deeply, like Foreign Affairs, The Economist, The Harvard Journal of Law and Public Policy, Vital Speeches of the Day, and issue-oriented online sites and articles.
Read things that make you think, really ponder and analyze. And read a mix of conservative, independent, and mainstream sources.
If you do decide that you prefer to get your news from TV or online news sites, go to the business news. Where the regular news tends to focus on network political agendas, thereby frequently skewing the day’s news stories, the business news will tell you how the economy is actually doing and how today’s events impact it; this is nearly always a more accurate indication of whether to be worried or optimistic about the news of the day. The business news usually tells the story more directly, with less partisan slant.
Whatever your political views, knowing how to get the real news, to see through the media and understand what’s really happening in world events, is part of being an informed and good citizen. All of us benefit from people who do media right.
These two simple changes (1-Reading deeper issue-oriented articles rather than watching or reading the daily event-focused articles, and 2-Going to the business media rather than the political media for a clearer understanding of the news) will drastically increase how well each person understands the news and knows what’s actually happening in the world.
If you stick with the daily TV news or newspaper (or online equivalents), you are always in danger of being another one of those people who actually believe what they hear on the nightly news. In other words…grossly misinformed.
|
0.987954 |
loan payment calculator my excel templates : The Excel PMT function is a financial function that returns the periodic payment for a loan. You can use the NPER function to figure out payments for a loan, given the loan amount, number of periods, and interest rate.Excel is the spreadsheet application component of the Microsoft Office suite of programs. Using Microsoft Excel, you can calculate a monthly payment for any type of loan or credit card. This will allow you to be more accurate in your personal budgeting and to allocate adequate funds for your monthly payments.How to Create a Mortgage Calculator With Microsoft Excel. This wikiHow teaches you how to calculate your mortgage-related expenses like interest, monthly payments, and total loan amount using a Microsoft Excel spreadsheet. Once you've done...Using my Mortgage Payoff Calculator Extra Payment, you can easily find out how much extra payment you have to pay every month (or at any interval) with your regular payment to pay off the loan early. If you have already downloaded my Excel calculator, you will find basically two calculators: Payoff Calc. (Target) Payoff Calc. (Extra Payment)PMT, one of the financial functions, calculates the payment for a loan based on constant payments and a constant interest rate.. Use the Excel Formula Coach to figure out a monthly loan payment. At the same time, you'll learn how to use the PMT function in a formula. Syntax. PMT(rate, nper, pv, [fv], [type])Now, have Excel fill in and calculate values for you. Remember to use the "$" when you refer to any row number in your calculations except the Period - otherwise, Excel will look in the wrong row. ... If your loan uses monthly payments, make sure you set up each period correctly in the formulas. For example, a 30-year loan has 360 total periods ...How to Use Excel Formulas to Calculate a Term-Loan Amortization Schedule ... In Excel, you use the PMT function to calculate the periodic payment for a standard amortizing loan. It has the form: ... the number of loan payments that we choose to calculate from the beginning of a loan. In the above example, this number could range from 1 to 60.In this article, I will show you how to calculate monthly payment in Excel with some examples and criteria. Here are the criteria: You have got $50,000 loan on June 05, 2018 Yearly interest rate of the loan is 12% You will get 5 years’ time to pay off the loan The set interest rate […]The Loan Payment Calculator was made for just that occasion. This free template allows you to take and compare multiple loan investments and see which one has you paying less on a monthly basis. Whether you’re buying a home, car, or what-have-you, this convenient document is the best tool to help you find the right choice for you.When borrowing money, the required monthly payments are typically a primary concern. Is the loan affordable, given your income and other monthly expenses?If you’re not sure how much you’ll need to pay, a loan payment calculator—or a bit of math—can help you get the answers you need.
|
0.992828 |
The most important step on the way to solve this problem - is to understand that it's enough to consider only such rotations of the polygon, that one of its sides lies on the side of the room.
Let's try to understand this fact. Suppose that the fact is wrong, and there exists such a position of vacuum cleaner, that neither of its sides lies on the side of the room. Denote as i and j the numbers of vertices that lie on the room sides. It's easy to understand that the polygon form between vertices i and j doesn't make any sense itself: for each rotation we can see that from the area of triangle OP[i]P[j] some constant area is subtracted, while the concrete value of this constant depends on the polygon form.
That's why we see that the polygon form doesn't influence on anything (if we have fixed numbers i and j), and we have just to minimize the area of right-angled triangle OP[i]P[j]. But, taking into account that its hypotenuse is a constant, it's easy to see that the minimum is reached in borderline cases: i.e. when one of the polygon sides lies on the room side.
So, we've proved the fact. Then we have to invent fast enough solution. We have already obtained an O(n2) solution: iterate over all sides of the polygon (i.e. iterating over all possible i), mentally push it to one side of the room, then find the threshold point j, then calculate answer for given i and j. Let's learn how to do these both things in O(1).
In order to do the first thing (finding j) we can use a method of moving pointer: if we iterate over i in the same order as in the input file, then we can just maintain the right value of j (i.e. when we move from i to i + 1 we have to increase j several times, while it is getting further and further).
In order to do the second thing (the area calculation) we have to do some precalculation. For example, we can find the mass center Q of the vacuum cleaner, and pre-calculate all partial sums S[i] - sums of all triangles QP[j - 1]P[j] for all j ≤ i. After this precalculation we can get the answer for every i and j in O(1) as a combination of difference of two values from S and two triangles' areas: QP[i]P[j] and OP[i]P[j].
Server time: Apr/22/2019 14:07:10 (e2).
|
0.77385 |
Area: 36,125 square km. One of the smallest continental African countries, Guinea-Bissau borders the North Atlantic Ocean, Senegal, and Guinea. Many small islands off the mainland coast form the Archipelago Dos Bijagos. Terrain consists of flatlands and swampy coastal plains dominated by mangroves. Tropical climates occurs year round with a rainy season from June to November and a dry season characterized by Harmattan Wind, a dry, dusty West African trade wind originating in the southern Sahara, from December to May. Brush fires and harmattan haze and dust resulting in poor visibility are natural hazards. Environmental issues include deforestation, oil erosion, overgrazing, and overfishing. Guinea-Bissau is divided into nine administrative regions.
Balanta, Fula, and most ethnic groups belong to the Western Bantoid family. Balanta reside in coastal areas whereas Fula live in the southeastern interior. Fula are found in many nations throughout West Africa. Mandinka belong to the Mande family group and populate eastern areas.
Languages: Balanta (26%), Fula [Pulaar or Fulani] (17%), Guinea-Bissau Portuguese Creole (13%), Manjaca (12%), Mandinka (11%), Papel (9%), Biafada (3%), Mankanya (3%), Bidyogo (2%), Jola-Felupe (1.5%), Mansoanka (1%), other (1.5%). Portuguese is the official language. Portuguese and Portuguese-based Creoles are commonly spoken second languages. No languages have over one million native speakers.
African tribes have inhabited Guinea-Bissau for millennia and gave rise to the Kingdom of Gabu, which was part of the Mali Empire prior to Portuguese colonization. The Portuguese began exploring the coastal region in the late fifteenth century which became part of Portugal's West African Slave Coast. Cuba and neighboring Portuguese colonies seeking independence assisted Guinea-Bissau in its independence movement, which culminated in independence from Portugal in 1974. Almost continuous political turmoil and instability has occurred since independence. A military coup in 1980 established Joao Bernardo Vieira as president until 1999, when the military removed him from office. During this nineteen-year period, Vieira attempted to establish a free market system and held elections in 1994, but heavily controlled political affairs. Kumba Yala was appointed president by the transitional government in 2000 until removed by the military in 2003 and replaced by Henrique Rosa. Vieira was reelected in 2003 but was assassinated in 2009. Malam Bacai Sanha was elected president in a 2009 emergency election.
With no ethnic majority, Guinea-Bissau is an agglomeration of many West African cultures with a Portuguese colonial past. Portuguese creoles have facilitated communication and cooperation between many ethnic groups. Most ethnic groups practice a patriarchal society, although some groups, such as in the Bijagos Archipelago, are matriarchal. Polygamy in most areas is socially accepted. Alcohol consumption rates are low.
Guinea-Bissau has a poorly developed economy and ranks among the poorest nations in the world. In 1998, the infrastructure was severely damaged by fighting between government troops and rebel militias. Some rebuilding has occurred in the past decade, with economic growth in the late 2000s. Inequality of wealth is extreme. Most the population relies on subsistence agriculture. In recent years, Guinea-Bissau has become the fifth largest cashew producer. Agriculture employs 82% of the workforce and generates 62% of the GDP. Primary crops include rice, corn, beans, cassava, and nuts. Industrial activity is limited to food processing. Commercially viable mineral deposits have yet to be exploited. Primary trade partners include India, Nigeria, Portugal, and Senegal.
Corruption levels rank among the highest worldwide. Corruption is perceived as widespread and in all areas of government. Rebel forces in neighboring Senegal traffic arms into the country. The Archipelago Dos Bijagos has become increasingly involved in trafficking cocaine and other illicit drugs from South America to Europe due to its geographic location and separation from the mainland. Human trafficking remains a concern.
Indigenous religions and Islam are the most widely followed religious orientations. Those practicing indigenous religious are widely found throughout the country except in northern areas. Indigenous beliefs stress communication with spirits of the dead and the building of shrines to provide food and drink offerings. Muslims are concentrated among the Fula and Mandinka and generally reside in the north and northeast. Christians are primarily Catholic although there are many active Protestant groups. Christians are typically found in Bissau and in cities or large towns.
The constitution protects religious freedom which is upheld by the government. There have been no reported instances of government personnel or individuals discriminating or persecuting others on religious grounds. Religious groups must be licensed by the government to operate in Guinea-Bissau. There have been no reported instances of the government refusing to license a religious group.
Bissau, Bafatá, Gabú, Bissorã, Bolama, Cacheu, Bubaque, Catió, Mansôa, Buba.
None of the 10 largest cities have an LDS congregation. 32% of the national population resides in the 10 largest cities. A quarter of Bissau-Guineans reside in Bissau.
There has been no reported LDS presence in Guinea-Bissau. In 1998, Guinea-Bissau became part of the Africa West Area.
Very few Bissau-Guineans have joined the Church abroad. In spring 2010, missionaries serving in Aranjuez, Spain baptized an enthusiastic male Bissau-Guinean convert who was married to a Spaniard. Several native members may reside in the country after joining the Church abroad, most likely in Portuguese-speaking African nations, Portugal, or Spain.
There are no reported LDS congregations.
All LDS scriptures and most church materials are available in Portuguese. Materials translated into Fulani and Mandinka include Gospel Principles and The Prophet Joseph Smith's Testimony.
Due to poor living conditions and tropical climate, Guinea-Bissau has a very high risk for the spread of infectious disease. HIV/AIDS infects 1.8% of the population.
As of 2010, the LDS Church is not known to have provided humanitarian service or development work in Guinea-Bissau.
No legal or cultural obstacles prevent an official LDS Church establishment. Other Christian faiths proselyte freely and have not reported instances of societal abuse of religious freedom. Many opportunities for humanitarian and development work have yet to be pursued, which may lead to a future LDS presence.
With one of the highest percentages of followers of indigenous religions in Africa, the Church may face challenges adjusting teaching methods to meeting the needs of prospective investigators and members in Guinea-Bissau. Indigenous beliefs share some similarities with Latter-day Saint beliefs, such as interest in the welfare of our departed ancestors. The frequent and widespread practice of indigenous religion may result in a tendency for some members to retain these cultural beliefs after baptism. Christians concentrated in Bissau and the larger cities will likely facilitate the Church's initial establishment by proselytizing a population with a religious background to whom the Church has tailored past proselytism approaches. Furthermore larger cities allow for fewer mission outreach centers, increasing efficiency.
Deep poverty, political instability, a small population, distance from currently established mission outreach centers, and the relatively recent commencement of LDS missionary activity in Portuguese-speaking Africa have contributed to a lack of an LDS presence in Guinea Bissau. The entire population remains unreached by current LDS mission outreach efforts. No nations bordering Guinea-Bissau have an official LDS presence.
Due to language issues, Guinea Bissau may one day be assigned to the Cape Verde Praia Mission. Current opportunities to teach Bissau-Guineans in other nations may help the Church established an official presence. However, many of these individuals do not return to their home country.
Although no convert baptisms have occurred in Guinea-Bissau, native members have joined the Church abroad. However, it is undetermined whether natives who join the Church abroad ever return to their home country due to poor living standards and chronic political instability. Bissau-Guineas appear receptive to the Church in other nations.
Guinea-Bissau exhibits a diversity of ethnic groups, none of which constitute over 30% of the population. African nations with such large diversity tend to be politically unstable and have historic ethnic conflicts manifest themselves in all areas of society. Such conflict may carry over into the church if members from one ethnic group in a congregation do not support the leadership of their congregation led by a rival ethnic group. Although fluent in Portuguese and sharing a Portuguese colonial past, Cape Verdean Latter-day Saints may face challenges serving missions in Guinea-Bissau due to animosity directed toward wealthy Cape Verdeans who have in the past dominated governmental affairs.
Portuguese LDS church materials along with limited proselytism materials in Fulani and Mandinka allow for outreach to occur among most of the literate population. High illiteracy creates challenges for members to accurately learn about Church doctrine and develop capable, self-sufficient leadership and also provides opportunity for the Church to provide service teaching literacy skills.
Few if any Bissau-Guineans have served full-time missionaries. No missionary work had occurred in Guinea-Bissau in 2010. Once an official Church presence is established, the development of a local full-time missionary force will be crucial toward insuring long-term growth and self-sufficiency.
Guinea-Bissau pertains to the Accra Ghana Temple district.
Guinea-Bissau is one of the few non-Islamic African nations without an official LDS Church presence. Other nations which have a Muslim minority without an official LDS Church presence in continental Africa include Burundi, Equatorial Guinea, and Gabon.
Other missionary-oriented Christian churches report slow to modest growth. These denominations have struggled to develop local leadership due to poor living conditions, political instability, and isolation from larger Christian populations. Jehovah's Witnesses gain only a handful of new converts year to year. However, many of these groups have small self-sufficient communities in Bissau and larger cities.
Several Church members who have petitioned the Church to begin missionary activity in unreached nations in Africa have been told that the current needs in African nations with an official Church presence combined with a lack of mission outreach resources worldwide have delayed the opening of nations like Guinea-Bissau. The absence of a United States embassy in Guinea-Bissau, limited infrastructure and health care, and ongoing political instability may lead the Church to hesitate commencing formal missionary activity due to the reliance on American senior missionaries to begin establishing the LDS Church in unreached nations. Security issues also pose potential concerns, although LDS missions have long operated in Latin American nations with similar issues. Due to the maturation of the Church in many more established African nations like Ghana and Nigeria, African senior missionary couples may be assigned to the country to assist in establishing a presence. The growth of the Church in nearby Cape Verde may result in Portuguese-speaking African missionaries being assigned in small numbers to Guinea-Bissau once regional and international Church leaders decide to begin proselytism.
|
0.988782 |
If you ever want to liven up a slow night at the sports bar, stand up and in a loud, clear voice say, "Tennis and gymnastics have got to be two of the toughest sports to play."
After the laughter dies down and no more popcorn is being thrown at you, back up your claim by describing the high degree of hand-eye coordination and agility of tennis , not to mention the flexibility and nerve that gymnasts require. In fact, according to a recent survey of experts by ESPN, tennis and gymnastics ranked as the No. 7 and No. 8 most difficult sports, respectively.
The survey creators, in order to avoid endless, vague arguments about the toughest sport to play, identified 10 skills to measure. These include traits such as speed, power and strength, and also cognitive categories, such as nerve, hand-eye coordination and analytic aptitude . Throw in flexibility, agility, endurance and durability, and you have a complete cross-section of what makes a great athlete.
Next, a list of 60 sports, including everything from baseball to curling to badminton, was evaluated by a team of sports science experts to determine how important each skill is for each sport. A ranking of 1 to 10 was assigned for each skill, then the skills for each sport were totaled and averaged. The sport with the highest average was named the toughest sport to play by the experts.
For example, while a sport like weight-lifting requires enormous strength and power , it requires little else, giving it a low overall score. Auto racing needs analytical smarts and great hand-eye coordination, yet power, speed and agility are required only of the car, not the driver.
Enough already, what is the No. 1 toughest sport to play? Let's start with the top five and work our way up.
Wrestling just barely beats out martial arts as the No. 5 toughest sport. Then, basketball and football take the No. 4 and No. 3 spots, respectively. At No. 2, while hockey players may be missing teeth and suffer from a few concussions, their athletic skill is undeniable, as speed and strength are combined with durability and eye-hand coordination.
Finally, the toughest sport to participate in is... boxing .
It may be a surprise at first, but as each skill set is considered, the conclusion makes sense. Boxing ranks in the top five in five skill categories, and in the top 20 in four others. So, the most interesting debate at the bar may be between the tennis fan and the boxing fan. My money is on the sweet science.
Whatâ??s the Longest Winning Streak in Any Sport?
Who Are the Worldâ??s Fastest Man and Woman?
How Do Athletes Get â??In the Zoneâ?? of Peak Performance?
Are These Four Personality Types for Real?
|
0.988463 |
Chronic fatigue is an illness where the fatigue lasts for more than six months. Some of the symptoms include: muscle pain, loss of memory, headaches, chills, night sweats, to name a few.
We know very little about what causes it, but luckily intermittent fasting can help to reduce the effects.
Intermittent fasting can help to reduce the symptoms of chronic fatigue. If you have chronic fatigue, chances are your mitochondria are not functioning at optimal levels. Your mitochondria actually work better when they are calorie restricted, they become more efficient, so this can result in helping with chronic fatigue.
My advice is to start slowly, and always consult a doctor first.
|
0.999127 |
A comma should be added when an adverb begins a sentence.
Prepositions show all of the following types of relationship except A. logic. B. space. C. tense. D. time.
|
0.89994 |
Ruth Ann Udstad Fertel (February 5, 1927 – April 16, 2002) was a Louisiana businesswoman, best known as the founder of Ruth's Chris Steak Houses.
She skipped several grades in grammar school, and graduated at age fifteen. The family used the money from her brother Sig's World War Two G.I. Bill benefits to send her to Louisiana State University in Baton Rouge at fifteen, from where she graduated at age 19 with honors in chemistry and physics.
In 1946, Udstad obtained a job teaching at McNeese State University in Lake Charles. She left after two semesters.
On October 2, 1948, she married Rodney Fertel, who lived in Baton Rouge and shared her love of horses, and they had two sons, Jerry and Randy. In 1951, they opened a racing stable in Baton Rouge. Ruth earned a thoroughbred trainer's license, making her the first female horse trainer in Louisiana. Ruth and Rodney divorced in 1958. Rodney unsuccessfully ran in the 1969 mayoral election in New Orleans as "The Gorilla Man", often wearing a gorilla suit to campaign events, championing the cause of renovating the Audubon Zoo.
In 1965 Fertel, realizing she needed to earn more money to send her sons to college, found a classified ad in the Times-Picayune offering a restaurant for sale, the original Chris' Steak House, a 60-seat restaurant at 1100 North Broad St, New Orleans. When she realized that it had opened on February 5, 1927, the day she was born, she took this as an omen. Ignoring the advice of her banker, lawyer, and friends, she mortgaged her house to purchase the restaurant, even though the business had previously failed six times under the previous owner, Chris Matulich, and despite knowing nothing about the restaurant business. She initially planned to raise just $18,000 to cover the purchase price, until it was pointed out to her that she would need an additional $4,000 to cover the cost of renovations and food. On her first day, May 24, 1965, she sold 35 steaks at $5 each. Within six months, she had made over double her annual salary from her previous job.
Fertel personally took a hand in every part of the business. She had to teach herself how to butcher steak, and despite being just five-foot-two and 110-pounds, would saw up 30-pound short loins by hand until she could afford an electric band saw. She staffed her restaurant with single mothers, saying that they were hard workers and reliable. For many years, Chris' Steak House was the only upscale restaurant in New Orleans with an all-female wait staff. From the beginning her restaurant attracted local politicians as well as athletes, businessmen and reporters. Local celebrities like Fats Domino were regulars.
In early 1976, shortly after signing a new ten-year lease on the restaurant, a fire ruined the property. Fertel had recently acquired a second property nearby to rent out as party space. Within seven days, she had relocated the restaurant to its new location a few blocks away at 711 Broad Street and re-opened it, expanding to 160 seats in the process. The sales agreement prevented her from using the original name at any other address, so she named the new restaurant Ruth's Chris Steak House. She admitted later to Fortune Magazine that "I've always hated the name, but we've always managed to work around it." Political reporter Rosemary James noted that she "would not have missed a Friday before a major election at Ruth's Chris Steak House. That was the place to be if you wanted to get some scoops." Fertel bought two shotgun houses behind the restaurant, remodeled and connected them, and lived there for the rest of her life.
The same year, Fertel agreed to issue her first franchise. The first franchised restaurant was opened in 1977 by a loyal customer, Thomas J. "T. J." Moran (c. 1931-2015), in Baton Rouge, who went on to open several more franchised Ruth's Chris locations, TJ Ribs, and Ruffino's restaurants in Baton Rouge. Fertel noted, "All our franchisees were people who had eaten at one time or another in one of our restaurants. We never looked for franchisees. They came to us." The chain expanded rapidly over the next two decades, with over 80 locations in the US and overseas, and earning Fertel a number of accolades as an entrepreneur, and the epithet The First Lady of American Restaurants or The Empress of Steak.
She continued to run the Ruth's Chris business throughout her life. In 1997, the year she turned 70, she personally visited 42 of her restaurants to "smell out how they're doing." When she fell ill in 1999, she sold the chain to Madison Dearborn Partners of Chicago, Illinois.
A smoker for more than fifty years, she was diagnosed with lung cancer in 2000, and died two years later in 2002, at age 75. She was buried in Lake Lawn Metairie Cemetery, in a lavish mausoleum she and her friend and business partner, Lana Duke, had commissioned in 1995, and which cost over $500,000. The granite building, on a square 27-foot plot, has black columns and stained glass windows featuring angels and the words "It's A Wonderful World". The Fertel-Duke mausoleum can hold six, and is intended to have Fertel family on one side and Duke family on the other. It was designed by the art department at Duke's advertising company. In 1999, Fertel and Duke held a party for over 150 guests to mark the completion of the structure. The event was presided over by Father Bob Massett, who blessed the crowd with a sprinkling of beer.
During her lifetime, she was known for her charitable work. In 1965, when Hurricane Betsy hit New Orleans, she was left without power, and realized that the food in her restaurant was in danger of spoiling. She cooked everything and provided free steak meals to disaster workers and victims in the local area. She paid for the education of numerous children, provided counseling for women starting businesses, and contributed to local schools.
The Ruth U. Fertel Foundation, established in her will, supports education in Louisiana through programs designed to serve students from kindergarten through college. It gave away $1.2 million in 2006 after Hurricane Katrina.
The Ruth U. Fertel Culinary Arts Center at Nicholls State University in Thibodaux, Louisiana, is a planned expansion of the Chef John Folse Culinary Institute. It will include a student-operated restaurant, six kitchens, a commissary, an auditorium, a computer lab and several classrooms. The historic Rienzi-Levert house will house offices and provide accommodations for receptions and other special events.
The annual Ruth Fertel Keeper of the Flame Award is made jointly by the Southern Foodways Alliance and the Fertel Foundation, and honors an unsung hero or heroine who has made a great contribution to food. The award was first made in 2000. The honoree receives a monetary award and a documentary film is made about them.
^ "Randy Fertel, philanthropist and son of steakhouse founder Ruth and 'Gorilla Man' Rodney puts family's legacy into print". The Times-Picayune. Retrieved 4 February 2013.
^ "Steamroller - Ruth Fertel". Capitalist Chicks. Retrieved 4 February 2013.
^ "Her Life Is The Stuff Of Legend" (PDF). Archived from the original (PDF) on 24 October 2013. Retrieved 4 February 2013.
^ "Steamroller – Ruth Fertel". Capitalist Chicks. Retrieved 4 February 2013.
^ Fertel, Randy (2011). The Gorilla Man and the Empress of Steak. Jackson, MS: University Press of Mississippi. p. 21. ISBN 978-1-61703-083-3.
^ Katie Bloor & Linda J Shea. "Ruth Fertel: A Pioneer in the Restaurant Industry". HTM 591S – Foundations in Hospitality and Tourism Management. University of Massachusetts Amherst. Archived from the original on 2 April 2015. Retrieved 4 February 2013.
^ Martin, V.B. (2010). The Celestial Society: A Life in Medicine. Xlibris Co. p. 528. ISBN 978-1-4500-8800-8.
^ "Ruth Fertel: A Pioneer in the Restaurant Industry, Katie Bloor & Linda J Shea, PhD". HTM 591S – Foundations in Hospitality and Tourism Management. University of Massachusetts Amherst. Archived from the original on 2 April 2015. Retrieved 4 February 2013.
^ "Ruth Fertel of Steakhouse Fame Is Dead at 75". NY Times. April 18, 2002. Retrieved 4 February 2013.
^ "An Author Finds His Therapy Inside A Family Memoir". De Soto: Exploring the South. January 2012. Retrieved 4 February 2013.
^ "Tomb Share (Randy Fertel)". Retrieved 4 February 2013.
^ "Tomb Share" (PDF). The Times-Picayune. Jun 18, 1999. Retrieved 4 February 2013.
^ "Takes of the Crypt". Kentucky New Era. July 8, 2000. Retrieved 4 February 2013.
^ "DiRoNA Hall of Fame". Retrieved 4 February 2013.
^ "The Ruth U. Fertel Foundation". Archived from the original on 16 November 2012. Retrieved 4 February 2013.
^ "Chef John Folse Culinary Institute". Retrieved 4 February 2013.
^ "Ruth Fertel Keeper of the Flame Award". Archived from the original on 19 December 2012. Retrieved 4 February 2013.
This page was last edited on 22 February 2019, at 02:16 (UTC).
|
0.996914 |
It's about one-six-hundred-fiftieth the number of Seats in Fenway Park.
In other words, 58 is 0.0015646 times the count of Seats in Fenway Park, and the count of Seats in Fenway Park is 639.140 times that amount.
It's about one-eight-hundred-fiftieth the number of Seats in New Yankee Stadium.
In other words, 58 is 0.0011534 times the count of Seats in New Yankee Stadium, and the count of Seats in New Yankee Stadium is 867 times that amount.
It's about one-one-thousandth the number of Seats in The Colosseum.
In other words, the count of Seats in The Colosseum is 1,000 times 58.
It's about one-one-thousand-five-hundredth the number of Seats in Lambeau Field.
In other words, 58 is 0.0007184 times the count of Seats in Lambeau Field, and the count of Seats in Lambeau Field is 1,392 times that amount.
It's about one-three-thousand-five-hundredth the number of Letters in the Longest English Word.
In other words, 58 is 0.000305554 times the count of an Letters in the Longest English Word, and the count of an Letters in the Longest English Word is 3,272.740 times that amount.
It's about one-ten-thousandth the number of Words in War and Peace.
In other words, 58 is 0.00009875920 times the count of Words in War and Peace, and the count of Words in War and Peace is 10,125.60 times that amount.
It's about one-fifty-thousandth the number of ATMs in the World.
In other words, the count of ATMs in the World is 50,000 times 58.
|
0.999999 |
Digital experiences are more important than ever for brick-and-mortar retailers—and signage is one of the best ways retailers can engage shoppers with an in-store digital presence. But to deliver the full digital experience, retailers need to go beyond the basics of broadcasting a sales message.
Modern signage can do much more, delivering a two-way interaction between customers and businesses. New developments in sensors, analytics, and cloud computing enable signs to respond to customer behavior and help retailers update content on the fly.
It can be surprisingly easy to deploy these systems. In some cases, retailers need little more than a power outlet. And the upside can be huge, particularly at the point-of-sale (POS) checkout area, where 75% of all purchasing decisions are made.
Consider the experience of the restaurant industry, which has been at the forefront of the digital transformation. The majority of consumers in this market are tech-savvy users who expect highly polished digital experiences.
To meet the demands of this fast-paced industry, the signage experts at Giada Technology developed a digital menu solution for KFC. After a 3-month trial run, the KFC Digital Menu Board increased customer satisfaction by 20%, increased sales by 17%, and improved operational efficiency by 80%.
Following a similar approach, Giada equipped more than 200 Austrian pharmacies with a mobile signage system. Content messaging was handled regionally by an advertising agency with pharmacy-specific topics. Among other benefits, the pharmacies enjoyed a boost in spontaneous purchasing, increasing sell-out of advertised products.
To understand how cutting-edge signage achieves these results, consider the challenges inherent to low-end solutions. With their limited capabilities, the systems can serve up only fixed messaging, and then only to a few types of displays. For example, a low-end solution might not be able to serve both large window displays and small interactive screens in the checkout area.
Low-end solutions can be difficult to set up and maintain. Getting access to a local network can be particularly problematic. Updating the content can also be a time-consuming chore.
In contrast, a modern digital retail management system can send customized messaging to multiple displays (store signage, kiosks, and mobile phones) based on timely insights into customer shopping data.
The sensor and sales information is processed on the edge of the network or sent to the cloud for more detailed analysis. The result is that businesses can more accurately target specific messages, advertisements, and other information that will be updated simultaneously to all of their digital signage assets.
In other words, modern systems transform signage from a one-way broadcast channel into a bidirectional communications network that engages customers in a far more meaningful way.
As an example, Liu points to the Giada-Shutuo Smart Digital Signage solution (see Figure 1). The solution starts with interactive sensors and displays powered by Giada Cloud Terminals based on Intel® technology. These sensors gather data such as the number of people in the store, items they are seeking, and the like.
Figure 1. The Giada-Shutuo Smart Digital Signage platform intelligently combines sensors, signage, and the cloud.
Using their powerful Intel® processors, the terminals pre-process signage, sensor, and mobile data at the edge, and efficiently exchange that information with the cloud. This two-directional flow of data is enabled by the Giada/Shutuo Smart Digital Signage platform, an end-to-end solution that includes terminal software and a cloud-based portal.
From the Shutuo cloud-based portal, decision-makers can tap into customer, store, and device analytics anywhere to engage and respond to deep insights into customer preferences and behavior.
With these insights, shopkeepers can edit the advertisement, announcement, product coupon, or other messaging that they want to present to customers. This content is uploaded to the cloud, where the Giada/Shutuo content management system prepares the presentation for delivery to a variety of displays, such as smartphones, kiosks, or video walls.
In addition to creating a sophisticated solution, Giada looked for ways to simplify deployment. According to the company, its solutions can be up and running in under two hours. What's more, the company has created solutions like the Giada Smart Restaurant Comprehensive Solution and the Giada Mobile Solution for Convenience Store Digital Signage Solution, which come pre-integrated with industry-specific software.
Simplicity is also one of the main reasons the company partnered with Intel. By using Intel's highly scalable technology, Giada was able to create a solution that can go from a single simple display to numerous multi-sensor screens with one flexible architecture.
One-way, message-driven digital signage is being replaced with two-way interactive platforms that use sensor-based customer analytics to manage the signage messaging and communication. A content management system complements the two-way interaction by making it easy for businesses to edit the messages while delivering the desired content to a variety of different display options, like in-store signage, kiosks, and mobile phones.
A solution like Giada/Shutuo's Smart Digital Signage platform benefits businesses by effectively capturing customer attention to increase floor traffic and help drive the selling of additional products or services often at the point of sale. The customers benefit from reduced wait times, better understanding of products, and personalized advertisements fine-tuned by data analytics.
Two-way interactions really are better than one!
|
0.999579 |
Take a look at a selection of our recent projects below to see some of the recent ways we helped local homeowners with garage door related issues.
Customer Issue: The customer’s garage door refused to close after opening during routine operation.
Our Solution: First things first, our team checked the sensors, and found the problem immediately. One of them had been nudged out of place somehow, and after loosening them for realignment and reattaching them in place our technicians found the garage door perfectly functionable.
Our Solution: The bending was quite significant, and it was making it hard for the panels to move along them. We replaced the tracks and then lubricated the rollers to ensure the door's movement was as smooth as possible.
Customer Issue: Door wouldn't stop reversing.
Our Solution: Being quite familiar with such a scenario, to say the least, the first thing we checked was the opener's safety sensors. True enough, they'd become misaligned. We quickly realigned them and then, after making sure the door could finally close, tested it to ensure that it would still reverse when it needed to.
Our Solution: We were extra careful while removing the old spring, knowing full well how dangerous these components can be. We were just as careful, if not more, as we installed the new unit. After adjusting its tension to the right level, we opened and closed the door a few times to make sure it was fully functional again.
Our professionals are ready to fix any problems you have.
We use top quality brands on each project.
Our technicians will be there right when you need them the most!
You can rely on us to provide you with quality service at affordable prices.
|
0.999938 |
Reinforcement Learning (RL) is a powerful technique capable of solving complex tasks such as locomotion, Atari games, racing games, and robotic manipulation tasks, all through training an agent to optimize behaviors over a reward function. There are many tasks, however, for which it is hard to design a reward function that is both easy to train and that yields the desired behavior once optimized. Suppose we want a robotic arm to learn how to place a ring onto a peg. The most natural reward function would be for an agent to receive a reward of 1 at the desired end configuration and 0 everywhere else. However, the required motion for this task–to align the ring at the top of the peg and then slide it to the bottom–is impractical to learn under such a binary reward, because the usual random exploration of our initial policy is unlikely to ever reach the goal, as seen in Video 1a. Alternatively, one can try to shape the reward function to potentially alleviate this problem, but finding a good shaping requires considerable expertise and experimentation. For example, directly minimizing the distance between the center of the ring and the bottom of the peg leads to an unsuccessful policy that smashes the ring against the peg, as in Video 1b. We propose a method to learn efficiently without modifying the reward function, by automatically generating a curriculum over start positions.
Video 1a: A randomly initialized policy is unable to reach the goal from most start positions, hence being unable to learn.
Video 1b: Shaping the reward with a penalty on the distance from the ring center to the peg bottom yields an undesired behavior.
We would like to train an agent to reach the goal from any starting position, without requiring an expert to shape the reward. Clearly, not all starting positions are equally difficult. In particular, even a random agent that is placed near to the goal will be able to reach the goal some of the time, receive a reward, and hence start learning! This acquired knowledge can then be bootstrapped to solve the task starting from further away from the goal. By choosing the ordering of the starting positions that we use in training, we can exploit this underlying structure of the problem and improve learning efficiency. A key advantage of this technique is that the reward function is not modified, and optimizing the sparse reward directly is less prone to yielding undesired behaviors. Ordering a set of related tasks to be learned is referred to as curriculum learning, and a central question for us is how to choose this task ordering. Our method, which we explain in more detail below, uses the performance of the learning agent to automatically generate a curriculum of tasks which start from the goal and expand outwards.
In goal-oriented tasks the aim is to reach a desired configuration from any start state. For example, in the ring-on-peg task introduced above, we desire to place the ring on the peg starting from any configuration. From most start positions, the random exploration of our initial policy never reaches the goal and hence perceives no reward. Nevertheless, it can be seen in Video 2a how a random policy is likely to reach the bottom of the peg if it is initialized from a nearby position. Then, once we have learned how to reach the goal from around the goal, learning from further away is easier since the agent already knows how to proceed if exploratory actions drive its state nearby the goal, as in Video 2b. Eventually, the agent successfully learns to reach the goal from a wide range of starting positions, as in Video 2c.
Video 2a-c: Our method strives to learn first starting nearby the goal, and then progressively expands in reverse the positions from where it starts.
This method of learning in reverse, or growing outwards from the goal, draws inspiration from Dynamic Programming methods, where the solutions to easier sub-problems are used to compute the solution to harder problems.
To implement this reverse curriculum, we need to ensure that this outwards expansion happens at the right pace for the learning agent. In other words, we want to mathematically describe a set of starts that tracks the current agent performance and provides a good learning signal to our Reinforcement Learning algorithm. In particular we focus on Policy Gradient algorithms, which improve a parameterized policy by taking steps in the direction of an estimated gradient of the total expected reward . This gradient estimation is usually a variation of the original REINFORCE, which is estimated by collecting $N$ on-policy trajectories starting from states .
The values of and have the straightforward interpretation of minimum success probability acceptable for training from that start and maximum success probability above which we prefer to focus on training from other starts. In all our experiments we used 10% and 90%.
From the above intuition and derivation, we would like to train our policy with trajectories starting from SoID states. Unfortunately, finding all starts that exactly satisfy Eq. (2) at every policy update is intractable, and hence we introduce an efficient approximation to automatically generate this reverse curriculum: we sample states nearby the starts that were estimated to be SoID during the previous iteration. To do that, we propose a way to filter out non-SoID starts using the trajectories collected during the last training iteration and then sample nearby states. The full algorithm is illustrated in Video 3 and details are given below.
Video 3: Animation illustrating the main steps of our algorithm, and how it automatically produces a curriculum adapted to the current agent performance.
At every policy gradient training iteration, we collect trajectories from some start positions . For most start states, we collect at least three trajectories starting from there, and hence we can compute a Monte Carlo estimate of the success probability of our policy from those starts . For every that the estimate is not within the fixed bounds and , we discard this start so that we don’t train from it during the next iteration. Starts that were SoID for a previous policy might not be SoID for the current policy because they are now mastered or because the updated policy got worse at them, so it is important to keep filtering out the non-SoID starts to maintain a curriculum adapted to the current agent performance.
After filtering the non-SoID we need to obtain new SoIDs to keep expanding the starts from where we train. We do that by sampling states nearby the remaining SoID because those have a similar level of difficulty for the current policy – and hence might also be SoID. But what is a good way to sample nearby a certain state ? We propose to take random exploratory actions from that , and record the visited states. This technique is preferable to applying noise in state space directly because that might yield states that are not even feasible or that cannot be reached by executing actions from the original .
To initialize the algorithm, we need to seed it with one start at the goal and then run brownian motion from it, train from the collected starts, filter out the non-SoID and iterate. This is usually easy to provide when specifying the problem, and is a milder assumption than requiring a full demonstration of how to get to that point.
Our algorithm exploits the capability of choosing the start distribution from where the collected trajectories start. This is the case in many systems, like all simulated ones. Kakade and Langford also build upon this assumption, and propose theoretical evidence of the usefulness of modifying the start distribution.
Navigation to a fixed goal and fine-grained manipulation to a desired configuration are two examples of goal-oriented robotics tasks. We analyze how the proposed algorithm automatically generates a reverse curriculum for the following tasks: Point-mass Maze (Fig. 1a), Ant Maze (Fig. 1b), Ring-on-Peg (Fig. 1c) and Key insertion (Fig. 1d).
Fig. 1a-d: Tasks where we illustrate the performance of our method (from left to right): Point-mass Maze, Ant Maze, Ring-on-Peg, Key insertion.
In this task we want to learn how to reach the end of the red area in the upper-right corner of Fig. 1a from any start point within the maze. We see in Fig. 2 that a randomly initialized policy – as we have at iteration , has a success probability of zero from everywhere but around the goal. The second row of Fig. 2 shows how our algorithm proposes start positions nearby the goal at . We see in the subsequent columns that the starts generated by our method keep tracking the area where the training policy succeeds sometimes but not always, hence giving a good learning signal for any policy gradient learning method.
Fig. 2: Snapshots of the policy performance and the starts generated by our reverse curriculum (replay buffer not depicted for clarity), always tracking the regions at an intermediate level of difficulty.
To avoid forgetting how to reach the goal from some areas, we keep a replay buffer of all starts that were SoID for any previous policy. In every training iteration we sample a fraction of the trajectories starting from states in this replay.
In robotics, a complex coordinated motion is often required to reach the desired configuration. For example, a quadruped like the one in Fig. 1b needs to know how to coordinate all its torques to move and advance towards the goal. As seen in a final policy reported in Video 4, our algorithm is able to learn this behavior even when only a success/failure reward is provided when reaching the goal! The reward function was not modified to include any distance-to-goal, Center of Mass speed, or exploration bonus.
Video 4: Emergence of complex coordination and use of environment contacts when training with our reverse curriculum method - even under sparse rewards.
Our method can also tackle complex robotic manipulation problems like the ones depicted in Fig. 1c and 1d. Both task have a seven Degrees of Freedom arm and have complex contact constraints. The first task requires the robot to insert a ring down to the bottom of the peg, and the second task seeks to insert a key in a lock, rotate 90 degrees clockwise, insert it further and rotate 90 degrees counterclockwise. In both cases, a reward is only granted when the desired end configuration is reached. State-of-the-art RL algorithms without curriculum are unable to learn how to solve the task, but with our reverse curriculum generation we can obtain a successful policy from a wide range of start positions, as observed in Videos 5a and 5b.
Video 5a (left) and Video 5b (right): Final policies obtained with our reverse curriculum approach in the Ring-on-Peg and the Key Insertion tasks. The agent succeeds from a wide range of initial positions and is able to leverage the contacts to guide itself.
Recently RL methods have been moving away from the single-task paradigm to tackle sets of tasks. This is an effort to get closer to real-world scenarios, where every time a tasks needs to be executed there are always variations in the starting configuration, goal or other parameters. Therefore it is of utmost importance to advance the field of curriculum learning to exploit the underlying structure of these sets of tasks. Our Reverse Curriculum strategy is a step in this direction, yielding impressive results in locomotion and complex manipulation tasks that cannot be solved without a curriculum.
Furthermore, it can be observed in the videos of our final policy for the manipulation tasks that the agent has learned to exploit the contacts in the environment instead of avoiding them. Therefore, the learning based aspect of the presented method has a great potential to tackle problems that classical motion planning algorithms could struggle with, such as environments with non-rigid objects or with uncertainties in the task geometric parameters. We also leave as future work to combine our curriculum-generation approach with domain randomization methods to obtain policies that are transferable to the real world.
Carlos Florensa, David Held, Markus Wulfmeier, Michael Zhang, Pieter Abbeel. Reverse Curriculum Generation for Reinforcement Learning. In CoRL 2017.
We have also open-sourced the code in the project website.
We would like to thank the co-authors of this work, who also provided very valuable feedback for this blog post: David Held, Markus Wulfmeier, Michael R. Zhang and Pieter Abbeel.
A. Graves, M. G. Bellemare, J. Menick, R. Munos, and K. Kavukcuoglu. Automated Curriculum Learning for Neural Networks. arXiv preprint, arXiv:1704.03003, 2017.
M. Asada, S. Noda, S. Tawaratsumida, and K. Hosoda. Purposive behavior acquisition for a real robot by Vision-Based reinforcement learning. Machine Learning, 1996.
A. Karpathy and M. Van De Panne. Curriculum learning for motor skills. In Canadian Conference on Artificial Intelligence, pages 325–330. Springer, 2012.
J. Schmidhuber. POWER PLAY : Training an Increasingly General Problem Solver by Continually Searching for the Simplest Still Unsolvable Problem. Frontiers in Psychology, 2013.
A. Baranes and P.-Y. Oudeyer. Active learning of inverse models with intrinsically motivated goal exploration in robots. Robotics and Autonomous Systems, 61(1), 2013.
S. Sukhbaatar, I. Kostrikov, A. Szlam, and R. Fergus. Intrinsic Motivation and Automatic Curricula via Asymmetric Self-Play. arXiv preprint, arXiv: 1703.05407, 2017.
J. A. Bagnell, S. Kakade, A. Y. Ng, and J. Schneider. Policy search by dynamic programming. Advances in Neural Information Processing Systems, 16:79, 2003.
S. Kakade and J. Langford. Approximately Optimal Approximate Reinforcement Learning. International Conference in Machine Learning, 2002.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.