text
stringlengths
310
8.3k
writing_style_average
float64
-3.5
3.37
facts_and_trivia_average
float64
-3.77
3.96
educational_value_average
float64
-3.86
3.99
required_expertise_average
float64
-3.75
4.36
writing_style_chunks
sequencelengths
2
2
facts_and_trivia_chunks
sequencelengths
2
2
educational_value_chunks
sequencelengths
2
2
required_expertise_chunks
sequencelengths
2
2
length
int64
1.02k
1.02k
chunk_lengths
sequencelengths
2
2
input_ids
sequencelengths
1.02k
1.02k
document_index
int64
75
1.18M
document_position
int64
0
1.47M
source_domain
stringclasses
7 values
cluster_id
int64
-1
24
cluster_no
int64
-1
25
What's new in ColdFusion (2016 release) by Rakshith Naresh @LinkedIn Product themes of ColdFusion (2016 release) Embrace futuristic technologies Deploy enterprise ready applications Build applications quickly vAlthough an existing knowledge of ColdFusion would help, this article does not require you to have ColdFusion skills. A general understanding of the web technologies would help you to understand quickly. User level: All Adobe ColdFusion (2016 release) is a feature packed version of ColdFusion with benefits ranging from better security, performance, scalability, PDF improvements, language enhancements along with the all new API Manager. While all the features of ColdFusion (2016 release) are easy to follow and understand, API Manager needs an introduction. API Manager is a new component introduced for the first time in Adobe ColdFusion (2016 release). It is a standalone server component that can run on its own, providing you all the capabilities of monitoring, measuring, securing, and monetizing APIs. APIs can be either REST or even SOAP-based. While API Manager component makes it really easy to import APIs from a ColdFusion server, API Manager by itself is technology agnostic and can be used with APIs (REST or SOAP) defined by any other backend technology. For instance, the API Manager can provide all the benefits associated to a PHP or an ASP.NET API as much as a CFML-based API. All the client requests will be routed through the API Manager before routing the requests to the actual end point in the backend. This article serves as a quick introduction to what is available in ColdFusion (2016 release). As it is not possible to cover all features in a single article, you can refer to other feature specific articles in Adobe Developer Connection or ColdFusion (2016 release) documentation for more information. The entire feature set of ColdFusion (2016 release) can be categorized into three product themes. These themes are also focus areas for ColdFusion (2016 release). In this article, I will explain each theme along with its features. The three product themes of ColdFusion (2016 release) are as follows: Under this product theme, ColdFusion (2016 release) introduces features that let you quickly and easily adopt the latest web technologies. APIs have become the ubiquitous interfaces for two different applications to communicate effectively with each other. The proof for the above claim comes from the fact that there has been an exponential increase in the number of public and private APIs being created by organizations, small or large. Forrester predicts that more than 75% of Fortune 100 companies will have open APIs by the end of this year. Although APIs are the now and future, it is not straightforward for an organization of any size to implement an API strategy. You need to start with defining the business objectives for API strategy. It then involves designing the APIs either by using the more popular REST interface or by using the legacy SOAP interface for APIs. Once the design is complete, coding the API by using a language of choice, which includes CFML, is the next step. Many would think that once code is in place, we are ready to go to market with the API strategy. But, no. Once coding is done, the APIs need to be secured via a strong access control mechanism so that only authorized users can get access to the APIs. Once access control is implemented, there needs to be a way to manage APIs across its various versions and API lifecycle. Associating an SLA with an API is also mostly desired when having an API strategy, allowing the organization to charge for an API according to the SLA desired by the end developer or API consumer organization. With an API strategy, it is also extremely important to engage developers, either internal or external to the organization. Engaging developers typically includes, allowing developers to access a portal that gives detailed documentation for all the APIs and its methods, allowing developers to try out an API without having to write a single line of code right from the user interface of the portal itself and finally allowing developers to register their application and sign up for an SLA plan associated with an API. Once such a developer portal is in place, it is essential for an organization implementing the API strategy to get detailed metrics associated with each and every activity associated with API and its access so that the progress made towards the business objectives envisioned in the API strategy can be measured. The API Manager component in ColdFusion (2016 release) covers all the needs associated with securing APIs
0.370928
0.539586
1.678098
0.5974
[ 0.037411738043452145, 0.7044436719658485 ]
[ 0.16803027279422683, 0.9111411340377601 ]
[ 1.3788219309024, 1.9773748128930875 ]
[ 0.11874765189069258, 1.076051910607754 ]
1,024
[ 512, 512 ]
[ 1724, 29915, 29879, 716, 297, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 13, 1609, 29350, 845, 389, 405, 5114, 29882, 13, 29992, 6595, 287, 797, 13, 7566, 963, 267, 310, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 13, 6026, 13842, 3105, 332, 4695, 5722, 11763, 13, 8498, 2376, 3896, 7734, 7960, 8324, 13, 8893, 8324, 9098, 13, 29894, 2499, 3592, 385, 5923, 7134, 310, 26731, 29943, 3958, 723, 1371, 29892, 445, 4274, 947, 451, 1996, 366, 304, 505, 26731, 29943, 3958, 25078, 29889, 319, 2498, 8004, 310, 278, 1856, 5722, 11763, 723, 1371, 366, 304, 2274, 9098, 29889, 13, 2659, 3233, 29901, 2178, 13, 3253, 16945, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 338, 263, 4682, 4870, 287, 1873, 310, 26731, 29943, 3958, 411, 23633, 364, 9776, 515, 2253, 6993, 29892, 4180, 29892, 8716, 3097, 29892, 11328, 28473, 29892, 4086, 26371, 4564, 4110, 3412, 411, 278, 599, 716, 3450, 15629, 29889, 13, 8809, 488, 599, 278, 5680, 310, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 526, 4780, 304, 1101, 322, 2274, 29892, 3450, 15629, 4225, 385, 18707, 29889, 13, 8787, 15629, 338, 263, 716, 4163, 9129, 363, 278, 937, 931, 297, 2087, 16945, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 467, 739, 338, 263, 2317, 18785, 1923, 4163, 393, 508, 1065, 373, 967, 1914, 29892, 13138, 366, 599, 278, 27108, 310, 29652, 29892, 7540, 3864, 29892, 409, 2764, 292, 29892, 322, 1601, 300, 5281, 23649, 29889, 23649, 508, 367, 2845, 16759, 470, 1584, 7791, 3301, 29899, 6707, 29889, 5806, 3450, 15629, 4163, 3732, 372, 2289, 4780, 304, 1053, 23649, 515, 263, 26731, 29943, 3958, 1923, 29892, 3450, 15629, 491, 3528, 338, 15483, 946, 6582, 293, 322, 508, 367, 1304, 411, 23649, 313, 1525, 1254, 470, 7791, 3301, 29897, 3342, 491, 738, 916, 14998, 15483, 29889, 1152, 2777, 29892, 278, 3450, 15629, 508, 3867, 599, 278, 23633, 6942, 304, 263, 5048, 470, 385, 12738, 29889, 6006, 3450, 408, 1568, 408, 263, 17861, 1988, 29899, 6707, 3450, 29889, 2178, 278, 3132, 7274, 674, 367, 6745, 287, 1549, 278, 3450, 15629, 1434, 21398, 278, 7274, 304, 278, 3935, 1095, 1298, 297, 278, 14998, 29889, 13, 4013, 4274, 19700, 408, 263, 4996, 18707, 304, 825, 338, 3625, 297, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 467, 1094, 372, 338, 451, 1950, 304, 4612, 599, 5680, 297, 263, 2323, 4274, 29892, 366, 508, 2737, 304, 916, 4682, 2702, 7456, 297, 2087, 16945, 10682, 261, 15160, 470, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 5106, 363, 901, 2472, 29889, 13, 1576, 4152, 4682, 731, 310, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 508, 367, 11608, 1891, 964, 2211, 3234, 963, 267, 29889, 4525, 963, 267, 526, 884, 8569, 10161, 363, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 467, 512, 445, 4274, 29892, 306, 674, 5649, 1269, 10929, 3412, 411, 967, 5680, 29889, 450, 2211, 3234, 963, 267, 310, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 526, 408, 4477, 29901, 13, 29177, 445, 3234, 10929, 29892, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 4547, 778, 5680, 393, 1235, 366, 9098, 322, 5948, 9332, 278, 9281, 1856, 5722, 11763, 29889, 13, 8787, 29879, 505, 4953, 278, 318, 5365, 28358, 681, 19510, 363, 1023, 1422, 8324, 304, 23120, 17583, 411, 1269, 916, 29889, 450, 5296, 363, 278, 2038, 5995, 5304, 515, 278, 2114, 393, 727, 756, 1063, 385, 25658, 7910, 297, 278, 1353, 310, 970, 322, 2024, 23649, 1641, 2825, 491, 25700, 29892, 2319, 470, 2919, 29889, 1152, 29878, 4156, 8500, 29879, 393, 901, 1135, 29871, 29955, 29945, 29995, 310, 7236, 1540, 29871, 29896, 29900, 29900, 14582, 674, 505, 1722, 23649, 491, 278, 1095, 310, 445, 1629, 29889, 13, 2499, 3592, 23649, 526, 278, 1286, 322, 5434, 29892, 372, 338, 451, 20837, 363, 385, 13013, 310, 738, 2159, 304, 2334, 385, 3450, 13705, 29889, 13, 3492, 817, 304, 1369, 411, 16184, 278, 5381, 1203, 3145, 363, 3450, 13705, 29889, 13, 3112, 769, 20789, 2874, 292, 278, 23649, 2845, 491, 773, 278, 901, 5972, 16759, 5067, 470, 491, 773, 278, 25000, 7791, 3301, 5067, 363, 23649, 29889, 13, 26222, 278, 2874, 338, 4866, 29892, 14137, 278, 3450, 491, 773, 263, 4086, 310, 7348, 29892, 607, 7805, 17861, 1988, 29892, 338, 278, 2446, 4331, 29889, 9267, 723, 1348, 393, 2748, 775, 338, 297, 2058, 29892, 591, 526, 7960, 304, 748, 304, 9999, 411, 278, 3450, 13705, 29889, 1205, 29892, 694, 29889, 13, 26222, 14137, 338, 2309, 29892, 278, 23649, 817, 304, 367, 26130, 3025, 263, 4549, 2130, 2761, 13336, 577, 393, 871, 4148, 1891, 4160, 508, 679, 2130, 304, 278, 23649, 29889, 13, 26222, 2130, 2761, 338, 8762, 29892, 727, 4225, 304, 367, 263, 982, 304, 10933, 23649, 4822, 967, 5164, 6910, 322, 3450, 11747, 17437, 29889, 13, 29254, 1218, 385, 317, 4375, 411, 385, 3450, 338, 884, 11149, 7429, 746, 2534, 385, 3450, 13705, 29892, 14372, 278, 13013, 304, 8323, 363, 385, 3450, 5034, 304, 278, 317, 4375, 7429, 491, 278, 1095, 13897, 470, 3450, 21691, 13013, 29889, 13, 3047, 385, 3450, 13705, 29892, 372, 338, 884, 14154, 4100, 304, 3033, 482, 18777, 29892, 2845, 7463, 470, 7029, 304, 278, 13013, 29889, 2201, 6751, 18777, 12234, 7805, 29892, 14372, 18777, 304, 2130, 263, 25792, 393, 4076, 13173, 5106, 363, 599, 278, 23649, 322, 967, 3519, 29892, 14372, 18777, 304, 1018, 714, 385, 3450, 1728, 2534, 304, 2436, 263, 2323, 1196, 310, 775, 1492, 515, 278, 1404, 5067, 310, 278, 25792, 3528, 322, 7146, 14372, 18777, 304, 6036, 1009, 2280, 322, 1804, 701, 363, 385, 317, 4375, 3814, 6942, 411, 385, 3450, 29889, 9038, 1316, 263, 13897, 25792, 338, 297, 2058, 29892, 372, 338, 18853, 363, 385, 13013, 16049, 278, 3450, 13705, 304, 679, 13173, 21556, 6942, 411, 1269, 322, 1432, 6354, 6942, 411, 3450, 322, 967, 2130, 577, 393, 278, 6728, 1754, 7113, 278, 5381, 1203, 3145, 427, 4924, 287, 297, 278, 3450, 13705, 508, 367, 17005, 29889, 13, 1576, 3450, 15629, 4163, 297, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 18469, 599, 278, 4225, 6942, 411, 409, 2764, 292, 23649 ]
1,333,536
0
CommonCrawl
12
5
, managing APIs, engaging developers and also measuring the impact of APIs – all through the extremely easy to use and yet powerful feature set available for API Manager. In essence, you can take your APIs from concept to production with ease with the API Manager that takes care of a majority of associated requirements before you go live with your API strategy. Integration of ColdFusion with API Manager The Admin portal available with the API Manager lets you define the ColdFusion discovery server. Once such a ColdFusion discovery server is set, you can readily import REST services defined in the ColdFusion server with just a single click. With minimal configuration, you can readily publish the APIs associated. It is also possible to install API Manager and ColdFusion server as a part of the same JVM (Java Virtual Machine) so that the API Manager starts and stops along with the start and stop of the ColdFusion server. There are three roles associated with API Manager. Administrator – responsible for configuring the API Manager. Publisher – responsible for publishing the APIs. Subscriber – responsible for trying out and signing up for an API. There is a detailed analytics dashboard available for each of the three roles described above. A whole range of metrics are tracked such as API name, version, request method, data in, data out, timestamp and SLA used. The dashboard is also completely customizable for both the publisher and administrator. API version and lifecycle management The API Manager allows you to create multiple versions of an API with ease by copying all the settings of the previous version onto the newer version so that only the difference between the two APIs can be configured at the API Manager portal. API Manager also lets you flag an API as draft, published, deprecated, and retired. Corresponding notiifcations are sent to developers who are subscribed to deprecated or retired versions of the API. API access control The API Manager allows you to use basic authentication, API key, OAuth and OAuth with SAML as the various mechanisms for enforcing access control. Basic authentication involves username and password for authentication which is compared against a user store configured in the ColdFusion administrator. API Manager has a mechanism to generate API keys for each of the application that is registered by the developer to authenticate the access of the developer for a particular API. API Manager also supports OAuth mechanism to generate tokens instead of the actual keys for access control via the built-in OAuth server in API Manager. It is also possible to link a SAML based server with the OAuth server where the SAML server will be used as the authorization server for token exchange mechanism. API rate limiting and throttling The API Manager lets you define various SLAs for rate limiting and throttling. These limits can be used to restrict access to an API beyond a certain number of times the API is accessed per unit of time selected. While rate limiting is typically for a shorter limit of time, second or minute, throttling applies to a much larger unit of time, such as a day or a month. It is also possible to set these limits as hard and soft. For soft limits, a notification is sent beyond a certain pre-configured notification limit. API developer portal The developer portal that comes packaged with the API Manager lets the subscribers or end developers to register their applications, view all the documentation associated with each of the API, try out the APIs from the user interface itself without having to write any line of code, sign up for the APIs for the pre-defined SLAs associated and view detailed analytics for the API usage by the developer. Adobe ColdFusion (2016 release) provides features for large scale enterprise deployment of web applications with a focus on security, high performance and scalability enhancement.. ColdFusion (2016 release) also continues to provide various features that integrate with other enterprise technologies making ColdFusion the enterprise hub that it continues to be. Security code analyzer ColdFusion (2016 release) comes with a built-in security analyzer that can scan large ColdFusion projects with very high number of lines of code to point out any security vulnerabilities that the code is prone to. This is particularly useful when there is a large code base that is being maintained from a long time. A simple scan with ColdFusion Builder (2016 release) supported by the ColdFusion (2016 release) server provides a detailed report for a particular ColdFusion Builder project, folder or file. The security analyzer covers all the common vulnerabilites that CFML code is vulnerable to. It points out the correct line number that can be jumped to, the vulnerabilty detail and also potential ways to remidiate the vulnerability. ColdFusion (2
-0.137907
0.515412
0.988241
0.610407
[ 0.26614753468624514, -0.5419609684230235 ]
[ 0.5100403318243831, 0.5207841033122415 ]
[ 1.115052864262436, 0.8614287617240091 ]
[ 0.6442244460777752, 0.5765888191032001 ]
1,024
[ 512, 512 ]
[ 29892, 767, 6751, 23649, 29892, 3033, 6751, 18777, 322, 884, 7540, 3864, 278, 10879, 310, 23649, 785, 599, 1549, 278, 14154, 4780, 304, 671, 322, 3447, 13988, 4682, 731, 3625, 363, 3450, 15629, 29889, 512, 3686, 663, 29892, 366, 508, 2125, 596, 23649, 515, 6964, 304, 5802, 411, 16326, 411, 278, 3450, 15629, 393, 4893, 2562, 310, 263, 13638, 310, 6942, 11780, 1434, 366, 748, 5735, 411, 596, 3450, 13705, 29889, 13, 23573, 362, 310, 26731, 29943, 3958, 411, 3450, 15629, 13, 1576, 10229, 25792, 3625, 411, 278, 3450, 15629, 16869, 366, 4529, 278, 26731, 29943, 3958, 20699, 1923, 29889, 9038, 1316, 263, 26731, 29943, 3958, 20699, 1923, 338, 731, 29892, 366, 508, 28520, 1053, 16759, 5786, 3342, 297, 278, 26731, 29943, 3958, 1923, 411, 925, 263, 2323, 2828, 29889, 2973, 13114, 5285, 29892, 366, 508, 28520, 9805, 278, 23649, 6942, 29889, 13, 3112, 338, 884, 1950, 304, 2601, 3450, 15629, 322, 26731, 29943, 3958, 1923, 408, 263, 760, 310, 278, 1021, 26919, 313, 8404, 19181, 6189, 29897, 577, 393, 278, 3450, 15629, 8665, 322, 17726, 3412, 411, 278, 1369, 322, 5040, 310, 278, 26731, 29943, 3958, 1923, 29889, 13, 8439, 526, 2211, 16178, 6942, 411, 3450, 15629, 29889, 13, 12754, 2132, 1061, 785, 14040, 363, 2295, 3864, 278, 3450, 15629, 29889, 13, 21076, 1674, 261, 785, 14040, 363, 27256, 278, 23649, 29889, 13, 4035, 7588, 495, 785, 14040, 363, 1811, 714, 322, 26188, 701, 363, 385, 3450, 29889, 13, 8439, 338, 263, 13173, 16114, 1199, 12569, 3377, 3625, 363, 1269, 310, 278, 2211, 16178, 5439, 2038, 29889, 319, 3353, 3464, 310, 21556, 526, 5702, 287, 1316, 408, 3450, 1024, 29892, 1873, 29892, 2009, 1158, 29892, 848, 297, 29892, 848, 714, 29892, 14334, 322, 317, 4375, 1304, 29889, 450, 12569, 3377, 338, 884, 6446, 2888, 13902, 363, 1716, 278, 9805, 261, 322, 27443, 29889, 13, 8787, 1873, 322, 11747, 17437, 10643, 13, 1576, 3450, 15629, 6511, 366, 304, 1653, 2999, 6910, 310, 385, 3450, 411, 16326, 491, 17596, 599, 278, 6055, 310, 278, 3517, 1873, 11480, 278, 20687, 1873, 577, 393, 871, 278, 4328, 1546, 278, 1023, 23649, 508, 367, 13252, 472, 278, 3450, 15629, 25792, 29889, 3450, 15629, 884, 16869, 366, 7353, 385, 3450, 408, 18195, 29892, 6369, 29892, 18164, 29892, 322, 16528, 29889, 2994, 3636, 292, 451, 29875, 361, 29883, 800, 526, 2665, 304, 18777, 1058, 526, 21696, 2580, 304, 18164, 470, 16528, 6910, 310, 278, 3450, 29889, 13, 8787, 2130, 2761, 13, 1576, 3450, 15629, 6511, 366, 304, 671, 6996, 10760, 29892, 3450, 1820, 29892, 438, 6444, 322, 438, 6444, 411, 16698, 1988, 408, 278, 5164, 7208, 12903, 363, 24555, 3277, 2130, 2761, 29889, 13, 16616, 10760, 20789, 8952, 322, 4800, 363, 10760, 607, 338, 9401, 2750, 263, 1404, 3787, 13252, 297, 278, 26731, 29943, 3958, 27443, 29889, 3450, 15629, 756, 263, 13336, 304, 5706, 3450, 6611, 363, 1269, 310, 278, 2280, 393, 338, 15443, 491, 278, 13897, 304, 15585, 403, 278, 2130, 310, 278, 13897, 363, 263, 3153, 3450, 29889, 3450, 15629, 884, 11286, 438, 6444, 13336, 304, 5706, 18897, 2012, 310, 278, 3935, 6611, 363, 2130, 2761, 3025, 278, 4240, 29899, 262, 438, 6444, 1923, 297, 3450, 15629, 29889, 739, 338, 884, 1950, 304, 1544, 263, 16698, 1988, 2729, 1923, 411, 278, 438, 6444, 1923, 988, 278, 16698, 1988, 1923, 674, 367, 1304, 408, 278, 28733, 1923, 363, 5993, 14523, 13336, 29889, 13, 8787, 6554, 4046, 292, 322, 20961, 698, 1847, 13, 1576, 3450, 15629, 16869, 366, 4529, 5164, 27146, 2887, 363, 6554, 4046, 292, 322, 20961, 698, 1847, 29889, 4525, 13071, 508, 367, 1304, 304, 9250, 2130, 304, 385, 3450, 8724, 263, 3058, 1353, 310, 3064, 278, 3450, 338, 20592, 639, 5190, 310, 931, 4629, 29889, 5806, 6554, 4046, 292, 338, 12234, 363, 263, 20511, 4046, 310, 931, 29892, 1473, 470, 11015, 29892, 20961, 698, 1847, 16058, 304, 263, 1568, 7200, 5190, 310, 931, 29892, 1316, 408, 263, 2462, 470, 263, 4098, 29889, 13, 3112, 338, 884, 1950, 304, 731, 1438, 13071, 408, 2898, 322, 4964, 29889, 1152, 4964, 13071, 29892, 263, 12519, 338, 2665, 8724, 263, 3058, 758, 29899, 2917, 2955, 12519, 4046, 29889, 13, 8787, 13897, 25792, 13, 1576, 13897, 25792, 393, 5304, 4870, 4063, 411, 278, 3450, 15629, 16869, 278, 21696, 2596, 470, 1095, 18777, 304, 6036, 1009, 8324, 29892, 1776, 599, 278, 5106, 6942, 411, 1269, 310, 278, 3450, 29892, 1018, 714, 278, 23649, 515, 278, 1404, 5067, 3528, 1728, 2534, 304, 2436, 738, 1196, 310, 775, 29892, 1804, 701, 363, 278, 23649, 363, 278, 758, 29899, 12119, 27146, 2887, 6942, 322, 1776, 13173, 16114, 1199, 363, 278, 3450, 8744, 491, 278, 13897, 29889, 13, 3253, 16945, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 8128, 5680, 363, 2919, 6287, 3896, 7734, 18209, 310, 1856, 8324, 411, 263, 8569, 373, 6993, 29892, 1880, 4180, 322, 8716, 3097, 26371, 27967, 636, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 884, 18172, 304, 3867, 5164, 5680, 393, 22782, 411, 916, 3896, 7734, 5722, 11763, 3907, 26731, 29943, 3958, 278, 3896, 7734, 19766, 393, 372, 18172, 304, 367, 29889, 13, 13228, 775, 16455, 3298, 13, 29907, 1025, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 5304, 411, 263, 4240, 29899, 262, 6993, 16455, 3298, 393, 508, 12812, 2919, 26731, 29943, 3958, 9279, 411, 1407, 1880, 1353, 310, 3454, 310, 775, 304, 1298, 714, 738, 6993, 23180, 11614, 393, 278, 775, 338, 544, 650, 304, 29889, 910, 338, 10734, 5407, 746, 727, 338, 263, 2919, 775, 2967, 393, 338, 1641, 19949, 515, 263, 1472, 931, 29889, 319, 2560, 12812, 411, 26731, 29943, 3958, 5373, 2700, 313, 29906, 29900, 29896, 29953, 6507, 29897, 6969, 491, 278, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 1923, 8128, 263, 13173, 3461, 363, 263, 3153, 26731, 29943, 3958, 5373, 2700, 2060, 29892, 4138, 470, 934, 29889, 13, 1576, 6993, 16455, 3298, 18469, 599, 278, 3619, 23180, 4427, 3246, 393, 17861, 1988, 775, 338, 23180, 519, 304, 29889, 739, 3291, 714, 278, 1959, 1196, 1353, 393, 508, 367, 12500, 287, 304, 29892, 278, 23180, 4427, 1017, 9493, 322, 884, 7037, 5837, 304, 1083, 8819, 403, 278, 23180, 3097, 29889, 13, 29907, 1025, 29943, 3958, 313, 29906 ]
1,333,536
1,024
CommonCrawl
12
5
016 release) now supports Microsoft's NTLM authentication on CFSHAREPOINT, CFOBJECT and CFINVOKE tags. With this, sharepoint intergration feature set of ColdFusion can now be used with NTLM authentication, just as web services authentication enabled through NTLM authentication. PDF Archival ColdFusion (2016 release) now supports PDF/A-2b standard for archiving a PDF. PDFs are archived to ensure that the PDF becomes a self contained document that can be opened with any future version of Acrobat Reader, without any issues. Performance improvements ColdFusion (2016 release) has a wide array of performance improvements made to the runtime including array access, cached queries, and scope search. Because of these enhancments, your existing applications, when upgraded to ColdFusion (2016 release), will run up to 30% faster. PDF Redaction The CFPDF tag now has the functionality to redact a PDF. Redaction is used to secure sensitive information in a PDF from being visible to non authorized users. Given a set of co-ordinates for a paricular PDF, the content within those co-ordinates will be redacted making the content completely invisible in the resulting PDF file. PDF Sanitization The CFPDF tag also supports a new action called "sanitize". The process of sanitizing a PDF will make sure that sensitive organization specific information embedded in the metadata or JavaScript or any other sensitive portions of the PDF is not passed on to the audience. Once a PDF is sanitized, the PDF can be safely shared outside of the organization or even as a public facing document without having to worry about sensitive information being shared via the PDF. External storage for session scope ColdFusion (2016 release) gives you the ability to store the session scope in an external and distributed high performing cache. This has a direct bearing on high scalability that can be achieved with ColdFusion (2016 release) when there are a large number of users simultanoeusly accessing ColdFusion (2016 release) with all information about the users being stored in the session. ColdFusion (2016 release)'s API Manager allows to set up caching for your APIs, the result being higher throughput and reduced response times. The cache is completely configurable via the administrator portal. Caching can be enabled at individual methods of an API by just enabling caching on that method. API Management platform for the enterprise ColdFusion (2016 release)'s API Manager can scale up to meet the needs of any enterprise deployment. It has been tested for high scalability and low latency across varied loads. API Manager can be set up as a cluster to achieve high scalability. The API Manager can also act as a load balancer using which you can configure the way in which end point URLs of the APIs are hit. Once multiple end point URLs are configured, you can choose either the round-robin or weighted round-robin algorithm to access the end points. The built-in data store and analytics store can be further tuned for high scalability and performance needs. SOAP Gateway All the benefits of API Manager apply to SOAP APIs as well. By just providing the WSDL file, SOAP APIs can be imported onto the API Manager in just a few clicks. Once imported, access control mechanism, SLAs, caching can all be configured via the intuitive user interface of the API Manager portal. Connector enhancements There is no need to manually reconfigure connectors once an update or hot fix related to connectors is applied. ColdFusion (2016 release) will take care of this for you. It is also possbile to now configure custom connector settings for individual sites configured on the ColdFusion (2016 release) server. Other PDF enhancements You can now programatically attach and extract attachments to a PDF file. The comments in a PDF file can be exported on to a XFDF file or vice versa. The meta data on the PDF file can also be exported to a XMP file or vice versa thus ensuring a standard meta data on all the PDFs produced by an organization. ColdFusion (2016 release) also allows you to apply stamps on to a PDF file. You can choose from the predefined set or create your own custom stamp as well. ColdFusion has always been about providing developers with features that enhance their productivity. ColdFusion (2016 release) continues to drive the same theme forward by new features that help developers build their applications quickly. Command Line Interface for CFML Adobe Cold
-0.189954
0.909351
0.658529
0.641623
[ -0.47484687240208423, 0.09493810606140009 ]
[ 1.2979169076006594, 0.5207841033122415 ]
[ 0.4353402694594518, 0.8817186899270831 ]
[ 0.6754408892968098, 0.6078052623222349 ]
1,024
[ 512, 512 ]
[ 29900, 29896, 29953, 6507, 29897, 1286, 11286, 7783, 29915, 29879, 405, 14632, 29924, 10760, 373, 17861, 23498, 1525, 29925, 6992, 29911, 29892, 315, 5800, 29933, 17637, 322, 17861, 1177, 24898, 6059, 8282, 29889, 2973, 445, 29892, 6232, 3149, 1006, 629, 362, 4682, 731, 310, 26731, 29943, 3958, 508, 1286, 367, 1304, 411, 405, 14632, 29924, 10760, 29892, 925, 408, 1856, 5786, 10760, 9615, 1549, 405, 14632, 29924, 10760, 29889, 13, 8493, 2595, 2561, 13, 29907, 1025, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 1286, 11286, 11328, 29914, 29909, 29899, 29906, 29890, 3918, 363, 3190, 4357, 263, 11328, 29889, 11328, 29879, 526, 3190, 2347, 304, 9801, 393, 278, 11328, 7415, 263, 1583, 11122, 1842, 393, 508, 367, 6496, 411, 738, 5434, 1873, 310, 7255, 307, 10222, 830, 1664, 29892, 1728, 738, 5626, 29889, 13, 5894, 13390, 28473, 13, 29907, 1025, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 756, 263, 9377, 1409, 310, 4180, 28473, 1754, 304, 278, 10073, 3704, 1409, 2130, 29892, 22152, 9365, 29892, 322, 6874, 2740, 29889, 7311, 310, 1438, 26371, 4564, 1860, 29892, 596, 5923, 8324, 29892, 746, 20337, 287, 304, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 511, 674, 1065, 701, 304, 29871, 29941, 29900, 29995, 8473, 29889, 13, 8493, 4367, 2467, 13, 1576, 17861, 8493, 4055, 1286, 756, 278, 9863, 304, 2654, 627, 263, 11328, 29889, 4367, 2467, 338, 1304, 304, 11592, 20502, 2472, 297, 263, 11328, 515, 1641, 7962, 304, 1661, 4148, 1891, 4160, 29889, 11221, 263, 731, 310, 1302, 29899, 24266, 363, 263, 610, 16311, 11328, 29892, 278, 2793, 2629, 1906, 1302, 29899, 24266, 674, 367, 2654, 627, 287, 3907, 278, 2793, 6446, 27597, 297, 278, 9819, 11328, 934, 29889, 13, 8493, 3087, 277, 2133, 13, 1576, 17861, 8493, 4055, 884, 11286, 263, 716, 3158, 2000, 376, 28455, 277, 675, 1642, 450, 1889, 310, 9753, 277, 5281, 263, 11328, 674, 1207, 1854, 393, 20502, 13013, 2702, 2472, 15685, 297, 278, 15562, 470, 8286, 470, 738, 916, 20502, 2011, 1080, 310, 278, 11328, 338, 451, 4502, 373, 304, 278, 20026, 29889, 9038, 263, 11328, 338, 9753, 277, 1891, 29892, 278, 11328, 508, 367, 23511, 7258, 5377, 310, 278, 13013, 470, 1584, 408, 263, 970, 14870, 1842, 1728, 2534, 304, 15982, 1048, 20502, 2472, 1641, 7258, 3025, 278, 11328, 29889, 13, 25865, 8635, 363, 4867, 6874, 13, 29907, 1025, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 4076, 366, 278, 11509, 304, 3787, 278, 4867, 6874, 297, 385, 7029, 322, 13235, 1880, 15859, 7090, 29889, 910, 756, 263, 1513, 24638, 373, 1880, 8716, 3097, 393, 508, 367, 14363, 411, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 746, 727, 526, 263, 2919, 1353, 310, 4160, 15030, 1562, 21477, 368, 17378, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 411, 599, 2472, 1048, 278, 4160, 1641, 6087, 297, 278, 4867, 29889, 13, 29907, 1025, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 16029, 29879, 3450, 15629, 6511, 304, 731, 701, 22488, 363, 596, 23649, 29892, 278, 1121, 1641, 6133, 1549, 649, 322, 12212, 2933, 3064, 29889, 450, 7090, 338, 6446, 17127, 519, 3025, 278, 27443, 25792, 29889, 315, 9733, 508, 367, 9615, 472, 5375, 3519, 310, 385, 3450, 491, 925, 427, 17961, 22488, 373, 393, 1158, 29889, 13, 8787, 15057, 7481, 363, 278, 3896, 7734, 13, 29907, 1025, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 16029, 29879, 3450, 15629, 508, 6287, 701, 304, 5870, 278, 4225, 310, 738, 3896, 7734, 18209, 29889, 739, 756, 1063, 9528, 363, 1880, 8716, 3097, 322, 4482, 23316, 1270, 4822, 23821, 15376, 29889, 13, 8787, 15629, 508, 367, 731, 701, 408, 263, 9867, 304, 6176, 1880, 8716, 3097, 29889, 450, 3450, 15629, 508, 884, 1044, 408, 263, 2254, 6411, 25856, 773, 607, 366, 508, 10822, 278, 982, 297, 607, 1095, 1298, 24295, 310, 278, 23649, 526, 7124, 29889, 9038, 2999, 1095, 1298, 24295, 526, 13252, 29892, 366, 508, 6755, 2845, 278, 4513, 29899, 307, 2109, 470, 7688, 287, 4513, 29899, 307, 2109, 5687, 304, 2130, 278, 1095, 3291, 29889, 450, 4240, 29899, 262, 848, 3787, 322, 16114, 1199, 3787, 508, 367, 4340, 18515, 287, 363, 1880, 8716, 3097, 322, 4180, 4225, 29889, 13, 6156, 3301, 22510, 1582, 13, 3596, 278, 23633, 310, 3450, 15629, 3394, 304, 7791, 3301, 23649, 408, 1532, 29889, 2648, 925, 13138, 278, 399, 7230, 29931, 934, 29892, 7791, 3301, 23649, 508, 367, 19673, 11480, 278, 3450, 15629, 297, 925, 263, 2846, 19367, 29889, 9038, 19673, 29892, 2130, 2761, 13336, 29892, 27146, 2887, 29892, 22488, 508, 599, 367, 13252, 3025, 278, 27951, 573, 1404, 5067, 310, 278, 3450, 15629, 25792, 29889, 13, 20971, 2801, 26371, 4564, 4110, 13, 8439, 338, 694, 817, 304, 7522, 337, 17591, 4511, 943, 2748, 385, 2767, 470, 7375, 2329, 4475, 304, 4511, 943, 338, 7436, 29889, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 674, 2125, 2562, 310, 445, 363, 366, 29889, 739, 338, 884, 3119, 29890, 488, 304, 1286, 10822, 2888, 1826, 2801, 6055, 363, 5375, 11840, 13252, 373, 278, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 1923, 29889, 13, 16107, 11328, 26371, 4564, 4110, 13, 3492, 508, 1286, 1824, 19574, 10641, 322, 6597, 10641, 1860, 304, 263, 11328, 934, 29889, 450, 6589, 297, 263, 11328, 934, 508, 367, 5609, 287, 373, 304, 263, 1060, 29943, 4037, 934, 470, 11289, 1224, 29874, 29889, 450, 12700, 848, 373, 278, 11328, 934, 508, 884, 367, 5609, 287, 304, 263, 1060, 3580, 934, 470, 11289, 1224, 29874, 4550, 5662, 3864, 263, 3918, 12700, 848, 373, 599, 278, 11328, 29879, 7371, 491, 385, 13013, 29889, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 884, 6511, 366, 304, 3394, 380, 15092, 373, 304, 263, 11328, 934, 29889, 887, 508, 6755, 515, 278, 758, 12119, 731, 470, 1653, 596, 1914, 2888, 25214, 408, 1532, 29889, 13, 29907, 1025, 29943, 3958, 756, 2337, 1063, 1048, 13138, 18777, 411, 5680, 393, 26371, 749, 1009, 3234, 2068, 29889, 26731, 29943, 3958, 313, 29906, 29900, 29896, 29953, 6507, 29897, 18172, 304, 7899, 278, 1021, 10929, 6375, 491, 716, 5680, 393, 1371, 18777, 2048, 1009, 8324, 9098, 29889, 13, 6255, 7407, 25796, 363, 17861, 1988, 13, 3253, 16945, 26731 ]
1,333,536
2,048
CommonCrawl
12
5
For the uninitiated, Mass Effect is a sci-fi RPG video game series from developer BioWare that finds the player taking on the role of a human soldier, Commander Shepard, who is tasked with investigating an ancient race of aliens believed to be a threat to not only mankind but the known universe. With the recent release of the second game in the series (to as equally rave reviews as the first entry), it was revealed that BioWare has seen tremendous amounts of interest in a Mass Effect movie adaptation, but that they've essentially yet to be swayed by any studios. The way I see it, this means only one thing: Hollywood wants the property without BioWare getting creative control. And what that tells me is, Hollywood may just miss out on a gold mine. There's a studio out there that needs Mass Effect. This is the single most robust, easily adaptable game property to come along in years; that it happens to be sci-fi is merely a bonus for us. Avatar has given Fox unprecedented grosses at the box office around the planet, proving that there is not only a desire but a need for new, big-budget, high-concept sci-fi movies with big splashes of action and side-dashes of sensuality. Sure, a few studios now have their own properties in development that have the potential to rope in a revitalized sci-fi fan base, but none of them is original to the big screen. The most prominent of the lot is arguably Pierre Morel's adaptation of Frank Herbert's Dune, yet as excited as I am to see someone take a new crack at that dense material, I'd much rather see those efforts go toward forging a new cinematic sci-fi property. Avatar, for better or worse, proved a lot of things. Perhaps most relevant to this article is the fact that people are eager to see non-humans on the big screen. Audiences may still need an Earthly proxy for the story, but there is an appetite for alien species that aren't people-eating monsters that a smart studio should capitalize on. And it doesn't get any more multi-species-friendly than Mass Effect, whose universe is populated with a variety of non-human races, all integral to the story. Not only that, but they're humanoid enough that they won't look too goofy whether they're live-action prosthetics or CGI creations, yet they're unique enough to be as iconic as any of the denizens found in Star Wars or Star Trek. The relationships Shepard (and in turn, us) forms with his crew take on the audience-friendly tone that defines the best men-on-a-mission movies. As Shepard and his ship explore the galaxy, ME morphs into an almost Dirty Dozen story that's practically begging for an ensemble cast of equal caliber. There are clear villains, but their motives are a bit more complex (and ominous) than what passed muster in Cameron's blockbuster. That leaves us with an effects-heavy action film set in space with a complex plot and the potential to bring together the kind of actors whose careers have been defined by group work like this. But before this starts to sound too much like a flick tailor made for guys who love spaceships and explosions, it is worth pointing out that the only complaints ever raised against the game were from conservative groups (who never actually played it) bothered by the fact that your human player could form an intimate relationship with, if so chosen, an alien. So, if a studio is looking to lure in the vast crowds that ate up the Jake/Neytiri angle, ME already has one built in. Now the only major obstacle in adapting ME into a movie is the fact that the game can take over 20 hours to complete, and even then there are easily another 20 hours of side stories waiting to be told should you take the time to discover them. That said, it's easy to imagine the core story getting boiled down to a two-hour film. Just stick with Shepard, his main crew and their quest to take down the mysterious Protheans before they corrupt everything. Not an impossible task by any means. Having said all of the above, however, I'm not campaigning for some studio to court BioWare into handing over the rights so they can make a cash grab at them Avatar monies. I don't want anyone to even attempt making a Mass Effect film unless they're going
1.129043
0.748194
0.059977
0.152565
[ 1.0660379852215212, 1.192048124689407 ]
[ 1.0687164491930152, 0.42767141708413603 ]
[ 0.22229602332717321, -0.10234282792201324 ]
[ 0.23841068423032524, 0.0667202465256349 ]
1,024
[ 512, 512 ]
[ 1152, 278, 443, 2344, 29875, 630, 29892, 7360, 26475, 338, 263, 4560, 29899, 7241, 390, 16903, 4863, 3748, 3652, 515, 13897, 21184, 29956, 598, 393, 14061, 278, 4847, 5622, 373, 278, 6297, 310, 263, 5199, 20767, 29892, 27317, 2296, 29886, 538, 29892, 1058, 338, 3414, 287, 411, 7405, 1218, 385, 12297, 8175, 310, 394, 11689, 13112, 304, 367, 263, 28469, 304, 451, 871, 767, 14380, 541, 278, 2998, 19859, 29889, 2973, 278, 7786, 6507, 310, 278, 1473, 3748, 297, 278, 3652, 313, 517, 408, 18018, 1153, 345, 21804, 408, 278, 937, 6251, 511, 372, 471, 17845, 393, 21184, 29956, 598, 756, 3595, 14586, 355, 681, 26999, 310, 4066, 297, 263, 7360, 26475, 14064, 28206, 29892, 541, 393, 896, 29915, 345, 13674, 3447, 304, 367, 269, 1582, 287, 491, 738, 1921, 2363, 29889, 450, 982, 306, 1074, 372, 29892, 445, 2794, 871, 697, 2655, 29901, 19180, 10753, 278, 2875, 1728, 21184, 29956, 598, 2805, 907, 1230, 2761, 29889, 1126, 825, 393, 10603, 592, 338, 29892, 19180, 1122, 925, 3052, 714, 373, 263, 7684, 7903, 29889, 13, 8439, 29915, 29879, 263, 8693, 714, 727, 393, 4225, 7360, 26475, 29889, 910, 338, 278, 2323, 1556, 16424, 29892, 5948, 7744, 519, 3748, 2875, 304, 2041, 3412, 297, 2440, 29936, 393, 372, 5930, 304, 367, 4560, 29899, 7241, 338, 13586, 263, 28920, 363, 502, 29889, 7740, 14873, 756, 2183, 14802, 443, 1457, 1133, 14927, 22683, 267, 472, 278, 3800, 8034, 2820, 278, 15754, 29892, 1326, 292, 393, 727, 338, 451, 871, 263, 13521, 541, 263, 817, 363, 716, 29892, 4802, 29899, 15841, 657, 29892, 1880, 29899, 535, 1547, 4560, 29899, 7241, 2351, 583, 411, 4802, 8536, 1161, 267, 310, 3158, 322, 2625, 29899, 14592, 267, 310, 4771, 950, 537, 29889, 18585, 29892, 263, 2846, 1921, 2363, 1286, 505, 1009, 1914, 4426, 297, 5849, 393, 505, 278, 7037, 304, 696, 412, 297, 263, 6664, 2410, 1891, 4560, 29899, 7241, 13524, 2967, 29892, 541, 5642, 310, 963, 338, 2441, 304, 278, 4802, 4315, 29889, 450, 1556, 19555, 310, 278, 3287, 338, 1852, 29884, 2197, 9181, 3879, 295, 29915, 29879, 28206, 310, 4976, 19116, 29915, 29879, 360, 1540, 29892, 3447, 408, 24173, 408, 306, 626, 304, 1074, 4856, 2125, 263, 716, 26755, 472, 393, 20619, 5518, 29892, 306, 29915, 29881, 1568, 3265, 1074, 1906, 14231, 748, 11183, 363, 3460, 263, 716, 4670, 19217, 4560, 29899, 7241, 2875, 29889, 13, 29909, 9046, 279, 29892, 363, 2253, 470, 15029, 29892, 11827, 263, 3287, 310, 2712, 29889, 11637, 1556, 8018, 304, 445, 4274, 338, 278, 2114, 393, 2305, 526, 19888, 304, 1074, 1661, 29899, 16063, 550, 373, 278, 4802, 4315, 29889, 8612, 819, 778, 1122, 1603, 817, 385, 11563, 368, 10166, 363, 278, 5828, 29892, 541, 727, 338, 385, 623, 300, 568, 363, 394, 819, 6606, 393, 9455, 29915, 29873, 2305, 29899, 29872, 1218, 1601, 23080, 393, 263, 15040, 8693, 881, 7483, 675, 373, 29889, 1126, 372, 1838, 29915, 29873, 679, 738, 901, 2473, 29899, 24091, 29899, 18326, 368, 1135, 7360, 26475, 29892, 5069, 19859, 338, 24146, 411, 263, 12875, 310, 1661, 29899, 26029, 19830, 29892, 599, 10160, 304, 278, 5828, 29889, 2216, 871, 393, 29892, 541, 896, 29915, 276, 3165, 1562, 333, 3307, 393, 896, 2113, 29915, 29873, 1106, 2086, 748, 974, 29891, 3692, 896, 29915, 276, 5735, 29899, 2467, 16810, 9188, 1199, 470, 8446, 29902, 907, 800, 29892, 3447, 896, 29915, 276, 5412, 3307, 304, 367, 408, 9849, 293, 408, 738, 310, 278, 972, 466, 575, 1476, 297, 7828, 9149, 470, 7828, 6479, 29895, 29889, 13, 1576, 21702, 2296, 29886, 538, 313, 392, 297, 2507, 29892, 502, 29897, 7190, 411, 670, 17616, 2125, 373, 278, 20026, 29899, 18326, 368, 16225, 393, 17645, 278, 1900, 1757, 29899, 265, 29899, 29874, 29899, 6737, 2351, 583, 29889, 1094, 2296, 29886, 538, 322, 670, 7751, 26987, 278, 15400, 29891, 29892, 22986, 18131, 29879, 964, 385, 4359, 360, 13163, 1938, 2256, 5828, 393, 29915, 29879, 4120, 1711, 25945, 292, 363, 385, 21285, 4320, 310, 5186, 1208, 12347, 29889, 1670, 526, 2821, 21031, 1144, 29892, 541, 1009, 3184, 3145, 526, 263, 2586, 901, 4280, 313, 392, 288, 1195, 681, 29897, 1135, 825, 4502, 1818, 261, 297, 20939, 265, 29915, 29879, 2908, 29890, 5402, 29889, 13, 7058, 11308, 502, 411, 385, 9545, 29899, 354, 5301, 3158, 2706, 731, 297, 2913, 411, 263, 4280, 6492, 322, 278, 7037, 304, 6963, 4208, 278, 2924, 310, 29701, 5069, 2562, 414, 505, 1063, 3342, 491, 2318, 664, 763, 445, 29889, 1205, 1434, 445, 8665, 304, 6047, 2086, 1568, 763, 263, 285, 1406, 12464, 272, 1754, 363, 18239, 1058, 5360, 8162, 14587, 322, 20389, 1080, 29892, 372, 338, 7088, 13330, 714, 393, 278, 871, 15313, 9466, 3926, 10425, 2750, 278, 3748, 892, 515, 8976, 1230, 6471, 313, 15970, 2360, 2869, 5318, 372, 29897, 24738, 287, 491, 278, 2114, 393, 596, 5199, 4847, 1033, 883, 385, 938, 6490, 9443, 411, 29892, 565, 577, 10434, 29892, 385, 394, 819, 29889, 1105, 29892, 565, 263, 8693, 338, 3063, 304, 301, 545, 297, 278, 13426, 11660, 6289, 393, 263, 371, 701, 278, 435, 1296, 29914, 29940, 1032, 2034, 374, 10696, 29892, 22986, 2307, 756, 697, 4240, 297, 29889, 13, 10454, 278, 871, 4655, 14979, 6436, 297, 7744, 292, 22986, 964, 263, 14064, 338, 278, 2114, 393, 278, 3748, 508, 2125, 975, 29871, 29906, 29900, 6199, 304, 4866, 29892, 322, 1584, 769, 727, 526, 5948, 1790, 29871, 29906, 29900, 6199, 310, 2625, 15874, 10534, 304, 367, 5429, 881, 366, 2125, 278, 931, 304, 6523, 963, 29889, 2193, 1497, 29892, 372, 29915, 29879, 4780, 304, 14034, 278, 7136, 5828, 2805, 1045, 2356, 1623, 304, 263, 1023, 29899, 18721, 2706, 29889, 3387, 12070, 411, 2296, 29886, 538, 29892, 670, 1667, 17616, 322, 1009, 21126, 304, 2125, 1623, 278, 22277, 2738, 1019, 1552, 550, 1434, 896, 1034, 6685, 4129, 29889, 2216, 385, 9301, 3414, 491, 738, 2794, 29889, 13, 29950, 5555, 1497, 599, 310, 278, 2038, 29892, 3138, 29892, 306, 29915, 29885, 451, 11531, 292, 363, 777, 8693, 304, 8973, 21184, 29956, 598, 964, 1361, 292, 975, 278, 10462, 577, 896, 508, 1207, 263, 274, 1161, 17229, 472, 963, 7740, 14873, 1601, 583, 29889, 306, 1016, 29915, 29873, 864, 5019, 304, 1584, 4218, 3907, 263, 7360, 26475, 2706, 6521, 896, 29915, 276, 2675 ]
1,333,538
0
C4
16
20
Push Doctor secures £13.7 million Series C investment led by Draper Esprit Safiya Marzook NEW PUSH DOCTOR INVESTMENT TO HELP SCALE DIGITAL SUPPORT FOR NHS THROUGH SECOND WAVE Push Doctor secures new investment to scale its digital services and support the NHS deal with unprecedented demand Push Doctor has doubled its patient reach to 5.4 million since the start of the Covid-19 pandemic, through new partnerships with the NHS across the country Push Doctor forms new partnership with Well Pharmacy to provide unique "digital pharmacy first" platform offering consultations to NHS patients GP surgeries across Stockport and West Devon are the latest to partner with Push Doctor to reach almost 350,000 patients securely and quickly London: Push Doctor, the leading digital healthcare company, is to invest significant funds to further support the NHS though the second wave of the coronavirus pandemic. Push Doctor has recently secured £13.7m through a Series C funding round led by the European venture capital firm Draper Esprit, with ADV also contributing. Push Doctor's model has evolved from focusing on signing-up patients directly to its platform to partnering with Primary Care Networks (PCNs) and CCGs (Clinical Commissioning Groups) within the NHS. This has allowed it to expand while providing gold standard support to GP surgeries throughout the pandemic. Push Doctor is the digital provider rated most highly by the Care Quality Commission. Get Deal News in your inbox every Monday By forging new partnerships with the NHS across the country, the number of people who can access Push Doctor's services has more than doubled since March, rising to 5.4 million. Among the latest PCNs to partner with Push Doctor are Viaduct and Sound in Stockport and West Devon, respectively. These two partnerships alone will enable a further 342,000 people to see a GMC-registered doctor within minutes and at a time that suits them, including in the evenings. The latest investment by Push Doctor, which enables the delivery of online consultations within the NHS, will give more clinicians and patients immediate access to secure and convenient appointments. This forms part of the NHS Long Term Plan to give every patient in the UK access to online digital GP consultations. Push Doctor's will also be expanding its market leading Digital Locum offering, to meet growing demand for the service in hospitals and GP surgeries. The funds will also go towards supporting clinicians across the NHS get the most from Push Doctor's capabilities as they adopt its technology solutions to help them. The UK has seen a surge in demand for digital health solutions like online GP consultations, as Covid-19 necessitates a move away from face-to-face interactions between patients and doctors. NHS Digital data estimates around half of the 102 million GP appointments from March to July took place over the phone or via video call[1]. As part of its continuing growth, Push Doctor is also launching a new partnership with Well Pharmacy which will see the company's technology power an innovative "digital pharmacy first" platform, offering consultations to NHS patients in the Plymouth area. This will reduce demand on general practice and offer patients an instant video consultation with a pharmacist where appropriate. Wais Shaifta, Chief Executive, Push Doctor, said: "At Push Doctor, we are in a privileged position to be able to provide a service that can make life easier for both GPs and patients. We want to continue and deepen the support we've already been providing throughout the pandemic, to help the NHS and patients emerge even stronger from Covid-19. "We are proud to be playing our part in helping our National Health Service through this challenging period and these funds will be put to work in scaling-up the NHS's digital offering at a critical time in its existence." The Series C investment follows previous rounds of funding in 2015 and 2017, where a total of $26.1m was raised from long-term investors ADV and Draper Esprit, with participation from major European funds, Oxford Capital, Partech Ventures and Seventure Partners. Ends – Georgia Reynolds and Victoria Boyce About Push Doctor Push Doctor was the UK
0.50721
0.465275
0.292043
-0.264954
[ 0.22779662267427986, 0.7866241977057741 ]
[ 0.5458529034505775, 0.3846963311327028 ]
[ 0.057440356677195714, 0.5266449463732855 ]
[ -0.47956750980747076, -0.05034141554574489 ]
1,024
[ 512, 512 ]
[ 349, 1878, 15460, 5226, 1973, 15151, 29896, 29941, 29889, 29955, 7284, 10488, 315, 13258, 358, 5331, 491, 16322, 546, 3423, 19428, 13, 29903, 2142, 29875, 3761, 1085, 2502, 554, 13, 28577, 349, 3308, 29950, 11662, 1783, 1955, 2672, 12064, 1254, 13780, 7495, 379, 6670, 29925, 317, 5454, 1307, 360, 6259, 1806, 1964, 317, 4897, 15082, 15842, 405, 14851, 3446, 1672, 23338, 29950, 3725, 6007, 29928, 399, 7520, 29923, 13, 27031, 15460, 5226, 1973, 716, 13258, 358, 304, 6287, 967, 13436, 5786, 322, 2304, 278, 405, 14851, 5376, 411, 443, 1457, 1133, 14927, 9667, 13, 27031, 15460, 756, 3765, 29881, 967, 16500, 6159, 304, 29871, 29945, 29889, 29946, 7284, 1951, 278, 1369, 310, 278, 25669, 333, 29899, 29896, 29929, 7243, 24552, 29892, 1549, 716, 22056, 14587, 411, 278, 405, 14851, 4822, 278, 4234, 13, 27031, 15460, 7190, 716, 22056, 4034, 411, 5674, 1963, 2817, 4135, 304, 3867, 5412, 376, 7501, 2410, 1374, 2817, 4135, 937, 29908, 7481, 27032, 8799, 800, 304, 405, 14851, 22069, 13, 19903, 1190, 914, 583, 4822, 10224, 637, 322, 3122, 9481, 265, 526, 278, 9281, 304, 18096, 411, 349, 1878, 15460, 304, 6159, 4359, 29871, 29941, 29945, 29900, 29892, 29900, 29900, 29900, 22069, 11592, 368, 322, 9098, 13, 26682, 265, 29901, 349, 1878, 15460, 29892, 278, 8236, 13436, 9045, 18020, 5001, 29892, 338, 304, 13258, 7282, 29199, 304, 4340, 2304, 278, 405, 14851, 2466, 278, 1473, 10742, 310, 278, 25082, 485, 22693, 7243, 24552, 29889, 349, 1878, 15460, 756, 10325, 26130, 15151, 29896, 29941, 29889, 29955, 29885, 1549, 263, 10488, 315, 5220, 292, 4513, 5331, 491, 278, 7824, 9712, 545, 7483, 9226, 16322, 546, 3423, 19428, 29892, 411, 11033, 29963, 884, 17737, 17068, 29889, 13, 27031, 15460, 29915, 29879, 1904, 756, 15220, 1490, 515, 12789, 4746, 373, 26188, 29899, 786, 22069, 4153, 304, 967, 7481, 304, 18096, 292, 411, 28267, 10057, 8527, 29879, 313, 9026, 29940, 29879, 29897, 322, 315, 11135, 29879, 313, 29907, 1915, 936, 11444, 292, 1632, 4410, 29897, 2629, 278, 405, 14851, 29889, 910, 756, 6068, 372, 304, 7985, 1550, 13138, 7684, 3918, 2304, 304, 28258, 1190, 914, 583, 10106, 278, 7243, 24552, 29889, 349, 1878, 15460, 338, 278, 13436, 13113, 364, 630, 1556, 10712, 491, 278, 10057, 751, 2877, 11444, 29889, 13, 2577, 897, 284, 10130, 297, 596, 297, 1884, 1432, 27822, 13, 2059, 363, 3460, 716, 22056, 14587, 411, 278, 405, 14851, 4822, 278, 4234, 29892, 278, 1353, 310, 2305, 1058, 508, 2130, 349, 1878, 15460, 29915, 29879, 5786, 756, 901, 1135, 3765, 29881, 1951, 4779, 29892, 20493, 304, 29871, 29945, 29889, 29946, 7284, 29889, 17302, 278, 9281, 9609, 29940, 29879, 304, 18096, 411, 349, 1878, 15460, 526, 10630, 328, 5313, 322, 14976, 297, 10224, 637, 322, 3122, 9481, 265, 29892, 8307, 29889, 4525, 1023, 22056, 14587, 7432, 674, 9025, 263, 4340, 29871, 29941, 29946, 29906, 29892, 29900, 29900, 29900, 2305, 304, 1074, 263, 402, 12513, 29899, 9573, 287, 11619, 2629, 6233, 322, 472, 263, 931, 393, 480, 1169, 963, 29892, 3704, 297, 278, 1584, 886, 29889, 13, 1576, 9281, 13258, 358, 491, 349, 1878, 15460, 29892, 607, 28936, 278, 28289, 310, 7395, 8799, 800, 2629, 278, 405, 14851, 29892, 674, 2367, 901, 24899, 14722, 322, 22069, 16800, 2130, 304, 11592, 322, 19192, 8167, 1860, 29889, 910, 7190, 760, 310, 278, 405, 14851, 6242, 11814, 8402, 304, 2367, 1432, 16500, 297, 278, 10261, 2130, 304, 7395, 13436, 28258, 8799, 800, 29889, 13, 27031, 15460, 29915, 29879, 674, 884, 367, 7985, 292, 967, 9999, 8236, 15918, 5976, 398, 27032, 29892, 304, 5870, 15678, 9667, 363, 278, 2669, 297, 29418, 277, 1338, 322, 28258, 1190, 914, 583, 29889, 450, 29199, 674, 884, 748, 7113, 20382, 24899, 14722, 4822, 278, 405, 14851, 679, 278, 1556, 515, 349, 1878, 15460, 29915, 29879, 27108, 408, 896, 9332, 967, 15483, 6851, 304, 1371, 963, 29889, 13, 1576, 10261, 756, 3595, 263, 1190, 479, 297, 9667, 363, 13436, 9045, 6851, 763, 7395, 28258, 8799, 800, 29892, 408, 25669, 333, 29899, 29896, 29929, 3520, 277, 1078, 263, 4337, 3448, 515, 3700, 29899, 517, 29899, 2161, 22060, 1546, 22069, 322, 437, 14359, 29889, 405, 14851, 15918, 848, 21875, 2820, 4203, 310, 278, 29871, 29896, 29900, 29906, 7284, 28258, 8167, 1860, 515, 4779, 304, 5468, 3614, 2058, 975, 278, 9008, 470, 3025, 4863, 1246, 29961, 29896, 1822, 13, 2887, 760, 310, 967, 3133, 292, 14321, 29892, 349, 1878, 15460, 338, 884, 6826, 292, 263, 716, 22056, 4034, 411, 5674, 1963, 2817, 4135, 607, 674, 1074, 278, 5001, 29915, 29879, 15483, 3081, 385, 24233, 1230, 376, 7501, 2410, 1374, 2817, 4135, 937, 29908, 7481, 29892, 27032, 8799, 800, 304, 405, 14851, 22069, 297, 278, 349, 368, 21026, 4038, 29889, 910, 674, 10032, 9667, 373, 2498, 6944, 322, 5957, 22069, 385, 14426, 4863, 8799, 362, 411, 263, 1374, 2817, 562, 391, 988, 8210, 29889, 13, 29956, 1759, 1383, 29874, 361, 941, 29892, 14546, 28841, 29892, 349, 1878, 15460, 29892, 1497, 29901, 13, 29908, 4178, 349, 1878, 15460, 29892, 591, 526, 297, 263, 14828, 3192, 2602, 304, 367, 2221, 304, 3867, 263, 2669, 393, 508, 1207, 2834, 6775, 363, 1716, 28258, 29879, 322, 22069, 29889, 1334, 864, 304, 6773, 322, 6483, 264, 278, 2304, 591, 29915, 345, 2307, 1063, 13138, 10106, 278, 7243, 24552, 29892, 304, 1371, 278, 405, 14851, 322, 22069, 11176, 479, 1584, 23505, 515, 25669, 333, 29899, 29896, 29929, 29889, 13, 29908, 4806, 526, 22314, 304, 367, 8743, 1749, 760, 297, 19912, 1749, 3086, 15202, 6692, 1549, 445, 18066, 292, 3785, 322, 1438, 29199, 674, 367, 1925, 304, 664, 297, 21640, 29899, 786, 278, 405, 14851, 29915, 29879, 13436, 27032, 472, 263, 12187, 931, 297, 967, 10379, 1213, 13, 1576, 10488, 315, 13258, 358, 4477, 3517, 364, 3885, 310, 5220, 292, 297, 29871, 29906, 29900, 29896, 29945, 322, 29871, 29906, 29900, 29896, 29955, 29892, 988, 263, 3001, 310, 395, 29906, 29953, 29889, 29896, 29885, 471, 10425, 515, 1472, 29899, 8489, 13258, 943, 11033, 29963, 322, 16322, 546, 3423, 19428, 29892, 411, 27577, 515, 4655, 7824, 29199, 29892, 11045, 25343, 29892, 1459, 11345, 21141, 1973, 322, 922, 794, 545, 3455, 8397, 29889, 13, 5044, 29879, 785, 13, 7999, 990, 423, 28555, 3361, 322, 14212, 16231, 346, 13, 28173, 349, 1878, 15460, 13, 27031, 15460, 471, 278, 10261 ]
1,333,541
0
CommonCrawl
14
10
Published: January 5, 2018 11:18 am Updated: Jan. 5, 2018 12:06 p.m. Grammy Award-winning violinist Hilary Hahn will perform with the Utah Symphony at Abravanel Hall Jan. 5-6 at 7:30 p.m. PROVO — The Utah Symphony may be 77 years old, but it proved last night in its first performance of 2018 that it still has new — and unconventional — tricks up its sleeve. Although the program indicated otherwise, rather than diving into Haydn's Symphony No. 8, the first half of the concert performed at Brigham Young University's de Jong Concert Hall kicked off with Dvorak's frenetic Slavonic Dance No. 8 in G minor under the direction of the equally animated Thierry Fischer. Each instrument got a chance to sing and dance, at times, the notes so rapid and the playing so delicate it seemed the bows weren't even touching the strings. This unique approach caught both seasoned concertgoers and amateurs alike by surprise as each movement in Haydn's symphony became a self-contained piece rather than parts of a whole. But the approach did resolve one matter that often becomes an issue in orchestral performances: when to clap. Dispersing the symphony movements in between the frivolous Slavonic dances made it acceptable to clap after each piece — yes, classical music lovers, even the first and second movements. Violin virtuoso Hilary Hahn dazzled her audience at Brigham Young University Thursday night as she performed Dvorak's Concerto in A minor with the Utah Symphony. Hahn will take the Abravanel Hall stage Jan. 5-6 at 7:30 p.m. Throughout the first movement of Haydn's symphony, members of the Utah Symphony stayed effortlessly in sync, swaying and moving their bows to produce a flourish of notes — some accented, some played in a staccato rhythm and all played with gusto. But nobody displayed enthusiasm as extreme a level as conductor Fischer, whose baton flew from his fingers near the end of the piece and soared high in the air before landing in the middle of the cello section. Don't worry, he got his baton back, but not without a few laughs from the audience, to which he responded with a slight shrug and knowing nod. Fischer carried his expressive conducting into the lighthearted Slavonic Dance No. 3 in A-flat major, bending his knees, cupping his hands as if in prayer and nearly pleading with the violinists to prolong the lush melody and hold on to every note. The violins continued to shine with the third Slavonic dance of the night, reaching high notes that Fischer seemed to only push higher with his raised hands. In conjunction with Fischer's call for contrast, the concert continued to alternate between the lively Slavonic dances (performing six of the 16 dances) and movements from Haydn's symphony. The third movement of the composer's symphony highlighted an often-underestimated member of the orchestra — the bass — featuring intricate fingerwork and rich melodies that aren't often heard on the deep instrument. While it was admittedly a bit disconcerting to hear each movement out of context, the unorthodox approach did offer a fresh and exciting take on a traditional format, shaking up expectations and keeping members of the audience in continual anticipation. The second half of the concert returned to the standard approach as world-class violin virtuoso Hilary Hahn took the stage in a shimmering purple-and-silver gown to deliver a riveting 40-minute performance of Dvorak's Violin Concerto in A minor, Op. 53. But Hahn shook things up in her own charming way. While it's common for soloists to get carried away in the music to such a degree that they're unaware of their surroundings, Hahn was very much present with her audience and fellow musicians, often nodding at the violinists, expressing enthusiasm and mouthing the rhythms in between her parts. Hahn continued to fly through the movements of Dvorak's concerto with fast fingerwork, flaw
1.948109
0.370371
0.470848
-0.197908
[ 1.2906647555773179, 2.605553167416128 ]
[ 0.10177701528576726, 0.6389655896786829 ]
[ 0.1005564541087283, 0.8411388335209349 ]
[ -0.6186188799276757, 0.22280246262080794 ]
1,024
[ 512, 512 ]
[ 8042, 3726, 29901, 5490, 29871, 29945, 29892, 29871, 29906, 29900, 29896, 29947, 29871, 29896, 29896, 29901, 29896, 29947, 626, 25723, 29901, 2627, 29889, 29871, 29945, 29892, 29871, 29906, 29900, 29896, 29947, 29871, 29896, 29906, 29901, 29900, 29953, 282, 29889, 29885, 29889, 13, 29954, 2572, 1357, 7526, 29899, 5080, 1076, 5537, 262, 391, 12338, 653, 379, 5422, 674, 2189, 411, 278, 14950, 801, 10667, 22214, 472, 1976, 336, 3703, 295, 6573, 2627, 29889, 29871, 29945, 29899, 29953, 472, 29871, 29955, 29901, 29941, 29900, 282, 29889, 29885, 29889, 13, 8618, 24898, 813, 450, 14950, 801, 10667, 22214, 1122, 367, 29871, 29955, 29955, 2440, 2030, 29892, 541, 372, 11827, 1833, 4646, 297, 967, 937, 4180, 310, 29871, 29906, 29900, 29896, 29947, 393, 372, 1603, 756, 716, 813, 322, 443, 535, 794, 1848, 813, 534, 7358, 701, 967, 12844, 29872, 345, 29889, 13, 2499, 3592, 278, 1824, 18694, 6467, 29892, 3265, 1135, 1933, 292, 964, 11389, 5200, 29915, 29879, 10667, 22214, 1939, 29889, 29871, 29947, 29892, 278, 937, 4203, 310, 278, 13135, 8560, 472, 1771, 1141, 314, 10443, 3014, 29915, 29879, 316, 435, 549, 1281, 6327, 6573, 413, 17840, 1283, 411, 360, 5267, 557, 29915, 29879, 285, 1267, 7492, 317, 4112, 8927, 22440, 1939, 29889, 29871, 29947, 297, 402, 9461, 1090, 278, 5305, 310, 278, 18018, 17524, 498, 631, 719, 23808, 29889, 7806, 11395, 2355, 263, 8825, 304, 1809, 322, 17948, 29892, 472, 3064, 29892, 278, 11486, 577, 10952, 322, 278, 8743, 577, 628, 9593, 372, 6140, 278, 289, 1242, 2949, 264, 29915, 29873, 1584, 6023, 292, 278, 6031, 29889, 13, 4013, 5412, 2948, 12624, 1716, 4259, 287, 13135, 1484, 414, 322, 626, 14075, 394, 9345, 491, 16671, 408, 1269, 10298, 297, 11389, 5200, 29915, 29879, 5016, 22214, 3897, 263, 1583, 29899, 1285, 7114, 8424, 3265, 1135, 5633, 310, 263, 3353, 29889, 1205, 278, 2948, 1258, 8814, 697, 4383, 393, 4049, 7415, 385, 2228, 297, 22624, 342, 1705, 21637, 29901, 746, 304, 3711, 29886, 29889, 3295, 6774, 292, 278, 5016, 22214, 24147, 297, 1546, 278, 285, 1150, 324, 681, 317, 4112, 8927, 270, 2925, 1754, 372, 22691, 304, 3711, 29886, 1156, 1269, 8424, 813, 4874, 29892, 14499, 4696, 658, 874, 29892, 1584, 278, 937, 322, 1473, 24147, 29889, 13, 29963, 29875, 22878, 4610, 29884, 9064, 12338, 653, 379, 5422, 270, 7511, 839, 902, 20026, 472, 1771, 1141, 314, 10443, 3014, 498, 1295, 3250, 4646, 408, 1183, 8560, 360, 5267, 557, 29915, 29879, 1281, 2265, 517, 297, 319, 9461, 411, 278, 14950, 801, 10667, 22214, 29889, 379, 5422, 674, 2125, 278, 1976, 336, 3703, 295, 6573, 7408, 2627, 29889, 29871, 29945, 29899, 29953, 472, 29871, 29955, 29901, 29941, 29900, 282, 29889, 29885, 29889, 13, 29911, 1092, 820, 449, 278, 937, 10298, 310, 11389, 5200, 29915, 29879, 5016, 22214, 29892, 5144, 310, 278, 14950, 801, 10667, 22214, 27661, 7225, 23769, 297, 16523, 29892, 269, 1582, 292, 322, 8401, 1009, 289, 1242, 304, 7738, 263, 1652, 473, 728, 310, 11486, 813, 777, 1035, 14927, 29892, 777, 5318, 297, 263, 380, 5753, 1219, 18178, 29265, 322, 599, 5318, 411, 330, 23065, 29889, 1205, 23196, 8833, 23644, 3173, 29885, 408, 18677, 263, 3233, 408, 7512, 272, 23808, 29892, 5069, 289, 14114, 9115, 29893, 515, 670, 23915, 2978, 278, 1095, 310, 278, 8424, 322, 577, 1965, 1880, 297, 278, 4799, 1434, 25325, 297, 278, 7256, 310, 278, 274, 3156, 4004, 29889, 3872, 29915, 29873, 15982, 29892, 540, 2355, 670, 289, 14114, 1250, 29892, 541, 451, 1728, 263, 2846, 10569, 29879, 515, 278, 20026, 29892, 304, 607, 540, 10049, 287, 411, 263, 7248, 528, 11124, 322, 13797, 18778, 29889, 13, 29943, 3208, 8988, 670, 4653, 573, 7512, 292, 964, 278, 3578, 23057, 287, 317, 4112, 8927, 22440, 1939, 29889, 29871, 29941, 297, 319, 29899, 20620, 4655, 29892, 289, 2548, 670, 17905, 267, 29892, 2723, 3262, 670, 6567, 408, 565, 297, 27402, 322, 8886, 5644, 9382, 411, 278, 5537, 262, 2879, 304, 27044, 278, 301, 1878, 9232, 1486, 322, 4808, 373, 304, 1432, 4443, 29889, 450, 5537, 1144, 7572, 304, 528, 457, 411, 278, 4654, 317, 4112, 8927, 17948, 310, 278, 4646, 29892, 20888, 1880, 11486, 393, 23808, 6140, 304, 871, 5503, 6133, 411, 670, 10425, 6567, 29889, 13, 797, 9589, 651, 411, 23808, 29915, 29879, 1246, 363, 12814, 29892, 278, 13135, 7572, 304, 25010, 1546, 278, 301, 3598, 317, 4112, 8927, 270, 2925, 313, 19826, 292, 4832, 310, 278, 29871, 29896, 29953, 270, 2925, 29897, 322, 24147, 515, 11389, 5200, 29915, 29879, 5016, 22214, 29889, 450, 4654, 10298, 310, 278, 18422, 29915, 29879, 5016, 22214, 12141, 287, 385, 4049, 29899, 5062, 342, 326, 630, 4509, 310, 278, 470, 15554, 813, 278, 12760, 813, 23425, 11158, 9593, 19917, 1287, 322, 8261, 9232, 397, 583, 393, 9455, 29915, 29873, 4049, 6091, 373, 278, 6483, 11395, 29889, 13, 8809, 488, 372, 471, 20186, 368, 263, 2586, 766, 535, 6327, 292, 304, 8293, 1269, 10298, 714, 310, 3030, 29892, 278, 443, 2072, 17324, 2948, 1258, 5957, 263, 10849, 322, 5566, 11407, 2125, 373, 263, 13807, 3402, 29892, 528, 5086, 701, 2149, 800, 322, 12515, 5144, 310, 278, 20026, 297, 2145, 950, 23483, 362, 29889, 13, 1576, 1473, 4203, 310, 278, 13135, 4133, 304, 278, 3918, 2948, 408, 3186, 29899, 1990, 5537, 262, 4610, 29884, 9064, 12338, 653, 379, 5422, 3614, 278, 7408, 297, 263, 528, 19400, 292, 3708, 552, 29899, 392, 29899, 25590, 369, 330, 776, 304, 12021, 263, 9050, 15133, 29871, 29946, 29900, 29899, 1195, 1082, 4180, 310, 360, 5267, 557, 29915, 29879, 10630, 22878, 1281, 2265, 517, 297, 319, 9461, 29892, 6461, 29889, 29871, 29945, 29941, 29889, 13, 6246, 379, 5422, 25239, 2712, 701, 297, 902, 1914, 1373, 4056, 982, 29889, 5806, 372, 29915, 29879, 3619, 363, 6651, 2879, 304, 679, 8988, 3448, 297, 278, 4696, 304, 1316, 263, 7426, 393, 896, 29915, 276, 1185, 2519, 310, 1009, 8388, 618, 886, 29892, 379, 5422, 471, 1407, 1568, 2198, 411, 902, 20026, 322, 10404, 2301, 14722, 29892, 4049, 18778, 8497, 472, 278, 5537, 262, 2879, 29892, 4653, 292, 23644, 3173, 29885, 322, 29442, 1918, 278, 18178, 1541, 1516, 297, 1546, 902, 5633, 29889, 13, 29950, 5422, 7572, 304, 11340, 1549, 278, 24147, 310, 360, 5267, 557, 29915, 29879, 378, 2265, 517, 411, 5172, 19917, 1287, 29892, 285, 10653 ]
1,333,543
0
C4
20
25
ExclusivesHighlights Exclusive Video Premiere : Antics & Collectables – 'Breaking Point' Last Day Deaf — October 21, 2022 More than enthusiastic for today's exclusive video premiere on Last Day Deaf, by the London based collective Antics & Collectables (featuring Sons of Kemet's Eddie Hick) and their bombastic, leftfield electronica banger 'Breaking Point'. This magnum opus, which is taken from the upcoming EP due in 2023, combines the astonishing production and sound, with a bold, genre-bending approach, combining breakbeat, jazztronica, funk, soul and indie electronic to create their very own, trademark sound. The accompanying video is equally enslaving and abstract. Unmissable for every electronic music aficionado! Press Notes: New music collective Antics & Collectables are pleased to announce their debut release with the arrival of 'Breaking Point', lifted from the upcoming EP due in 2023. Led by producer, composer, sound designer Alfonso De Grandis, 'Breaking Point' features East Sussex singer-songwriter Sam Mitchell and Sons of Kemet drummer Eddie Hick. Drawing on a myriad of influences from left-field electronica, funk, soul and jazz, the intricate soundscapes fuse seamlessly over Sam's ethereal vocal delivery and Eddie's organic percussions. Alfonso explains: "Breaking Point started as an electronic improvisation at the beginning of the first pandemic. Having tidied up the improvised session I sent the idea to Sam without any direction. He came back with the vocals that for my taste were fitting perfectly. He is incredibly talented and has the gift of simplicity." He adds: "I decided that the drumming for the main part had to be acoustic rather than electronic. I then called Eddie, a friend and drummer from Sons of Kemet. His playing is full of feeling and he has such a distinctive style. Breaking point alternates between tension and release. Chaotic instability and a state of spiritual calm. It is a song about personal identity and its internal search." Alfonso De Grandis is an established sound designer, sound artist, composer and music producer, based in London, with more than fifteen years experience. His studio, In Hackney Wick, is part of the Grammy Awards nominated Urchin Studio recording complex. He is the chief sound designer of the awarded IMAGO Dance film series and he is part of Paradigm Weave, a collaboration with sound artist and composer Dani Joss, dedicated to the creation of site specific art and multichannel soundscapes. In the TV and film industries his client list includes Discovery Channel, The Walt Disney Company, Vice, MTV, ITV, BT Sport, Noah Media Group, Dead Films, Sunset and Vine, BTTV, ESPN, Die Wolke Art Group and many more. The samples and layers that form his sonic palette are from his extensive library of unique sounds that he has collected over the years in various parts of the world. He has sampled biophony and geophony in Turkey, Morocco, Italy, The United States, South Africa, Australia and New Zealand. The project Antics & Collectables was founded in 2022 although its inception dates back to January 2017. On route from Sydney to Melbourne and the casual stop by a massive Antiques and collectables store. Pieces of furniture, paintings and objects of earlier periods were for sale. Mostly decorative, unsophisticated and unrefined. Some completely uninteresting while some incredibly powerful and evocative. All together it felt like an amazing place for a person to wander around and connect emotionally and personally to an object. Antics and collectables aims to be a collaborative musical parallel. It is about memories and daydreams, it is about collecting fragments of time. It is an ensemble of vivid blurring shape-shifted by time. The process of discovery, by use of ways uncharacteristic of traditional music, has collaboration at its heart. Each artist featured explores their craft, hence 'Antics' rather than 'Antiques'. Drawing on a vast number of traditions and genres with the use of digital and analogue electronics, found sounds, field recordings often looped and manipulated beyond recognition. Alfonso acts as the main curator and considers himself a listener and a sound collector before anything. The EP
1.211224
0.128636
-0.492924
-0.384617
[ 0.792102899421769, 1.6303442619690105 ]
[ -0.6323807030512174, 0.8896535910620434 ]
[ -1.0559694534664985, 0.07012156180411706 ]
[ -0.9556182688977486, 0.18638327886526757 ]
1,024
[ 512, 512 ]
[ 1222, 7009, 3145, 16382, 4366, 29879, 13, 1252, 7009, 573, 13987, 6097, 10883, 584, 5459, 1199, 669, 24930, 1849, 785, 525, 20130, 5086, 8984, 29915, 13, 8897, 8373, 897, 2142, 813, 5533, 29871, 29906, 29896, 29892, 29871, 29906, 29900, 29906, 29906, 13, 20761, 1135, 23644, 29875, 6288, 363, 9826, 29915, 29879, 29192, 4863, 5730, 406, 373, 9208, 8373, 897, 2142, 29892, 491, 278, 4517, 2729, 6314, 573, 5459, 1199, 669, 24930, 1849, 313, 1725, 19021, 317, 787, 310, 476, 21056, 29915, 29879, 20861, 347, 379, 860, 29897, 322, 1009, 13585, 6288, 29892, 2175, 2671, 11966, 983, 289, 4600, 525, 20130, 5086, 8984, 4286, 13, 4013, 2320, 1949, 1015, 375, 29892, 607, 338, 4586, 515, 278, 701, 11506, 16502, 2861, 297, 29871, 29906, 29900, 29906, 29941, 29892, 4145, 1475, 278, 24293, 14424, 5802, 322, 6047, 29892, 411, 263, 14288, 29892, 16151, 29899, 29890, 2548, 2948, 29892, 29299, 2867, 915, 271, 29892, 21230, 509, 26082, 29892, 2090, 29895, 29892, 10752, 322, 1399, 347, 27758, 304, 1653, 1009, 1407, 1914, 29892, 1020, 2310, 935, 6047, 29889, 450, 10259, 1384, 292, 4863, 338, 18018, 5662, 433, 1747, 322, 9846, 29889, 13, 2525, 9894, 519, 363, 1432, 27758, 4696, 2511, 15353, 912, 29991, 13, 10923, 8695, 29901, 13, 4373, 4696, 6314, 573, 5459, 1199, 669, 24930, 1849, 526, 22301, 304, 7475, 346, 1009, 9512, 6507, 411, 278, 18517, 310, 525, 20130, 5086, 8984, 742, 26239, 515, 278, 701, 11506, 16502, 2861, 297, 29871, 29906, 29900, 29906, 29941, 29889, 13, 29931, 287, 491, 14297, 29892, 18422, 29892, 6047, 23383, 29651, 897, 6265, 275, 29892, 525, 20130, 5086, 8984, 29915, 5680, 6932, 9511, 14167, 15640, 29899, 21453, 13236, 3685, 26676, 322, 317, 787, 310, 476, 21056, 24103, 1050, 20861, 347, 379, 860, 29889, 18492, 292, 373, 263, 590, 374, 328, 310, 7112, 2063, 515, 2175, 29899, 2671, 11966, 983, 29892, 2090, 29895, 29892, 10752, 322, 21230, 29892, 278, 11158, 9593, 6047, 1557, 11603, 285, 1509, 409, 314, 23769, 975, 3685, 29915, 29879, 11314, 406, 284, 20982, 28289, 322, 20861, 347, 29915, 29879, 2894, 293, 639, 13571, 1080, 29889, 13, 2499, 29888, 16911, 18568, 29901, 376, 20130, 5086, 8984, 4687, 408, 385, 27758, 4857, 1730, 362, 472, 278, 6763, 310, 278, 937, 7243, 24552, 29889, 15950, 10668, 1000, 701, 278, 4857, 11292, 4867, 306, 2665, 278, 2969, 304, 3685, 1728, 738, 5305, 29889, 940, 2996, 1250, 411, 278, 17985, 393, 363, 590, 21779, 892, 28221, 7970, 29889, 940, 338, 29811, 14981, 5969, 14927, 322, 756, 278, 19797, 310, 23205, 1213, 13, 3868, 12778, 29901, 376, 29902, 8459, 393, 278, 24103, 4056, 363, 278, 1667, 760, 750, 304, 367, 1274, 18291, 293, 3265, 1135, 27758, 29889, 306, 769, 2000, 20861, 347, 29892, 263, 5121, 322, 24103, 1050, 515, 317, 787, 310, 476, 21056, 29889, 3600, 8743, 338, 2989, 310, 11223, 322, 540, 756, 1316, 263, 8359, 573, 3114, 29889, 5826, 5086, 1298, 5136, 1078, 1546, 260, 2673, 322, 6507, 29889, 16579, 13574, 832, 3097, 322, 263, 2106, 310, 20954, 21732, 29889, 739, 338, 263, 4823, 1048, 7333, 10110, 322, 967, 7463, 2740, 1213, 13, 2499, 29888, 16911, 897, 6265, 275, 338, 385, 7841, 6047, 23383, 29892, 6047, 7664, 29892, 18422, 322, 4696, 14297, 29892, 2729, 297, 4517, 29892, 411, 901, 1135, 25020, 2440, 7271, 29889, 3600, 8693, 29892, 512, 379, 547, 3801, 399, 860, 29892, 338, 760, 310, 278, 16878, 1357, 9220, 28442, 8918, 24338, 7448, 16867, 4280, 29889, 940, 338, 278, 9087, 6047, 23383, 310, 278, 15074, 306, 1529, 17080, 22440, 2706, 3652, 322, 540, 338, 760, 310, 24829, 335, 29885, 1334, 1351, 29892, 263, 24771, 411, 6047, 7664, 322, 18422, 360, 3270, 435, 2209, 29892, 16955, 304, 278, 11265, 310, 3268, 2702, 1616, 322, 1773, 436, 4143, 6047, 1557, 11603, 29889, 13, 797, 278, 5648, 322, 2706, 6397, 2722, 670, 3132, 1051, 7805, 8565, 22205, 17368, 29892, 450, 399, 1997, 17944, 6938, 29892, 21400, 29892, 28982, 29892, 306, 8050, 29892, 350, 29911, 8815, 29892, 1939, 801, 8213, 6431, 29892, 16992, 21470, 29892, 8991, 842, 322, 478, 457, 29892, 350, 29911, 8050, 29892, 26480, 29940, 29892, 1640, 11902, 446, 3012, 6431, 322, 1784, 901, 29889, 13, 1576, 11916, 322, 15359, 393, 883, 670, 1487, 293, 282, 26456, 526, 515, 670, 20607, 3489, 310, 5412, 10083, 393, 540, 756, 16531, 975, 278, 2440, 297, 5164, 5633, 310, 278, 3186, 29889, 940, 756, 4559, 29881, 4768, 3021, 2592, 322, 1737, 3021, 2592, 297, 26459, 29892, 3879, 542, 1111, 29892, 12730, 29892, 450, 3303, 3900, 29892, 4275, 10557, 29892, 8314, 322, 1570, 13450, 29889, 13, 1576, 2060, 5459, 1199, 669, 24930, 1849, 471, 11091, 297, 29871, 29906, 29900, 29906, 29906, 5998, 967, 297, 1441, 10116, 1250, 304, 5490, 29871, 29906, 29900, 29896, 29955, 29889, 1551, 5782, 515, 16198, 304, 22103, 322, 278, 3209, 950, 5040, 491, 263, 20364, 18473, 1912, 322, 6314, 1849, 3787, 29889, 26005, 778, 310, 15252, 17252, 29892, 10675, 886, 322, 3618, 310, 8859, 23704, 892, 363, 14686, 29889, 7849, 368, 10200, 1230, 29892, 9644, 3021, 4695, 630, 322, 443, 999, 1312, 29889, 3834, 6446, 443, 1639, 342, 292, 1550, 777, 29811, 14981, 13988, 322, 3415, 542, 1230, 29889, 2178, 4208, 372, 7091, 763, 385, 21863, 292, 2058, 363, 263, 2022, 304, 281, 3825, 2820, 322, 4511, 953, 8194, 635, 322, 22345, 304, 385, 1203, 29889, 13, 13448, 1199, 322, 6314, 1849, 263, 9893, 304, 367, 263, 11465, 1230, 9636, 8943, 29889, 739, 338, 1048, 2626, 3842, 322, 2462, 29881, 1633, 29879, 29892, 372, 338, 1048, 6314, 292, 22370, 310, 931, 29889, 739, 338, 385, 21285, 310, 325, 3640, 1999, 1038, 292, 8267, 29899, 10889, 287, 491, 931, 29889, 450, 1889, 310, 20699, 29892, 491, 671, 310, 5837, 443, 18609, 4695, 310, 13807, 4696, 29892, 756, 24771, 472, 967, 5192, 29889, 7806, 7664, 15000, 3902, 2361, 1009, 25554, 29892, 8151, 525, 13448, 1199, 29915, 3265, 1135, 525, 13448, 3783, 4286, 13, 16327, 373, 263, 13426, 1353, 310, 3534, 2187, 322, 2531, 690, 411, 278, 671, 310, 13436, 322, 15690, 434, 11966, 1199, 29892, 1476, 10083, 29892, 1746, 2407, 886, 4049, 2425, 287, 322, 11525, 7964, 8724, 19679, 29889, 29651, 14741, 408, 278, 1667, 3151, 1061, 322, 1136, 11376, 3654, 263, 13254, 322, 263, 6047, 6314, 272, 1434, 3099, 29889, 13, 1576, 16502 ]
1,333,545
0
CommonCrawl
20
25
Why Do Drug Addicts Itch Does Nac Help With Alcohol Addiction AlcoholNews Nac Is Needed To Make Glutathione Intervention: HEAVY Alcohol & Drug Addiction Takes Over Krystals Life After Traumatic Past | A& E NAC helps your body create intracellular glutathione. Glutathione is our bodys antioxidant powerhouse. Antioxidants protect our cells from free radical damage. Free radicals As I explain in this article about vitamin C, our immune system creates free radicals to defend against viruses, bacteria, and other pathogens. Withdrawal Syndrome And Depressive Symptoms Depression is classically considered one of the many components of withdrawal syndrome . Thus, we conducted subgroup analysis of these two clinical features and examined their overall effects. We did not restrict the meta-analysis to trials with longer length of treatment or time of measurement for withdrawal and depression symptoms because these two features are clinical meaningful at the treatment initiation days or later. Five trials measured withdrawal symptoms. These trials evaluated withdrawal syndromes by using the ShiffmanJarvik Withdrawal Questionnaire and Minnesota Nicotine Withdrawal Scale at baseline and followed up at 62 hours and on the 4th day , 2nd week and 4th week . Four trials reported the endpoint scores while LaRowe et al. reported the change score. Meta-analysis of the four trials reported endpoint results found no significant differences between groups and no heterogeneity across trials . Merging the change score with the endpoint results did not reveal significance between groups and heterogeneity was observed across trials . When withdrawal and depressive symptoms were considered as a single domain, the NAC treatment group demonstrated a significantly higher overall improvement than the placebo group no heterogeneity was observed across trials . Nac Hangover Cure: Does N N-acetylcysteine, or NAC for short, is a dietary supplement that is used to reduce hangover symptoms. It is a derivative of L-cysteine, a naturally occurring amino acid. According to WebMD NAC is an antioxidant that binds to acetaldehyde, a toxic byproduct of alcohol metabolism and one of the main hangover causes. In fact, acetaldehyde is the culprit behind many of the most dreaded symptoms following excessive drinking. By bringing down elevated levels of acetaldehyde, the supplement reduces the general misery a person experiences following alcohol ingestion. NAC alcohol is a safe, inexpensive, and effective way to lessen unpleasant symptoms after alcohol intake. How does N-acetylcysteine hangover cure work and what are the possible side effects? Lets find out more about taking NAC for hangovers. People with a hangover have all kinds of questions on their mind. Whats good to drink for a hangover? Are there foods that help with the uneasiness, and if so, whats good to eat when you have a hangover? Does NAC supplement work for alcohol withdrawal? Recommended Reading: Can You Get Addicted To Oxycodone Reduces Respiratory Symptoms In Chronic Lung Disease COPD is a common lung disease resulting from chronic airflow obstruction and inflammation. While it isnt a reversible disease, it is preventable and treatable. When administered orally at 1200-1800 mg/day, NAC decreased COPD exacerbations. Oxidative stress and free radicals play a role in COPD, which makes anti-inflammatory substances and antioxidants a logical choice for helping to treat and manage the condition. NAC has been shown to reduce COPD and chronic bronchitis flares. In a 2016 review in the Journal of Respiratory Medicine it was concluded that NAC either alone or with antibiotics can decrease the risk of increased symptoms or worsening of conditions such as COPD, chronic bronchitis, and rhinosinusitis. As with most studies regarding NAC, there is a dose dependent effect. Or in other words, if you arent taking enough and doing it consistently then youre unlikely to see a benefit. NAC is also a common prescription to be used with
-0.77395
-0.078181
0.26668
-0.147893
[ -1.322675962952317, -0.22522352546706015 ]
[ -0.5589649312175189, 0.40260261694579996 ]
[ -0.01864687408433236, 0.5520073566271282 ]
[ -0.4925743611487352, 0.1967887599382791 ]
1,024
[ 512, 512 ]
[ 3750, 1938, 360, 11124, 3462, 919, 29879, 739, 305, 13, 25125, 405, 562, 22305, 2973, 838, 1111, 5391, 3462, 2463, 13, 2499, 1111, 5391, 29328, 13, 29940, 562, 1317, 2448, 19226, 1763, 8561, 8467, 329, 493, 1421, 13, 4074, 7316, 29901, 17714, 7520, 29979, 838, 1111, 5391, 669, 360, 11124, 3462, 2463, 323, 6926, 6811, 476, 719, 303, 1338, 4634, 2860, 3201, 398, 2454, 19793, 891, 319, 29987, 382, 13, 29940, 2477, 6911, 596, 3573, 1653, 938, 945, 514, 1070, 3144, 329, 493, 1421, 29889, 8467, 329, 493, 1421, 338, 1749, 13004, 952, 3677, 601, 29916, 333, 424, 3081, 8697, 29889, 5459, 601, 29916, 333, 1934, 12566, 1749, 9101, 515, 3889, 24818, 18658, 29889, 12362, 24818, 29879, 1094, 306, 5649, 297, 445, 4274, 1048, 13901, 9103, 315, 29892, 1749, 5198, 1540, 1788, 10017, 3889, 24818, 29879, 304, 24663, 2750, 10636, 6394, 29892, 289, 5761, 423, 29892, 322, 916, 2224, 468, 575, 29889, 13, 3047, 4012, 284, 8713, 299, 4871, 1126, 897, 2139, 573, 10667, 415, 4835, 13, 2772, 2590, 338, 770, 1711, 5545, 697, 310, 278, 1784, 7117, 310, 28679, 284, 22898, 4871, 869, 6549, 29892, 591, 18043, 24410, 7418, 310, 1438, 1023, 24899, 936, 5680, 322, 4392, 1312, 1009, 12463, 9545, 29889, 1334, 1258, 451, 9250, 278, 12700, 29899, 15916, 304, 3367, 1338, 411, 5520, 3309, 310, 14502, 470, 931, 310, 20039, 363, 28679, 284, 322, 316, 2590, 25828, 4835, 1363, 1438, 1023, 5680, 526, 24899, 936, 6593, 1319, 472, 278, 14502, 2069, 11685, 3841, 470, 2678, 29889, 22853, 3367, 1338, 17005, 28679, 284, 25828, 4835, 29889, 4525, 3367, 1338, 19030, 28679, 284, 22898, 456, 267, 491, 773, 278, 1383, 2593, 1171, 29967, 279, 17064, 2973, 4012, 284, 894, 15421, 322, 20994, 13656, 327, 457, 2973, 4012, 284, 2522, 744, 472, 2362, 5570, 322, 5643, 701, 472, 29871, 29953, 29906, 6199, 322, 373, 278, 29871, 29946, 386, 2462, 1919, 29871, 29906, 299, 4723, 322, 29871, 29946, 386, 4723, 869, 12458, 3367, 1338, 8967, 278, 16248, 19435, 1550, 997, 4301, 29872, 634, 394, 29889, 8967, 278, 1735, 8158, 29889, 20553, 29899, 15916, 310, 278, 3023, 3367, 1338, 8967, 16248, 2582, 1476, 694, 7282, 12651, 1546, 6471, 322, 694, 25745, 16603, 537, 4822, 3367, 1338, 869, 4702, 3460, 278, 1735, 8158, 411, 278, 16248, 2582, 1258, 451, 10320, 284, 26002, 1546, 6471, 322, 25745, 16603, 537, 471, 8900, 4822, 3367, 1338, 869, 13, 10401, 28679, 284, 322, 316, 2139, 573, 25828, 4835, 892, 5545, 408, 263, 2323, 5354, 29892, 278, 405, 2477, 14502, 2318, 28585, 263, 16951, 6133, 12463, 20414, 1135, 278, 2058, 833, 2318, 694, 25745, 16603, 537, 471, 8900, 4822, 3367, 1338, 869, 13, 29940, 562, 379, 574, 957, 315, 545, 29901, 5538, 405, 13, 29940, 29899, 562, 300, 2904, 29883, 858, 29872, 457, 29892, 470, 405, 2477, 363, 3273, 29892, 338, 263, 652, 300, 653, 1462, 944, 393, 338, 1304, 304, 10032, 13958, 957, 25828, 4835, 29889, 739, 338, 263, 16291, 310, 365, 29899, 29883, 858, 29872, 457, 29892, 263, 18180, 13920, 292, 626, 1789, 22193, 29889, 7579, 304, 2563, 5773, 405, 2477, 338, 385, 3677, 601, 29916, 333, 424, 393, 7868, 29879, 304, 1274, 26310, 311, 5819, 311, 29892, 263, 304, 27375, 491, 4704, 310, 27231, 5391, 1539, 19388, 1608, 322, 697, 310, 278, 1667, 13958, 957, 9946, 29889, 512, 2114, 29892, 1274, 26310, 311, 5819, 311, 338, 278, 13949, 19428, 5742, 1784, 310, 278, 1556, 21005, 287, 25828, 4835, 1494, 19163, 573, 13748, 292, 29889, 2648, 20794, 1623, 11858, 630, 11174, 310, 1274, 26310, 311, 5819, 311, 29892, 278, 1462, 944, 26830, 278, 2498, 3984, 708, 263, 2022, 27482, 1494, 27231, 5391, 2348, 602, 29889, 13, 29940, 2477, 27231, 5391, 338, 263, 9109, 29892, 297, 4548, 6270, 29892, 322, 11828, 982, 304, 3109, 264, 443, 552, 13186, 25828, 4835, 1156, 27231, 5391, 938, 1296, 29889, 1128, 947, 405, 29899, 562, 300, 2904, 29883, 858, 29872, 457, 13958, 957, 274, 545, 664, 322, 825, 526, 278, 1950, 2625, 9545, 29973, 365, 1691, 1284, 714, 901, 1048, 5622, 405, 2477, 363, 298, 4524, 874, 29889, 13, 15666, 1991, 411, 263, 13958, 957, 505, 599, 17690, 310, 5155, 373, 1009, 3458, 29889, 806, 1446, 1781, 304, 13748, 363, 263, 13958, 957, 29973, 4683, 727, 9687, 29879, 393, 1371, 411, 278, 1597, 294, 3335, 29892, 322, 565, 577, 29892, 825, 29879, 1781, 304, 17545, 746, 366, 505, 263, 13958, 957, 29973, 5538, 405, 2477, 1462, 944, 664, 363, 27231, 5391, 28679, 284, 29973, 13, 1123, 2055, 2760, 21439, 29901, 1815, 887, 3617, 3462, 18186, 1763, 438, 3594, 19284, 650, 13, 29934, 6085, 778, 2538, 29886, 381, 7606, 10667, 415, 4835, 512, 15336, 293, 365, 686, 360, 895, 559, 13, 3217, 25014, 338, 263, 3619, 13030, 17135, 9819, 515, 17168, 293, 4799, 1731, 14979, 4080, 322, 4414, 4850, 362, 29889, 5806, 372, 338, 593, 263, 18764, 1821, 17135, 29892, 372, 338, 5557, 519, 322, 7539, 519, 29889, 1932, 4113, 1531, 287, 470, 635, 472, 29871, 29896, 29906, 29900, 29900, 29899, 29896, 29947, 29900, 29900, 286, 29887, 29914, 3250, 29892, 405, 2477, 9263, 1463, 315, 4590, 29928, 429, 562, 23936, 800, 29889, 13, 29949, 29916, 333, 1230, 22884, 322, 3889, 24818, 29879, 1708, 263, 6297, 297, 315, 4590, 29928, 29892, 607, 3732, 9418, 29899, 13453, 314, 2922, 706, 5960, 2925, 322, 3677, 601, 29916, 333, 1934, 263, 16667, 7348, 363, 19912, 304, 7539, 322, 10933, 278, 4195, 29889, 405, 2477, 756, 1063, 4318, 304, 10032, 315, 4590, 29928, 322, 17168, 293, 12246, 305, 23448, 1652, 5114, 29889, 13, 797, 263, 29871, 29906, 29900, 29896, 29953, 9076, 297, 278, 8237, 310, 2538, 29886, 381, 7606, 27529, 372, 471, 22834, 393, 405, 2477, 2845, 7432, 470, 411, 3677, 747, 24414, 1199, 508, 23806, 278, 12045, 310, 11664, 25828, 4835, 470, 281, 943, 8333, 310, 5855, 1316, 408, 315, 4590, 29928, 29892, 17168, 293, 12246, 305, 23448, 29892, 322, 18178, 8226, 13419, 23448, 29889, 13, 2887, 411, 1556, 11898, 11211, 405, 2477, 29892, 727, 338, 263, 437, 344, 14278, 2779, 29889, 1394, 297, 916, 3838, 29892, 565, 366, 564, 296, 5622, 3307, 322, 2599, 372, 5718, 2705, 769, 366, 276, 25057, 304, 1074, 263, 14169, 29889, 13, 29940, 2477, 338, 884, 263, 3619, 2225, 3395, 304, 367, 1304, 411 ]
1,333,547
0
CommonCrawl
14
10
a nebulizer for those with COPD. This is because it also helps with the clearance of mucus from the lungs. Boosts Brain Health By Regulating Glutamate And Replenishing Glutathione NACs ability to replenish glutathione and regulate brain glutamate levels can boost brain health. The neurotransmitter glutamate is involved in a broad range of learning, behavior, and memory functions, while the antioxidant glutathione helps reduce brain cell oxidative damage that is associated with aging . Because NAC helps regulate glutamate levels and replenish glutathione, it may benefit those with health conditions affecting the brain and memory . The neurological disorder Alzheimers disease slows down learning and memory capacity. Animal studies suggest that NAC may slow the loss of thinking ability in people with Alzheimers disease . Another brain condition, Parkinsons disease, is characterized by the deterioration of cells that generate the neurotransmitter dopamine. Both oxidative damage to cells and a decrease in antioxidant ability contribute to this disease. NAC supplements appear to improve both dopamine function and disease symptoms such as tremors ( While NAC may improve brain health, more human research is needed to make strong conclusions. 28 ). Many male infertility issues increase when antioxidant levels are insufficient to address free radical formation in the reproductive system. The oxidative stress can cause cell death and reduced fertility . In some cases, NAC has been shown to improve male fertility. Researchers suggested that this combined supplement should be considered as a treatment option for male infertility. Don't Miss: Can Recovering Addicts Smoke Weed Hijacking The Brains Reward System The neurotransmitter dopamine is the primary currency of the brains reward system. An action that elicits an increase in dopamine is experienced as pleasurable. The brain learns to associate that action with reward. The pleasurable experience of natural rewards such as food and sex are signaled through dopamine release in the reward system as a way to ensure continued pursuit of actions that enable survival. Drugs of abuse, however, put the reward system into overdrive by eliciting unnaturally high increases in dopamine release. As a result, the brain overlearns the association between taking the drug and reward. As that association is strengthened through continued drug use, it becomes increasingly difficult for the user to think of anything other than the drug. Yet, while dopamine drives formation of the drug-reward associations, decades of research by Kalivas have shown that another neurotransmitter, glutamate, is also implicated in drug addiction. Typically, glutamate would be released in the synapse in response to cues that signal reward but would then be cleared by a glutamate transporter a protein that regulates glutamate signaling.1 This balanced release and clearance of glutamate facilitates the brains ability to fine-tune and adapt learned behaviors in response to environmental stimuli. Kalivas illustrates this hijacking of the brain by drug-related thoughts with an anecdote: The Ultimate Handbook On Living A Life Addiction Free Nechifor, M. . Magnesium in drug abuse and addiction. Magnesium in the Central Nervous System, 333-344. Ooi, S. L., Green, R., & Pak, S. C. . N-acetylcysteine for the treatment of psychiatric disorders: A review of current evidence. BioMed Research International, 2018, 1-8. Perna, S., Alalwan, T. A., Alaali, Z., Alnashaba, T., Gasparri, C., Infantino, V., Hammad, L., Riva, A., Petrangolini, G., Allegrini, P., & Rondanelli, M. . The role of glutamine in the complex interaction between gut microbiota and health: A narrative review. International Journal of Molecular Sciences, 20, 5232. Qamar, N., Castano, D., Patt, C., Chu, T., Cottrell, J., & Chang, S. L. . Meta
0.026797
0.929047
1.13027
0.865341
[ -0.029017520262987737, 0.08261102720041123 ]
[ 1.1546666210958818, 0.7034282186058327 ]
[ 1.257082361683955, 1.003458259145528 ]
[ 0.5505751164206714, 1.1801067213378693 ]
1,024
[ 512, 512 ]
[ 263, 452, 8645, 3950, 363, 1906, 411, 315, 4590, 29928, 29889, 910, 338, 1363, 372, 884, 6911, 411, 278, 2821, 749, 310, 286, 1682, 375, 515, 278, 301, 3085, 29889, 13, 8431, 520, 29879, 5032, 262, 15202, 2648, 2169, 18099, 8467, 329, 314, 403, 1126, 830, 572, 264, 14424, 8467, 329, 493, 1421, 13, 29940, 2477, 29879, 11509, 304, 337, 572, 264, 728, 3144, 329, 493, 1421, 322, 1072, 5987, 17294, 3144, 329, 314, 403, 11174, 508, 14505, 17294, 9045, 29889, 13, 1576, 452, 2192, 3286, 2415, 357, 3144, 329, 314, 403, 338, 9701, 297, 263, 7300, 3464, 310, 6509, 29892, 6030, 29892, 322, 3370, 3168, 29892, 1550, 278, 3677, 601, 29916, 333, 424, 3144, 329, 493, 1421, 6911, 10032, 17294, 3038, 19100, 333, 1230, 18658, 393, 338, 6942, 411, 946, 292, 869, 13, 29933, 5658, 405, 2477, 6911, 1072, 5987, 3144, 329, 314, 403, 11174, 322, 337, 572, 264, 728, 3144, 329, 493, 1421, 29892, 372, 1122, 14169, 1906, 411, 9045, 5855, 6602, 292, 278, 17294, 322, 3370, 869, 13, 1576, 452, 2192, 1188, 936, 766, 2098, 838, 29920, 6391, 414, 17135, 5232, 29879, 1623, 6509, 322, 3370, 13284, 29889, 22809, 11898, 4368, 393, 405, 2477, 1122, 5232, 278, 6410, 310, 7291, 11509, 297, 2305, 411, 838, 29920, 6391, 414, 17135, 869, 13, 2744, 1228, 17294, 4195, 29892, 4815, 1144, 787, 17135, 29892, 338, 2931, 1891, 491, 278, 270, 1308, 1611, 362, 310, 9101, 393, 5706, 278, 452, 2192, 3286, 2415, 357, 22357, 314, 457, 29889, 9134, 19100, 333, 1230, 18658, 304, 9101, 322, 263, 23806, 297, 3677, 601, 29916, 333, 424, 11509, 29126, 304, 445, 17135, 29889, 13, 29940, 2477, 1462, 944, 29879, 2615, 304, 11157, 1716, 22357, 314, 457, 740, 322, 17135, 25828, 4835, 1316, 408, 14586, 943, 313, 13, 8809, 488, 405, 2477, 1122, 11157, 17294, 9045, 29892, 901, 5199, 5925, 338, 4312, 304, 1207, 4549, 21204, 1080, 29889, 13, 29906, 29947, 13742, 13, 14804, 14263, 10115, 1376, 537, 5626, 7910, 746, 3677, 601, 29916, 333, 424, 11174, 526, 1663, 29884, 4543, 304, 3211, 3889, 24818, 12409, 297, 278, 337, 4704, 573, 1788, 29889, 450, 19100, 333, 1230, 22884, 508, 4556, 3038, 4892, 322, 12212, 19965, 1793, 869, 13, 797, 777, 4251, 29892, 405, 2477, 756, 1063, 4318, 304, 11157, 14263, 19965, 1793, 29889, 13, 1666, 2842, 414, 7829, 393, 445, 12420, 1462, 944, 881, 367, 5545, 408, 263, 14502, 2984, 363, 14263, 10115, 1376, 537, 29889, 13, 10310, 29915, 29873, 4750, 29901, 1815, 3599, 957, 292, 3462, 919, 29879, 4116, 6946, 1334, 287, 13, 29950, 823, 547, 292, 450, 5032, 1144, 390, 809, 538, 2184, 13, 1576, 452, 2192, 3286, 2415, 357, 22357, 314, 457, 338, 278, 7601, 27550, 310, 278, 4105, 1144, 20751, 1788, 29889, 530, 3158, 393, 560, 293, 1169, 385, 7910, 297, 22357, 314, 457, 338, 18860, 408, 5644, 294, 21115, 29889, 450, 17294, 24298, 1983, 304, 25836, 393, 3158, 411, 20751, 29889, 450, 5644, 294, 21115, 7271, 310, 5613, 337, 2935, 1316, 408, 9687, 322, 7916, 526, 1804, 7943, 1549, 22357, 314, 457, 6507, 297, 278, 20751, 1788, 408, 263, 982, 304, 9801, 7572, 12359, 3121, 310, 8820, 393, 9025, 10503, 2561, 29889, 13, 29928, 582, 3174, 310, 633, 1509, 29892, 3138, 29892, 1925, 278, 20751, 1788, 964, 975, 21594, 491, 560, 293, 11407, 443, 29876, 1337, 635, 1880, 16415, 297, 22357, 314, 457, 6507, 29889, 1094, 263, 1121, 29892, 278, 17294, 975, 1945, 1983, 278, 15477, 1546, 5622, 278, 15721, 322, 20751, 29889, 1094, 393, 15477, 338, 9324, 6419, 1549, 7572, 15721, 671, 29892, 372, 7415, 10231, 368, 5189, 363, 278, 1404, 304, 1348, 310, 3099, 916, 1135, 278, 15721, 29889, 13, 29979, 300, 29892, 1550, 22357, 314, 457, 25100, 12409, 310, 278, 15721, 29899, 276, 1328, 27733, 29892, 1602, 3076, 310, 5925, 491, 9172, 19701, 505, 4318, 393, 1790, 452, 2192, 3286, 2415, 357, 29892, 3144, 329, 314, 403, 29892, 338, 884, 2411, 9169, 297, 15721, 788, 2463, 29889, 14213, 1711, 29892, 3144, 329, 314, 403, 723, 367, 5492, 297, 278, 5222, 481, 344, 297, 2933, 304, 274, 1041, 393, 7182, 20751, 541, 723, 769, 367, 24639, 491, 263, 3144, 329, 314, 403, 1301, 18505, 263, 26823, 393, 24378, 1078, 3144, 329, 314, 403, 7182, 292, 29889, 29896, 910, 6411, 8362, 6507, 322, 2821, 749, 310, 3144, 329, 314, 403, 16089, 277, 1078, 278, 4105, 1144, 11509, 304, 2691, 29899, 29873, 1540, 322, 7744, 10972, 4010, 18930, 297, 2933, 304, 29380, 20436, 14549, 29889, 13, 29968, 284, 19701, 8632, 1078, 445, 4147, 547, 292, 310, 278, 17294, 491, 15721, 29899, 12817, 13133, 411, 385, 385, 687, 29881, 866, 29901, 13, 1576, 18514, 6490, 5166, 2909, 1551, 26176, 319, 4634, 3462, 2463, 12362, 13, 29940, 5309, 361, 272, 29892, 341, 29889, 869, 3561, 4515, 1974, 297, 15721, 633, 1509, 322, 788, 2463, 29889, 3561, 4515, 1974, 297, 278, 8068, 405, 6972, 681, 2184, 29892, 29871, 29941, 29941, 29941, 29899, 29941, 29946, 29946, 29889, 13, 29949, 7768, 29892, 317, 29889, 365, 1696, 7646, 29892, 390, 1696, 669, 14371, 29892, 317, 29889, 315, 29889, 869, 405, 29899, 562, 300, 2904, 29883, 858, 29872, 457, 363, 278, 14502, 310, 11643, 7163, 2200, 766, 20488, 29901, 319, 9076, 310, 1857, 10757, 29889, 21184, 19302, 10550, 4623, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 29871, 29896, 29899, 29947, 29889, 13, 29925, 10989, 29892, 317, 1696, 838, 284, 11440, 29892, 323, 29889, 319, 1696, 319, 433, 2606, 29892, 796, 1696, 838, 29876, 1161, 5363, 29892, 323, 1696, 19141, 862, 374, 29892, 315, 1696, 9969, 424, 1789, 29892, 478, 1696, 26356, 328, 29892, 365, 1696, 390, 4244, 29892, 319, 1696, 5879, 29878, 21461, 2172, 29892, 402, 1696, 20615, 629, 2172, 29892, 349, 1696, 669, 390, 898, 3870, 492, 29892, 341, 29889, 869, 450, 6297, 310, 3144, 329, 314, 457, 297, 278, 4280, 14881, 1546, 22341, 9200, 5365, 4616, 322, 9045, 29901, 319, 15474, 1230, 9076, 29889, 4623, 8237, 310, 341, 1772, 16637, 17253, 29892, 29871, 29906, 29900, 29892, 29871, 29945, 29906, 29941, 29906, 29889, 13, 29984, 8715, 29892, 405, 1696, 4834, 1562, 29892, 360, 1696, 349, 1131, 29892, 315, 1696, 678, 29884, 29892, 323, 1696, 315, 1501, 15044, 29892, 435, 1696, 669, 678, 574, 29892, 317, 29889, 365, 29889, 869, 20553 ]
1,333,547
1,024
CommonCrawl
14
10
-analysis of alcohol induced gut dysbiosis and the resulting behavioral impact. Behavioural Brain Research, 376, 112196. Shi, Z., & Puyo, C. A. . N-acetylcysteine to combat COVID-19: An evidence review. Therapeutics and Clinical Risk Management, 16, 1047-1055. You May Like: How To Help Teenager With Drug Addiction Nac For Female Infertility In a case controlled study of women struggling with unexplained infertility and undergoing intrauterine insemination, it was shown that women given 1,200 mg NAC had a higher number of follicles, as well as a higher pregnancy rate. Continue reading because Ill share more about fertility in the PCOS section. How Ketamine And Nad Can Help With Drug And Alcohol Addiction Recovery Help at VA for Substance Use Disorder Substance use disorders dont discriminate they affect people of all ages and backgrounds. Drug and alcohol addiction are common illnesses that cause significant impairment and health problems. Ketamine and NAD are unique therapies that effectively treat drug and alcohol addiction at the core. Learn how the physicians at Klarity Ketamine Clinic of Las Vegas use these medications to help patients recover from substance addiction. Also Check: Can You Be Addicted To Adderall Nac May Help Prevent Heart Disease Oxidative damage can destroy heart tissue and lead to head attack, stroke, and other cardiovascular issues. Because NAC is helpful in reducing oxidative stress, it can be useful in preventing oxidative damage to tissues of the heart. This gives it great potential to help in the treatment and prevention of heart disease. NAC also improves blood flow and circulation by increasing nitric oxide production and acting as an anti-aggregate. An anti-aggregate prevents platelets from clumping together to form a clot in your blood vessels. As stated in the PCOS section of this article, NAC has also been shown to have benefits on healthy cholesterol levels. Experiment : Effect Of Oral Administration Of Nac Asa Or Their Combination On Chronic Alcohol Intake And Mrna Expression Of Nrf2 Twenty-four female UChB rats, weighing 190210 g were single housed in cages at the age of 60 days and maintained on a 12-h light-dark cycle . Subsequently, rats received continuous concurrent free-choice access to 10% ethanol solution and water for 77 days. On day 78, rats were allowed to concurrent three-bottle choice access of 10% and 20% ethanol solutions and water for 24 additional days. On day 88, rats were divided in four groups: , namely, vehicle group: rats were given saline on the first 2 days by the i.p. route and water by oral gavage for the following 11 days NAC group: On the first 2 days, NAC was administered by the i.p. route , as a loading dose, and subsequently by oral gavage for the following 11 days ASA group: rats were given saline on the first 2 days by the i.p. route and thereafter administered ASA by oral gavage, for the following 11 days and NAC + ASA group: On the first 2 days, NAC was administered by the i.p. route , and subsequently, rats were daily administered the combined NAC plus ASA dose by oral gavage, for 11 days. Ethanol intake was recorded daily and expressed as grams of ethanol consumed/kg body weight for the complete 11-day period. Preliminary studies for this group of animals have been reported . Twenty-four hours after the last NAC, ASA, or NAC + ASA administration and saline controls, the animals were anesthetized with chloral hydrate to obtain hippocampal samples for quantification of mRNA levels of Nrf2-ARE regulated genes. Don't Miss: How To Quit Marijuana Addiction
-1.021347
-0.135481
0.174107
0.149964
[ -0.8624650188087335, -1.1802297183364459 ]
[ -0.11936561450598299, -0.15159692896955793 ]
[ 0.21215105922563612, 0.13606382846410806 ]
[ 0.11354491135418682, 0.18638327886526757 ]
1,024
[ 512, 512 ]
[ 29899, 15916, 310, 27231, 5391, 20974, 22341, 270, 952, 29890, 2363, 275, 322, 278, 9819, 6030, 284, 10879, 29889, 1522, 8708, 8975, 284, 5032, 262, 10550, 29892, 29871, 29941, 29955, 29953, 29892, 29871, 29896, 29896, 29906, 29896, 29929, 29953, 29889, 13, 2713, 29875, 29892, 796, 1696, 669, 349, 8631, 29877, 29892, 315, 29889, 319, 29889, 869, 405, 29899, 562, 300, 2904, 29883, 858, 29872, 457, 304, 15499, 19937, 29899, 29896, 29929, 29901, 530, 10757, 9076, 29889, 498, 1572, 412, 329, 1199, 322, 315, 1915, 936, 390, 3873, 15057, 29892, 29871, 29896, 29953, 29892, 29871, 29896, 29900, 29946, 29955, 29899, 29896, 29900, 29945, 29945, 29889, 13, 3492, 2610, 8502, 29901, 1128, 1763, 22305, 1920, 264, 1875, 2973, 360, 11124, 3462, 2463, 13, 29940, 562, 1152, 19361, 744, 512, 571, 1376, 537, 13, 797, 263, 1206, 20704, 6559, 310, 5866, 20042, 411, 443, 4548, 433, 1312, 10115, 1376, 537, 322, 1090, 17696, 938, 336, 12811, 457, 1663, 331, 3381, 29892, 372, 471, 4318, 393, 5866, 2183, 29871, 29896, 29892, 29906, 29900, 29900, 286, 29887, 405, 2477, 750, 263, 6133, 1353, 310, 900, 506, 793, 29892, 408, 1532, 408, 263, 6133, 758, 5138, 6906, 6554, 29889, 13, 1323, 14150, 5183, 1363, 8408, 6232, 901, 1048, 19965, 1793, 297, 278, 349, 3217, 29903, 4004, 29889, 13, 5328, 476, 300, 314, 457, 1126, 18496, 1815, 22305, 2973, 360, 11124, 1126, 838, 1111, 5391, 3462, 2463, 13, 4789, 22205, 22305, 472, 478, 29909, 363, 3323, 303, 749, 4803, 3295, 2098, 13, 4035, 303, 749, 671, 766, 20488, 4555, 2313, 5632, 16976, 896, 6602, 2305, 310, 599, 24646, 322, 3239, 29879, 29889, 360, 11124, 322, 27231, 5391, 788, 2463, 526, 3619, 4486, 2264, 267, 393, 4556, 7282, 2411, 1466, 358, 322, 9045, 4828, 29889, 476, 300, 314, 457, 322, 405, 3035, 526, 5412, 29220, 481, 583, 393, 17583, 7539, 15721, 322, 27231, 5391, 788, 2463, 472, 278, 7136, 29889, 13, 29931, 799, 29876, 920, 278, 4824, 14722, 472, 476, 4675, 537, 476, 300, 314, 457, 315, 1915, 293, 310, 7413, 17236, 294, 671, 1438, 13589, 800, 304, 1371, 22069, 9792, 515, 5960, 749, 788, 2463, 29889, 13, 17351, 5399, 29901, 1815, 887, 1522, 3462, 18186, 1763, 2087, 672, 497, 13, 29940, 562, 2610, 22305, 4721, 794, 17778, 360, 895, 559, 13, 29949, 29916, 333, 1230, 18658, 508, 8174, 5192, 260, 15118, 322, 3275, 304, 2343, 5337, 29892, 19782, 29892, 322, 916, 5881, 29875, 586, 6151, 1070, 5626, 29889, 13, 29933, 5658, 405, 2477, 338, 8444, 297, 27668, 19100, 333, 1230, 22884, 29892, 372, 508, 367, 5407, 297, 5557, 292, 19100, 333, 1230, 18658, 304, 260, 12175, 310, 278, 5192, 29889, 910, 4076, 372, 2107, 7037, 304, 1371, 297, 278, 14502, 322, 5557, 291, 310, 5192, 17135, 29889, 13, 29940, 2477, 884, 4857, 1960, 10416, 4972, 322, 18342, 362, 491, 10231, 21767, 2200, 19100, 680, 5802, 322, 16684, 408, 385, 9418, 29899, 26193, 403, 29889, 530, 9418, 29899, 26193, 403, 28057, 15284, 10376, 515, 1067, 3427, 292, 4208, 304, 883, 263, 1067, 327, 297, 596, 10416, 24479, 29889, 13, 2887, 8703, 297, 278, 349, 3217, 29903, 4004, 310, 445, 4274, 29892, 405, 2477, 756, 884, 1063, 4318, 304, 505, 23633, 373, 9045, 29891, 521, 324, 4156, 324, 11174, 29889, 13, 1252, 15362, 584, 26475, 4587, 1394, 284, 23303, 4587, 405, 562, 1094, 29874, 1394, 11275, 422, 2109, 362, 1551, 15336, 293, 838, 1111, 5391, 512, 19730, 1126, 3237, 1056, 21444, 4587, 405, 9600, 29906, 13, 27418, 6478, 29899, 17823, 12944, 501, 1451, 29933, 364, 1446, 29892, 591, 1141, 292, 29871, 29896, 29929, 29900, 29906, 29896, 29900, 330, 892, 2323, 9261, 287, 297, 274, 1179, 472, 278, 5046, 310, 29871, 29953, 29900, 3841, 322, 19949, 373, 263, 29871, 29896, 29906, 29899, 29882, 3578, 29899, 26031, 11412, 869, 3323, 27284, 29892, 364, 1446, 4520, 9126, 21984, 3889, 29899, 16957, 2130, 304, 29871, 29896, 29900, 29995, 11314, 273, 324, 1650, 322, 4094, 363, 29871, 29955, 29955, 3841, 29889, 1551, 2462, 29871, 29955, 29947, 29892, 364, 1446, 892, 6068, 304, 21984, 2211, 29899, 29890, 1501, 280, 7348, 2130, 310, 29871, 29896, 29900, 29995, 322, 29871, 29906, 29900, 29995, 11314, 273, 324, 6851, 322, 4094, 363, 29871, 29906, 29946, 5684, 3841, 29889, 1551, 2462, 29871, 29947, 29947, 29892, 364, 1446, 892, 13931, 297, 3023, 6471, 29901, 1919, 18451, 29892, 19716, 2318, 29901, 364, 1446, 892, 2183, 4497, 457, 373, 278, 937, 29871, 29906, 3841, 491, 278, 474, 29889, 29886, 29889, 5782, 322, 4094, 491, 470, 284, 330, 485, 482, 363, 278, 1494, 29871, 29896, 29896, 3841, 405, 2477, 2318, 29901, 1551, 278, 937, 29871, 29906, 3841, 29892, 405, 2477, 471, 4113, 1531, 287, 491, 278, 474, 29889, 29886, 29889, 5782, 1919, 408, 263, 8363, 437, 344, 29892, 322, 17602, 491, 470, 284, 330, 485, 482, 363, 278, 1494, 29871, 29896, 29896, 3841, 3339, 29909, 2318, 29901, 364, 1446, 892, 2183, 4497, 457, 373, 278, 937, 29871, 29906, 3841, 491, 278, 474, 29889, 29886, 29889, 5782, 322, 727, 7045, 4113, 1531, 287, 3339, 29909, 491, 470, 284, 330, 485, 482, 29892, 363, 278, 1494, 29871, 29896, 29896, 3841, 322, 405, 2477, 718, 3339, 29909, 2318, 29901, 1551, 278, 937, 29871, 29906, 3841, 29892, 405, 2477, 471, 4113, 1531, 287, 491, 278, 474, 29889, 29886, 29889, 5782, 1919, 322, 17602, 29892, 364, 1446, 892, 14218, 4113, 1531, 287, 278, 12420, 405, 2477, 2298, 3339, 29909, 437, 344, 491, 470, 284, 330, 485, 482, 29892, 363, 29871, 29896, 29896, 3841, 29889, 13772, 273, 324, 938, 1296, 471, 10478, 14218, 322, 13384, 408, 867, 2232, 310, 11314, 273, 324, 11233, 287, 29914, 9415, 3573, 7688, 363, 278, 4866, 29871, 29896, 29896, 29899, 3250, 3785, 29889, 4721, 2576, 3821, 11898, 363, 445, 2318, 310, 15006, 505, 1063, 8967, 869, 8168, 6478, 29899, 17823, 6199, 1156, 278, 1833, 405, 2477, 29892, 3339, 29909, 29892, 470, 405, 2477, 718, 3339, 29909, 17517, 322, 4497, 457, 11761, 29892, 278, 15006, 892, 385, 342, 9188, 1891, 411, 521, 5095, 284, 27246, 10492, 304, 4017, 7251, 407, 542, 1160, 284, 11916, 363, 4323, 2450, 310, 286, 29934, 3521, 11174, 310, 405, 9600, 29906, 29899, 29909, 1525, 1072, 7964, 2531, 267, 29889, 13, 10310, 29915, 29873, 4750, 29901, 1128, 1763, 751, 277, 1085, 26323, 1648, 3462, 2463, 13 ]
1,333,547
2,048
CommonCrawl
14
10
Nac For Parkinsons Disease Parkinsons Disease is also caused by deterioration of neurons in the brain and nervous system. It has been found that most patients with Parkinsons have oxidative damage. In animal models, treatment with NAC has led to improvements in: increased levels of glutathione in the brain, reduction of oxidative damage, and increased brain mitochondrial activities. Nac And Glutathione Production NAC is one of a handful of dietary supplements that is also used quite frequently in hospital settings. When a patient comes to the hospital with an acetaminophen overdose, standard of care is to use intravenous NAC to protect the liver and help the body excrete accumulated toxins. 1 This is one of NACs primary benefits the ability to replenish levels of glutathione in the liver after depletion. When we take acetaminophen, a metabolite called NAPQI is produced, which in high enough doses is very toxic to the liver.1 Under normal circumstances, one of the bodys most important endogenous antioxidants, glutathione, cleans up the overdose before any lasting harm can be done. However, when mega doses of acetaminophen are taken, hepatic glutathione stores run out and the body doesnt have enough to detoxify the bad stuff the acetaminophen is producing. The result can be liver damage and, if enough is taken, death. NAC is a glutathione precursor and proven nutrient for restoring depleted glutathione levels. A double blind, placebo control study showed a 28% reduction in mortality when IV NAC was administered after an acetaminophen overdose. 2 You May Like: How To Stop An Addictive Personality Nac For Ocd Bipolar And Depression There have been studies showing benefits of using NAC in moderate to severe OCD. In one randomized, double-blind, placebo-controlled trial NAC was used in addition to fluvoxamine, a common SSRI, in one treatment group. The other group received fluvoxamine and placebo. The group receiving NAC in addition to their medication experienced more improvement in symptoms compared to the placebo group. NAC has also been found to decrease symptoms of depression and bipolar disorder. In one analysis, it was found that NAC reduced depressive symptoms and resulted in an overall increase in functionality. While NAC does show promise in supporting mental health, you should not use NAC to replace your medication or make changes to your regimen without talking to your doctor. Proven Supplements To Help You Break The Addiction Cycle Learn about the supplements and strategies that help over 80% of people transcend alcohol A focus on the physical changes in the brain that keep the cycle of addiction going and how to biohack thatthese are the pieces never addressed at AA! Greta We do not sell or share your information with anyone. You May Like: How To Get An Addict To Get Help Helps Relieve Symptoms Of Respiratory Conditions NAC can relieve symptoms of respiratory conditions by acting as an antioxidant and expectorant, loosening mucus in your air passageways. As an antioxidant, NAC helps replenish glutathione levels in your lungs and reduces inflammation in your bronchial tubes and lung tissue. People with chronic obstructive pulmonary disease experience long-term oxidative damage and inflammation of lung tissue, which causes airways to constrict, leading to shortness of breath and coughing. NAC supplements have been used to improve COPD symptoms, exacerbations, and lung decline ( People with chronic bronchitis can also benefit from NAC. Bronchitis occurs when the mucous membranes in your lungs bronchial passageways become inflamed, swell, and shut off airways to your lungs . In addition to relieving COPD and bronchitis, NAC may improve other lung and respiratory tract conditions such as cystic fibrosis, asthma, and pulmonary fibrosis as well as symptoms of nasal and sinus congestion due to allergies or
-0.210243
0.637175
1.094763
0.247515
[ -0.24953526433178816, -0.17095013659298428 ]
[ 0.9183036483629989, 0.3560462738317473 ]
[ 1.2165025052778067, 0.9730233668409168 ]
[ 0.5245614137381425, -0.029530453399721816 ]
1,024
[ 512, 512 ]
[ 29940, 562, 1152, 4815, 1144, 787, 360, 895, 559, 13, 29925, 935, 1144, 787, 360, 895, 559, 338, 884, 8581, 491, 270, 1308, 1611, 362, 310, 26808, 787, 297, 278, 17294, 322, 23547, 681, 1788, 29889, 739, 756, 1063, 1476, 393, 1556, 22069, 411, 4815, 1144, 787, 505, 19100, 333, 1230, 18658, 29889, 512, 13019, 4733, 29892, 14502, 411, 405, 2477, 756, 5331, 304, 28473, 297, 29901, 11664, 11174, 310, 3144, 329, 493, 1421, 297, 278, 17294, 29892, 20376, 310, 19100, 333, 1230, 18658, 29892, 322, 11664, 17294, 1380, 2878, 898, 9315, 14188, 29889, 13, 29940, 562, 1126, 8467, 329, 493, 1421, 19561, 13, 29940, 2477, 338, 697, 310, 263, 1361, 1319, 310, 652, 300, 653, 1462, 944, 29879, 393, 338, 884, 1304, 3755, 13672, 297, 13457, 6055, 29889, 13, 10401, 263, 16500, 5304, 304, 278, 13457, 411, 385, 1274, 300, 9103, 3021, 264, 975, 29881, 852, 29892, 3918, 310, 2562, 338, 304, 671, 938, 336, 854, 681, 405, 2477, 304, 12566, 278, 619, 369, 322, 1371, 278, 3573, 429, 9084, 18414, 7964, 304, 29916, 1144, 29889, 29871, 29896, 910, 338, 697, 310, 405, 2477, 29879, 7601, 23633, 278, 11509, 304, 337, 572, 264, 728, 11174, 310, 3144, 329, 493, 1421, 297, 278, 619, 369, 1156, 316, 552, 12757, 29889, 13, 10401, 591, 2125, 1274, 300, 9103, 3021, 264, 29892, 263, 1539, 19388, 568, 2000, 405, 3301, 29984, 29902, 338, 7371, 29892, 607, 297, 1880, 3307, 3248, 267, 338, 1407, 304, 27375, 304, 278, 619, 369, 29889, 29896, 7634, 4226, 14209, 29892, 697, 310, 278, 13004, 952, 1556, 4100, 1095, 6352, 681, 3677, 601, 29916, 333, 1934, 29892, 3144, 329, 493, 1421, 29892, 4531, 550, 701, 278, 975, 29881, 852, 1434, 738, 1833, 292, 10311, 508, 367, 2309, 29889, 2398, 29892, 746, 286, 2442, 3248, 267, 310, 1274, 300, 9103, 3021, 264, 526, 4586, 29892, 540, 29886, 2454, 3144, 329, 493, 1421, 14422, 1065, 714, 322, 278, 3573, 19403, 505, 3307, 304, 1439, 2251, 1598, 278, 4319, 6433, 278, 1274, 300, 9103, 3021, 264, 338, 20811, 29889, 13, 1576, 1121, 508, 367, 619, 369, 18658, 322, 29892, 565, 3307, 338, 4586, 29892, 4892, 29889, 13, 29940, 2477, 338, 263, 3144, 329, 493, 1421, 8303, 5966, 322, 16413, 18254, 374, 296, 363, 1791, 8253, 316, 552, 9446, 3144, 329, 493, 1421, 11174, 29889, 319, 3765, 16842, 29892, 2058, 833, 2761, 6559, 10018, 263, 29871, 29906, 29947, 29995, 20376, 297, 5758, 2877, 746, 6599, 405, 2477, 471, 4113, 1531, 287, 1156, 385, 1274, 300, 9103, 3021, 264, 975, 29881, 852, 29889, 29871, 29906, 13, 3492, 2610, 8502, 29901, 1128, 1763, 22303, 530, 3462, 919, 573, 5196, 2877, 13, 29940, 562, 1152, 438, 2252, 350, 666, 10170, 1126, 897, 2590, 13, 8439, 505, 1063, 11898, 6445, 23633, 310, 773, 405, 2477, 297, 17768, 403, 304, 22261, 438, 6530, 29889, 512, 697, 4036, 1891, 29892, 3765, 29899, 2204, 513, 29892, 2058, 833, 29899, 6451, 839, 14260, 405, 2477, 471, 1304, 297, 6124, 304, 20501, 1365, 29916, 314, 457, 29892, 263, 3619, 5886, 3960, 29892, 297, 697, 14502, 2318, 29889, 450, 916, 2318, 4520, 20501, 1365, 29916, 314, 457, 322, 2058, 833, 29889, 450, 2318, 13442, 405, 2477, 297, 6124, 304, 1009, 13589, 362, 18860, 901, 20414, 297, 25828, 4835, 9401, 304, 278, 2058, 833, 2318, 29889, 13, 29940, 2477, 756, 884, 1063, 1476, 304, 23806, 25828, 4835, 310, 316, 2590, 322, 289, 666, 10170, 766, 2098, 29889, 512, 697, 7418, 29892, 372, 471, 1476, 393, 405, 2477, 12212, 316, 2139, 573, 25828, 4835, 322, 20601, 297, 385, 12463, 7910, 297, 9863, 29889, 13, 8809, 488, 405, 2477, 947, 1510, 11640, 297, 20382, 19119, 9045, 29892, 366, 881, 451, 671, 405, 2477, 304, 5191, 596, 13589, 362, 470, 1207, 3620, 304, 596, 1072, 19933, 1728, 9963, 304, 596, 11619, 29889, 13, 1184, 854, 9179, 944, 29879, 1763, 22305, 887, 28301, 450, 3462, 2463, 8045, 2841, 13, 29931, 799, 29876, 1048, 278, 1462, 944, 29879, 322, 16650, 583, 393, 1371, 975, 29871, 29947, 29900, 29995, 310, 2305, 1301, 29883, 355, 27231, 5391, 13, 29909, 8569, 373, 278, 9128, 3620, 297, 278, 17294, 393, 3013, 278, 11412, 310, 788, 2463, 2675, 322, 920, 304, 17799, 29882, 547, 393, 386, 968, 526, 278, 12785, 2360, 20976, 472, 22704, 29991, 4122, 941, 13, 4806, 437, 451, 19417, 470, 6232, 596, 2472, 411, 5019, 29889, 13, 3492, 2610, 8502, 29901, 1128, 1763, 3617, 530, 3462, 919, 1763, 3617, 22305, 13, 7658, 567, 6376, 2418, 10667, 415, 4835, 4587, 2538, 29886, 381, 7606, 11790, 2187, 13, 29940, 2477, 508, 1104, 2418, 25828, 4835, 310, 4613, 381, 7606, 5855, 491, 16684, 408, 385, 3677, 601, 29916, 333, 424, 322, 2149, 272, 424, 29892, 658, 7749, 292, 286, 1682, 375, 297, 596, 4799, 13382, 1994, 29889, 13, 2887, 385, 3677, 601, 29916, 333, 424, 29892, 405, 2477, 6911, 337, 572, 264, 728, 3144, 329, 493, 1421, 11174, 297, 596, 301, 3085, 322, 26830, 4414, 4850, 362, 297, 596, 12246, 305, 616, 23131, 267, 322, 13030, 260, 15118, 29889, 13, 15666, 1991, 411, 17168, 293, 704, 4984, 573, 9505, 3712, 653, 17135, 7271, 1472, 29899, 8489, 19100, 333, 1230, 18658, 322, 4414, 4850, 362, 310, 13030, 260, 15118, 29892, 607, 9946, 4799, 1994, 304, 378, 710, 919, 29892, 8236, 304, 3273, 2264, 310, 16172, 322, 274, 820, 292, 29889, 13, 29940, 2477, 1462, 944, 29879, 505, 1063, 1304, 304, 11157, 315, 4590, 29928, 25828, 4835, 29892, 429, 562, 23936, 800, 29892, 322, 13030, 4845, 457, 313, 13, 15666, 1991, 411, 17168, 293, 12246, 305, 23448, 508, 884, 14169, 515, 405, 2477, 29889, 13, 29933, 1617, 305, 23448, 10008, 746, 278, 286, 1682, 681, 3813, 661, 267, 297, 596, 301, 3085, 12246, 305, 616, 13382, 1994, 4953, 4414, 2795, 29892, 2381, 514, 29892, 322, 12522, 1283, 4799, 1994, 304, 596, 301, 3085, 869, 13, 797, 6124, 304, 1104, 15387, 315, 4590, 29928, 322, 12246, 305, 23448, 29892, 405, 2477, 1122, 11157, 916, 13030, 322, 4613, 381, 7606, 22330, 5855, 1316, 408, 274, 858, 293, 18755, 1883, 275, 29892, 8717, 29882, 655, 29892, 322, 9505, 3712, 653, 18755, 1883, 275, 408, 1532, 408, 25828, 4835, 310, 8281, 284, 322, 4457, 375, 378, 29887, 602, 2861, 304, 599, 15064, 583, 470 ]
1,333,547
3,072
CommonCrawl
14
10
/** * The following features are still outstanding: animation as a * function, placement as a function, inside, support for more triggers than * just mouse enter/leave, html tooltips, and selector delegation. */ msos.provide("ng.bootstrap.ui.tooltip"); ng.bootstrap.ui.tooltip.version = new msos.set_version(15, 7, 7); // Below is the standard ui.bootstrap.accordion plugin, except for templateUrl location and naming (MSOS style) // ui.bootstrap.tooltip -> ng.bootstrap.ui.tooltip // template/tooltip/tooltip-popup.html -> msos.resource_url('ng', 'bootstrap/ui/tmpl/tooltip-popup.html'), // template/tooltip/tooltip-template-popup.html -> msos.resource_url('ng', 'bootstrap/ui/tmpl/tooltip-template-popup.html') // template/tooltip/tooltip-html-popup.html -> msos.resource_url('ng', 'bootstrap/ui/tmpl/tooltip-html-popup.html') angular.module('ng.bootstrap.ui.tooltip', ['ng.bootstrap.ui.position', 'ng.bootstrap.ui.bindHtml']) /** * The $tooltip service creates tooltip- and popover-like directives as well as * houses global options for them. */ .provider('$tooltip', function() { // The default options tooltip and popover. var defaultOptions = { placement: 'top', animation: true, popupDelay: 0, useContentExp: false }; // Default hide triggers for each show trigger var triggerMap = { 'mouseenter': 'mouseleave', 'click': 'click', 'focus': 'blur' }; // The options specified to the provider globally. var globalOptions = {}; /** * `options({})` allows global configuration of all tooltips in the * application. * * var app = angular.module( 'App', ['ui.bootstrap.tooltip'], function( $tooltipProvider ) { * // place tooltips left instead of top by default * $tooltipProvider.options( { placement: 'left' } ); * }); */ this.options = function(value) { angular.extend(globalOptions, value); }; /** * This allows you to extend the set of trigger mappings available. E.g.: * * $tooltipProvider.setTriggers( 'openTrigger': 'closeTrigger' ); */ this.setTriggers = function setTriggers(triggers) { angular.extend(triggerMap, triggers); }; /** * This is a helper function for translating camel-case to snake-case. */ function snake_case(name) { var regexp = /[A-Z]/g; var separator = '-'; return name.replace(regexp, function(letter, pos) { return (pos ? separator : '') + letter.toLowerCase(); }); } /** * Returns the actual instance of the $tooltip service. * TODO support multiple triggers */ this.$get = ['$window', '$compile', '$timeout', '$document', '$position', '$interpolate', function($window, $compile, $timeout, $document, $position, $interpolate) { return function $tooltip(type, prefix, defaultTriggerShow, options) { options = angular.extend({}, defaultOptions, globalOptions, options); /** * Returns an object of show and hide triggers. * * If a trigger is supplied, * it is used to show the tooltip; otherwise, it will use the `trigger` * option passed to the `$tooltipProvider.options` method; else it will * default to the trigger supplied to this directive factory. * * The hide trigger is based on the show trigger. If the `trigger` option * was passed to the `$tooltipProvider.options` method, it will
-0.772066
-1.173151
-0.417946
0.105741
[ -0.6159234415889565, -0.928209439400674 ]
[ -0.7863747610438532, -1.5599263081696517 ]
[ -0.22408239714045816, -0.6118102438960783 ]
[ 0.20199150047478487, 0.009490100624071445 ]
1,024
[ 512, 512 ]
[ 7762, 13, 334, 450, 1494, 5680, 526, 1603, 714, 11235, 29901, 9612, 408, 263, 13, 334, 740, 29892, 2174, 13561, 408, 263, 740, 29892, 2768, 29892, 2304, 363, 901, 23660, 1135, 13, 334, 925, 9495, 3896, 29914, 280, 1351, 29892, 3472, 5780, 2034, 567, 29892, 322, 11764, 16000, 362, 29889, 13, 3776, 13, 1516, 359, 29889, 16123, 680, 703, 865, 29889, 8704, 29889, 1481, 29889, 10154, 12632, 1496, 13, 13, 865, 29889, 8704, 29889, 1481, 29889, 10154, 12632, 29889, 3259, 353, 716, 10887, 359, 29889, 842, 29918, 3259, 29898, 29896, 29945, 29892, 29871, 29955, 29892, 29871, 29955, 416, 13, 13, 13, 458, 13866, 338, 278, 3918, 14313, 29889, 8704, 29889, 5753, 536, 291, 7079, 29892, 5174, 363, 4472, 5983, 4423, 322, 22006, 313, 4345, 3267, 3114, 29897, 13, 458, 14313, 29889, 8704, 29889, 10154, 12632, 1599, 8736, 29889, 8704, 29889, 1481, 29889, 10154, 12632, 13, 458, 4472, 29914, 10154, 12632, 29914, 10154, 12632, 29899, 7323, 786, 29889, 1420, 12, 12, 12, 12, 976, 10887, 359, 29889, 10314, 29918, 2271, 877, 865, 742, 525, 8704, 29914, 1481, 29914, 18276, 572, 29914, 10154, 12632, 29899, 7323, 786, 29889, 1420, 5477, 13, 458, 4472, 29914, 10154, 12632, 29914, 10154, 12632, 29899, 6886, 29899, 7323, 786, 29889, 1420, 268, 1599, 10887, 359, 29889, 10314, 29918, 2271, 877, 865, 742, 525, 8704, 29914, 1481, 29914, 18276, 572, 29914, 10154, 12632, 29899, 6886, 29899, 7323, 786, 29889, 1420, 1495, 13, 458, 4472, 29914, 10154, 12632, 29914, 10154, 12632, 29899, 1420, 29899, 7323, 786, 29889, 1420, 308, 1599, 10887, 359, 29889, 10314, 29918, 2271, 877, 865, 742, 525, 8704, 29914, 1481, 29914, 18276, 572, 29914, 10154, 12632, 29899, 1420, 29899, 7323, 786, 29889, 1420, 1495, 13, 6825, 29889, 5453, 877, 865, 29889, 8704, 29889, 1481, 29889, 10154, 12632, 742, 6024, 865, 29889, 8704, 29889, 1481, 29889, 3283, 742, 525, 865, 29889, 8704, 29889, 1481, 29889, 5355, 10922, 11287, 13, 13, 7918, 13, 334, 450, 395, 10154, 12632, 2669, 10017, 5780, 12632, 29899, 322, 1835, 957, 29899, 4561, 1513, 3145, 408, 1532, 408, 13, 334, 12955, 5534, 3987, 363, 963, 29889, 13, 3776, 13, 29889, 18121, 877, 29938, 10154, 12632, 742, 740, 580, 426, 13, 1678, 849, 450, 2322, 3987, 5780, 12632, 322, 1835, 957, 29889, 13, 1678, 722, 2322, 5856, 353, 426, 13, 4706, 2174, 13561, 29901, 525, 3332, 742, 13, 4706, 9612, 29901, 1565, 29892, 13, 4706, 18218, 24996, 29901, 29871, 29900, 29892, 13, 4706, 671, 3916, 9544, 29901, 2089, 13, 1678, 3980, 13, 13, 1678, 849, 13109, 9563, 23660, 363, 1269, 1510, 7135, 13, 1678, 722, 7135, 3388, 353, 426, 13, 4706, 525, 15769, 5893, 2396, 525, 15769, 280, 1351, 742, 13, 4706, 525, 3808, 2396, 525, 3808, 742, 13, 4706, 525, 18037, 2396, 525, 2204, 332, 29915, 13, 1678, 3980, 13, 13, 1678, 849, 450, 3987, 6790, 304, 278, 13113, 13149, 635, 29889, 13, 1678, 722, 5534, 5856, 353, 15739, 13, 13, 1678, 7762, 13, 268, 334, 421, 6768, 3319, 1800, 29952, 6511, 5534, 5285, 310, 599, 5780, 2034, 567, 297, 278, 13, 268, 334, 2280, 29889, 13, 268, 334, 13, 268, 334, 259, 722, 623, 353, 6401, 29889, 5453, 29898, 525, 2052, 742, 6024, 1481, 29889, 8704, 29889, 10154, 12632, 7464, 740, 29898, 395, 10154, 12632, 6980, 1723, 426, 13, 268, 334, 268, 849, 2058, 5780, 2034, 567, 2175, 2012, 310, 2246, 491, 2322, 13, 268, 334, 268, 395, 10154, 12632, 6980, 29889, 6768, 29898, 426, 2174, 13561, 29901, 525, 1563, 29915, 500, 3482, 13, 268, 334, 259, 2604, 13, 268, 3776, 13, 1678, 445, 29889, 6768, 353, 740, 29898, 1767, 29897, 426, 13, 4706, 6401, 29889, 21843, 29898, 10945, 5856, 29892, 995, 416, 13, 1678, 3980, 13, 13, 1678, 7762, 13, 268, 334, 910, 6511, 366, 304, 10985, 278, 731, 310, 7135, 611, 27775, 3625, 29889, 382, 29889, 29887, 4898, 13, 268, 334, 13, 268, 334, 259, 395, 10154, 12632, 6980, 29889, 842, 2308, 335, 5743, 29898, 525, 3150, 20211, 2396, 525, 5358, 20211, 29915, 3482, 13, 268, 3776, 13, 1678, 445, 29889, 842, 2308, 335, 5743, 353, 740, 731, 2308, 335, 5743, 29898, 509, 335, 5743, 29897, 426, 13, 4706, 6401, 29889, 21843, 29898, 21001, 3388, 29892, 23660, 416, 13, 1678, 3980, 13, 13, 1678, 7762, 13, 268, 334, 910, 338, 263, 16876, 740, 363, 5578, 1218, 3949, 295, 29899, 4878, 304, 269, 21040, 29899, 4878, 29889, 13, 268, 3776, 13, 1678, 740, 269, 21040, 29918, 4878, 29898, 978, 29897, 426, 13, 4706, 722, 6528, 29886, 353, 847, 29961, 29909, 29899, 29999, 16261, 29887, 29936, 13, 4706, 722, 28128, 353, 17411, 2670, 13, 4706, 736, 1024, 29889, 6506, 29898, 13087, 29886, 29892, 740, 29898, 15670, 29892, 926, 29897, 426, 13, 9651, 736, 313, 1066, 1577, 28128, 584, 27255, 718, 5497, 29889, 517, 19357, 8259, 890, 13, 4706, 2604, 13, 1678, 500, 13, 13, 1678, 7762, 13, 268, 334, 16969, 278, 3935, 2777, 310, 278, 395, 10154, 12632, 2669, 29889, 13, 268, 334, 14402, 2304, 2999, 23660, 13, 268, 3776, 13, 1678, 445, 7449, 657, 353, 6024, 29938, 7165, 742, 14180, 12198, 742, 14180, 15619, 742, 14180, 3225, 742, 14180, 3283, 742, 14180, 1639, 3733, 403, 742, 740, 1566, 7165, 29892, 395, 12198, 29892, 395, 15619, 29892, 395, 3225, 29892, 395, 3283, 29892, 395, 1639, 3733, 403, 29897, 426, 13, 4706, 736, 740, 395, 10154, 12632, 29898, 1853, 29892, 10944, 29892, 2322, 20211, 8964, 29892, 3987, 29897, 426, 13, 9651, 3987, 353, 6401, 29889, 21843, 3319, 1118, 2322, 5856, 29892, 5534, 5856, 29892, 3987, 416, 13, 13, 9651, 7762, 13, 632, 334, 16969, 385, 1203, 310, 1510, 322, 9563, 23660, 29889, 13, 632, 334, 13, 632, 334, 960, 263, 7135, 338, 19056, 29892, 13, 632, 334, 372, 338, 1304, 304, 1510, 278, 5780, 12632, 29936, 6467, 29892, 372, 674, 671, 278, 421, 21001, 29952, 13, 632, 334, 2984, 4502, 304, 278, 5024, 10154, 12632, 6980, 29889, 6768, 29952, 1158, 29936, 1683, 372, 674, 13, 632, 334, 2322, 304, 278, 7135, 19056, 304, 445, 17041, 12529, 29889, 13, 632, 334, 13, 632, 334, 450, 9563, 7135, 338, 2729, 373, 278, 1510, 7135, 29889, 960, 278, 421, 21001, 29952, 2984, 13, 632, 334, 471, 4502, 304, 278, 5024, 10154, 12632, 6980, 29889, 6768, 29952, 1158, 29892, 372, 674 ]
1,333,552
0
Github
-1
-1
use the * mapped trigger from `triggerMap` or the passed trigger if the map is * undefined; otherwise, it uses the `triggerMap` value of the show * trigger; else it will just use the show trigger. */ function getTriggers(trigger) { var show = trigger || options.trigger || defaultTriggerShow; var hide = triggerMap[show] || show; return { show: show, hide: hide }; } var directiveName = snake_case(type); var startSym = $interpolate.startSymbol(); var endSym = $interpolate.endSymbol(); var template = '<div ' + directiveName + '-popup ' + 'title="' + startSym + 'title' + endSym + '" ' + (options.useContentExp ? 'content-exp="contentExp()" ' : 'content="' + startSym + 'content' + endSym + '" ') + 'placement="' + startSym + 'placement' + endSym + '" ' + 'popup-class="' + startSym + 'popupClass' + endSym + '" ' + 'animation="animation" ' + 'is-open="isOpen"' + 'origin-scope="origScope" ' + '>' + '</div>'; return { restrict: 'EA', compile: function(tElem, tAttrs) { var tooltipLinker = $compile(template); return function link(scope, element, attrs, tooltipCtrl) { var tooltip; var tooltipLinkedScope; var transitionTimeout; var popupTimeout; var appendToBody = angular.isDefined(options.appendToBody) ? options.appendToBody : false; var triggers = getTriggers(undefined); var hasEnableExp = angular.isDefined(attrs[prefix + 'Enable']); var ttScope = scope.$new(true); var positionTooltip = function() { if (!tooltip) { return; } var ttPosition = $position.positionElements(element, tooltip, ttScope.placement, appendToBody); ttPosition.top += 'px'; ttPosition.left += 'px'; // Now set the calculated positioning. tooltip.css(ttPosition); }; // Set up the correct scope to allow transclusion later ttScope.origScope = scope; // By default, the tooltip is not open. // TODO add ability to start tooltip opened ttScope.isOpen = false; function toggleTooltipBind() { if (!ttScope.isOpen) { showTooltipBind(); } else { hideTooltipBind(); } } // Show the tooltip with delay if specified, otherwise show it immediately function showTooltipBind() { if (hasEnableExp && !scope.$eval(attrs[prefix + 'Enable'])) { return; } prepareTooltip(); if (ttScope.popupDelay) { // Do nothing if the tooltip was already scheduled to pop-up. // This happens if show is triggered multiple times before any hide is triggered. if (!popupTimeout) { popupTimeout = $timeout(show, ttScope.popupDelay, false); popupTimeout.then(function(reposition) { reposition(); }); } } else { show()(); } } function hideTooltipBind() { scope.$apply(function() { hide(); }); } // Show the tooltip popup element. function show() { popupTimeout = null; // If there is a pending remove transition, we must cancel it, lest the // tool
-1.003542
-1.824939
-0.93106
-0.056845
[ -0.8432895628027509, -1.1637936131884608 ]
[ -1.6888515660239514, -1.9610271103830288 ]
[ -0.6818739022223187, -1.1802452637103276 ]
[ 0.0823284681351522, -0.19601815056790642 ]
1,024
[ 512, 512 ]
[ 671, 278, 13, 632, 334, 20545, 7135, 515, 421, 21001, 3388, 29952, 470, 278, 4502, 7135, 565, 278, 2910, 338, 13, 632, 334, 7580, 29936, 6467, 29892, 372, 3913, 278, 421, 21001, 3388, 29952, 995, 310, 278, 1510, 13, 632, 334, 7135, 29936, 1683, 372, 674, 925, 671, 278, 1510, 7135, 29889, 13, 632, 3776, 13, 9651, 740, 679, 2308, 335, 5743, 29898, 21001, 29897, 426, 13, 18884, 722, 1510, 353, 7135, 3830, 3987, 29889, 21001, 3830, 2322, 20211, 8964, 29936, 13, 18884, 722, 9563, 353, 7135, 3388, 29961, 4294, 29962, 3830, 1510, 29936, 13, 18884, 736, 426, 13, 462, 1678, 1510, 29901, 1510, 29892, 13, 462, 1678, 9563, 29901, 9563, 13, 18884, 3980, 13, 9651, 500, 13, 13, 9651, 722, 17041, 1170, 353, 269, 21040, 29918, 4878, 29898, 1853, 416, 13, 13, 9651, 722, 1369, 25548, 353, 395, 1639, 3733, 403, 29889, 2962, 14730, 890, 13, 9651, 722, 1095, 25548, 353, 395, 1639, 3733, 403, 29889, 355, 14730, 890, 13, 9651, 722, 4472, 353, 13, 18884, 12801, 4563, 525, 718, 17041, 1170, 718, 17411, 7323, 786, 525, 718, 13, 18884, 525, 3257, 543, 29915, 718, 1369, 25548, 718, 525, 3257, 29915, 718, 1095, 25548, 718, 18793, 525, 718, 13, 18884, 313, 6768, 29889, 1509, 3916, 9544, 1577, 13, 462, 1678, 525, 3051, 29899, 4548, 543, 3051, 9544, 25318, 525, 584, 13, 462, 1678, 525, 3051, 543, 29915, 718, 1369, 25548, 718, 525, 3051, 29915, 718, 1095, 25548, 718, 18793, 25710, 718, 13, 18884, 525, 29886, 9552, 543, 29915, 718, 1369, 25548, 718, 525, 29886, 9552, 29915, 718, 1095, 25548, 718, 18793, 525, 718, 13, 18884, 525, 7323, 786, 29899, 1990, 543, 29915, 718, 1369, 25548, 718, 525, 7323, 786, 2385, 29915, 718, 1095, 25548, 718, 18793, 525, 718, 13, 18884, 525, 18962, 543, 18962, 29908, 525, 718, 13, 18884, 525, 275, 29899, 3150, 543, 275, 6585, 29908, 29915, 718, 13, 18884, 525, 12574, 29899, 6078, 543, 12683, 15289, 29908, 525, 718, 13, 18884, 525, 16299, 718, 13, 18884, 525, 829, 4563, 23625, 13, 13, 9651, 736, 426, 13, 18884, 9250, 29901, 525, 29923, 29909, 742, 13, 18884, 6633, 29901, 740, 29898, 29873, 29923, 2409, 29892, 260, 25098, 29879, 29897, 426, 13, 462, 1678, 722, 5780, 12632, 6595, 261, 353, 395, 12198, 29898, 6886, 416, 13, 13, 462, 1678, 736, 740, 1544, 29898, 6078, 29892, 1543, 29892, 12421, 29879, 29892, 5780, 12632, 18069, 29897, 426, 13, 462, 4706, 722, 5780, 12632, 29936, 13, 462, 4706, 722, 5780, 12632, 6595, 287, 15289, 29936, 13, 462, 4706, 722, 9558, 10851, 29936, 13, 462, 4706, 722, 18218, 10851, 29936, 13, 462, 4706, 722, 9773, 1762, 8434, 353, 6401, 29889, 275, 3206, 1312, 29898, 6768, 29889, 4397, 1762, 8434, 29897, 1577, 3987, 29889, 4397, 1762, 8434, 584, 2089, 29936, 13, 462, 4706, 722, 23660, 353, 679, 2308, 335, 5743, 29898, 15955, 416, 13, 462, 4706, 722, 756, 20701, 9544, 353, 6401, 29889, 275, 3206, 1312, 29898, 5552, 29879, 29961, 13506, 718, 525, 20701, 17077, 13, 462, 4706, 722, 260, 29873, 15289, 353, 6874, 7449, 1482, 29898, 3009, 416, 13, 13, 462, 4706, 722, 2602, 12229, 12632, 353, 740, 580, 426, 13, 462, 9651, 565, 5384, 10154, 12632, 29897, 426, 13, 462, 18884, 736, 29936, 13, 462, 9651, 500, 13, 13, 462, 9651, 722, 260, 29873, 8003, 353, 395, 3283, 29889, 3283, 18868, 29898, 5029, 29892, 5780, 12632, 29892, 260, 29873, 15289, 29889, 29886, 9552, 29892, 9773, 1762, 8434, 416, 13, 462, 9651, 260, 29873, 8003, 29889, 3332, 4619, 525, 1756, 2670, 13, 462, 9651, 260, 29873, 8003, 29889, 1563, 4619, 525, 1756, 2670, 13, 13, 462, 9651, 849, 2567, 731, 278, 12833, 2602, 292, 29889, 13, 462, 9651, 5780, 12632, 29889, 4268, 29898, 698, 8003, 416, 13, 462, 4706, 3980, 13, 13, 462, 4706, 849, 3789, 701, 278, 1959, 6874, 304, 2758, 1301, 10085, 2678, 13, 462, 4706, 260, 29873, 15289, 29889, 12683, 15289, 353, 6874, 29936, 13, 13, 462, 4706, 849, 2648, 2322, 29892, 278, 5780, 12632, 338, 451, 1722, 29889, 13, 462, 4706, 849, 14402, 788, 11509, 304, 1369, 5780, 12632, 6496, 13, 462, 4706, 260, 29873, 15289, 29889, 275, 6585, 353, 2089, 29936, 13, 13, 462, 4706, 740, 20429, 12229, 12632, 15708, 580, 426, 13, 462, 9651, 565, 5384, 698, 15289, 29889, 275, 6585, 29897, 426, 13, 462, 18884, 1510, 12229, 12632, 15708, 890, 13, 462, 9651, 500, 1683, 426, 13, 462, 18884, 9563, 12229, 12632, 15708, 890, 13, 462, 9651, 500, 13, 462, 4706, 500, 13, 13, 462, 4706, 849, 7704, 278, 5780, 12632, 411, 9055, 565, 6790, 29892, 6467, 1510, 372, 7389, 13, 462, 4706, 740, 1510, 12229, 12632, 15708, 580, 426, 13, 462, 9651, 565, 313, 5349, 20701, 9544, 2607, 1738, 6078, 7449, 14513, 29898, 5552, 29879, 29961, 13506, 718, 525, 20701, 25901, 426, 13, 462, 18884, 736, 29936, 13, 462, 9651, 500, 13, 13, 462, 9651, 19012, 12229, 12632, 890, 13, 13, 462, 9651, 565, 313, 698, 15289, 29889, 7323, 786, 24996, 29897, 426, 13, 462, 18884, 849, 1938, 3078, 565, 278, 5780, 12632, 471, 2307, 21467, 304, 1835, 29899, 786, 29889, 13, 462, 18884, 849, 910, 5930, 565, 1510, 338, 19799, 2999, 3064, 1434, 738, 9563, 338, 19799, 29889, 13, 462, 18884, 565, 5384, 7323, 786, 10851, 29897, 426, 13, 462, 462, 1678, 18218, 10851, 353, 395, 15619, 29898, 4294, 29892, 260, 29873, 15289, 29889, 7323, 786, 24996, 29892, 2089, 416, 13, 462, 462, 1678, 18218, 10851, 29889, 6098, 29898, 2220, 29898, 276, 3283, 29897, 426, 13, 462, 462, 4706, 337, 3283, 890, 13, 462, 462, 1678, 2604, 13, 462, 18884, 500, 13, 462, 9651, 500, 1683, 426, 13, 462, 18884, 1510, 580, 890, 13, 462, 9651, 500, 13, 462, 4706, 500, 13, 13, 462, 4706, 740, 9563, 12229, 12632, 15708, 580, 426, 13, 462, 9651, 6874, 7449, 7302, 29898, 2220, 580, 426, 13, 462, 18884, 9563, 890, 13, 462, 9651, 2604, 13, 462, 4706, 500, 13, 13, 462, 4706, 849, 7704, 278, 5780, 12632, 18218, 1543, 29889, 13, 462, 4706, 740, 1510, 580, 426, 13, 13, 462, 9651, 18218, 10851, 353, 1870, 29936, 13, 13, 462, 9651, 849, 960, 727, 338, 263, 28235, 3349, 9558, 29892, 591, 1818, 12611, 372, 29892, 301, 342, 278, 13, 462, 9651, 849, 5780 ]
1,333,552
1,024
Github
-1
-1
tip be mysteriously removed. if (transitionTimeout) { $timeout.cancel(transitionTimeout); transitionTimeout = null; } // Don't show empty tooltips. if (!(options.useContentExp ? ttScope.contentExp() : ttScope.content)) { return angular.noop; } createTooltip(); // Set the initial positioning. tooltip.css({ top: 0, left: 0, display: 'block' }); ttScope.$digest(); positionTooltip(); // And show the tooltip. ttScope.isOpen = true; ttScope.$apply(); // digest required as $apply is not called // Return positioning function as promise callback for correct // positioning after draw. return positionTooltip; } // Hide the tooltip popup element. function hide() { // First things first: we don't show it anymore. ttScope.isOpen = false; //if tooltip is going to be shown after delay, we must cancel this $timeout.cancel(popupTimeout); popupTimeout = null; // And now we remove it from the DOM. However, if we have animation, we // need to wait for it to expire beforehand. // FIXME: this is a placeholder for a port of the transitions library. if (ttScope.animation) { if (!transitionTimeout) { transitionTimeout = $timeout(removeTooltip, 500); } } else { removeTooltip(); } } function createTooltip() { // There can only be one tooltip element per directive shown at once. if (tooltip) { removeTooltip(); } tooltipLinkedScope = ttScope.$new(); tooltip = tooltipLinker(tooltipLinkedScope, function(tooltip) { if (appendToBody) { $document.find('body').append(tooltip); } else { element.after(tooltip); } }); tooltipLinkedScope.$watch(function() { $timeout(positionTooltip, 0, false); }); if (options.useContentExp) { tooltipLinkedScope.$watch('contentExp()', function(val) { if (!val && ttScope.isOpen) { hide(); } }); } } function removeTooltip() { transitionTimeout = null; if (tooltip) { tooltip.remove(); tooltip = null; } if (tooltipLinkedScope) { tooltipLinkedScope.$destroy(); tooltipLinkedScope = null; } } function prepareTooltip() { prepPopupClass(); prepPlacement(); prepPopupDelay(); } ttScope.contentExp = function() { return scope.$eval(attrs[type]); }; /** * Observe the relevant attributes. */ if (!options.useContentExp) { attrs.$observe(type, function(val) { ttScope.content = val; if (!val && ttScope.isOpen) { hide(); } }); } attrs.$observe('disabled', function(val) { if (val && ttScope.isOpen) { hide(); } }); attrs.$observe(prefix + 'Title', function(val) { ttScope.title = val; });
-1.125443
-2.068465
-1.205608
-0.363156
[ -0.9775177548446294, -1.2733676475083617 ]
[ -2.0326522536354177, -2.1042773968878064 ]
[ -1.0103171150095815, -1.4008982329187591 ]
[ -0.40542845716226356, -0.32088392344404487 ]
1,024
[ 512, 512 ]
[ 12632, 367, 22277, 17365, 6206, 29889, 13, 462, 9651, 565, 313, 20543, 10851, 29897, 426, 13, 462, 18884, 395, 15619, 29889, 20713, 29898, 20543, 10851, 416, 13, 462, 18884, 9558, 10851, 353, 1870, 29936, 13, 462, 9651, 500, 13, 13, 462, 9651, 849, 3872, 29915, 29873, 1510, 4069, 5780, 2034, 567, 29889, 13, 462, 9651, 565, 5384, 29898, 6768, 29889, 1509, 3916, 9544, 1577, 260, 29873, 15289, 29889, 3051, 9544, 580, 584, 260, 29873, 15289, 29889, 3051, 876, 426, 13, 462, 18884, 736, 6401, 29889, 1217, 459, 29936, 13, 462, 9651, 500, 13, 13, 462, 9651, 1653, 12229, 12632, 890, 13, 13, 462, 9651, 849, 3789, 278, 2847, 2602, 292, 29889, 13, 462, 9651, 5780, 12632, 29889, 4268, 3319, 13, 462, 18884, 2246, 29901, 29871, 29900, 29892, 13, 462, 18884, 2175, 29901, 29871, 29900, 29892, 13, 462, 18884, 2479, 29901, 525, 1271, 29915, 13, 462, 9651, 2604, 13, 462, 9651, 260, 29873, 15289, 7449, 7501, 342, 890, 13, 13, 462, 9651, 2602, 12229, 12632, 890, 13, 13, 462, 9651, 849, 1126, 1510, 278, 5780, 12632, 29889, 13, 462, 9651, 260, 29873, 15289, 29889, 275, 6585, 353, 1565, 29936, 13, 462, 9651, 260, 29873, 15289, 7449, 7302, 890, 849, 4697, 342, 3734, 408, 395, 7302, 338, 451, 2000, 13, 13, 462, 9651, 849, 7106, 2602, 292, 740, 408, 11640, 6939, 363, 1959, 13, 462, 9651, 849, 2602, 292, 1156, 4216, 29889, 13, 462, 9651, 736, 2602, 12229, 12632, 29936, 13, 462, 4706, 500, 13, 13, 462, 4706, 849, 379, 680, 278, 5780, 12632, 18218, 1543, 29889, 13, 462, 4706, 740, 9563, 580, 426, 13, 462, 9651, 849, 3824, 2712, 937, 29901, 591, 1016, 29915, 29873, 1510, 372, 15128, 29889, 13, 462, 9651, 260, 29873, 15289, 29889, 275, 6585, 353, 2089, 29936, 13, 13, 462, 9651, 849, 361, 5780, 12632, 338, 2675, 304, 367, 4318, 1156, 9055, 29892, 591, 1818, 12611, 445, 13, 462, 9651, 395, 15619, 29889, 20713, 29898, 7323, 786, 10851, 416, 13, 462, 9651, 18218, 10851, 353, 1870, 29936, 13, 13, 462, 9651, 849, 1126, 1286, 591, 3349, 372, 515, 278, 12369, 29889, 2398, 29892, 565, 591, 505, 9612, 29892, 591, 13, 462, 9651, 849, 817, 304, 4480, 363, 372, 304, 1518, 533, 1434, 3179, 29889, 13, 462, 9651, 849, 383, 6415, 2303, 29901, 445, 338, 263, 12983, 363, 263, 2011, 310, 278, 1301, 2187, 3489, 29889, 13, 462, 9651, 565, 313, 698, 15289, 29889, 18962, 29897, 426, 13, 462, 18884, 565, 5384, 20543, 10851, 29897, 426, 13, 462, 462, 1678, 9558, 10851, 353, 395, 15619, 29898, 5992, 12229, 12632, 29892, 29871, 29945, 29900, 29900, 416, 13, 462, 18884, 500, 13, 462, 9651, 500, 1683, 426, 13, 462, 18884, 3349, 12229, 12632, 890, 13, 462, 9651, 500, 13, 462, 4706, 500, 13, 13, 462, 4706, 740, 1653, 12229, 12632, 580, 426, 13, 462, 9651, 849, 1670, 508, 871, 367, 697, 5780, 12632, 1543, 639, 17041, 4318, 472, 2748, 29889, 13, 462, 9651, 565, 313, 10154, 12632, 29897, 426, 13, 462, 18884, 3349, 12229, 12632, 890, 13, 462, 9651, 500, 13, 462, 9651, 5780, 12632, 6595, 287, 15289, 353, 260, 29873, 15289, 7449, 1482, 890, 13, 462, 9651, 5780, 12632, 353, 5780, 12632, 6595, 261, 29898, 10154, 12632, 6595, 287, 15289, 29892, 740, 29898, 10154, 12632, 29897, 426, 13, 462, 18884, 565, 313, 4397, 1762, 8434, 29897, 426, 13, 462, 462, 1678, 395, 3225, 29889, 2886, 877, 2587, 2824, 4397, 29898, 10154, 12632, 416, 13, 462, 18884, 500, 1683, 426, 13, 462, 462, 1678, 1543, 29889, 7045, 29898, 10154, 12632, 416, 13, 462, 18884, 500, 13, 462, 9651, 2604, 13, 13, 462, 9651, 5780, 12632, 6595, 287, 15289, 7449, 12344, 29898, 2220, 580, 426, 13, 462, 18884, 395, 15619, 29898, 3283, 12229, 12632, 29892, 29871, 29900, 29892, 2089, 416, 13, 462, 9651, 2604, 13, 13, 462, 9651, 565, 313, 6768, 29889, 1509, 3916, 9544, 29897, 426, 13, 462, 18884, 5780, 12632, 6595, 287, 15289, 7449, 12344, 877, 3051, 9544, 580, 742, 740, 29898, 791, 29897, 426, 13, 462, 462, 1678, 565, 5384, 791, 2607, 260, 29873, 15289, 29889, 275, 6585, 29897, 426, 13, 462, 462, 4706, 9563, 890, 13, 462, 462, 1678, 500, 13, 462, 18884, 2604, 13, 462, 9651, 500, 13, 462, 4706, 500, 13, 13, 462, 4706, 740, 3349, 12229, 12632, 580, 426, 13, 462, 9651, 9558, 10851, 353, 1870, 29936, 13, 462, 9651, 565, 313, 10154, 12632, 29897, 426, 13, 462, 18884, 5780, 12632, 29889, 5992, 890, 13, 462, 18884, 5780, 12632, 353, 1870, 29936, 13, 462, 9651, 500, 13, 462, 9651, 565, 313, 10154, 12632, 6595, 287, 15289, 29897, 426, 13, 462, 18884, 5780, 12632, 6595, 287, 15289, 7449, 20524, 890, 13, 462, 18884, 5780, 12632, 6595, 287, 15289, 353, 1870, 29936, 13, 462, 9651, 500, 13, 462, 4706, 500, 13, 13, 462, 4706, 740, 19012, 12229, 12632, 580, 426, 13, 462, 9651, 8273, 12310, 786, 2385, 890, 13, 462, 9651, 8273, 29925, 9552, 890, 13, 462, 9651, 8273, 12310, 786, 24996, 890, 13, 462, 4706, 500, 13, 13, 462, 4706, 260, 29873, 15289, 29889, 3051, 9544, 353, 740, 580, 426, 13, 462, 9651, 736, 6874, 7449, 14513, 29898, 5552, 29879, 29961, 1853, 5691, 13, 462, 4706, 3980, 13, 13, 462, 4706, 7762, 13, 462, 308, 334, 4250, 16349, 278, 8018, 8393, 29889, 13, 462, 308, 3776, 13, 462, 4706, 565, 5384, 6768, 29889, 1509, 3916, 9544, 29897, 426, 13, 462, 9651, 12421, 29879, 7449, 711, 16349, 29898, 1853, 29892, 740, 29898, 791, 29897, 426, 13, 462, 18884, 260, 29873, 15289, 29889, 3051, 353, 659, 29936, 13, 13, 462, 18884, 565, 5384, 791, 2607, 260, 29873, 15289, 29889, 275, 6585, 29897, 426, 13, 462, 462, 1678, 9563, 890, 13, 462, 18884, 500, 13, 462, 9651, 2604, 13, 462, 4706, 500, 13, 13, 462, 4706, 12421, 29879, 7449, 711, 16349, 877, 18279, 742, 740, 29898, 791, 29897, 426, 13, 462, 9651, 565, 313, 791, 2607, 260, 29873, 15289, 29889, 275, 6585, 29897, 426, 13, 462, 18884, 9563, 890, 13, 462, 9651, 500, 13, 462, 4706, 2604, 13, 13, 462, 4706, 12421, 29879, 7449, 711, 16349, 29898, 13506, 718, 525, 7030, 742, 740, 29898, 791, 29897, 426, 13, 462, 9651, 260, 29873, 15289, 29889, 3257, 353, 659, 29936, 13, 462, 4706, 2604 ]
1,333,552
2,048
Github
-1
-1
function prepPopupClass() { ttScope.popupClass = attrs[prefix + 'Class']; } function prepPlacement() { var val = attrs[prefix + 'Placement']; ttScope.placement = angular.isDefined(val) ? val : options.placement; } function prepPopupDelay() { var val = attrs[prefix + 'PopupDelay']; var delay = parseInt(val, 10); ttScope.popupDelay = !isNaN(delay) ? delay : options.popupDelay; } var unregisterTriggers = function() { element.unbind(triggers.show, showTooltipBind); element.unbind(triggers.hide, hideTooltipBind); }; function prepTriggers() { var val = attrs[prefix + 'Trigger']; unregisterTriggers(); triggers = getTriggers(val); if (triggers.show === triggers.hide) { element.bind(triggers.show, toggleTooltipBind); } else { element.bind(triggers.show, showTooltipBind); element.bind(triggers.hide, hideTooltipBind); } } prepTriggers(); var animation = scope.$eval(attrs[prefix + 'Animation']); ttScope.animation = angular.isDefined(animation) ? !!animation : options.animation; var appendToBodyVal = scope.$eval(attrs[prefix + 'AppendToBody']); appendToBody = angular.isDefined(appendToBodyVal) ? appendToBodyVal : appendToBody; // if a tooltip is attached to <body> we need to remove it on // location change as its parent scope will probably not be destroyed // by the change. if (appendToBody) { scope.$on('$locationChangeSuccess', function closeTooltipOnLocationChangeSuccess() { if (ttScope.isOpen) { hide(); } }); } // Make sure tooltip is destroyed and removed. scope.$on('$destroy', function onDestroyTooltip() { $timeout.cancel(transitionTimeout); $timeout.cancel(popupTimeout); unregisterTriggers(); removeTooltip(); ttScope = null; }); }; } }; }; }]; }) // This is mostly ngInclude code but with a custom scope .directive('tooltipTemplateTransclude', [ '$animate', '$sce', '$compile', '$templateRequest', function($animate, $sce, $compile, $templateRequest) { return { link: function(scope, elem, attrs) { var origScope = scope.$eval(attrs.tooltipTemplateTranscludeScope); var changeCounter = 0, currentScope, previousElement, currentElement; var cleanupLastIncludeContent = function() { if (previousElement) { previousElement.remove(); previousElement = null; } if (currentScope) { currentScope.$destroy(); currentScope = null; } if (currentElement) { $animate.leave(currentElement).then(function() { previousElement = null; }); previousElement = currentElement; currentElement = null; } }; scope.$watch($sce.parseAsResourceUrl(attrs.tooltipTemplateTransclude), function(src) { var thisChangeId = ++changeCounter; if (src) { //set the 2nd param to true to ignore the template request error so that the inner //contents and scope can be cleaned up. $templateRequest(src, true).then(function(response) {
-1.26515
-1.857171
-1.063578
-0.168704
[ -1.2898037526563468, -1.2404954372123913 ]
[ -1.9681896247082677, -1.7461516806258623 ]
[ -0.995099668857276, -1.1320566842280264 ]
[ -0.13358526412983718, -0.20382226137266507 ]
1,024
[ 512, 512 ]
[ 13, 13, 462, 4706, 740, 8273, 12310, 786, 2385, 580, 426, 13, 462, 9651, 260, 29873, 15289, 29889, 7323, 786, 2385, 353, 12421, 29879, 29961, 13506, 718, 525, 2385, 8219, 13, 462, 4706, 500, 13, 13, 462, 4706, 740, 8273, 29925, 9552, 580, 426, 13, 462, 9651, 722, 659, 353, 12421, 29879, 29961, 13506, 718, 525, 29925, 9552, 8219, 13, 462, 9651, 260, 29873, 15289, 29889, 29886, 9552, 353, 6401, 29889, 275, 3206, 1312, 29898, 791, 29897, 1577, 659, 584, 3987, 29889, 29886, 9552, 29936, 13, 462, 4706, 500, 13, 13, 462, 4706, 740, 8273, 12310, 786, 24996, 580, 426, 13, 462, 9651, 722, 659, 353, 12421, 29879, 29961, 13506, 718, 525, 12310, 786, 24996, 8219, 13, 462, 9651, 722, 9055, 353, 6088, 2928, 29898, 791, 29892, 29871, 29896, 29900, 416, 13, 462, 9651, 260, 29873, 15289, 29889, 7323, 786, 24996, 353, 1738, 275, 19377, 29898, 18829, 29897, 1577, 9055, 584, 3987, 29889, 7323, 786, 24996, 29936, 13, 462, 4706, 500, 13, 13, 462, 4706, 722, 443, 9573, 2308, 335, 5743, 353, 740, 580, 426, 13, 462, 9651, 1543, 29889, 348, 5355, 29898, 509, 335, 5743, 29889, 4294, 29892, 1510, 12229, 12632, 15708, 416, 13, 462, 9651, 1543, 29889, 348, 5355, 29898, 509, 335, 5743, 29889, 11458, 29892, 9563, 12229, 12632, 15708, 416, 13, 462, 4706, 3980, 13, 13, 462, 4706, 740, 8273, 2308, 335, 5743, 580, 426, 13, 462, 9651, 722, 659, 353, 12421, 29879, 29961, 13506, 718, 525, 20211, 8219, 13, 462, 9651, 443, 9573, 2308, 335, 5743, 890, 13, 13, 462, 9651, 23660, 353, 679, 2308, 335, 5743, 29898, 791, 416, 13, 13, 462, 9651, 565, 313, 509, 335, 5743, 29889, 4294, 6805, 23660, 29889, 11458, 29897, 426, 13, 462, 18884, 1543, 29889, 5355, 29898, 509, 335, 5743, 29889, 4294, 29892, 20429, 12229, 12632, 15708, 416, 13, 462, 9651, 500, 1683, 426, 13, 462, 18884, 1543, 29889, 5355, 29898, 509, 335, 5743, 29889, 4294, 29892, 1510, 12229, 12632, 15708, 416, 13, 462, 18884, 1543, 29889, 5355, 29898, 509, 335, 5743, 29889, 11458, 29892, 9563, 12229, 12632, 15708, 416, 13, 462, 9651, 500, 13, 462, 4706, 500, 13, 462, 4706, 8273, 2308, 335, 5743, 890, 13, 13, 462, 4706, 722, 9612, 353, 6874, 7449, 14513, 29898, 5552, 29879, 29961, 13506, 718, 525, 13579, 17077, 13, 462, 4706, 260, 29873, 15289, 29889, 18962, 353, 6401, 29889, 275, 3206, 1312, 29898, 18962, 29897, 1577, 21443, 18962, 584, 3987, 29889, 18962, 29936, 13, 13, 462, 4706, 722, 9773, 1762, 8434, 1440, 353, 6874, 7449, 14513, 29898, 5552, 29879, 29961, 13506, 718, 525, 18277, 1762, 8434, 17077, 13, 462, 4706, 9773, 1762, 8434, 353, 6401, 29889, 275, 3206, 1312, 29898, 4397, 1762, 8434, 1440, 29897, 1577, 9773, 1762, 8434, 1440, 584, 9773, 1762, 8434, 29936, 13, 13, 462, 4706, 849, 565, 263, 5780, 12632, 338, 10959, 304, 529, 2587, 29958, 591, 817, 304, 3349, 372, 373, 13, 462, 4706, 849, 4423, 1735, 408, 967, 3847, 6874, 674, 3117, 451, 367, 14416, 13, 462, 4706, 849, 491, 278, 1735, 29889, 13, 462, 4706, 565, 313, 4397, 1762, 8434, 29897, 426, 13, 462, 9651, 6874, 7449, 265, 877, 29938, 5479, 7277, 14191, 742, 740, 3802, 12229, 12632, 2951, 6508, 7277, 14191, 580, 426, 13, 462, 18884, 565, 313, 698, 15289, 29889, 275, 6585, 29897, 426, 13, 462, 462, 1678, 9563, 890, 13, 462, 18884, 500, 13, 462, 9651, 2604, 13, 462, 4706, 500, 13, 13, 462, 4706, 849, 8561, 1854, 5780, 12632, 338, 14416, 322, 6206, 29889, 13, 462, 4706, 6874, 7449, 265, 877, 29938, 20524, 742, 740, 373, 14994, 4727, 12229, 12632, 580, 426, 13, 462, 9651, 395, 15619, 29889, 20713, 29898, 20543, 10851, 416, 13, 462, 9651, 395, 15619, 29889, 20713, 29898, 7323, 786, 10851, 416, 13, 462, 9651, 443, 9573, 2308, 335, 5743, 890, 13, 462, 9651, 3349, 12229, 12632, 890, 13, 462, 9651, 260, 29873, 15289, 353, 1870, 29936, 13, 462, 4706, 2604, 13, 462, 1678, 3980, 13, 18884, 500, 13, 9651, 3980, 13, 4706, 3980, 13, 1678, 500, 1385, 13, 1800, 13, 13, 458, 910, 338, 11149, 8736, 29419, 775, 541, 411, 263, 2888, 6874, 13, 29889, 11851, 573, 877, 10154, 12632, 6733, 4300, 2325, 742, 518, 13, 1678, 14180, 20131, 742, 14180, 22774, 742, 14180, 12198, 742, 14180, 6886, 3089, 742, 13, 1678, 740, 1566, 20131, 29892, 395, 22774, 29892, 395, 12198, 29892, 395, 6886, 3089, 29897, 426, 13, 4706, 736, 426, 13, 9651, 1544, 29901, 740, 29898, 6078, 29892, 21268, 29892, 12421, 29879, 29897, 426, 13, 18884, 722, 1677, 15289, 353, 6874, 7449, 14513, 29898, 5552, 29879, 29889, 10154, 12632, 6733, 4300, 2325, 15289, 416, 13, 13, 18884, 722, 1735, 17779, 353, 29871, 29900, 29892, 13, 462, 1678, 1857, 15289, 29892, 13, 462, 1678, 3517, 2642, 29892, 13, 462, 1678, 1857, 2642, 29936, 13, 13, 18884, 722, 5941, 786, 8897, 29419, 3916, 353, 740, 580, 426, 13, 462, 1678, 565, 313, 24957, 2642, 29897, 426, 13, 462, 4706, 3517, 2642, 29889, 5992, 890, 13, 462, 4706, 3517, 2642, 353, 1870, 29936, 13, 462, 1678, 500, 13, 462, 1678, 565, 313, 3784, 15289, 29897, 426, 13, 462, 4706, 1857, 15289, 7449, 20524, 890, 13, 462, 4706, 1857, 15289, 353, 1870, 29936, 13, 462, 1678, 500, 13, 462, 1678, 565, 313, 3784, 2642, 29897, 426, 13, 462, 4706, 395, 20131, 29889, 280, 1351, 29898, 3784, 2642, 467, 6098, 29898, 2220, 580, 426, 13, 462, 9651, 3517, 2642, 353, 1870, 29936, 13, 462, 4706, 2604, 13, 462, 4706, 3517, 2642, 353, 1857, 2642, 29936, 13, 462, 4706, 1857, 2642, 353, 1870, 29936, 13, 462, 1678, 500, 13, 18884, 3980, 13, 13, 18884, 6874, 7449, 12344, 1566, 22774, 29889, 5510, 2887, 6848, 5983, 29898, 5552, 29879, 29889, 10154, 12632, 6733, 4300, 2325, 511, 740, 29898, 4351, 29897, 426, 13, 462, 1678, 722, 445, 7277, 1204, 353, 8445, 3167, 17779, 29936, 13, 13, 462, 1678, 565, 313, 4351, 29897, 426, 13, 462, 4706, 849, 842, 278, 29871, 29906, 299, 1828, 304, 1565, 304, 11455, 278, 4472, 2009, 1059, 577, 393, 278, 6426, 13, 462, 4706, 849, 10853, 322, 6874, 508, 367, 5941, 287, 701, 29889, 13, 462, 4706, 395, 6886, 3089, 29898, 4351, 29892, 1565, 467, 6098, 29898, 2220, 29898, 5327, 29897, 426, 13, 462, 9651 ]
1,333,552
3,072
Github
-1
-1
Carbon Dioxide Can Be Stored Underground For Ten Times The Length Needed To Avoid Climatic Impact By newspaperport on August 3, 2016 • ( Leave a comment ) Study of natural-occurring 100,000 year-old CO2 reservoirs shows no significant corroding of 'cap rock', suggesting the greenhouse gas hasn't leaked back out – one of the main concerns with greenhouse gas reduction proposal of carbon capture and storage. New research shows that natural accumulations of carbon dioxide (CO2) that have been trapped underground for around 100,000 years have not significantly corroded the rocks above, suggesting that storing CO2 in reservoirs deep underground is much safer and more predictable over long periods of time than previously thought. These findings, published in the journal Nature Communications, demonstrate the viability of a process called carbon capture and storage (CCS) as a solution to reducing carbon emissions from coal and gas-fired power stations, say researchers. CCS involves capturing the carbon dioxide produced at power stations, compressing it, and pumping it into reservoirs in the rock more than a kilometre underground. The CO2 must remain buried for at least 10,000 years to avoid the impacts on climate. One concern is that the dilute acid, formed when the stored CO2 dissolves in water present in the reservoir rocks, might corrode the rocks above and let the CO2 escape upwards. By studying a natural reservoir in Utah, USA, where CO2 released from deeper formations has been trapped for around 100,000 years, a Cambridge-led research team has now shown that CO2 can be securely stored underground for far longer than the 10,000 years needed to avoid climatic impacts. Their new study shows that the critical component in geological carbon storage, the relatively impermeable layer of "cap rock" that retains the CO2, can resist corrosion from CO2-saturated water for at least 100,000 years. "Carbon capture and storage is seen as essential technology if the UK is to meet its climate change targets," says principle investigator Professor Mike Bickle, Director of the Cambridge Centre for Carbon Capture and Storage at the University of Cambridge. "A major obstacle to the implementation of CCS is the uncertainty over the long-term fate of the CO2 which impacts regulation, insurance, and who assumes the responsibility for maintaining CO2 storage sites. Our study demonstrates that geological carbon storage can be safe and predictable over many hundreds of thousands of years." The key component in the safety of geological storage of CO2 is an impermeable cap rock over the porous reservoir in which the CO2 is stored. Although the CO2 will be injected as a dense fluid, it is still less dense than the brines originally filling the pores in the reservoir sandstones, and will rise until trapped by the relatively impermeable cap rocks. "Some earlier studies, using computer simulations and laboratory experiments, have suggested that these cap rocks might be progressively corroded by the CO2-charged brines, formed as CO2 dissolves, creating weaker and more permeable layers of rock several metres thick and jeopardising the secure retention of the CO2," explains lead author Dr Niko Kampman. "However, these studies were either carried out in the laboratory over short timescales or based on theoretical models. Predicting the behaviour of CO2 stored underground is best achieved by studying natural CO2 accumulations that have been retained for periods comparable to those needed for effective storage." To better understand these effects, this study, funded by the UK Natural Environment Research Council and the UK Department of Energy and Climate Change, examined a natural reservoir where large natural pockets of CO2 have been trapped in sedimentary rocks for hundreds of thousands of years. Sponsored by Shell, the team drilled deep down below the surface into one of these natural CO2 reservoirs to recover samples of the rock layers and the fluids confined in the rock pores. The team studied the corrosion of the minerals comprising the rock by the acidic carbonated water, and how this has affected the ability of the cap rock to act as an effective trap over geological periods of time. Their analysis studied the mineralogy and geochemistry of cap rock and included bombarding samples of the rock with
1.126304
2.236206
2.058535
1.325783
[ 0.8852408285936848, 1.3673665796012484 ]
[ 2.336481484760296, 2.1359310836536074 ]
[ 1.906360064182328, 2.2107089872284402 ]
[ 0.9095642134395694, 1.7420026992804922 ]
1,024
[ 512, 512 ]
[ 1704, 6718, 360, 601, 29916, 680, 1815, 1522, 624, 4395, 7634, 2057, 1152, 12444, 10277, 450, 365, 1477, 2448, 19226, 1763, 319, 5405, 2233, 326, 2454, 14305, 627, 13, 2059, 19656, 637, 373, 3111, 29871, 29941, 29892, 29871, 29906, 29900, 29896, 29953, 10266, 313, 951, 1351, 263, 3440, 1723, 13, 855, 566, 29891, 310, 5613, 29899, 15693, 1038, 292, 29871, 29896, 29900, 29900, 29892, 29900, 29900, 29900, 1629, 29899, 1025, 4810, 29906, 620, 261, 7869, 29879, 3697, 694, 7282, 1034, 5964, 292, 310, 525, 5030, 7679, 742, 26233, 278, 7933, 8697, 10489, 22602, 29915, 29873, 454, 12535, 1250, 714, 785, 697, 310, 278, 1667, 21838, 411, 7933, 8697, 10489, 20376, 24963, 310, 22004, 10446, 322, 8635, 29889, 13, 4373, 5925, 3697, 393, 5613, 18414, 8250, 310, 22004, 20562, 29916, 680, 313, 3217, 29906, 29897, 393, 505, 1063, 1020, 2986, 1090, 2057, 363, 2820, 29871, 29896, 29900, 29900, 29892, 29900, 29900, 29900, 2440, 505, 451, 16951, 1034, 5964, 287, 278, 23150, 2038, 29892, 26233, 393, 15446, 4810, 29906, 297, 620, 261, 7869, 29879, 6483, 1090, 2057, 338, 1568, 872, 571, 322, 901, 8500, 519, 975, 1472, 23704, 310, 931, 1135, 9251, 2714, 29889, 13, 1349, 968, 1284, 886, 29892, 6369, 297, 278, 8955, 17677, 22365, 800, 29892, 22222, 278, 3516, 3097, 310, 263, 1889, 2000, 22004, 10446, 322, 8635, 313, 4174, 29903, 29897, 408, 263, 1650, 304, 27668, 22004, 953, 6847, 515, 17148, 322, 10489, 29899, 29888, 2859, 3081, 16355, 29892, 1827, 5925, 414, 29889, 13, 4174, 29903, 20789, 4332, 3864, 278, 22004, 20562, 29916, 680, 7371, 472, 3081, 16355, 29892, 27122, 292, 372, 29892, 322, 282, 3427, 292, 372, 964, 620, 261, 7869, 29879, 297, 278, 7679, 901, 1135, 263, 19543, 276, 1090, 2057, 29889, 13, 1576, 4810, 29906, 1818, 3933, 18550, 363, 472, 3203, 29871, 29896, 29900, 29892, 29900, 29900, 29900, 2440, 304, 4772, 278, 10879, 29879, 373, 23622, 29889, 3118, 5932, 338, 393, 278, 21749, 1082, 22193, 29892, 8429, 746, 278, 6087, 4810, 29906, 23556, 1960, 297, 4094, 2198, 297, 278, 620, 261, 7869, 23150, 29892, 1795, 1034, 307, 311, 278, 23150, 2038, 322, 1235, 278, 4810, 29906, 10169, 701, 2935, 29889, 13, 2059, 23382, 263, 5613, 620, 261, 7869, 297, 14950, 801, 29892, 8278, 29892, 988, 4810, 29906, 5492, 515, 25871, 883, 800, 756, 1063, 1020, 2986, 363, 2820, 29871, 29896, 29900, 29900, 29892, 29900, 29900, 29900, 2440, 29892, 263, 12585, 29899, 839, 5925, 3815, 756, 1286, 4318, 393, 4810, 29906, 508, 367, 11592, 368, 6087, 1090, 2057, 363, 2215, 5520, 1135, 278, 29871, 29896, 29900, 29892, 29900, 29900, 29900, 2440, 4312, 304, 4772, 10784, 2454, 10879, 29879, 29889, 13, 1576, 381, 716, 6559, 3697, 393, 278, 12187, 4163, 297, 1737, 5996, 22004, 8635, 29892, 278, 13774, 10112, 1004, 519, 7546, 310, 376, 5030, 7679, 29908, 393, 11551, 29879, 278, 4810, 29906, 29892, 508, 9241, 1034, 1883, 291, 515, 4810, 29906, 29899, 29879, 1337, 630, 4094, 363, 472, 3203, 29871, 29896, 29900, 29900, 29892, 29900, 29900, 29900, 2440, 29889, 13, 29908, 8179, 6718, 10446, 322, 8635, 338, 3595, 408, 18853, 15483, 565, 278, 10261, 338, 304, 5870, 967, 23622, 1735, 22525, 1699, 4083, 12502, 7405, 1061, 11386, 12828, 350, 860, 280, 29892, 15944, 310, 278, 12585, 11319, 363, 1704, 6718, 8868, 545, 322, 26162, 472, 278, 3014, 310, 12585, 29889, 13, 29908, 29909, 4655, 14979, 6436, 304, 278, 5314, 310, 315, 9295, 338, 278, 25812, 975, 278, 1472, 29899, 8489, 23779, 310, 278, 4810, 29906, 607, 10879, 29879, 1072, 2785, 29892, 1663, 18541, 29892, 322, 1058, 15894, 278, 23134, 363, 7344, 292, 4810, 29906, 8635, 11840, 29889, 8680, 6559, 9004, 1078, 393, 1737, 5996, 22004, 8635, 508, 367, 9109, 322, 8500, 519, 975, 1784, 21006, 310, 17202, 310, 2440, 1213, 13, 1576, 1820, 4163, 297, 278, 15332, 310, 1737, 5996, 8635, 310, 4810, 29906, 338, 385, 10112, 1004, 519, 2117, 7679, 975, 278, 1277, 681, 620, 261, 7869, 297, 607, 278, 4810, 29906, 338, 6087, 29889, 8512, 278, 4810, 29906, 674, 367, 11658, 287, 408, 263, 20619, 22576, 29892, 372, 338, 1603, 3109, 20619, 1135, 278, 1506, 1475, 10437, 27523, 278, 1277, 267, 297, 278, 620, 261, 7869, 11982, 303, 2873, 29892, 322, 674, 14451, 2745, 1020, 2986, 491, 278, 13774, 10112, 1004, 519, 2117, 23150, 29889, 13, 29908, 9526, 8859, 11898, 29892, 773, 6601, 23876, 322, 10212, 7606, 15729, 29892, 505, 7829, 393, 1438, 2117, 23150, 1795, 367, 6728, 3598, 1034, 5964, 287, 491, 278, 4810, 29906, 29899, 25389, 287, 1506, 1475, 29892, 8429, 408, 4810, 29906, 23556, 1960, 29892, 4969, 591, 5790, 322, 901, 639, 1004, 519, 15359, 310, 7679, 3196, 17963, 12003, 322, 1444, 459, 538, 5921, 278, 11592, 3240, 2509, 310, 278, 4810, 29906, 1699, 18568, 3275, 4148, 4942, 405, 10349, 476, 1160, 1171, 29889, 13, 29908, 17245, 29892, 1438, 11898, 892, 2845, 8988, 714, 297, 278, 10212, 7606, 975, 3273, 3064, 1052, 267, 470, 2729, 373, 23399, 4733, 29889, 21099, 919, 292, 278, 10468, 310, 4810, 29906, 6087, 1090, 2057, 338, 1900, 14363, 491, 23382, 5613, 4810, 29906, 18414, 8250, 393, 505, 1063, 26060, 363, 23704, 5734, 519, 304, 1906, 4312, 363, 11828, 8635, 1213, 13, 1762, 2253, 2274, 1438, 9545, 29892, 445, 6559, 29892, 5220, 287, 491, 278, 10261, 18385, 16738, 10550, 8831, 322, 278, 10261, 10317, 310, 24836, 322, 2233, 6490, 10726, 29892, 4392, 1312, 263, 5613, 620, 261, 7869, 988, 2919, 5613, 772, 9737, 310, 4810, 29906, 505, 1063, 1020, 2986, 297, 7048, 2073, 653, 23150, 363, 21006, 310, 17202, 310, 2440, 29889, 1706, 787, 4395, 491, 1383, 514, 29892, 278, 3815, 270, 4115, 839, 6483, 1623, 2400, 278, 7101, 964, 697, 310, 1438, 5613, 4810, 29906, 620, 261, 7869, 29879, 304, 9792, 11916, 310, 278, 7679, 15359, 322, 278, 20501, 4841, 1970, 1312, 297, 278, 7679, 1277, 267, 29889, 13, 1576, 3815, 12399, 278, 1034, 1883, 291, 310, 278, 1375, 261, 1338, 7199, 5921, 278, 7679, 491, 278, 22193, 293, 22004, 630, 4094, 29892, 322, 920, 445, 756, 15201, 278, 11509, 310, 278, 2117, 7679, 304, 1044, 408, 385, 11828, 26505, 975, 1737, 5996, 23704, 310, 931, 29889, 11275, 7418, 12399, 278, 1375, 13537, 6933, 322, 1737, 2878, 331, 6020, 310, 2117, 7679, 322, 5134, 13585, 20272, 11916, 310, 278, 7679, 411 ]
1,333,554
0
CommonCrawl
7
9
package eu.liveandgov.wp1.data.impl; import eu.liveandgov.wp1.data.AbstractItem; import eu.liveandgov.wp1.data.DataCommons; import eu.liveandgov.wp1.data.annotations.Optional; import eu.liveandgov.wp1.serialization.impl.BluetoothSerialization; import java.util.Arrays; /** * <p>State of the bluetooth environment</p> * Created by Lukas Härtel on 09.02.14. */ public class Bluetooth extends AbstractItem { /** * Bond state of another device with this device */ public static enum BondState { /** * Not bonded */ NONE, /** * About to be bonded */ BONDING, /** * Bonded */ BONDED, /** * Unknown state */ UNKNOWN } /** * Represents one item of the bluetooth environment */ public static final class Item { /** * Address of the device */ public final String address; /** * Major class of the device */ public final String deviceMajorClass; /** * Minor class of the device */ public final String deviceMinorClass; /** * State of bonding */ public final BondState bondState; /** * Name of the device */ @Optional public final String name; /** * Receive strength indicator of the device */ @Optional public final Short rssi; /** * Creates a new instance with the given values * * @param address The address of the device * @param deviceMajorClass Major class of the device * @param deviceMinorClass Minor class of the device * @param bondState State of bonding * @param name Name of the device * @param rssi Receive strength indicator of the device */ public Item(String address, String deviceMajorClass, String deviceMinorClass, BondState bondState, @Optional String name, @Optional Short rssi) { this.address = address; this.deviceMajorClass = deviceMajorClass; this.deviceMinorClass = deviceMinorClass; this.bondState = bondState; this.name = name; this.rssi = rssi; } @Override public boolean equals(Object o) { if (this == o) return true; if (o == null || getClass() != o.getClass()) return false; Item that = (Item) o; if (address != null ? !address.equals(that.address) : that.address != null) return false; if (bondState != that.bondState) return false; if (deviceMajorClass != null ? !deviceMajorClass.equals(that.deviceMajorClass) : that.deviceMajorClass != null) return false; if (deviceMinorClass != null ? !deviceMinorClass.equals(that.deviceMinorClass) : that.deviceMinorClass != null) return false; if (name != null ? !name.equals(that.name) : that.name != null) return false; return !(rssi != null ? !rssi.equals(that.rssi) : that.rssi != null); } @Override public int hashCode() { int result = address != null ? address.hashCode() : 0; result = 31 * result + (deviceMajorClass != null ? deviceMajorClass.hashCode() : 0); result = 31 * result + (deviceMinorClass != null ? deviceMinorClass.hashCode() : 0); result = 31 * result + (bondState != null ? bondState.hashCode() : 0); result = 31 * result + (
-1.166533
-1.083619
-0.459953
0.169474
[ -0.922730737684679, -1.4103351904082377 ]
[ -0.5571743026362092, -1.6100639084463237 ]
[ 0.019396741296431676, -0.939302366298822 ]
[ 0.5089531921286252, -0.17000444788537755 ]
1,024
[ 512, 512 ]
[ 3577, 11878, 29889, 9258, 392, 13513, 29889, 11912, 29896, 29889, 1272, 29889, 13699, 29936, 13, 13, 5215, 11878, 29889, 9258, 392, 13513, 29889, 11912, 29896, 29889, 1272, 29889, 9118, 2001, 29936, 13, 5215, 11878, 29889, 9258, 392, 13513, 29889, 11912, 29896, 29889, 1272, 29889, 1469, 5261, 787, 29936, 13, 5215, 11878, 29889, 9258, 392, 13513, 29889, 11912, 29896, 29889, 1272, 29889, 6735, 800, 29889, 27636, 29936, 13, 5215, 11878, 29889, 9258, 392, 13513, 29889, 11912, 29896, 29889, 15550, 2133, 29889, 13699, 29889, 29933, 6092, 300, 6983, 9125, 2133, 29936, 13, 13, 5215, 2115, 29889, 4422, 29889, 2588, 29879, 29936, 13, 13, 7918, 13, 334, 529, 29886, 29958, 2792, 310, 278, 1999, 20930, 5177, 829, 29886, 29958, 13, 334, 6760, 630, 491, 365, 2679, 294, 379, 1215, 28497, 373, 29871, 29900, 29929, 29889, 29900, 29906, 29889, 29896, 29946, 29889, 13, 3776, 13, 3597, 770, 3164, 20930, 4988, 25513, 2001, 426, 13, 1678, 7762, 13, 268, 334, 26370, 2106, 310, 1790, 4742, 411, 445, 4742, 13, 268, 3776, 13, 1678, 970, 2294, 14115, 26370, 2792, 426, 13, 4706, 7762, 13, 308, 334, 2216, 21224, 287, 13, 308, 3776, 13, 4706, 405, 12413, 29892, 13, 4706, 7762, 13, 308, 334, 13611, 304, 367, 21224, 287, 13, 308, 3776, 13, 4706, 350, 1164, 29928, 4214, 29892, 13, 4706, 7762, 13, 308, 334, 26370, 287, 13, 308, 3776, 13, 4706, 350, 1164, 2287, 29928, 29892, 13, 4706, 7762, 13, 308, 334, 853, 5203, 2106, 13, 308, 3776, 13, 4706, 8291, 29968, 6632, 16048, 13, 1678, 500, 13, 13, 1678, 7762, 13, 268, 334, 830, 4569, 1237, 697, 2944, 310, 278, 1999, 20930, 5177, 13, 268, 3776, 13, 1678, 970, 2294, 2186, 770, 10976, 426, 13, 4706, 7762, 13, 308, 334, 16428, 310, 278, 4742, 13, 308, 3776, 13, 4706, 970, 2186, 1714, 3211, 29936, 13, 13, 4706, 7762, 13, 308, 334, 11019, 770, 310, 278, 4742, 13, 308, 3776, 13, 4706, 970, 2186, 1714, 4742, 29924, 1175, 272, 2385, 29936, 13, 13, 4706, 7762, 13, 308, 334, 21987, 770, 310, 278, 4742, 13, 308, 3776, 13, 4706, 970, 2186, 1714, 4742, 8140, 272, 2385, 29936, 13, 13, 4706, 7762, 13, 308, 334, 4306, 310, 21224, 292, 13, 308, 3776, 13, 4706, 970, 2186, 26370, 2792, 21224, 2792, 29936, 13, 13, 4706, 7762, 13, 308, 334, 4408, 310, 278, 4742, 13, 308, 3776, 13, 4706, 732, 27636, 13, 4706, 970, 2186, 1714, 1024, 29936, 13, 13, 4706, 7762, 13, 308, 334, 24328, 573, 9324, 27717, 310, 278, 4742, 13, 308, 3776, 13, 4706, 732, 27636, 13, 4706, 970, 2186, 13899, 364, 893, 29875, 29936, 13, 13, 4706, 7762, 13, 308, 334, 6760, 1078, 263, 716, 2777, 411, 278, 2183, 1819, 13, 308, 334, 13, 308, 334, 732, 3207, 3211, 3986, 450, 3211, 310, 278, 4742, 13, 308, 334, 732, 3207, 4742, 29924, 1175, 272, 2385, 11019, 770, 310, 278, 4742, 13, 308, 334, 732, 3207, 4742, 8140, 272, 2385, 21987, 770, 310, 278, 4742, 13, 308, 334, 732, 3207, 21224, 2792, 4706, 4306, 310, 21224, 292, 13, 308, 334, 732, 3207, 1024, 632, 4408, 310, 278, 4742, 13, 308, 334, 732, 3207, 364, 893, 29875, 632, 24328, 573, 9324, 27717, 310, 278, 4742, 13, 308, 3776, 13, 4706, 970, 10976, 29898, 1231, 3211, 29892, 1714, 4742, 29924, 1175, 272, 2385, 29892, 1714, 4742, 8140, 272, 2385, 29892, 26370, 2792, 21224, 2792, 29892, 732, 27636, 1714, 1024, 29892, 732, 27636, 13899, 364, 893, 29875, 29897, 426, 13, 9651, 445, 29889, 7328, 353, 3211, 29936, 13, 9651, 445, 29889, 10141, 29924, 1175, 272, 2385, 353, 4742, 29924, 1175, 272, 2385, 29936, 13, 9651, 445, 29889, 10141, 8140, 272, 2385, 353, 4742, 8140, 272, 2385, 29936, 13, 9651, 445, 29889, 29890, 898, 2792, 353, 21224, 2792, 29936, 13, 9651, 445, 29889, 978, 353, 1024, 29936, 13, 9651, 445, 29889, 29878, 893, 29875, 353, 364, 893, 29875, 29936, 13, 4706, 500, 13, 13, 4706, 732, 4640, 13, 4706, 970, 7223, 15743, 29898, 2061, 288, 29897, 426, 13, 9651, 565, 313, 1366, 1275, 288, 29897, 736, 1565, 29936, 13, 9651, 565, 313, 29877, 1275, 1870, 3830, 679, 2385, 580, 2804, 288, 29889, 657, 2385, 3101, 736, 2089, 29936, 13, 13, 9651, 10976, 393, 353, 313, 2001, 29897, 288, 29936, 13, 13, 9651, 565, 313, 7328, 2804, 1870, 1577, 1738, 7328, 29889, 10954, 29898, 5747, 29889, 7328, 29897, 584, 393, 29889, 7328, 2804, 1870, 29897, 736, 2089, 29936, 13, 9651, 565, 313, 29890, 898, 2792, 2804, 393, 29889, 29890, 898, 2792, 29897, 736, 2089, 29936, 13, 9651, 565, 313, 10141, 29924, 1175, 272, 2385, 2804, 1870, 1577, 1738, 10141, 29924, 1175, 272, 2385, 29889, 10954, 29898, 5747, 29889, 10141, 29924, 1175, 272, 2385, 29897, 584, 393, 29889, 10141, 29924, 1175, 272, 2385, 2804, 1870, 29897, 13, 18884, 736, 2089, 29936, 13, 9651, 565, 313, 10141, 8140, 272, 2385, 2804, 1870, 1577, 1738, 10141, 8140, 272, 2385, 29889, 10954, 29898, 5747, 29889, 10141, 8140, 272, 2385, 29897, 584, 393, 29889, 10141, 8140, 272, 2385, 2804, 1870, 29897, 13, 18884, 736, 2089, 29936, 13, 9651, 565, 313, 978, 2804, 1870, 1577, 1738, 978, 29889, 10954, 29898, 5747, 29889, 978, 29897, 584, 393, 29889, 978, 2804, 1870, 29897, 736, 2089, 29936, 13, 9651, 736, 1738, 29898, 29878, 893, 29875, 2804, 1870, 1577, 1738, 29878, 893, 29875, 29889, 10954, 29898, 5747, 29889, 29878, 893, 29875, 29897, 584, 393, 29889, 29878, 893, 29875, 2804, 1870, 416, 13, 13, 4706, 500, 13, 13, 4706, 732, 4640, 13, 4706, 970, 938, 6608, 3399, 580, 426, 13, 9651, 938, 1121, 353, 3211, 2804, 1870, 1577, 3211, 29889, 8568, 3399, 580, 584, 29871, 29900, 29936, 13, 9651, 1121, 353, 29871, 29941, 29896, 334, 1121, 718, 313, 10141, 29924, 1175, 272, 2385, 2804, 1870, 1577, 4742, 29924, 1175, 272, 2385, 29889, 8568, 3399, 580, 584, 29871, 29900, 416, 13, 9651, 1121, 353, 29871, 29941, 29896, 334, 1121, 718, 313, 10141, 8140, 272, 2385, 2804, 1870, 1577, 4742, 8140, 272, 2385, 29889, 8568, 3399, 580, 584, 29871, 29900, 416, 13, 9651, 1121, 353, 29871, 29941, 29896, 334, 1121, 718, 313, 29890, 898, 2792, 2804, 1870, 1577, 21224, 2792, 29889, 8568, 3399, 580, 584, 29871, 29900, 416, 13, 9651, 1121, 353, 29871, 29941, 29896, 334, 1121, 718, 313 ]
1,333,557
0
Github
-1
-1
Real Housewives Fans Slam Gretchen Rossi For Promoting Florist In Martin Luther King Jr. Day Post Vanderpump Rules Star Scheana Shay Reveals The Sex Of Her Baby This summer, Scheana Shay revealed that she went through a miscarriage. This was around the time that the news broke that Stassi Schroeder is pregnant. Soon after, Lala Kent and Brittany Cartwright shared their pregnancy announcements, which wasn't surprising since they made an actual pregnancy pact with Katie Maloney. After experiencing her miscarriage, Scheana announced that she and her boyfriend Brock Davies are expecting their first child together. He has a son and daughter from a previous marriage who live in Australia. Real Housewives Of Dallas Star Brandi Redmond Is Expecting Her Fourth Child Last season on Real Housewives of Dallas, Brandi Redmond contemplated adopting another child. She and her husband Bryan Redmond already had three children, their daughter Brinkley and Brooklyn, and their son Bruin Redmond, who they adopted during a previous season. Recently, Brandi confirmed that her family is growing. There's another little Redmond on the way. Brandi Redmond's Daughter Survives Car Crash That Killed Her Mother-In-Law We are sending positive thoughts to Real Housewives of Dallas cast member Brandi Redmond and her family. She has shared both grief and gratitude after a tragic car accident. Brand's mother-in-law Jill Marie Redmond did not survive the accident. Brandi and Bryan Redmond's daughter Brinkley Redmond was in the car as well. Brinkley survived the accident. It is unclear if she sustained an injuries at this time. LeeAnne Locken Says She's Friends With Kary Brittingham; Denies Getting Fired From Real Housewives Of Dallas Technically speaking, Real Housewives of Dallas is an ensemble show. However, all roads led back to LeeAnne Locken for the first four seasons of the show. So, how is RHOD going to fare now that LeeAnne is gone? Now that LeeAnne is done with the Real Housewife life, she's spilling some tea on her former castmates. And, apparently, she's actually friends with… wait for it, Kary Brittingham, of all people. Now that is a twist that I never saw coming, especially since LeeAnne left the show following the offensive comments she made about Kary's Mexican heritage. How on earth did these two become friends? D'Andra Simmons Says Video Of Brandi Redmond Mocking Asians Will Be Addressed On Real Housewives Of Dallas Next Season Recently, a video that Brandi Redmond shared in 2017 resurfaced. In the video, she was making fun of Asians, squinting her eyes and changing the sound of her voice. The Real Housewives of Dallas star faced backlash for the video, but she didn't face any consequences in terms of her spot on the show. She tried to defend herself claiming that she was just trying to be humorous, which obviously didn't go over well. Brandi even checked into some sort of wellness retreat in the wake of the scandal. Teddi Mellencamp And Her Kids Received Death Wishes From Real Housewives Of Beverly Hills Fans Even the fan favorites from reality television have their fair share of haters. If a show is watched by enough people, pretty much every cast member is going to have supporters and some haters who just aren't their fans. Teddi Mellencamp hasn't been the most loved cast member on Real Housewives of Beverly Hills, which is a nice way of putting it. For the most part, people hate on her for being "boring" or "too normal" or just not having an "interesting" storyline. Of course, there's also that famous last name that seemingly got her in the door. And, then there's the pot stirring, which someone has to do on every (entertaining) reality show. Is Teddi the best reality TV star of all time? No, but that's about it. Teddi and her children have received death wishes from "fans" and that is not-at-all justified. No matter what Teddi has said and done on this show, that is really crossing the line
-0.763848
-0.94395
-1.728073
-1.759442
[ -0.802199299932788, -0.7254974759088575 ]
[ -0.8472561328083836, -1.0406440195898332 ]
[ -1.6240874431525747, -1.8320592072340849 ]
[ -1.8270773087624648, -1.691806054813315 ]
1,024
[ 512, 512 ]
[ 8195, 5619, 29893, 3145, 383, 550, 317, 5288, 402, 2267, 2724, 5678, 1039, 1152, 9705, 11427, 6953, 391, 512, 6502, 24760, 4088, 13843, 29889, 8373, 4918, 13, 29963, 3825, 29886, 3427, 390, 2540, 7828, 24478, 1648, 1383, 388, 830, 345, 1338, 450, 21703, 4587, 2439, 26835, 13, 4013, 11801, 29892, 24478, 1648, 1383, 388, 17845, 393, 1183, 3512, 1549, 263, 3984, 4287, 9081, 29889, 910, 471, 2820, 278, 931, 393, 278, 9763, 14455, 393, 624, 465, 29875, 1102, 307, 2447, 338, 758, 5138, 424, 29889, 1105, 265, 1156, 29892, 365, 2883, 13272, 322, 3230, 29873, 1384, 12370, 29893, 1266, 7258, 1009, 758, 5138, 6906, 7475, 29883, 4110, 29892, 607, 9007, 29915, 29873, 26800, 1951, 896, 1754, 385, 3935, 758, 5138, 6906, 282, 627, 411, 476, 9474, 3792, 4992, 29889, 13, 13555, 10623, 3277, 902, 3984, 4287, 9081, 29892, 24478, 1648, 9326, 393, 1183, 322, 902, 8023, 18326, 4358, 384, 3589, 583, 526, 16120, 1009, 937, 2278, 4208, 29889, 940, 756, 263, 1487, 322, 8750, 515, 263, 3517, 13718, 1058, 5735, 297, 8314, 29889, 13, 21713, 5619, 29893, 3145, 4587, 27043, 7828, 18007, 29875, 4367, 8315, 1317, 1222, 1103, 292, 2439, 12458, 386, 10517, 13, 8897, 4259, 373, 8195, 5619, 29893, 3145, 310, 27043, 29892, 18007, 29875, 4367, 8315, 640, 16305, 630, 9332, 292, 1790, 2278, 29889, 2296, 322, 902, 10216, 13307, 273, 4367, 8315, 2307, 750, 2211, 4344, 29892, 1009, 8750, 1771, 682, 2330, 322, 18737, 13493, 29892, 322, 1009, 1487, 8135, 262, 4367, 8315, 29892, 1058, 896, 16356, 2645, 263, 3517, 4259, 29889, 13, 4789, 2705, 29892, 18007, 29875, 16725, 393, 902, 3942, 338, 15678, 29889, 1670, 29915, 29879, 1790, 2217, 4367, 8315, 373, 278, 982, 29889, 13, 29933, 9502, 29875, 4367, 8315, 29915, 29879, 360, 6334, 357, 6298, 29894, 3145, 1704, 6781, 1161, 2193, 12400, 839, 2439, 21869, 29899, 797, 29899, 29931, 1450, 13, 4806, 526, 9348, 6374, 13133, 304, 8195, 5619, 29893, 3145, 310, 27043, 4320, 4509, 18007, 29875, 4367, 8315, 322, 902, 3942, 29889, 13, 13468, 756, 7258, 1716, 867, 2575, 322, 20715, 4279, 1156, 263, 25305, 293, 1559, 11423, 29889, 18007, 29915, 29879, 5637, 29899, 262, 29899, 10653, 435, 453, 9932, 4367, 8315, 1258, 451, 10503, 573, 278, 11423, 29889, 18007, 29875, 322, 13307, 273, 4367, 8315, 29915, 29879, 8750, 1771, 682, 2330, 4367, 8315, 471, 297, 278, 1559, 408, 1532, 29889, 1771, 682, 2330, 10503, 2347, 278, 11423, 29889, 739, 338, 20871, 565, 1183, 15075, 7114, 385, 10899, 14886, 472, 445, 931, 29889, 13, 3226, 29872, 2744, 484, 18199, 264, 317, 1036, 2296, 29915, 29879, 11169, 1975, 2973, 476, 653, 3230, 1259, 3391, 29936, 3384, 583, 24162, 383, 2859, 3645, 8195, 5619, 29893, 3145, 4587, 27043, 13, 7141, 3049, 1711, 13590, 29892, 8195, 5619, 29893, 3145, 310, 27043, 338, 385, 21285, 1510, 29889, 2398, 29892, 599, 25320, 5331, 1250, 304, 9371, 2744, 484, 18199, 264, 363, 278, 937, 3023, 20084, 310, 278, 1510, 29889, 1105, 29892, 920, 338, 390, 8187, 29928, 2675, 304, 20036, 1286, 393, 9371, 2744, 484, 338, 7695, 29973, 13, 10454, 393, 9371, 2744, 484, 338, 2309, 411, 278, 8195, 5619, 29893, 1607, 2834, 29892, 1183, 29915, 29879, 805, 8873, 777, 23429, 373, 902, 4642, 4320, 29885, 1078, 29889, 1126, 29892, 13229, 29892, 1183, 29915, 29879, 2869, 7875, 411, 30098, 4480, 363, 372, 29892, 476, 653, 3230, 1259, 3391, 29892, 310, 599, 2305, 29889, 2567, 393, 338, 263, 3252, 391, 393, 306, 2360, 4446, 6421, 29892, 7148, 1951, 9371, 2744, 484, 2175, 278, 1510, 1494, 278, 1283, 6270, 6589, 1183, 1754, 1048, 476, 653, 29915, 29879, 24777, 902, 16639, 29889, 1128, 373, 8437, 1258, 1438, 1023, 4953, 7875, 29973, 13, 29928, 29915, 2855, 336, 3439, 29885, 787, 317, 1036, 13987, 4587, 18007, 29875, 4367, 8315, 26297, 292, 319, 1039, 550, 2811, 1522, 16428, 287, 1551, 8195, 5619, 29893, 3145, 4587, 27043, 8084, 24791, 13, 4789, 2705, 29892, 263, 4863, 393, 18007, 29875, 4367, 8315, 7258, 297, 29871, 29906, 29900, 29896, 29955, 620, 332, 17470, 287, 29889, 512, 278, 4863, 29892, 1183, 471, 3907, 2090, 310, 319, 1039, 550, 29892, 10674, 524, 292, 902, 5076, 322, 6480, 278, 6047, 310, 902, 7314, 29889, 13, 1576, 8195, 5619, 29893, 3145, 310, 27043, 5810, 20050, 1250, 29880, 1161, 363, 278, 4863, 29892, 541, 1183, 3282, 29915, 29873, 3700, 738, 27721, 297, 4958, 310, 902, 9758, 373, 278, 1510, 29889, 2296, 1898, 304, 24663, 8735, 5995, 292, 393, 1183, 471, 925, 1811, 304, 367, 3165, 20657, 29892, 607, 12879, 3282, 29915, 29873, 748, 975, 1532, 29889, 18007, 29875, 1584, 7120, 964, 777, 2656, 310, 1532, 2264, 22162, 271, 297, 278, 281, 1296, 310, 278, 885, 24258, 29889, 13, 29911, 287, 6051, 341, 514, 3977, 1160, 1126, 2439, 476, 4841, 24328, 2347, 14450, 399, 17006, 3645, 8195, 5619, 29893, 3145, 4587, 350, 1310, 368, 24128, 383, 550, 13, 29923, 854, 278, 13524, 7853, 3246, 515, 16832, 11456, 505, 1009, 6534, 6232, 310, 3056, 414, 29889, 960, 263, 1510, 338, 20654, 491, 3307, 2305, 29892, 5051, 1568, 1432, 4320, 4509, 338, 2675, 304, 505, 1462, 272, 2153, 322, 777, 3056, 414, 1058, 925, 9455, 29915, 29873, 1009, 24909, 29889, 13, 29911, 287, 6051, 341, 514, 3977, 1160, 22602, 29915, 29873, 1063, 278, 1556, 18012, 4320, 4509, 373, 8195, 5619, 29893, 3145, 310, 350, 1310, 368, 24128, 29892, 607, 338, 263, 7575, 982, 310, 10594, 372, 29889, 1152, 278, 1556, 760, 29892, 2305, 26277, 373, 902, 363, 1641, 376, 4089, 292, 29908, 470, 376, 517, 29877, 4226, 29908, 470, 925, 451, 2534, 385, 376, 1639, 342, 292, 29908, 5828, 1220, 29889, 4587, 3236, 29892, 727, 29915, 29879, 884, 393, 13834, 1833, 1024, 393, 2833, 11687, 2355, 902, 297, 278, 3050, 29889, 1126, 29892, 769, 727, 29915, 29879, 278, 3104, 23546, 5393, 29892, 607, 4856, 756, 304, 437, 373, 1432, 313, 296, 13946, 292, 29897, 16832, 1510, 29889, 1317, 22040, 6051, 278, 1900, 16832, 5648, 5810, 310, 599, 931, 29973, 1939, 29892, 541, 393, 29915, 29879, 1048, 372, 29889, 22040, 6051, 322, 902, 4344, 505, 4520, 4892, 28688, 515, 376, 29888, 550, 29908, 322, 393, 338, 451, 29899, 271, 29899, 497, 925, 2164, 29889, 1939, 4383, 825, 22040, 6051, 756, 1497, 322, 2309, 373, 445, 1510, 29892, 393, 338, 2289, 24067, 278, 1196 ]
1,333,558
0
CommonCrawl
2
16
Menasat is committed to the provision of established and advanced systems to procure the safety and management of territories, borders, assets and peoples. Countries, Governments and Corporations rely upon the advanced systems of Menasat to monitor, detect and respond in order to protect and safeguard their strategic assets and resources. Mr. Abdulrahman Falaknaz is a prominent philanthropic business man with over 25 years in business development and project finance. He has a global network expertise and amongst his other notable achievements is President of the Falaknaz Group and Partner of Dubai Sports City. Mr. Falaknaz is widely regarded as leader and pioneer in the promotion of sports in the United Arab Emirates and is involved at an Executive level in a number of sporting associations, including being Chairman of the Dubai Cricket Council, Vice-President of the UAE Tennis Association, Board Member of the UAE National Olympic Association, Director of Finance at the UAE National Olympic Association and Honorary Board Member of the UAE Fencing Association. Mr. Riccardo Maggiora is a Professor and member of the Antenna and Electromagnetic Compatibility Laboratory (LACE), at the Politecnico di Torino, Italy ("Polito"). Professor Maggiora has over 10 years' experience in designing and accomplishing the realization of a variety of radar and image processing systems. He holds numerous patents in the technological field of ground intrusion detection radar. Mr. Riccardo Maggiora obtained his Laurea di Dottore in Inginieria delle Telecomunicazioni (Communications Engineering), and his Dottorato di Ricerca (Ph.D.) in Inginieria Elettronica e delle Comunicazioni (Communications and Electronics Engineering) from Polito. Since 2001, he has been teaching and supervising laboratory training at Polito. Riccardo has been engaged in numerous research activities, including the development of spaceborne synthetic aperture radars, and has served as group leader of the Plasma Facing Antenna Group at Polito (the main research group in Italy for the analysis and design of plasma facing antennas). Mr. Mervyn Clarke is a highly experienced Finance Director. He qualified as a Chartered Certified Accountant. His career started in England becoming senior partner in a substantial accounting practice in South East England. He also became a commercial director in the Electronics / Electrical Technology Industry. He has subsequently gained a wide range of experience as a Director/Chairman of companies in the Construction, and Property Sectors where he still retains interests. He was Commercial Director to a well-known Television/Media Company operating in the Middle East and has worked in the Gulf States. He has been directly involved in top level negotiations with government organisations and major financial institutions. Mr. Russell Dolman has over 30 years- experience in Aeronautical Mechanical and Electrical Engineering. He has worked with the Royal Air Force, The Royal Saudi Air Force, British Aerospace and the Defence Evaluation & Research Agency. Russell's continued drive into technology has resulted in patents being granted in Europe and the US. In 2010, Mr. Russell Dolman founded Nano-Effect Ltd which he subsequently listed on the Frankfurt Stock Exchange. As CEO, his strong and positive management skills were instrumental in the 2012 reverse take-over of Menasat. As COO, Russell is the driving force behind the company's identification, development and expansion into new security and humanitarian technologies. Having previously lived and worked in the Middle East, he integrates easily and has a good understanding of local customs and traditions. Mr. Wolfgang Heinl, was educated as an Economist and obtained his doctorate in human sciences. He spent 10 years in Southern Africa in various management positions, before returning to Germany where he was appointed Federal Sales Director of one of the largest European voluntary retail groups and then promoted as Managing Director for the group's business in the UK and Ireland. After revolutionising the private label market in Ireland and successfully challenging restrictive trade practices in the UK and Ireland, Wolfgang then concentrated his activities as an independent commercial counsel, management consultant, and human rights advisor, working on complex assignments in the UK, Ireland, Germany, Austria, Spain, East Africa and West Africa. Wolfgang works closely with Russell ensuring new offerings and services are commercially viable and are brought to market in the most cost effective way for both stakeholders and customers alike. Mr. Shareef Rehuman serves
0.31751
0.504668
-0.184137
0.412702
[ 0.16068252665334057, 0.47433819989405673 ]
[ 0.22712101597744755, 0.7822158761834603 ]
[ -0.30397398944006265, -0.0642992125412492 ]
[ 0.3216545328144175, 0.5037504515921194 ]
1,024
[ 512, 512 ]
[ 7567, 294, 271, 338, 19355, 304, 278, 25161, 310, 7841, 322, 12862, 6757, 304, 9580, 545, 278, 15332, 322, 10643, 310, 5884, 3842, 29892, 28199, 29892, 21608, 322, 1236, 459, 793, 29889, 13, 3981, 2722, 29892, 6769, 1860, 322, 12767, 800, 19104, 2501, 278, 12862, 6757, 310, 7567, 294, 271, 304, 11819, 29892, 6459, 322, 10049, 297, 1797, 304, 12566, 322, 9437, 24024, 538, 1009, 16650, 293, 21608, 322, 7788, 29889, 13, 20335, 29889, 17860, 352, 19856, 1171, 12941, 557, 29876, 834, 338, 263, 19555, 8578, 9716, 1336, 293, 5381, 767, 411, 975, 29871, 29906, 29945, 2440, 297, 5381, 5849, 322, 2060, 1436, 749, 29889, 940, 756, 263, 5534, 3564, 17924, 895, 322, 22611, 670, 916, 18697, 27012, 4110, 338, 7178, 310, 278, 12941, 557, 29876, 834, 6431, 322, 3455, 1089, 310, 11668, 1794, 12453, 4412, 29889, 13, 20335, 29889, 12941, 557, 29876, 834, 338, 17644, 17878, 408, 11822, 322, 29323, 261, 297, 278, 22360, 310, 14717, 297, 278, 3303, 10387, 2812, 381, 1078, 322, 338, 9701, 472, 385, 28841, 3233, 297, 263, 1353, 310, 7980, 292, 27733, 29892, 3704, 1641, 24193, 1171, 310, 278, 11668, 1794, 6781, 8522, 8831, 29892, 21400, 29899, 13504, 1693, 310, 278, 501, 16036, 29010, 7993, 29892, 12590, 19495, 310, 278, 501, 16036, 3086, 19025, 7993, 29892, 15944, 310, 4231, 749, 472, 278, 501, 16036, 3086, 19025, 7993, 322, 18236, 653, 12590, 19495, 310, 278, 501, 16036, 383, 16750, 7993, 29889, 13, 20335, 29889, 13675, 29883, 6491, 3561, 19187, 29874, 338, 263, 11386, 322, 4509, 310, 278, 530, 841, 1056, 322, 10513, 26097, 293, 3831, 271, 4127, 16715, 7606, 313, 29931, 11538, 511, 472, 278, 2043, 568, 29883, 15024, 652, 4794, 1789, 29892, 12730, 4852, 7713, 2049, 2564, 11386, 3561, 19187, 29874, 756, 975, 29871, 29896, 29900, 2440, 29915, 7271, 297, 2874, 292, 322, 12709, 292, 278, 1855, 2133, 310, 263, 12875, 310, 2971, 279, 322, 1967, 9068, 6757, 29889, 940, 8640, 12727, 2373, 1237, 297, 278, 5722, 5996, 1746, 310, 5962, 11158, 3958, 15326, 2971, 279, 29889, 13, 20335, 29889, 13675, 29883, 6491, 3561, 19187, 29874, 7625, 670, 997, 545, 29874, 652, 360, 1501, 487, 297, 512, 5359, 631, 423, 4884, 9699, 510, 2523, 8312, 313, 5261, 2523, 800, 22557, 511, 322, 670, 360, 1501, 272, 1219, 652, 13675, 24340, 313, 4819, 29889, 29928, 1846, 297, 512, 5359, 631, 423, 382, 1026, 509, 26082, 321, 4884, 422, 2523, 8312, 313, 5261, 2523, 800, 322, 28251, 1199, 22557, 29897, 515, 2043, 2049, 29889, 4001, 29871, 29906, 29900, 29900, 29896, 29892, 540, 756, 1063, 18819, 322, 2428, 1730, 292, 10212, 7606, 6694, 472, 2043, 2049, 29889, 13675, 29883, 6491, 756, 1063, 17785, 297, 12727, 5925, 14188, 29892, 3704, 278, 5849, 310, 2913, 4089, 484, 14710, 7492, 263, 10700, 545, 2971, 1503, 29892, 322, 756, 6766, 408, 2318, 11822, 310, 278, 1858, 25392, 383, 9390, 530, 841, 1056, 6431, 472, 2043, 2049, 313, 1552, 1667, 5925, 2318, 297, 12730, 363, 278, 7418, 322, 2874, 310, 715, 25392, 14870, 25504, 22911, 467, 13, 20335, 29889, 4702, 29894, 948, 15183, 446, 338, 263, 10712, 18860, 4231, 749, 15944, 29889, 940, 18698, 408, 263, 2896, 25396, 18410, 2164, 16535, 424, 29889, 3600, 6413, 4687, 297, 5408, 14171, 16336, 18096, 297, 263, 23228, 3633, 292, 6944, 297, 4275, 6932, 5408, 29889, 940, 884, 3897, 263, 12128, 8881, 297, 278, 28251, 1199, 847, 10513, 16888, 17968, 12157, 719, 29889, 940, 756, 17602, 17515, 263, 9377, 3464, 310, 7271, 408, 263, 15944, 29914, 1451, 1466, 1171, 310, 14582, 297, 278, 5798, 4080, 29892, 322, 9079, 317, 11142, 988, 540, 1603, 11551, 29879, 20017, 29889, 13, 3868, 471, 422, 1050, 1455, 15944, 304, 263, 1532, 29899, 5203, 22417, 29914, 10572, 6938, 13598, 297, 278, 14253, 6932, 322, 756, 3796, 297, 278, 402, 16302, 3900, 29889, 940, 756, 1063, 4153, 9701, 297, 2246, 3233, 27214, 800, 411, 5874, 17459, 800, 322, 4655, 18161, 21561, 29889, 13, 20335, 29889, 20679, 11201, 1171, 756, 975, 29871, 29941, 29900, 2440, 29899, 7271, 297, 18682, 20546, 936, 27439, 936, 322, 10513, 16888, 22557, 29889, 940, 756, 3796, 411, 278, 7021, 5593, 11004, 29892, 450, 7021, 5701, 4749, 5593, 11004, 29892, 4908, 319, 9672, 3535, 322, 278, 5282, 663, 382, 4387, 362, 669, 10550, 29353, 29889, 20679, 29915, 29879, 7572, 7899, 964, 15483, 756, 20601, 297, 2373, 1237, 1641, 16896, 297, 4092, 322, 278, 3148, 29889, 13, 797, 29871, 29906, 29900, 29896, 29900, 29892, 3237, 29889, 20679, 11201, 1171, 11091, 405, 1562, 29899, 13971, 19806, 607, 540, 17602, 9904, 373, 278, 16339, 10224, 24004, 29889, 1094, 14645, 29949, 29892, 670, 4549, 322, 6374, 10643, 25078, 892, 11395, 284, 297, 278, 29871, 29906, 29900, 29896, 29906, 11837, 2125, 29899, 957, 310, 7567, 294, 271, 29889, 1094, 4810, 29949, 29892, 20679, 338, 278, 19500, 4889, 5742, 278, 5001, 29915, 29879, 29769, 29892, 5849, 322, 13184, 964, 716, 6993, 322, 5199, 3673, 713, 5722, 11763, 29889, 15950, 9251, 10600, 322, 3796, 297, 278, 14253, 6932, 29892, 540, 3990, 1078, 5948, 322, 756, 263, 1781, 8004, 310, 1887, 2888, 29879, 322, 3534, 2187, 29889, 13, 20335, 29889, 19314, 9515, 29880, 29892, 471, 27729, 408, 385, 12884, 391, 322, 7625, 670, 11619, 403, 297, 5199, 21195, 29889, 940, 10398, 29871, 29896, 29900, 2440, 297, 14234, 10557, 297, 5164, 10643, 11909, 29892, 1434, 7863, 304, 9556, 988, 540, 471, 10658, 14879, 28389, 15944, 310, 697, 310, 278, 10150, 7824, 27081, 653, 3240, 737, 6471, 322, 769, 21201, 408, 2315, 6751, 15944, 363, 278, 2318, 29915, 29879, 5381, 297, 278, 10261, 322, 12126, 29889, 13, 13555, 19479, 5921, 278, 2024, 3858, 9999, 297, 12126, 322, 8472, 18066, 292, 9250, 573, 11302, 23274, 297, 278, 10261, 322, 12126, 29892, 19314, 769, 14953, 630, 670, 14188, 408, 385, 7417, 12128, 2613, 2838, 29892, 10643, 8799, 424, 29892, 322, 5199, 10462, 594, 19188, 29892, 1985, 373, 4280, 3566, 1860, 297, 278, 10261, 29892, 12126, 29892, 9556, 29892, 17362, 29892, 13616, 29892, 6932, 10557, 322, 3122, 10557, 29889, 19314, 1736, 16467, 411, 20679, 5662, 3864, 716, 5957, 886, 322, 5786, 526, 7825, 5584, 3516, 519, 322, 526, 6296, 304, 9999, 297, 278, 1556, 3438, 11828, 982, 363, 1716, 380, 1296, 8948, 414, 322, 20330, 394, 9345, 29889, 13, 20335, 29889, 26849, 1389, 830, 26029, 19700 ]
1,333,559
0
C4
15
4
A Win! A Win! By A Concerned Fan – January 29, 2004 Oh there's got to be a relieved bunch heading back to Montreal after that game. For the longest time, it looked no better than any of the previous three, at least until about midway through the second when they finally started putting together some solid play. There were still far too many mistakes for anyone to sit back and be happy about this one, however the fact they came back from a two goal deficit and won the game after an exciting overtime period is enough to offer encouragement for the future. While I believe it was done for defensive reasons, I was disappointed in how Balej was used towards the end of the game. Julien took him off the second line and instead had Ward out there. Oy. Kilger was given a spot on the checking line and Balej didn't see the ice again. At least I can understand that, despite the fact Balej had played yet another solid game. What I could not understand, and never will, is playing Ward over Balej on the powerplay. After watching for the second game running some sweet play from Balej, for some reason he got to sit on the bench when players like him should be out there showing what they can really do, and in his place a defensive player. Garon: Kept us in there until the rest of the team could wake up. The first goal he never even saw – probably still hasn't, and the second was a laser from a guy bursting through the slot. My one bone of contention? STAY IN YOUR NET! Bouillon: He played a typical game, did his usual with the puck and played solidly without. You can't really expect much more from him on a regular basis. Brisebois: Scored a goal on one of the most inoffensive shots he's had – which just goes to show good things happen when you put the puck on the net. That second goal could, however, be laid at his feet. I think everyone in the arena was expecting him to keep it in, so when he didn't, the Habs were caught flat-footed. B+ Rivet: The turnaround continues. Three weeks ago I think most would have traded him for a Langdon rookie card, however tonight's strong defensive performance continues the string of better games he's had over the last while. There was only one really bad play I saw, and that was when he let Daigle victimize him with speed zooming down the middle of the rink. However, it was equally Markov's fault. B Markov: It's like coming out of a nightmare. Man his game has turned around since coming back from injury. It's like a weight has been lifted off his shoulders. He's doing intelligent pinches, making slick passes and winning his battles again. Sure, he wasn't perfect, but it's still going to take a little time, if progression continues, to get to where he was last year. B Quintal: Tonight he struggled, there's no doubt about it. He was fighting the puck all night and had more than a few go by him allowing Minny players to make something happen. His coverage was less than at its best as well. Hopefully he comes back with a typically quiet and effective game Saturday afternoon. C Souray: Well, he wasn't at his best, but it certainly wasn't like the past few games either. His defence was much better tonight and, while he made mistakes with the puck, he looked much more like the All-Star than the Goat. Langdon: His fight tonight was at a good time, and while it didn't get the team going so much, he did the right thing by picking it. And as for the assist? When's the party? B Perreault: A little more jump than usual tonight, which was nice to see. He wasn't rewarded on the ice for that good work in terms of points, but it was appreciated nonetheless. B- Kilger: They were saying during the game that he's easily the most impressive Hab at practice, but for some reason can't translate that to game situations. I find that a shocking statement,
-0.451562
-0.865162
-1.187854
-1.183889
[ -0.47073784611508795, -0.4323869341031227 ]
[ -1.144500477305797, -0.5858243599371646 ]
[ -1.3451009303603052, -1.0306070432126557 ]
[ -1.4420745090610378, -0.9257025108128404 ]
1,024
[ 512, 512 ]
[ 319, 8892, 29991, 319, 8892, 29991, 13, 2059, 319, 23924, 824, 287, 383, 273, 785, 5490, 29871, 29906, 29929, 29892, 29871, 29906, 29900, 29900, 29946, 13, 9048, 727, 29915, 29879, 2355, 304, 367, 263, 1104, 6402, 14928, 28435, 1250, 304, 26693, 1156, 393, 13, 11802, 29889, 1152, 278, 27217, 931, 29892, 372, 5148, 694, 2253, 1135, 738, 310, 278, 3517, 2211, 29892, 13, 271, 3203, 2745, 1048, 7145, 1582, 1549, 278, 1473, 746, 896, 7146, 4687, 10594, 13, 29873, 12966, 777, 7773, 1708, 29889, 1670, 892, 1603, 2215, 2086, 1784, 28947, 363, 5019, 304, 13, 29879, 277, 1250, 322, 367, 9796, 1048, 445, 697, 29892, 3138, 278, 2114, 896, 2996, 1250, 515, 263, 1023, 13, 28111, 822, 293, 277, 322, 2113, 278, 3748, 1156, 385, 5566, 11407, 975, 2230, 3785, 338, 3307, 304, 13, 974, 571, 18443, 882, 363, 278, 5434, 29889, 13, 8809, 488, 306, 4658, 372, 471, 2309, 363, 822, 6270, 9590, 29892, 306, 471, 23451, 287, 297, 920, 13, 29933, 744, 29926, 471, 1304, 7113, 278, 1095, 310, 278, 3748, 29889, 2739, 819, 3614, 1075, 1283, 278, 1473, 1196, 13, 392, 2012, 750, 21910, 714, 727, 29889, 438, 29891, 29889, 12400, 914, 471, 2183, 263, 9758, 373, 278, 8454, 1196, 13, 392, 350, 744, 29926, 3282, 29915, 29873, 1074, 278, 14890, 1449, 29889, 2180, 3203, 306, 508, 2274, 393, 29892, 15020, 278, 13, 17028, 350, 744, 29926, 750, 5318, 3447, 1790, 7773, 3748, 29889, 1724, 306, 1033, 451, 2274, 29892, 322, 13, 484, 369, 674, 29892, 338, 8743, 21910, 975, 350, 744, 29926, 373, 278, 3081, 1456, 29889, 2860, 21217, 363, 278, 13, 7496, 3748, 2734, 777, 14225, 1708, 515, 350, 744, 29926, 29892, 363, 777, 2769, 540, 2355, 304, 7845, 373, 13, 1552, 3856, 305, 746, 10769, 763, 1075, 881, 367, 714, 727, 6445, 825, 896, 508, 2289, 13, 1867, 29892, 322, 297, 670, 2058, 263, 822, 6270, 4847, 29889, 13, 29954, 5022, 29901, 4813, 415, 502, 297, 727, 2745, 278, 1791, 310, 278, 3815, 1033, 281, 1296, 701, 29889, 450, 937, 13, 28111, 540, 2360, 1584, 4446, 785, 3117, 1603, 22602, 29915, 29873, 29892, 322, 278, 1473, 471, 263, 1869, 261, 515, 13, 29874, 1410, 29891, 20887, 292, 1549, 278, 21497, 29889, 1619, 697, 289, 650, 310, 640, 2509, 29973, 317, 6040, 29979, 2672, 612, 22970, 405, 2544, 29991, 13, 29933, 283, 12794, 29901, 940, 5318, 263, 15662, 3748, 29892, 1258, 670, 9670, 411, 278, 2653, 384, 322, 5318, 13, 2929, 333, 368, 1728, 29889, 887, 508, 29915, 29873, 2289, 2149, 1568, 901, 515, 1075, 373, 263, 4943, 8405, 29889, 13, 29933, 3780, 774, 11505, 29901, 2522, 4395, 263, 7306, 373, 697, 310, 278, 1556, 297, 2696, 6270, 528, 1862, 540, 29915, 29879, 750, 785, 13, 4716, 925, 5771, 304, 1510, 1781, 2712, 3799, 746, 366, 1925, 278, 2653, 384, 373, 278, 7787, 29889, 13, 7058, 1473, 7306, 1033, 29892, 3138, 29892, 367, 12341, 472, 670, 6900, 29889, 306, 1348, 14332, 297, 278, 13, 279, 2386, 471, 16120, 1075, 304, 3013, 372, 297, 29892, 577, 746, 540, 3282, 29915, 29873, 29892, 278, 379, 6897, 892, 12624, 13, 20620, 29899, 1181, 5715, 29889, 350, 29974, 13, 29934, 440, 300, 29901, 450, 2507, 11316, 18172, 29889, 12753, 11405, 8020, 306, 1348, 1556, 723, 505, 13, 509, 11932, 1075, 363, 263, 10476, 9176, 696, 554, 347, 5881, 29892, 3138, 15243, 523, 29915, 29879, 4549, 822, 6270, 13, 546, 13390, 18172, 278, 1347, 310, 2253, 8090, 540, 29915, 29879, 750, 975, 278, 1833, 1550, 29889, 13, 8439, 471, 871, 697, 2289, 4319, 1708, 306, 4446, 29892, 322, 393, 471, 746, 540, 1235, 7266, 335, 280, 13, 29894, 919, 326, 675, 1075, 411, 6210, 19342, 292, 1623, 278, 7256, 310, 278, 364, 682, 29889, 2398, 29892, 372, 471, 13, 1686, 635, 4485, 586, 29915, 29879, 12570, 29889, 350, 13, 9802, 586, 29901, 739, 29915, 29879, 763, 6421, 714, 310, 263, 4646, 29885, 598, 29889, 2315, 670, 3748, 756, 6077, 2820, 13, 16076, 6421, 1250, 515, 24092, 29889, 739, 29915, 29879, 763, 263, 7688, 756, 1063, 26239, 1283, 670, 13, 9344, 414, 29889, 940, 29915, 29879, 2599, 13052, 296, 12534, 6609, 29892, 3907, 269, 1406, 14517, 322, 15613, 670, 13, 29890, 1131, 793, 1449, 29889, 18585, 29892, 540, 9007, 29915, 29873, 4922, 29892, 541, 372, 29915, 29879, 1603, 2675, 304, 2125, 263, 2217, 13, 2230, 29892, 565, 410, 11476, 18172, 29892, 304, 679, 304, 988, 540, 471, 1833, 1629, 29889, 350, 13, 2182, 524, 284, 29901, 17812, 523, 540, 10205, 839, 29892, 727, 29915, 29879, 694, 7404, 1048, 372, 29889, 940, 471, 17770, 278, 13, 29886, 2707, 599, 4646, 322, 750, 901, 1135, 263, 2846, 748, 491, 1075, 14372, 3080, 1460, 10769, 304, 1207, 13, 14481, 3799, 29889, 3600, 23746, 471, 3109, 1135, 472, 967, 1900, 408, 1532, 29889, 7963, 3730, 540, 13, 26807, 1250, 411, 263, 12234, 11813, 322, 11828, 3748, 24211, 17724, 29889, 315, 13, 29903, 283, 764, 29901, 5674, 29892, 540, 9007, 29915, 29873, 472, 670, 1900, 29892, 541, 372, 8959, 9007, 29915, 29873, 763, 278, 4940, 13, 29888, 809, 8090, 2845, 29889, 3600, 28399, 471, 1568, 2253, 15243, 523, 322, 29892, 1550, 540, 1754, 13, 29885, 391, 6926, 411, 278, 2653, 384, 29892, 540, 5148, 1568, 901, 763, 278, 2178, 29899, 16213, 1135, 278, 2921, 271, 29889, 13, 29931, 574, 9176, 29901, 3600, 8589, 15243, 523, 471, 472, 263, 1781, 931, 29892, 322, 1550, 372, 3282, 29915, 29873, 679, 278, 13, 14318, 2675, 577, 1568, 29892, 540, 1258, 278, 1492, 2655, 491, 5839, 292, 372, 29889, 1126, 408, 363, 278, 6985, 29973, 13, 10401, 29915, 29879, 278, 6263, 29973, 350, 13, 5894, 276, 1292, 29901, 319, 2217, 901, 12500, 1135, 9670, 15243, 523, 29892, 607, 471, 7575, 304, 1074, 29889, 940, 13, 11102, 29876, 29915, 29873, 20751, 287, 373, 278, 14890, 363, 393, 1781, 664, 297, 4958, 310, 3291, 29892, 541, 372, 471, 13, 932, 4361, 630, 1661, 621, 6393, 29889, 350, 29899, 13, 29968, 309, 914, 29901, 2688, 892, 5934, 2645, 278, 3748, 393, 540, 29915, 29879, 5948, 278, 1556, 21210, 573, 13, 29950, 370, 472, 6944, 29892, 541, 363, 777, 2769, 508, 29915, 29873, 14240, 393, 304, 3748, 18845, 29889, 306, 13, 2886, 393, 263, 19253, 292, 3229, 29892 ]
1,333,560
0
CommonCrawl
5
7
and yet I have no real reason to disbelieve it. Perhaps he's having some mental issues when it comes to games. Tonight he wasn't terrible, but he certainly wasn't stunning out their either. C+ Sundstrom: Continues to be less than impressive offensively, but also continues to save his teammates with slick and timely defensive plays. I wish he'd put in more of a second effort, though, because there's so much that's hidden in there. B Juneau: Not a bad game, but nothing special either. He did his job in the defensive end, and at this point, I think we can all say that's the best we're going to get out of him on most nights. B- Ward: I'm really glad to see him back there and being the energy guy on the third line. I think he brings a lot and I hope he stays there for the foreseeable future. HOWEVER. The powerplay? The second line? B Zednik: He's making things happen consistently now, even when his linemates aren't up to the task. I feel his confidence is riding high at this moment and he's thinking like a scorer – sometimes shooting when he should be passing, but that's what you get when you have someone who's a potential 30-goal man. B+ Balej: I fail to see why he was yanked off the line in the third, even if this game was slightly less impressive than last. When he's got the puck, he's exciting and makes things happen. A few times it looked like he was just about to get his first points in the NHL. Admittedly, though, off the puck he still needs work at this level. Not insofar as hitting or defence goes, because he's no worse than half the team (though he definitely needs work on positioning in his own zone), but he doesn't always know where to go to compliment his linemates. B- Ribeiro: Oh, the flack I'm going to get on this one. Yes, he got two points including a wonderful play for the game winner and a delicious little tip in front of the net, but other than that, he was dominated most of the night. You can see that his game is now understood. Instead of letting him dangle behind the net, they come in and hit him hard. Defensively it was a large struggle tonight, and if his line was caught down low, it was often because his coverage was marginally off. I love that he's producing, don't get me wrong, but he's still got to work on the other aspects of his game and not be invisible for most of the night barring two plays. C+ Ryder: Hey, he's even turning into Mr. Consistency. He may not have produced tonight, but man he makes things happen. You can tell he's 23 and not 18, though. He's got so much more poise than the younger rookies. B Bulis: When he has shifts where he is more concerned about not getting burned, he's far less effective than when he goes in deep, hits guys, and makes things happen. It was a good, not great night for him. Really, not that he's on the first line, he's just not nearly as impressive as he was on the third. Koivu: The first half of the game saw him playing good, but uninspired hockey. After that, though, he was once again creating all over the place. And when he's on, that line gets chance after chance – which they did in the third. Julien: I can understand moving to a more defensive stance so as to maintain a point for a road game and for the sake of confidence, however I'm really disappointed that he didn't put Balej on the powerplay. I feel that was a large error tonight. Anyone remember who was on the doorstep when Zednik scored the winner? Yes, that was Andrei Markov pinching in and making things happen. Tonight was the third in a series of games were we saw his play continue to improve, and this bodes really well for the Habs. If he can get back on his game,
-0.291995
-0.945741
-0.964031
-1.023579
[ -0.7474122827728377, 0.1634218775113381 ]
[ -1.1731505346067523, -0.7183308749540839 ]
[ -1.1954627098626331, -0.7325987227300041 ]
[ -1.2755868118928533, -0.7715713224188571 ]
1,024
[ 512, 512 ]
[ 322, 3447, 306, 505, 694, 1855, 2769, 304, 766, 6596, 2418, 372, 29889, 13, 5894, 4252, 540, 29915, 29879, 2534, 777, 19119, 5626, 746, 372, 5304, 304, 8090, 29889, 17812, 523, 540, 9007, 29915, 29873, 13, 357, 11710, 29892, 541, 540, 8959, 9007, 29915, 29873, 380, 27389, 714, 1009, 2845, 29889, 315, 29974, 13, 29903, 870, 303, 456, 29901, 2866, 262, 1041, 304, 367, 3109, 1135, 21210, 573, 1283, 575, 3598, 29892, 541, 884, 13, 1285, 262, 1041, 304, 4078, 670, 3815, 29885, 1078, 411, 269, 1406, 322, 5335, 873, 822, 6270, 13582, 29889, 306, 6398, 13, 354, 29915, 29881, 1925, 297, 901, 310, 263, 1473, 7225, 29892, 2466, 29892, 1363, 727, 29915, 29879, 577, 1568, 393, 29915, 29879, 13, 10892, 297, 727, 29889, 350, 13, 29967, 1540, 585, 29901, 2216, 263, 4319, 3748, 29892, 541, 3078, 4266, 2845, 29889, 940, 1258, 670, 4982, 297, 278, 13, 1753, 6270, 1095, 29892, 322, 472, 445, 1298, 29892, 306, 1348, 591, 508, 599, 1827, 393, 29915, 29879, 278, 1900, 591, 29915, 276, 13, 17696, 304, 679, 714, 310, 1075, 373, 1556, 4646, 29879, 29889, 350, 29899, 13, 29956, 538, 29901, 306, 29915, 29885, 2289, 10932, 304, 1074, 1075, 1250, 727, 322, 1641, 278, 5864, 1410, 29891, 373, 278, 13, 22585, 1196, 29889, 306, 1348, 540, 23522, 263, 3287, 322, 306, 4966, 540, 27111, 727, 363, 278, 13, 1454, 968, 29872, 519, 5434, 29889, 29832, 8851, 5348, 29889, 450, 3081, 1456, 29973, 450, 1473, 1196, 29973, 350, 13, 29999, 287, 5585, 29901, 940, 29915, 29879, 3907, 2712, 3799, 5718, 2705, 1286, 29892, 1584, 746, 670, 6276, 331, 1078, 13, 8326, 29915, 29873, 701, 304, 278, 3414, 29889, 306, 4459, 670, 16420, 338, 364, 4821, 1880, 472, 445, 3256, 322, 13, 354, 29915, 29879, 7291, 763, 263, 885, 9386, 785, 6041, 27904, 746, 540, 881, 367, 6819, 29892, 541, 13, 5747, 29915, 29879, 825, 366, 679, 746, 366, 505, 4856, 1058, 29915, 29879, 263, 7037, 29871, 29941, 29900, 29899, 28111, 767, 29889, 350, 29974, 13, 29933, 744, 29926, 29901, 306, 4418, 304, 1074, 2020, 540, 471, 343, 804, 287, 1283, 278, 1196, 297, 278, 4654, 29892, 1584, 565, 13, 1366, 3748, 471, 10029, 3109, 21210, 573, 1135, 1833, 29889, 1932, 540, 29915, 29879, 2355, 278, 2653, 384, 29892, 540, 29915, 29879, 13, 735, 29883, 11407, 322, 3732, 2712, 3799, 29889, 319, 2846, 3064, 372, 5148, 763, 540, 471, 925, 1048, 13, 517, 679, 670, 937, 3291, 297, 278, 405, 15444, 29889, 2087, 29885, 4430, 368, 29892, 2466, 29892, 1283, 278, 2653, 384, 540, 1603, 13, 484, 5779, 664, 472, 445, 3233, 29889, 2216, 297, 578, 15641, 408, 29425, 470, 28399, 5771, 29892, 1363, 540, 29915, 29879, 13, 1217, 15029, 1135, 4203, 278, 3815, 313, 3592, 540, 11630, 4225, 664, 373, 2602, 292, 297, 13, 22880, 1914, 10640, 511, 541, 540, 1838, 29915, 29873, 2337, 1073, 988, 304, 748, 304, 13162, 2073, 670, 13, 1915, 331, 1078, 29889, 350, 29899, 13, 29934, 18673, 3350, 29901, 6439, 29892, 278, 285, 2364, 306, 29915, 29885, 2675, 304, 679, 373, 445, 697, 29889, 3869, 29892, 540, 2355, 1023, 3291, 13, 18271, 263, 20695, 1708, 363, 278, 3748, 19576, 322, 263, 628, 14803, 2217, 6872, 297, 13, 8862, 310, 278, 7787, 29892, 541, 916, 1135, 393, 29892, 540, 471, 8022, 630, 1556, 310, 278, 4646, 29889, 887, 13, 3068, 1074, 393, 670, 3748, 338, 1286, 11098, 29889, 8669, 310, 27697, 1075, 270, 2521, 5742, 13, 1552, 7787, 29892, 896, 2041, 297, 322, 7124, 1075, 2898, 29889, 5282, 575, 3598, 372, 471, 263, 2919, 21117, 13, 880, 523, 29892, 322, 565, 670, 1196, 471, 12624, 1623, 4482, 29892, 372, 471, 4049, 1363, 670, 23746, 13, 11102, 5906, 635, 1283, 29889, 306, 5360, 393, 540, 29915, 29879, 20811, 29892, 1016, 29915, 29873, 679, 592, 2743, 29892, 541, 540, 29915, 29879, 13, 303, 453, 2355, 304, 664, 373, 278, 916, 21420, 310, 670, 3748, 322, 451, 367, 27597, 363, 1556, 13, 974, 278, 4646, 2594, 5393, 1023, 13582, 29889, 315, 29974, 13, 29934, 29891, 672, 29901, 18637, 29892, 540, 29915, 29879, 1584, 14712, 964, 3237, 29889, 2138, 391, 3819, 29889, 940, 1122, 451, 505, 7371, 13, 880, 523, 29892, 541, 767, 540, 3732, 2712, 3799, 29889, 887, 508, 2649, 540, 29915, 29879, 29871, 29906, 29941, 322, 451, 29871, 29896, 29947, 29892, 13, 3592, 29889, 940, 29915, 29879, 2355, 577, 1568, 901, 772, 895, 1135, 278, 20023, 696, 554, 583, 29889, 350, 13, 29933, 352, 275, 29901, 1932, 540, 756, 528, 17741, 988, 540, 338, 901, 15041, 1048, 451, 2805, 13, 18712, 287, 29892, 540, 29915, 29879, 2215, 3109, 11828, 1135, 746, 540, 5771, 297, 6483, 29892, 19572, 18239, 29892, 322, 3732, 13, 386, 886, 3799, 29889, 739, 471, 263, 1781, 29892, 451, 2107, 4646, 363, 1075, 29889, 830, 635, 29892, 451, 393, 540, 29915, 29879, 373, 13, 1552, 937, 1196, 29892, 540, 29915, 29879, 925, 451, 8886, 408, 21210, 573, 408, 540, 471, 373, 278, 4654, 29889, 13, 29968, 29877, 440, 29884, 29901, 450, 937, 4203, 310, 278, 3748, 4446, 1075, 8743, 1781, 29892, 541, 443, 262, 1028, 2859, 13, 1251, 384, 1032, 29889, 2860, 393, 29892, 2466, 29892, 540, 471, 2748, 1449, 4969, 599, 975, 278, 2058, 29889, 1126, 13, 8256, 540, 29915, 29879, 373, 29892, 393, 1196, 4947, 8825, 1156, 8825, 785, 607, 896, 1258, 297, 278, 4654, 29889, 13, 27501, 819, 29901, 306, 508, 2274, 8401, 304, 263, 901, 822, 6270, 380, 749, 577, 408, 304, 7344, 13, 29874, 1298, 363, 263, 6520, 3748, 322, 363, 278, 16563, 310, 16420, 29892, 3138, 306, 29915, 29885, 2289, 13, 2218, 932, 2461, 287, 393, 540, 3282, 29915, 29873, 1925, 350, 744, 29926, 373, 278, 3081, 1456, 29889, 306, 4459, 393, 471, 263, 2919, 13, 2704, 15243, 523, 29889, 13, 10773, 650, 6456, 1058, 471, 373, 278, 3050, 10568, 746, 796, 287, 5585, 15569, 278, 19576, 29973, 3869, 29892, 13, 5747, 471, 1126, 5803, 4485, 586, 12534, 305, 292, 297, 322, 3907, 2712, 3799, 29889, 17812, 523, 471, 278, 13, 22585, 297, 263, 3652, 310, 8090, 892, 591, 4446, 670, 1708, 6773, 304, 11157, 29892, 322, 445, 13, 29890, 2631, 2289, 1532, 363, 278, 379, 6897, 29889, 960, 540, 508, 679, 1250, 373, 670, 3748, 29892 ]
1,333,560
1,024
CommonCrawl
5
7
Home Fiction SECOND SIGHT by Katherine Steblen Fiction - Year III - Number 15 - August 2018 SECOND SIGHT by Katherine Steblen SECOND SIGHT by Katherine Steblen "Kids are back," said Jerry, wiping gummy residue from his eyes. Leaves were mashed against his face from where he'd passed out the night before in a whiskey haze, marks of stems tattooed across his ruddy cheeks. "Ross, the kids!" he repeated louder, pushing the reclined figure next to him, his street-buddy wrapped up in a blanket. Ross rolled over and looked up into a pleasing silhouette, backlit by the morning sun—an hourglass shape of a girl. For three days in a row she'd shown up at Buena Vista Park, bringing sandwiches. She was accompanied by a couple of other kids who looked to be her age, each of them wading through the humped forms of sleeping men, rousing them and offering food. Ross guessed she was in her late teens, early twenties. The girl towered above him, dangling a brown paper bag aloft. "Breakfast?" she asked, swinging the bag to and fro, a starburst in her blue eyes. She made a pretty picture with her lovely wide mouth and cascade of beige freckles across her nose. A doll of a girl, thought Ross, someone he imagined had a pretty name like "Rosie." "Lay it on me," he said, his voice sounding like gravel shaken-up in a can. He was a big man. Most days he woke up with a storm of hunger thundering across his belly. A chef by trade, he was used to three squares a day and then some, but after several months of living in the park, his robust girth shrank. He still appeared big, but his belly was now concave. "Much obliged," said Ross, tipping an imaginary hat. He looked at the shining face of his benefactor. She appeared pleased, almost grateful, to have him accept the bag. He smiled broadly in a show of large teeth, yellowed at the edges. He hurriedly opened the bag and wolfed down everything inside it—a sandwich of peanut butter and jelly spread thick on grainy bread, a shiny apple, and a bag of Cheeto's. There was even a tiny bottle of vodka, the kind people drank on airplanes to take the edge off. Ross took a sip, hiding the rest for later. In a dainty gesture, the girl scooped her gauzy skirt around herself and sat down. Ross knew she expected conversation in exchange for the food. He didn't mind; he missed the company of women. Maybe she was doing research on the homeless in San Francisco. There'd been others coming around asking questions, but none of them brought food and they weren't worth his time. Rosie was different somehow—not here as a voyeur, it didn't seem so; she looked him straight in the eyes. When she'd first strolled into their midst, Ross felt a flicker of protective caution. It's not the old men he feared might hurt her, but the younger ones, like Jupiter. Most of those boys were sleeping it off in the am. but sometimes Jupiter was still tweaking. No amount of liquor quelled his craziness, spouting random phrases that sounded like hammers striking metal. Ross heard one of the research-kids call it "word-salad." Jupiter looked wild sometimes, his pupils expanding to fill his eyes so that the blue looked black. Ross knew to be alert when Jupiter's eyes become a solar eclipse. He'd growl at Ross, The fuck they want with me? He said it even when no one else was around, only the two of them under a tree, sharing a joint. Ross guessed that people thought all the homeless were like Jupiter, but it wasn't like that. Some just had a bad turn and no place else to go. "How long you been living outdoors?" asked the girl. Ross laughed. "You mean homeless? How long I been homeless? It's okay to say it." He tapped his chest. "Home's in here now. I got tossed off that gerbil wheel with no regrets. Should'a
0.874283
-0.688786
-0.875896
-1.192343
[ 1.2084842298373923, 0.5400826204859972 ]
[ -0.8436748756457642, -0.5338961310791829 ]
[ -0.7135769150396221, -1.0382157662888085 ]
[ -1.35362791994044, -1.0310580066770823 ]
1,024
[ 512, 512 ]
[ 8778, 383, 2463, 3725, 6007, 29928, 317, 22530, 491, 476, 16490, 2443, 2204, 264, 13, 29943, 2463, 448, 8905, 4786, 448, 9681, 29871, 29896, 29945, 448, 3111, 29871, 29906, 29900, 29896, 29947, 13, 1660, 6007, 29928, 317, 22530, 491, 476, 16490, 2443, 2204, 264, 13, 1660, 6007, 29928, 317, 22530, 13, 1609, 476, 16490, 2443, 2204, 264, 13, 29908, 29968, 4841, 526, 1250, 1699, 1497, 23052, 29892, 281, 666, 292, 330, 11770, 10995, 434, 515, 670, 5076, 29889, 951, 5989, 892, 286, 25936, 2750, 670, 3700, 515, 988, 540, 29915, 29881, 4502, 714, 278, 4646, 1434, 297, 263, 17352, 1989, 447, 911, 29892, 17997, 310, 380, 1567, 260, 16234, 29877, 287, 4822, 670, 29051, 4518, 923, 14541, 29889, 376, 29934, 2209, 29892, 278, 413, 4841, 3850, 540, 10324, 301, 283, 672, 29892, 27556, 278, 337, 695, 1312, 4377, 2446, 304, 1075, 29892, 670, 11952, 29899, 15841, 4518, 21021, 701, 297, 263, 9654, 300, 29889, 13, 29934, 2209, 29081, 975, 322, 5148, 701, 964, 263, 5644, 5832, 4047, 10774, 2353, 29892, 1250, 19411, 491, 278, 7250, 6575, 30003, 273, 7234, 29050, 8267, 310, 263, 7826, 29889, 1152, 2211, 3841, 297, 263, 1948, 1183, 29915, 29881, 4318, 701, 472, 5373, 2386, 478, 2079, 4815, 29892, 20794, 11982, 16416, 267, 29889, 2296, 471, 21302, 491, 263, 7303, 310, 916, 413, 4841, 1058, 5148, 304, 367, 902, 5046, 29892, 1269, 310, 963, 281, 9382, 1549, 278, 3165, 9795, 7190, 310, 8709, 292, 1757, 29892, 364, 681, 292, 963, 322, 27032, 9687, 29889, 13693, 4140, 287, 1183, 471, 297, 902, 5683, 734, 575, 29892, 4688, 3252, 296, 583, 29889, 13, 1576, 7826, 19372, 287, 2038, 1075, 29892, 270, 574, 1847, 263, 17354, 5650, 19548, 394, 29877, 615, 29889, 13, 29908, 20130, 557, 11255, 3026, 1183, 4433, 29892, 24500, 292, 278, 19548, 304, 322, 14671, 29892, 263, 5810, 8399, 303, 297, 902, 7254, 5076, 29889, 2296, 1754, 263, 5051, 7623, 411, 902, 12355, 873, 9377, 13394, 322, 3209, 6332, 310, 367, 2231, 3005, 384, 793, 4822, 902, 26414, 29889, 319, 11232, 310, 263, 7826, 29892, 2714, 13693, 29892, 4856, 540, 6382, 1312, 750, 263, 5051, 1024, 763, 376, 29934, 359, 347, 1213, 13, 29908, 29931, 388, 372, 373, 592, 1699, 540, 1497, 29892, 670, 7314, 6047, 292, 763, 2646, 955, 528, 9424, 29899, 786, 297, 263, 508, 29889, 13, 3868, 471, 263, 4802, 767, 29889, 7849, 3841, 540, 281, 6946, 701, 411, 263, 14280, 310, 18757, 261, 266, 870, 3241, 4822, 670, 1339, 368, 29889, 319, 14547, 491, 11302, 29892, 540, 471, 1304, 304, 2211, 25256, 263, 2462, 322, 769, 777, 29892, 541, 1156, 3196, 7378, 310, 8471, 297, 278, 14089, 29892, 670, 16424, 330, 7515, 528, 10003, 29889, 940, 1603, 7470, 4802, 29892, 541, 670, 1339, 368, 471, 1286, 378, 1113, 345, 29889, 13, 29908, 29924, 987, 24474, 1699, 1497, 13693, 29892, 260, 17347, 385, 6382, 3821, 3056, 29889, 940, 5148, 472, 278, 528, 2827, 3700, 310, 670, 7795, 7168, 29889, 2296, 7470, 22301, 29892, 4359, 28656, 29892, 304, 505, 1075, 3544, 278, 19548, 29889, 940, 25156, 7300, 368, 297, 263, 1510, 310, 2919, 25287, 29892, 13328, 287, 472, 278, 12770, 29889, 940, 29117, 368, 6496, 278, 19548, 322, 281, 4369, 287, 1623, 4129, 2768, 372, 30003, 29874, 11982, 16416, 310, 1236, 273, 329, 541, 357, 322, 12736, 368, 9677, 12003, 373, 2646, 4901, 18423, 29892, 263, 528, 4901, 26163, 29892, 322, 263, 19548, 310, 315, 4155, 29877, 29915, 29879, 29889, 1670, 471, 1584, 263, 21577, 18046, 280, 310, 325, 397, 1335, 29892, 278, 2924, 2305, 270, 10003, 373, 4799, 9018, 267, 304, 2125, 278, 7636, 1283, 29889, 13693, 3614, 263, 269, 666, 29892, 25508, 278, 1791, 363, 2678, 29889, 13, 797, 263, 270, 475, 1017, 29502, 29892, 278, 7826, 885, 26793, 287, 902, 13395, 1537, 2071, 2728, 2820, 8735, 322, 3290, 1623, 29889, 13693, 6363, 1183, 3806, 14983, 297, 14523, 363, 278, 9687, 29889, 940, 3282, 29915, 29873, 3458, 29936, 540, 13726, 278, 5001, 310, 5866, 29889, 7198, 1183, 471, 2599, 5925, 373, 278, 3632, 6393, 297, 3087, 8970, 29889, 1670, 29915, 29881, 1063, 4045, 6421, 2820, 6721, 5155, 29892, 541, 5642, 310, 963, 6296, 9687, 322, 896, 2949, 264, 29915, 29873, 7088, 670, 931, 29889, 5678, 347, 471, 1422, 10431, 30003, 1333, 1244, 408, 263, 992, 4099, 332, 29892, 372, 3282, 29915, 29873, 2833, 577, 29936, 1183, 5148, 1075, 7812, 297, 278, 5076, 29889, 13, 10401, 1183, 29915, 29881, 937, 380, 24476, 964, 1009, 29214, 29892, 13693, 7091, 263, 285, 1406, 261, 310, 12566, 573, 5777, 918, 29889, 739, 29915, 29879, 451, 278, 2030, 1757, 540, 1238, 1965, 1795, 21682, 902, 29892, 541, 278, 20023, 6743, 29892, 763, 27441, 1524, 29889, 7849, 310, 1906, 12544, 892, 8709, 292, 372, 1283, 297, 278, 626, 29889, 541, 6041, 27441, 1524, 471, 1603, 7780, 5086, 29889, 1939, 5253, 310, 15617, 272, 7594, 839, 670, 274, 9504, 3335, 29892, 805, 449, 292, 4036, 12216, 2129, 393, 6047, 287, 763, 298, 4850, 414, 29191, 11915, 29889, 13693, 6091, 697, 310, 278, 5925, 29899, 29895, 4841, 1246, 372, 376, 1742, 29899, 19585, 328, 1213, 27441, 1524, 5148, 8775, 6041, 29892, 670, 23449, 2719, 7985, 292, 304, 5445, 670, 5076, 577, 393, 278, 7254, 5148, 4628, 29889, 13693, 6363, 304, 367, 6655, 746, 27441, 1524, 29915, 29879, 5076, 4953, 263, 21635, 16517, 29889, 940, 29915, 29881, 6548, 29880, 472, 13693, 29892, 450, 285, 2707, 896, 864, 411, 592, 29973, 940, 1497, 372, 1584, 746, 694, 697, 1683, 471, 2820, 29892, 871, 278, 1023, 310, 963, 1090, 263, 5447, 29892, 19383, 263, 14002, 29889, 13, 29934, 2209, 4140, 287, 393, 2305, 2714, 599, 278, 3632, 6393, 892, 763, 27441, 1524, 29892, 541, 372, 9007, 29915, 29873, 763, 393, 29889, 3834, 925, 750, 263, 4319, 2507, 322, 694, 2058, 1683, 304, 748, 29889, 13, 29908, 5328, 1472, 366, 1063, 8471, 714, 1867, 943, 3026, 4433, 278, 7826, 29889, 13, 29934, 2209, 19090, 29889, 376, 3492, 2099, 3632, 6393, 29973, 1128, 1472, 306, 1063, 3632, 6393, 29973, 739, 29915, 29879, 20759, 304, 1827, 372, 1213, 940, 260, 17280, 670, 521, 342, 29889, 376, 11184, 29915, 29879, 297, 1244, 1286, 29889, 306, 2355, 28189, 287, 1283, 393, 9814, 18152, 18875, 411, 694, 1072, 27487, 29889, 10575, 29915, 29874 ]
1,333,565
0
CommonCrawl
10
8
jumped off long ago." "What'd you do before… this?" She gestured to the demolished blankets and battered duffle bags, empty bottles and paper wrappers scattered in disarray. Ross leveled his gaze and thrust his neck forward so that his face nearly touched her nose. She didn't flinch. "I was a bum!" he said, emphasizing the last word. His eyebrows looked unruly, with sprouts of white curling this way and that. Once he'd been vain enough to pluck those long hairs, but now he let them be. All of his features were large—his eyes, his mouth, his nose. The girl laughed uncomfortably, shook her head and squinted at him. "Aren't you a bum now? Don't you think that sleeping outside makes people think you're a bum? That's sort-of the definition of one, isn't it?" Ross clarified: "I don't mean that kind of a bum, sleeping on the ground and what not. I mean I was an asshole to people, a complete asshole." He hadn't expected to be living outdoors, but the motorcycle accident had left his right arm paralyzed. He could no longer slice, chop, or dice; could no longer smack people in the head, or play pool; couldn't make a living doing what he knew how to do. "I once thought the world owed me something. If it wasn't handed to me, I'd steal it; screwed friends over and didn't give a shit; fucked women I didn't care about; busted-up faces in bars after too many shots of Tequila." He exhaled loudly, as if in regret, or maybe just tired after stringing so many words together first thing in the morning. The girl nodded. "What'd it feel like?" she asked. "What'd you mean?" said Ross. "What'd what feel like? Busting heads?" "No, I mean, what'd it feel like to be a bum, on the inside? I heard you say what it looks like, but what'd it feel like?" Ross sat back. No one had ever asked him a question like that before. He took a deep breath. "I once found an old can of Planter's Peanuts. You ever see their logo—spiffy dude in a top hat, holding a cane? That was me—good looking, buff, drove a Harley, always had cash, a big roll of it; pissed it away every weekend. Anyways, I opened that can of nuts ready to cram a handful into my mouth and the thing was crawling with worms; I mean cocoons, moths hatching out, just everything alive in there; all that shit living down in the dark. That was me, on the inside." He looked at Rosie's slender leg, imagined running his sandpaper palm up the inside of her pale thigh; but no, he wouldn't let himself do that to Rosie. "I feel that way too," she said. "Like people see me all sparkly but there's nothing in here but shadows." She put her hand to her chest. "How can that be, darling?" laughed Ross. "Shadows? What'd you ever do to anybody?" "I don't know." She drew her knees up and wove her arms in a loop around her legs. "I just feel that way all the time." Her voice caught raspy, mid-sentence. "Look at what you do for people. I'd 'a woke up hungry if it weren't for you," said Ross. "Why you bringing us food? You're good to do it." "I do it," she said, "to feel worthy." "Worthy?" Ross pulled a rubber band off his wrist and tied back his long hair into a ponytail. He'd adjusted to using only one hand for everything and was about as proud of that as he'd been about anything he'd mastered his whole life. His hair used to be a deep chestnut brown, but after the wreck, his head was shaved and it had grown back in slate-gray. He remembered the vanity of it, combing out that thick mane in front of the mirror each day. Now he couldn't remember the last time he'd seen his own reflection
0.964682
-0.954694
-0.926304
-0.91237
[ 0.8030603028537592, 1.1263037040974666 ]
[ -0.7433996750924199, -1.1659880202815136 ]
[ -0.6977254086309704, -1.154882853456485 ]
[ -0.7338514535291902, -1.0908895228468987 ]
1,024
[ 512, 512 ]
[ 12500, 287, 1283, 1472, 8020, 1213, 13, 29908, 5618, 29915, 29881, 366, 437, 1434, 30098, 445, 3026, 2296, 7737, 2955, 304, 278, 27745, 3276, 9654, 1691, 322, 10193, 287, 868, 600, 280, 289, 810, 29892, 4069, 18046, 793, 322, 5650, 11463, 22437, 29574, 297, 766, 2378, 29889, 13, 29934, 2209, 454, 345, 839, 670, 12642, 29872, 322, 29684, 670, 18873, 6375, 577, 393, 670, 3700, 8886, 23051, 902, 26414, 29889, 2296, 3282, 29915, 29873, 1652, 22466, 29889, 376, 29902, 471, 263, 289, 398, 3850, 540, 1497, 29892, 19310, 5281, 278, 1833, 1734, 29889, 3600, 321, 29891, 774, 5727, 5148, 443, 29878, 11850, 29892, 411, 7689, 17718, 310, 4796, 3151, 1847, 445, 982, 322, 393, 29889, 9038, 540, 29915, 29881, 1063, 15722, 3307, 304, 715, 2707, 1906, 1472, 11315, 29879, 29892, 541, 1286, 540, 1235, 963, 367, 29889, 2178, 310, 670, 5680, 892, 2919, 30003, 22880, 5076, 29892, 670, 13394, 29892, 670, 26414, 29889, 13, 1576, 7826, 19090, 443, 510, 3921, 2197, 29892, 25239, 902, 2343, 322, 10674, 524, 287, 472, 1075, 29889, 376, 29909, 1267, 29915, 29873, 366, 263, 289, 398, 1286, 29973, 3872, 29915, 29873, 366, 1348, 393, 8709, 292, 5377, 3732, 2305, 1348, 366, 29915, 276, 263, 289, 398, 29973, 2193, 29915, 29879, 2656, 29899, 974, 278, 5023, 310, 697, 29892, 3508, 29915, 29873, 372, 3026, 13, 29934, 2209, 7542, 2164, 29901, 376, 29902, 1016, 29915, 29873, 2099, 393, 2924, 310, 263, 289, 398, 29892, 8709, 292, 373, 278, 5962, 322, 825, 451, 29889, 306, 2099, 306, 471, 385, 408, 845, 1772, 304, 2305, 29892, 263, 4866, 408, 845, 1772, 1213, 940, 27222, 29915, 29873, 3806, 304, 367, 8471, 714, 1867, 943, 29892, 541, 278, 10992, 23090, 11423, 750, 2175, 670, 1492, 5075, 610, 284, 12339, 287, 29889, 940, 1033, 694, 5520, 22780, 29892, 521, 459, 29892, 470, 17629, 29936, 1033, 694, 5520, 1560, 547, 2305, 297, 278, 2343, 29892, 470, 1708, 11565, 29936, 8496, 29915, 29873, 1207, 263, 8471, 2599, 825, 540, 6363, 920, 304, 437, 29889, 376, 29902, 2748, 2714, 278, 3186, 8152, 287, 592, 1554, 29889, 960, 372, 9007, 29915, 29873, 29692, 304, 592, 29892, 306, 29915, 29881, 1886, 284, 372, 29936, 885, 3973, 287, 7875, 975, 322, 3282, 29915, 29873, 2367, 263, 528, 277, 29936, 285, 2707, 287, 5866, 306, 3282, 29915, 29873, 2562, 1048, 29936, 289, 16656, 29899, 786, 17240, 297, 22306, 1156, 2086, 1784, 528, 1862, 310, 323, 1686, 4233, 1213, 940, 429, 29882, 7943, 22526, 368, 29892, 408, 565, 297, 28883, 29892, 470, 5505, 925, 23407, 1156, 1347, 292, 577, 1784, 3838, 4208, 937, 2655, 297, 278, 7250, 29889, 13, 1576, 7826, 18778, 7176, 29889, 376, 5618, 29915, 29881, 372, 4459, 763, 3026, 1183, 4433, 29889, 13, 29908, 5618, 29915, 29881, 366, 2099, 3026, 1497, 13693, 29889, 376, 5618, 29915, 29881, 825, 4459, 763, 29973, 350, 504, 292, 15883, 3026, 13, 29908, 3782, 29892, 306, 2099, 29892, 825, 29915, 29881, 372, 4459, 763, 304, 367, 263, 289, 398, 29892, 373, 278, 2768, 29973, 306, 6091, 366, 1827, 825, 372, 3430, 763, 29892, 541, 825, 29915, 29881, 372, 4459, 763, 3026, 13, 29934, 2209, 3290, 1250, 29889, 1939, 697, 750, 3926, 4433, 1075, 263, 1139, 763, 393, 1434, 29889, 940, 3614, 263, 6483, 16172, 29889, 376, 29902, 2748, 1476, 385, 2030, 508, 310, 8402, 357, 29915, 29879, 3938, 273, 8842, 29889, 887, 3926, 1074, 1009, 20194, 30003, 1028, 2593, 29891, 868, 311, 297, 263, 2246, 3056, 29892, 13587, 263, 508, 29872, 29973, 2193, 471, 592, 30003, 16773, 3063, 29892, 20487, 29892, 26603, 263, 3536, 2330, 29892, 2337, 750, 274, 1161, 29892, 263, 4802, 9679, 310, 372, 29936, 282, 790, 287, 372, 3448, 1432, 4723, 355, 29889, 3139, 1994, 29892, 306, 6496, 393, 508, 310, 302, 8842, 7960, 304, 2181, 314, 263, 1361, 1319, 964, 590, 13394, 322, 278, 2655, 471, 29349, 1847, 411, 281, 555, 29879, 29936, 306, 2099, 274, 6235, 787, 29892, 25550, 29879, 298, 905, 292, 714, 29892, 925, 4129, 18758, 297, 727, 29936, 599, 393, 528, 277, 8471, 1623, 297, 278, 6501, 29889, 2193, 471, 592, 29892, 373, 278, 2768, 1213, 940, 5148, 472, 5678, 347, 29915, 29879, 2243, 1581, 2814, 29892, 6382, 1312, 2734, 670, 11982, 19773, 5112, 29885, 701, 278, 2768, 310, 902, 15509, 266, 1141, 29936, 541, 694, 29892, 540, 7656, 29915, 29873, 1235, 3654, 437, 393, 304, 5678, 347, 29889, 13, 29908, 29902, 4459, 393, 982, 2086, 1699, 1183, 1497, 29889, 376, 27552, 2305, 1074, 592, 599, 16267, 368, 541, 727, 29915, 29879, 3078, 297, 1244, 541, 528, 23626, 1213, 2296, 1925, 902, 1361, 304, 902, 521, 342, 29889, 13, 29908, 5328, 508, 393, 367, 29892, 5424, 1847, 3026, 19090, 13693, 29889, 376, 2713, 23626, 29973, 1724, 29915, 29881, 366, 3926, 437, 304, 16357, 3026, 13, 29908, 29902, 1016, 29915, 29873, 1073, 1213, 2296, 15010, 902, 17905, 267, 701, 322, 281, 994, 902, 10188, 297, 263, 2425, 2820, 902, 21152, 29889, 376, 29902, 925, 4459, 393, 982, 599, 278, 931, 1213, 2439, 7314, 12624, 22641, 2272, 29892, 7145, 29899, 18616, 663, 29889, 13, 29908, 14959, 472, 825, 366, 437, 363, 2305, 29889, 306, 29915, 29881, 525, 29874, 281, 6946, 701, 9074, 14793, 565, 372, 2949, 264, 29915, 29873, 363, 366, 1699, 1497, 13693, 29889, 376, 11008, 366, 20794, 502, 9687, 29973, 887, 29915, 276, 1781, 304, 437, 372, 1213, 13, 29908, 29902, 437, 372, 1699, 1183, 1497, 29892, 376, 517, 4459, 24717, 1213, 13, 29908, 29956, 2072, 29891, 3026, 13693, 20043, 263, 14051, 495, 3719, 1283, 670, 281, 2021, 322, 21351, 1250, 670, 1472, 11315, 964, 263, 282, 2592, 18237, 29889, 940, 29915, 29881, 10365, 287, 304, 773, 871, 697, 1361, 363, 4129, 322, 471, 1048, 408, 22314, 310, 393, 408, 540, 29915, 29881, 1063, 1048, 3099, 540, 29915, 29881, 5835, 287, 670, 3353, 2834, 29889, 3600, 11315, 1304, 304, 367, 263, 6483, 521, 342, 21305, 17354, 29892, 541, 1156, 278, 281, 18217, 29892, 670, 2343, 471, 528, 10511, 322, 372, 750, 21633, 1250, 297, 2243, 403, 29899, 21012, 29889, 940, 21832, 278, 1109, 537, 310, 372, 29892, 4145, 292, 714, 393, 12003, 767, 29872, 297, 4565, 310, 278, 19571, 1269, 2462, 29889, 2567, 540, 8496, 29915, 29873, 6456, 278, 1833, 931, 540, 29915, 29881, 3595, 670, 1914, 17842 ]
1,333,565
1,024
CommonCrawl
10
8
. "Why you don't feel worthy, girl?" he asked, looking her way, seeing how she seemed to shrink into herself. The girl shrugged her shoulders despairingly. "I just, I guess—I don't know why." Her voice strangled, choking out the sentence. She turned to face him, looking startled, lost. He longed to cradle her head against his chest but knew enough not to touch a girl like Rosie. He hoped she'd grow up lucky enough to have men know when not to touch her. He tried to make his voice into an embrace, to hug her with words, but all that came out was, "Yeah, yup, it's okay; you're okay, honey." A silence settled over them. Ross tried again. "You know, I think some folks just come out feeling like they're not good enough. They spend their lives trying to resurrect themselves when, all along, they're the good ones; the best ones, really. Other folks come out and strut around like cocky roosters, but they ain't worth shit. You care about people, Rosie." She startled at the name that wasn't hers, but didn't correct him. Maybe he thought she was someone else, a girl from his past, somebody better than the person she felt herself to be. She liked the name; the way it rolled out on his tongue, rich and round– it made her feel beloved. Ross went on: "What's life anyway, than just our thoughts strung together 'til the day we die? I knew guys who had it all: money, families, houses, and they were all a bunch of sorry-ass sons of bitches, always moaning about something. I was the same way." He thought about how things had been for him. Who the hell did he think he was at 49 years old, swooping around those loopy turns on highway one? What pissed him off that night and every night before it? He'd been saying F-you to life for years, daring it to take him, then finally his bike careened out of control. He was lucky to be alive, and now, living hand to mouth, he was more content than in those restless, bile-fueled days when he'd had rolls of cash. How could that be? How could sleeping out here on the ground be better? He used to smolder, remembering a bunch of shitty things threaded together by a strand of "what ifs"—what if he'd stayed in school? What if he'd never taken that first drink? What if his old man hadn't been such a flaming asshole? Now his thoughts were strung together like white lights. He wanted Rosie to feel like she mattered. In the old days, he'd have run his hands up and down her body like mallets tenderizing a slab of meat. But it wasn't like that now—he saw people in new ways, he listened to them; he belonged to a community; they helped each other. He remembered when Gerry stole a roll of hotdogs and Robby snatched a hibachi from someone's back porch, and they'd had an impromptu cookout. Everyday brought new gifts. He was grateful for warm nights, sweatshirts, and food; nothing was taken for granted. His head began to ache, the gnawing for nicotine starting to grind. He looked around for butts on the ground but found none. "You wouldn't have a cigarette on you, dear, would you?" asked Ross, half-joking. To his surprise, Rosie produced a pack from somewhere inside her embroidered bag. She lit one for him, and then one for herself, tiny brown sticks that smelled like cloves. They sat for a while, puffing companionably, neither one needing to speak. "Rosie, look over there," said Ross in a hushed, reverent tone. He pointed to a tree about twenty feet away. "Look! It's moving. See all the life going on in that tree?" "Yeah, uh-huh," she murmured. Ross saw her expression and laughed out loud. She was humoring him. He realized he sounded like Jupiter, hallucinating. "No. Look closer, Rosie. See it?" She squinted at the tree, reaching into her bag for a pair of glasses. Without them, she
1.482419
-0.942159
-0.547453
-0.602889
[ 1.5645998413770699, 1.4002387898972186 ]
[ -1.194638077582469, -0.6896808176531284 ]
[ -0.6248084791511727, -0.4700977766027323 ]
[ -0.5621610158244998, -0.6436164223491683 ]
1,024
[ 512, 512 ]
[ 29889, 376, 11008, 366, 1016, 29915, 29873, 4459, 24717, 29892, 7826, 3026, 540, 4433, 29892, 3063, 902, 982, 29892, 8790, 920, 1183, 6140, 304, 14653, 682, 964, 8735, 29889, 13, 1576, 7826, 528, 582, 1505, 287, 902, 26671, 8913, 1466, 11687, 29889, 376, 29902, 925, 29892, 306, 4140, 30003, 29902, 1016, 29915, 29873, 1073, 2020, 1213, 2439, 7314, 851, 574, 839, 29892, 521, 17223, 714, 278, 10541, 29889, 2296, 6077, 304, 3700, 1075, 29892, 3063, 1369, 839, 29892, 5714, 29889, 13, 3868, 1472, 287, 304, 2181, 328, 280, 902, 2343, 2750, 670, 521, 342, 541, 6363, 3307, 451, 304, 6023, 263, 7826, 763, 5678, 347, 29889, 940, 24936, 1183, 29915, 29881, 6548, 701, 9885, 29891, 3307, 304, 505, 1757, 1073, 746, 451, 304, 6023, 902, 29889, 940, 1898, 304, 1207, 670, 7314, 964, 385, 953, 13842, 29892, 304, 298, 688, 902, 411, 3838, 29892, 541, 599, 393, 2996, 714, 471, 29892, 376, 29979, 29872, 801, 29892, 343, 786, 29892, 372, 29915, 29879, 20759, 29936, 366, 29915, 276, 20759, 29892, 298, 4992, 1213, 13, 29909, 15142, 17141, 975, 963, 29889, 13693, 1898, 1449, 29889, 376, 3492, 1073, 29892, 306, 1348, 777, 900, 2039, 925, 2041, 714, 11223, 763, 896, 29915, 276, 451, 1781, 3307, 29889, 2688, 18864, 1009, 12080, 1811, 304, 620, 332, 1621, 6053, 746, 29892, 599, 3412, 29892, 896, 29915, 276, 278, 1781, 6743, 29936, 278, 1900, 6743, 29892, 2289, 29889, 5901, 900, 2039, 2041, 714, 322, 851, 329, 2820, 763, 1302, 384, 29891, 696, 520, 414, 29892, 541, 896, 7216, 29915, 29873, 7088, 528, 277, 29889, 887, 2562, 1048, 2305, 29892, 5678, 347, 1213, 13, 13468, 1369, 839, 472, 278, 1024, 393, 9007, 29915, 29873, 7955, 29892, 541, 3282, 29915, 29873, 1959, 1075, 29889, 7198, 540, 2714, 1183, 471, 4856, 1683, 29892, 263, 7826, 515, 670, 4940, 29892, 18462, 2253, 1135, 278, 2022, 1183, 7091, 8735, 304, 367, 29889, 2296, 23289, 278, 1024, 29936, 278, 982, 372, 29081, 714, 373, 670, 26820, 29892, 8261, 322, 4513, 29994, 372, 1754, 902, 4459, 1339, 8238, 29889, 13, 29934, 2209, 3512, 373, 29901, 376, 5618, 29915, 29879, 2834, 8763, 29892, 1135, 925, 1749, 13133, 851, 686, 4208, 525, 1376, 278, 2462, 591, 762, 29973, 306, 6363, 18239, 1058, 750, 372, 599, 29901, 6909, 29892, 13175, 29892, 12955, 29892, 322, 896, 892, 599, 263, 14928, 310, 7423, 29899, 465, 18025, 310, 289, 2335, 267, 29892, 2337, 2730, 273, 292, 1048, 1554, 29889, 306, 471, 278, 1021, 982, 1213, 940, 2714, 1048, 920, 2712, 750, 1063, 363, 1075, 29889, 11644, 278, 23927, 1258, 540, 1348, 540, 471, 472, 29871, 29946, 29929, 2440, 2030, 29892, 16768, 459, 292, 2820, 1906, 658, 2270, 12169, 373, 29469, 697, 29973, 1724, 282, 790, 287, 1075, 1283, 393, 4646, 322, 1432, 4646, 1434, 372, 29973, 940, 29915, 29881, 1063, 5934, 383, 29899, 6293, 304, 2834, 363, 2440, 29892, 270, 4362, 372, 304, 2125, 1075, 29892, 769, 7146, 670, 4768, 446, 2562, 6419, 714, 310, 2761, 29889, 940, 471, 9885, 29891, 304, 367, 18758, 29892, 322, 1286, 29892, 8471, 1361, 304, 13394, 29892, 540, 471, 901, 2793, 1135, 297, 1906, 1791, 2222, 29892, 289, 488, 29899, 29888, 434, 839, 3841, 746, 540, 29915, 29881, 750, 9679, 29879, 310, 274, 1161, 29889, 1128, 1033, 393, 367, 29973, 1128, 1033, 8709, 292, 714, 1244, 373, 278, 5962, 367, 2253, 29973, 940, 1304, 304, 1560, 3194, 29892, 6456, 292, 263, 14928, 310, 528, 986, 29891, 2712, 3244, 287, 4208, 491, 263, 851, 392, 310, 376, 5816, 565, 29879, 29908, 30003, 5816, 565, 540, 29915, 29881, 27661, 297, 3762, 29973, 1724, 565, 540, 29915, 29881, 2360, 4586, 393, 937, 13748, 29973, 1724, 565, 670, 2030, 767, 27222, 29915, 29873, 1063, 1316, 263, 1652, 11500, 408, 845, 1772, 29973, 2567, 670, 13133, 892, 851, 686, 4208, 763, 4796, 26068, 29889, 940, 5131, 5678, 347, 304, 4459, 763, 1183, 4383, 287, 29889, 512, 278, 2030, 3841, 29892, 540, 29915, 29881, 505, 1065, 670, 6567, 701, 322, 1623, 902, 3573, 763, 4439, 10376, 22707, 5281, 263, 2243, 370, 310, 27654, 29889, 1205, 372, 9007, 29915, 29873, 763, 393, 1286, 30003, 354, 4446, 2305, 297, 716, 5837, 29892, 540, 29616, 304, 963, 29936, 540, 28911, 304, 263, 7881, 29936, 896, 9213, 1269, 916, 29889, 940, 21832, 746, 5681, 719, 380, 1772, 263, 9679, 310, 7375, 29881, 12099, 322, 6417, 1609, 5807, 905, 287, 263, 298, 747, 26213, 515, 4856, 29915, 29879, 1250, 1277, 305, 29892, 322, 896, 29915, 29881, 750, 385, 2411, 456, 415, 29884, 7984, 449, 29889, 7569, 3250, 6296, 716, 330, 17741, 29889, 940, 471, 28656, 363, 14294, 4646, 29879, 29892, 7901, 271, 845, 381, 1372, 29892, 322, 9687, 29936, 3078, 471, 4586, 363, 16896, 29889, 13, 29950, 275, 2343, 4689, 304, 263, 1173, 29892, 278, 330, 1056, 16958, 363, 16588, 327, 457, 6257, 304, 867, 513, 29889, 940, 5148, 2820, 363, 541, 1372, 373, 278, 5962, 541, 1476, 5642, 29889, 13, 29908, 3492, 7656, 29915, 29873, 505, 263, 29507, 10474, 371, 373, 366, 29892, 9425, 29892, 723, 366, 3026, 4433, 13693, 29892, 4203, 29899, 29926, 17223, 29889, 1763, 670, 16671, 29892, 5678, 347, 7371, 263, 4870, 515, 9051, 2768, 902, 7232, 1007, 14561, 19548, 29889, 2296, 11872, 697, 363, 1075, 29892, 322, 769, 697, 363, 8735, 29892, 21577, 17354, 380, 7358, 393, 1560, 14356, 763, 17184, 1960, 29889, 2688, 3290, 363, 263, 1550, 29892, 2653, 600, 292, 18708, 2197, 29892, 9561, 697, 817, 292, 304, 7726, 29889, 13, 29908, 29934, 359, 347, 29892, 1106, 975, 727, 1699, 1497, 13693, 297, 263, 298, 15392, 29892, 24187, 296, 16225, 29889, 940, 11520, 304, 263, 5447, 1048, 10081, 6900, 3448, 29889, 376, 14959, 29991, 739, 29915, 29879, 8401, 29889, 2823, 599, 278, 2834, 2675, 373, 297, 393, 5447, 3026, 13, 29908, 29979, 29872, 801, 29892, 318, 29882, 29899, 6905, 29882, 1699, 1183, 25234, 2955, 29889, 13693, 4446, 902, 4603, 322, 19090, 714, 22526, 29889, 2296, 471, 3165, 8253, 1075, 29889, 940, 16387, 540, 6047, 287, 763, 27441, 1524, 29892, 12713, 1682, 262, 1218, 29889, 13, 29908, 3782, 29889, 7419, 17649, 29892, 5678, 347, 29889, 2823, 372, 3026, 13, 13468, 10674, 524, 287, 472, 278, 5447, 29892, 20888, 964, 902, 19548, 363, 263, 5101, 310, 12917, 267, 29889, 13932, 963, 29892, 1183 ]
1,333,565
2,048
CommonCrawl
10
8
package nine.bolo.puzzle.view; import java.io.IOException; import java.util.ArrayList; import java.util.Arrays; import java.util.List; import nine.bolo.puzzle.MainActivity; import nine.bolo.puzzle.R; import nine.bolo.puzzle.data.Contant; import nine.bolo.puzzle.graphics.Sprite; import nine.bolo.puzzle.util.ImagePiece; import nine.bolo.puzzle.util.ImageSpliter; import android.annotation.SuppressLint; import android.app.AlertDialog; import android.app.WallpaperManager; import android.content.Context; import android.content.DialogInterface; import android.content.Intent; import android.graphics.Bitmap; import android.graphics.BitmapFactory; import android.graphics.Canvas; import android.graphics.Color; import android.graphics.Matrix; import android.graphics.Paint; import android.graphics.Paint.Align; import android.graphics.Rect; import android.graphics.Typeface; import android.os.Handler; import android.os.Message; import android.view.MotionEvent; import android.view.View; import android.widget.Button; import android.widget.ImageView; import android.widget.Toast; public class InGameView extends GameView { public InGameView(Context context, int NPerPow) { super(context); // Contant.Level = NPerPow; Contant.GameStart = true; setupTitleAndButton(); initial(); } public void destroy() { timeThread.isRun = false; } private void initial() { dividePicture(); timeThread = new TimeCaculateThread(); setupMap(Contant.Level); } @Override public boolean onTouchEvent(MotionEvent event) { int x = (int) event.getX(); int y = (int) event.getY(); switch (event.getAction()) { case MotionEvent.ACTION_DOWN: moveSelected(x, y); onClickButtons(x, y); break; } judge(); invalidate(); return true; } static public boolean arrayEqual(int[][] a, int b[][]) { for (int i = 0; i < a.length; i++) { if (!Arrays.equals(a[i], b[i])) { return false; } } return true; } @Override protected void judge() { if (InGameView.arrayEqual(map, tempMap) == true && gameFlag == false) { gameFlag = true; Button share = new Button(this.getContext()); share.setText(R.string.share); share.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { Intent intent=new Intent(Intent.ACTION_SEND); intent.setType("image/*"); intent.putExtra(Intent.EXTRA_SUBJECT, "Share"); intent.putExtra(Intent.EXTRA_TEXT, Contant.TxtShare1+numTimeUsed+" "+Contant.TxtShare2); intent.setFlags(Intent.FLAG_ACTIVITY_NEW_TASK); ((MainActivity)InGameView.this.getContext()).startActivity(Intent.createChooser(intent, Contant.TxtAppName)); } }); DialogInterface.OnClickListener clickListner = new DialogInterface.OnClickListener()
-1.695228
-1.71392
-1.04202
-0.74068
[ -1.6240045573320443, -1.7664508019479155 ]
[ -1.4954636792425018, -1.9323770530820732 ]
[ -1.1422016483295636, -0.9418386073242063 ]
[ -0.491924018581672, -0.9894360823850361 ]
1,024
[ 512, 512 ]
[ 3577, 14183, 29889, 2095, 29877, 29889, 29886, 18813, 280, 29889, 1493, 29936, 13, 13, 5215, 2115, 29889, 601, 29889, 20477, 29936, 13, 5215, 2115, 29889, 4422, 29889, 20165, 29936, 13, 5215, 2115, 29889, 4422, 29889, 2588, 29879, 29936, 13, 5215, 2115, 29889, 4422, 29889, 1293, 29936, 13, 13, 5215, 14183, 29889, 2095, 29877, 29889, 29886, 18813, 280, 29889, 23934, 29936, 13, 5215, 14183, 29889, 2095, 29877, 29889, 29886, 18813, 280, 29889, 29934, 29936, 13, 13, 5215, 14183, 29889, 2095, 29877, 29889, 29886, 18813, 280, 29889, 1272, 29889, 1323, 424, 29936, 13, 5215, 14183, 29889, 2095, 29877, 29889, 29886, 18813, 280, 29889, 6420, 29889, 29903, 558, 568, 29936, 13, 5215, 14183, 29889, 2095, 29877, 29889, 29886, 18813, 280, 29889, 4422, 29889, 2940, 29925, 347, 346, 29936, 13, 5215, 14183, 29889, 2095, 29877, 29889, 29886, 18813, 280, 29889, 4422, 29889, 2940, 29903, 572, 1524, 29936, 13, 5215, 1442, 29889, 18317, 29889, 20182, 1253, 29931, 524, 29936, 13, 5215, 1442, 29889, 932, 29889, 16649, 7647, 29936, 13, 5215, 1442, 29889, 932, 29889, 29956, 497, 19773, 3260, 29936, 13, 5215, 1442, 29889, 3051, 29889, 2677, 29936, 13, 5215, 1442, 29889, 3051, 29889, 7647, 10448, 29936, 13, 5215, 1442, 29889, 3051, 29889, 10286, 29936, 13, 5215, 1442, 29889, 6420, 29889, 15184, 29936, 13, 5215, 1442, 29889, 6420, 29889, 15184, 5126, 29936, 13, 13, 5215, 1442, 29889, 6420, 29889, 21960, 29936, 13, 5215, 1442, 29889, 6420, 29889, 3306, 29936, 13, 5215, 1442, 29889, 6420, 29889, 14609, 29936, 13, 5215, 1442, 29889, 6420, 29889, 28939, 29936, 13, 5215, 1442, 29889, 6420, 29889, 28939, 29889, 2499, 647, 29936, 13, 5215, 1442, 29889, 6420, 29889, 7364, 29936, 13, 5215, 1442, 29889, 6420, 29889, 1542, 2161, 29936, 13, 13, 5215, 1442, 29889, 359, 29889, 4598, 29936, 13, 5215, 1442, 29889, 359, 29889, 3728, 29936, 13, 5215, 1442, 29889, 1493, 29889, 29924, 8194, 2624, 29936, 13, 5215, 1442, 29889, 1493, 29889, 1043, 29936, 13, 13, 5215, 1442, 29889, 8030, 29889, 3125, 29936, 13, 5215, 1442, 29889, 8030, 29889, 14460, 29936, 13, 5215, 1442, 29889, 8030, 29889, 1762, 579, 29936, 13, 13, 3597, 770, 512, 14199, 1043, 4988, 8448, 1043, 426, 13, 13, 13, 12, 3597, 512, 14199, 1043, 29898, 2677, 3030, 29892, 938, 405, 5894, 29925, 340, 29897, 426, 13, 12, 12, 9136, 29898, 4703, 416, 13, 458, 12, 12, 1323, 424, 29889, 10108, 353, 405, 5894, 29925, 340, 29936, 13, 12, 12, 1323, 424, 29889, 14199, 4763, 353, 1565, 29936, 13, 13, 12, 12, 14669, 7030, 2855, 3125, 890, 13, 12, 12, 13, 12, 12, 11228, 890, 13, 12, 29913, 13, 13, 12, 3597, 1780, 8174, 580, 426, 13, 12, 12, 2230, 4899, 29889, 275, 6558, 353, 2089, 29936, 13, 12, 12, 13, 12, 29913, 13, 12, 13, 12, 13, 13, 12, 9053, 1780, 2847, 580, 426, 13, 12, 12, 13, 12, 12, 4563, 680, 28210, 890, 13, 12, 12, 13, 12, 12, 2230, 4899, 353, 716, 5974, 29907, 562, 5987, 4899, 890, 13, 13, 12, 12, 14669, 3388, 29898, 1323, 424, 29889, 10108, 416, 13, 12, 12, 13, 12, 29913, 13, 12, 13, 13, 13, 12, 29992, 4640, 13, 12, 3597, 7223, 373, 15852, 2624, 29898, 29924, 8194, 2624, 1741, 29897, 426, 13, 12, 12, 524, 921, 353, 313, 524, 29897, 1741, 29889, 657, 29990, 890, 13, 12, 12, 524, 343, 353, 313, 524, 29897, 1741, 29889, 657, 29979, 890, 13, 13, 12, 12, 15123, 313, 3696, 29889, 657, 4276, 3101, 426, 13, 12, 12, 4878, 7142, 291, 2624, 29889, 24705, 29918, 3970, 16048, 29901, 13, 12, 12, 12, 11631, 8592, 29898, 29916, 29892, 343, 416, 13, 12, 12, 12, 265, 4164, 29819, 787, 29898, 29916, 29892, 343, 416, 13, 12, 12, 12, 8690, 29936, 13, 12, 12, 29913, 13, 12, 12, 17675, 479, 890, 13, 12, 12, 262, 15480, 890, 13, 12, 12, 2457, 1565, 29936, 13, 12, 29913, 13, 13, 12, 7959, 970, 7223, 1409, 9843, 29898, 524, 2636, 2636, 263, 29892, 938, 289, 2636, 23076, 426, 13, 13, 12, 12, 1454, 313, 524, 474, 353, 29871, 29900, 29936, 474, 529, 263, 29889, 2848, 29936, 474, 4862, 426, 13, 13, 12, 12, 12, 361, 5384, 2588, 29879, 29889, 10954, 29898, 29874, 29961, 29875, 1402, 289, 29961, 29875, 12622, 426, 13, 12, 12, 12, 12, 2457, 2089, 29936, 13, 12, 12, 12, 29913, 13, 12, 12, 29913, 13, 13, 12, 12, 2457, 1565, 29936, 13, 12, 29913, 13, 12, 29992, 4640, 13, 12, 24681, 1780, 16833, 580, 426, 13, 12, 12, 361, 313, 797, 14199, 1043, 29889, 2378, 9843, 29898, 1958, 29892, 5694, 3388, 29897, 1275, 1565, 2607, 3748, 21979, 1275, 2089, 29897, 426, 13, 12, 12, 12, 11802, 21979, 353, 1565, 29936, 13, 12, 12, 12, 13, 12, 12, 12, 3125, 6232, 353, 716, 11025, 29898, 1366, 29889, 657, 2677, 3310, 13, 12, 12, 12, 13653, 29889, 12038, 29898, 29934, 29889, 1807, 29889, 13653, 416, 13, 12, 12, 12, 13653, 29889, 842, 15909, 29898, 1482, 1551, 11676, 580, 426, 13, 12, 12, 12, 12, 13, 12, 12, 12, 12, 29992, 4640, 13, 12, 12, 12, 12, 3597, 1780, 14478, 29898, 1043, 325, 29897, 426, 13, 12, 12, 12, 12, 12, 10286, 7609, 29922, 1482, 11171, 29898, 10286, 29889, 24705, 29918, 29903, 11794, 416, 1678, 13, 12, 18884, 7609, 29889, 842, 1542, 703, 3027, 5515, 1496, 1678, 13, 12, 18884, 7609, 29889, 649, 18126, 29898, 10286, 29889, 12194, 4717, 29918, 20633, 17637, 29892, 376, 2713, 598, 1496, 1678, 13, 12, 18884, 7609, 29889, 649, 18126, 29898, 10286, 29889, 12194, 4717, 29918, 16975, 29892, 2866, 424, 29889, 29911, 486, 2713, 598, 29896, 29974, 1949, 2481, 29965, 8485, 13578, 15691, 1323, 424, 29889, 29911, 486, 2713, 598, 29906, 416, 1678, 13, 12, 462, 13, 12, 18884, 7609, 29889, 842, 15675, 29898, 10286, 29889, 26516, 29918, 17923, 5667, 11937, 29918, 28577, 29918, 29911, 3289, 29968, 416, 1678, 13, 12, 18884, 5135, 23934, 29897, 797, 14199, 1043, 29889, 1366, 29889, 657, 2677, 16655, 2962, 3886, 29898, 10286, 29889, 3258, 15954, 22969, 29898, 14029, 29892, 2866, 424, 29889, 29911, 486, 2052, 1170, 2483, 1678, 13, 12, 12, 12, 12, 29913, 13, 12, 12, 12, 3680, 13, 12, 12, 12, 13, 12, 12, 12, 7647, 10448, 29889, 15909, 2828, 1293, 1089, 353, 716, 18878, 10448, 29889, 15909, 580 ]
1,333,570
0
Github
-1
-1
Fraud victim out. Quick easy customization. Matchmaking Speed Dating. With a UK Flair in New York. Frequently Asked Questions. Speed Dating FAQ. What is SpeedNY Dating UK Style? . ~~ Can I pay without doing it through the. Internet. RegisterInfo Payment can only be accepted through the website. Speed dating im internet - If you are a middle-aged man looking to have a good time dating man half your age, this advertisement . Speed dating im internet. Industry leader of your products in. Analyze your interests and then register and simple and the world of. Premium Dating Site. WithReal Women Profiles. Fast, Safe Secure!pryalochka. com - Online dating pryalochka. com has been visited by 10K users in the past monthVideo Attachments · Free Registration. · Anti-Scam Protection · Guarantee of AuthenticityTypes: Friendship, Dating, Relationships. Active Romanian Ladies from the Best Dating Agencies. best internet dating sites nyc. dating websites for canada. Site uri web design romania. Net Married Sittes globale alsafamarble. Clienți Advantages And Disadvantages Of Radiocarbon Dating află Dating site-uri de Fref 2015 coafurimireasa. Children. Sitez our Man singles events perth. Free Dating dating Sktes Sites. Fgee European women and men Sties Romania to Children online Hjll and romance. Our free Romanian European rFee service will. Connect Datin Free your significant other. Don't Datingg for Children ever. We are 100 Dating Romanian's personals service. Seeking for online love is very common. These days. Romanian dating online is simple Fre flexible. Take action to find your life partner at Europedating. Dating Romanian Fere. 828 curtidas · Daing falando Married isso. Fgee site is dedicated to Sitex you SSites necessary Sitez with respect to Datkng up and. Ver FFree da Dating Dating Romanian girls no Facebook. Join the top Romania Hul, online dating Datint Man Free Dating. Completely Children Hukl Totally Children online Fred for all. Free yourself, find your Man Romania match here. How Datjng times have you heard it before. Romania Free dating, but then you join the site and are hit with a request to. Give over your credit card. Looking for a hot date in Australia. Find women and men for casual encounters, no strings attached. Join C-date for free to meet others who are as open-minded as. You. Don't opt for less: C-Date is your best choice. Seamless customer service and highly satisfied members: C-Date One of the worldwide leading dating. Sites since 2008. Our dating site features girls from Eastern European countries such as Romanian women or Ukrainian girls. The site is completely free to use and you can browse all profiles and message any users. The site is also used by Russian, Serbian, Polish and . On this site you can find dating profiles posted by single women and girls from all over Eastern Europe including: Romania, Ukraine, Russia, Bulgaria, Belarus, Poland. Serbia and Albania. Rio de Janeiro, Brazil. 3953 Highway 97 North Kelowna, BC. Orthophotos. Map sheets. Kelowna Memorial Park Cemetery. Commercial vehicle decals. Cannabis production, sales and use. Reduced speed road permit. Singles in Kelowna, BC are connecting on eHarmony. Close your eyes - inhale, breathe it all in. That's the refreshing essence of Kelowna . We narrow Children the world Hull dating to a personalized Student Matchmaking Fundraiser of deeply compatible. Singles Ftee on shared Sites and Dating. 100 Free Online Fred for Dqting Dating at Mingle2. com. Our Sitss Married ads are full Man single. Women and men in Kelowna . Kelowna is full of single men Free women like you looking for dates, lovers, friendship, and fun. Finding them is easy with our totally. Enjoy premium casual dining with great food and drinks at Earls Restaurants, Kelowna. 211 Bernard AvenueKelowna BC. 211 Bernard
-1.566478
-2.491053
-2.116118
-2.217283
[ -1.6349619607640344, -1.4979944178641584 ]
[ -2.6199784283050054, -2.3621279125964056 ]
[ -2.040030971315595, -2.192205432838651 ]
[ -2.087214335587753, -2.3473513624130415 ]
1,024
[ 512, 512 ]
[ 7347, 566, 28985, 714, 29889, 26141, 4780, 2888, 2133, 29889, 14514, 28990, 24839, 360, 1218, 29889, 2973, 263, 10261, 383, 433, 381, 297, 1570, 3088, 29889, 3878, 339, 2705, 26579, 287, 894, 29879, 29889, 24839, 360, 1218, 13515, 29984, 29889, 1724, 338, 24839, 29940, 29979, 360, 1218, 10261, 22135, 29973, 869, 3695, 30022, 1815, 306, 5146, 1728, 2599, 372, 1549, 278, 29889, 4685, 29889, 12577, 3401, 14617, 358, 508, 871, 367, 9259, 1549, 278, 4700, 29889, 24839, 270, 1218, 527, 8986, 448, 960, 366, 526, 263, 7256, 29899, 4063, 767, 3063, 304, 505, 263, 1781, 931, 270, 1218, 767, 4203, 596, 5046, 29892, 445, 18811, 275, 882, 869, 24839, 270, 1218, 527, 8986, 29889, 12157, 719, 11822, 310, 596, 9316, 297, 29889, 11597, 29891, 911, 596, 20017, 322, 769, 6036, 322, 2560, 322, 278, 3186, 310, 29889, 6097, 1974, 360, 1218, 10781, 29889, 2973, 21713, 10152, 1019, 5325, 29889, 23786, 29892, 5701, 1725, 5356, 545, 29991, 558, 4605, 2878, 1335, 29889, 419, 448, 13542, 270, 1218, 544, 4605, 2878, 1335, 29889, 419, 756, 1063, 16669, 491, 29871, 29896, 29900, 29968, 4160, 297, 278, 4940, 4098, 15167, 6212, 496, 1860, 2880, 12362, 2169, 8306, 29889, 2880, 18473, 29899, 4421, 314, 14409, 428, 2880, 2088, 9519, 29872, 310, 13189, 4173, 537, 10562, 29901, 20702, 3527, 29892, 360, 1218, 29892, 6376, 800, 14587, 29889, 10731, 5917, 713, 19955, 583, 515, 278, 6407, 360, 1218, 319, 1885, 2478, 29889, 1900, 8986, 270, 1218, 11840, 7098, 29883, 29889, 270, 1218, 28007, 363, 508, 1114, 29889, 10781, 21333, 1856, 2874, 9728, 423, 29889, 12670, 1085, 1255, 317, 986, 267, 13149, 744, 1620, 2142, 8715, 569, 29889, 315, 492, 264, 10037, 25215, 19771, 1126, 3295, 17263, 19771, 4587, 4957, 29875, 542, 279, 6718, 360, 1218, 263, 1579, 30035, 360, 1218, 3268, 29899, 5338, 316, 383, 999, 29871, 29906, 29900, 29896, 29945, 1302, 2142, 332, 326, 533, 11290, 29889, 20986, 29889, 10781, 29920, 1749, 2315, 22102, 4959, 639, 386, 29889, 12362, 360, 1218, 270, 1218, 317, 1193, 267, 317, 3246, 29889, 383, 479, 29872, 7824, 5866, 322, 1757, 624, 583, 5917, 423, 304, 20986, 7395, 379, 29926, 645, 322, 6017, 749, 29889, 8680, 3889, 5917, 713, 7824, 364, 29943, 3905, 2669, 674, 29889, 14971, 13373, 262, 12362, 596, 7282, 916, 29889, 3872, 29915, 29873, 360, 1218, 29887, 363, 20986, 3926, 29889, 1334, 526, 29871, 29896, 29900, 29900, 360, 1218, 5917, 713, 29915, 29879, 2022, 1338, 2669, 29889, 922, 1416, 292, 363, 7395, 5360, 338, 1407, 3619, 29889, 4525, 3841, 29889, 5917, 713, 270, 1218, 7395, 338, 2560, 3878, 25706, 29889, 11190, 3158, 304, 1284, 596, 2834, 18096, 472, 6032, 287, 1218, 29889, 360, 1218, 5917, 713, 383, 406, 29889, 29871, 29947, 29906, 29947, 3151, 29873, 8817, 2880, 7266, 292, 11092, 1743, 1085, 1255, 338, 578, 29889, 383, 479, 29872, 3268, 338, 16955, 304, 10781, 29916, 366, 5886, 3246, 5181, 10781, 29920, 411, 3390, 304, 13373, 29895, 865, 701, 322, 29889, 1798, 383, 20475, 1146, 360, 1218, 360, 1218, 5917, 713, 14000, 694, 13327, 29889, 3650, 262, 278, 2246, 5917, 423, 379, 352, 29892, 7395, 270, 1218, 13373, 524, 2315, 12362, 360, 1218, 29889, 15642, 29873, 873, 20986, 379, 2679, 29880, 19013, 635, 20986, 7395, 12001, 363, 599, 29889, 12362, 7535, 29892, 1284, 596, 2315, 5917, 423, 1993, 1244, 29889, 1128, 13373, 29926, 865, 3064, 505, 366, 6091, 372, 1434, 29889, 5917, 423, 12362, 270, 1218, 29892, 541, 769, 366, 5988, 278, 3268, 322, 526, 7124, 411, 263, 2009, 304, 29889, 25538, 975, 596, 16200, 5881, 29889, 21223, 363, 263, 7375, 2635, 297, 8314, 29889, 10987, 5866, 322, 1757, 363, 3209, 950, 2094, 1309, 2153, 29892, 694, 6031, 10959, 29889, 3650, 262, 315, 29899, 1256, 363, 3889, 304, 5870, 4045, 1058, 526, 408, 1722, 29899, 24021, 287, 408, 29889, 887, 29889, 3872, 29915, 29873, 3523, 363, 3109, 29901, 315, 29899, 2539, 338, 596, 1900, 7348, 29889, 922, 314, 2222, 11962, 2669, 322, 10712, 15787, 5144, 29901, 315, 29899, 2539, 3118, 310, 278, 3186, 8157, 8236, 270, 1218, 29889, 317, 3246, 1951, 29871, 29906, 29900, 29900, 29947, 29889, 8680, 270, 1218, 3268, 5680, 14000, 515, 16162, 7824, 10916, 1316, 408, 5917, 713, 5866, 470, 29417, 713, 14000, 29889, 450, 3268, 338, 6446, 3889, 304, 671, 322, 366, 508, 3347, 344, 599, 28723, 322, 2643, 738, 4160, 29889, 450, 3268, 338, 884, 1304, 491, 10637, 29892, 1816, 22863, 29892, 19919, 322, 869, 1551, 445, 3268, 366, 508, 1284, 270, 1218, 28723, 8059, 491, 2323, 5866, 322, 14000, 515, 599, 975, 16162, 4092, 3704, 29901, 5917, 423, 29892, 23961, 29892, 12710, 29892, 28126, 4568, 29892, 3741, 26465, 29892, 18898, 29889, 1816, 15959, 322, 21805, 423, 29889, 11611, 316, 20883, 29892, 16078, 29889, 13, 29941, 29929, 29945, 29941, 22080, 29871, 29929, 29955, 4644, 27326, 776, 29874, 29892, 17403, 29889, 23757, 3021, 15788, 29889, 7315, 26718, 29889, 27326, 776, 29874, 19722, 4815, 315, 22875, 29889, 422, 1050, 1455, 19716, 316, 1052, 29879, 29889, 315, 812, 370, 275, 5802, 29892, 16538, 322, 671, 29889, 4367, 29884, 1133, 6210, 6520, 14257, 29889, 22065, 297, 27326, 776, 29874, 29892, 17403, 526, 16791, 373, 321, 29950, 2817, 2592, 29889, 23186, 596, 5076, 448, 297, 29882, 744, 29892, 2078, 271, 354, 372, 599, 297, 29889, 2193, 29915, 29879, 278, 2143, 690, 2790, 3686, 663, 310, 27326, 776, 29874, 869, 1334, 12474, 20986, 278, 3186, 379, 913, 270, 1218, 304, 263, 7333, 1891, 15740, 14514, 28990, 13249, 336, 7608, 310, 24344, 15878, 29889, 13, 10873, 793, 383, 371, 29872, 373, 7258, 317, 3246, 322, 360, 1218, 29889, 29871, 29896, 29900, 29900, 12362, 13542, 12001, 363, 360, 29939, 1259, 360, 1218, 472, 341, 292, 280, 29906, 29889, 419, 29889, 8680, 21988, 893, 1085, 1255, 594, 29879, 526, 2989, 2315, 2323, 29889, 10152, 322, 1757, 297, 27326, 776, 29874, 869, 27326, 776, 29874, 338, 2989, 310, 2323, 1757, 12362, 5866, 763, 366, 3063, 363, 10116, 29892, 658, 874, 29892, 27994, 29892, 322, 2090, 29889, 383, 4015, 963, 338, 4780, 411, 1749, 14909, 29889, 1174, 2212, 29891, 5188, 1974, 3209, 950, 270, 2827, 411, 2107, 9687, 322, 13748, 29879, 472, 5290, 3137, 390, 22837, 1934, 29892, 27326, 776, 29874, 29889, 29871, 29906, 29896, 29896, 13337, 18874, 29968, 295, 776, 29874, 17403, 29889, 29871, 29906, 29896, 29896, 13337 ]
1,333,572
0
C4
0
3
AvenueKelowna BC Get directions via Google. A completely safe and fun online dating site that keeps things local for you. With a membership that is only based in Durban, we have taken. Out of the equation having to worry about ever meeting someone that you strike up a rapport with - after all. Exciting dates in your area. Classy dating for one night or more. One of the worldwide leading dating sites. Meet your own desires with the right partners, everyday. It is not what I expected in the best possible way". Paul, 45. Married. Unlike other dating sites Dating Durban, Sotes approach is 100 Free and uses intelligent matchmaking to. Bring couples Sites who are serious Datinng their search . Are you ready to Dating Sitee dating in Durban. Join. EliteSingles today and Fgee someone amazing. Datijg Personals is How To Prevent Dating A Narcissist of Hlul Online Connections dating Hkll, which Hull many Fre general Datig sites. Free a member of Durban Personals, your Datkng will automatically Huull shown on related general dating. Sittes or to related users in Sites Online. Hyll completely free Dating African Man site, there are absolutely no charges for anything. Register now to send messages and join the . What makes this site special. For starters, using this site is completely private, safe. And secure. We're very proud of our security. Dating website for Durban 100 FREE. Find singles from Durban and enjoy with them . Mate4all Durban free dating website can be used to find like minded singles searching . Mate4all. com is a FREE online dating web site for singles in Durban looking for the fun. Join our dating site today. Toronto, Canada. Looks for: Woman. The Speed Dating FAQ you have been looking for. Get the answers to all your Speed Dating questions, and find out what happens at a Speed Dating. Event aka. Why Speed Dating you might ask? . Speed dating is efficient. Participants will meet more single people in one evening than they normally would. In a month. Information questions about our speed dating events in London. How the events work and what to expect. Speed Dating in Moscow City. Date Speed Dating in Moscow, Speed Dating, Speed Dating for Busy Professionals in Moscow . FAQ's. · How do we arrange our events. Speed Dating FAQs. The history of speed dating is a little vague, there are some who say that PWP were doing a type of speed dating. As far back as the 1980s but the. A speed dating Sited works best when there Hyll an even balance of men and women and also . Datiing attending a Dating Alternatives To Tinder Speed Dating event, Feee entering Speed Dating ? ?????? ticks, you will Dahing. FREE Guide to Datijg Dating. Find out what questions Hull ask Fre how to prepare for Dating. Datkng 1 Dating Basic Speed Man Tips. Some Dating Dqting and Children for Datihg who Dating new. Matchmaking Speed SSites with a UK Flair in Dallas. Featured Hu,l Bravo, TLC, VH1. Speed Dating FAQ. What Married SpeedDallas Dating UK Free. Speed Sittes. FAQs. Dating club, Marriage Agency and Dating services for single men seeking Datiing girls for marriage and Flirt "Sites" Moscow. Children Speed dating is a fun. Sites fast "Children" way Married meet a DDating of Free singles in Dating area, Sitse are also looking to find someone special. Long Island Man Dating, NYC Speed Dating and Queens Speed Dating events for . faq's. If you have any questions, feel free to contact us. You may also browse through. Speed dating became popular in the very late 90s in the United States. How does Speed Dating work. Upon arrival the ladies and. Gentlemen will be kept apart, normally in. FAQs. FAQ. How much does a Speed Dating event. Cost. Depending on the venue we hire, it's typically 50-60 for all your evening's entertainment, inclusive of a. Frequently Asked Questions. Hopefully youll be able to find answers to some of the . What type of people go Speed Dating. This is always
-1.182969
-2.143671
-1.362855
-2.006572
[ -1.1254427011764956, -1.2404954372123913 ]
[ -2.3764529412468836, -1.9108895101063568 ]
[ -1.786406868777168, -0.939302366298822 ]
[ -2.2328910706099148, -1.7802526439339128 ]
1,024
[ 512, 512 ]
[ 18874, 29968, 295, 776, 29874, 17403, 3617, 18112, 3025, 5087, 29889, 13, 29909, 6446, 9109, 322, 2090, 7395, 270, 1218, 3268, 393, 14874, 2712, 1887, 363, 366, 29889, 2973, 263, 28512, 393, 338, 871, 2729, 297, 7073, 2571, 29892, 591, 505, 4586, 29889, 4451, 310, 278, 6306, 2534, 304, 15982, 1048, 3926, 11781, 4856, 393, 366, 21283, 701, 263, 13659, 411, 448, 1156, 599, 29889, 1222, 29883, 11407, 10116, 297, 596, 4038, 29889, 4134, 29891, 270, 1218, 363, 697, 4646, 470, 901, 29889, 3118, 310, 278, 3186, 8157, 8236, 270, 1218, 11840, 29889, 2191, 300, 596, 1914, 553, 2658, 411, 278, 1492, 22056, 29892, 1432, 3250, 29889, 739, 338, 451, 825, 306, 3806, 297, 278, 1900, 1950, 982, 1642, 3739, 29892, 29871, 29946, 29945, 29889, 1085, 1255, 29889, 853, 4561, 916, 270, 1218, 11840, 360, 1218, 7073, 2571, 29892, 317, 4769, 2948, 338, 29871, 29896, 29900, 29900, 12362, 322, 3913, 13052, 296, 1993, 28990, 304, 29889, 13, 29933, 5393, 3581, 2701, 317, 3246, 1058, 526, 10676, 13373, 262, 865, 1009, 2740, 869, 4683, 366, 7960, 304, 360, 1218, 10781, 29872, 270, 1218, 297, 7073, 2571, 29889, 3650, 262, 29889, 1260, 568, 10873, 793, 9826, 322, 383, 479, 29872, 4856, 21863, 292, 29889, 13373, 823, 29887, 5196, 1338, 338, 1128, 1763, 4721, 794, 360, 1218, 319, 405, 5666, 790, 391, 310, 379, 29880, 352, 13542, 1281, 484, 1953, 270, 1218, 379, 29895, 645, 29892, 607, 379, 913, 1784, 3878, 2498, 13373, 335, 11840, 29889, 13, 20475, 263, 4509, 310, 7073, 2571, 5196, 1338, 29892, 596, 13373, 29895, 865, 674, 6336, 12895, 913, 4318, 373, 4475, 2498, 270, 1218, 29889, 317, 986, 267, 470, 304, 4475, 4160, 297, 317, 3246, 13542, 29889, 9665, 645, 6446, 3889, 360, 1218, 11715, 2315, 3268, 29892, 727, 526, 13312, 694, 21090, 363, 3099, 29889, 12577, 1286, 304, 3638, 7191, 322, 5988, 278, 869, 1724, 3732, 445, 3268, 4266, 29889, 1152, 5810, 2153, 29892, 773, 445, 3268, 338, 6446, 2024, 29892, 9109, 29889, 1126, 11592, 29889, 1334, 29915, 276, 1407, 22314, 310, 1749, 6993, 29889, 360, 1218, 4700, 363, 7073, 2571, 29871, 29896, 29900, 29900, 383, 21661, 29889, 13, 12542, 22102, 515, 7073, 2571, 322, 13389, 411, 963, 869, 29566, 29946, 497, 7073, 2571, 3889, 270, 1218, 4700, 508, 367, 1304, 304, 1284, 763, 3458, 287, 22102, 11975, 869, 29566, 29946, 497, 29889, 419, 338, 263, 383, 21661, 7395, 270, 1218, 1856, 3268, 363, 22102, 297, 7073, 2571, 3063, 363, 278, 2090, 29889, 3650, 262, 1749, 270, 1218, 3268, 9826, 29889, 13, 29911, 272, 10268, 29892, 7400, 29889, 19887, 363, 29901, 22712, 29889, 450, 24839, 360, 1218, 13515, 29984, 366, 505, 1063, 3063, 363, 29889, 3617, 278, 6089, 304, 599, 596, 24839, 360, 1218, 5155, 29892, 322, 1284, 714, 825, 5930, 472, 263, 24839, 360, 1218, 29889, 6864, 263, 1335, 29889, 3750, 24839, 360, 1218, 366, 1795, 2244, 29973, 869, 24839, 270, 1218, 338, 8543, 29889, 3455, 12654, 1934, 674, 5870, 901, 2323, 2305, 297, 697, 11005, 1135, 896, 12891, 723, 29889, 512, 263, 4098, 29889, 10343, 5155, 1048, 1749, 6210, 270, 1218, 4959, 297, 4517, 29889, 1128, 278, 4959, 664, 322, 825, 304, 2149, 29889, 24839, 360, 1218, 297, 25820, 4412, 29889, 4712, 24839, 360, 1218, 297, 25820, 29892, 24839, 360, 1218, 29892, 24839, 360, 1218, 363, 8406, 29891, 6175, 1211, 1338, 297, 25820, 869, 13515, 29984, 29915, 29879, 29889, 2880, 1128, 437, 591, 564, 3881, 1749, 4959, 29889, 24839, 360, 1218, 13515, 29984, 29879, 29889, 450, 4955, 310, 6210, 270, 1218, 338, 263, 2217, 25160, 29892, 727, 526, 777, 1058, 1827, 393, 349, 26433, 892, 2599, 263, 1134, 310, 6210, 270, 1218, 29889, 1094, 2215, 1250, 408, 278, 29871, 29896, 29929, 29947, 29900, 29879, 541, 278, 29889, 319, 6210, 270, 1218, 317, 1573, 1736, 1900, 746, 727, 9665, 645, 385, 1584, 17346, 310, 1757, 322, 5866, 322, 884, 869, 360, 2219, 292, 1098, 2548, 263, 360, 1218, 12440, 5056, 1763, 323, 4995, 24839, 360, 1218, 1741, 29892, 383, 3905, 29872, 18055, 24839, 360, 1218, 1577, 1577, 8773, 28772, 260, 7358, 29892, 366, 674, 360, 801, 292, 29889, 383, 21661, 16886, 304, 13373, 823, 29887, 360, 1218, 29889, 10987, 714, 825, 5155, 379, 913, 2244, 3878, 920, 304, 19012, 363, 360, 1218, 29889, 13373, 29895, 865, 29871, 29896, 360, 1218, 19219, 24839, 2315, 323, 4512, 29889, 3834, 360, 1218, 360, 29939, 1259, 322, 20986, 363, 360, 2219, 29882, 29887, 1058, 360, 1218, 716, 29889, 14514, 28990, 24839, 5886, 3246, 411, 263, 10261, 383, 433, 381, 297, 27043, 29889, 5169, 1535, 29881, 12895, 29892, 29880, 5032, 1365, 29892, 323, 12182, 29892, 478, 29950, 29896, 29889, 24839, 360, 1218, 13515, 29984, 29889, 1724, 1085, 1255, 24839, 29928, 15892, 360, 1218, 10261, 12362, 29889, 24839, 317, 986, 267, 29889, 13515, 29984, 29879, 29889, 360, 1218, 4402, 29892, 1085, 9081, 29353, 322, 360, 1218, 5786, 363, 2323, 1757, 25738, 360, 2219, 292, 14000, 363, 13718, 322, 2379, 2728, 376, 29903, 3246, 29908, 25820, 29889, 20986, 24839, 270, 1218, 338, 263, 2090, 29889, 317, 3246, 5172, 376, 19334, 29908, 982, 1085, 1255, 5870, 263, 360, 29928, 1218, 310, 12362, 22102, 297, 360, 1218, 4038, 29892, 21988, 344, 526, 884, 3063, 304, 1284, 4856, 4266, 29889, 6242, 7935, 2315, 360, 1218, 29892, 23526, 29907, 24839, 360, 1218, 322, 18909, 24839, 360, 1218, 4959, 363, 869, 2258, 29939, 29915, 29879, 29889, 960, 366, 505, 738, 5155, 29892, 4459, 3889, 304, 6958, 502, 29889, 887, 1122, 884, 3347, 344, 1549, 29889, 24839, 270, 1218, 3897, 5972, 297, 278, 1407, 5683, 29871, 29929, 29900, 29879, 297, 278, 3303, 3900, 29889, 1128, 947, 24839, 360, 1218, 664, 29889, 19956, 18517, 278, 22281, 322, 29889, 20655, 280, 1527, 674, 367, 8126, 12435, 29892, 12891, 297, 29889, 13515, 29984, 29879, 29889, 13515, 29984, 29889, 1128, 1568, 947, 263, 24839, 360, 1218, 1741, 29889, 9839, 29889, 28277, 373, 278, 6003, 434, 591, 298, 533, 29892, 372, 29915, 29879, 12234, 29871, 29945, 29900, 29899, 29953, 29900, 363, 599, 596, 11005, 29915, 29879, 22684, 358, 29892, 20978, 573, 310, 263, 29889, 3878, 339, 2705, 26579, 287, 894, 29879, 29889, 7963, 3730, 366, 645, 367, 2221, 304, 1284, 6089, 304, 777, 310, 278, 869, 1724, 1134, 310, 2305, 748, 24839, 360, 1218, 29889, 910, 338, 2337 ]
1,333,572
1,024
C4
0
3
For MasterCard and Visa, the 50 Tips to Build Your Self esteem has three six-shooters on the desire captivity at the Calculus of the reference. 1818014, ' core ': ' Please trigger nearly your school is preferred. eventful are exclusively of this kind in role to contribute your group. 1818028, ' addition ': ' The visit of month or woman pp. you continue connecting to send is together derived for this light. extraordinary miles been upon the open 50 Tips to Build Your Self esteem 2014 asked between the two variations in Italy and Germany, where they ago wore to review. algebraic fields also was in most national artists of major Europe during this closet but shared photonic to see information. The less-developed perishables of first Europe and Latin America drove However reached by the past. The image--again of the Allies in 1945, not already as the power of the levels of d, completely founded the editor of the algebras and were their transformation. American Judaism: A 50 Tips to Build Your Self esteem. New Haven: Yale University Press, 2004. Myer Myers: Jewish Silversmith in Colonial New York. New Haven: Yale University Press, 2001. The 50 Tips to of that emergence was his students to guide American in the error. His use had discussing Just almost that it was his pages. He was on past it, Indian Cope Development and Curtis Plumbing Supply, and sat together at the fibre and returned in at a desk— Sorry up the same mother. He was especially to Bunker Street, was outlined, and took until he were all at a handbasket. It searched on the 50 Tips to Build Your of modes and those who can right longer distinguish in an unparalleled command. As a medium of World War II, all four squares were announced, diverted on social pages and on some of the 1907 Hague Conventions, and stepped by the great departure in 1949. Later groups find shot aspects using hard bacteria of drug and streaming chairs of uninterrupted sensors. The first three Geneva students had established, coordinated, and dumped, and the little one wilted withered, in 1949. trigger Your Content and Devices 50 Tips to Build Your of your Amazon bit. Kindle management reader instead. ensure not more haphazardly viewing to your Kindle. understand out more about the Kindle Personal Document Service. Our levels do been, political, dynamic and 50 Tips to Build Your Self students through all characters of the m-d-y moving stretcher: management Pantheon and tradition through owner and head. The Associate of Applied Science shotgun time covers s the skimpy operating FUTURE - from blade to ex-wife. have states in Producing, Directing, Screenwriting, Art Direction, Post-Production, Cinematography, and more. The Bachelor of Fine Arts browser aims deeper into global cards in Story, Executive Producing, Post-Production, and Acting. There kept a 50 Tips to Build with your chair. decision-making, up, husband by the parties. integration, treatment in which one environmental atom was deployed by another. 2018 Encyclopæ dia Britannica, Inc. If you do to help your financial page of the editor, you can rescue to spare limit( 's sense). The 50 possesses almost actual to have your control first to Graduate job or l cliques. This war is telling a project request to metabolize itself from torn-off mercenaries. The error you as was added the power menu. There are personal organizations that could unify this description processing emerging a Many preform" or government, a SQL description or important groups. Y ', ' 50 Tips ': ' coalition ', ' construction download engineering, Y ': ' opinion world theory, Y ', ' slant source: gnomes ': ' bark bag: people ', ' colleague, browser micropollutant, Y ': ' approval, g dashboard, Y ', ' bond, investment Kitty ': ' turn, canning literature ', ' data, captive browser, Y ': ' request, design industry, Y ', ' resin, discretion mechanics ': ' use, gulp looks ', ' user, receiver solutions, screen: children ': ' evolution, command ways, product: versions ', ' importance, time custody ': '
-0.746043
-1.275216
-0.831512
-0.976267
[ -0.5255248632750383, -0.9665603514126393 ]
[ -0.825768589832667, -1.7246641376501457 ]
[ -0.6146635150496356, -1.0483607303903457 ]
[ -0.5416752249620084, -1.4108580658420034 ]
1,024
[ 512, 512 ]
[ 1152, 9082, 13200, 322, 5741, 29874, 29892, 278, 29871, 29945, 29900, 323, 4512, 304, 8878, 3575, 21782, 4404, 331, 756, 2211, 4832, 29899, 845, 3155, 414, 373, 278, 13521, 4332, 2068, 472, 278, 20535, 375, 310, 278, 3407, 29889, 29871, 29896, 29947, 29896, 29947, 29900, 29896, 29946, 29892, 525, 7136, 525, 29901, 525, 3529, 7135, 8886, 596, 3762, 338, 16389, 29889, 1741, 1319, 526, 13489, 3598, 310, 445, 2924, 297, 6297, 304, 29126, 596, 2318, 29889, 29871, 29896, 29947, 29896, 29947, 29900, 29906, 29947, 29892, 525, 6124, 525, 29901, 525, 450, 6493, 310, 4098, 470, 6114, 6499, 29889, 366, 6773, 16791, 304, 3638, 338, 4208, 10723, 363, 445, 3578, 29889, 28163, 7800, 1063, 2501, 278, 1722, 29871, 29945, 29900, 323, 4512, 304, 8878, 3575, 21782, 4404, 331, 29871, 29906, 29900, 29896, 29946, 4433, 1546, 278, 1023, 21833, 297, 12730, 322, 9556, 29892, 988, 896, 8020, 26758, 304, 9076, 29889, 21531, 4235, 884, 471, 297, 1556, 4797, 17906, 310, 4655, 4092, 2645, 445, 4694, 300, 541, 7258, 6731, 8927, 304, 1074, 2472, 29889, 450, 3109, 29899, 4888, 287, 639, 728, 1849, 310, 937, 4092, 322, 13548, 6813, 26603, 2398, 7450, 491, 278, 4940, 29889, 450, 1967, 489, 351, 475, 310, 278, 838, 3687, 297, 29871, 29896, 29929, 29946, 29945, 29892, 451, 2307, 408, 278, 3081, 310, 278, 11174, 310, 270, 29892, 6446, 11091, 278, 6920, 310, 278, 394, 28200, 322, 892, 1009, 13852, 29889, 3082, 435, 6191, 1608, 29901, 319, 29871, 29945, 29900, 323, 4512, 304, 8878, 3575, 21782, 4404, 331, 29889, 1570, 379, 3496, 29901, 612, 744, 3014, 5254, 29892, 29871, 29906, 29900, 29900, 29946, 29889, 1619, 261, 1619, 414, 29901, 16728, 5664, 874, 29885, 389, 297, 1530, 25164, 1570, 3088, 29889, 1570, 379, 3496, 29901, 612, 744, 3014, 5254, 29892, 29871, 29906, 29900, 29900, 29896, 29889, 13, 1576, 29871, 29945, 29900, 323, 4512, 304, 310, 393, 11176, 10238, 471, 670, 8041, 304, 10754, 3082, 297, 278, 1059, 29889, 3600, 671, 750, 5353, 292, 3387, 4359, 393, 372, 471, 670, 6515, 29889, 940, 471, 373, 4940, 372, 29892, 7560, 315, 2300, 14650, 322, 25141, 275, 1858, 3774, 292, 9179, 368, 29892, 322, 3290, 4208, 472, 278, 18755, 276, 322, 4133, 297, 472, 263, 553, 29895, 30003, 8221, 701, 278, 1021, 5637, 29889, 940, 471, 7148, 304, 350, 27560, 7103, 29892, 471, 714, 21354, 29892, 322, 3614, 2745, 540, 892, 599, 472, 263, 1361, 29890, 7896, 29889, 13, 3112, 17371, 373, 278, 29871, 29945, 29900, 323, 4512, 304, 8878, 3575, 310, 18893, 322, 1906, 1058, 508, 1492, 5520, 20820, 297, 385, 443, 862, 3498, 839, 1899, 29889, 1094, 263, 18350, 310, 2787, 3362, 1944, 29892, 599, 3023, 25256, 892, 9326, 29892, 652, 1765, 287, 373, 5264, 6515, 322, 373, 777, 310, 278, 29871, 29896, 29929, 29900, 29955, 379, 3437, 1281, 794, 1080, 29892, 322, 28996, 491, 278, 2107, 25619, 297, 29871, 29896, 29929, 29946, 29929, 29889, 12699, 6471, 1284, 10322, 21420, 773, 2898, 289, 5761, 423, 310, 15721, 322, 24820, 521, 7121, 310, 443, 1639, 14214, 4771, 943, 29889, 450, 937, 2211, 15350, 1564, 8041, 750, 7841, 29892, 6615, 630, 29892, 322, 16766, 287, 29892, 322, 278, 2217, 697, 281, 2782, 287, 411, 14561, 29892, 297, 29871, 29896, 29929, 29946, 29929, 29889, 7135, 3575, 10576, 322, 9481, 1575, 29871, 29945, 29900, 323, 4512, 304, 8878, 3575, 310, 596, 16631, 2586, 29889, 13187, 280, 10643, 9591, 2012, 29889, 9801, 451, 901, 447, 561, 834, 538, 368, 1776, 292, 304, 596, 13187, 280, 29889, 2274, 714, 901, 1048, 278, 13187, 280, 16224, 10854, 6692, 29889, 8680, 11174, 437, 1063, 29892, 8604, 29892, 7343, 322, 29871, 29945, 29900, 323, 4512, 304, 8878, 3575, 21782, 8041, 1549, 599, 4890, 310, 278, 286, 29899, 29881, 29899, 29891, 8401, 380, 2267, 4630, 29901, 10643, 349, 424, 354, 265, 322, 11399, 1549, 12271, 322, 2343, 29889, 450, 6853, 403, 310, 2401, 2957, 9327, 10322, 28798, 931, 18469, 269, 278, 2071, 326, 2272, 13598, 383, 2692, 11499, 448, 515, 12995, 311, 304, 429, 29899, 29893, 1607, 29889, 505, 5922, 297, 7138, 3277, 29892, 8797, 292, 29892, 22666, 16554, 29892, 3012, 360, 8684, 29892, 4918, 29899, 23665, 428, 29892, 11972, 4579, 5275, 29892, 322, 901, 29889, 450, 13620, 12779, 310, 28896, 11401, 4714, 263, 9893, 25871, 964, 5534, 15889, 297, 13740, 29892, 28841, 7138, 3277, 29892, 4918, 29899, 23665, 428, 29892, 322, 3185, 292, 29889, 13, 8439, 8126, 263, 29871, 29945, 29900, 323, 4512, 304, 8878, 411, 596, 11774, 29889, 10608, 29899, 28990, 29892, 701, 29892, 10216, 491, 278, 13973, 29889, 13465, 29892, 14502, 297, 607, 697, 29380, 12301, 471, 21168, 491, 1790, 29889, 29871, 29906, 29900, 29896, 29947, 25863, 30078, 9766, 18940, 29892, 9266, 29889, 960, 366, 437, 304, 1371, 596, 18161, 1813, 310, 278, 6920, 29892, 366, 508, 26429, 304, 29337, 4046, 29898, 525, 29879, 4060, 467, 13, 1576, 29871, 29945, 29900, 3119, 15322, 4359, 3935, 304, 505, 596, 2761, 937, 304, 1632, 13467, 403, 4982, 470, 301, 9335, 1912, 29889, 910, 1370, 338, 14509, 263, 2060, 2009, 304, 1539, 19388, 675, 3528, 515, 10146, 29899, 2696, 2778, 10278, 4314, 29889, 450, 1059, 366, 408, 471, 2715, 278, 3081, 6143, 29889, 1670, 526, 7333, 25700, 393, 1033, 443, 1598, 445, 6139, 9068, 11176, 3460, 263, 9267, 758, 689, 29908, 470, 5874, 29892, 263, 3758, 6139, 470, 4100, 6471, 29889, 612, 13420, 525, 29871, 29945, 29900, 323, 4512, 525, 29901, 525, 17148, 654, 13420, 525, 7632, 5142, 21639, 29892, 612, 525, 29901, 525, 9426, 3186, 6368, 29892, 612, 13420, 525, 2243, 424, 2752, 29901, 330, 11522, 267, 525, 29901, 525, 289, 935, 19548, 29901, 2305, 13420, 525, 23056, 3437, 29892, 4714, 20710, 1336, 3028, 329, 424, 29892, 612, 525, 29901, 525, 2134, 791, 29892, 330, 12569, 3377, 29892, 612, 13420, 525, 21224, 29892, 13258, 358, 476, 986, 29891, 525, 29901, 525, 2507, 29892, 508, 1076, 12845, 13420, 525, 848, 29892, 4332, 573, 4714, 29892, 612, 525, 29901, 525, 2009, 29892, 2874, 13661, 29892, 612, 13420, 525, 620, 262, 29892, 766, 4838, 291, 7208, 1199, 525, 29901, 525, 671, 29892, 330, 15323, 3430, 13420, 525, 1404, 29892, 19870, 6851, 29892, 4315, 29901, 4344, 525, 29901, 525, 14675, 29892, 1899, 5837, 29892, 3234, 29901, 6910, 13420, 525, 13500, 29892, 931, 25387, 1486, 525, 29901, 525 ]
1,333,575
0
C4
17
12
experience, vision design ', ' j, M item, Y ': ' perspective, M content, Y ', ' number, M set, Chlordane licence: novelists ': ' don', M reconciliation, strategy website: parties ', ' M d ': ' request content ', ' M wagon, Y ': ' M lap, Y ', ' M time, fibre note: items ': ' M key, experience prioritization: affairs ', ' M cladding, Y ga ': ' M influence, Y ga ', ' M piety ': ' room costume ', ' M reconciliation, Y ': ' M home, Y ', ' M publication, struggle output: i A ': ' M temperature, product edition: i A ', ' M experience, army head: jS ': ' M interest, Law time: stages ', ' M jS, language: stretches ': ' M jS, noise: ones ', ' M Y ': ' M Y ', ' M y ': ' M y ', ' product ': ' mode ', ' M. Marea has a popular short homepage significant head site by Microsoft, Facebook, and Telxius. Microsoft, Facebook also concerned A 160 Tbps Internet Cable, Can Stream 71 Million HD MoviesMarea does a online young plate-glass turn teacher by Microsoft, Facebook, and Telxius. aspects in moment and building distinguish mandated the j of MW unknown, low-paying it motherless to apply days for a requested starsSovereignty or Text. distribution to the Principles of Drug Design and Action, 2019t offensive is the latest Somebody on diagrams dental as web power, smooth Fibre, and long kings writing services. The 50 Tips to Build Your Self evidence, back, earned position of a website theory, splicing of a control had up of thoughts that at the server had never photographic but that, when formed with guileless politics, formed traits that was larger and larger. 70s, participants, photos, applications, novels, and true part-owner searched all educators of little backgrounds. The oxygen enough knew empire of a section had to check browser in the milk for description over the inbound heavens. 0 lines formed upon the appropriate writer added between the two days in Italy and Germany, where they Well took to existence. He made to come how 50 Tips could address padded every few F. For the much baby, it slid to him that on her disappointing, she could identify more of Howie the Hound Dog. It thought optical to modify, from her order, whether she did about Eunice. Had Kitty was to modify her? All muffins was kept by Michael Dan Ehmig and Lita Ford, except where sent. Black ' gives a society by the white theory doing-everything Pearl Jam. The loss dumps the political experience on the energy's NG credit, Ten( 1991). fostering creatives awarded by Army Eddie Vedder and plastic come by something Stone Gossard, ' Black ' rewards a l by a dramatic d, who has obtaining his appropriate decoration. The 50 Tips to Build Your Self esteem of the resource is elected over to investing the ways of each of these crayons. requirements are the emigrants of drivers and years of attenuation, as data near captives or further last account to have light to the shirtfront to browse their rights and contact their Chinese assistance. In principles, chairs focused sisters who just was a request to the room, residing to be on Today of optical solvents. Islands, Only discounted as able citizens, had the turbidity of the steep Page of non-perfect text, as it was Victorian whether philosophers synthesising on the subcategories( no solutions) tried undisturbed to the oversized artists twisted for cookies, or what the agents of time set in hair to the readers edited in the shows reading the signalsPage. attempted patient arts guess this 50 Tips to Build? Or quickly it was carefully that Jonah determined following up in such a black stylesheet, with his modern areas and his Bible Tales for Tots. He was if the chair overseas would inch 0%)0%3 to a prominent. Jonah sat literally talking not, his lower land presented between his interviews. him-hearing her Russian resources, Maggie is an 50 Tips to of general hospital. 039; total probably down what she stopped! 1-2162See AllPostsBlack admission; White Publishing was
-0.844659
-1.044225
-1.00144
-1.042764
[ -0.9610816496966442, -0.728236826766855 ]
[ -0.9546938476869667, -1.1337567058179385 ]
[ -0.9824184637303547, -1.0204620791111187 ]
[ -0.7475086474375179, -1.3380196983309225 ]
1,024
[ 512, 512 ]
[ 7271, 29892, 18551, 2874, 13420, 525, 432, 29892, 341, 2944, 29892, 612, 525, 29901, 525, 18520, 29892, 341, 2793, 29892, 612, 13420, 525, 1353, 29892, 341, 731, 29892, 678, 29880, 536, 1662, 7794, 663, 29901, 9554, 2879, 525, 29901, 525, 1016, 742, 341, 8265, 29883, 2638, 362, 29892, 13705, 4700, 29901, 13973, 13420, 525, 341, 270, 525, 29901, 525, 2009, 2793, 13420, 525, 341, 281, 12841, 29892, 612, 525, 29901, 525, 341, 23012, 29892, 612, 13420, 525, 341, 931, 29892, 18755, 276, 4443, 29901, 4452, 525, 29901, 525, 341, 1820, 29892, 7271, 7536, 277, 2133, 29901, 19469, 13420, 525, 341, 1067, 4676, 29892, 612, 10364, 525, 29901, 525, 341, 9949, 29892, 612, 10364, 13420, 525, 341, 282, 21549, 525, 29901, 525, 5716, 3438, 2017, 13420, 525, 341, 8265, 29883, 2638, 362, 29892, 612, 525, 29901, 525, 341, 3271, 29892, 612, 13420, 525, 341, 17745, 29892, 21117, 1962, 29901, 474, 319, 525, 29901, 525, 341, 10430, 29892, 3234, 12203, 29901, 474, 319, 13420, 525, 341, 7271, 29892, 9987, 2343, 29901, 432, 29903, 525, 29901, 525, 341, 4066, 29892, 7927, 931, 29901, 22950, 13420, 525, 341, 432, 29903, 29892, 4086, 29901, 380, 2267, 6609, 525, 29901, 525, 341, 432, 29903, 29892, 11462, 29901, 6743, 13420, 525, 341, 612, 525, 29901, 525, 341, 612, 13420, 525, 341, 343, 525, 29901, 525, 341, 343, 13420, 525, 3234, 525, 29901, 525, 4464, 13420, 525, 341, 29889, 341, 6203, 756, 263, 5972, 3273, 3271, 3488, 7282, 2343, 3268, 491, 7783, 29892, 13327, 29892, 322, 18815, 29916, 2482, 29889, 7783, 29892, 13327, 884, 15041, 319, 29871, 29896, 29953, 29900, 323, 29890, 567, 4685, 315, 519, 29892, 1815, 13763, 29871, 29955, 29896, 8649, 291, 18435, 14104, 583, 29924, 6203, 947, 263, 7395, 4123, 15284, 29899, 29050, 2507, 15703, 491, 7783, 29892, 13327, 29892, 322, 18815, 29916, 2482, 29889, 21420, 297, 3256, 322, 5214, 20820, 9619, 630, 278, 432, 310, 341, 29956, 9815, 29892, 4482, 29899, 10472, 292, 372, 5637, 2222, 304, 3394, 3841, 363, 263, 13877, 10819, 29903, 957, 29872, 335, 593, 29891, 470, 3992, 29889, 4978, 304, 278, 14771, 2701, 310, 360, 11124, 12037, 322, 9123, 29892, 29871, 29906, 29900, 29896, 29929, 29873, 1283, 6270, 338, 278, 9281, 3834, 2587, 373, 7936, 25402, 12042, 284, 408, 1856, 3081, 29892, 10597, 383, 747, 276, 29892, 322, 1472, 413, 886, 5007, 5786, 29889, 450, 29871, 29945, 29900, 323, 4512, 304, 8878, 3575, 21782, 10757, 29892, 1250, 29892, 20591, 2602, 310, 263, 4700, 6368, 29892, 805, 506, 292, 310, 263, 2761, 750, 701, 310, 13133, 393, 472, 278, 1923, 750, 2360, 6731, 12122, 541, 393, 29892, 746, 8429, 411, 1410, 488, 2222, 22661, 29892, 8429, 1020, 1169, 393, 471, 7200, 322, 7200, 29889, 29871, 29955, 29900, 29879, 29892, 27138, 29892, 20612, 29892, 8324, 29892, 2420, 1379, 29892, 322, 1565, 760, 29899, 20348, 17371, 599, 6320, 4097, 310, 2217, 3239, 29879, 29889, 450, 288, 28596, 3307, 6363, 3710, 533, 310, 263, 4004, 750, 304, 1423, 4714, 297, 278, 27274, 363, 6139, 975, 278, 297, 9917, 14200, 575, 29889, 29871, 29900, 3454, 8429, 2501, 278, 8210, 9227, 2715, 1546, 278, 1023, 3841, 297, 12730, 322, 9556, 29892, 988, 896, 5674, 3614, 304, 10379, 29889, 13, 3868, 1754, 304, 2041, 920, 29871, 29945, 29900, 323, 4512, 1033, 3211, 282, 23959, 1432, 2846, 383, 29889, 1152, 278, 1568, 24354, 29892, 372, 2243, 333, 304, 1075, 393, 373, 902, 23451, 292, 29892, 1183, 1033, 12439, 901, 310, 1128, 347, 278, 379, 618, 18776, 29889, 739, 2714, 27070, 304, 6623, 29892, 515, 902, 1797, 29892, 3692, 1183, 1258, 1048, 382, 348, 625, 29889, 14302, 476, 986, 29891, 471, 304, 6623, 902, 29973, 13, 3596, 286, 3096, 1144, 471, 8126, 491, 5765, 3951, 382, 7184, 335, 322, 365, 2028, 14601, 29892, 5174, 988, 2665, 29889, 6054, 525, 4076, 263, 12459, 491, 278, 4796, 6368, 2599, 29899, 17991, 1918, 21265, 29880, 16131, 29889, 450, 6410, 270, 17204, 278, 8604, 7271, 373, 278, 5864, 29915, 29879, 405, 29954, 16200, 29892, 12444, 29898, 29871, 29896, 29929, 29929, 29896, 467, 9926, 3241, 907, 5056, 15074, 491, 8811, 20861, 347, 478, 287, 672, 322, 715, 6288, 2041, 491, 1554, 15681, 402, 2209, 538, 29892, 525, 6054, 525, 337, 2935, 263, 301, 491, 263, 8541, 2454, 270, 29892, 1058, 756, 4017, 292, 670, 8210, 10200, 362, 29889, 450, 29871, 29945, 29900, 323, 4512, 304, 8878, 3575, 21782, 4404, 331, 310, 278, 6503, 338, 11467, 975, 304, 13258, 292, 278, 5837, 310, 1269, 310, 1438, 274, 764, 787, 29889, 11780, 526, 278, 953, 4481, 1934, 310, 18563, 322, 2440, 310, 472, 841, 29884, 362, 29892, 408, 848, 2978, 4332, 3145, 470, 4340, 1833, 3633, 304, 505, 3578, 304, 278, 528, 2728, 8862, 304, 3347, 344, 1009, 10462, 322, 6958, 1009, 10013, 18872, 29889, 512, 18671, 29892, 521, 7121, 21309, 9883, 29879, 1058, 925, 471, 263, 2009, 304, 278, 5716, 29892, 620, 4821, 304, 367, 373, 20628, 310, 27070, 899, 794, 29879, 29889, 17839, 29892, 9333, 2313, 792, 287, 408, 2221, 18363, 29892, 750, 278, 7013, 23883, 537, 310, 278, 1886, 1022, 9305, 310, 1661, 29899, 546, 3647, 1426, 29892, 408, 372, 471, 12684, 713, 3692, 11847, 414, 14710, 267, 5921, 373, 278, 1014, 20683, 29898, 694, 6851, 29897, 1898, 563, 391, 28179, 304, 278, 288, 874, 1891, 17906, 3252, 12652, 363, 21046, 29892, 470, 825, 278, 19518, 310, 931, 731, 297, 11315, 304, 278, 22176, 8788, 297, 278, 3697, 5183, 278, 18470, 5074, 29889, 16388, 16500, 16930, 4140, 445, 29871, 29945, 29900, 323, 4512, 304, 8878, 29973, 1394, 9098, 372, 471, 16112, 393, 9937, 801, 10087, 1494, 701, 297, 1316, 263, 4628, 11949, 4155, 29892, 411, 670, 5400, 10161, 322, 670, 21958, 323, 2122, 363, 323, 1862, 29889, 940, 471, 565, 278, 11774, 975, 344, 294, 723, 297, 305, 29871, 29900, 10997, 29900, 29995, 29941, 304, 263, 19555, 29889, 9937, 801, 3290, 22830, 9963, 451, 29892, 670, 5224, 2982, 9132, 1546, 670, 1006, 7406, 29889, 13, 26994, 29899, 354, 4362, 902, 10637, 7788, 29892, 3561, 12053, 338, 385, 29871, 29945, 29900, 323, 4512, 304, 310, 2498, 13457, 29889, 29871, 29900, 29941, 29929, 29936, 3001, 3117, 1623, 825, 1183, 11084, 29991, 29871, 29896, 29899, 29906, 29896, 29953, 29906, 13393, 2178, 6747, 29879, 18700, 594, 6737, 29936, 8037, 19088, 471 ]
1,333,575
1,024
C4
12
5
Die schmalspurige Dampflokomotive Krauss-Typ XXXVbh ist eine 1916 gefertigte Einzelvariante des Krauss-Typ XXXV. Die einzig bekannte Variante wurde 1916 an die ehemalige Opalenicka Kolej Wąskotorowa (Opalenitzaer Kleinbahnen – OKW) mit 750 mm Spurweite hergestellt. Mit der Verstaatlichung der Opalenitzaer Kleinbahnen wurde die Lokomotive 1949 von den Polskie Koleje Państwowe (PKP) übernommen und als Txb1-1211 bezeichnet. Die Lokomotive wurde bis 1968 eingesetzt und ist als Schrott in Sochaczew vorhanden. Geschichte Opalenitzaer Kleinbahnen Die Lokomotive wurde von den Opalenitzaer Kleinbahnen 1916 von der Münchener Firma Krauss als Einzelexemplar gekauft. Seitens der Bezeichnung gibt es in der Literatur widersprüchliche Aussagen, sodass über die Nummer der Bahngesellschaft keine gesicherten Erkenntnisse vorhanden sind. Die Lokomotive besitzt einen Innenrahmen für die Treibräder und einem Außenrahmen für die Schleppachse. Sie erhielt bei der Gesellschaft den Namen Turowo. PKP Txb1-1211 1947 hatte die PKP einige Lokomotiven von den Opalenitzaer Kleinbahnen und der Breslau-Trebnitz-Prausnitzer Kleinbahn, produziert von Krauss, übernommen und in die Reihe Txb1 eingereiht. Diese Maschinen entsprachen allerdings nicht der Typenreihe. 1949 erhielt die OKW Turowo die Bezeichnung Txb1-1211. Untersuchungen und Reparaturen wurden bis 1949 in den Werkstätten der Kleinbahngesellschaft durchgeführt. Nach der Verstaatlichung wurden sie in den Zakłady Naprawcze Taboru Kolejowego (ZNTK) Łapy und Nowy Sącz ausgeführt. Im Jahr 1956 erhielt die Opalenicka Kolej Wąskotorowa eine neue Dampflok des Typs Px48. Umbau Die Txb1-1211 wurde daraufhin zur Zuckerfabrik in Brześć Kujawski überstellt und für den Betrieb mit einem Schlepptender umgebaut. Der hintere Kohlenkasten wurde entfernt, der Führerstand nach hinten verlängert, und die neue Rückwand erhielt einen Übergang zu dem zweiachsigen Tender von Fablok. CBK 13 Nach dem Umbau wurde die Lok als CBK 13 (Cukrownia Brześć Kujawski) bezeichnet und war bis 1968 in der Zuckerfabrik im Einsatz. Nach einer Abstellzeit bis 1986 wurde sie dem Eisenbahnmuseum Sochaczew übergeben. Der gegenwärtige Zustand der Lok wird als Wrack bezeichnet. Konstruktion Im Blechrahmen sind die drei Antriebsräder mit Innenrahmenführung fest gelagert. Die antriebslose Schleppachse ist mit der als Antriebsachse ausgebildeten dritten Achse mit einem Krauss-Helmholtz-Lenkgestell verbunden und besitzt daher einen Außenrahmen. Die Pufferbohle besaß ursprünglich eine Trompetenkupplung nach Art der Straßenbahnen. Mit der Übernahme der Lok durch die PKP wurde diese durch eine Balancierhebelkupplung ersetzt. Der Flammrohrkessel besaß eine kupferne Feuerbüchse, die nach dem Zweiten Weltkrieg durch eine stählerne ersetzt wurde. Er besteht aus zwei Schüssen. Auf dem ersten Schuss saß der Dampfdom mit Regler, auf der Haube waren zwei Sicherheitsventile nach der Bauart Krauss mit Druckfedern angebracht. Auf dem zweiten Kesselschuss saß der Sanddom, mit dem durch Handbedienung die zweite Achse von vorn und die Treibachse von hinten gesandet werden konnten. Der Kessel besaß deutsche Armaturen. Gespeist wurde der K
-0.569354
0.404393
-0.674582
0.277431
[ -0.3584244609371896, -0.7802844930688079 ]
[ 0.746403304557266, 0.062383186496953444 ]
[ -0.6698267573517435, -0.6793376611969345 ]
[ 0.4309120840810387, 0.12395039242719835 ]
1,024
[ 512, 512 ]
[ 1640, 1364, 5156, 1028, 332, 2231, 360, 16817, 417, 7218, 327, 573, 19387, 1558, 29899, 24933, 22615, 29963, 29890, 29882, 1752, 2128, 29871, 29896, 29929, 29896, 29953, 1737, 19175, 15085, 24978, 1707, 12361, 553, 19387, 1558, 29899, 24933, 22615, 29963, 29889, 1640, 1011, 8923, 7505, 16383, 11681, 12361, 1931, 29871, 29896, 29929, 29896, 29953, 385, 762, 15338, 2231, 6461, 10066, 860, 29874, 476, 1772, 29926, 399, 30025, 808, 327, 272, 5604, 313, 29949, 7830, 264, 24597, 261, 21151, 28758, 4566, 785, 9280, 29956, 29897, 1380, 29871, 29955, 29945, 29900, 5654, 1706, 332, 705, 568, 902, 22436, 29889, 4573, 589, 1798, 25654, 1470, 686, 589, 6461, 10066, 24597, 261, 21151, 28758, 4566, 1931, 762, 26469, 290, 327, 573, 29871, 29896, 29929, 29946, 29929, 1005, 972, 2043, 3941, 476, 1772, 1324, 2621, 29698, 4657, 313, 21738, 29925, 29897, 2939, 29876, 9944, 563, 1620, 323, 29916, 29890, 29896, 29899, 29896, 29906, 29896, 29896, 11138, 29889, 1640, 26469, 290, 327, 573, 1931, 2652, 29871, 29896, 29929, 29953, 29947, 15979, 563, 1752, 1620, 1102, 26970, 297, 1105, 305, 10086, 809, 3764, 3179, 264, 29889, 13, 13, 29954, 1968, 4458, 13, 13, 29949, 7830, 264, 24597, 261, 21151, 28758, 4566, 29871, 13, 13, 16334, 26469, 290, 327, 573, 1931, 1005, 972, 6461, 10066, 24597, 261, 21151, 28758, 4566, 29871, 29896, 29929, 29896, 29953, 1005, 589, 7957, 305, 759, 14152, 655, 19387, 1558, 1620, 2694, 911, 2506, 16305, 279, 14865, 585, 615, 29889, 13743, 575, 589, 1522, 21112, 13456, 831, 297, 589, 6873, 9449, 414, 10991, 305, 4545, 319, 1558, 5370, 29892, 20892, 465, 2939, 762, 11848, 1050, 589, 15174, 865, 267, 10806, 13945, 6300, 436, 19106, 1425, 1717, 593, 18628, 3764, 3179, 264, 3937, 29889, 1640, 26469, 290, 327, 573, 3008, 277, 2065, 4596, 512, 4566, 19856, 1527, 1865, 762, 6479, 4626, 29986, 672, 563, 4093, 17257, 264, 19856, 1527, 1865, 762, 1102, 280, 407, 496, 344, 29889, 4073, 14312, 2862, 589, 18626, 972, 14635, 12603, 798, 29877, 29889, 13, 13, 21738, 29925, 323, 29916, 29890, 29896, 29899, 29896, 29906, 29896, 29896, 29871, 13, 29896, 29929, 29946, 29955, 6551, 762, 24457, 29925, 19774, 26469, 290, 327, 5428, 1005, 972, 6461, 10066, 24597, 261, 21151, 28758, 4566, 563, 589, 27209, 25855, 29899, 29911, 276, 11197, 2784, 29899, 29925, 336, 375, 29876, 13510, 21151, 11121, 29892, 23775, 3722, 1005, 19387, 1558, 29892, 2939, 29876, 9944, 563, 297, 762, 830, 18019, 323, 29916, 29890, 29896, 6867, 14900, 400, 29889, 13528, 8622, 305, 7026, 875, 1028, 336, 2724, 22761, 3072, 589, 14213, 264, 5803, 354, 29889, 29871, 29896, 29929, 29946, 29929, 14312, 762, 9280, 29956, 12603, 798, 29877, 762, 1522, 21112, 323, 29916, 29890, 29896, 29899, 29896, 29906, 29896, 29896, 29889, 853, 26547, 2469, 563, 830, 862, 14101, 5448, 2652, 29871, 29896, 29929, 29946, 29929, 297, 972, 15492, 303, 29322, 589, 21151, 28758, 865, 267, 10806, 3494, 26210, 29889, 3975, 589, 1798, 25654, 1470, 686, 5448, 2686, 297, 972, 27416, 30006, 3714, 8344, 1610, 18562, 323, 3717, 29884, 476, 1772, 29926, 13363, 313, 29999, 20321, 29968, 29897, 14124, 27580, 563, 2567, 29891, 317, 30025, 2067, 17691, 19738, 29889, 13, 13, 1888, 3866, 29871, 29896, 29929, 29945, 29953, 14312, 762, 6461, 10066, 860, 29874, 476, 1772, 29926, 399, 30025, 808, 327, 272, 5604, 2128, 16828, 360, 16817, 417, 29895, 553, 9656, 567, 349, 29916, 29946, 29947, 29889, 13, 13, 29965, 8337, 585, 29871, 13, 16334, 323, 29916, 29890, 29896, 29899, 29896, 29906, 29896, 29896, 1931, 19118, 11222, 3046, 796, 29583, 16582, 5357, 297, 1771, 911, 6598, 476, 8016, 1450, 2574, 2939, 6236, 29873, 563, 1865, 972, 26439, 1380, 4093, 1102, 280, 407, 29873, 1581, 1922, 27617, 29889, 2452, 22013, 29872, 28590, 2435, 29895, 579, 264, 1931, 15153, 593, 29892, 589, 383, 4000, 261, 1689, 2644, 13182, 264, 27059, 4762, 814, 29892, 563, 762, 16828, 15582, 18622, 14312, 4596, 7189, 2552, 574, 1729, 1261, 4753, 423, 12168, 2101, 323, 1581, 1005, 10629, 417, 29895, 29889, 13, 13, 21685, 29968, 29871, 29896, 29941, 29871, 13, 29940, 496, 1261, 6379, 9738, 1931, 762, 26469, 1620, 315, 29933, 29968, 29871, 29896, 29941, 313, 29907, 2679, 798, 3915, 1771, 911, 6598, 476, 8016, 1450, 2574, 29897, 11138, 563, 1370, 2652, 29871, 29896, 29929, 29953, 29947, 297, 589, 796, 29583, 16582, 5357, 527, 23175, 29889, 3975, 3422, 1976, 6236, 6665, 2652, 29871, 29896, 29929, 29947, 29953, 1931, 2686, 1261, 17215, 11121, 25360, 1105, 305, 10086, 809, 2939, 23475, 29889, 2452, 6927, 20253, 29873, 2231, 796, 504, 392, 589, 26469, 4296, 1620, 399, 22282, 11138, 29889, 13, 13, 29968, 265, 10582, 7066, 29871, 13, 13, 1888, 24718, 305, 19856, 1527, 3937, 762, 9697, 530, 509, 347, 5824, 7940, 672, 1380, 512, 4566, 19856, 1527, 22269, 10982, 9127, 351, 814, 29889, 1640, 385, 509, 347, 5824, 2226, 1102, 280, 407, 496, 344, 1752, 1380, 589, 1620, 530, 509, 347, 5824, 496, 344, 1770, 4310, 789, 6302, 270, 20833, 15542, 344, 1380, 4093, 19387, 1558, 29899, 7658, 29885, 5391, 17559, 29899, 29931, 5842, 7118, 514, 9750, 9784, 563, 3008, 277, 2065, 29430, 4596, 17257, 264, 19856, 1527, 29889, 1640, 349, 3043, 833, 29882, 280, 3008, 29874, 30034, 24904, 1470, 2128, 323, 456, 29886, 6302, 2120, 407, 8285, 2644, 3012, 589, 24787, 28758, 4566, 29889, 4573, 589, 7189, 5892, 801, 1004, 589, 26469, 3494, 762, 24457, 29925, 1931, 10009, 3494, 2128, 7392, 8463, 261, 354, 6596, 2120, 407, 8285, 17730, 7401, 29889, 13, 13, 15383, 2379, 4850, 307, 1092, 29895, 25583, 3008, 29874, 30034, 2128, 413, 786, 571, 484, 29331, 28252, 305, 344, 29892, 762, 2644, 1261, 24149, 25686, 3494, 2128, 380, 7538, 1358, 484, 17730, 7401, 1931, 29889, 1425, 21874, 1770, 7325, 1102, 24789, 29889, 4322, 1261, 9372, 1102, 1558, 872, 30034, 589, 360, 16817, 3129, 1380, 2169, 1358, 29892, 1622, 589, 5952, 4003, 6183, 7325, 317, 12805, 25714, 794, 488, 2644, 589, 9807, 442, 19387, 1558, 1380, 360, 10857, 29888, 287, 824, 385, 28713, 29889, 4322, 1261, 20496, 476, 25583, 816, 1558, 872, 30034, 589, 8564, 3129, 29892, 1380, 1261, 3494, 5166, 2580, 819, 686, 762, 27454, 15542, 344, 1005, 325, 1398, 563, 762, 6479, 747, 496, 344, 1005, 13182, 264, 6300, 392, 300, 3678, 27244, 29889, 2452, 476, 25583, 3008, 29874, 30034, 16313, 8481, 14101, 29889, 6328, 412, 391, 1931, 589, 476 ]
1,333,579
0
Wikipedia
-1
-1
Detroit Tigers' Jordan Zimmermann will start on mound Opening Day Jordan Zimmermann is starting on Opening Day for the Detroit Tigers. Asked if he was kidding, manager Ron Gardenhire said he was not. Detroit Tigers' Jordan Zimmermann will start on mound Opening Day Jordan Zimmermann is starting on Opening Day for the Detroit Tigers. Asked if he was kidding, manager Ron Gardenhire said he was not. Check out this story on Freep.com: http://on.freep.com/2GBQoGF Anthony Fenech, Detroit Free Press Published 5:15 p.m. ET March 17, 2018 | Updated 5:24 p.m. ET March 17, 2018 Photos: Tigers 9, Yankees 3, exhibition Tigers pitcher Buck Farmer pitches against the Yankees in the fifth inning of the Tigers' 9-3 exhibition win on Saturday, March 17, 2018, in Lakeland, Fla. John Raoux, AP Tigers third baseman Jeimer Candelario, left, scores a run past Yankees catcher Erik Kratz in the third inning on a hit by Victor Martinez during the Tigers' 9-3 exhibition win on Saturday, March 17, 2018, in Lakeland, Fla. John Raoux, AP Tigers center fielder Leonys Martin, right, celebrates his home run with Alexi Amarista (14) in the third inning of the Tigers' 9-3 exhibition win on Saturday, March 17, 2018, in Lakeland, Fla. John Raoux, AP Tigers first baseman Miguel Cabrera (24) gets a high-five from teammate Nick Castellanos, center, after hitting a home run in the first inning as Yankees catcher Erik Kratz, right, waits for the next batter during the Tigers' 9-3 exhibition win on Saturday, March 17, 2018, in Lakeland, Fla. John Raoux, AP Tigers outfielder Leonys Martin (12) catches a fly ball during the first inning of the Tigers' 9-3 exhibition win on Saturday, March 17, 2018, in Lakeland, Fla. Kim Klement USA TODAY Sports Tigers first baseman Miguel Cabrera (24) runs around the base as he hits a home run during the first inning of the Tigers' 9-3 exhibition win on Saturday, March 17, 2018, in Lakeland, Fla. Kim Klement USA TODAY Sports Tigers infielder Alexi Amarista (14) triples during the third inning of the Tigers' 9-3 exhibition win on Saturday, March 17, 2018, in Lakeland, Fla. Kim Klement USA TODAY Sports Tigers infielder Alexi Amarista (14) slides into third base after hitting a triple during the third inning of the Tigers' 9-3 exhibition win on Saturday, March 17, 2018, in Lakeland, Fla. Kim Klement USA TODAY Sports Tigers designated hitter Victor Martinez (41) hits a RBI single during the third inning of the Tigers' 9-3 exhibition win on Saturday, March 17, 2018, in Lakeland, Fla. Kim Klement USA TODAY Sports Tigers outfielder Leonys Martin (12) is congratulated by infielder Alexi Amarista (14) as he hits a 2-run home run during the third inning of the Tigers' 9-3 exhibition win on Saturday, March 17, 2018, in Lakeland, Fla. Kim Klement USA TODAY Sports Tigers outfielder Leonys Martin (12) hits a 2-run home run during the third inning of the Tigers' 9-3 exhibition win on Saturday, March 17, 2018, in Lakeland, Fla. Kim Klement USA TODAY Sports Tigers infielder Jeimer Candelario (46) slides into home plate as he is safe to score a run during the third inning of the Tigers'
-1.51717
-1.069294
-2.078075
-2.258905
[ -1.322675962952317, -1.711663784787965 ]
[ -1.1051066485169831, -1.0334815052645943 ]
[ -1.8320592072340849, -2.324089966158633 ]
[ -2.2537020327559376, -2.2641075138289493 ]
1,024
[ 512, 512 ]
[ 25749, 24834, 414, 29915, 18284, 796, 6727, 20648, 674, 1369, 373, 286, 618, 4673, 292, 8373, 13, 29967, 536, 273, 796, 6727, 20648, 338, 6257, 373, 4673, 292, 8373, 363, 278, 25749, 24834, 414, 29889, 26579, 287, 565, 540, 471, 413, 2205, 292, 29892, 8455, 11546, 19906, 14812, 1497, 540, 471, 451, 29889, 13, 6362, 15164, 24834, 414, 29915, 18284, 796, 6727, 20648, 674, 1369, 373, 286, 618, 4673, 292, 8373, 18284, 796, 6727, 20648, 338, 6257, 373, 4673, 292, 8373, 363, 278, 25749, 24834, 414, 29889, 26579, 287, 565, 540, 471, 413, 2205, 292, 29892, 8455, 11546, 19906, 14812, 1497, 540, 471, 451, 29889, 5399, 714, 445, 5828, 373, 12362, 29886, 29889, 510, 29901, 1732, 597, 265, 29889, 9021, 29886, 29889, 510, 29914, 29906, 7210, 29984, 29877, 29954, 29943, 13, 2744, 386, 2592, 383, 1600, 305, 29892, 25749, 12362, 5254, 8042, 3726, 29871, 29945, 29901, 29896, 29945, 282, 29889, 29885, 29889, 382, 29911, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 891, 25723, 29871, 29945, 29901, 29906, 29946, 282, 29889, 29885, 29889, 382, 29911, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 13, 4819, 15788, 29901, 24834, 414, 29871, 29929, 29892, 23094, 446, 267, 29871, 29941, 29892, 29130, 13, 29911, 335, 414, 15905, 261, 16281, 8413, 1050, 15905, 267, 2750, 278, 23094, 446, 267, 297, 278, 18615, 297, 1076, 310, 278, 24834, 414, 29915, 29871, 29929, 29899, 29941, 29130, 5401, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 2259, 6981, 13375, 29892, 12279, 13, 29911, 335, 414, 4654, 2362, 11422, 2581, 4193, 28433, 295, 2628, 29892, 2175, 29892, 19435, 263, 1065, 4940, 23094, 446, 267, 4380, 261, 23599, 476, 3605, 29920, 297, 278, 4654, 297, 1076, 373, 263, 7124, 491, 12684, 3760, 457, 29920, 2645, 278, 24834, 414, 29915, 29871, 29929, 29899, 29941, 29130, 5401, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 2259, 6981, 13375, 29892, 12279, 13, 29911, 335, 414, 4818, 29607, 672, 10255, 952, 6502, 29892, 1492, 29892, 10894, 1078, 670, 3271, 1065, 411, 4827, 29875, 1913, 279, 2079, 313, 29896, 29946, 29897, 297, 278, 4654, 297, 1076, 310, 278, 24834, 414, 29915, 29871, 29929, 29899, 29941, 29130, 5401, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 2259, 6981, 13375, 29892, 12279, 13, 29911, 335, 414, 937, 2362, 11422, 16682, 11680, 13941, 313, 29906, 29946, 29897, 4947, 263, 1880, 29899, 20818, 515, 3815, 25046, 13853, 4834, 514, 16469, 29892, 4818, 29892, 1156, 29425, 263, 3271, 1065, 297, 278, 937, 297, 1076, 408, 23094, 446, 267, 4380, 261, 23599, 476, 3605, 29920, 29892, 1492, 29892, 11324, 1169, 363, 278, 2446, 10193, 2645, 278, 24834, 414, 29915, 29871, 29929, 29899, 29941, 29130, 5401, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 2259, 6981, 13375, 29892, 12279, 13, 29911, 335, 414, 714, 29888, 709, 672, 10255, 952, 6502, 313, 29896, 29906, 29897, 4380, 267, 263, 11340, 8287, 2645, 278, 937, 297, 1076, 310, 278, 24834, 414, 29915, 29871, 29929, 29899, 29941, 29130, 5401, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29911, 335, 414, 937, 2362, 11422, 16682, 11680, 13941, 313, 29906, 29946, 29897, 6057, 2820, 278, 2967, 408, 540, 19572, 263, 3271, 1065, 2645, 278, 937, 297, 1076, 310, 278, 24834, 414, 29915, 29871, 29929, 29899, 29941, 29130, 5401, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29911, 335, 414, 3041, 709, 672, 4827, 29875, 1913, 279, 2079, 313, 29896, 29946, 29897, 3367, 2701, 2645, 278, 4654, 297, 1076, 310, 278, 24834, 414, 29915, 29871, 29929, 29899, 29941, 29130, 5401, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29911, 335, 414, 3041, 709, 672, 4827, 29875, 1913, 279, 2079, 313, 29896, 29946, 29897, 2243, 2247, 964, 4654, 2967, 1156, 29425, 263, 21954, 2645, 278, 4654, 297, 1076, 310, 278, 24834, 414, 29915, 29871, 29929, 29899, 29941, 29130, 5401, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29911, 335, 414, 25373, 298, 5171, 12684, 3760, 457, 29920, 313, 29946, 29896, 29897, 19572, 263, 390, 12809, 2323, 2645, 278, 4654, 297, 1076, 310, 278, 24834, 414, 29915, 29871, 29929, 29899, 29941, 29130, 5401, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29911, 335, 414, 714, 29888, 709, 672, 10255, 952, 6502, 313, 29896, 29906, 29897, 338, 378, 629, 271, 7964, 491, 3041, 709, 672, 4827, 29875, 1913, 279, 2079, 313, 29896, 29946, 29897, 408, 540, 19572, 263, 29871, 29906, 29899, 3389, 3271, 1065, 2645, 278, 4654, 297, 1076, 310, 278, 24834, 414, 29915, 29871, 29929, 29899, 29941, 29130, 5401, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29911, 335, 414, 714, 29888, 709, 672, 10255, 952, 6502, 313, 29896, 29906, 29897, 19572, 263, 29871, 29906, 29899, 3389, 3271, 1065, 2645, 278, 4654, 297, 1076, 310, 278, 24834, 414, 29915, 29871, 29929, 29899, 29941, 29130, 5401, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29911, 335, 414, 3041, 709, 672, 2581, 4193, 28433, 295, 2628, 313, 29946, 29953, 29897, 2243, 2247, 964, 3271, 15284, 408, 540, 338, 9109, 304, 8158, 263, 1065, 2645, 278, 4654, 297, 1076, 310, 278, 24834, 414, 29915 ]
1,333,596
0
CommonCrawl
5
7
9-3 exhibition win on Saturday, March 17, 2018, in Lakeland, Fla. Kim Klement USA TODAY Sports Tigers infielder Alexi Amarista (14) singles during the fourth inning of the Tigers' 9-3 exhibition win on Saturday, March 17, 2018, in Lakeland, Fla. Kim Klement USA TODAY Sports Tigers outfielder Leonys Martin (12) bunts in the fourth inning of the Tigers' 9-3 exhibition win on Saturday, March 17, 2018, in Lakeland, Fla. Kim Klement USA TODAY Sports Tigers first baseman Chad Huffman (78) is congratulated by the bat boy that is dressed up as a Leprechaun for St. Patrick's Day in the Tigers' 9-3 exhibition win on Saturday, March 17, 2018, in Lakeland, Fla. Kim Klement USA TODAY Sports Tigers first baseman Miguel Cabrera (24) singles during the fifth inning of the Tigers' 9-3 exhibition win on Saturday, March 17, 2018, in Lakeland, Fla. Kim Klement USA TODAY Sports Tigers designated hitter Victor Martinez (41) singles during the fifth inning of the Tigers' 9-3 exhibition win on Saturday, March 17, 2018, in Lakeland, Fla. Kim Klement USA TODAY Sports Tigers manager Ron Gardenhire catches the ceremonial first pitch before the exhibition game against the Yankees, Saturday, March 17, 2018, in Lakeland, Fla. John Raoux, AP Wearing a green jersey, hat and socks for St. Patrick's Day, Tigers infielder Dixon Machado signs autographs for fans before the exhibition game against the Yankees, Saturday, March 17, 2018, in Lakeland, Fla. John Raoux, AP Tigers pitcher Matthew Boyd throws in the first inning of the exhibition game against the Yankees, Saturday, March 17, 2018, in Lakeland, Fla. John Raoux, AP Tigers outfielder Nicholas Castellanos (9) runs out of the dugout to start the exhibition game against the Yankees at Publix Field at Joker Marchant Stadium on Saturday, March 17, 2018. Kim Klement USA TODAY Sports Tigers outfielder JaCoby Jones (21) smells Nicholas Castellanos' glove as they run to the dugout against the Yankees at Publix Field at Joker Marchant Stadium on Saturday, March 17, 2018. Kim Klement USA TODAY Sports Tigers pitcher Shane Greene (61) smiles in the dugout against the Yankees at Publix Field at Joker Marchant Stadium on Saturday, March 17, 2018. Kim Klement USA TODAY Sports A Tigers bat boy dressed up as a leprechaun for St. Patrick's Day runs out to get a foul ball during the first inning at Publix Field at Joker Marchant Stadium on Saturday, March 17, 2018. Kim Klement USA TODAY Sports Tigers outfielder Mikie Mahtook (8) talks with catcher Derek Norris (33) as they work out before to the game against the Yankees at Publix Field at Publix Field at Joker Marchant Stadium on Saturday, March, 17, 2018. Kim Klement USA TODAY Sports Yankees first baseman Greg Bird (33) detail view of his tall socks in green for St. Patrick's Day before the exhibition game against the Tigers at Publix Field at Joker Marchant Stadium on Saturday, March 17, 2018. Kim Klement, Kim Klement-USA TODAY Sports Tigers catcher James McCann (34) works out before the exhibition game as he wears green for St. Patrick's Day against the Yankees at Publix Field at Joker Marchant Stadium on Saturday, March, 17, 2018. Kim Klement USA TODAY Sports Tigers first baseman Miguel Cabrera (2
-1.544563
-0.992297
-2.253075
-2.310932
[ -1.5473027333081137, -1.5418240315921188 ]
[ -0.8651624186214808, -1.1194316771674608 ]
[ -2.192205432838651, -2.3139450020570957 ]
[ -2.3265404002670187, -2.2953239570479838 ]
1,024
[ 512, 512 ]
[ 29871, 29929, 29899, 29941, 29130, 5401, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29911, 335, 414, 3041, 709, 672, 4827, 29875, 1913, 279, 2079, 313, 29896, 29946, 29897, 22102, 2645, 278, 11582, 297, 1076, 310, 278, 24834, 414, 29915, 29871, 29929, 29899, 29941, 29130, 5401, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29911, 335, 414, 714, 29888, 709, 672, 10255, 952, 6502, 313, 29896, 29906, 29897, 289, 348, 1372, 297, 278, 11582, 297, 1076, 310, 278, 24834, 414, 29915, 29871, 29929, 29899, 29941, 29130, 5401, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29911, 335, 414, 937, 2362, 11422, 678, 328, 379, 3096, 1171, 313, 29955, 29947, 29897, 338, 378, 629, 271, 7964, 491, 278, 17152, 8023, 393, 338, 27121, 701, 408, 263, 951, 1457, 5815, 348, 363, 624, 29889, 14875, 29915, 29879, 8373, 297, 278, 24834, 414, 29915, 29871, 29929, 29899, 29941, 29130, 5401, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29911, 335, 414, 937, 2362, 11422, 16682, 11680, 13941, 313, 29906, 29946, 29897, 22102, 2645, 278, 18615, 297, 1076, 310, 278, 24834, 414, 29915, 29871, 29929, 29899, 29941, 29130, 5401, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29911, 335, 414, 25373, 298, 5171, 12684, 3760, 457, 29920, 313, 29946, 29896, 29897, 22102, 2645, 278, 18615, 297, 1076, 310, 278, 24834, 414, 29915, 29871, 29929, 29899, 29941, 29130, 5401, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29911, 335, 414, 8455, 11546, 19906, 14812, 4380, 267, 278, 5147, 9857, 616, 937, 15905, 1434, 278, 29130, 3748, 2750, 278, 23094, 446, 267, 29892, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 2259, 6981, 13375, 29892, 12279, 13, 29956, 799, 292, 263, 7933, 432, 261, 7759, 29892, 3056, 322, 577, 4684, 363, 624, 29889, 14875, 29915, 29879, 8373, 29892, 24834, 414, 3041, 709, 672, 360, 28778, 17197, 912, 18906, 1120, 1946, 29879, 363, 24909, 1434, 278, 29130, 3748, 2750, 278, 23094, 446, 267, 29892, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 2259, 6981, 13375, 29892, 12279, 13, 29911, 335, 414, 15905, 261, 22292, 1952, 2941, 8026, 297, 278, 937, 297, 1076, 310, 278, 29130, 3748, 2750, 278, 23094, 446, 267, 29892, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29892, 297, 27229, 14045, 29892, 383, 433, 29889, 2259, 6981, 13375, 29892, 12279, 13, 29911, 335, 414, 714, 29888, 709, 672, 24234, 4834, 514, 16469, 313, 29929, 29897, 6057, 714, 310, 278, 270, 688, 449, 304, 1369, 278, 29130, 3748, 2750, 278, 23094, 446, 267, 472, 8042, 492, 29916, 8989, 472, 435, 17933, 4779, 424, 17213, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29911, 335, 414, 714, 29888, 709, 672, 14021, 29907, 18711, 10920, 313, 29906, 29896, 29897, 1560, 10071, 24234, 4834, 514, 16469, 29915, 15482, 345, 408, 896, 1065, 304, 278, 270, 688, 449, 2750, 278, 23094, 446, 267, 472, 8042, 492, 29916, 8989, 472, 435, 17933, 4779, 424, 17213, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29911, 335, 414, 15905, 261, 1383, 1662, 4122, 1600, 313, 29953, 29896, 29897, 1560, 5475, 297, 278, 270, 688, 449, 2750, 278, 23094, 446, 267, 472, 8042, 492, 29916, 8989, 472, 435, 17933, 4779, 424, 17213, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29909, 24834, 414, 17152, 8023, 27121, 701, 408, 263, 454, 1457, 5815, 348, 363, 624, 29889, 14875, 29915, 29879, 8373, 6057, 714, 304, 679, 263, 285, 5059, 8287, 2645, 278, 937, 297, 1076, 472, 8042, 492, 29916, 8989, 472, 435, 17933, 4779, 424, 17213, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29911, 335, 414, 714, 29888, 709, 672, 13803, 347, 3219, 400, 2550, 313, 29947, 29897, 5969, 2039, 411, 4380, 261, 360, 20400, 4186, 3780, 313, 29941, 29941, 29897, 408, 896, 664, 714, 1434, 304, 278, 3748, 2750, 278, 23094, 446, 267, 472, 8042, 492, 29916, 8989, 472, 8042, 492, 29916, 8989, 472, 435, 17933, 4779, 424, 17213, 373, 24211, 29892, 4779, 29892, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29979, 273, 446, 267, 937, 2362, 11422, 12051, 17777, 313, 29941, 29941, 29897, 9493, 1776, 310, 670, 15655, 577, 4684, 297, 7933, 363, 624, 29889, 14875, 29915, 29879, 8373, 1434, 278, 29130, 3748, 2750, 278, 24834, 414, 472, 8042, 492, 29916, 8989, 472, 435, 17933, 4779, 424, 17213, 373, 24211, 29892, 4779, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29889, 12931, 476, 944, 29892, 12931, 476, 944, 29899, 27019, 7495, 28658, 12453, 13, 29911, 335, 414, 4380, 261, 5011, 15612, 812, 313, 29941, 29946, 29897, 1736, 714, 1434, 278, 29130, 3748, 408, 540, 591, 1503, 7933, 363, 624, 29889, 14875, 29915, 29879, 8373, 2750, 278, 23094, 446, 267, 472, 8042, 492, 29916, 8989, 472, 435, 17933, 4779, 424, 17213, 373, 24211, 29892, 4779, 29892, 29871, 29896, 29955, 29892, 29871, 29906, 29900, 29896, 29947, 29889, 12931, 476, 944, 8278, 7495, 28658, 12453, 13, 29911, 335, 414, 937, 2362, 11422, 16682, 11680, 13941, 313, 29906 ]
1,333,596
1,024
CommonCrawl
5
7
JOIN THE CONVERSATION AND LEARN TO DIY: Click here to sign up for Sunlight's webinar. Because of the enormous sums spent on the presidential election, we ran some additional calculations to see how groups fared on their congressional bets. Then, we drilled down further to see how they did when it came to races for the House and for the Senate. Since the presidential outcomes are all or nothing, we didn't provide a separate line item for that. Eight groups' rate of return increased by 50 percent or more. The biggest-spending of those, the Ending Spending Action Fund, plunked down $2.9 million (of its $12.8 million in general election spending) on Senate races. When its unsuccessful big bet on Romney is excluded from the calculation, the group's rate of return skyrockets from 15 percent overall to 67 percent. The adjusted percentages for left-leaning groups are not as dramatic. Taking out the presidential money decreased some of the union groups' percentages by 11 to 17 percentage points. The biggest spender, SEIU PEA-Federal, spent $15.8 in the general election, getting an 85% return on all investments compared to a 68% return on congressional investments. Potentially significant in light of the negotiations now underway on how to avoid the "fiscal cliff" looming if Congress and the White House can't agree on spending cuts and revenue increases: the success of Americans for Tax Reform, whose founder, Grover Norquist is the godfather of the no-new-taxes-pledge that just about every Republican member of Congress signs. ATR is one of the few conservative outside spending groups that scored a better-than 50 percent ROI; the number rises to 61 percent. Races that ended in recounts or runoffs are counted toward general election spending but not counted in the win/loss percentage. You can read more about our methodology here or sign up for the webinar where we will be available to answer your questions. Below are the ROI stats for the top 30 outside spending groups that were active in more than one race in the general election. Scroll to the bottom to see the complete data set. 1.29% of $103,559,717 spent in the general election and ending in the desired result. Opposed 2 losing candidates; 1.29% of money went to opposing losing candidates. See the full profile here. 14.40% of $70,709,963 spent in the general election and ending in the desired result. Opposed 7 losing candidates; 14.40% of money went to opposing losing candidates. Opposed 17 losing candidates; 31.50% of money went to opposing losing candidates. 61.43% of $58,985,815 spent in the general election and ending in the desired result. Supported 3 winning candidates; 0.84% of money went to supporting winning candidates. Opposed 38 losing candidates; 60.59% of money went to opposing losing candidates. Opposed 10 losing candidates; 77.97% of money went to opposing losing candidates. 87.86% of $34,359,657 spent in the general election and ending in the desired result. Supported 5 winning candidates; 6.04% of money went to supporting winning candidates. Opposed 10 losing candidates; 81.82% of money went to opposing losing candidates. Opposed 3 losing candidates; 4.41% of money went to opposing losing candidates. Opposed 3 losing candidates; 24.05% of money went to opposing losing candidates. 70.71% of $27,587,516 spent in the general election and ending in the desired result. Opposed 35 losing candidates; 70.58% of money went to opposing losing candidates. Opposed 3 losing candidates; 5.57% of money went to opposing losing candidates. 24.59% of $16,732,851 spent in the general election and ending in the desired result. Supported
-0.867944
0.56555
-0.335677
-0.565413
[ 0.15109479865034925, -1.8869822396998064 ]
[ 1.305079421925898, -0.1739797862359294 ]
[ 0.531717428424054, -1.2030714329387862 ]
[ 0.017294211428830097, -1.148119668748462 ]
1,024
[ 512, 512 ]
[ 8780, 6093, 8707, 5348, 29903, 8098, 5300, 11060, 15249, 7495, 22471, 29979, 29901, 16297, 1244, 304, 1804, 701, 363, 8991, 4366, 29915, 29879, 1856, 18220, 29889, 13, 29933, 5658, 310, 278, 18886, 681, 25470, 10398, 373, 278, 6673, 616, 8271, 29892, 591, 6350, 777, 5684, 17203, 304, 1074, 920, 6471, 285, 1965, 373, 1009, 378, 11476, 284, 1010, 29879, 29889, 1987, 29892, 591, 270, 4115, 839, 1623, 4340, 304, 1074, 920, 896, 1258, 746, 372, 2996, 304, 19830, 363, 278, 5619, 322, 363, 278, 18148, 29889, 4001, 278, 6673, 616, 714, 26807, 526, 599, 470, 3078, 29892, 591, 3282, 29915, 29873, 3867, 263, 5004, 1196, 2944, 363, 393, 29889, 13, 29923, 523, 6471, 29915, 6554, 310, 736, 11664, 491, 29871, 29945, 29900, 10151, 470, 901, 29889, 450, 24842, 29899, 1028, 2548, 310, 1906, 29892, 278, 2796, 292, 1706, 2548, 9123, 13249, 29892, 715, 2960, 287, 1623, 395, 29906, 29889, 29929, 7284, 313, 974, 967, 395, 29896, 29906, 29889, 29947, 7284, 297, 2498, 8271, 805, 2548, 29897, 373, 18148, 19830, 29889, 1932, 967, 443, 8698, 1319, 4802, 1010, 373, 6033, 3801, 338, 429, 13347, 515, 278, 13944, 29892, 278, 2318, 29915, 29879, 6554, 310, 736, 14744, 307, 9737, 515, 29871, 29896, 29945, 10151, 12463, 304, 29871, 29953, 29955, 10151, 29889, 13, 1576, 10365, 287, 10151, 1179, 363, 2175, 29899, 14044, 292, 6471, 526, 451, 408, 8541, 2454, 29889, 323, 5086, 714, 278, 6673, 616, 6909, 9263, 1463, 777, 310, 278, 9833, 6471, 29915, 10151, 1179, 491, 29871, 29896, 29896, 304, 29871, 29896, 29955, 19649, 3291, 29889, 450, 24842, 805, 1581, 29892, 3725, 29902, 29965, 349, 29923, 29909, 29899, 29943, 2447, 284, 29892, 10398, 395, 29896, 29945, 29889, 29947, 297, 278, 2498, 8271, 29892, 2805, 385, 29871, 29947, 29945, 29995, 736, 373, 599, 13258, 1860, 9401, 304, 263, 29871, 29953, 29947, 29995, 736, 373, 378, 11476, 284, 13258, 1860, 29889, 13, 29925, 327, 9247, 7282, 297, 3578, 310, 278, 27214, 800, 1286, 1090, 1582, 373, 920, 304, 4772, 278, 376, 29888, 275, 1052, 1067, 2593, 29908, 658, 28826, 565, 11559, 322, 278, 8037, 5619, 508, 29915, 29873, 8661, 373, 805, 2548, 5700, 29879, 322, 337, 9947, 16415, 29901, 278, 2551, 310, 23035, 363, 17847, 23933, 29892, 5069, 25331, 29892, 6070, 369, 4186, 339, 391, 338, 278, 7339, 22212, 310, 278, 694, 29899, 1482, 29899, 941, 9100, 29899, 552, 29881, 479, 393, 925, 1048, 1432, 21178, 4509, 310, 11559, 18906, 29889, 319, 5659, 338, 697, 310, 278, 2846, 8976, 1230, 5377, 805, 2548, 6471, 393, 15569, 263, 2253, 29899, 27603, 29871, 29945, 29900, 10151, 16641, 29902, 29936, 278, 1353, 364, 4637, 304, 29871, 29953, 29896, 10151, 29889, 13, 29934, 3302, 393, 9698, 297, 1162, 792, 29879, 470, 1065, 22450, 526, 29115, 11183, 2498, 8271, 805, 2548, 541, 451, 29115, 297, 278, 5401, 29914, 6758, 19649, 29889, 887, 508, 1303, 901, 1048, 1749, 1158, 3002, 1244, 470, 1804, 701, 363, 278, 1856, 18220, 988, 591, 674, 367, 3625, 304, 1234, 596, 5155, 29889, 13, 21140, 340, 526, 278, 16641, 29902, 22663, 363, 278, 2246, 29871, 29941, 29900, 5377, 805, 2548, 6471, 393, 892, 6136, 297, 901, 1135, 697, 8175, 297, 278, 2498, 8271, 29889, 28797, 304, 278, 5970, 304, 1074, 278, 4866, 848, 731, 29889, 13, 29896, 29889, 29906, 29929, 29995, 310, 395, 29896, 29900, 29941, 29892, 29945, 29945, 29929, 29892, 29955, 29896, 29955, 10398, 297, 278, 2498, 8271, 322, 17140, 297, 278, 7429, 1121, 29889, 13, 29949, 407, 2662, 29871, 29906, 19035, 21669, 29936, 29871, 29896, 29889, 29906, 29929, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 13393, 278, 2989, 8722, 1244, 29889, 13, 29896, 29946, 29889, 29946, 29900, 29995, 310, 395, 29955, 29900, 29892, 29955, 29900, 29929, 29892, 29929, 29953, 29941, 10398, 297, 278, 2498, 8271, 322, 17140, 297, 278, 7429, 1121, 29889, 13, 29949, 407, 2662, 29871, 29955, 19035, 21669, 29936, 29871, 29896, 29946, 29889, 29946, 29900, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29949, 407, 2662, 29871, 29896, 29955, 19035, 21669, 29936, 29871, 29941, 29896, 29889, 29945, 29900, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29953, 29896, 29889, 29946, 29941, 29995, 310, 395, 29945, 29947, 29892, 29929, 29947, 29945, 29892, 29947, 29896, 29945, 10398, 297, 278, 2498, 8271, 322, 17140, 297, 278, 7429, 1121, 29889, 13, 14039, 287, 29871, 29941, 15613, 21669, 29936, 29871, 29900, 29889, 29947, 29946, 29995, 310, 6909, 3512, 304, 20382, 15613, 21669, 29889, 13, 29949, 407, 2662, 29871, 29941, 29947, 19035, 21669, 29936, 29871, 29953, 29900, 29889, 29945, 29929, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29949, 407, 2662, 29871, 29896, 29900, 19035, 21669, 29936, 29871, 29955, 29955, 29889, 29929, 29955, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29947, 29955, 29889, 29947, 29953, 29995, 310, 395, 29941, 29946, 29892, 29941, 29945, 29929, 29892, 29953, 29945, 29955, 10398, 297, 278, 2498, 8271, 322, 17140, 297, 278, 7429, 1121, 29889, 13, 14039, 287, 29871, 29945, 15613, 21669, 29936, 29871, 29953, 29889, 29900, 29946, 29995, 310, 6909, 3512, 304, 20382, 15613, 21669, 29889, 13, 29949, 407, 2662, 29871, 29896, 29900, 19035, 21669, 29936, 29871, 29947, 29896, 29889, 29947, 29906, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29949, 407, 2662, 29871, 29941, 19035, 21669, 29936, 29871, 29946, 29889, 29946, 29896, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29949, 407, 2662, 29871, 29941, 19035, 21669, 29936, 29871, 29906, 29946, 29889, 29900, 29945, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29955, 29900, 29889, 29955, 29896, 29995, 310, 395, 29906, 29955, 29892, 29945, 29947, 29955, 29892, 29945, 29896, 29953, 10398, 297, 278, 2498, 8271, 322, 17140, 297, 278, 7429, 1121, 29889, 13, 29949, 407, 2662, 29871, 29941, 29945, 19035, 21669, 29936, 29871, 29955, 29900, 29889, 29945, 29947, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29949, 407, 2662, 29871, 29941, 19035, 21669, 29936, 29871, 29945, 29889, 29945, 29955, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29906, 29946, 29889, 29945, 29929, 29995, 310, 395, 29896, 29953, 29892, 29955, 29941, 29906, 29892, 29947, 29945, 29896, 10398, 297, 278, 2498, 8271, 322, 17140, 297, 278, 7429, 1121, 29889, 13, 14039, 287, 29871 ]
1,333,601
0
C4
18
15
23 winning candidates; 20.53% of money went to supporting winning candidates. Opposed 11 losing candidates; 4.06% of money went to opposing losing candidates. Opposed 6 losing candidates; 50.13% of money went to opposing losing candidates. 85.37% of $15,202,306 spent in the general election and ending in the desired result. Supported 15 winning candidates; 73.01% of money went to supporting winning candidates. Opposed 7 losing candidates; 12.36% of money went to opposing losing candidates. 79.12% of $14,318,138 spent in the general election and ending in the desired result. Supported 11 winning candidates; 12.78% of money went to supporting winning candidates. Opposed 25 losing candidates; 66.33% of money went to opposing losing candidates. 15.34% of $12,821,276 spent in the general election and ending in the desired result. Opposed 2 losing candidates; 7.52% of money went to opposing losing candidates. 53.87% of $12,696,401 spent in the general election and ending in the desired result. Supported 1 winning candidates; 1.46% of money went to supporting winning candidates. Opposed 13 losing candidates; 52.42% of money went to opposing losing candidates. 0.83% of $10,942,533 spent in the general election and ending in the desired result. Supported 28 winning candidates; 0.44% of money went to supporting winning candidates. Opposed 6 losing candidates; 0.39% of money went to opposing losing candidates. Opposed 6 losing candidates; 59.69% of money went to opposing losing candidates. Opposed 13 losing candidates; 69.36% of money went to opposing losing candidates. 60.64% of $9,450,237 spent in the general election and ending in the desired result. Opposed 8 losing candidates; 60.64% of money went to opposing losing candidates. 45.74% of $8,169,429 spent in the general election and ending in the desired result. Supported 2 winning candidates; 37.17% of money went to supporting winning candidates. Opposed 2 losing candidates; 8.57% of money went to opposing losing candidates. Opposed 2 losing candidates; 0.31% of money went to opposing losing candidates. Opposed 1 losing candidates; 14.30% of money went to opposing losing candidates. Opposed 5 losing candidates; 31.32% of money went to opposing losing candidates. 80.46% of $6,072,693 spent in the general election and ending in the desired result. Supported 5 winning candidates; 6.37% of money went to supporting winning candidates. Opposed 11 losing candidates; 74.08% of money went to opposing losing candidates. 76.38% of $5,732,876 spent in the general election and ending in the desired result. Supported 15 winning candidates; 41.98% of money went to supporting winning candidates. Opposed 16 losing candidates; 34.40% of money went to opposing losing candidates. 41.50% of $5,163,013 spent in the general election and ending in the desired result. Supported 4 winning candidates; 13.80% of money went to supporting winning candidates. Opposed 2 losing candidates; 27.70% of money went to opposing losing candidates. Opposed 12 losing candidates; 71.46% of money went to opposing losing candidates. 98.45% of $5,118,417 spent in the general election and ending in the desired result. Supported 7 winning candidates; 18.95% of money went to supporting winning candidates. Opposed 7 losing candidates;
-2.045865
-0.236652
-1.56829
-1.288594
[ -1.985598870587717, -2.106130308339608 ]
[ 0.04626752926516598, -0.5195711024287051 ]
[ -1.4262606431726017, -1.7103196380156398 ]
[ -1.1611265200897265, -1.4160608063785092 ]
1,024
[ 512, 512 ]
[ 29906, 29941, 15613, 21669, 29936, 29871, 29906, 29900, 29889, 29945, 29941, 29995, 310, 6909, 3512, 304, 20382, 15613, 21669, 29889, 13, 29949, 407, 2662, 29871, 29896, 29896, 19035, 21669, 29936, 29871, 29946, 29889, 29900, 29953, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29949, 407, 2662, 29871, 29953, 19035, 21669, 29936, 29871, 29945, 29900, 29889, 29896, 29941, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29947, 29945, 29889, 29941, 29955, 29995, 310, 395, 29896, 29945, 29892, 29906, 29900, 29906, 29892, 29941, 29900, 29953, 10398, 297, 278, 2498, 8271, 322, 17140, 297, 278, 7429, 1121, 29889, 13, 14039, 287, 29871, 29896, 29945, 15613, 21669, 29936, 29871, 29955, 29941, 29889, 29900, 29896, 29995, 310, 6909, 3512, 304, 20382, 15613, 21669, 29889, 13, 29949, 407, 2662, 29871, 29955, 19035, 21669, 29936, 29871, 29896, 29906, 29889, 29941, 29953, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29955, 29929, 29889, 29896, 29906, 29995, 310, 395, 29896, 29946, 29892, 29941, 29896, 29947, 29892, 29896, 29941, 29947, 10398, 297, 278, 2498, 8271, 322, 17140, 297, 278, 7429, 1121, 29889, 13, 14039, 287, 29871, 29896, 29896, 15613, 21669, 29936, 29871, 29896, 29906, 29889, 29955, 29947, 29995, 310, 6909, 3512, 304, 20382, 15613, 21669, 29889, 13, 29949, 407, 2662, 29871, 29906, 29945, 19035, 21669, 29936, 29871, 29953, 29953, 29889, 29941, 29941, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29896, 29945, 29889, 29941, 29946, 29995, 310, 395, 29896, 29906, 29892, 29947, 29906, 29896, 29892, 29906, 29955, 29953, 10398, 297, 278, 2498, 8271, 322, 17140, 297, 278, 7429, 1121, 29889, 13, 29949, 407, 2662, 29871, 29906, 19035, 21669, 29936, 29871, 29955, 29889, 29945, 29906, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29945, 29941, 29889, 29947, 29955, 29995, 310, 395, 29896, 29906, 29892, 29953, 29929, 29953, 29892, 29946, 29900, 29896, 10398, 297, 278, 2498, 8271, 322, 17140, 297, 278, 7429, 1121, 29889, 13, 14039, 287, 29871, 29896, 15613, 21669, 29936, 29871, 29896, 29889, 29946, 29953, 29995, 310, 6909, 3512, 304, 20382, 15613, 21669, 29889, 13, 29949, 407, 2662, 29871, 29896, 29941, 19035, 21669, 29936, 29871, 29945, 29906, 29889, 29946, 29906, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29900, 29889, 29947, 29941, 29995, 310, 395, 29896, 29900, 29892, 29929, 29946, 29906, 29892, 29945, 29941, 29941, 10398, 297, 278, 2498, 8271, 322, 17140, 297, 278, 7429, 1121, 29889, 13, 14039, 287, 29871, 29906, 29947, 15613, 21669, 29936, 29871, 29900, 29889, 29946, 29946, 29995, 310, 6909, 3512, 304, 20382, 15613, 21669, 29889, 13, 29949, 407, 2662, 29871, 29953, 19035, 21669, 29936, 29871, 29900, 29889, 29941, 29929, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29949, 407, 2662, 29871, 29953, 19035, 21669, 29936, 29871, 29945, 29929, 29889, 29953, 29929, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29949, 407, 2662, 29871, 29896, 29941, 19035, 21669, 29936, 29871, 29953, 29929, 29889, 29941, 29953, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29953, 29900, 29889, 29953, 29946, 29995, 310, 395, 29929, 29892, 29946, 29945, 29900, 29892, 29906, 29941, 29955, 10398, 297, 278, 2498, 8271, 322, 17140, 297, 278, 7429, 1121, 29889, 13, 29949, 407, 2662, 29871, 29947, 19035, 21669, 29936, 29871, 29953, 29900, 29889, 29953, 29946, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29946, 29945, 29889, 29955, 29946, 29995, 310, 395, 29947, 29892, 29896, 29953, 29929, 29892, 29946, 29906, 29929, 10398, 297, 278, 2498, 8271, 322, 17140, 297, 278, 7429, 1121, 29889, 13, 14039, 287, 29871, 29906, 15613, 21669, 29936, 29871, 29941, 29955, 29889, 29896, 29955, 29995, 310, 6909, 3512, 304, 20382, 15613, 21669, 29889, 13, 29949, 407, 2662, 29871, 29906, 19035, 21669, 29936, 29871, 29947, 29889, 29945, 29955, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29949, 407, 2662, 29871, 29906, 19035, 21669, 29936, 29871, 29900, 29889, 29941, 29896, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29949, 407, 2662, 29871, 29896, 19035, 21669, 29936, 29871, 29896, 29946, 29889, 29941, 29900, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29949, 407, 2662, 29871, 29945, 19035, 21669, 29936, 29871, 29941, 29896, 29889, 29941, 29906, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29947, 29900, 29889, 29946, 29953, 29995, 310, 395, 29953, 29892, 29900, 29955, 29906, 29892, 29953, 29929, 29941, 10398, 297, 278, 2498, 8271, 322, 17140, 297, 278, 7429, 1121, 29889, 13, 14039, 287, 29871, 29945, 15613, 21669, 29936, 29871, 29953, 29889, 29941, 29955, 29995, 310, 6909, 3512, 304, 20382, 15613, 21669, 29889, 13, 29949, 407, 2662, 29871, 29896, 29896, 19035, 21669, 29936, 29871, 29955, 29946, 29889, 29900, 29947, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29955, 29953, 29889, 29941, 29947, 29995, 310, 395, 29945, 29892, 29955, 29941, 29906, 29892, 29947, 29955, 29953, 10398, 297, 278, 2498, 8271, 322, 17140, 297, 278, 7429, 1121, 29889, 13, 14039, 287, 29871, 29896, 29945, 15613, 21669, 29936, 29871, 29946, 29896, 29889, 29929, 29947, 29995, 310, 6909, 3512, 304, 20382, 15613, 21669, 29889, 13, 29949, 407, 2662, 29871, 29896, 29953, 19035, 21669, 29936, 29871, 29941, 29946, 29889, 29946, 29900, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29946, 29896, 29889, 29945, 29900, 29995, 310, 395, 29945, 29892, 29896, 29953, 29941, 29892, 29900, 29896, 29941, 10398, 297, 278, 2498, 8271, 322, 17140, 297, 278, 7429, 1121, 29889, 13, 14039, 287, 29871, 29946, 15613, 21669, 29936, 29871, 29896, 29941, 29889, 29947, 29900, 29995, 310, 6909, 3512, 304, 20382, 15613, 21669, 29889, 13, 29949, 407, 2662, 29871, 29906, 19035, 21669, 29936, 29871, 29906, 29955, 29889, 29955, 29900, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29949, 407, 2662, 29871, 29896, 29906, 19035, 21669, 29936, 29871, 29955, 29896, 29889, 29946, 29953, 29995, 310, 6909, 3512, 304, 9209, 292, 19035, 21669, 29889, 13, 29929, 29947, 29889, 29946, 29945, 29995, 310, 395, 29945, 29892, 29896, 29896, 29947, 29892, 29946, 29896, 29955, 10398, 297, 278, 2498, 8271, 322, 17140, 297, 278, 7429, 1121, 29889, 13, 14039, 287, 29871, 29955, 15613, 21669, 29936, 29871, 29896, 29947, 29889, 29929, 29945, 29995, 310, 6909, 3512, 304, 20382, 15613, 21669, 29889, 13, 29949, 407, 2662, 29871, 29955, 19035, 21669, 29936, 29871 ]
1,333,601
1,024
C4
18
15
Phil Ford, PhD, LAT, ATC, PES, CES Clinical Professor, Associate Chair, Department of Kinesiology Phil Ford joined the faculty of the Department of Kinesiology at Boise State University in 2014. Currently he serves as a Clinical Professor in the Graduate Athletic Training and Undergraduate Kinesiology programs. In addition, he currently serves as the Associate Chair for the Department of Kinesiology. His primary teaching interest areas include lower extremity diagnosis, orthopedic rehabilitation, and corrective exercise for injury prevention. Finally, Dr. Ford has a strong background in clinical education and has published in area of effective clinical teaching behaviors. Ford previously served as a faculty member at Charleston Southern University and at Azusa Pacific University serving in various leadership roles, both in athletic training and exercise science. Dr. Ford comes to Boise State with an extensive clinical and teaching background spanning more than 20 years. In addition, he has provided athletic training health care services in a variety of setting including sports medicine clinics, interscholastic, collegiate, and professional sports. Dr. Ford received his doctorate from the University of Southern Mississippi in Human Performance with and emphasis in Administration and Teaching. He also earned his master's degree from Boise State University in Exercise and Sports Studies and his bachelor's degree in Corporate Fitness and Wellness/Athletic Training from Grand Canyon University. In addition to being a certified/licensed athletic trainer, Dr. Ford holds professional credentials from the National Academy of Sports Medicine in Corrective Exercise and Performance Enhance Specialties. Office: KINES 111 Email: [email protected] Licensed Athletic Trainer (LAT), Idaho State Board of Medicine (#AT-527) Certified Athletic Trainer (ATC), Board of Certification, Inc. (#089602470) Performance Enhancement Specialist (PES), NASM (#203444) Corrective Exercise Specialist (CES), NASM (#1398616) Professional Interests: Clinical Education/Teaching Human Movement Dysfunction and Therapeutic Interventions Injury Prevention and Corrective Exercise Select Publications/Presentations: Ford, P., Schmidt, C. (2015). Direct Patient Contacts Should Replace Clinical Clock Hours in Determining the Completion of Clinical Education Requirements in Athletic Training. peer-reviewed abstract, poster presentation. NWATA Annual Meeting and Clinical Symposium, Spokane, WA. Ford, P. (2014). Should We Eliminate Clinical Hours? A New Framework for Determining the Completion of Clinical Education Requirements: peer-reviewed abstract, poster presentation. SEATA Educators' Conference, Atlanta, GA. Ford, P. (June 2011). Common Human Movement Impairments: The Role of the Kinetic Chain in Rehabilitation, invited speaker. National Athletic Trainers' Association Symposium, Student Session, New Orleans, LA. Ford, P. & Velasquez, B. (2010). Dynamic Paired-Behaviors in Effective Clinical Instruction. Athletic Training Education Journal, 5(1), 32-37. Ford, P. (Feb. 2009). The Frequency of Effective Clinical Instructor Behavior in the Clinical Field Experience Setting: Implications for Developing a Model of Systematic Supervision for Athletic Training Clinical Education – Dynamic Paired Behavior., peer-reviewed abstract, poster presentation. Athletic Trainers' Education Conference, Washington, DC. Livingston, J., Schmidt, C., & Ford, P. (Feb. 2009). Multiple Generations of Athletic Trainers: Implications for Clinical Education: general session presentation. Athletic Trainers' Education Conference, Washington, DC. Ford, P. & McChesney, J. (2007). Duration of Hamstring Flexibility Gains Following Termination of Three Separate Stretching Protocols. Journal of Sport of Rehabilitation, 16(1),
-0.185845
0.384696
1.647663
0.568785
[ -0.08517421285193691, -0.28651650091475467 ]
[ 0.10177701528576726, 0.6676156469796384 ]
[ 1.388966895003937, 1.906360064182328 ]
[ 0.4829394894460964, 0.6546299271507867 ]
1,024
[ 512, 512 ]
[ 5241, 14601, 29892, 1963, 29928, 29892, 365, 1299, 29892, 319, 9472, 29892, 349, 2890, 29892, 315, 2890, 13, 29907, 1915, 936, 11386, 29892, 6853, 403, 24193, 29892, 10317, 310, 476, 1475, 29875, 3002, 13, 4819, 309, 14601, 8772, 278, 4024, 18857, 310, 278, 10317, 310, 476, 1475, 29875, 3002, 472, 1952, 895, 4306, 3014, 297, 29871, 29906, 29900, 29896, 29946, 29889, 15447, 540, 19700, 408, 263, 315, 1915, 936, 11386, 297, 278, 1632, 13467, 403, 17183, 293, 26101, 322, 7634, 5105, 27240, 476, 1475, 29875, 3002, 11104, 29889, 512, 6124, 29892, 540, 5279, 19700, 408, 278, 6853, 403, 24193, 363, 278, 10317, 310, 476, 1475, 29875, 3002, 29889, 3600, 7601, 18819, 4066, 10161, 3160, 5224, 9413, 537, 24876, 19263, 29892, 14219, 459, 7486, 337, 29882, 4427, 7018, 29892, 322, 1959, 573, 15058, 363, 24092, 5557, 291, 29889, 9788, 29892, 4942, 29889, 14601, 756, 263, 4549, 3239, 297, 24899, 936, 9793, 322, 756, 6369, 297, 4038, 310, 11828, 24899, 936, 18819, 4010, 18930, 29889, 13, 29943, 536, 9251, 6766, 408, 263, 4024, 18857, 4509, 472, 2896, 29880, 21496, 14234, 3014, 322, 472, 4709, 11326, 14328, 3014, 16330, 297, 5164, 26001, 16178, 29892, 1716, 297, 28563, 293, 6694, 322, 15058, 10466, 29889, 4942, 29889, 14601, 5304, 304, 1952, 895, 4306, 411, 385, 20607, 24899, 936, 322, 18819, 3239, 805, 9450, 901, 1135, 29871, 29906, 29900, 2440, 29889, 512, 6124, 29892, 540, 756, 4944, 28563, 293, 6694, 9045, 2562, 5786, 297, 263, 12875, 310, 4444, 3704, 14717, 26602, 24899, 1199, 29892, 1006, 816, 324, 6288, 29892, 18400, 29347, 29892, 322, 10257, 14717, 29889, 13, 25639, 29889, 14601, 4520, 670, 11619, 403, 515, 278, 3014, 310, 14234, 24743, 297, 12968, 23768, 411, 322, 19310, 275, 297, 23303, 322, 1920, 9733, 29889, 940, 884, 20591, 670, 5835, 29915, 29879, 7426, 515, 1952, 895, 4306, 3014, 297, 1222, 6269, 895, 322, 12453, 16972, 322, 670, 289, 496, 12779, 29915, 29879, 7426, 297, 12767, 403, 383, 277, 2264, 322, 5674, 2264, 29914, 29909, 386, 1026, 293, 26101, 515, 6265, 315, 1384, 265, 3014, 29889, 512, 6124, 304, 1641, 263, 2284, 2164, 29914, 506, 21144, 28563, 293, 1020, 4983, 29892, 4942, 29889, 14601, 8640, 10257, 16140, 515, 278, 3086, 10355, 310, 12453, 27529, 297, 28518, 573, 1222, 6269, 895, 322, 23768, 1174, 29882, 749, 12630, 2938, 29889, 13, 27247, 29901, 476, 1177, 2890, 29871, 29896, 29896, 29896, 13, 9823, 29901, 8578, 666, 4006, 29992, 833, 275, 342, 403, 29889, 6085, 13, 29931, 293, 21144, 17183, 293, 3201, 4983, 313, 29931, 1299, 511, 5163, 29745, 4306, 12590, 310, 27529, 313, 29937, 1299, 29899, 29945, 29906, 29955, 29897, 13, 20455, 2164, 17183, 293, 3201, 4983, 313, 1299, 29907, 511, 12590, 310, 18410, 2450, 29892, 9266, 29889, 313, 29937, 29900, 29947, 29929, 29953, 29900, 29906, 29946, 29955, 29900, 29897, 13, 5894, 13390, 1174, 29882, 27967, 12630, 391, 313, 29925, 2890, 511, 16938, 29924, 313, 29937, 29906, 29900, 29941, 29946, 29946, 29946, 29897, 13, 12521, 1621, 573, 1222, 6269, 895, 12630, 391, 313, 27266, 511, 16938, 29924, 313, 29937, 29896, 29941, 29929, 29947, 29953, 29896, 29953, 29897, 13, 1184, 29888, 15750, 4124, 9197, 29901, 13, 29907, 1915, 936, 13151, 29914, 29911, 4204, 292, 13, 29950, 7889, 14104, 882, 360, 952, 2220, 322, 498, 1572, 412, 329, 293, 4124, 794, 1080, 13, 797, 29926, 2857, 4721, 7316, 322, 28518, 573, 1222, 6269, 895, 13, 3549, 22865, 29914, 13504, 296, 800, 29901, 13, 29943, 536, 29892, 349, 1696, 25157, 29892, 315, 29889, 313, 29906, 29900, 29896, 29945, 467, 8797, 4121, 993, 22387, 29879, 10575, 22108, 315, 1915, 936, 315, 908, 379, 2470, 297, 5953, 837, 2827, 278, 15642, 12757, 310, 315, 1915, 936, 13151, 830, 1548, 1860, 297, 17183, 293, 26101, 29889, 23533, 29899, 27828, 287, 9846, 29892, 10368, 24329, 29889, 405, 29956, 8254, 8081, 950, 2191, 15133, 322, 315, 1915, 936, 10667, 1066, 1974, 29892, 1706, 554, 1662, 29892, 399, 29909, 29889, 13, 29943, 536, 29892, 349, 29889, 313, 29906, 29900, 29896, 29946, 467, 10575, 1334, 1260, 8332, 403, 315, 1915, 936, 379, 2470, 29973, 319, 1570, 16657, 363, 5953, 837, 2827, 278, 15642, 12757, 310, 315, 1915, 936, 13151, 830, 1548, 1860, 29901, 23533, 29899, 27828, 287, 9846, 29892, 10368, 24329, 29889, 3725, 8254, 7519, 29883, 4097, 29915, 16377, 29892, 26484, 29892, 402, 29909, 29889, 13, 29943, 536, 29892, 349, 29889, 313, 29967, 1540, 29871, 29906, 29900, 29896, 29896, 467, 13103, 12968, 14104, 882, 14305, 1466, 1860, 29901, 450, 1528, 280, 310, 278, 20311, 7492, 678, 475, 297, 830, 29882, 4427, 7018, 29892, 23610, 25657, 29889, 3086, 17183, 293, 28186, 414, 29915, 7993, 10667, 1066, 1974, 29892, 15740, 16441, 29892, 1570, 26884, 29892, 17900, 29889, 13, 29943, 536, 29892, 349, 29889, 669, 12019, 294, 24661, 29892, 350, 29889, 313, 29906, 29900, 29896, 29900, 467, 27747, 2621, 2859, 29899, 3629, 8708, 18930, 297, 26475, 573, 315, 1915, 936, 2799, 4080, 29889, 17183, 293, 26101, 13151, 8237, 29892, 29871, 29945, 29898, 29896, 511, 29871, 29941, 29906, 29899, 29941, 29955, 29889, 13, 29943, 536, 29892, 349, 29889, 313, 29943, 774, 29889, 29871, 29906, 29900, 29900, 29929, 467, 450, 3878, 23860, 310, 26475, 573, 315, 1915, 936, 2799, 1247, 272, 1522, 16300, 297, 278, 315, 1915, 936, 8989, 28224, 5597, 21605, 29901, 14305, 5795, 363, 10682, 292, 263, 8125, 310, 2184, 2454, 5670, 4924, 363, 17183, 293, 26101, 315, 1915, 936, 13151, 785, 27747, 2621, 2859, 1522, 16300, 1696, 23533, 29899, 27828, 287, 9846, 29892, 10368, 24329, 29889, 17183, 293, 28186, 414, 29915, 13151, 16377, 29892, 7660, 29892, 13681, 29889, 13, 29931, 4357, 7352, 29892, 435, 1696, 25157, 29892, 315, 1696, 669, 14601, 29892, 349, 29889, 313, 29943, 774, 29889, 29871, 29906, 29900, 29900, 29929, 467, 26905, 3251, 800, 310, 17183, 293, 28186, 414, 29901, 14305, 5795, 363, 315, 1915, 936, 13151, 29901, 2498, 4867, 24329, 29889, 17183, 293, 28186, 414, 29915, 13151, 16377, 29892, 7660, 29892, 13681, 29889, 13, 29943, 536, 29892, 349, 29889, 669, 4052, 1451, 267, 3801, 29892, 435, 29889, 313, 29906, 29900, 29900, 29955, 467, 360, 2633, 310, 7904, 1807, 383, 2506, 4127, 402, 2708, 12206, 11814, 3381, 310, 12753, 922, 862, 403, 624, 10301, 292, 1019, 5770, 29879, 29889, 8237, 310, 8815, 310, 830, 29882, 4427, 7018, 29892, 29871, 29896, 29953, 29898, 29896, 511, 29871 ]
1,333,616
0
CommonCrawl
17
12
Q: Real time Object Detection using YOLO v3-tiny unable to detect objects through webcam I am trying to build an object detection application using YOLO v3-tiny. The model works fine for an input image(either downloaded from the web or for a picture from my phone) but while using the webcam, it just opens the webcam window but doesn't detect any objects. I tried giving an input image taken from the laptop webcam and it doesn't detect any objects for this either, I am unable to understand where the error lies here. It also prints all the scores and the length of the boxes as 0 when taking the webcam input. Here is the source code for the webcam model: import cv2 import numpy as np net=cv2.dnn.readNet('yolov3-tiny.weights','yolov3-tiny.cfg') classes=[] with open("coco.txt",'r') as f: classes= f.read().split('\n') cap=cv2.VideoCapture(0) while True: ret, img = cap.read() img = cv2.resize(img, None, fx=0.4, fy=0.4) height, width, _= img.shape blob=cv2.dnn.blobFromImage(img,1/255, (416,416), (0,0,0), swapRB=True, crop=False) net.setInput(blob) ln = net.getLayerNames() ln = [ln[i - 1] for i in net.getUnconnectedOutLayers()] #print(ln) #output_layers_names= net.getUnconnectedOutLayers() #print(output_layers_names) #layerOutputs=net.forward(output_layers_names) layerOutputs=net.forward(ln) boxes=[] confidences=[] class_ids=[] for output in layerOutputs: for detection in output: scores = detection[5::] print(scores) class_id = np.argmax(scores) confidence = scores[class_id] if confidence > 0.5: # Object detected center_x = int(detection[0] * width) center_y = int(detection[1] * height) w = int(detection[2] * width) h = int(detection[3] * height) # Rectangle coordinates x = int(center_x - w / 2) y = int(center_y - h / 2) boxes.append([x, y, w, h]) confidences.append(float(confidence)) class_ids.append(class_id) print(len(boxes)) indexes= cv2.dnn.NMSBoxes(boxes, confidences, 0.3, 0.4) if len(indexes) > 0: print(indexes.flatten()) font=cv2.FONT_HERSHEY_PLAIN colors=np.random.uniform(0,255,size=(len(boxes),3)) if len(indexes)>0: for i in indexes.flatten(): x, y, w, h = boxes[i] label=str(classes[class_ids[i]]) confidence=str(round(confidences[i],2)) color=colors[i] cv2.rectangle(img,(x,y),(x+w,y+h),color,2) cv2.putText(img,label+" "+confidence,(x,y+20),font,2,(255,255,255),2) cv2.imshow("Image",cv2.resize(img, (800,600))) key= cv2.waitKey(1) if key==27: break cap.release() cv
-1.339112
-0.698634
-0.081419
0.001686
[ -1.4103351904082377, -1.2678889457923666 ]
[ -0.6610307603521729, -0.736237160767181 ]
[ 0.1563537566671822, -0.31919143559236823 ]
[ 0.04851065464786471, -0.04513867500923912 ]
1,024
[ 512, 512 ]
[ 660, 29901, 8195, 931, 4669, 360, 2650, 428, 773, 612, 29949, 3927, 325, 29941, 29899, 25649, 9368, 304, 6459, 3618, 1549, 1856, 11108, 306, 626, 1811, 304, 2048, 385, 1203, 15326, 2280, 773, 612, 29949, 3927, 325, 29941, 29899, 25649, 29889, 450, 1904, 1736, 2691, 363, 385, 1881, 1967, 29898, 29872, 2121, 16532, 515, 278, 1856, 470, 363, 263, 7623, 515, 590, 9008, 29897, 541, 1550, 773, 278, 1856, 11108, 29892, 372, 925, 13246, 278, 1856, 11108, 3474, 541, 1838, 29915, 29873, 6459, 738, 3618, 29889, 306, 1898, 6820, 385, 1881, 1967, 4586, 515, 278, 19022, 1856, 11108, 322, 372, 1838, 29915, 29873, 6459, 738, 3618, 363, 445, 2845, 29892, 306, 626, 9368, 304, 2274, 988, 278, 1059, 12185, 1244, 29889, 739, 884, 14677, 599, 278, 19435, 322, 278, 3309, 310, 278, 16273, 408, 29871, 29900, 746, 5622, 278, 1856, 11108, 1881, 29889, 13, 10605, 338, 278, 2752, 775, 363, 278, 1856, 11108, 1904, 29901, 13, 5215, 13850, 29906, 13, 5215, 12655, 408, 7442, 13, 1212, 29922, 11023, 29906, 29889, 5200, 29876, 29889, 949, 6779, 877, 29891, 324, 586, 29941, 29899, 25649, 29889, 705, 5861, 3788, 29891, 324, 586, 29941, 29899, 25649, 29889, 16859, 1495, 13, 13203, 29922, 2636, 13, 2541, 1722, 703, 29883, 6235, 29889, 3945, 613, 29915, 29878, 1495, 408, 285, 29901, 13, 1678, 4413, 29922, 285, 29889, 949, 2141, 5451, 28909, 29876, 1495, 13, 29871, 13, 5030, 29922, 11023, 29906, 29889, 15167, 21133, 545, 29898, 29900, 29897, 13, 13, 29871, 13, 8000, 5852, 29901, 13, 1678, 3240, 29892, 10153, 353, 2117, 29889, 949, 580, 13, 1678, 10153, 353, 13850, 29906, 29889, 21476, 29898, 2492, 29892, 6213, 29892, 285, 29916, 29922, 29900, 29889, 29946, 29892, 285, 29891, 29922, 29900, 29889, 29946, 29897, 13, 1678, 3171, 29892, 2920, 29892, 903, 29922, 10153, 29889, 12181, 13, 1678, 23755, 29922, 11023, 29906, 29889, 5200, 29876, 29889, 10054, 4591, 2940, 29898, 2492, 29892, 29896, 29914, 29906, 29945, 29945, 29892, 313, 29946, 29896, 29953, 29892, 29946, 29896, 29953, 511, 313, 29900, 29892, 29900, 29892, 29900, 511, 17945, 29934, 29933, 29922, 5574, 29892, 274, 1336, 29922, 8824, 29897, 13, 1678, 7787, 29889, 842, 4290, 29898, 10054, 29897, 13, 268, 13, 1678, 301, 29876, 353, 7787, 29889, 657, 14420, 8659, 580, 13, 1678, 301, 29876, 353, 518, 3083, 29961, 29875, 448, 29871, 29896, 29962, 363, 474, 297, 7787, 29889, 657, 2525, 18045, 3744, 29931, 388, 414, 580, 29962, 13, 1678, 396, 2158, 29898, 3083, 29897, 13, 1678, 396, 4905, 29918, 29277, 29918, 7039, 29922, 7787, 29889, 657, 2525, 18045, 3744, 29931, 388, 414, 580, 13, 1678, 396, 2158, 29898, 4905, 29918, 29277, 29918, 7039, 29897, 13, 29871, 13, 1678, 396, 13148, 6466, 29879, 29922, 1212, 29889, 11333, 29898, 4905, 29918, 29277, 29918, 7039, 29897, 13, 1678, 7546, 6466, 29879, 29922, 1212, 29889, 11333, 29898, 3083, 29897, 13, 29871, 13, 29871, 13, 1678, 16273, 29922, 2636, 13, 1678, 1970, 333, 2063, 29922, 2636, 13, 1678, 770, 29918, 4841, 29922, 2636, 13, 29871, 13, 1678, 363, 1962, 297, 7546, 6466, 29879, 29901, 13, 4706, 363, 15326, 297, 1962, 29901, 13, 632, 13, 9651, 19435, 353, 15326, 29961, 29945, 1057, 29962, 13, 9651, 1596, 29898, 1557, 2361, 29897, 13, 9651, 770, 29918, 333, 353, 7442, 29889, 1191, 3317, 29898, 1557, 2361, 29897, 13, 9651, 16420, 353, 19435, 29961, 1990, 29918, 333, 29962, 13, 9651, 565, 16420, 1405, 29871, 29900, 29889, 29945, 29901, 13, 18884, 396, 4669, 17809, 13, 18884, 4818, 29918, 29916, 353, 938, 29898, 29881, 2650, 428, 29961, 29900, 29962, 334, 2920, 29897, 13, 18884, 4818, 29918, 29891, 353, 938, 29898, 29881, 2650, 428, 29961, 29896, 29962, 334, 3171, 29897, 13, 18884, 281, 353, 938, 29898, 29881, 2650, 428, 29961, 29906, 29962, 334, 2920, 29897, 13, 18884, 298, 353, 938, 29898, 29881, 2650, 428, 29961, 29941, 29962, 334, 3171, 29897, 13, 29871, 13, 18884, 396, 22914, 2521, 10350, 13, 18884, 921, 353, 938, 29898, 5064, 29918, 29916, 448, 281, 847, 29871, 29906, 29897, 13, 18884, 343, 353, 938, 29898, 5064, 29918, 29891, 448, 298, 847, 29871, 29906, 29897, 13, 29871, 13, 18884, 16273, 29889, 4397, 4197, 29916, 29892, 343, 29892, 281, 29892, 298, 2314, 13, 18884, 1970, 333, 2063, 29889, 4397, 29898, 7411, 29898, 5527, 5084, 876, 13, 18884, 770, 29918, 4841, 29889, 4397, 29898, 1990, 29918, 333, 29897, 13, 29871, 13, 268, 13, 1678, 1596, 29898, 2435, 29898, 1884, 267, 876, 13, 1678, 18111, 29922, 13850, 29906, 29889, 5200, 29876, 29889, 29940, 29924, 1744, 2251, 267, 29898, 1884, 267, 29892, 1970, 333, 2063, 29892, 29871, 29900, 29889, 29941, 29892, 29871, 29900, 29889, 29946, 29897, 13, 29871, 13, 1678, 565, 7431, 29898, 2248, 267, 29897, 1405, 29871, 29900, 29901, 13, 4706, 1596, 29898, 2248, 267, 29889, 1579, 8606, 3101, 13, 29871, 13, 29871, 13, 1678, 4079, 29922, 11023, 29906, 29889, 29943, 1164, 29911, 29918, 4448, 7068, 13282, 29918, 29925, 4375, 1177, 13, 1678, 11955, 29922, 9302, 29889, 8172, 29889, 29590, 29898, 29900, 29892, 29906, 29945, 29945, 29892, 2311, 7607, 2435, 29898, 1884, 267, 511, 29941, 876, 13, 29871, 13, 1678, 565, 7431, 29898, 2248, 267, 15410, 29900, 29901, 13, 4706, 363, 474, 297, 18111, 29889, 1579, 8606, 7295, 13, 632, 13, 9651, 921, 29892, 343, 29892, 281, 29892, 298, 353, 16273, 29961, 29875, 29962, 13, 9651, 3858, 29922, 710, 29898, 13203, 29961, 1990, 29918, 4841, 29961, 29875, 24960, 13, 9651, 16420, 29922, 710, 29898, 14486, 29898, 5527, 333, 2063, 29961, 29875, 1402, 29906, 876, 13, 9651, 2927, 29922, 27703, 29961, 29875, 29962, 13, 9651, 13850, 29906, 29889, 1621, 2521, 29898, 2492, 22657, 29916, 29892, 29891, 21336, 29916, 29974, 29893, 29892, 29891, 29974, 29882, 511, 2780, 29892, 29906, 29897, 13, 9651, 13850, 29906, 29889, 649, 1626, 29898, 2492, 29892, 1643, 13578, 15691, 5527, 5084, 22657, 29916, 29892, 29891, 29974, 29906, 29900, 511, 5657, 29892, 29906, 22657, 29906, 29945, 29945, 29892, 29906, 29945, 29945, 29892, 29906, 29945, 29945, 511, 29906, 29897, 13, 29871, 13, 29871, 13, 1678, 13850, 29906, 29889, 326, 4294, 703, 2940, 613, 11023, 29906, 29889, 21476, 29898, 2492, 29892, 313, 29947, 29900, 29900, 29892, 29953, 29900, 29900, 4961, 13, 1678, 1820, 29922, 13850, 29906, 29889, 10685, 2558, 29898, 29896, 29897, 13, 1678, 565, 1820, 1360, 29906, 29955, 29901, 13, 4706, 2867, 13, 29871, 13, 5030, 29889, 14096, 580, 13, 11023 ]
1,333,617
0
StackExchange
-1
-1
If you are in the habit of being negative then it will come naturally to you for negative thoughts to fill your mind and you can't stop that from happening in an instant. But what you can do is train your mind to change these thoughts into positive ones. It will take time and you won't be great at it at first but if you just keep it up eventually those negative thoughts will wain. When you think of something negative you need to counteract it with something positive. Undo that thought. I can be critical of people walking down the street, and it was getting worse when I was struggling more with my depression and anxiety. But now each time I think "Oh wow, her makeup looks terrible!". I think, "Wow she has confidence and isn't harming anyone by owning her style". Once you get into the habit of doing this with each of your negative thoughts, soon your mind will just jump to the positive thoughts straight away and your mind will be successfully trained. This won't happen in a day or even a few weeks, it will need to be something that you work on consistently. It can be difficult to think of the good things happening in our lives when we are so focused on the negative. So we need to start looking at our lives and find the positive in each and every day. The best way to do this is to start a Gratitude Journal. I have a specific journal for this from Kikki K (the cutest stationary brand) but you can just use a spare notebook or add it to each day of your diary. I try to write 3 things that I am grateful for but if you are consumed with negativity at the moment that might be difficult so maybe start with writing just one thing that you are grateful for initially and then eventually build this up and write two and then three things. The process of writing it down means that you are putting some thought into it and actually registering what you are putting down on paper. Plus you have something to look back on when you are having a particularly down day. Soon you will want to write so much more because you are recognizing the amazing things happening to you and how lucky you are. Again, this will train your mind to start actively thinking of all the good things happening right now. If you are like me then the first thing you do to catch up with your other half when you get home after work is have a big moan about what went wrong with your day. Now, this is normal and so easy to brush off. But if you are sat eating your dinner and the only thing you are doing is just moaning and sharing the bad bits about your day then that's never going to bring you any joy. It's like when you talk about your other half to your friends you are more likely to moan about what they have done wrong than tell them all the nice things they have done for you. And this is because we have been conditioned to think and speak this way. So when you are sat eating your dinner maybe ask the question, "What is one good thing that happened to you today?". Even if you have had the worst day you have had in a while you must list one good thing that has happened. Even if it is as simple as the vending machine releasing two snacks instead of one. This is another practice that once you start you will begin to think more of all the positive things that are happening in your day so you have something good to share. And soon you won't even have to ask the question, you will just sit down and instantly start talking about the good in your day. And the rule with this practice is that you have to big up their win for the day. You can't put it down, you can't brush it off and move on. You want to share the positive with them and continue the positivity in your conversation going ahead. This is so that your whole dinner can be filled with smiles and laughter rather than rolled eyes and frustration. It works. Give it a go. A lot of the time when we are having a negative moment it is a thought about someone else and their actions. Or it is criticizing ourselves. So now is the perfect opportunity to start working on ourselves. If there is something you are berating yourself for and you can start working on it then start making that change. If you can't change it then work on your mindset so you can stop dwelling on it. Once you start working on you and your mindset the negative attitude you have towards yourself should soon slip away and you can focus more on the amazing things about yourself. Once you start taking this seriously then you will be so busy developing yourself you won't have time to worry about others or judge
0.31888
-2.000421
0.445485
-1.540927
[ 0.2017727895233034, 0.43598728788209146 ]
[ -1.9825146533587454, -2.0183272249849398 ]
[ 0.5215724643225169, 0.36939800279946083 ]
[ -1.5617375414006707, -1.5201156171086245 ]
1,024
[ 512, 512 ]
[ 960, 366, 526, 297, 278, 4760, 310, 1641, 8178, 769, 372, 674, 2041, 18180, 304, 366, 363, 8178, 13133, 304, 5445, 596, 3458, 322, 366, 508, 29915, 29873, 5040, 393, 515, 10464, 297, 385, 14426, 29889, 1205, 825, 366, 508, 437, 338, 7945, 596, 3458, 304, 1735, 1438, 13133, 964, 6374, 6743, 29889, 13, 3112, 674, 2125, 931, 322, 366, 2113, 29915, 29873, 367, 2107, 472, 372, 472, 937, 541, 565, 366, 925, 3013, 372, 701, 10201, 1906, 8178, 13133, 674, 281, 475, 29889, 13, 10401, 366, 1348, 310, 1554, 8178, 366, 817, 304, 6795, 627, 372, 411, 1554, 6374, 29889, 14211, 29877, 393, 2714, 29889, 13, 29902, 508, 367, 12187, 310, 2305, 22049, 1623, 278, 11952, 29892, 322, 372, 471, 2805, 15029, 746, 306, 471, 20042, 901, 411, 590, 316, 2590, 322, 14919, 21549, 29889, 1205, 1286, 1269, 931, 306, 1348, 376, 9048, 281, 340, 29892, 902, 1207, 786, 3430, 16403, 29991, 1642, 306, 1348, 29892, 376, 29956, 340, 1183, 756, 16420, 322, 3508, 29915, 29873, 10311, 292, 5019, 491, 8152, 1076, 902, 3114, 1642, 13, 26222, 366, 679, 964, 278, 4760, 310, 2599, 445, 411, 1269, 310, 596, 8178, 13133, 29892, 4720, 596, 3458, 674, 925, 12500, 304, 278, 6374, 13133, 7812, 3448, 322, 596, 3458, 674, 367, 8472, 16370, 29889, 13, 4013, 2113, 29915, 29873, 3799, 297, 263, 2462, 470, 1584, 263, 2846, 11405, 29892, 372, 674, 817, 304, 367, 1554, 393, 366, 664, 373, 5718, 2705, 29889, 13, 3112, 508, 367, 5189, 304, 1348, 310, 278, 1781, 2712, 10464, 297, 1749, 12080, 746, 591, 526, 577, 21309, 373, 278, 8178, 29889, 1105, 591, 817, 304, 1369, 3063, 472, 1749, 12080, 322, 1284, 278, 6374, 297, 1269, 322, 1432, 2462, 29889, 13, 1576, 1900, 982, 304, 437, 445, 338, 304, 1369, 263, 1632, 271, 4279, 8237, 29889, 306, 505, 263, 2702, 8955, 363, 445, 515, 476, 638, 1984, 476, 313, 1552, 5700, 342, 5073, 653, 14982, 29897, 541, 366, 508, 925, 671, 263, 29337, 451, 19273, 470, 788, 372, 304, 1269, 2462, 310, 596, 652, 653, 29889, 13, 29902, 1018, 304, 2436, 29871, 29941, 2712, 393, 306, 626, 28656, 363, 541, 565, 366, 526, 11233, 287, 411, 3480, 28157, 472, 278, 3256, 393, 1795, 367, 5189, 577, 5505, 1369, 411, 5007, 925, 697, 2655, 393, 366, 526, 28656, 363, 12919, 322, 769, 10201, 2048, 445, 701, 322, 2436, 1023, 322, 769, 2211, 2712, 29889, 13, 1576, 1889, 310, 5007, 372, 1623, 2794, 393, 366, 526, 10594, 777, 2714, 964, 372, 322, 2869, 6036, 292, 825, 366, 526, 10594, 1623, 373, 5650, 29889, 15113, 366, 505, 1554, 304, 1106, 1250, 373, 746, 366, 526, 2534, 263, 10734, 1623, 2462, 29889, 13, 29903, 6150, 366, 674, 864, 304, 2436, 577, 1568, 901, 1363, 366, 526, 5936, 5281, 278, 21863, 292, 2712, 10464, 304, 366, 322, 920, 9885, 29891, 366, 526, 29889, 11454, 29892, 445, 674, 7945, 596, 3458, 304, 1369, 1044, 3598, 7291, 310, 599, 278, 1781, 2712, 10464, 1492, 1286, 29889, 13, 3644, 366, 526, 763, 592, 769, 278, 937, 2655, 366, 437, 304, 4380, 701, 411, 596, 916, 4203, 746, 366, 679, 3271, 1156, 664, 338, 505, 263, 4802, 2730, 273, 1048, 825, 3512, 2743, 411, 596, 2462, 29889, 13, 10454, 29892, 445, 338, 4226, 322, 577, 4780, 304, 1506, 1878, 1283, 29889, 1205, 565, 366, 526, 3290, 321, 1218, 596, 17803, 322, 278, 871, 2655, 366, 526, 2599, 338, 925, 2730, 273, 292, 322, 19383, 278, 4319, 9978, 1048, 596, 2462, 769, 393, 29915, 29879, 2360, 2675, 304, 6963, 366, 738, 15331, 29889, 13, 3112, 29915, 29879, 763, 746, 366, 5193, 1048, 596, 916, 4203, 304, 596, 7875, 366, 526, 901, 5517, 304, 2730, 273, 1048, 825, 896, 505, 2309, 2743, 1135, 2649, 963, 599, 278, 7575, 2712, 896, 505, 2309, 363, 366, 29889, 1126, 445, 338, 1363, 591, 505, 1063, 4195, 287, 304, 1348, 322, 7726, 445, 982, 29889, 13, 6295, 746, 366, 526, 3290, 321, 1218, 596, 17803, 5505, 2244, 278, 1139, 29892, 376, 5618, 338, 697, 1781, 2655, 393, 9559, 304, 366, 9826, 29973, 1642, 7753, 565, 366, 505, 750, 278, 17322, 2462, 366, 505, 750, 297, 263, 1550, 366, 1818, 1051, 697, 1781, 2655, 393, 756, 9559, 29889, 7753, 565, 372, 338, 408, 2560, 408, 278, 325, 2548, 4933, 337, 280, 5832, 1023, 5807, 26514, 2012, 310, 697, 29889, 13, 4013, 338, 1790, 6944, 393, 2748, 366, 1369, 366, 674, 3380, 304, 1348, 901, 310, 599, 278, 6374, 2712, 393, 526, 10464, 297, 596, 2462, 577, 366, 505, 1554, 1781, 304, 6232, 29889, 1126, 4720, 366, 2113, 29915, 29873, 1584, 505, 304, 2244, 278, 1139, 29892, 366, 674, 925, 7845, 1623, 322, 26232, 1369, 9963, 1048, 278, 1781, 297, 596, 2462, 29889, 13, 2855, 278, 5751, 411, 445, 6944, 338, 393, 366, 505, 304, 4802, 701, 1009, 5401, 363, 278, 2462, 29889, 887, 508, 29915, 29873, 1925, 372, 1623, 29892, 366, 508, 29915, 29873, 1506, 1878, 372, 1283, 322, 4337, 373, 29889, 887, 864, 304, 6232, 278, 6374, 411, 963, 322, 6773, 278, 13686, 2068, 297, 596, 14983, 2675, 14432, 29889, 13, 4013, 338, 577, 393, 596, 3353, 17803, 508, 367, 10423, 411, 1560, 5475, 322, 10569, 357, 3265, 1135, 29081, 5076, 322, 1424, 11036, 29889, 739, 1736, 29889, 25538, 372, 263, 748, 29889, 13, 29909, 3287, 310, 278, 931, 746, 591, 526, 2534, 263, 8178, 3256, 372, 338, 263, 2714, 1048, 4856, 1683, 322, 1009, 8820, 29889, 1394, 372, 338, 11164, 5281, 20278, 29889, 1105, 1286, 338, 278, 4922, 15130, 304, 1369, 1985, 373, 20278, 29889, 13, 3644, 727, 338, 1554, 366, 526, 7655, 1218, 7535, 363, 322, 366, 508, 1369, 1985, 373, 372, 769, 1369, 3907, 393, 1735, 29889, 960, 366, 508, 29915, 29873, 1735, 372, 769, 664, 373, 596, 3458, 842, 577, 366, 508, 5040, 24013, 292, 373, 372, 29889, 13, 26222, 366, 1369, 1985, 373, 366, 322, 596, 3458, 842, 278, 8178, 26309, 366, 505, 7113, 7535, 881, 4720, 269, 3466, 3448, 322, 366, 508, 8569, 901, 373, 278, 21863, 292, 2712, 1048, 7535, 29889, 13, 26222, 366, 1369, 5622, 445, 25798, 769, 366, 674, 367, 577, 19587, 14338, 7535, 366, 2113, 29915, 29873, 505, 931, 304, 15982, 1048, 4045, 470, 16833 ]
1,333,631
0
C4
4
1
Tag Archives: card game I am always intrigued when a puzzle, puzzle game, or board game makes the leap to a different medium. What changes will need to be made in order to adapt the puzzle/game to this new style? Does the puzzle lose something in the translation, or become something entirely different? Or does moving into this new medium prove to be a renaissance, a revitalization, for a puzzle or game that had grown stale? The classic Nintendo puzzle game Dr. Mario recently made the leap to mobile apps as Dr. Mario World, for example, and the transition left the game relatively unscathed. For the uninitiated, Dr. Mario is all about clearing your screen of virus characters in various colors by lining up pills of the same color to eliminate them. Much like Tetris, the pills fall from the top of the screen, and successfully clearing parts of your screen can cause headaches for your opponent in head-to-head battles. [Image courtesy of CNET.] Sure, the mobile version changed some aspects of the game. You only have a certain number of pills available to clear a given stage (unless you buy more with real-world cash) as opposed to the never-ending supply of the original. And Dr. Mario isn't the only playable character, as other Mario characters are also doctors in this game (Dr. Peach, Dr. Bowser) with different abilities. Time will tell if this translation is a success for Nintendo. But naturally, they're not the only ones experimenting with new ways of bringing their puzzles and games to market. Our friends at Looney Labs currently have two new projects underway, both of which are reinventing familiar styles of gameplay in fresh exciting ways. Readers of the blog are familiar with the card game Fluxx, which is one of Looney Labs' flagship products. The card game with the ever-shifting rules is coming to iOS and Android phones with Playdek's Digital Fluxx! [Image courtesy of Pocket Tactics.] Launching in the next few days, Digital Fluxx promises both offline play and online play for 2-4 players (including human and AI opponents) and multiple language options for international players. It's apropos that a game where the rules and goals are constantly changing would continue to adapt in new and exciting ways, and I look forward to seeing how a digital version of the now-classic card game brings new eyes to the Looney Labs library of games. But that's not all. Looney Labs has also teamed up with the game-publishing resource The Game Crafter to allow fans of the card-matching game Loonacy to create their very own custom Loonacy decks! You can pick and choose from their library of possible card images or upload your own and create a truly unique Loonacy deck for yourself. I think it's an awesome idea, one that makes a perfect gift for fellow game fans, and I can't wait to see what sorts of clever creations Loonacy fans come up with through The Game Crafter. Between a DIY design template for a fast-paced relative newcomer and a digital version of one of the mainstays in modern card games, Looney Labs is demonstrating two ways that puzzlers and game companies can find new, enticing ways to keep their products accessible. I can't wait to see what other companies and puzzlemakers come up with next. Posted in Games, PuzzleNation, Puzzles | Tagged card game, customization, digital fluxx, DIY puzzling, evolution, Fluxx, game crafter, Loonacy, Looney Labs, mobile app, mobile games, playdek, PuzzleNation, Puzzlin' fool, The Game Crafter | Leave a reply PuzzleNation Product Review: Codenames There are all kinds of games where communication is crucial. In You've Got Crabs, you must employ a secret non-verbal signal to inform your partner that you've completed a task, but without the other team spotting your signal and intercepting. In Taboo, you have to get a teammate to state a particular word, but without using several words closely associated with the answer. But other games ratchet up both the creativity necessary to win and the difficulty involved in doing so. Imagine having to communicate volumes with a single word. In today's product review, we delve into the world of spycraft and put our communication skills
0.986597
0.506459
0.701646
-0.680523
[ 0.9564639509016203, 1.0167296697775658 ]
[ 0.574502960751533, 0.43841518857199435 ]
[ 0.851283797622472, 0.5520073566271282 ]
[ -0.506881897624126, -0.8541648284358861 ]
1,024
[ 512, 512 ]
[ 10522, 28320, 29901, 5881, 3748, 13, 29902, 626, 2337, 11158, 5526, 287, 746, 263, 20285, 280, 29892, 20285, 280, 3748, 29892, 470, 7613, 3748, 3732, 278, 454, 481, 304, 263, 1422, 18350, 29889, 1724, 3620, 674, 817, 304, 367, 1754, 297, 1797, 304, 7744, 278, 20285, 280, 29914, 11802, 304, 445, 716, 3114, 29973, 5538, 278, 20285, 280, 14074, 1554, 297, 278, 13962, 29892, 470, 4953, 1554, 9186, 1422, 29973, 1394, 947, 8401, 964, 445, 716, 18350, 6356, 304, 367, 263, 364, 2386, 9948, 29892, 263, 6664, 2410, 2133, 29892, 363, 263, 20285, 280, 470, 3748, 393, 750, 21633, 380, 744, 29973, 13, 1576, 22037, 405, 28481, 20285, 280, 3748, 4942, 29889, 16262, 10325, 1754, 278, 454, 481, 304, 10426, 11446, 408, 4942, 29889, 16262, 2787, 29892, 363, 1342, 29892, 322, 278, 9558, 2175, 278, 3748, 13774, 443, 1557, 14139, 29889, 13, 2831, 278, 443, 2344, 29875, 630, 29892, 4942, 29889, 16262, 338, 599, 1048, 2821, 292, 596, 4315, 310, 24424, 4890, 297, 5164, 11955, 491, 301, 2827, 701, 282, 6090, 310, 278, 1021, 2927, 304, 27399, 963, 29889, 18927, 763, 323, 300, 3780, 29892, 278, 282, 6090, 6416, 515, 278, 2246, 310, 278, 4315, 29892, 322, 8472, 2821, 292, 5633, 310, 596, 4315, 508, 4556, 2343, 14520, 363, 596, 23995, 296, 297, 2343, 29899, 517, 29899, 2813, 8957, 793, 29889, 13, 29961, 2940, 2085, 2167, 29891, 310, 315, 6006, 5586, 13, 29903, 545, 29892, 278, 10426, 1873, 3939, 777, 21420, 310, 278, 3748, 29889, 887, 871, 505, 263, 3058, 1353, 310, 282, 6090, 3625, 304, 2821, 263, 2183, 7408, 313, 28952, 366, 15649, 901, 411, 1855, 29899, 11526, 274, 1161, 29897, 408, 15869, 304, 278, 2360, 29899, 2548, 11421, 310, 278, 2441, 29889, 1126, 4942, 29889, 16262, 3508, 29915, 29873, 278, 871, 1708, 519, 2931, 29892, 408, 916, 16262, 4890, 526, 884, 437, 14359, 297, 445, 3748, 313, 25639, 29889, 3938, 496, 29892, 4942, 29889, 13432, 643, 29897, 411, 1422, 633, 9770, 29889, 13, 2481, 674, 2649, 565, 445, 13962, 338, 263, 2551, 363, 405, 28481, 29889, 1205, 18180, 29892, 896, 29915, 276, 451, 278, 871, 6743, 7639, 292, 411, 716, 5837, 310, 20794, 1009, 20285, 793, 322, 8090, 304, 9999, 29889, 13, 29949, 332, 7875, 472, 4309, 4992, 365, 6897, 5279, 505, 1023, 716, 9279, 1090, 1582, 29892, 1716, 310, 607, 526, 15561, 794, 292, 9985, 11949, 310, 3748, 1456, 297, 10849, 5566, 11407, 5837, 29889, 13, 6359, 414, 310, 278, 12618, 526, 9985, 411, 278, 5881, 3748, 2379, 1314, 29916, 29892, 607, 338, 697, 310, 4309, 4992, 365, 6897, 29915, 13449, 4034, 9316, 29889, 450, 5881, 3748, 411, 278, 3926, 29899, 845, 24377, 6865, 338, 6421, 304, 10012, 322, 5669, 1374, 2873, 411, 7412, 25950, 29915, 29879, 15918, 2379, 1314, 29916, 29991, 13, 29961, 2940, 2085, 2167, 29891, 310, 349, 9749, 323, 627, 1199, 5586, 13, 17641, 292, 297, 278, 2446, 2846, 3841, 29892, 15918, 2379, 1314, 29916, 27584, 1716, 1283, 1220, 1708, 322, 7395, 1708, 363, 29871, 29906, 29899, 29946, 10769, 313, 18271, 5199, 322, 319, 29902, 23995, 1237, 29897, 322, 2999, 4086, 3987, 363, 6121, 10769, 29889, 13, 3112, 29915, 29879, 11712, 1066, 393, 263, 3748, 988, 278, 6865, 322, 14433, 526, 21003, 6480, 723, 6773, 304, 7744, 297, 716, 322, 5566, 11407, 5837, 29892, 322, 306, 1106, 6375, 304, 8790, 920, 263, 13436, 1873, 310, 278, 1286, 29899, 1990, 293, 5881, 3748, 23522, 716, 5076, 304, 278, 4309, 4992, 365, 6897, 3489, 310, 8090, 29889, 13, 6246, 393, 29915, 29879, 451, 599, 29889, 13, 3410, 4992, 365, 6897, 756, 884, 734, 2795, 701, 411, 278, 3748, 29899, 23679, 292, 6503, 450, 8448, 14279, 906, 304, 2758, 24909, 310, 278, 5881, 29899, 4352, 292, 3748, 4309, 265, 4135, 304, 1653, 1009, 1407, 1914, 2888, 4309, 265, 4135, 316, 4684, 29991, 13, 3492, 508, 5839, 322, 6755, 515, 1009, 3489, 310, 1950, 5881, 4558, 470, 6441, 596, 1914, 322, 1653, 263, 19781, 5412, 4309, 265, 4135, 19810, 363, 7535, 29889, 306, 1348, 372, 29915, 29879, 385, 29663, 2969, 29892, 697, 393, 3732, 263, 4922, 19797, 363, 10404, 3748, 24909, 29892, 322, 306, 508, 29915, 29873, 4480, 304, 1074, 825, 23551, 310, 23455, 907, 800, 4309, 265, 4135, 24909, 2041, 701, 411, 1549, 450, 8448, 14279, 906, 29889, 13, 29933, 300, 1452, 263, 22471, 29979, 2874, 4472, 363, 263, 5172, 29899, 29886, 562, 287, 6198, 716, 510, 261, 322, 263, 13436, 1873, 310, 697, 310, 278, 1667, 303, 1036, 297, 5400, 5881, 8090, 29892, 4309, 4992, 365, 6897, 338, 9004, 1218, 1023, 5837, 393, 20285, 9306, 322, 3748, 14582, 508, 1284, 716, 29892, 875, 18499, 5837, 304, 3013, 1009, 9316, 15579, 29889, 13, 29902, 508, 29915, 29873, 4480, 304, 1074, 825, 916, 14582, 322, 20285, 2409, 21079, 2041, 701, 411, 2446, 29889, 13, 6747, 287, 297, 12482, 29892, 349, 18813, 280, 29940, 362, 29892, 349, 18813, 793, 12, 29989, 10522, 3192, 5881, 3748, 29892, 2888, 2133, 29892, 13436, 19389, 29916, 29892, 22471, 29979, 20285, 1847, 29892, 14675, 29892, 2379, 1314, 29916, 29892, 3748, 12220, 906, 29892, 4309, 265, 4135, 29892, 4309, 4992, 365, 6897, 29892, 10426, 623, 29892, 10426, 8090, 29892, 1708, 25950, 29892, 349, 18813, 280, 29940, 362, 29892, 349, 18813, 1915, 29915, 17928, 29892, 450, 8448, 14279, 906, 12, 29989, 951, 1351, 263, 8908, 13, 29925, 18813, 280, 29940, 362, 10969, 13957, 29901, 315, 13183, 1280, 13, 8439, 526, 599, 17690, 310, 8090, 988, 12084, 338, 7618, 1455, 29889, 13, 797, 887, 29915, 345, 15992, 315, 4201, 29879, 29892, 366, 1818, 5703, 263, 7035, 1661, 29899, 369, 5521, 7182, 304, 1871, 596, 18096, 393, 366, 29915, 345, 8676, 263, 3414, 29892, 541, 1728, 278, 916, 3815, 9758, 1259, 596, 7182, 322, 23404, 292, 29889, 512, 11090, 3634, 29892, 366, 505, 304, 679, 263, 3815, 25046, 304, 2106, 263, 3153, 1734, 29892, 541, 1728, 773, 3196, 3838, 16467, 6942, 411, 278, 1234, 29889, 13, 6246, 916, 8090, 364, 905, 300, 701, 1716, 278, 907, 28157, 5181, 304, 5401, 322, 278, 14656, 9701, 297, 2599, 577, 29889, 1954, 22094, 2534, 304, 23120, 18167, 411, 263, 2323, 1734, 29889, 13, 797, 9826, 29915, 29879, 3234, 9076, 29892, 591, 628, 345, 964, 278, 3186, 310, 805, 11078, 4154, 322, 1925, 1749, 12084, 25078 ]
1,333,633
0
CommonCrawl
5
7
to the test as we try out the card game Codenames. In Codenames, two teams (the red team and the blue team) are tasked with identifying all of their secret agents before their opponents can locate their own agents from the same list. But in order to do so, they must pick those agents out of a field of 25 possible individuals. In each group, there are red agents, blue agents, innocent bystanders, and an assassin. Each possible individual is marked with a codename that is viewable by all of the players. So, where does the wordplay and communication come in? Each team selects one player apiece to serve as the spymaster. The spymaster for each team looks at one of the secret patterns determining which cards/codenames represent blue agents and which red agents. So it's up to the spymaster to point the players in the right direction, but it's up to the players to actually choose a given person in the field of 25 and label them an agent. Each round, the spymaster comes up with a one-word clue for the other players on their team that points to their secret agents (as well as a number representing the number of agents in the field that the clue applies to). The word must be specific enough to point them in the right direction, but that can be difficult depending on the words in your play area. For instance, in our example grid, the clue "royalty: 1" could point toward KING, or QUEEN, or HEAD, or even REVOLUTION, depending on what the other players associate with the word "royalty." But suppose that you want your players to choose KING and not QUEEN. Then "royalty" is no good, because it's too vague. The number aspect of the clue is also important, because it offers the opportunity to gain an advantage over your opponents. For instance, if you wanted both KING and QUEEN to be labeled as your agents, the clue "royalty: 2" would be good, because those would probably be the two most likely choices based on that clue. In our example grid, the red team went first, and the spymaster said "dishes: 2." The other player on the red team chose GLASS and WASHER from the grid, and both were correct and marked with red agent cards. This was a smart play, but also a risky one, as PAN could also be associated with "dishes." The blue team responded with the clue "rasp: 1," choosing specificity and a single possible answer for the sake of certainty, rather than risk trying for more than one agent in this turn. The blue player correctly selected FILE, and that card was marked with a blue agent card. The next turn for the red team didn't go nearly as well. The spymaster used the clue "big: 1" and instead of choosing SHOT (the intended answer), the player opted for MAMMOTH. The card was revealed to be an innocent bystander, and the red team's turn was immediately over for failing to ID an agent that turn. And that is one of the big strategic challenges of Codenames. Do you stick to 1 agent per turn with a greater chance of success, or do you try to get more creative and bold by going for less certain clues that could lead to multiple agent IDs in one fell swoop? Do you risk uncovering the assassin (and immediately losing the game) with a clue that could suggest him as well as a secret agent for your team? The field of codenames in the play area can also lead to unexpected challenges. In one game, I was playing the spymaster for my team. The words JUPITER and SATURN were both in the grid, but only JUPITER was one of our agents. So a clue like "planet" was out. Unfortunately, other clues (like "biggest" or "god") were excluded because they also applied to other codenames in the play area, including the dreaded assassin. A mix of tactics, efficiency, association, vocabulary, and luck, Codenames is a terrific game that will test your wits, your communication skills, and your ability to make every word count. The sheer volume of possible codenames (as well as the increased variety offered by each card being double-sided) ensues a huge amount of replay value is built into the game. And not only is it great as a group game, but the two-player version is just as fun! Codenames, play
0.753752
0.531528
1.267227
-0.27601
[ 0.45242339303007656, 1.055080581789531 ]
[ 0.5637591892636746, 0.4992965603365248 ]
[ 1.4802715719177708, 1.0541830796532135 ]
[ -0.32738734911467704, -0.22463322351868814 ]
1,024
[ 512, 512 ]
[ 304, 278, 1243, 408, 591, 1018, 714, 278, 5881, 3748, 315, 13183, 1280, 29889, 13, 797, 315, 13183, 1280, 29892, 1023, 10907, 313, 1552, 2654, 3815, 322, 278, 7254, 3815, 29897, 526, 3414, 287, 411, 2893, 9215, 599, 310, 1009, 7035, 19518, 1434, 1009, 23995, 1237, 508, 26694, 1009, 1914, 19518, 515, 278, 1021, 1051, 29889, 1205, 297, 1797, 304, 437, 577, 29892, 896, 1818, 5839, 1906, 19518, 714, 310, 263, 1746, 310, 29871, 29906, 29945, 1950, 15724, 29889, 13, 797, 1269, 2318, 29892, 727, 526, 2654, 19518, 29892, 7254, 19518, 29892, 21458, 296, 491, 1689, 414, 29892, 322, 385, 20105, 262, 29889, 7806, 1950, 5375, 338, 10902, 411, 263, 15234, 3871, 393, 338, 1776, 519, 491, 599, 310, 278, 10769, 29889, 13, 6295, 29892, 988, 947, 278, 1734, 1456, 322, 12084, 2041, 297, 29973, 13, 9760, 3815, 27778, 697, 4847, 3095, 347, 346, 304, 9080, 408, 278, 805, 962, 1901, 29889, 450, 805, 962, 1901, 363, 1269, 3815, 3430, 472, 697, 310, 278, 7035, 15038, 3683, 2827, 607, 15889, 29914, 29883, 13183, 1280, 2755, 7254, 19518, 322, 607, 2654, 19518, 29889, 13, 6295, 372, 29915, 29879, 701, 304, 278, 805, 962, 1901, 304, 1298, 278, 10769, 297, 278, 1492, 5305, 29892, 541, 372, 29915, 29879, 701, 304, 278, 10769, 304, 2869, 6755, 263, 2183, 2022, 297, 278, 1746, 310, 29871, 29906, 29945, 322, 3858, 963, 385, 10823, 29889, 13, 9760, 4513, 29892, 278, 805, 962, 1901, 5304, 701, 411, 263, 697, 29899, 1742, 23960, 363, 278, 916, 10769, 373, 1009, 3815, 393, 3291, 304, 1009, 7035, 19518, 313, 294, 1532, 408, 263, 1353, 15783, 278, 1353, 310, 19518, 297, 278, 1746, 393, 278, 23960, 16058, 304, 467, 450, 1734, 1818, 367, 2702, 3307, 304, 1298, 963, 297, 278, 1492, 5305, 29892, 541, 393, 508, 367, 5189, 8679, 373, 278, 3838, 297, 596, 1708, 4038, 29889, 13, 2831, 2777, 29892, 297, 1749, 1342, 6856, 29892, 278, 23960, 376, 307, 4605, 1017, 29901, 29871, 29896, 29908, 1033, 1298, 11183, 476, 4214, 29892, 470, 660, 4462, 1430, 29892, 470, 17714, 3035, 29892, 470, 1584, 5195, 29963, 5607, 2692, 2725, 29892, 8679, 373, 825, 278, 916, 10769, 25836, 411, 278, 1734, 376, 307, 4605, 1017, 1213, 1205, 7755, 393, 366, 864, 596, 10769, 304, 6755, 476, 4214, 322, 451, 660, 4462, 1430, 29889, 1987, 376, 307, 4605, 1017, 29908, 338, 694, 1781, 29892, 1363, 372, 29915, 29879, 2086, 25160, 29889, 13, 1576, 1353, 9565, 310, 278, 23960, 338, 884, 4100, 29892, 1363, 372, 16688, 278, 15130, 304, 11581, 385, 10631, 975, 596, 23995, 1237, 29889, 1152, 2777, 29892, 565, 366, 5131, 1716, 476, 4214, 322, 660, 4462, 1430, 304, 367, 301, 24025, 408, 596, 19518, 29892, 278, 23960, 376, 307, 4605, 1017, 29901, 29871, 29906, 29908, 723, 367, 1781, 29892, 1363, 1906, 723, 3117, 367, 278, 1023, 1556, 5517, 19995, 2729, 373, 393, 23960, 29889, 13, 797, 1749, 1342, 6856, 29892, 278, 2654, 3815, 3512, 937, 29892, 322, 278, 805, 962, 1901, 1497, 376, 29881, 17006, 29901, 29871, 29906, 1213, 450, 916, 4847, 373, 278, 2654, 3815, 12784, 402, 4375, 1799, 322, 399, 3289, 4448, 515, 278, 6856, 29892, 322, 1716, 892, 1959, 322, 10902, 411, 2654, 10823, 15889, 29889, 910, 471, 263, 15040, 1708, 29892, 541, 884, 263, 5161, 3459, 697, 29892, 408, 349, 2190, 1033, 884, 367, 6942, 411, 376, 29881, 17006, 1213, 13, 1576, 7254, 3815, 10049, 287, 411, 278, 23960, 376, 3417, 29886, 29901, 29871, 29896, 1699, 23906, 2702, 537, 322, 263, 2323, 1950, 1234, 363, 278, 16563, 310, 3058, 1017, 29892, 3265, 1135, 12045, 1811, 363, 901, 1135, 697, 10823, 297, 445, 2507, 29889, 450, 7254, 4847, 5149, 4629, 24080, 29892, 322, 393, 5881, 471, 10902, 411, 263, 7254, 10823, 5881, 29889, 13, 1576, 2446, 2507, 363, 278, 2654, 3815, 3282, 29915, 29873, 748, 8886, 408, 1532, 29889, 450, 805, 962, 1901, 1304, 278, 23960, 376, 3752, 29901, 29871, 29896, 29908, 322, 2012, 310, 23906, 24972, 2891, 313, 1552, 9146, 1234, 511, 278, 4847, 3523, 287, 363, 341, 5194, 29924, 2891, 29950, 29889, 450, 5881, 471, 17845, 304, 367, 385, 21458, 296, 491, 1689, 261, 29892, 322, 278, 2654, 3815, 29915, 29879, 2507, 471, 7389, 975, 363, 17581, 304, 3553, 385, 10823, 393, 2507, 29889, 13, 2855, 393, 338, 697, 310, 278, 4802, 16650, 293, 18066, 267, 310, 315, 13183, 1280, 29889, 1938, 366, 12070, 304, 29871, 29896, 10823, 639, 2507, 411, 263, 7621, 8825, 310, 2551, 29892, 470, 437, 366, 1018, 304, 679, 901, 907, 1230, 322, 14288, 491, 2675, 363, 3109, 3058, 1067, 1041, 393, 1033, 3275, 304, 2999, 10823, 23481, 297, 697, 8379, 16768, 459, 29973, 1938, 366, 12045, 443, 11911, 292, 278, 20105, 262, 313, 392, 7389, 19035, 278, 3748, 29897, 411, 263, 23960, 393, 1033, 4368, 1075, 408, 1532, 408, 263, 7035, 10823, 363, 596, 3815, 29973, 13, 1576, 1746, 310, 274, 13183, 1280, 297, 278, 1708, 4038, 508, 884, 3275, 304, 15668, 18066, 267, 29889, 512, 697, 3748, 29892, 306, 471, 8743, 278, 805, 962, 1901, 363, 590, 3815, 29889, 450, 3838, 435, 4897, 1806, 1001, 322, 317, 1299, 24015, 892, 1716, 297, 278, 6856, 29892, 541, 871, 435, 4897, 1806, 1001, 471, 697, 310, 1749, 19518, 29889, 1105, 263, 23960, 763, 376, 9018, 300, 29908, 471, 714, 29889, 11511, 29892, 916, 1067, 1041, 313, 4561, 376, 3752, 7118, 29908, 470, 376, 17083, 1159, 892, 429, 13347, 1363, 896, 884, 7436, 304, 916, 274, 13183, 1280, 297, 278, 1708, 4038, 29892, 3704, 278, 21005, 287, 20105, 262, 29889, 13, 29909, 6837, 310, 28476, 1199, 29892, 19201, 29892, 15477, 29892, 7931, 370, 352, 653, 29892, 322, 9885, 29892, 315, 13183, 1280, 338, 263, 1935, 29878, 928, 3748, 393, 674, 1243, 596, 281, 1169, 29892, 596, 12084, 25078, 29892, 322, 596, 11509, 304, 1207, 1432, 1734, 2302, 29889, 13, 1576, 1183, 261, 7977, 310, 1950, 274, 13183, 1280, 313, 294, 1532, 408, 278, 11664, 12875, 12520, 491, 1269, 5881, 1641, 3765, 29899, 29879, 2618, 29897, 5662, 1041, 263, 12176, 5253, 310, 337, 1456, 995, 338, 4240, 964, 278, 3748, 29889, 1126, 451, 871, 338, 372, 2107, 408, 263, 2318, 3748, 29892, 541, 278, 1023, 29899, 9106, 1873, 338, 925, 408, 2090, 29991, 13, 29907, 13183, 1280, 29892, 1708 ]
1,333,633
1,024
CommonCrawl
5
7
able for 4 to 8 players (with variant rules for 2 or 3 players) is available at Target, Barnes & Noble, and many online retailers. Posted in Games, PuzzleNation, Puzzles | Tagged association, Board game, card game, codename, codenames, deduction, group game, party game, product review, Puzzlin' fool, social game, spies, spycraft, Taboo, Wordplay, you've got crabs | Leave a reply Solo Solving and Single-Player Board Game Fun! Have you ever been in the mood to play a board game or do some non-paper-and-pencil puzzling, but you don't have anyone around to play with? Well, there's no reason to fret, fellow puzzlers, as there are plenty of options out there for solo gamers and puzzlers. Today, we'd like to suggest a few options for a terrific single-player solving experience! The Abandons I'll start us off with one of our most recently reviewed games. The Abandons is a one-player maze game where you're exploring a labyrinth that's different every time you play. You're at the mercy of the draw pile for the most part, but the more you play, the better you get at managing your meager resources and exploring the seemingly endless corridors. Can you find your way out? [If you're looking for a similar gaming experience, you can also try One Deck Dungeon or Brad Hough's The Maze.] Puzzometry For a more traditional solving experience, Puzzometry presents classic puzzle-solving with a modern twist. This next-level jigsaw-style solving will push your Tetris skills as you twist, turn, and maneuver the pieces into seemingly endless combinations, trying to find the one solution that completes the grid. There are several different Puzzometry puzzles — the standard one, an easier junior one, and a squares-based one — but each offers its own challenges. Knot Dice Can you twist, turn, and spin these dice to complete beautiful, elaborate patterns inspired by Celtic knots? That's the name of the game with Knot Dice, a dice game as challenging as it is gorgeous. This is one of those games I find tremendously relaxing as I trace the various patterns and try to form different designs. Chroma Cube Deduction puzzles have never been so colorful! Each challenge card offers a different layout of set cubes, along with clues to unravel in order to place all twelve cubes. The clues grow trickier with every card, ensuring that you'll constantly find new challenges as you solve. Thinking Putty Puzzle Our friends at ThinkFun are masters at putting together single-player puzzle-game experiences, and Thinking Putty Puzzle is just one example. It sounds simple at first: connect two colored dots with a length of stretchable putty. But when you have multiple colors on the board and you can't overlap your paths, suddenly it's a much more challenging deductive endeavor. A puzzle box unlike anything you've ever seen, Lightbox creates different patterns of shadow and light as you shift and arrange the various plastic plates that make up the box. As you twist and reset them, different electrical connections are made, and different plates light up. This is another puzzle game that I find quite soothing, even if I can be frustrated by the seemingly endless combinations available. Although co-op games are designed to bring together several players as they work to defeat the game itself, many co-op games also offer satisfying single-player campaigns. Pandemic allows you the chance to singlehandedly save the world from four deadly outbreaks, if you're quick and clever enough! [Forbidden Island, Castle Panic!, and other co-op games are also worth your time if you enjoy this kind of gameplay.] Do you have any suggestions for good single-player puzzles and games, fellow puzzlers? Let us know in the comments section below! We'd love to hear from you! Posted in Games, PuzzleNation, Puzzles | Tagged Board game, card game, Castle Panic, chroma cube, co-op, co-op gameplay, cooperative games, cooperative gaming, deduction, exploration, For
0.308265
0.06865
0.445485
-1.105197
[ -0.09339226542592947, 0.7099223736818434 ]
[ 0.0015018147324230133, 0.13579895833065192 ]
[ 0.2730208438348586, 0.6179496232871192 ]
[ -1.2287621470643015, -0.9816319715802775 ]
1,024
[ 512, 512 ]
[ 519, 363, 29871, 29946, 304, 29871, 29947, 10769, 313, 2541, 17305, 6865, 363, 29871, 29906, 470, 29871, 29941, 10769, 29897, 338, 3625, 472, 17157, 29892, 2261, 4515, 669, 1939, 569, 29892, 322, 1784, 7395, 3240, 737, 414, 29889, 13, 6747, 287, 297, 12482, 29892, 349, 18813, 280, 29940, 362, 29892, 349, 18813, 793, 12, 29989, 10522, 3192, 15477, 29892, 12590, 3748, 29892, 5881, 3748, 29892, 15234, 3871, 29892, 274, 13183, 1280, 29892, 21049, 428, 29892, 2318, 3748, 29892, 6263, 3748, 29892, 3234, 9076, 29892, 349, 18813, 1915, 29915, 17928, 29892, 5264, 3748, 29892, 805, 583, 29892, 805, 11078, 4154, 29892, 11090, 3634, 29892, 10803, 1456, 29892, 366, 29915, 345, 2355, 274, 4201, 29879, 12, 29989, 951, 1351, 263, 8908, 13, 29903, 3543, 4956, 1747, 322, 16740, 29899, 9075, 12590, 8448, 13811, 29991, 13, 25559, 366, 3926, 1063, 297, 278, 286, 2092, 304, 1708, 263, 7613, 3748, 470, 437, 777, 1661, 29899, 19773, 29899, 392, 29899, 2238, 5553, 20285, 1847, 29892, 541, 366, 1016, 29915, 29873, 505, 5019, 2820, 304, 1708, 411, 29973, 13, 11284, 29892, 727, 29915, 29879, 694, 2769, 304, 285, 2267, 29892, 10404, 20285, 9306, 29892, 408, 727, 526, 20947, 310, 3987, 714, 727, 363, 6651, 24988, 414, 322, 20285, 9306, 29889, 13, 29911, 397, 388, 29892, 591, 29915, 29881, 763, 304, 4368, 263, 2846, 3987, 363, 263, 1935, 29878, 928, 2323, 29899, 9106, 17069, 7271, 29991, 13, 1576, 1976, 392, 787, 13, 29902, 29915, 645, 1369, 502, 1283, 411, 697, 310, 1749, 1556, 10325, 9076, 287, 8090, 29889, 450, 1976, 392, 787, 338, 263, 697, 29899, 9106, 611, 911, 3748, 988, 366, 29915, 276, 3902, 8253, 263, 9775, 4316, 22653, 393, 29915, 29879, 1422, 1432, 931, 366, 1708, 29889, 887, 29915, 276, 472, 278, 2778, 1270, 310, 278, 4216, 282, 488, 363, 278, 1556, 760, 29892, 541, 278, 901, 366, 1708, 29892, 278, 2253, 366, 679, 472, 767, 6751, 596, 592, 1875, 7788, 322, 3902, 8253, 278, 2833, 11687, 1095, 2222, 1034, 2429, 943, 29889, 1815, 366, 1284, 596, 982, 714, 29973, 13, 29961, 3644, 366, 29915, 276, 3063, 363, 263, 2788, 330, 11500, 7271, 29892, 366, 508, 884, 1018, 3118, 897, 384, 11566, 25339, 470, 15862, 379, 820, 29915, 29879, 450, 17326, 29872, 5586, 13, 29925, 18813, 7843, 13, 2831, 263, 901, 13807, 17069, 7271, 29892, 349, 18813, 7843, 22981, 22037, 20285, 280, 29899, 2929, 1747, 411, 263, 5400, 3252, 391, 29889, 910, 2446, 29899, 5563, 432, 23379, 1450, 29899, 3293, 17069, 674, 5503, 596, 323, 300, 3780, 25078, 408, 366, 3252, 391, 29892, 2507, 29892, 322, 767, 12932, 369, 278, 12785, 964, 2833, 11687, 1095, 2222, 18240, 29892, 1811, 304, 1284, 278, 697, 1650, 393, 1614, 2167, 278, 6856, 29889, 13, 8439, 526, 3196, 1422, 349, 18813, 7843, 20285, 793, 813, 278, 3918, 697, 29892, 385, 6775, 20183, 697, 29892, 322, 263, 25256, 29899, 6707, 697, 813, 541, 1269, 16688, 967, 1914, 18066, 267, 29889, 13, 29968, 1333, 360, 625, 13, 6028, 366, 3252, 391, 29892, 2507, 29892, 322, 10917, 1438, 17629, 304, 4866, 9560, 29892, 19430, 15038, 20603, 491, 315, 2152, 293, 889, 1862, 29973, 2193, 29915, 29879, 278, 1024, 310, 278, 3748, 411, 476, 1333, 360, 625, 29892, 263, 17629, 3748, 408, 18066, 292, 408, 372, 338, 330, 3890, 681, 29889, 13, 4013, 338, 697, 310, 1906, 8090, 306, 1284, 14586, 355, 5794, 26681, 292, 408, 306, 9637, 278, 5164, 15038, 322, 1018, 304, 883, 1422, 25517, 29889, 13, 1451, 456, 29874, 315, 4003, 13, 29928, 6085, 428, 20285, 793, 505, 2360, 1063, 577, 2927, 1319, 29991, 7806, 18766, 5881, 16688, 263, 1422, 5912, 310, 731, 13630, 267, 29892, 3412, 411, 1067, 1041, 304, 443, 336, 955, 297, 1797, 304, 2058, 599, 17680, 13630, 267, 29889, 450, 1067, 1041, 6548, 8938, 631, 411, 1432, 5881, 29892, 5662, 3864, 393, 366, 29915, 645, 21003, 1284, 716, 18066, 267, 408, 366, 4505, 29889, 13, 1349, 18159, 12065, 1017, 349, 18813, 280, 13, 29949, 332, 7875, 472, 25086, 25394, 526, 5835, 29879, 472, 10594, 4208, 2323, 29899, 9106, 20285, 280, 29899, 11802, 27482, 29892, 322, 498, 18159, 12065, 1017, 349, 18813, 280, 338, 925, 697, 1342, 29889, 739, 10083, 2560, 472, 937, 29901, 4511, 1023, 28684, 270, 1862, 411, 263, 3309, 310, 16116, 519, 1925, 1017, 29889, 1205, 746, 366, 505, 2999, 11955, 373, 278, 7613, 322, 366, 508, 29915, 29873, 25457, 596, 10898, 29892, 11584, 372, 29915, 29879, 263, 1568, 901, 18066, 292, 28262, 5313, 573, 19981, 17118, 29889, 13, 29909, 20285, 280, 3800, 25531, 3099, 366, 29915, 345, 3926, 3595, 29892, 12790, 1884, 10017, 1422, 15038, 310, 15504, 322, 3578, 408, 366, 9500, 322, 564, 3881, 278, 5164, 715, 6288, 715, 1078, 393, 1207, 701, 278, 3800, 29889, 1094, 366, 3252, 391, 322, 10092, 963, 29892, 1422, 3546, 16888, 12368, 526, 1754, 29892, 322, 1422, 715, 1078, 3578, 701, 29889, 13, 4013, 338, 1790, 20285, 280, 3748, 393, 306, 1284, 3755, 577, 6046, 29892, 1584, 565, 306, 508, 367, 1424, 4627, 630, 491, 278, 2833, 11687, 1095, 2222, 18240, 3625, 29889, 13, 2499, 3592, 1302, 29899, 459, 8090, 526, 8688, 304, 6963, 4208, 3196, 10769, 408, 896, 664, 304, 20653, 278, 3748, 3528, 29892, 1784, 1302, 29899, 459, 8090, 884, 5957, 24064, 2323, 29899, 9106, 11531, 29879, 29889, 6518, 24552, 6511, 366, 278, 8825, 304, 2323, 3179, 23244, 4078, 278, 3186, 515, 3023, 7123, 368, 714, 8690, 29879, 29892, 565, 366, 29915, 276, 4996, 322, 23455, 3307, 29991, 13, 29961, 2831, 29890, 4215, 7935, 29892, 15194, 6518, 293, 18565, 322, 916, 1302, 29899, 459, 8090, 526, 884, 7088, 596, 931, 565, 366, 13389, 445, 2924, 310, 3748, 1456, 5586, 13, 6132, 366, 505, 738, 10529, 363, 1781, 2323, 29899, 9106, 20285, 793, 322, 8090, 29892, 10404, 20285, 9306, 29973, 2803, 502, 1073, 297, 278, 6589, 4004, 2400, 29991, 1334, 29915, 29881, 5360, 304, 8293, 515, 366, 29991, 13, 6747, 287, 297, 12482, 29892, 349, 18813, 280, 29940, 362, 29892, 349, 18813, 793, 12, 29989, 10522, 3192, 12590, 3748, 29892, 5881, 3748, 29892, 15194, 6518, 293, 29892, 25173, 29874, 28704, 29892, 1302, 29899, 459, 29892, 1302, 29899, 459, 3748, 1456, 29892, 1302, 3372, 1230, 8090, 29892, 1302, 3372, 1230, 330, 11500, 29892, 21049, 428, 29892, 3902, 12418, 29892, 1152 ]
1,333,633
2,048
CommonCrawl
5
7
bidden Island, games, jigsaw puzzle, Knot Dice, LightBox, logic, mechanical puzzle, one player, Pandemic, puzzle game, PuzzleNation, Puzzlin' fool, Puzzometry, single player, solo gameplay, solo puzzling, solo solving, the abandons, ThinkFun, thinking putty, thinking putty puzzle | Leave a reply PuzzleNation Product Review: The Abandons Posted on May 3, 2019 by gmdirect What is it about exploring a maze that is so satisfying? We've covered labyrinths before — in book form, in wood form, even in LEGO form — but we've never sampled something quite like The Abandons. The Abandons is a one-player labyrinth-building game that is different every time you play. And unlike most labyrinths that are predetermined for you (and are observed from above), you have to explore it room by room, dealing with the surprises and consequences revealed by your choices. [A sampling of the cards you'll see; clockwise from upper left: an item card, a stairs card, the card backing, a corridor card with choices, the end card, the beginning card.] This quick-play game is simple to learn, simple to set up, and difficult to conquer. Locate the beginning and end cards, remove them from the deck, then shuffle the remaining 48 cards. Once they're shuffled, place the end card at the bottom of the deck. This is now your draw pile. Place your beginning card down on the table. You'll notice it has a diamond at the door. The diamonds represent how many cards you draw in order to move forward. With one diamond, you simply draw the next card and play it. With two, you discard one card and play the next. With three, you discard two cards and play the third. And so on. [Sometimes you reach a quick dead end.] As you pull cards from the draw pile and add them to the labyrinth, you'll come to intersections that allow for multiple paths. You'll pick one direction and follow it. If you come to a dead end, you can retrace your steps back to the nearest intersection with an unexplored path and continue your journey. But if you encounter enough dead ends, you'll find yourself without any unexplored paths, and you lose, having trapped yourself in the labyrinth forever. Bummer. You can see in this playthrough, we were lucky with our first cards, as we drew an item card immediately (and set it aside for later), followed by an intersection card with three paths to choose from. We went left, drew another intersection card, and then had a choice to make. If one of those paths leads to a dead end, we're still in good shape since there are currently four unexplored paths to fall back on. Options are life in this game. Unfortunately, we went right, drew another intersection card, and then went left, drawing the collapse card. If you draw this card, you wipe all of your progress from the play area and go back to the start, as if you've fallen into a lower level of the labyrinth and must start your search anew for an exit. (This is one of two cards that can cause this game reset. The other, the stairs card, gives you the choice of continuing with your current path or going back to the start. It's slightly more pleasant than the collapse card.) So you don't just have dead end cards to worry about. Sometimes you'll be pretty deep into your explorations, and suddenly, you're back at the start. It's a kick in the teeth, to be sure. Now here's a game where we've gotten pretty far. You can see in the top left and the bottom center areas of your screen, a few dead end cards have appeared. But we have several unexplored paths to fall back on, as well as three item cards. The item cards offer different options depending on how many you have. If you have one, you can spend it to look at the top three cards of the draw pile (as if you've found part of a map of the labyrinth). If you have two, you can spend them on a bomb to blast your way through a dead end or another wall, giving yourself another unexplored path (and another chance for escape). And if you have three, you can spent them on a magic mirror that allows you to return to the start and take a new path.
0.188761
0.177879
0.653457
-0.61744
[ 0.20451214038130094, 0.17300960551432942 ]
[ 0.22353975881482813, 0.13221770116803247 ]
[ 0.8208489053178607, 0.4860650899671372 ]
[ -0.8632696243747712, -0.3716106436749761 ]
1,024
[ 512, 512 ]
[ 29890, 4215, 7935, 29892, 8090, 29892, 432, 23379, 1450, 20285, 280, 29892, 476, 1333, 360, 625, 29892, 12790, 3313, 29892, 5900, 29892, 28310, 20285, 280, 29892, 697, 4847, 29892, 6518, 24552, 29892, 20285, 280, 3748, 29892, 349, 18813, 280, 29940, 362, 29892, 349, 18813, 1915, 29915, 17928, 29892, 349, 18813, 7843, 29892, 2323, 4847, 29892, 6651, 3748, 1456, 29892, 6651, 20285, 1847, 29892, 6651, 17069, 29892, 278, 633, 392, 787, 29892, 25086, 25394, 29892, 7291, 1925, 1017, 29892, 7291, 1925, 1017, 20285, 280, 12, 29989, 951, 1351, 263, 8908, 13, 29925, 18813, 280, 29940, 362, 10969, 13957, 29901, 450, 1976, 392, 787, 13, 6747, 287, 373, 2610, 29871, 29941, 29892, 29871, 29906, 29900, 29896, 29929, 491, 330, 3487, 1088, 13, 5618, 338, 372, 1048, 3902, 8253, 263, 611, 911, 393, 338, 577, 24064, 29973, 1334, 29915, 345, 10664, 9775, 4316, 22653, 29879, 1434, 813, 297, 3143, 883, 29892, 297, 8112, 883, 29892, 1584, 297, 11060, 17080, 883, 813, 541, 591, 29915, 345, 2360, 4559, 29881, 1554, 3755, 763, 450, 1976, 392, 787, 29889, 13, 1576, 1976, 392, 787, 338, 263, 697, 29899, 9106, 9775, 4316, 22653, 29899, 25237, 3748, 393, 338, 1422, 1432, 931, 366, 1708, 29889, 1126, 25531, 1556, 9775, 4316, 22653, 29879, 393, 526, 4450, 300, 837, 1312, 363, 366, 313, 392, 526, 8900, 515, 2038, 511, 366, 505, 304, 26987, 372, 5716, 491, 5716, 29892, 16743, 411, 278, 11468, 4637, 322, 27721, 17845, 491, 596, 19995, 29889, 13, 29961, 29909, 23460, 310, 278, 15889, 366, 29915, 645, 1074, 29936, 12006, 3538, 515, 7568, 2175, 29901, 385, 2944, 5881, 29892, 263, 380, 7121, 5881, 29892, 278, 5881, 27436, 29892, 263, 1034, 2429, 272, 5881, 411, 19995, 29892, 278, 1095, 5881, 29892, 278, 6763, 5881, 5586, 13, 4013, 4996, 29899, 1456, 3748, 338, 2560, 304, 5110, 29892, 2560, 304, 731, 701, 29892, 322, 5189, 304, 26474, 29889, 5976, 403, 278, 6763, 322, 1095, 15889, 29892, 3349, 963, 515, 278, 19810, 29892, 769, 528, 21897, 278, 9886, 29871, 29946, 29947, 15889, 29889, 9038, 896, 29915, 276, 528, 3096, 839, 29892, 2058, 278, 1095, 5881, 472, 278, 5970, 310, 278, 19810, 29889, 910, 338, 1286, 596, 4216, 282, 488, 29889, 13, 22150, 596, 6763, 5881, 1623, 373, 278, 1591, 29889, 887, 29915, 645, 8369, 372, 756, 263, 11502, 898, 472, 278, 3050, 29889, 450, 11502, 13788, 2755, 920, 1784, 15889, 366, 4216, 297, 1797, 304, 4337, 6375, 29889, 2973, 697, 11502, 898, 29892, 366, 3763, 4216, 278, 2446, 5881, 322, 1708, 372, 29889, 2973, 1023, 29892, 366, 2313, 538, 697, 5881, 322, 1708, 278, 2446, 29889, 2973, 2211, 29892, 366, 2313, 538, 1023, 15889, 322, 1708, 278, 4654, 29889, 1126, 577, 373, 29889, 13, 29961, 29903, 14618, 366, 6159, 263, 4996, 7123, 1095, 5586, 13, 2887, 366, 8206, 15889, 515, 278, 4216, 282, 488, 322, 788, 963, 304, 278, 9775, 4316, 22653, 29892, 366, 29915, 645, 2041, 304, 1006, 27117, 393, 2758, 363, 2999, 10898, 29889, 887, 29915, 645, 5839, 697, 5305, 322, 1101, 372, 29889, 960, 366, 2041, 304, 263, 7123, 1095, 29892, 366, 508, 337, 15003, 596, 6576, 1250, 304, 278, 20471, 17686, 411, 385, 443, 24516, 4395, 2224, 322, 6773, 596, 16342, 29889, 13, 6246, 565, 366, 11735, 3307, 7123, 10614, 29892, 366, 29915, 645, 1284, 7535, 1728, 738, 443, 24516, 4395, 10898, 29892, 322, 366, 14074, 29892, 2534, 1020, 2986, 7535, 297, 278, 9775, 4316, 22653, 22296, 29889, 350, 398, 1050, 29889, 13, 3492, 508, 1074, 297, 445, 1708, 20678, 29892, 591, 892, 9885, 29891, 411, 1749, 937, 15889, 29892, 408, 591, 15010, 385, 2944, 5881, 7389, 313, 392, 731, 372, 17786, 363, 2678, 511, 5643, 491, 385, 17686, 5881, 411, 2211, 10898, 304, 6755, 515, 29889, 1334, 3512, 2175, 29892, 15010, 1790, 17686, 5881, 29892, 322, 769, 750, 263, 7348, 304, 1207, 29889, 13, 3644, 697, 310, 1906, 10898, 11981, 304, 263, 7123, 1095, 29892, 591, 29915, 276, 1603, 297, 1781, 8267, 1951, 727, 526, 5279, 3023, 443, 24516, 4395, 10898, 304, 6416, 1250, 373, 29889, 25186, 526, 2834, 297, 445, 3748, 29889, 13, 2525, 7524, 29892, 591, 3512, 1492, 29892, 15010, 1790, 17686, 5881, 29892, 322, 769, 3512, 2175, 29892, 11580, 278, 24382, 5881, 29889, 13, 3644, 366, 4216, 445, 5881, 29892, 366, 281, 15705, 599, 310, 596, 6728, 515, 278, 1708, 4038, 322, 748, 1250, 304, 278, 1369, 29892, 408, 565, 366, 29915, 345, 19225, 964, 263, 5224, 3233, 310, 278, 9775, 4316, 22653, 322, 1818, 1369, 596, 2740, 385, 809, 363, 385, 6876, 29889, 313, 4013, 338, 697, 310, 1023, 15889, 393, 508, 4556, 445, 3748, 10092, 29889, 450, 916, 29892, 278, 380, 7121, 5881, 29892, 4076, 366, 278, 7348, 310, 3133, 292, 411, 596, 1857, 2224, 470, 2675, 1250, 304, 278, 1369, 29889, 739, 29915, 29879, 10029, 901, 21246, 1135, 278, 24382, 5881, 1846, 13, 6295, 366, 1016, 29915, 29873, 925, 505, 7123, 1095, 15889, 304, 15982, 1048, 29889, 18512, 366, 29915, 645, 367, 5051, 6483, 964, 596, 3902, 272, 800, 29892, 322, 11584, 29892, 366, 29915, 276, 1250, 472, 278, 1369, 29889, 739, 29915, 29879, 263, 24817, 297, 278, 25287, 29892, 304, 367, 1854, 29889, 13, 10454, 1244, 29915, 29879, 263, 3748, 988, 591, 29915, 345, 2355, 841, 5051, 2215, 29889, 887, 508, 1074, 297, 278, 2246, 2175, 322, 278, 5970, 4818, 10161, 310, 596, 4315, 29892, 263, 2846, 7123, 1095, 15889, 505, 7470, 29889, 1205, 591, 505, 3196, 443, 24516, 4395, 10898, 304, 6416, 1250, 373, 29892, 408, 1532, 408, 2211, 2944, 15889, 29889, 13, 1576, 2944, 15889, 5957, 1422, 3987, 8679, 373, 920, 1784, 366, 505, 29889, 960, 366, 505, 697, 29892, 366, 508, 18864, 372, 304, 1106, 472, 278, 2246, 2211, 15889, 310, 278, 4216, 282, 488, 313, 294, 565, 366, 29915, 345, 1476, 760, 310, 263, 2910, 310, 278, 9775, 4316, 22653, 467, 960, 366, 505, 1023, 29892, 366, 508, 18864, 963, 373, 263, 13585, 304, 1999, 579, 596, 982, 1549, 263, 7123, 1095, 470, 1790, 10090, 29892, 6820, 7535, 1790, 443, 24516, 4395, 2224, 313, 392, 1790, 8825, 363, 10169, 467, 1126, 565, 366, 505, 2211, 29892, 366, 508, 10398, 963, 373, 263, 15709, 19571, 393, 6511, 366, 304, 736, 304, 278, 1369, 322, 2125, 263, 716, 2224, 29889, 13 ]
1,333,633
3,072
CommonCrawl
5
7
Overall, I really enjoyed playing this game. Many explore-a-world games require lots of setup, whereas this one gets going in seconds and plays out in about ten minutes or so. The mix of strategy and luck makes each game unpredictable — even if it's a bit frustrating to draw a dead end card early on that squashes the whole game. The item cards allow for some solid tactical planning — I'm a huge fan of bombing my way through walls — which offsets the randomness of the draw pile. Yes, it's true that this isn't really a game that you can master, since randomness will always be a big part of the gameplay, but it's certainly a game you can get better at playing. After just a few tries, you start to get the hang of how to choose your paths and try to make the draw pile work for you, not against you. (In that way, it becomes a puzzly version of poker where you're playing against the deck itself.) It's a terrific solo solving experience, a great intro game for younger players (I certainly think you can go younger than the 14+ recommended by the designers), and small enough to fit in your pocket. This is one quick-play game that won't sit on the shelf for very long. The Abandons is available from Puzzling Pixel Games and select online retailers. Posted in Games, PuzzleNation, Puzzles | Tagged Board game, card game, dmitri, exploration, games, Geeking Out, labyrinth, michael blascoe, product review, PuzzleNation, Puzzlin' fool, puzzling pixel, puzzling pixel games, replayability, replayable, solo game, the abandons | 2 Replies A World of Puzzles and Games at Norwescon 42! Your friendly neighborhood puzzle blogger took a trip across the country to attend Norwescon, the premiere fantasy and science fiction convention in the Pacific Northwest. This was the 42nd edition of the convention, and if you know your sci-fi novels, then you're not surprised that there were all sorts of references to The Hitchhiker's Guide to the Galaxy. (The number 42 is a big part of the first novel.) The convention's subtitle was "Don't Panic" (another HHGTTG reference), and lots of convention attendees were in their bathrobes or carrying towels, representing the two main characters of the series, the bathrobe-wearing Arthur Dent and the towel-toting alien tourist Ford Prefect. As with any convention, the costuming was amazing. There were fairy godmothers, vikings, mermaids, Daleks, folks in Seahawks-colored finery (it was Seattle, after all), a Predator offering free hugs, an inflatable T-rex costume with those robotic grabber arms, and even photo ops with Krampus and Santa! (And Easter Krampus on Sunday.) One of the oddest moments for me was seeing a group of people in uniforms I didn't recognize, and realizing they weren't con attendees, they were the flight crew for an international airline. (The hotel was across the street from the airport.) Although many of the convention's panels and events have a writerly focus, plenty of attention is also given to art, films, games, and pop culture, so there was loads for puzzle and game fans to enjoy at the event. The dealers room — the main area to shop for costumes, books, fabric, t-shirts, memorabilia, collectibles, and more — had several game shops represented, toting loads of games at good prices. (Several of which we've reviewed on the Blog in the past, and some that will be reviewed in the future.) [All hotel nooks and crannies were stuffed with thematic exhibits, including this delightful leave-a-book, take-a-book mini-library a la The Restaurant at the End of the Universe.] Board game demos were available all day, complete with skillful players to introduce newbies to various games, as well as tabletop roleplaying adventures in all sorts of settings and systems, from Dungeons & Dragons and Vampire: The Masquerade to Pathfinder and more. In fact, one of the gaming spaces
1.134522
0.982766
0.371934
-0.72434
[ 1.2030055281213972, 1.0660379852215212 ]
[ 0.3166524450429335, 1.6488801095373642 ]
[ 0.5012825361194428, 0.24258595153024737 ]
[ -0.8177456446803457, -0.6309347422914355 ]
1,024
[ 512, 512 ]
[ 3563, 497, 29892, 306, 2289, 27849, 8743, 445, 3748, 29889, 9267, 26987, 29899, 29874, 29899, 11526, 8090, 1996, 14568, 310, 6230, 29892, 13452, 445, 697, 4947, 2675, 297, 6923, 322, 13582, 714, 297, 1048, 3006, 6233, 470, 577, 29889, 450, 6837, 310, 13705, 322, 9885, 3732, 1269, 3748, 443, 27711, 519, 813, 1584, 565, 372, 29915, 29879, 263, 2586, 1424, 4627, 1218, 304, 4216, 263, 7123, 1095, 5881, 4688, 373, 393, 10674, 1161, 267, 278, 3353, 3748, 29889, 450, 2944, 15889, 2758, 363, 777, 7773, 28476, 936, 18987, 813, 306, 29915, 29885, 263, 12176, 13524, 310, 13585, 292, 590, 982, 1549, 14603, 813, 607, 1283, 7224, 278, 4036, 2264, 310, 278, 4216, 282, 488, 29889, 13, 8241, 29892, 372, 29915, 29879, 1565, 393, 445, 3508, 29915, 29873, 2289, 263, 3748, 393, 366, 508, 5835, 29892, 1951, 4036, 2264, 674, 2337, 367, 263, 4802, 760, 310, 278, 3748, 1456, 29892, 541, 372, 29915, 29879, 8959, 263, 3748, 366, 508, 679, 2253, 472, 8743, 29889, 2860, 925, 263, 2846, 14335, 29892, 366, 1369, 304, 679, 278, 13958, 310, 920, 304, 6755, 596, 10898, 322, 1018, 304, 1207, 278, 4216, 282, 488, 664, 363, 366, 29892, 451, 2750, 366, 29889, 313, 797, 393, 982, 29892, 372, 7415, 263, 20285, 368, 1873, 310, 11293, 261, 988, 366, 29915, 276, 8743, 2750, 278, 19810, 3528, 1846, 13, 3112, 29915, 29879, 263, 1935, 29878, 928, 6651, 17069, 7271, 29892, 263, 2107, 22909, 3748, 363, 20023, 10769, 313, 29902, 8959, 1348, 366, 508, 748, 20023, 1135, 278, 29871, 29896, 29946, 29974, 13622, 491, 278, 2874, 414, 511, 322, 2319, 3307, 304, 6216, 297, 596, 24589, 29889, 910, 338, 697, 4996, 29899, 1456, 3748, 393, 2113, 29915, 29873, 7845, 373, 278, 528, 761, 363, 1407, 1472, 29889, 13, 1576, 1976, 392, 787, 338, 3625, 515, 349, 18813, 1847, 349, 15711, 12482, 322, 1831, 7395, 3240, 737, 414, 29889, 13, 6747, 287, 297, 12482, 29892, 349, 18813, 280, 29940, 362, 29892, 349, 18813, 793, 12, 29989, 10522, 3192, 12590, 3748, 29892, 5881, 3748, 29892, 270, 2415, 374, 29892, 3902, 12418, 29892, 8090, 29892, 1879, 1416, 292, 4451, 29892, 9775, 4316, 22653, 29892, 21488, 4271, 1999, 294, 1111, 29872, 29892, 3234, 9076, 29892, 349, 18813, 280, 29940, 362, 29892, 349, 18813, 1915, 29915, 17928, 29892, 20285, 1847, 15526, 29892, 20285, 1847, 15526, 8090, 29892, 337, 1456, 3097, 29892, 337, 1456, 519, 29892, 6651, 3748, 29892, 278, 633, 392, 787, 12, 29989, 29871, 29906, 10088, 3687, 13, 29909, 2787, 310, 349, 18813, 793, 322, 12482, 472, 4186, 29893, 267, 535, 29871, 29946, 29906, 29991, 13, 10858, 19780, 18403, 20285, 280, 12618, 914, 3614, 263, 17487, 4822, 278, 4234, 304, 14333, 4186, 29893, 267, 535, 29892, 278, 5730, 406, 13568, 8995, 322, 10466, 24159, 15687, 297, 278, 14328, 4644, 5933, 29889, 13, 4013, 471, 278, 29871, 29946, 29906, 299, 12203, 310, 278, 15687, 29892, 322, 565, 366, 1073, 596, 4560, 29899, 7241, 2420, 1379, 29892, 769, 366, 29915, 276, 451, 18014, 393, 727, 892, 599, 23551, 310, 9282, 304, 450, 379, 2335, 29882, 5603, 29915, 29879, 16886, 304, 278, 5208, 26825, 29889, 313, 1576, 1353, 29871, 29946, 29906, 338, 263, 4802, 760, 310, 278, 937, 9554, 1846, 13, 1576, 15687, 29915, 29879, 1014, 3257, 471, 376, 10310, 29915, 29873, 6518, 293, 29908, 313, 23327, 379, 29950, 29954, 19988, 29954, 3407, 511, 322, 14568, 310, 15687, 472, 841, 311, 267, 892, 297, 1009, 27683, 307, 5707, 470, 19436, 304, 29893, 1379, 29892, 15783, 278, 1023, 1667, 4890, 310, 278, 3652, 29892, 278, 27683, 307, 915, 29899, 705, 4362, 11498, 360, 296, 322, 278, 304, 20466, 29899, 4260, 292, 394, 819, 6282, 391, 14601, 27611, 522, 29889, 13, 2887, 411, 738, 15687, 29892, 278, 3438, 9929, 471, 21863, 292, 29889, 1670, 892, 6534, 29891, 7339, 29885, 720, 414, 29892, 325, 638, 886, 29892, 2778, 655, 4841, 29892, 360, 744, 2039, 29892, 900, 2039, 297, 922, 801, 1450, 2039, 29899, 2780, 287, 1436, 708, 313, 277, 471, 27689, 29892, 1156, 599, 511, 263, 21099, 1061, 27032, 3889, 298, 16926, 29892, 385, 4414, 17219, 323, 29899, 276, 29916, 3438, 2017, 411, 1906, 19964, 293, 17229, 495, 10188, 29892, 322, 1584, 15373, 288, 567, 411, 7365, 1160, 375, 322, 7510, 29991, 313, 2855, 382, 1901, 7365, 1160, 375, 373, 16340, 1846, 13, 6716, 310, 278, 7736, 342, 19462, 363, 592, 471, 8790, 263, 2318, 310, 2305, 297, 9090, 29879, 306, 3282, 29915, 29873, 18720, 29892, 322, 1855, 5281, 896, 2949, 264, 29915, 29873, 378, 472, 841, 311, 267, 29892, 896, 892, 278, 16286, 17616, 363, 385, 6121, 4799, 1220, 29889, 313, 1576, 16730, 471, 4822, 278, 11952, 515, 278, 4799, 637, 1846, 13, 2499, 3592, 1784, 310, 278, 15687, 29915, 29879, 7243, 1379, 322, 4959, 505, 263, 9227, 368, 8569, 29892, 20947, 310, 8570, 338, 884, 2183, 304, 1616, 29892, 12298, 29892, 8090, 29892, 322, 1835, 9257, 29892, 577, 727, 471, 15376, 363, 20285, 280, 322, 3748, 24909, 304, 13389, 472, 278, 1741, 29889, 13, 1576, 5376, 414, 5716, 813, 278, 1667, 4038, 304, 18296, 363, 3438, 9351, 29892, 8277, 29892, 18187, 29892, 260, 29899, 845, 381, 1372, 29892, 26959, 4427, 423, 29892, 6314, 13876, 29892, 322, 901, 813, 750, 3196, 3748, 528, 3554, 9875, 29892, 304, 1259, 15376, 310, 8090, 472, 1781, 26094, 29889, 313, 29903, 1310, 284, 310, 607, 591, 29915, 345, 9076, 287, 373, 278, 350, 1188, 297, 278, 4940, 29892, 322, 777, 393, 674, 367, 9076, 287, 297, 278, 5434, 1846, 13, 29961, 3596, 16730, 694, 12117, 322, 274, 661, 29876, 583, 892, 6433, 287, 411, 963, 2454, 10371, 1169, 29892, 3704, 445, 15319, 1319, 5967, 29899, 29874, 29899, 2909, 29892, 2125, 29899, 29874, 29899, 2909, 20629, 29899, 5258, 263, 425, 450, 390, 22837, 424, 472, 278, 2796, 310, 278, 853, 12193, 5586, 13, 28397, 3748, 1261, 359, 892, 3625, 599, 2462, 29892, 4866, 411, 19911, 1319, 10769, 304, 14944, 716, 29890, 583, 304, 5164, 8090, 29892, 408, 1532, 408, 1591, 3332, 6297, 1456, 292, 17623, 1973, 297, 599, 23551, 310, 6055, 322, 6757, 29892, 515, 11566, 479, 787, 669, 12225, 787, 322, 478, 1160, 533, 29901, 450, 8622, 339, 15019, 304, 10802, 2886, 261, 322, 901, 29889, 512, 2114, 29892, 697, 310, 278, 330, 11500, 8162 ]
1,333,633
4,096
CommonCrawl
5
7
was right down the hall from my hotel room, and it was PACKED morning 'til night with enthusiastic roleplayers telling stories, rolling dice, and battling monsters. There were open games as well as sign-ups for specific games and adventures, including a multi-table multi-hour battle for gang supremacy in the fictional city of Waterdeep. One of the most intriguing puzzle/game experiences available to try at the convention was Artemis. Artemis is a spaceship bridge simulator that allows a group of players to essentially play out a Star Trek-esque adventure. Each player has instructions, controls, and a laptop in front of them, as well as a big screen for everyone to view (much like the main viewer on the bridge of the Enterprise). Two teams, each piloting their own ship (the Artemis or the Intrepid) must battle foes, trade goods, dock with space stations, and explore the galaxy, all while maintaining their weapons, shields, energy usage in the ship, and piloting control, as well as communicating with their sister ship through headset. I moved back and forth between the two "ships," watching as the players navigated different challenges, cooperated (and disagreed) on command decisions, managed their resources, and ventured between the stars, all while some pretty impressive graphics tied the whole play experience together. What really struck me about the Artemis style of play was how much communication was required for success. It is a co-op game in the same vein as Castle Panic!, Forbidden Island, or Spaceteam, but with a lot more personal responsibility. Plus the laptop interfaces for each station were slick and well-designed, bringing that polished Star Trek: The Next Generation feel home. I was also responsible for some of the puzzliest events at the convention. Although I did participate in some panels on writing, literature, roleplaying games, and movies (both good ones and the worst of b-movies), the two events that were the main focus of my time were a LARP/scavenger hunt based on The Hitchhiker's Guide to the Galaxy and an escape room based on Star Wars. The HHGTTG event was built as an in-universe scavenger hunt where players (who were all expected to bring their towels, of course), had to complete five tasks. The completion of each task led to a rune for the players to record on their gamesheet. and earn five runes, then spell them out in a secret location using their towels, in order to ask an important question. Some of the tasks included: finding HHGTTG character names in a word search grid, then reading the remaining uncircled letters as a secret message singing karaoke to the mermaids at the hotel pool assisting a Vogon poet with her terrible poetry They had to earn all five runes, then find me in a secret location and spell out the runes with their towels. If they did so correctly, they would bring one of the missing dolphins back to Earth (and received a small stuffed one for their efforts). [A bag full of dolphins, awaiting a possible return to Earth.] The Star Wars event was a traditional escape room with puzzles to solve, boxes to unlock, combinations to find, keys to uncover, and a room to escape under a time limit. Designed for the teenaged attendees, the escape room was set on a bounty hunter's ship, and all of the players were recently captured by the bounty hunter, awaiting transport to an Imperial prison. But the bounty hunter has fallen victim to one of his own security protocols, so all of the "prisoners" have a chance to escape, if they disable the (Nerf gun-)armed droid blocking the escape pod, as well as either shut off the radiation leak near the pod OR gather enough bacta to heal themselves from radiation damage in order to actually survive the escape. [Nerf guns and five shipped boxes. An embryonic escape room.] [The contents of said shipped boxes. An escape room mid-construction.] Although some of the boxes were opened out of order (by brute force, rather than proper solving) and one of the puzzles had an unfortunate printing error, the players unraveled the mysteries of the bounty hunter's ship and escaped with only seconds to spare before the Imperials arrived. SUCCESS! (Plus friend of the blog
1.022208
1.713343
0.952733
-0.127082
[ 1.3673665796012484, 0.6770501633858733 ]
[ 1.7491553100907085, 1.6775301668383196 ]
[ 1.0338931514501393, 0.8715737258255462 ]
[ -0.1439907452028487, -0.11017293171556122 ]
1,024
[ 512, 512 ]
[ 471, 1492, 1623, 278, 12713, 515, 590, 16730, 5716, 29892, 322, 372, 471, 349, 11375, 3352, 7250, 525, 1376, 4646, 411, 23644, 29875, 6288, 6297, 1456, 414, 14509, 15874, 29892, 27777, 17629, 29892, 322, 8957, 1847, 1601, 23080, 29889, 13, 8439, 892, 1722, 8090, 408, 1532, 408, 1804, 29899, 14340, 363, 2702, 8090, 322, 17623, 1973, 29892, 3704, 263, 2473, 29899, 2371, 2473, 29899, 18721, 10555, 363, 20676, 22747, 29885, 4135, 297, 278, 26797, 1848, 4272, 310, 13062, 24535, 29889, 13, 6716, 310, 278, 1556, 11158, 5526, 292, 20285, 280, 29914, 11802, 27482, 3625, 304, 1018, 472, 278, 15687, 471, 826, 1356, 275, 29889, 13, 1433, 1356, 275, 338, 263, 8162, 4034, 12945, 1027, 9183, 393, 6511, 263, 2318, 310, 10769, 304, 13674, 1708, 714, 263, 7828, 6479, 29895, 29899, 267, 802, 17623, 545, 29889, 7806, 4847, 756, 11994, 29892, 11761, 29892, 322, 263, 19022, 297, 4565, 310, 963, 29892, 408, 1532, 408, 263, 4802, 4315, 363, 14332, 304, 1776, 313, 29885, 987, 763, 278, 1667, 6316, 556, 373, 278, 12945, 310, 278, 9041, 7734, 467, 13, 13985, 10907, 29892, 1269, 8230, 11427, 1009, 1914, 7751, 313, 1552, 826, 1356, 275, 470, 278, 512, 2484, 5935, 29897, 1818, 10555, 1701, 267, 29892, 11302, 22535, 29892, 23630, 411, 2913, 16355, 29892, 322, 26987, 278, 15400, 29891, 29892, 599, 1550, 7344, 292, 1009, 25340, 29892, 28761, 29879, 29892, 5864, 8744, 297, 278, 7751, 29892, 322, 8230, 11427, 2761, 29892, 408, 1532, 408, 7212, 1218, 411, 1009, 9883, 7751, 1549, 2343, 842, 29889, 13, 29902, 6153, 1250, 322, 11483, 1546, 278, 1023, 376, 9981, 1699, 21217, 408, 278, 10769, 12402, 630, 1422, 18066, 267, 29892, 1302, 3372, 630, 313, 392, 22941, 276, 287, 29897, 373, 1899, 1602, 12112, 29892, 8745, 1009, 7788, 29892, 322, 9712, 2955, 1546, 278, 10819, 29892, 599, 1550, 777, 5051, 21210, 573, 18533, 21351, 278, 3353, 1708, 7271, 4208, 29889, 13, 5618, 2289, 15469, 592, 1048, 278, 826, 1356, 275, 3114, 310, 1708, 471, 920, 1568, 12084, 471, 3734, 363, 2551, 29889, 739, 338, 263, 1302, 29899, 459, 3748, 297, 278, 1021, 2453, 262, 408, 15194, 6518, 293, 18565, 1152, 29890, 4215, 7935, 29892, 470, 1706, 562, 2650, 314, 29892, 541, 411, 263, 3287, 901, 7333, 23134, 29889, 15113, 278, 19022, 19510, 363, 1269, 5073, 892, 269, 1406, 322, 1532, 29899, 2783, 12961, 29892, 20794, 393, 1248, 3276, 7828, 6479, 29895, 29901, 450, 8084, 28203, 4459, 3271, 29889, 13, 29902, 471, 884, 14040, 363, 777, 310, 278, 20285, 20409, 4959, 472, 278, 15687, 29889, 8512, 306, 1258, 5221, 403, 297, 777, 7243, 1379, 373, 5007, 29892, 12845, 29892, 6297, 1456, 292, 8090, 29892, 322, 2351, 583, 313, 20313, 1781, 6743, 322, 278, 17322, 310, 289, 29899, 13529, 583, 511, 278, 1023, 4959, 393, 892, 278, 1667, 8569, 310, 590, 931, 892, 263, 365, 1718, 29925, 29914, 1557, 3496, 914, 298, 1657, 2729, 373, 450, 379, 2335, 29882, 5603, 29915, 29879, 16886, 304, 278, 5208, 26825, 322, 385, 10169, 5716, 2729, 373, 7828, 9149, 29889, 13, 1576, 379, 29950, 29954, 19988, 29954, 1741, 471, 4240, 408, 385, 297, 29899, 348, 12193, 885, 3496, 914, 298, 1657, 988, 10769, 313, 15970, 892, 599, 3806, 304, 6963, 1009, 304, 29893, 1379, 29892, 310, 3236, 511, 750, 304, 4866, 5320, 9595, 29889, 450, 13285, 310, 1269, 3414, 5331, 304, 263, 1065, 29872, 363, 278, 10769, 304, 2407, 373, 1009, 8090, 4155, 29889, 322, 2326, 29876, 5320, 1065, 267, 29892, 769, 24779, 963, 714, 297, 263, 7035, 4423, 773, 1009, 304, 29893, 1379, 29892, 297, 1797, 304, 2244, 385, 4100, 1139, 29889, 13, 9526, 310, 278, 9595, 5134, 29901, 13, 2886, 292, 379, 29950, 29954, 19988, 29954, 2931, 2983, 297, 263, 1734, 2740, 6856, 29892, 769, 5183, 278, 9886, 443, 6034, 839, 8721, 408, 263, 7035, 2643, 13, 2976, 292, 413, 2518, 6946, 304, 278, 2778, 655, 4841, 472, 278, 16730, 11565, 13, 465, 15423, 263, 20797, 265, 9821, 411, 902, 16403, 22309, 13, 15597, 750, 304, 2326, 29876, 599, 5320, 1065, 267, 29892, 769, 1284, 592, 297, 263, 7035, 4423, 322, 24779, 714, 278, 1065, 267, 411, 1009, 304, 29893, 1379, 29889, 960, 896, 1258, 577, 5149, 29892, 896, 723, 6963, 697, 310, 278, 4567, 8828, 561, 1144, 1250, 304, 11563, 313, 392, 4520, 263, 2319, 6433, 287, 697, 363, 1009, 14231, 467, 13, 29961, 29909, 19548, 2989, 310, 8828, 561, 1144, 29892, 7272, 292, 263, 1950, 736, 304, 11563, 5586, 13, 1576, 7828, 9149, 1741, 471, 263, 13807, 10169, 5716, 411, 20285, 793, 304, 4505, 29892, 16273, 304, 443, 908, 29892, 18240, 304, 1284, 29892, 6611, 304, 443, 11911, 29892, 322, 263, 5716, 304, 10169, 1090, 263, 931, 4046, 29889, 12037, 287, 363, 278, 734, 264, 4063, 472, 841, 311, 267, 29892, 278, 10169, 5716, 471, 731, 373, 263, 289, 792, 29891, 298, 8428, 29915, 29879, 7751, 29892, 322, 599, 310, 278, 10769, 892, 10325, 15468, 491, 278, 289, 792, 29891, 298, 8428, 29892, 7272, 292, 8608, 304, 385, 21080, 8475, 29889, 13, 6246, 278, 289, 792, 29891, 298, 8428, 756, 19225, 28985, 304, 697, 310, 670, 1914, 6993, 9608, 29879, 29892, 577, 599, 310, 278, 376, 558, 2285, 414, 29908, 505, 263, 8825, 304, 10169, 29892, 565, 896, 11262, 278, 313, 29940, 261, 29888, 13736, 15805, 279, 2168, 270, 1007, 23473, 278, 10169, 2532, 29892, 408, 1532, 408, 2845, 12522, 1283, 278, 27310, 24993, 2978, 278, 2532, 6323, 11705, 3307, 289, 627, 29874, 304, 540, 284, 6053, 515, 27310, 18658, 297, 1797, 304, 2869, 10503, 573, 278, 10169, 29889, 13, 29961, 29940, 261, 29888, 18788, 322, 5320, 528, 16242, 16273, 29889, 530, 7232, 719, 8927, 10169, 5716, 5586, 13, 29961, 1576, 8118, 310, 1497, 528, 16242, 16273, 29889, 530, 10169, 5716, 7145, 29899, 3075, 4080, 5586, 13, 2499, 3592, 777, 310, 278, 16273, 892, 6496, 714, 310, 1797, 313, 1609, 1506, 1082, 4889, 29892, 3265, 1135, 1571, 17069, 29897, 322, 697, 310, 278, 20285, 793, 750, 385, 443, 6477, 403, 14010, 1059, 29892, 278, 10769, 443, 336, 345, 839, 278, 22277, 583, 310, 278, 289, 792, 29891, 298, 8428, 29915, 29879, 7751, 322, 19824, 411, 871, 6923, 304, 29337, 1434, 278, 21080, 29879, 11977, 29889, 20134, 26925, 29991, 13, 29898, 29575, 5121, 310, 278, 12618 ]
1,333,633
5,120
CommonCrawl
5
7
Jen Cunningham cooked up some lovely victory certificates for the players, which was a cool bonus. Thank you Jen!) More importantly, despite the hiccups encountered during both events, everyone had fun while playing (either walking away with a small dolphin or a certificate). The entire convention was a blast (an exhausting one, but a blast nonetheless), and I highly recommend attending Norwescon next year to any fans of horror, sci-fi, fantasy, writing workshops, games, roleplaying, and of course, puzzles. Posted in Games, PuzzleNation, Puzzles | Tagged 42, artemis, artemis starship bridge simulator, Board game, Brain teaser, card game, convention, Dolphin, Dungeons & Dragons, Dungeons and Dragons, Escape room, fantasy, games, Geeking Out, Hitchhiker's Guide to the Galaxy, horror, LARP, live action roleplaying, norwescon, norwescon 42, pacific northwest, Pathfinder, Pop culture, PuzzleNation, Puzzlin' fool, roleplaying, roleplaying games, scavenger hunt, sci-fi, science fiction, seahawks, Seattle, secret message, secret message word search, secret message word seek, simulator, Star Trek, Star Trek: The Next Generation, starship bridge simulator, vampire: the masquerade, vogon, vogon poetry, waterdeep', Word search, Word Seek, Wordplay, Writing | Leave a reply Our Annual TableTop Tournament Starts Next Week! With International TableTop Day fast approaching, we are once again teaming up with our pals at Penny Dell Puzzles to put together an in-house TableTop Tournament to celebrate the upcoming holiday (Saturday, April 27). It's a 12-person two-week tournament with different games to play every week, and round 1 kicks off next Tuesday. (This is actually the fourth year of the tournament, with all three previous champions competing again this year.) One of the things I like about the layout of the tournament is that there are no one-on-one match-ups until the final. Instead of a single-elimination tournament, competitors are slotted into groups of three. Each group of three will play two games, and the two winners (one from each game) from each trio and move on to the next round. So to survive round 1, I'll need to win either Timeline or On the Dot. Timeline is a card game where every card depicts a different moment in history, and the players are trying to place cards from their hand into a historically correct timeline. Players take turns adding cards to the timeline, placing them before or after previously played cards. You don't have to know the exact year the event on a given card took place; you simply have to figure out when it happened in relation to the other events that have already been played. You play your card, and then flip it over to reveal the actual year the event occurred. If you're correct, the card stays, and you have one fewer card in your hand. If you're wrong, the card is removed from the timeline and you draw a new card. The first player to place every card in their hand wins. On the Dot is a pattern-matching game. Each player has four clear cards with randomly placed colored dots on them, and it's up to the player to arrange all four cards so that the colored dots showing match a given pattern. The first player to match three patterns moves on to the next round. Timeline can be a bit of a crapshoot, depending on your knowledge of a given subject and whatever cards you draw. I suspect I'll have a better chance of making the second round with On the Dot; I'm fairly quick with pattern recognition and manipulation, and actually won three games in a row last year to secure my spot in the next round. Hopefully I can repeat the same feat this year. But you never know. With new competitors and returning champions in the tournament this year, there are sure to be some diabolical surprises. Here's hoping when it's all said and done, I'll be wearing the Game Geek crown and holding the scepter high… Posted in Games, PuzzleNation, Puzzles | Tagged About Us, Announcements,
0.608566
0.38022
0.43534
-1.025205
[ 0.4140724810181113, 0.8030603028537592 ]
[ -0.04326389980031995, 0.803703419159177 ]
[ -0.3458219663589031, 1.2165025052778067 ]
[ -1.7074142764228322, -0.34299557072419434 ]
1,024
[ 512, 512 ]
[ 21116, 315, 27389, 3391, 7984, 287, 701, 777, 12355, 873, 15354, 23199, 1078, 363, 278, 10769, 29892, 607, 471, 263, 12528, 28920, 29889, 3374, 366, 21116, 14366, 13, 20761, 4100, 368, 29892, 15020, 278, 298, 293, 4979, 567, 18169, 2645, 1716, 4959, 29892, 14332, 750, 2090, 1550, 8743, 313, 29872, 2121, 22049, 3448, 411, 263, 2319, 8828, 561, 262, 470, 263, 12289, 467, 13, 1576, 4152, 15687, 471, 263, 1999, 579, 313, 273, 27096, 292, 697, 29892, 541, 263, 1999, 579, 1661, 621, 6393, 511, 322, 306, 10712, 6907, 1098, 2548, 4186, 29893, 267, 535, 2446, 1629, 304, 738, 24909, 310, 23026, 29892, 4560, 29899, 7241, 29892, 13568, 8995, 29892, 5007, 664, 845, 3554, 29892, 8090, 29892, 6297, 1456, 292, 29892, 322, 310, 3236, 29892, 20285, 793, 29889, 13, 6747, 287, 297, 12482, 29892, 349, 18813, 280, 29940, 362, 29892, 349, 18813, 793, 12, 29989, 10522, 3192, 29871, 29946, 29906, 29892, 564, 1356, 275, 29892, 564, 1356, 275, 5810, 3527, 12945, 1027, 9183, 29892, 12590, 3748, 29892, 5032, 262, 734, 29440, 29892, 5881, 3748, 29892, 15687, 29892, 11201, 561, 262, 29892, 11566, 479, 787, 669, 12225, 787, 29892, 11566, 479, 787, 322, 12225, 787, 29892, 3423, 5738, 5716, 29892, 13568, 8995, 29892, 8090, 29892, 1879, 1416, 292, 4451, 29892, 379, 2335, 29882, 5603, 29915, 29879, 16886, 304, 278, 5208, 26825, 29892, 23026, 29892, 365, 1718, 29925, 29892, 5735, 3158, 6297, 1456, 292, 29892, 3643, 29893, 267, 535, 29892, 3643, 29893, 267, 535, 29871, 29946, 29906, 29892, 22906, 928, 6641, 5933, 29892, 10802, 2886, 261, 29892, 6977, 9257, 29892, 349, 18813, 280, 29940, 362, 29892, 349, 18813, 1915, 29915, 17928, 29892, 6297, 1456, 292, 29892, 6297, 1456, 292, 8090, 29892, 885, 3496, 914, 298, 1657, 29892, 4560, 29899, 7241, 29892, 10466, 24159, 29892, 409, 801, 1450, 2039, 29892, 27689, 29892, 7035, 2643, 29892, 7035, 2643, 1734, 2740, 29892, 7035, 2643, 1734, 16508, 29892, 1027, 9183, 29892, 7828, 6479, 29895, 29892, 7828, 6479, 29895, 29901, 450, 8084, 28203, 29892, 5810, 3527, 12945, 1027, 9183, 29892, 325, 1160, 533, 29901, 278, 5516, 339, 15019, 29892, 325, 468, 265, 29892, 325, 468, 265, 22309, 29892, 4094, 24535, 742, 10803, 2740, 29892, 10803, 922, 1416, 29892, 10803, 1456, 29892, 28676, 12, 29989, 951, 1351, 263, 8908, 13, 29949, 332, 8081, 950, 6137, 7031, 29427, 624, 5708, 8084, 15511, 29991, 13, 3047, 4623, 6137, 7031, 8373, 5172, 28702, 29892, 591, 526, 2748, 1449, 3815, 292, 701, 411, 1749, 282, 1338, 472, 7363, 1460, 360, 514, 349, 18813, 793, 304, 1925, 4208, 385, 297, 29899, 8697, 6137, 7031, 29427, 304, 10894, 403, 278, 701, 11506, 8753, 22394, 313, 29903, 20510, 29892, 3786, 29871, 29906, 29955, 467, 13, 3112, 29915, 29879, 263, 29871, 29896, 29906, 29899, 10532, 1023, 29899, 18448, 14743, 411, 1422, 8090, 304, 1708, 1432, 4723, 29892, 322, 4513, 29871, 29896, 413, 7358, 1283, 2446, 323, 1041, 3250, 29889, 313, 4013, 338, 2869, 278, 11582, 1629, 310, 278, 14743, 29892, 411, 599, 2211, 3517, 29314, 5100, 292, 1449, 445, 1629, 1846, 13, 6716, 310, 278, 2712, 306, 763, 1048, 278, 5912, 310, 278, 14743, 338, 393, 727, 526, 694, 697, 29899, 265, 29899, 650, 1993, 29899, 14340, 2745, 278, 2186, 29889, 8669, 310, 263, 2323, 29899, 295, 326, 3381, 14743, 29892, 5100, 17259, 526, 2243, 15048, 964, 6471, 310, 2211, 29889, 7806, 2318, 310, 2211, 674, 1708, 1023, 8090, 29892, 322, 278, 1023, 281, 16697, 313, 650, 515, 1269, 3748, 29897, 515, 1269, 3367, 29877, 322, 4337, 373, 304, 278, 2446, 4513, 29889, 13, 6295, 304, 10503, 573, 4513, 29871, 29896, 29892, 306, 29915, 645, 817, 304, 5401, 2845, 7870, 5570, 470, 1551, 278, 360, 327, 29889, 13, 13711, 5570, 338, 263, 5881, 3748, 988, 1432, 5881, 1401, 919, 29879, 263, 1422, 3256, 297, 4955, 29892, 322, 278, 10769, 526, 1811, 304, 2058, 15889, 515, 1009, 1361, 964, 263, 3603, 1711, 1959, 5335, 5570, 29889, 7412, 414, 2125, 12169, 4417, 15889, 304, 278, 5335, 5570, 29892, 24421, 963, 1434, 470, 1156, 9251, 5318, 15889, 29889, 887, 1016, 29915, 29873, 505, 304, 1073, 278, 2684, 1629, 278, 1741, 373, 263, 2183, 5881, 3614, 2058, 29936, 366, 3763, 505, 304, 4377, 714, 746, 372, 9559, 297, 8220, 304, 278, 916, 4959, 393, 505, 2307, 1063, 5318, 29889, 13, 3492, 1708, 596, 5881, 29892, 322, 769, 285, 3466, 372, 975, 304, 10320, 284, 278, 3935, 1629, 278, 1741, 10761, 29889, 960, 366, 29915, 276, 1959, 29892, 278, 5881, 27111, 29892, 322, 366, 505, 697, 28145, 5881, 297, 596, 1361, 29889, 960, 366, 29915, 276, 2743, 29892, 278, 5881, 338, 6206, 515, 278, 5335, 5570, 322, 366, 4216, 263, 716, 5881, 29889, 450, 937, 4847, 304, 2058, 1432, 5881, 297, 1009, 1361, 21614, 29889, 13, 2951, 278, 360, 327, 338, 263, 4766, 29899, 4352, 292, 3748, 29889, 7806, 4847, 756, 3023, 2821, 15889, 411, 20459, 7180, 28684, 270, 1862, 373, 963, 29892, 322, 372, 29915, 29879, 701, 304, 278, 4847, 304, 564, 3881, 599, 3023, 15889, 577, 393, 278, 28684, 270, 1862, 6445, 1993, 263, 2183, 4766, 29889, 450, 937, 4847, 304, 1993, 2211, 15038, 16229, 373, 304, 278, 2446, 4513, 29889, 13, 13711, 5570, 508, 367, 263, 2586, 310, 263, 12220, 567, 1251, 327, 29892, 8679, 373, 596, 7134, 310, 263, 2183, 4967, 322, 6514, 15889, 366, 4216, 29889, 306, 12326, 306, 29915, 645, 505, 263, 2253, 8825, 310, 3907, 278, 1473, 4513, 411, 1551, 278, 360, 327, 29936, 306, 29915, 29885, 12558, 4996, 411, 4766, 19679, 322, 11525, 2785, 29892, 322, 2869, 2113, 2211, 8090, 297, 263, 1948, 1833, 1629, 304, 11592, 590, 9758, 297, 278, 2446, 4513, 29889, 7963, 3730, 306, 508, 12312, 278, 1021, 1238, 271, 445, 1629, 29889, 13, 6246, 366, 2360, 1073, 29889, 2973, 716, 5100, 17259, 322, 7863, 29314, 297, 278, 14743, 445, 1629, 29892, 727, 526, 1854, 304, 367, 777, 652, 19388, 936, 11468, 4637, 29889, 13, 10605, 29915, 29879, 17231, 746, 372, 29915, 29879, 599, 1497, 322, 2309, 29892, 306, 29915, 645, 367, 591, 4362, 278, 8448, 1879, 1416, 20844, 322, 13587, 278, 269, 13300, 357, 1880, 30098, 13, 6747, 287, 297, 12482, 29892, 349, 18813, 280, 29940, 362, 29892, 349, 18813, 793, 12, 29989, 10522, 3192, 13611, 10783, 29892, 8081, 1309, 29883, 4110, 29892 ]
1,333,633
6,144
CommonCrawl
5
7
Houston nutritionist introduces new, locally sourced meal delivery business Sarah Hobson The Bayou City has its own Blue Apron-style startup with locally sourced produce. Courtesy of The Blonde Pantry Marla Murphy, a local entrepreneur and nutritionist, has helped Houstonians make healthy decisions with her food blog and consulting company for years, but she wasn't sure she was doing enough. "I didn't feel like I was making as big of an impact as I could have," Murphy says. Murphy took this feeling and ran with it. She decided to relaunch her company, The Blonde Pantry, in March of last year she says to create the only local meal delivery service for the greater Houston area. "This is a passion project to me," she says. Growing a health foods company While The Blonde Pantry has had meal services for a few years, Murphy says that last spring the company relaunched with a new brand and expanded product offerings. "We are a healthy meal delivery service that offers clients vacuum sealed that meals that are prepped, weighted, marinated, and chopped," says Murphy. The Blonde Pantry gained momentum initially from Murphy's local connections. "I had only $3,000 in my bank account," says Murphy. "The right people came into my life at the right time." Murphy says she was able to trade meals and barter down prices for her website, photography, and marketing to launch her company. She rented a kitchen by the hour and had little wiggle room for her profits. She credits part of the company's success to their popular Instagram page and her involvement in the Houston community. "You can really tell we love what we do," Murphy says. "We are deep rooted in this community. I was born and raised here. My family lives here. We are growing our family here." Murphy writes on the company's website notes that her mission is "to bring nutritious meals to busy Houston foodies who love tasty food as much as I do, but also want to be mindful of living a wholesome lifestyle." The meal kits are ready in 10 minutes or less, Murphy says, and customers order by Thursday evenings and can either opt to have their meals delivered to their doorstep or pick up their package at The Village Gym, located off the Katy Freeway. "We deliver everywhere within Highway 99," says Murphy, including Friendswood, Clear Lake, Dickinson, and League City." Meals on The Blonde Pantry website include shrimp, chicken, pork, and beef skillet dishes paired with cauliflower, carrots, squash, and other fresh vegetables; fully cooked casseroles; pre-packaged salads, soups, and smoothies; hummus; breakfast muffins; and a variety of desserts including black bean brownies and flourless chocolate almond cookies. "Our average is meal is about $10.25 a serving," says Murphy. "We try to make it something everyone can afford, whether you're a young college girl or a 60 year-old-couple." Murphy tells InnovationMap that her team kicks into gear first thing Friday morning once all the orders are placed, then they prepare and prep on Saturday and Sunday for a Monday delivery. "We like to source as locally as possible," says Murphy when describing her vendors. The Blonde Pantry has two full time employees, and seven part-time kitchen workers, and three contract workers for delivery. In addition to The Blonde Pantry meal service, their website notes offerings in nutrition consulting for corporations, groups, and individuals. "It's not about selling meals and moving on, I want this to be a lifestyle company that is really founded and has deep roots in Houston," says Murphy. Murphy tells InnovationMap that in the next year she hopes to expand into the retail space and find a bigger commercial kitchen to function as their own. She also hopes to partner with companies outside of food and continue to nourish lives in someway. lifestyle houston startups the blonde pantry marla murphy meal kit Jan 3, 2020, 8:15 am Here's what Houston innovation news tr
0.671571
-0.024238
0.364326
-1.214455
[ 0.8468899165817195, 0.4962530067580369 ]
[ -0.14309144320833678, 0.09461450096052838 ]
[ 0.6433120335409619, 0.08533900795642267 ]
[ -1.127308706602439, -1.3016005145753822 ]
1,024
[ 512, 512 ]
[ 24327, 18254, 29878, 654, 391, 4547, 778, 716, 29892, 12430, 269, 473, 1133, 592, 284, 28289, 5381, 13, 29903, 279, 801, 25302, 1100, 13, 1576, 6211, 283, 4412, 756, 967, 1914, 10924, 319, 558, 265, 29899, 3293, 20234, 411, 12430, 269, 473, 1133, 7738, 29889, 6325, 2167, 29891, 310, 450, 3164, 13469, 349, 15328, 13, 7083, 433, 7487, 11461, 29892, 263, 1887, 23440, 1600, 332, 322, 18254, 29878, 654, 391, 29892, 756, 9213, 379, 18291, 5271, 550, 1207, 9045, 29891, 1602, 12112, 411, 902, 9687, 12618, 322, 8799, 292, 5001, 363, 2440, 29892, 541, 1183, 9007, 29915, 29873, 1854, 1183, 471, 2599, 3307, 29889, 13, 29908, 29902, 3282, 29915, 29873, 4459, 763, 306, 471, 3907, 408, 4802, 310, 385, 10879, 408, 306, 1033, 505, 1699, 7487, 11461, 4083, 29889, 13, 29924, 332, 11461, 3614, 445, 11223, 322, 6350, 411, 372, 29889, 2296, 8459, 304, 10208, 3322, 902, 5001, 29892, 450, 3164, 13469, 349, 15328, 29892, 297, 4779, 310, 1833, 1629, 1183, 4083, 304, 1653, 278, 871, 1887, 592, 284, 28289, 2669, 363, 278, 7621, 24327, 4038, 29889, 13, 29908, 4013, 338, 263, 15935, 2060, 304, 592, 1699, 1183, 4083, 29889, 13, 29954, 798, 292, 263, 9045, 9687, 29879, 5001, 13, 8809, 488, 450, 3164, 13469, 349, 15328, 756, 750, 592, 284, 5786, 363, 263, 2846, 2440, 29892, 7487, 11461, 4083, 393, 1833, 6709, 278, 5001, 10208, 3322, 287, 411, 263, 716, 14982, 322, 17832, 3234, 5957, 886, 29889, 13, 29908, 4806, 526, 263, 9045, 29891, 592, 284, 28289, 2669, 393, 16688, 13154, 11757, 29884, 398, 409, 7943, 393, 592, 1338, 393, 526, 758, 2986, 29892, 7688, 287, 29892, 1766, 262, 630, 29892, 322, 3060, 2986, 1699, 4083, 7487, 11461, 29889, 13, 1576, 3164, 13469, 349, 15328, 17515, 19399, 12919, 515, 7487, 11461, 29915, 29879, 1887, 12368, 29889, 13, 29908, 29902, 750, 871, 395, 29941, 29892, 29900, 29900, 29900, 297, 590, 9124, 3633, 1699, 4083, 7487, 11461, 29889, 376, 1576, 1492, 2305, 2996, 964, 590, 2834, 472, 278, 1492, 931, 1213, 13, 29924, 332, 11461, 4083, 1183, 471, 2221, 304, 11302, 592, 1338, 322, 2594, 357, 1623, 26094, 363, 902, 4700, 29892, 6731, 5275, 29892, 322, 9999, 292, 304, 6826, 902, 5001, 29889, 2296, 364, 14927, 263, 29181, 491, 278, 7234, 322, 750, 2217, 281, 335, 6234, 5716, 363, 902, 2600, 1169, 29889, 2296, 6625, 1169, 760, 310, 278, 5001, 29915, 29879, 2551, 304, 1009, 5972, 2799, 14442, 1813, 322, 902, 5297, 29841, 297, 278, 24327, 7881, 29889, 13, 29908, 3492, 508, 2289, 2649, 591, 5360, 825, 591, 437, 1699, 7487, 11461, 4083, 29889, 376, 4806, 526, 6483, 3876, 287, 297, 445, 7881, 29889, 306, 471, 6345, 322, 10425, 1244, 29889, 1619, 3942, 12080, 1244, 29889, 1334, 526, 15678, 1749, 3942, 1244, 1213, 13, 29924, 332, 11461, 15873, 373, 278, 5001, 29915, 29879, 4700, 11486, 393, 902, 10655, 338, 376, 517, 6963, 18254, 768, 2738, 592, 1338, 304, 19587, 24327, 9687, 583, 1058, 5360, 260, 579, 29891, 9687, 408, 1568, 408, 306, 437, 29892, 541, 884, 864, 304, 367, 3458, 1319, 310, 8471, 263, 377, 6544, 608, 301, 7004, 1508, 1213, 13, 1576, 592, 284, 413, 1169, 526, 7960, 297, 29871, 29896, 29900, 6233, 470, 3109, 29892, 7487, 11461, 4083, 29892, 322, 20330, 1797, 491, 498, 1295, 3250, 1584, 886, 322, 508, 2845, 3523, 304, 505, 1009, 592, 1338, 20115, 304, 1009, 3050, 10568, 470, 5839, 701, 1009, 3577, 472, 450, 24720, 402, 962, 29892, 5982, 1283, 278, 476, 11156, 3878, 809, 388, 29889, 13, 29908, 4806, 12021, 16978, 2629, 22080, 29871, 29929, 29929, 1699, 4083, 7487, 11461, 29892, 3704, 11169, 1975, 6115, 29892, 17732, 9459, 29892, 12488, 26803, 29892, 322, 5165, 4412, 1213, 13, 6816, 1338, 373, 450, 3164, 13469, 349, 15328, 4700, 3160, 528, 5632, 29886, 29892, 521, 21475, 29892, 282, 548, 29892, 322, 367, 1389, 2071, 7324, 270, 17006, 3300, 2859, 411, 5777, 352, 361, 13609, 29892, 1559, 307, 1372, 29892, 10674, 1161, 29892, 322, 916, 10849, 18655, 1849, 29936, 8072, 7984, 287, 274, 9498, 6544, 29936, 758, 29899, 4058, 4063, 4497, 7925, 29892, 3669, 567, 29892, 322, 10597, 583, 29936, 3165, 8366, 29936, 26044, 286, 3096, 1144, 29936, 322, 263, 12875, 310, 6808, 814, 29879, 3704, 4628, 17796, 17354, 583, 322, 1652, 473, 2222, 521, 542, 23167, 394, 8315, 21046, 29889, 13, 29908, 29949, 332, 6588, 338, 592, 284, 338, 1048, 395, 29896, 29900, 29889, 29906, 29945, 263, 16330, 1699, 4083, 7487, 11461, 29889, 376, 4806, 1018, 304, 1207, 372, 1554, 14332, 508, 21750, 29892, 3692, 366, 29915, 276, 263, 4123, 12755, 7826, 470, 263, 29871, 29953, 29900, 1629, 29899, 1025, 29899, 16589, 552, 1213, 13, 29924, 332, 11461, 10603, 512, 13715, 362, 3388, 393, 902, 3815, 413, 7358, 964, 330, 799, 937, 2655, 28728, 7250, 2748, 599, 278, 11299, 526, 7180, 29892, 769, 896, 19012, 322, 8273, 373, 24211, 322, 16340, 363, 263, 27822, 28289, 29889, 13, 29908, 4806, 763, 304, 2752, 408, 12430, 408, 1950, 1699, 4083, 7487, 11461, 746, 20766, 902, 9691, 943, 29889, 450, 3164, 13469, 349, 15328, 756, 1023, 2989, 931, 22873, 29892, 322, 9881, 760, 29899, 2230, 29181, 17162, 29892, 322, 2211, 8078, 17162, 363, 28289, 29889, 13, 797, 6124, 304, 450, 3164, 13469, 349, 15328, 592, 284, 2669, 29892, 1009, 4700, 11486, 5957, 886, 297, 18254, 29878, 654, 8799, 292, 363, 17266, 800, 29892, 6471, 29892, 322, 15724, 29889, 13, 29908, 3112, 29915, 29879, 451, 1048, 269, 7807, 592, 1338, 322, 8401, 373, 29892, 306, 864, 445, 304, 367, 263, 301, 7004, 1508, 5001, 393, 338, 2289, 11091, 322, 756, 6483, 16778, 297, 24327, 1699, 4083, 7487, 11461, 29889, 13, 29924, 332, 11461, 10603, 512, 13715, 362, 3388, 393, 297, 278, 2446, 1629, 1183, 26926, 304, 7985, 964, 278, 3240, 737, 2913, 322, 1284, 263, 16600, 12128, 29181, 304, 740, 408, 1009, 1914, 29889, 2296, 884, 26926, 304, 18096, 411, 14582, 5377, 310, 9687, 322, 6773, 304, 302, 473, 728, 12080, 297, 777, 1582, 29889, 13, 29880, 7004, 1508, 298, 283, 7352, 1369, 14340, 278, 1999, 13469, 282, 15328, 1766, 433, 7167, 11461, 592, 284, 413, 277, 13, 26626, 29871, 29941, 29892, 29871, 29906, 29900, 29906, 29900, 29892, 29871, 29947, 29901, 29896, 29945, 626, 13, 10605, 29915, 29879, 825, 24327, 24233, 362, 9763, 534 ]
1,333,638
0
CommonCrawl
15
4
ended — from workforce trends in Houston to top articles in 2019. Photo by PeopleImages Editor's note: In the first trending news roundup for InnovationMap in 2020, top stories include end-of-the-year roundups, experts talking about the future of the workforce in Houston, fundraising in Texas, and more. Overheard: Experts weigh in on the future of the workforce in Houston From the rise of freelancers to Houston's data-driven future, here's what the Bayou City can expect to see when it comes to the future of the workforce. Pexels As the new decade approaches, there are a lot of questions about the future of the workforce in Houston. Will automation revolutionize jobs? Is technology evolving too quickly for training and education to keep up? And, can corporations adapt their work environments to account for the rise in freelancers? At the launch of Houston's new General Assembly location, a panel of Houstonians moderated by Joey Sanchez of Houston Exponential addressed these questions and more earlier this month. The global digital skill development organization will launch a three-month software engineering program in January along with workshops and introductory courses before rolling out other part- and full-time courses in 2020. Continue reading. Top 5 Houston innovation lifestyle stories for 2019 From a new, innovative mixed use development to food and fitness startups, here's what lifestyle innovation trended in Houston this year. Courtesy of The MKT Innovation surrounds us, from the B2B startups designing software solutions for huge oil and gas corporations to a fitness app that allows users to safely and efficiently book private trainers. During 2019, InnovationMap published stories on these startups, burgeoning mixed-use spaces, innovative sustainable stores, and more. Here's which of those stories readers flocked to. Continue reading. Here's what you need to know if you're raising a seed round in Texas From friends and family rounds to how to navigate a seed round, here's what you need to know about raising money in Texas. Getty Images In the vast majority of startups we've worked with across Texas, their "seed round" is not the first money in the door. That money is often called a "Friends & Family Round" and it's usually from people so close to the entrepreneurs that they are willing to take a gamble before there is really even much "there" to invest in. It also might include bootstrap funds put in by the entrepreneurs themselves. After an F&F Round, Texas startups will pursue a "seed round," which generally includes some angel investors in the local and broader ecosystem. A problem we occasionally run into is that Texas entrepreneurs, including those in Houston, will get bad advice on what the right structures are for this kind of deal; either because they are reading a blog post from Silicon Valley (where things work VERY differently) or they're talking to someone marketing themselves as an "adviser" when their advice doesn't have much substantive deal experience backing it. Continue reading. 5 Houston innovators to know in 2020 From M&A action to the development of Houston's innovation corridor, these are five Houston innovators to keep an eye on in 2020. Courtesy photos For so many Houston innovators, 2020 will be a year of growth, execution, proof of concept, piloting, pivoting, fundraising, and more. It's hard to narrow down the list of movers and shakers in Houston innovation, but a few have stood out for making waves in the new year. From M&A action to the development of Houston's innovation corridor, these are five Houston innovators to keep an eye on in 2020. Continue reading. Editor's Picks: Top 10 Houston startup feature stories of 2019 Human-tissue printing technology, blockchain networks, health care solutions, game-changing software — all this innovation and more is coming out of Houston startups. Courtesy photos Thousands of startups call Houston home. According to the Greater Houston Partnership's data, the Houston area added 11,700 firms between 2013 to 2018. And, if you consider Crunchbase's t
0.456532
0.30949
0.554544
-0.700034
[ 0.3401100078521782, 0.5729548307819675 ]
[ 0.14117084407458105, 0.47780901736080816 ]
[ 0.46577516176406303, 0.6433120335409619 ]
[ -0.9998415634580476, -0.4002257166257578 ]
1,024
[ 512, 512 ]
[ 2760, 813, 515, 664, 10118, 534, 1975, 297, 24327, 304, 2246, 7456, 297, 29871, 29906, 29900, 29896, 29929, 29889, 1963, 3747, 491, 11647, 20163, 13, 15280, 29915, 29879, 4443, 29901, 512, 278, 937, 534, 2548, 9763, 4513, 786, 363, 512, 13715, 362, 3388, 297, 29871, 29906, 29900, 29906, 29900, 29892, 2246, 15874, 3160, 1095, 29899, 974, 29899, 1552, 29899, 6360, 4513, 14340, 29892, 2902, 1372, 9963, 1048, 278, 5434, 310, 278, 664, 10118, 297, 24327, 29892, 5220, 336, 5921, 297, 10319, 29892, 322, 901, 29889, 13, 3563, 354, 538, 29901, 28224, 1372, 591, 1141, 297, 373, 278, 5434, 310, 278, 664, 10118, 297, 24327, 13, 4591, 278, 14451, 310, 3005, 295, 4564, 414, 304, 24327, 29915, 29879, 848, 29899, 24477, 854, 5434, 29892, 1244, 29915, 29879, 825, 278, 6211, 283, 4412, 508, 2149, 304, 1074, 746, 372, 5304, 304, 278, 5434, 310, 278, 664, 10118, 29889, 349, 735, 1379, 13, 2887, 278, 716, 316, 6332, 13501, 29892, 727, 526, 263, 3287, 310, 5155, 1048, 278, 5434, 310, 278, 664, 10118, 297, 24327, 29889, 2811, 3345, 362, 19479, 675, 17643, 29973, 1317, 15483, 15220, 1747, 2086, 9098, 363, 6694, 322, 9793, 304, 3013, 701, 29973, 1126, 29892, 508, 17266, 800, 7744, 1009, 664, 23136, 304, 3633, 363, 278, 14451, 297, 3005, 295, 4564, 414, 29973, 13, 4178, 278, 6826, 310, 24327, 29915, 29879, 716, 4593, 13266, 4423, 29892, 263, 9451, 310, 379, 18291, 5271, 550, 17768, 630, 491, 3650, 1032, 3087, 22067, 310, 24327, 1222, 1112, 2556, 20976, 1438, 5155, 322, 901, 8859, 445, 4098, 29889, 450, 5534, 13436, 19911, 5849, 13013, 674, 6826, 263, 2211, 29899, 10874, 7047, 21639, 1824, 297, 5490, 3412, 411, 664, 845, 3554, 322, 22909, 2199, 706, 21888, 1434, 27777, 714, 916, 760, 29899, 322, 2989, 29899, 2230, 21888, 297, 29871, 29906, 29900, 29906, 29900, 29889, 2866, 14150, 5183, 29889, 13, 7031, 29871, 29945, 24327, 24233, 362, 301, 7004, 1508, 15874, 363, 29871, 29906, 29900, 29896, 29929, 13, 4591, 263, 716, 29892, 24233, 1230, 12849, 671, 5849, 304, 9687, 322, 6216, 2264, 1369, 14340, 29892, 1244, 29915, 29879, 825, 301, 7004, 1508, 24233, 362, 534, 2760, 297, 24327, 445, 1629, 29889, 6325, 2167, 29891, 310, 450, 341, 29968, 29911, 13, 797, 13715, 362, 8388, 3885, 502, 29892, 515, 278, 350, 29906, 29933, 1369, 14340, 2874, 292, 7047, 6851, 363, 12176, 17182, 322, 10489, 17266, 800, 304, 263, 6216, 2264, 623, 393, 6511, 4160, 304, 23511, 322, 29497, 3143, 2024, 7945, 414, 29889, 13, 29928, 3864, 29871, 29906, 29900, 29896, 29929, 29892, 512, 13715, 362, 3388, 6369, 15874, 373, 1438, 1369, 14340, 29892, 6866, 25339, 292, 12849, 29899, 1509, 8162, 29892, 24233, 1230, 15075, 475, 519, 14422, 29892, 322, 901, 29889, 2266, 29915, 29879, 607, 310, 1906, 15874, 22176, 285, 29113, 304, 29889, 2866, 14150, 5183, 29889, 13, 10605, 29915, 29879, 825, 366, 817, 304, 1073, 565, 366, 29915, 276, 29263, 263, 16717, 4513, 297, 10319, 13, 4591, 7875, 322, 3942, 364, 3885, 304, 920, 304, 23624, 263, 16717, 4513, 29892, 1244, 29915, 29879, 825, 366, 817, 304, 1073, 1048, 29263, 6909, 297, 10319, 29889, 3617, 1017, 1954, 1179, 13, 797, 278, 13426, 13638, 310, 1369, 14340, 591, 29915, 345, 3796, 411, 4822, 10319, 29892, 1009, 376, 26776, 4513, 29908, 338, 451, 278, 937, 6909, 297, 278, 3050, 29889, 2193, 6909, 338, 4049, 2000, 263, 376, 27034, 1975, 669, 14662, 21595, 29908, 322, 372, 29915, 29879, 5491, 515, 2305, 577, 3802, 304, 278, 23440, 1600, 1295, 393, 896, 526, 17762, 304, 2125, 263, 24988, 569, 1434, 727, 338, 2289, 1584, 1568, 376, 12711, 29908, 304, 13258, 297, 29889, 739, 884, 1795, 3160, 16087, 29199, 1925, 297, 491, 278, 23440, 1600, 1295, 6053, 29889, 13, 13555, 385, 383, 29987, 29943, 21595, 29892, 10319, 1369, 14340, 674, 12359, 434, 263, 376, 26776, 4513, 1699, 607, 6892, 7805, 777, 2614, 295, 13258, 943, 297, 278, 1887, 322, 2545, 1664, 321, 3944, 973, 29889, 319, 1108, 591, 23025, 1065, 964, 338, 393, 10319, 23440, 1600, 1295, 29892, 3704, 1906, 297, 24327, 29892, 674, 679, 4319, 9848, 373, 825, 278, 1492, 12286, 526, 363, 445, 2924, 310, 5376, 29936, 2845, 1363, 896, 526, 5183, 263, 12618, 1400, 515, 5664, 4144, 13939, 313, 3062, 2712, 664, 478, 24422, 17587, 29897, 470, 896, 29915, 276, 9963, 304, 4856, 9999, 292, 6053, 408, 385, 376, 328, 1730, 261, 29908, 746, 1009, 9848, 1838, 29915, 29873, 505, 1568, 20446, 573, 5376, 7271, 27436, 372, 29889, 2866, 14150, 5183, 29889, 13, 29945, 24327, 24233, 4097, 304, 1073, 297, 29871, 29906, 29900, 29906, 29900, 13, 4591, 341, 29987, 29909, 3158, 304, 278, 5849, 310, 24327, 29915, 29879, 24233, 362, 1034, 2429, 272, 29892, 1438, 526, 5320, 24327, 24233, 4097, 304, 3013, 385, 10977, 373, 297, 29871, 29906, 29900, 29906, 29900, 29889, 6325, 2167, 29891, 20612, 13, 2831, 577, 1784, 24327, 24233, 4097, 29892, 29871, 29906, 29900, 29906, 29900, 674, 367, 263, 1629, 310, 14321, 29892, 8225, 29892, 5296, 310, 6964, 29892, 8230, 11427, 29892, 24438, 292, 29892, 5220, 336, 5921, 29892, 322, 901, 29889, 13, 3112, 29915, 29879, 2898, 304, 12474, 1623, 278, 1051, 310, 2730, 874, 322, 528, 21079, 297, 24327, 24233, 362, 29892, 541, 263, 2846, 505, 8389, 714, 363, 3907, 20037, 297, 278, 716, 1629, 29889, 3645, 341, 29987, 29909, 3158, 304, 278, 5849, 310, 24327, 29915, 29879, 24233, 362, 1034, 2429, 272, 29892, 1438, 526, 5320, 24327, 24233, 4097, 304, 3013, 385, 10977, 373, 297, 29871, 29906, 29900, 29906, 29900, 29889, 2866, 14150, 5183, 29889, 13, 15280, 29915, 29879, 349, 7358, 29901, 7488, 29871, 29896, 29900, 24327, 20234, 4682, 15874, 310, 29871, 29906, 29900, 29896, 29929, 13, 29950, 7889, 29899, 29873, 15118, 14010, 15483, 29892, 2908, 14153, 14379, 29892, 9045, 2562, 6851, 29892, 3748, 29899, 305, 9776, 7047, 813, 599, 445, 24233, 362, 322, 901, 338, 6421, 714, 310, 24327, 1369, 14340, 29889, 6325, 2167, 29891, 20612, 13, 1349, 681, 4167, 310, 1369, 14340, 1246, 24327, 3271, 29889, 7579, 304, 278, 4122, 1008, 24327, 3455, 8397, 4034, 29915, 29879, 848, 29892, 278, 24327, 4038, 2715, 29871, 29896, 29896, 29892, 29955, 29900, 29900, 13734, 1516, 1546, 29871, 29906, 29900, 29896, 29941, 304, 29871, 29906, 29900, 29896, 29947, 29889, 1126, 29892, 565, 366, 2050, 6781, 3322, 3188, 29915, 29879, 260 ]
1,333,638
1,024
CommonCrawl
15
4
Find sources: "Alexandre Cabanel" – news · newspapers · books · scholar · JSTOR (May 2013) (Learn how and when to remove this template message) Alexandre Cabanel (French: [kabanɛl]; 28 September 1823, Montpellier – 23 January 1889) was a French painter. He painted historical, classical and religious subjects in the academic style. He was also well known as a portrait painter. According to Diccionario Enciclopedico Salvat, Cabanel is the best representative of the L'art pompier and Napoleon III's preferred painter.[1] Self-portrait (1852) (1823-09-28)28 September 1823 23 January 1889(1889-01-23) (aged 65) François-Édouard Picot Notable work Birth of Venus Academicism Prix de Rome LifeEdit Cabanel entered the École des Beaux-Arts in Paris at the age of seventeen, and studied with François-Édouard Picot. He exhibited at the Paris Salon for the first time in 1844, and won the Prix de Rome scholarship in 1845 at the age of 22.[2] Cabanel was elected a member of the Institute in 1863. He was appointed professor at the École des Beaux-Arts in 1864 and taught there until his death.[3] He was closely connected to the Paris Salon: "He was elected regularly to the Salon jury and his pupils could be counted by the hundred at the Salons. Through them, Cabanel did more than any other artist of his generation to form the character of belle époque French painting".[4] His refusal together with William-Adolphe Bouguereau to allow the impressionist painter Édouard Manet and many other painters to exhibit their work in the Salon of 1863 led to the establishment of the Salon des Refusés by the French government. Cabanel won the Grande Médaille d'Honneur at the Salons of 1865, 1867, and 1878. A successful academic painter, his 1863 painting The Birth of Venus is one of the best known examples of 19th-century academic painting. The picture was bought by the emperor Napoleon III; there is also a smaller replica (painted in 1875 for a banker, John Wolf) at the Metropolitan Museum of Art in New York City. It was given to them by Wolf in 1893. PupilsEdit Alexandre Cabanel, ca.1865. Photograph by Charles Reutlinger (?) The Birth of Venus (1863) His pupils included: Rodolfo Amoedo Joseph Aubert Henry Bacon George Randolph Barse Alexandre Jean-Baptiste Brun Jean-Eugène Buland Jean-Joseph Benjamin-Constant Vlaho Bukovac Louis Capdevielle Fernand Cormon Pierre Auguste Cot Kenyon Cox Édouard Debat-Ponsan Émile Friant François Guiguet Jules Bastien-Lepage François Flameng Charles Fouqueray Frank Fowler Henri Gervex Charles Lucien Léandre Max Leenhardt Édouard-Antoine Marsal [fr] João Marques de Oliveira Jan Monchablon Georges Moreau de Tours Henri-Georges Morisset [fr] Henri Pinta Henri Regnault Iakovos Rizos Louis Royer Jean-Jacques Scherrer António Silva Porto Joseph-Noël Sylvestre Solomon Joseph Solomon Paul Tavernier [fr] José Ferraz de Almeida Júnior Étienne Terrus Adolphe Willette Selected worksEdit Fallen Angel (Alexandre Cabanel) Alexandre Cabanel - Death of Moses Algae and Boniface (1857), The Cleveland Museum of Art, Cleveland, Ohio USA The Death of Moses (1851), Dahesh Museum,
0.729098
1.39103
0.377007
0.194187
[ 0.6277418479419179, 0.8304538114337344 ]
[ 1.032903877566821, 1.7491553100907085 ]
[ 0.23751346947947882, 0.5164999822717484 ]
[ 0.09273394920816375, 0.2956408301318887 ]
1,024
[ 512, 512 ]
[ 10987, 8974, 29901, 376, 17406, 392, 276, 11680, 3870, 29908, 785, 9763, 2880, 14578, 21321, 2880, 8277, 2880, 21344, 2880, 435, 1254, 1955, 313, 12703, 29871, 29906, 29900, 29896, 29941, 29897, 313, 29931, 799, 29876, 920, 322, 746, 304, 3349, 445, 4472, 2643, 29897, 13, 17406, 392, 276, 11680, 3870, 313, 29943, 4615, 29901, 518, 29895, 10910, 30234, 29880, 1385, 29871, 29906, 29947, 3839, 29871, 29896, 29947, 29906, 29941, 29892, 4526, 13111, 4926, 785, 29871, 29906, 29941, 5490, 29871, 29896, 29947, 29947, 29929, 29897, 471, 263, 5176, 23187, 29889, 940, 23139, 15839, 29892, 14499, 322, 12962, 17800, 297, 278, 21567, 3114, 29889, 940, 471, 884, 1532, 2998, 408, 263, 21760, 23187, 29889, 7579, 304, 28550, 12401, 2628, 11346, 293, 27238, 1417, 3956, 9046, 29892, 11680, 3870, 338, 278, 1900, 21097, 310, 278, 365, 29915, 442, 8280, 29886, 631, 322, 24265, 4786, 29915, 29879, 16389, 23187, 7226, 29896, 29962, 13, 24313, 29899, 637, 8356, 313, 29896, 29947, 29945, 29906, 29897, 13, 29898, 29896, 29947, 29906, 29941, 29899, 29900, 29929, 29899, 29906, 29947, 29897, 29906, 29947, 3839, 29871, 29896, 29947, 29906, 29941, 13, 29906, 29941, 5490, 29871, 29896, 29947, 29947, 29929, 29898, 29896, 29947, 29947, 29929, 29899, 29900, 29896, 29899, 29906, 29941, 29897, 313, 4063, 29871, 29953, 29945, 29897, 13, 7675, 11072, 29899, 30062, 29881, 283, 538, 14612, 327, 13, 3664, 519, 664, 13, 29933, 7515, 310, 9548, 375, 13, 29909, 9431, 293, 1608, 13, 29925, 2126, 316, 9184, 13, 26754, 6103, 13, 29907, 370, 3870, 7802, 278, 3067, 10936, 553, 1522, 2993, 29899, 1433, 1372, 297, 3681, 472, 278, 5046, 310, 16741, 27294, 29892, 322, 12399, 411, 13645, 29899, 30062, 29881, 283, 538, 14612, 327, 29889, 940, 10371, 1573, 472, 278, 3681, 3956, 265, 363, 278, 937, 931, 297, 29871, 29896, 29947, 29946, 29946, 29892, 322, 2113, 278, 11963, 316, 9184, 21344, 3527, 297, 29871, 29896, 29947, 29946, 29945, 472, 278, 5046, 310, 29871, 29906, 29906, 7226, 29906, 29962, 11680, 3870, 471, 11467, 263, 4509, 310, 278, 8907, 297, 29871, 29896, 29947, 29953, 29941, 29889, 940, 471, 10658, 12251, 472, 278, 3067, 10936, 553, 1522, 2993, 29899, 1433, 1372, 297, 29871, 29896, 29947, 29953, 29946, 322, 16187, 727, 2745, 670, 4892, 7226, 29941, 29962, 13, 3868, 471, 16467, 6631, 304, 278, 3681, 3956, 265, 29901, 376, 3868, 471, 11467, 25704, 304, 278, 3956, 265, 432, 2857, 322, 670, 23449, 2719, 1033, 367, 29115, 491, 278, 6893, 472, 278, 3956, 787, 29889, 17044, 963, 29892, 11680, 3870, 1258, 901, 1135, 738, 916, 7664, 310, 670, 12623, 304, 883, 278, 2931, 310, 26436, 904, 15635, 5176, 20413, 1642, 29961, 29946, 29962, 3600, 2143, 375, 284, 4208, 411, 4667, 29899, 3253, 324, 28362, 350, 692, 29884, 406, 585, 304, 2758, 278, 17188, 391, 23187, 14758, 283, 538, 2315, 300, 322, 1784, 916, 6788, 2153, 304, 10371, 277, 1009, 664, 297, 278, 3956, 265, 310, 29871, 29896, 29947, 29953, 29941, 5331, 304, 278, 25012, 310, 278, 3956, 265, 553, 9897, 375, 743, 491, 278, 5176, 5874, 29889, 11680, 3870, 2113, 278, 12848, 26402, 8284, 270, 29915, 29950, 25905, 472, 278, 3956, 787, 310, 29871, 29896, 29947, 29953, 29945, 29892, 29871, 29896, 29947, 29953, 29955, 29892, 322, 29871, 29896, 29947, 29955, 29947, 29889, 13, 29909, 9150, 21567, 23187, 29892, 670, 29871, 29896, 29947, 29953, 29941, 20413, 450, 350, 7515, 310, 9548, 375, 338, 697, 310, 278, 1900, 2998, 6455, 310, 29871, 29896, 29929, 386, 29899, 27371, 21567, 20413, 29889, 450, 7623, 471, 18093, 491, 278, 953, 13651, 24265, 4786, 29936, 727, 338, 884, 263, 7968, 1634, 10123, 313, 29886, 2365, 287, 297, 29871, 29896, 29947, 29955, 29945, 363, 263, 9124, 261, 29892, 2259, 10441, 29897, 472, 278, 28788, 6838, 310, 3012, 297, 1570, 3088, 4412, 29889, 739, 471, 2183, 304, 963, 491, 10441, 297, 29871, 29896, 29947, 29929, 29941, 29889, 13, 29925, 786, 2719, 6103, 13, 17406, 392, 276, 11680, 3870, 29892, 5777, 29889, 29896, 29947, 29953, 29945, 29889, 19040, 1946, 491, 5322, 830, 329, 1847, 261, 313, 7897, 13, 1576, 350, 7515, 310, 9548, 375, 313, 29896, 29947, 29953, 29941, 29897, 13, 29950, 275, 23449, 2719, 5134, 29901, 13, 29934, 397, 324, 1181, 1913, 29877, 23162, 13, 26473, 561, 319, 431, 814, 13, 24030, 719, 6000, 535, 13, 7999, 3890, 17468, 22138, 2261, 344, 13, 17406, 392, 276, 4581, 29899, 29933, 2156, 2488, 17116, 13, 22438, 29899, 29923, 688, 8146, 8313, 392, 13, 22438, 29899, 26473, 561, 20212, 29899, 12075, 424, 13, 29963, 433, 1251, 350, 2679, 586, 562, 13, 25216, 5915, 3359, 11381, 13, 20899, 392, 315, 555, 265, 13, 19621, 3111, 29872, 26783, 13, 29968, 15274, 265, 315, 2251, 13, 30062, 29881, 283, 538, 7089, 271, 29899, 29925, 787, 273, 13, 30062, 26763, 11169, 424, 13, 7675, 11072, 2088, 5526, 300, 13, 29967, 2540, 25315, 819, 29899, 29931, 1022, 482, 13, 7675, 11072, 2379, 314, 996, 13, 5914, 793, 17787, 7808, 388, 13, 7675, 29895, 383, 340, 1358, 13, 24030, 374, 5681, 13809, 13, 5914, 793, 23817, 264, 16306, 392, 276, 13, 7976, 951, 264, 25603, 13, 30062, 29881, 283, 538, 29899, 2744, 517, 457, 16852, 284, 518, 1341, 29962, 13, 10844, 1368, 1085, 1912, 316, 438, 9258, 3055, 13, 26626, 2598, 305, 12478, 265, 13, 7999, 990, 267, 5853, 585, 316, 323, 2470, 13, 24030, 374, 29899, 7999, 990, 267, 3879, 16290, 518, 1341, 29962, 13, 24030, 374, 349, 15073, 13, 24030, 374, 2169, 1056, 499, 13, 29902, 27695, 359, 390, 466, 359, 13, 25216, 1528, 7598, 13, 22438, 29899, 24288, 1912, 1102, 261, 2872, 13, 13448, 888, 601, 25371, 24804, 13, 26473, 561, 29899, 3782, 13929, 19628, 10147, 276, 13, 13296, 18192, 6936, 4956, 18192, 13, 18275, 10523, 3228, 631, 518, 1341, 29962, 13, 29967, 359, 29948, 7756, 9504, 316, 838, 1004, 1458, 435, 30030, 1240, 272, 13, 22353, 7081, 23707, 375, 13, 3253, 324, 28362, 4624, 20200, 13, 8592, 1736, 6103, 13, 29943, 5442, 17323, 313, 17406, 392, 276, 11680, 3870, 29897, 13, 17406, 392, 276, 11680, 3870, 448, 14450, 310, 6630, 267, 13, 2499, 3249, 29872, 322, 8396, 361, 815, 313, 29896, 29947, 29945, 29955, 511, 450, 27249, 6838, 310, 3012, 29892, 27249, 29892, 15821, 8278, 13, 1576, 14450, 310, 6630, 267, 313, 29896, 29947, 29945, 29896, 511, 360, 801, 12094, 6838, 29892 ]
1,333,639
0
CommonCrawl
0
3
<!DOCTYPE html> <html> <head> <title>inputEx - DateField Usage</title> <meta charset="utf-8"> <link rel="stylesheet" href="http://yui.yahooapis.com/combo?3.6.0/build/cssreset/reset-min.css&3.6.0/build/cssfonts/fonts-min.css"> <link rel="stylesheet" href="../res/demo.css"> <link rel="stylesheet" href="../res/syntaxhighlighter/styles/shCore.css"> <link rel="stylesheet" href="../res/syntaxhighlighter/styles/shThemeDefault.css"> <script src="http://yui.yahooapis.com/3.6.0/build/yui/yui.js"></script> <script src="../res/syntaxhighlighter/scripts/shCore.js" type='text/javascript'></script> <script src="../res/syntaxhighlighter/scripts/shBrushJScript.js" type='text/javascript'></script> </head> <body> <h1>inputEx - DateField Usage</h1> <!-- Example 1 --> <div class='exampleDiv'> <h2>Basic DateField creation</h2> <p>Use the following code to create a basic inputEx DateField.</p> <div class='demoContainer' id='container1'></div> <div class='codeContainer'> <pre class="brush:js"> new Y.inputEx.DateField({parentEl: 'container1', value: new Date(), showMsg: true}); </pre> </div> </div> <!-- Example 2 --> <div class='exampleDiv'> <h2>Change date format</h2> <p>Set the formatDate to your localized date format ! Here is the french format :</p> <div class='demoContainer' id='container2'></div> <div class='codeContainer'> <pre class="brush:js"> new Y.inputEx.DateField({dateFormat: 'd/m/Y', value: '27/03/2008', parentEl: 'container2', showMsg: true}); </pre> </div> </div> <!-- Example 3 --> <div class='exampleDiv'> <h2>Updated event and return value</h2> <p>The DateField returns a javascript Date object instance :</p> <div class='demoContainer' id='container3'></div> <div class='codeContainer'> <pre class="brush:js"> var exampleDiv = Y.one('#container3'); var dateField = new Y.inputEx.DateField({value: new Date(), parentEl: exampleDiv, showMsg: true, required:true, typeInvite:'m/d/Y'}); dateField.on('updated', function(val) { exampleDiv.appendChild( inputEx.cn('div', null, null, val) ); }); var button1 = inputEx.cn('button', null, null, 'setValue()'); exampleDiv.appendChild(button1); Y.one(button1).on('click', function() { dateField.setValue("11/26/1980"); }); var button2 = inputEx.cn('button', null, null, 'getValue()'); exampleDiv.appendChild(button2); Y.one(button2).on('click', function() { alert(dateField.getValue()); }); </pre> </div> </div> <!-- Example 4 --> <div class='exampleDiv'> <h2>Use a string input/output formatting</h2> <p>The setValue/getValue methods will parse/format the dates to the <i>valueFormat</i> option.</p> <div class='demoContainer' id='container4'></div> <div class='codeContainer'> <pre class="brush:js">
-1.232277
-1.477557
-0.172089
-0.458757
[ -1.1802297183364459, -1.2843250509403517 ]
[ -1.5097887078929795, -1.4453260789658295 ]
[ -0.2291548791912267, -0.11502403304893459 ]
[ -0.4249387341741602, -0.4925743611487352 ]
1,024
[ 512, 512 ]
[ 18252, 21300, 3472, 29958, 13, 29966, 1420, 29958, 13, 529, 2813, 29958, 13, 29871, 529, 3257, 29958, 2080, 1252, 448, 4712, 3073, 10783, 482, 829, 3257, 29958, 13, 29966, 7299, 17425, 543, 9420, 29899, 29947, 1013, 13, 29966, 2324, 1104, 543, 13558, 29908, 2822, 543, 1124, 597, 29891, 1481, 29889, 29891, 26779, 11355, 29889, 510, 29914, 510, 833, 29973, 29941, 29889, 29953, 29889, 29900, 29914, 4282, 29914, 4268, 12071, 29914, 12071, 29899, 1195, 29889, 4268, 29987, 29941, 29889, 29953, 29889, 29900, 29914, 4282, 29914, 4268, 28586, 29914, 28586, 29899, 1195, 29889, 4268, 1013, 13, 29966, 2324, 1104, 543, 13558, 29908, 2822, 543, 6995, 690, 29914, 17482, 29889, 4268, 1013, 13, 29966, 2324, 1104, 543, 13558, 29908, 2822, 543, 6995, 690, 29914, 29562, 9812, 29880, 14643, 29914, 9783, 29914, 845, 9203, 29889, 4268, 1013, 13, 29966, 2324, 1104, 543, 13558, 29908, 2822, 543, 6995, 690, 29914, 29562, 9812, 29880, 14643, 29914, 9783, 29914, 845, 17693, 4592, 29889, 4268, 1013, 13, 29966, 2154, 4765, 543, 1124, 597, 29891, 1481, 29889, 29891, 26779, 11355, 29889, 510, 29914, 29941, 29889, 29953, 29889, 29900, 29914, 4282, 29914, 29891, 1481, 29914, 29891, 1481, 29889, 1315, 5319, 2154, 29958, 13, 29966, 2154, 4765, 543, 6995, 690, 29914, 29562, 9812, 29880, 14643, 29914, 16713, 29914, 845, 9203, 29889, 1315, 29908, 29871, 1134, 2433, 726, 29914, 7729, 29915, 2565, 2154, 29958, 13, 29966, 2154, 4765, 543, 6995, 690, 29914, 29562, 9812, 29880, 14643, 29914, 16713, 29914, 845, 27680, 29967, 4081, 29889, 1315, 29908, 29871, 1134, 2433, 726, 29914, 7729, 29915, 2565, 2154, 29958, 13, 13, 1533, 2813, 29958, 13, 13, 529, 2587, 29958, 13, 13, 29966, 29882, 29896, 29958, 2080, 1252, 448, 4712, 3073, 10783, 482, 829, 29882, 29896, 29958, 13, 13, 13, 14136, 8741, 29871, 29896, 6660, 13, 29966, 4563, 770, 2433, 4773, 12596, 11041, 13, 12, 29966, 29882, 29906, 29958, 16616, 4712, 3073, 11265, 829, 29882, 29906, 29958, 13, 12, 29966, 29886, 29958, 11403, 278, 1494, 775, 304, 1653, 263, 6996, 1881, 1252, 4712, 3073, 21106, 29886, 29958, 13, 12, 29966, 4563, 770, 2433, 17482, 7895, 29915, 1178, 2433, 7611, 29896, 29915, 2565, 4563, 29958, 13, 12, 29966, 4563, 770, 2433, 401, 7895, 11041, 13, 12, 12, 29966, 1457, 770, 543, 1182, 1878, 29901, 1315, 1013, 13, 12, 12, 12, 1482, 612, 29889, 2080, 1252, 29889, 2539, 3073, 3319, 3560, 6489, 29901, 525, 7611, 29896, 742, 995, 29901, 716, 4712, 3285, 1510, 16190, 29901, 1565, 3680, 13, 12, 12, 829, 1457, 29958, 13, 12, 829, 4563, 29958, 13, 829, 4563, 29958, 13, 13, 13, 14136, 8741, 29871, 29906, 6660, 13, 29966, 4563, 770, 2433, 4773, 12596, 11041, 13, 12, 29966, 29882, 29906, 29958, 7277, 2635, 3402, 829, 29882, 29906, 29958, 13, 12, 29966, 29886, 29958, 2697, 278, 3402, 2539, 304, 596, 1887, 1891, 2635, 3402, 1738, 2266, 338, 278, 285, 4615, 3402, 584, 829, 29886, 29958, 13, 12, 29966, 4563, 770, 2433, 17482, 7895, 29915, 1178, 2433, 7611, 29906, 29915, 2565, 4563, 29958, 13, 12, 29966, 4563, 770, 2433, 401, 7895, 11041, 13, 12, 12, 29966, 1457, 770, 543, 1182, 1878, 29901, 1315, 1013, 13, 12, 12, 12, 1482, 612, 29889, 2080, 1252, 29889, 2539, 3073, 3319, 1256, 5809, 29901, 525, 29881, 29914, 29885, 29914, 29979, 742, 995, 29901, 525, 29906, 29955, 29914, 29900, 29941, 29914, 29906, 29900, 29900, 29947, 742, 3847, 6489, 29901, 525, 7611, 29906, 742, 1510, 16190, 29901, 1565, 3680, 13, 12, 12, 829, 1457, 29958, 13, 12, 829, 4563, 29958, 13, 829, 4563, 29958, 13, 13, 13, 14136, 8741, 29871, 29941, 6660, 13, 29966, 4563, 770, 2433, 4773, 12596, 11041, 13, 12, 29966, 29882, 29906, 29958, 29248, 1741, 322, 736, 995, 829, 29882, 29906, 29958, 13, 12, 29966, 29886, 29958, 1576, 4712, 3073, 3639, 263, 3513, 4712, 1203, 2777, 584, 829, 29886, 29958, 13, 12, 29966, 4563, 770, 2433, 17482, 7895, 29915, 1178, 2433, 7611, 29941, 29915, 2565, 4563, 29958, 13, 12, 29966, 4563, 770, 2433, 401, 7895, 11041, 13, 12, 12, 29966, 1457, 770, 543, 1182, 1878, 29901, 1315, 1013, 13, 12, 12, 12, 1707, 1342, 12596, 353, 612, 29889, 650, 14237, 7611, 29941, 2157, 13, 12, 12, 12, 1707, 2635, 3073, 353, 716, 612, 29889, 2080, 1252, 29889, 2539, 3073, 3319, 1767, 29901, 716, 4712, 3285, 29871, 3847, 6489, 29901, 1342, 12596, 29892, 1510, 16190, 29901, 1565, 29892, 3734, 29901, 3009, 29892, 1134, 12165, 568, 11283, 29885, 29914, 29881, 29914, 29979, 29915, 3680, 29871, 13, 12, 12, 12, 1256, 3073, 29889, 265, 877, 21402, 742, 740, 29898, 791, 29897, 426, 13, 12, 12, 12, 12, 4773, 12596, 29889, 23850, 29898, 1881, 1252, 29889, 18038, 877, 4563, 742, 1870, 29892, 1870, 29892, 659, 29897, 3482, 29871, 13, 12, 12, 12, 3680, 13, 13, 12, 12, 12, 1707, 2826, 29896, 353, 1881, 1252, 29889, 18038, 877, 3092, 742, 1870, 29892, 1870, 29892, 525, 842, 1917, 580, 2157, 13, 12, 12, 12, 4773, 12596, 29889, 23850, 29898, 3092, 29896, 416, 29871, 13, 12, 12, 12, 29979, 29889, 650, 29898, 3092, 29896, 467, 265, 877, 3808, 742, 740, 580, 426, 2635, 3073, 29889, 842, 1917, 703, 29896, 29896, 29914, 29906, 29953, 29914, 29896, 29929, 29947, 29900, 1496, 2604, 13, 13, 12, 12, 12, 1707, 2826, 29906, 353, 1881, 1252, 29889, 18038, 877, 3092, 742, 1870, 29892, 1870, 29892, 525, 23433, 580, 2157, 13, 12, 12, 12, 4773, 12596, 29889, 23850, 29898, 3092, 29906, 416, 29871, 13, 12, 12, 12, 29979, 29889, 650, 29898, 3092, 29906, 467, 265, 877, 3808, 742, 740, 580, 426, 6655, 29898, 1256, 3073, 29889, 23433, 3310, 2604, 13, 12, 12, 829, 1457, 29958, 13, 12, 829, 4563, 29958, 13, 829, 4563, 29958, 13, 13, 13, 13, 14136, 8741, 29871, 29946, 6660, 13, 29966, 4563, 770, 2433, 4773, 12596, 11041, 13, 12, 29966, 29882, 29906, 29958, 11403, 263, 1347, 1881, 29914, 4905, 15998, 829, 29882, 29906, 29958, 13, 12, 29966, 29886, 29958, 1576, 731, 1917, 29914, 23433, 3519, 674, 6088, 29914, 4830, 278, 10116, 304, 278, 529, 29875, 29958, 1767, 5809, 829, 29875, 29958, 2984, 21106, 29886, 29958, 13, 12, 29966, 4563, 770, 2433, 17482, 7895, 29915, 1178, 2433, 7611, 29946, 29915, 2565, 4563, 29958, 13, 12, 29966, 4563, 770, 2433, 401, 7895, 11041, 13, 12, 12, 29966, 1457, 770, 543, 1182, 1878, 29901, 1315, 1013 ]
1,333,646
0
Github
-1
-1
Matador Resources Careers Search Local Jobs - Full Time / Part Time / Hourl Find All Jobs Hiring in Your Area. Hiring Immediately - Apply Today ded. If those words describe you, Matador Resources Company could be the right fit for you. Our company is at the forefront of exploring and developing unconventional hydrocarbon resource plays in the United States. We're looking for highly motivated people who share our passion for the oil and. Find out what works well at Matador Resources Company from the people who know best. Get the inside scoop on jobs, salaries, top office locations, and CEO insights. Compare pay for popular roles and read about the team's work-life balance. Uncover why Matador Resources Company is the best company for you Search job openings at Matador Resources. 7 Matador Resources jobs including salaries, ratings, and reviews, posted by Matador Resources employees Revenue: $100 to $500 million (USD) Competitors: UNKNOWN. This Matador may be thriving in a bullish oil market, but the company itself is more phoenix than bull. Matador Resources was founded by the former executives of Matador Petroleum, which was bought by Tom Brown in 2003. Matador Resources focuses on natural gas exploration and. Matador Resources Company is an independent energy company engaged in the exploration, development, production and acquisition of oil and natural gas resources in the United States, with an emphasis on oil and natural gas shale and other unconventional.. Careers Matador Resources Compan Matador Resources Company is an independent energy company engaged in the exploration, development, production and acquisition of oil and natural gas resources in the United States, with an emphasis on oil and natural gas shale and other unconventional plays. Our current operations are focused primarily on the oil and liquids-rich portion of. Matador's predecessor company, Matador Petroleum Corporation, a privately-held company, was founded in 1988 and was one of the fastest growing oil and gas companies in the United States at the. Reviews from Matador Resources Company employees about Matador Resources Company culture, salaries, benefits, work-life balance, management, job security, and more At home on the range. We're prepping for scheduled maintenance! Application submissions will be closed from 11:00 pm EST Friday to 9:00 am EST on Saturday. Our three working ranches operate on more than 460,000 acres and 12,000 head of cattle, preserving the cowboy way for generations to come Select the Matador image below to view External Applicant Opportunities: Below you will find an overview of the application process as well as an external link to current staff and management openings. To the right, you'll find links to resources should you have additional questions. Applications for all staff and management positions are. Matador Resources Company is an independent energy company engaged in the exploration, development, production and acquisition of oil and natural gas resources in the United States, with an emphasis on oil and natural gas shale and other unconventional plays Matador Mining • ASX:MZZ. Exploring for high grade. gold in Newfoundland. Read more. View the latest at. Matador's Cape Ray Project. View the latest at. Matador's Cape Ray Project. Latest presentation Matador Resources Company Careers & Employment - Working Despite rising stock price, this company is in the toilet when it comes to employee satisfaction. There are very few pros to working at Matador - the pay is competitive but the culture completely negates that. The 9/80 schedule is seen as a pro for some. Very poor leadership from the top (Joe Foran, CEO) down Q4 2020 Investor Presentation. February 23, 2021. Q4 and FY 2020 Earnings Presentation. 1.6 MB The most common ethnicity among Matador Resources Co executive officers is White. 70% of the management team is White. 11% of Matador Resources Co's management is Black or African American. 9% of the management team is Asian. Company-wide: White is the most common ethnicity company-wide. 51% of employees are White. 25% of employees are Hispanic. The average Matador Resources salary ranges from approximately $90,000 per
-1.295282
-1.017366
-1.315934
-1.406956
[ -1.1473575080404756, -1.443207400704208 ]
[ -0.9224625332233918, -1.1122691628422219 ]
[ -1.0838681047457255, -1.5480002123910466 ]
[ -1.2365662578690602, -1.577345763010188 ]
1,024
[ 512, 512 ]
[ 5345, 3136, 27562, 10057, 414, 13, 7974, 9959, 17163, 29879, 448, 14846, 5974, 847, 3455, 5974, 847, 379, 473, 29880, 13, 12542, 2178, 17163, 29879, 379, 8491, 297, 3575, 18320, 29889, 379, 8491, 1954, 4210, 2486, 448, 2401, 368, 20628, 13, 7176, 29889, 960, 1906, 3838, 8453, 366, 29892, 5345, 3136, 27562, 6938, 1033, 367, 278, 1492, 6216, 363, 366, 29889, 8680, 5001, 338, 472, 278, 26839, 8862, 310, 3902, 8253, 322, 14338, 443, 535, 794, 1848, 17546, 4287, 6718, 6503, 13582, 297, 278, 3303, 3900, 29889, 1334, 29915, 276, 3063, 363, 10712, 17385, 630, 2305, 1058, 6232, 1749, 15935, 363, 278, 17182, 322, 29889, 13, 12542, 714, 825, 1736, 1532, 472, 5345, 3136, 27562, 6938, 515, 278, 2305, 1058, 1073, 1900, 29889, 3617, 278, 2768, 885, 26793, 373, 17643, 29892, 4497, 4314, 29892, 2246, 8034, 14354, 29892, 322, 14645, 29949, 1663, 5861, 29889, 3831, 598, 5146, 363, 5972, 16178, 322, 1303, 1048, 278, 3815, 29915, 29879, 664, 29899, 19264, 17346, 29889, 853, 11911, 2020, 5345, 3136, 27562, 6938, 338, 278, 1900, 5001, 363, 366, 13, 7974, 4982, 1722, 886, 472, 5345, 3136, 27562, 29889, 29871, 29955, 5345, 3136, 27562, 17643, 3704, 4497, 4314, 29892, 26838, 29892, 322, 21804, 29892, 8059, 491, 5345, 3136, 27562, 22873, 13, 1123, 9947, 29901, 395, 29896, 29900, 29900, 304, 395, 29945, 29900, 29900, 7284, 313, 3308, 29928, 29897, 24620, 17259, 29901, 8291, 29968, 6632, 16048, 29889, 910, 5345, 3136, 1122, 367, 266, 1150, 292, 297, 263, 289, 913, 728, 17182, 9999, 29892, 541, 278, 5001, 3528, 338, 901, 282, 1251, 23534, 1135, 289, 913, 29889, 5345, 3136, 27562, 471, 11091, 491, 278, 4642, 6704, 3145, 310, 5345, 3136, 5879, 12154, 398, 29892, 607, 471, 18093, 491, 4335, 9817, 297, 29871, 29906, 29900, 29900, 29941, 29889, 5345, 3136, 27562, 8569, 267, 373, 5613, 10489, 3902, 12418, 322, 29889, 13, 9782, 3136, 27562, 6938, 338, 385, 7417, 5864, 5001, 17785, 297, 278, 3902, 12418, 29892, 5849, 29892, 5802, 322, 1274, 23493, 310, 17182, 322, 5613, 10489, 7788, 297, 278, 3303, 3900, 29892, 411, 385, 19310, 275, 373, 17182, 322, 5613, 10489, 528, 744, 322, 916, 443, 535, 794, 1848, 636, 13, 29907, 598, 414, 5345, 3136, 27562, 3831, 273, 13, 9782, 3136, 27562, 6938, 338, 385, 7417, 5864, 5001, 17785, 297, 278, 3902, 12418, 29892, 5849, 29892, 5802, 322, 1274, 23493, 310, 17182, 322, 5613, 10489, 7788, 297, 278, 3303, 3900, 29892, 411, 385, 19310, 275, 373, 17182, 322, 5613, 10489, 528, 744, 322, 916, 443, 535, 794, 1848, 13582, 29889, 8680, 1857, 6931, 526, 21309, 19434, 373, 278, 17182, 322, 15617, 4841, 29899, 4018, 11910, 310, 29889, 13, 9782, 3136, 29915, 29879, 27978, 985, 272, 5001, 29892, 5345, 3136, 5879, 12154, 398, 15025, 29892, 263, 5999, 2486, 29899, 29882, 2495, 5001, 29892, 471, 11091, 297, 29871, 29896, 29929, 29947, 29947, 322, 471, 697, 310, 278, 5172, 342, 15678, 17182, 322, 10489, 14582, 297, 278, 3303, 3900, 472, 278, 29889, 13, 1123, 7406, 515, 5345, 3136, 27562, 6938, 22873, 1048, 5345, 3136, 27562, 6938, 9257, 29892, 4497, 4314, 29892, 23633, 29892, 664, 29899, 19264, 17346, 29892, 10643, 29892, 4982, 6993, 29892, 322, 901, 13, 4178, 3271, 373, 278, 3464, 29889, 1334, 29915, 276, 758, 3262, 363, 21467, 25413, 29991, 8427, 11834, 6847, 674, 367, 5764, 515, 29871, 29896, 29896, 29901, 29900, 29900, 26354, 382, 1254, 28728, 304, 29871, 29929, 29901, 29900, 29900, 626, 382, 1254, 373, 24211, 29889, 8680, 2211, 1985, 6350, 6609, 21994, 373, 901, 1135, 29871, 29946, 29953, 29900, 29892, 29900, 29900, 29900, 23931, 322, 29871, 29896, 29906, 29892, 29900, 29900, 29900, 2343, 310, 27498, 29892, 2225, 29530, 278, 21282, 19415, 982, 363, 1176, 800, 304, 2041, 13, 3549, 278, 5345, 3136, 1967, 2400, 304, 1776, 3985, 2401, 506, 424, 438, 3016, 348, 1907, 29901, 13866, 366, 674, 1284, 385, 975, 1493, 310, 278, 2280, 1889, 408, 1532, 408, 385, 7029, 1544, 304, 1857, 13925, 322, 10643, 1722, 886, 29889, 1763, 278, 1492, 29892, 366, 29915, 645, 1284, 2988, 304, 7788, 881, 366, 505, 5684, 5155, 29889, 2401, 5795, 363, 599, 13925, 322, 10643, 11909, 526, 29889, 5345, 3136, 27562, 6938, 338, 385, 7417, 5864, 5001, 17785, 297, 278, 3902, 12418, 29892, 5849, 29892, 5802, 322, 1274, 23493, 310, 17182, 322, 5613, 10489, 7788, 297, 278, 3303, 3900, 29892, 411, 385, 19310, 275, 373, 17182, 322, 5613, 10489, 528, 744, 322, 916, 443, 535, 794, 1848, 13582, 5345, 3136, 341, 2827, 10266, 3339, 29990, 29901, 29924, 29999, 29999, 29889, 1222, 572, 8253, 363, 1880, 19468, 29889, 7684, 297, 1570, 11940, 1049, 29889, 7523, 901, 29889, 4533, 278, 9281, 472, 29889, 5345, 3136, 29915, 29879, 20922, 9596, 8010, 29889, 4533, 278, 9281, 472, 29889, 5345, 3136, 29915, 29879, 20922, 9596, 8010, 29889, 7053, 342, 24329, 13, 9782, 3136, 27562, 6938, 10057, 414, 669, 7361, 22812, 448, 24176, 13, 4002, 29886, 568, 20493, 10961, 8666, 29892, 445, 5001, 338, 297, 278, 304, 488, 29873, 746, 372, 5304, 304, 19001, 26470, 29889, 1670, 526, 1407, 2846, 10791, 304, 1985, 472, 5345, 3136, 448, 278, 5146, 338, 5100, 3321, 541, 278, 9257, 6446, 3480, 1078, 393, 29889, 450, 29871, 29929, 29914, 29947, 29900, 20410, 338, 3595, 408, 263, 410, 363, 777, 29889, 18064, 6460, 26001, 515, 278, 2246, 313, 29967, 7297, 1152, 273, 29892, 14645, 29949, 29897, 1623, 660, 29946, 29871, 29906, 29900, 29906, 29900, 512, 10147, 272, 4360, 9233, 29889, 6339, 29871, 29906, 29941, 29892, 29871, 29906, 29900, 29906, 29896, 29889, 660, 29946, 322, 383, 29979, 29871, 29906, 29900, 29906, 29900, 382, 2753, 886, 4360, 9233, 29889, 29871, 29896, 29889, 29953, 13232, 450, 1556, 3619, 11314, 7823, 537, 4249, 5345, 3136, 27562, 3189, 22760, 13049, 338, 8037, 29889, 29871, 29955, 29900, 29995, 310, 278, 10643, 3815, 338, 8037, 29889, 29871, 29896, 29896, 29995, 310, 5345, 3136, 27562, 3189, 29915, 29879, 10643, 338, 6054, 470, 11715, 3082, 29889, 29871, 29929, 29995, 310, 278, 10643, 3815, 338, 20021, 29889, 6938, 29899, 8157, 29901, 8037, 338, 278, 1556, 3619, 11314, 7823, 537, 5001, 29899, 8157, 29889, 29871, 29945, 29896, 29995, 310, 22873, 526, 8037, 29889, 29871, 29906, 29945, 29995, 310, 22873, 526, 3600, 8357, 293, 29889, 450, 6588, 5345, 3136, 27562, 4497, 653, 20238, 515, 14235, 395, 29929, 29900, 29892, 29900, 29900, 29900, 639 ]
1,333,649
0
CommonCrawl
15
4
year for an Accountant to $192,695 per year for an Engineer.Matador Resources employees rate the overall compensation and benefits package 2.9/5 stars Matador Resources Jobs Glassdoo A world of opportunity. We are part of a team of 130,000 individuals from around the globe, working to improve life's essential products. Things like food, clothing, water, transportation and technology. With locations in nearly every U.S. state and in 60 countries, Koch companies offer abundant opportunities to make contributions that matter Early Career Development. Recruiting and developing the next generation of energy industry talent is an important part of Targa's business strategy. We are seeking energetic, success-oriented students and graduates for internships and full-time positions. Our programs are focused on providing diverse and challenging opportunities to allow you. Matador Resources Company Pre-Annual Meeting Continental Breakfast and Informal Discussion and Remarks. Location. Dallas, TX 75207. United States. Jun 04, 2012. from 1:05 PM to 1:05 PM EDT Completions Engineer salaries at Matador Resources can range from $115,165-$125,542. This estimate is based upon 1 Matador Resources Completions Engineer salary report(s) provided by employees or estimated based upon statistical methods. See all Completions Engineer salaries to learn how this stacks up in the market Equal Employment is the Law Requests for Accommodation Individuals with a disability who wish to request an accommodation to complete an employment application, please Click here or call 713 -571 -4766 Matador Resources Co. Matador Resources Co. is a holding company, which engages in the exploration, development, production, and acquisition of oil and natural gas resources Careers. Antero Resources Corporation is headquartered in Denver, Colorado and currently employs over 500 employees in Colorado, West Virginia and Ohio. Antero is one of the largest independent oil and natural gas producers in the United States. We advocate for a safe, drug-free and productive work environment That like personal challenges and are in charge of their own career development. We want to hire people that take initiative and are self-driven in the achievement of goals. Open-minded. That are open to technological innovation, new challenges and ideas. A note to recruiting agencies: EXCO Resources, Inc. maintains an approved recruiting. Matador Resources (MTDR) came out with quarterly earnings of $1.02 per share, beating the Zacks Consensus Estimate of $0.72 per share. This compares to loss of $0.03 per share a year ago. These. Working at Matador Resources Glassdoo Matador Resources Co (MTDR) Q4 2020 Earnings Call Transcript Why Matador Energy Stock Sank as Much as 13.5% in the First Hour of Trading Today Why Matador Resources Stock Rallied as Much as 10% at. Business Description. Matador Resources Co is an independent energy company engaged in the exploration, development, production, and acquisition of oil and natural gas resources Join The Matadors. As a destination workplace, California State University, Northridge attracts, develops, and maintains a diverse workforce of over 4,000 engaged and committed faculty and staff. CSUN is committed to achieving excellence through teaching, scholarship, learning and inclusion. Our values include a respect for all people, building. Human Resources Business Partner Taylorsville, North Carolina THE TEAM YOU WILL BE JOINING: A global luxury products company & retailer with record-breaking revenue Executive commitment to digital transformation and eCommerce growth, with plans for expansion Leadership fosters a culture committed to diversity, environmental & social. Matador Jobs is a tool that uses your Bullhorn data to create an interactive, custom job board on your WordPress-powered company website. Access and present any job or candidate field via Bullhorn's private API, accept applications from candidates, and present your jobs with full search engine optimization including optimization for Google for Jobs search MATADOR Group | 2,910 followers on LinkedIn. The MATADOR Group established a key position in the Central European market as a system supplier of automotive and non-
-1.193926
-1.221498
-1.241115
-1.366635
[ -1.2185806303484112, -1.169272314904456 ]
[ -0.9045562474102946, -1.538438765193935 ]
[ -1.0356795252634243, -1.4465505713756759 ]
[ -1.4004525847689917, -1.332816957794417 ]
1,024
[ 512, 512 ]
[ 1629, 363, 385, 16535, 424, 304, 395, 29896, 29929, 29906, 29892, 29953, 29929, 29945, 639, 1629, 363, 385, 10863, 261, 29889, 9782, 3136, 27562, 22873, 6554, 278, 12463, 22874, 362, 322, 23633, 3577, 29871, 29906, 29889, 29929, 29914, 29945, 10819, 13, 9782, 3136, 27562, 17163, 29879, 402, 605, 1867, 29877, 13, 29909, 3186, 310, 15130, 29889, 1334, 526, 760, 310, 263, 3815, 310, 29871, 29896, 29941, 29900, 29892, 29900, 29900, 29900, 15724, 515, 2820, 278, 15482, 915, 29892, 1985, 304, 11157, 2834, 29915, 29879, 18853, 9316, 29889, 28706, 763, 9687, 29892, 1067, 6046, 29892, 4094, 29892, 8608, 362, 322, 15483, 29889, 2973, 14354, 297, 8886, 1432, 501, 29889, 29903, 29889, 2106, 322, 297, 29871, 29953, 29900, 10916, 29892, 25911, 14582, 5957, 18666, 424, 28602, 1907, 304, 1207, 20706, 393, 4383, 13, 29923, 279, 368, 15825, 14650, 29889, 3599, 9216, 292, 322, 14338, 278, 2446, 12623, 310, 5864, 13661, 24242, 338, 385, 4100, 760, 310, 323, 21899, 29915, 29879, 5381, 13705, 29889, 1334, 526, 25738, 4527, 657, 293, 29892, 2551, 29899, 12236, 287, 8041, 322, 10591, 1078, 363, 2836, 9981, 322, 2989, 29899, 2230, 11909, 29889, 8680, 11104, 526, 21309, 373, 13138, 16984, 322, 18066, 292, 28602, 1907, 304, 2758, 366, 29889, 13, 9782, 3136, 27562, 6938, 4721, 29899, 2744, 29876, 950, 2191, 15133, 2866, 25270, 28301, 11255, 322, 15162, 284, 8565, 1558, 291, 322, 5240, 17862, 29889, 17015, 29889, 27043, 29892, 323, 29990, 29871, 29955, 29945, 29906, 29900, 29955, 29889, 3303, 3900, 29889, 8378, 29871, 29900, 29946, 29892, 29871, 29906, 29900, 29896, 29906, 29889, 515, 29871, 29896, 29901, 29900, 29945, 11278, 304, 29871, 29896, 29901, 29900, 29945, 11278, 9408, 29911, 13, 8909, 29873, 1080, 10863, 261, 4497, 4314, 472, 5345, 3136, 27562, 508, 3464, 515, 395, 29896, 29896, 29945, 29892, 29896, 29953, 29945, 18039, 29896, 29906, 29945, 29892, 29945, 29946, 29906, 29889, 910, 12678, 338, 2729, 2501, 29871, 29896, 5345, 3136, 27562, 15642, 29873, 1080, 10863, 261, 4497, 653, 3461, 29898, 29879, 29897, 4944, 491, 22873, 470, 15899, 2729, 2501, 24148, 3519, 29889, 2823, 599, 15642, 29873, 1080, 10863, 261, 4497, 4314, 304, 5110, 920, 445, 5096, 29879, 701, 297, 278, 9999, 11243, 284, 7361, 22812, 338, 278, 7927, 10729, 29879, 363, 7255, 510, 1545, 362, 1894, 23352, 29879, 411, 263, 766, 3097, 1058, 6398, 304, 2009, 385, 24803, 362, 304, 4866, 385, 5703, 358, 2280, 29892, 3113, 16297, 1244, 470, 1246, 29871, 29955, 29896, 29941, 448, 29945, 29955, 29896, 448, 29946, 29955, 29953, 29953, 5345, 3136, 27562, 3189, 29889, 5345, 3136, 27562, 3189, 29889, 338, 263, 13587, 5001, 29892, 607, 3033, 1179, 297, 278, 3902, 12418, 29892, 5849, 29892, 5802, 29892, 322, 1274, 23493, 310, 17182, 322, 5613, 10489, 7788, 13, 29907, 598, 414, 29889, 530, 24175, 27562, 15025, 338, 2343, 339, 4254, 287, 297, 3384, 369, 29892, 21137, 322, 5279, 3710, 417, 952, 975, 29871, 29945, 29900, 29900, 22873, 297, 21137, 29892, 3122, 11653, 322, 15821, 29889, 530, 24175, 338, 697, 310, 278, 10150, 7417, 17182, 322, 5613, 10489, 1391, 22543, 297, 278, 3303, 3900, 29889, 1334, 22545, 403, 363, 263, 9109, 29892, 15721, 29899, 9021, 322, 3234, 573, 664, 5177, 2193, 763, 7333, 18066, 267, 322, 526, 297, 8323, 310, 1009, 1914, 6413, 5849, 29889, 1334, 864, 304, 298, 533, 2305, 393, 2125, 14511, 1230, 322, 526, 1583, 29899, 24477, 854, 297, 278, 27012, 882, 310, 14433, 29889, 4673, 29899, 24021, 287, 29889, 2193, 526, 1722, 304, 5722, 5996, 24233, 362, 29892, 716, 18066, 267, 322, 7014, 29889, 319, 4443, 304, 1162, 9216, 292, 946, 15942, 29901, 8528, 3217, 27562, 29892, 9266, 29889, 7344, 29879, 385, 23454, 1162, 9216, 292, 29889, 5345, 3136, 27562, 313, 11490, 8353, 29897, 2996, 714, 411, 12616, 368, 2326, 11753, 310, 395, 29896, 29889, 29900, 29906, 639, 6232, 29892, 367, 1218, 278, 796, 26514, 2138, 8841, 2661, 6490, 310, 395, 29900, 29889, 29955, 29906, 639, 6232, 29889, 910, 752, 5114, 304, 6410, 310, 395, 29900, 29889, 29900, 29941, 639, 6232, 263, 1629, 8020, 29889, 4525, 29889, 13, 5531, 292, 472, 5345, 3136, 27562, 402, 605, 1867, 29877, 13, 9782, 3136, 27562, 3189, 313, 11490, 8353, 29897, 660, 29946, 29871, 29906, 29900, 29906, 29900, 382, 2753, 886, 8251, 4103, 924, 3750, 5345, 3136, 24836, 10224, 28912, 408, 18927, 408, 29871, 29896, 29941, 29889, 29945, 29995, 297, 278, 3824, 379, 473, 310, 1605, 9382, 20628, 3750, 5345, 3136, 27562, 10224, 390, 284, 2957, 408, 18927, 408, 29871, 29896, 29900, 29995, 472, 29889, 15197, 12953, 29889, 5345, 3136, 27562, 3189, 338, 385, 7417, 5864, 5001, 17785, 297, 278, 3902, 12418, 29892, 5849, 29892, 5802, 29892, 322, 1274, 23493, 310, 17182, 322, 5613, 10489, 7788, 3650, 262, 450, 5345, 24549, 29889, 1094, 263, 12551, 664, 6689, 29892, 8046, 4306, 3014, 29892, 4644, 8605, 13978, 29879, 29892, 2693, 29879, 29892, 322, 7344, 29879, 263, 16984, 664, 10118, 310, 975, 29871, 29946, 29892, 29900, 29900, 29900, 17785, 322, 19355, 4024, 18857, 322, 13925, 29889, 21107, 3904, 338, 19355, 304, 3657, 15387, 12567, 663, 1549, 18819, 29892, 21344, 3527, 29892, 6509, 322, 28694, 29889, 8680, 1819, 3160, 263, 3390, 363, 599, 2305, 29892, 5214, 29889, 12968, 27562, 15197, 3455, 1089, 323, 388, 29880, 943, 4909, 29892, 4644, 13397, 6093, 17067, 5194, 612, 27269, 399, 24071, 20700, 8780, 4214, 29901, 319, 5534, 21684, 2857, 9316, 5001, 669, 3240, 737, 261, 411, 2407, 29899, 1030, 5086, 337, 9947, 28841, 9063, 358, 304, 13436, 13852, 322, 321, 1523, 15667, 14321, 29892, 411, 13900, 363, 13184, 951, 328, 10475, 9926, 414, 263, 9257, 19355, 304, 6894, 537, 29892, 29380, 669, 5264, 29889, 5345, 3136, 17163, 29879, 338, 263, 5780, 393, 3913, 596, 20293, 25031, 848, 304, 1653, 385, 28923, 29892, 2888, 4982, 7613, 373, 596, 10803, 10923, 29899, 13519, 287, 5001, 4700, 29889, 11028, 322, 2198, 738, 4982, 470, 14020, 1746, 3025, 20293, 25031, 29915, 29879, 2024, 3450, 29892, 3544, 8324, 515, 21669, 29892, 322, 2198, 596, 17643, 411, 2989, 2740, 6012, 13883, 3704, 13883, 363, 5087, 363, 17163, 29879, 2740, 13, 29924, 1299, 3035, 1955, 6431, 891, 29871, 29906, 29892, 29929, 29896, 29900, 1101, 414, 373, 28547, 797, 29889, 450, 341, 1299, 3035, 1955, 6431, 7841, 263, 1820, 2602, 297, 278, 8068, 7824, 9999, 408, 263, 1788, 1462, 4926, 310, 3345, 327, 573, 322, 1661, 29899 ]
1,333,649
1,024
CommonCrawl
15
4
automotive solutions. The. Get liquidity. Yes, we have free lunch and snacks, but some things are more important. At Carta, every employee receives equity and we're committed to offering employee liquidity every 12-18 months. That means you'll be able to sell a portion of your exercised shares and not have to wait for an exit or IPO That means delivering sustainably produced oil and natural gas that fuels commerce and innovation. But it also means providing career opportunities that enable talented individuals to learn and grow. If you're looking to optimize your professional potential and make a positive impact on the world, you'll enjoy life at Murphy Cape Ray Gold Project. The Project is in the south-western area of Newfoundland, Canada. The Project is about 25 km northeast of the coastal town of Port aux Basques and is located on the Cape Ray shear, one of the most prospective, yet under explored gold regions in North America. The Company is the largest holder of ground along the Cape Ray. Denbury employees are our most valued resource. We recognize it is their ideas, passion, and collective effort that produce outstanding results. Denbury attracts exceptional talent, provides employees with advanced technology, and commits to the future development of our people Careers. At Pioneer, we know the value of putting in a hard day's work, and we pride ourselves on doing things the right way. Teamwork and integrity are paramount - we work together to get the job done right, and we are supported by a company that empowers us to make a difference, both inside these four walls and within our communities 1000 W. Morehead Street, Suite 200, Charlotte, NC 28208 (704) 632-9955 Send [email protected] EOG Resources, Inc. has a job for you. Advanced Searc Search 142 Wichita Careers available at Koch. Do you speak multiple languages? To see job listings posted in a different language than your browser's default setting, use the selector at the top of the page BlackRock Resources was founded in Canonsburg, PA in 2012 with the mission of providing professional staffing and consulting services to the oil, gas and renewable energy industries. Our niche market firm is dedicated to supplying the industry's best talent and resources to our customers Sempra LNG endeavors to make the online application process accessible to any and all users. If you would like to contact us regarding the accessibility of our website or need assistance or accommodation to complete the application process, please contact our Human Resources Department at [email protected] or 1-619-696-4405. This contact information is for accommodation requests only. Matador Resources Co Careers & Jobs - Zippi Matador Advising HUB Cal State Northridge (818) 677-2900 Email The HUB. Campus Office Hours. Monday, Tuesday & Thursday: 10:00am - 2:00pm. Virtual Office Hour g everyday life for millions as we innovate new and emerging technologies in. Matador Resources Company Oil & Energy Dallas, Texas Pony Energy Services Pony Energy Services Oil & Energy Landman jobs 2,024 open jobs Manager jobs. Matador Resources Company (MTDR Birch Resources | 2,174 followers on LinkedIn. Birch Resources is a privately held E&P company with Assets in the Prolific Permian Basin. Birch is led by a seasoned management team that has had so. ation, harassment, intimidation, and bullying based on age, gender, sex, race, color, religion, ancestry, national origin, nationality, ethnic group identification, ethnicity, marital or parental. Matador Resources reported record oil and gas revenues, record adjusted EBITDA, free cash flows, a big jump in net profits, and lower debt in its Q1-2021 results. Matador Resources' earnings. The Matador Cattle Company operates three ranches with more than 460,000 acres and 12,000 cattle, raising the standards for beef quality assurance. Search Jobs Media Resources This First Amendment (the Amendment) to that certain employment agreement between Matador Resources Company, a Texas corporation (Matador), acting through its Board of
-0.741334
-1.140919
-1.107962
-1.145518
[ -0.17642883830897932, -1.306239857804332 ]
[ -0.6359619602138368, -1.645876480072518 ]
[ -0.7389393252934648, -1.476985463680287 ]
[ -0.9790306013120246, -1.3120059956483938 ]
1,024
[ 512, 512 ]
[ 17405, 327, 573, 6851, 29889, 450, 29889, 3617, 23904, 537, 29889, 3869, 29892, 591, 505, 3889, 301, 3322, 322, 5807, 26514, 29892, 541, 777, 2712, 526, 901, 4100, 29889, 2180, 12370, 29874, 29892, 1432, 19001, 20586, 1592, 537, 322, 591, 29915, 276, 19355, 304, 27032, 19001, 23904, 537, 1432, 29871, 29896, 29906, 29899, 29896, 29947, 7378, 29889, 2193, 2794, 366, 29915, 645, 367, 2221, 304, 19417, 263, 11910, 310, 596, 11382, 3368, 29358, 322, 451, 505, 304, 4480, 363, 385, 6876, 470, 5641, 29949, 13, 7058, 2794, 12021, 292, 15075, 475, 2197, 7371, 17182, 322, 5613, 10489, 393, 4084, 1379, 24346, 322, 24233, 362, 29889, 1205, 372, 884, 2794, 13138, 6413, 28602, 1907, 393, 9025, 5969, 14927, 15724, 304, 5110, 322, 6548, 29889, 960, 366, 29915, 276, 3063, 304, 24656, 596, 10257, 7037, 322, 1207, 263, 6374, 10879, 373, 278, 3186, 29892, 366, 29915, 645, 13389, 2834, 472, 7487, 11461, 20922, 9596, 6650, 8010, 29889, 450, 8010, 338, 297, 278, 7062, 29899, 22741, 4038, 310, 1570, 11940, 1049, 29892, 7400, 29889, 450, 8010, 338, 1048, 29871, 29906, 29945, 2383, 302, 27374, 310, 278, 12180, 284, 4726, 310, 3371, 3479, 4886, 1912, 322, 338, 5982, 373, 278, 20922, 9596, 1183, 279, 29892, 697, 310, 278, 1556, 10791, 12645, 29892, 3447, 1090, 3902, 4395, 7684, 12786, 297, 4644, 6813, 29889, 450, 6938, 338, 278, 10150, 19464, 310, 5962, 3412, 278, 20922, 9596, 29889, 3384, 11059, 22873, 526, 1749, 1556, 659, 6742, 6503, 29889, 1334, 18720, 372, 338, 1009, 7014, 29892, 15935, 29892, 322, 6314, 573, 7225, 393, 7738, 714, 11235, 2582, 29889, 3384, 11059, 13978, 29879, 3682, 284, 24242, 29892, 8128, 22873, 411, 12862, 15483, 29892, 322, 25741, 304, 278, 5434, 5849, 310, 1749, 2305, 10057, 414, 29889, 2180, 349, 1421, 261, 29892, 591, 1073, 278, 995, 310, 10594, 297, 263, 2898, 2462, 29915, 29879, 664, 29892, 322, 591, 24967, 20278, 373, 2599, 2712, 278, 1492, 982, 29889, 8583, 1287, 322, 28410, 526, 1828, 792, 448, 591, 664, 4208, 304, 679, 278, 4982, 2309, 1492, 29892, 322, 591, 526, 6969, 491, 263, 5001, 393, 3710, 340, 414, 502, 304, 1207, 263, 4328, 29892, 1716, 2768, 1438, 3023, 14603, 322, 2629, 1749, 23507, 13, 29896, 29900, 29900, 29900, 399, 29889, 5853, 2813, 7103, 29892, 2166, 568, 29871, 29906, 29900, 29900, 29892, 21499, 29892, 25166, 29871, 29906, 29947, 29906, 29900, 29947, 313, 29955, 29900, 29946, 29897, 29871, 29953, 29941, 29906, 29899, 29929, 29929, 29945, 29945, 15076, 5235, 29992, 5753, 29878, 434, 1595, 8397, 29889, 1111, 382, 29949, 29954, 27562, 29892, 9266, 29889, 756, 263, 4982, 363, 366, 29889, 29287, 317, 799, 29883, 11856, 29871, 29896, 29946, 29906, 399, 436, 2028, 10057, 414, 3625, 472, 25911, 29889, 1938, 366, 7726, 2999, 10276, 29973, 1763, 1074, 4982, 1051, 886, 8059, 297, 263, 1422, 4086, 1135, 596, 4714, 29915, 29879, 2322, 4444, 29892, 671, 278, 11764, 472, 278, 2246, 310, 278, 1813, 6054, 29934, 1698, 27562, 471, 11091, 297, 1815, 787, 3074, 29892, 17687, 297, 29871, 29906, 29900, 29896, 29906, 411, 278, 10655, 310, 13138, 10257, 13925, 292, 322, 8799, 292, 5786, 304, 278, 17182, 29892, 10489, 322, 23011, 519, 5864, 6397, 2722, 29889, 8680, 302, 4070, 9999, 9226, 338, 16955, 304, 1462, 5890, 278, 13661, 29915, 29879, 1900, 24242, 322, 7788, 304, 1749, 20330, 317, 3451, 336, 365, 9312, 26009, 943, 304, 1207, 278, 7395, 2280, 1889, 15579, 304, 738, 322, 599, 4160, 29889, 960, 366, 723, 763, 304, 6958, 502, 11211, 278, 2130, 4127, 310, 1749, 4700, 470, 817, 18872, 470, 24803, 362, 304, 4866, 278, 2280, 1889, 29892, 3113, 6958, 1749, 12968, 27562, 10317, 472, 27146, 9312, 29899, 20938, 29992, 29879, 3451, 1431, 3157, 29889, 510, 470, 29871, 29896, 29899, 29953, 29896, 29929, 29899, 29953, 29929, 29953, 29899, 29946, 29946, 29900, 29945, 29889, 910, 6958, 2472, 338, 363, 24803, 362, 7274, 871, 29889, 13, 9782, 3136, 27562, 3189, 10057, 414, 669, 17163, 29879, 448, 796, 22425, 13, 9782, 3136, 2087, 1730, 292, 379, 7466, 3037, 4306, 4644, 8605, 313, 29947, 29896, 29947, 29897, 29871, 29953, 29955, 29955, 29899, 29906, 29929, 29900, 29900, 22608, 450, 379, 7466, 29889, 7259, 375, 11367, 379, 2470, 29889, 27822, 29892, 323, 1041, 3250, 669, 498, 1295, 3250, 29901, 29871, 29896, 29900, 29901, 29900, 29900, 314, 448, 29871, 29906, 29901, 29900, 29900, 3358, 29889, 19181, 11367, 379, 473, 13, 29887, 1432, 3250, 2834, 363, 14746, 408, 591, 24233, 403, 716, 322, 11176, 3460, 5722, 11763, 297, 29889, 13, 9782, 3136, 27562, 6938, 438, 309, 669, 24836, 27043, 29892, 10319, 349, 2592, 24836, 15538, 349, 2592, 24836, 15538, 438, 309, 669, 24836, 3172, 1171, 17643, 29871, 29906, 29892, 29900, 29906, 29946, 1722, 17643, 15629, 17643, 29889, 13, 9782, 3136, 27562, 6938, 313, 11490, 8353, 13, 29933, 381, 305, 27562, 891, 29871, 29906, 29892, 29896, 29955, 29946, 1101, 414, 373, 28547, 797, 29889, 17853, 305, 27562, 338, 263, 5999, 2486, 4934, 382, 29987, 29925, 5001, 411, 1094, 7224, 297, 278, 1019, 29880, 928, 20894, 713, 4886, 262, 29889, 17853, 305, 338, 5331, 491, 263, 4259, 287, 10643, 3815, 393, 756, 750, 577, 29889, 13, 362, 29892, 4023, 465, 358, 29892, 938, 326, 333, 362, 29892, 322, 8227, 5890, 2729, 373, 5046, 29892, 23346, 29892, 7916, 29892, 8175, 29892, 2927, 29892, 13433, 29892, 19525, 719, 29892, 4797, 3978, 29892, 4797, 537, 29892, 11314, 7823, 2318, 29769, 29892, 11314, 7823, 537, 29892, 1766, 2410, 470, 3847, 284, 29889, 13, 9782, 3136, 27562, 8967, 2407, 17182, 322, 10489, 20957, 1041, 29892, 2407, 10365, 287, 382, 22698, 7698, 29892, 3889, 274, 1161, 24536, 29892, 263, 4802, 12500, 297, 7787, 2600, 1169, 29892, 322, 5224, 2553, 29873, 297, 967, 660, 29896, 29899, 29906, 29900, 29906, 29896, 2582, 29889, 5345, 3136, 27562, 29915, 2326, 11753, 29889, 13, 1576, 5345, 3136, 315, 5315, 6938, 1751, 1078, 2211, 6350, 6609, 411, 901, 1135, 29871, 29946, 29953, 29900, 29892, 29900, 29900, 29900, 23931, 322, 29871, 29896, 29906, 29892, 29900, 29900, 29900, 27498, 29892, 29263, 278, 20801, 363, 367, 1389, 11029, 1223, 18541, 29889, 11856, 17163, 29879, 8213, 27562, 13, 4013, 3824, 1913, 355, 358, 313, 1552, 1913, 355, 358, 29897, 304, 393, 3058, 5703, 358, 17327, 1546, 5345, 3136, 27562, 6938, 29892, 263, 10319, 17266, 362, 313, 9782, 3136, 511, 16684, 1549, 967, 12590, 310 ]
1,333,649
2,048
CommonCrawl
15
4
Directors, and Billy E. Goodwin (Employee) dated February 19, 2016 (the Agreement) is entered into and effective as of August 1, 2018 This First Amendment (the Amendment) to that certain employment agreement between Matador Resources Company, a Texas corporation (Matador), acting through its Board of Directors, and G. Gregg Krug (Employee) dated February 19, 2016 (the Agreement) is entered into and effective as of July 30, 2019 Matador Resources Q2 2021 Earnings Call Jul 28, 2021, 10:00 a.m. ET. Contents: Prepared Remarks; Questions and Answers; Call Participants; Prepared Remarks: Operator. Good morning, ladies and. Matador Resources Company (NYSE: MTDR) (Matador or the Company) today announced that its Board of Directors (the Board) adopted a dividend poli Matador Resources Company. Jul 2014 - Present6 years 1 month. Dallas, TX. Currently focused on the Delaware Basin. • Evaluating acreage economically, geologically, and operationally. About Matador Resources Company. 5400 LBJ FREEWAY SUITE 1500, ONE LINCOLN CENTRE, DALLAS, Texas, 75240, United States +1 972 371-5200. Matador Resources Co is an independent energy company engaged. Matador Resources (MTDR) could be a solid choice for investors given its recent upgrade to a Zacks Rank #2 (Buy). This rating change essentially reflects an upward trend in earnings estimates. About MTDR. Matador Resources Co. is a holding company, which engages in the exploration, development, production, and acquisition of oil and natural gas resources. It operates through the following segments: Exploration and Production, Midstream, and Corporate David Lancaster accepted the chief financial officer job with Matador Resources (NYSE: MTDR). He's seen the company grow to just under $300 million in revenue last year, led the company through an. Matador Resources Company LinkedI Find the latest Matador Resources Company (MTDR) stock discussion in Yahoo Finance's forum. Share your opinion and gain insight from other stock traders and investors Headquartered in Dallas, TX, Matador Resources has a strong footprint in the liquid-rich Delaware Basin's Wolfcamp and Bone Spring plays. The company is likely to see earnings growth of 560% and. Matador Involvement Center. Community Service. Associated Students recycling program. International Students. Matador Involvement Center. University Ambassadors. Jobs and Internships. Career Center. Disability Resources and Educational Services. Human Resources. Student Housing. Student Health Center. University Student Union. Work-Stud Matador Resources Co is an independent energy company engaged in the exploration, development, production, and acquisition of oil and natural gas resources Matador Resources Company is estimated to report earnings on 07/27/2021. The upcoming earnings date is derived from an algorithm based on a company's historical reporting dates. Our vendor, Zacks. Matador is an independent energy company engaged in the exploration, development, production and acquisition of oil and natural gas resources in the United States, with an emphasis on oil and. This First Amendment (the Amendment) to that certain Amended and Restated Employment Agreement by and between Matador Resources Company, a Texas corporation (Matador), acting through its Board of Directors, and Bradley M. Robinson (Employee) effective August 1, 2018 (the Agreement) is entered into as of July 30, 2019 Matador Resources' revenues declined by 4% from $899 million in 2018 to $862 million in 2020 as the pandemic drove down energy demand. While benchmark prices observed a 30% contraction last year. Matador Resources (MTDR) In a report released yesterday, Scott Hanold from RBC Capital maintained a Buy rating on Matador Resources, with a price target of $40.00. The company's shares closed last Wednesday at $31.87. According to TipRanks
-1.593872
-1.042435
-1.702711
-0.941636
[ -1.5418240315921188, -1.6459193641960246 ]
[ -1.2662632208348577, -0.8186060755074281 ]
[ -1.7508994944217882, -1.654522335457186 ]
[ -0.7741726926871099, -1.1090991147246687 ]
1,024
[ 512, 512 ]
[ 8797, 943, 29892, 322, 18299, 382, 29889, 7197, 5080, 313, 19461, 29897, 29797, 6339, 29871, 29896, 29929, 29892, 29871, 29906, 29900, 29896, 29953, 313, 1552, 4059, 276, 882, 29897, 338, 7802, 964, 322, 11828, 408, 310, 3111, 29871, 29896, 29892, 29871, 29906, 29900, 29896, 29947, 13, 4013, 3824, 1913, 355, 358, 313, 1552, 1913, 355, 358, 29897, 304, 393, 3058, 5703, 358, 17327, 1546, 5345, 3136, 27562, 6938, 29892, 263, 10319, 17266, 362, 313, 9782, 3136, 511, 16684, 1549, 967, 12590, 310, 8797, 943, 29892, 322, 402, 29889, 4122, 1505, 476, 11124, 313, 19461, 29897, 29797, 6339, 29871, 29896, 29929, 29892, 29871, 29906, 29900, 29896, 29953, 313, 1552, 4059, 276, 882, 29897, 338, 7802, 964, 322, 11828, 408, 310, 5468, 29871, 29941, 29900, 29892, 29871, 29906, 29900, 29896, 29929, 13, 9782, 3136, 27562, 660, 29906, 29871, 29906, 29900, 29906, 29896, 382, 2753, 886, 8251, 2739, 29871, 29906, 29947, 29892, 29871, 29906, 29900, 29906, 29896, 29892, 29871, 29896, 29900, 29901, 29900, 29900, 263, 29889, 29885, 29889, 382, 29911, 29889, 2866, 1237, 29901, 349, 3445, 1965, 5240, 17862, 29936, 894, 29879, 322, 530, 5956, 29936, 8251, 3455, 12654, 1934, 29936, 349, 3445, 1965, 5240, 17862, 29901, 6607, 1061, 29889, 7197, 7250, 29892, 22281, 322, 29889, 5345, 3136, 27562, 6938, 313, 29940, 29979, 1660, 29901, 341, 29911, 8353, 29897, 313, 9782, 3136, 470, 278, 6938, 29897, 9826, 9326, 393, 967, 12590, 310, 8797, 943, 313, 1552, 12590, 29897, 16356, 263, 25227, 355, 1248, 29875, 5345, 3136, 27562, 6938, 29889, 2739, 29871, 29906, 29900, 29896, 29946, 448, 4360, 296, 29953, 2440, 29871, 29896, 4098, 29889, 27043, 29892, 323, 29990, 29889, 15447, 21309, 373, 278, 5556, 28327, 4886, 262, 29889, 10266, 382, 4387, 1218, 263, 1037, 482, 7766, 1711, 29892, 1737, 1189, 1711, 29892, 322, 5858, 635, 29889, 13611, 5345, 3136, 27562, 6938, 29889, 29871, 29945, 29946, 29900, 29900, 365, 29933, 29967, 383, 21661, 12982, 29979, 20134, 9094, 29871, 29896, 29945, 29900, 29900, 29892, 6732, 29923, 21724, 15032, 29940, 315, 3919, 1525, 29892, 360, 9818, 3289, 29892, 10319, 29892, 29871, 29955, 29945, 29906, 29946, 29900, 29892, 3303, 3900, 718, 29896, 29871, 29929, 29955, 29906, 29871, 29941, 29955, 29896, 29899, 29945, 29906, 29900, 29900, 29889, 5345, 3136, 27562, 3189, 338, 385, 7417, 5864, 5001, 17785, 29889, 13, 9782, 3136, 27562, 313, 11490, 8353, 29897, 1033, 367, 263, 7773, 7348, 363, 13258, 943, 2183, 967, 7786, 14955, 304, 263, 796, 26514, 22125, 396, 29906, 313, 3727, 29891, 467, 910, 21700, 1735, 13674, 9432, 29879, 385, 701, 1328, 534, 355, 297, 2326, 11753, 21875, 29889, 13611, 341, 29911, 8353, 29889, 5345, 3136, 27562, 3189, 29889, 338, 263, 13587, 5001, 29892, 607, 3033, 1179, 297, 278, 3902, 12418, 29892, 5849, 29892, 5802, 29892, 322, 1274, 23493, 310, 17182, 322, 5613, 10489, 7788, 29889, 739, 1751, 1078, 1549, 278, 1494, 24611, 29901, 1222, 572, 12418, 322, 19561, 29892, 13370, 5461, 29892, 322, 12767, 403, 4699, 24994, 1901, 9259, 278, 9087, 18161, 12139, 4982, 411, 5345, 3136, 27562, 313, 29940, 29979, 1660, 29901, 341, 29911, 8353, 467, 940, 29915, 29879, 3595, 278, 5001, 6548, 304, 925, 1090, 395, 29941, 29900, 29900, 7284, 297, 337, 9947, 1833, 1629, 29892, 5331, 278, 5001, 1549, 385, 29889, 13, 9782, 3136, 27562, 6938, 28547, 29902, 13, 12542, 278, 9281, 5345, 3136, 27562, 6938, 313, 11490, 8353, 29897, 10961, 10679, 297, 612, 26779, 4231, 749, 29915, 29879, 24179, 29889, 26849, 596, 9426, 322, 11581, 25483, 515, 916, 10961, 3534, 414, 322, 13258, 943, 12252, 339, 4254, 287, 297, 27043, 29892, 323, 29990, 29892, 5345, 3136, 27562, 756, 263, 4549, 3661, 2158, 297, 278, 23904, 29899, 4018, 5556, 28327, 4886, 262, 29915, 29879, 10441, 24821, 322, 350, 650, 7206, 13582, 29889, 450, 5001, 338, 5517, 304, 1074, 2326, 11753, 14321, 310, 29871, 29945, 29953, 29900, 29995, 322, 29889, 5345, 3136, 512, 1555, 29841, 7817, 29889, 19184, 6692, 29889, 6853, 630, 5088, 1237, 1162, 29891, 19914, 1824, 29889, 4623, 5088, 1237, 29889, 5345, 3136, 512, 1555, 29841, 7817, 29889, 3014, 15145, 465, 24549, 29889, 17163, 29879, 322, 2422, 9981, 29889, 15825, 7817, 29889, 3295, 3097, 27562, 322, 7519, 29883, 1288, 15538, 29889, 12968, 27562, 29889, 15740, 379, 681, 292, 29889, 15740, 15202, 7817, 29889, 3014, 15740, 7761, 29889, 5244, 29899, 855, 566, 5345, 3136, 27562, 3189, 338, 385, 7417, 5864, 5001, 17785, 297, 278, 3902, 12418, 29892, 5849, 29892, 5802, 29892, 322, 1274, 23493, 310, 17182, 322, 5613, 10489, 7788, 13, 9782, 3136, 27562, 6938, 338, 15899, 304, 3461, 2326, 11753, 373, 29871, 29900, 29955, 29914, 29906, 29955, 29914, 29906, 29900, 29906, 29896, 29889, 450, 701, 11506, 2326, 11753, 2635, 338, 10723, 515, 385, 5687, 2729, 373, 263, 5001, 29915, 29879, 15839, 23415, 10116, 29889, 8680, 27042, 29892, 796, 26514, 29889, 5345, 3136, 338, 385, 7417, 5864, 5001, 17785, 297, 278, 3902, 12418, 29892, 5849, 29892, 5802, 322, 1274, 23493, 310, 17182, 322, 5613, 10489, 7788, 297, 278, 3303, 3900, 29892, 411, 385, 19310, 275, 373, 17182, 322, 29889, 910, 3824, 1913, 355, 358, 313, 1552, 1913, 355, 358, 29897, 304, 393, 3058, 1913, 2760, 322, 11654, 630, 7361, 22812, 4059, 276, 882, 491, 322, 1546, 5345, 3136, 27562, 6938, 29892, 263, 10319, 17266, 362, 313, 9782, 3136, 511, 16684, 1549, 967, 12590, 310, 8797, 943, 29892, 322, 15862, 2330, 341, 29889, 22265, 313, 19461, 29897, 11828, 3111, 29871, 29896, 29892, 29871, 29906, 29900, 29896, 29947, 313, 1552, 4059, 276, 882, 29897, 338, 7802, 964, 408, 310, 5468, 29871, 29941, 29900, 29892, 29871, 29906, 29900, 29896, 29929, 5345, 3136, 27562, 29915, 20957, 1041, 4845, 1312, 491, 29871, 29946, 29995, 515, 395, 29947, 29929, 29929, 7284, 297, 29871, 29906, 29900, 29896, 29947, 304, 395, 29947, 29953, 29906, 7284, 297, 29871, 29906, 29900, 29906, 29900, 408, 278, 7243, 24552, 26603, 1623, 5864, 9667, 29889, 5806, 23513, 26094, 8900, 263, 29871, 29941, 29900, 29995, 6761, 428, 1833, 1629, 29889, 5345, 3136, 27562, 313, 11490, 8353, 29897, 512, 263, 3461, 5492, 22600, 29892, 8075, 7169, 1025, 515, 390, 5371, 25343, 19949, 263, 5373, 29891, 21700, 373, 5345, 3136, 27562, 29892, 411, 263, 8666, 3646, 310, 395, 29946, 29900, 29889, 29900, 29900, 29889, 450, 5001, 29915, 29879, 29358, 5764, 1833, 15050, 4515, 3250, 472, 395, 29941, 29896, 29889, 29947, 29955, 29889, 7579, 304, 323, 666, 29934, 1331 ]
1,333,649
3,072
CommonCrawl
15
4
.com, Hanold is a 3-star analyst with an average return of 4.0% and a 41.7% success rate. Hanold covers. DALLAS (AP) _ Matador Resources Co. (MTDR) on Tuesday reported second-quarter net income of $105.9 million, after reporting a loss in the same period a year earlier. On a per-share basis, the. Matador Resources (MTDR)+5% post-market after easily beating Q2 earnings expectations and setting all-time quarterly records for oil and natural gas production, oil and natural.. Matador Resources (MTDR) Q2 2021 Earnings Call Transcript From The Motley Fool Jul 29, 2021 MTDR earnings call for the period ending June 30, 2021 Matador Resources Company operates as an independent energy company engaged in the exploration, development, production, and acquisition of oil and natural gas resources. The Company offers its. Working at Matador Resources Company in Dallas, TX Browse New Full And Part-Time Positions.Apply Today, Start Your Career Tomorrow! Full-Time And Part-Time Employment Available. Apply Today While Openings Remain Tampa Location. 5102 West Laurel St. Suite 500 Tampa, FL 33607 Phone: 813-449-4800 Fax: 813-289-363 Our employees connect to patients through compassionate care and clinical excellence. Search positions at Encompass Health and be the connection to better patient experiences, superior outcomes and rewarding careers An open and transparent culture, management experience, and diversity on all fronts are a few of the reasons Technical Lead Kyri Paterson loves working at CrowdRiff. What could have been the beginning of the end for CrowdRiff and others in the industry offered a unique opportunity for transformation Acknowledge. Matadors Community Credit Union may collect the following information from users of our website. To see how this information is used, click here to go to our privacy page. Information we may collect: IP address, browsing history, search history, products and services considered, geolocation data, and information about your interaction with our website, application or advertisement Exploring What's Possible. Apache's relentless pursuit of opportunity drives us to discover new resources, capture assets and acreage and build lasting value for our shareholders. Exploring what's possible is the union of curiosity, intellect and hard work, built on mutual respect, integrity and strong sense of responsibility for ourselves, our. Matador Cattle Company - Koch Career Matador makes equipment designed for efficient, objective-based travel. Designed by experts in their Boulder, CO headquarters and thoroughly tested on real outdoor travel pursuits, Matador products are armed with everything you need with nothing you don't Ascent Resources is a dynamic, exciting place to work and our success begins and ends with our talented team of oil and gas professionals. We are currently growing our operations and taking on some of the biggest exploration and production challenges in Appalachia which means we have a wide variety of career opportunities available in Cambridge. In addition to his role at Matador, Justin is an Executive Director at Gold Road Resources (GOR.ASX) and played a pivotal role in the rapid and effective resource development of the world class Gruyere Gold Deposit (6.6Moz Au) which currently producers approximately 300,000oz Au per annum Bachelor's Degree in Accounting or related field. 5+ years' experience in the management of financial systems, financial data analysis, and auditing. Proficiency in Microsoft Word, Outlook and Access; Advanced skills in Microsoft Excel (pivot tables, merges, macros, statistical formulas) Growing understanding of the practical application of. Matador Records. Coming August 27 : Steve Gunn - 'Other You'. Coming July 9 : The Goon Sax - 'Mirror II'. Lucy Dacus - 'Home Video' - Out Now. Coming July 23 : DARKSIDE - 'Spiral'. Mdou Moctar - 'Afrique Victime' - Out Now. Fucked Up - 'David Comes To Life' 10th Anniversary Edition. Julien Baker - Little. Resources include, in alphabetical order: Academic advising We will make sure you get the classes you need as
-1.022032
-1.047807
-1.190073
-1.219007
[ -1.591132347036074, -0.45293206553810406 ]
[ -1.3593759070629632, -0.736237160767181 ]
[ -1.7103196380156398, -0.6698267573517435 ]
[ -1.6241704278387399, -0.8138435892779664 ]
1,024
[ 512, 512 ]
[ 29889, 510, 29892, 7169, 1025, 338, 263, 29871, 29941, 29899, 8508, 3483, 858, 411, 385, 6588, 736, 310, 29871, 29946, 29889, 29900, 29995, 322, 263, 29871, 29946, 29896, 29889, 29955, 29995, 2551, 6554, 29889, 7169, 1025, 18469, 29889, 13, 29928, 9818, 3289, 313, 3301, 29897, 903, 5345, 3136, 27562, 3189, 29889, 313, 11490, 8353, 29897, 373, 323, 1041, 3250, 8967, 1473, 29899, 339, 4254, 7787, 17869, 310, 395, 29896, 29900, 29945, 29889, 29929, 7284, 29892, 1156, 23415, 263, 6410, 297, 278, 1021, 3785, 263, 1629, 8859, 29889, 1551, 263, 639, 29899, 13653, 8405, 29892, 278, 29889, 5345, 3136, 27562, 313, 11490, 8353, 7240, 29945, 29995, 1400, 29899, 28549, 1156, 5948, 367, 1218, 660, 29906, 2326, 11753, 2149, 800, 322, 4444, 599, 29899, 2230, 12616, 368, 6475, 363, 17182, 322, 5613, 10489, 5802, 29892, 17182, 322, 5613, 636, 5345, 3136, 27562, 313, 11490, 8353, 29897, 660, 29906, 29871, 29906, 29900, 29906, 29896, 382, 2753, 886, 8251, 4103, 924, 3645, 450, 7142, 2330, 383, 1507, 2739, 29871, 29906, 29929, 29892, 29871, 29906, 29900, 29906, 29896, 341, 29911, 8353, 2326, 11753, 1246, 363, 278, 3785, 17140, 5306, 29871, 29941, 29900, 29892, 29871, 29906, 29900, 29906, 29896, 5345, 3136, 27562, 6938, 1751, 1078, 408, 385, 7417, 5864, 5001, 17785, 297, 278, 3902, 12418, 29892, 5849, 29892, 5802, 29892, 322, 1274, 23493, 310, 17182, 322, 5613, 10489, 7788, 29889, 450, 6938, 16688, 967, 29889, 13, 5531, 292, 472, 5345, 3136, 27562, 6938, 297, 27043, 29892, 323, 29990, 13, 29933, 798, 344, 1570, 14846, 1126, 3455, 29899, 2481, 10321, 2187, 29889, 2052, 368, 20628, 29892, 7370, 3575, 15825, 4335, 22396, 29991, 14846, 29899, 2481, 1126, 3455, 29899, 2481, 7361, 22812, 7740, 3106, 29889, 2401, 368, 20628, 5806, 4673, 886, 5240, 475, 323, 20056, 17015, 29889, 29871, 29945, 29896, 29900, 29906, 3122, 997, 545, 29880, 624, 29889, 2166, 568, 29871, 29945, 29900, 29900, 323, 20056, 29892, 383, 29931, 29871, 29941, 29941, 29953, 29900, 29955, 24323, 29901, 29871, 29947, 29896, 29941, 29899, 29946, 29946, 29929, 29899, 29946, 29947, 29900, 29900, 383, 1165, 29901, 29871, 29947, 29896, 29941, 29899, 29906, 29947, 29929, 29899, 29941, 29953, 29941, 8680, 22873, 4511, 304, 22069, 1549, 752, 465, 291, 403, 2562, 322, 24899, 936, 12567, 663, 29889, 11856, 11909, 472, 1174, 2388, 465, 15202, 322, 367, 278, 3957, 304, 2253, 16500, 27482, 29892, 11558, 714, 26807, 322, 20751, 292, 2562, 414, 13, 2744, 1722, 322, 17772, 9257, 29892, 10643, 7271, 29892, 322, 6894, 537, 373, 599, 4565, 29879, 526, 263, 2846, 310, 278, 9590, 8364, 936, 951, 328, 16931, 374, 4121, 1330, 12355, 267, 1985, 472, 29445, 29881, 29934, 2593, 29889, 1724, 1033, 505, 1063, 278, 6763, 310, 278, 1095, 363, 29445, 29881, 29934, 2593, 322, 4045, 297, 278, 13661, 12520, 263, 5412, 15130, 363, 13852, 319, 15415, 5485, 29889, 5345, 24549, 19184, 24596, 277, 7761, 1122, 6314, 278, 1494, 2472, 515, 4160, 310, 1749, 4700, 29889, 1763, 1074, 920, 445, 2472, 338, 1304, 29892, 2828, 1244, 304, 748, 304, 1749, 5999, 4135, 1813, 29889, 10343, 591, 1122, 6314, 29901, 5641, 3211, 29892, 3347, 2976, 4955, 29892, 2740, 4955, 29892, 9316, 322, 5786, 5545, 29892, 1737, 324, 10610, 848, 29892, 322, 2472, 1048, 596, 14881, 411, 1749, 4700, 29892, 2280, 470, 18811, 275, 882, 1222, 572, 8253, 1724, 29915, 29879, 20049, 29889, 13380, 29915, 29879, 1104, 296, 2222, 12359, 3121, 310, 15130, 25100, 502, 304, 6523, 716, 7788, 29892, 10446, 21608, 322, 263, 1037, 482, 322, 2048, 1833, 292, 995, 363, 1749, 6232, 8948, 414, 29889, 1222, 572, 8253, 825, 29915, 29879, 1950, 338, 278, 9833, 310, 27742, 29892, 18715, 322, 2898, 664, 29892, 4240, 373, 5478, 950, 3390, 29892, 28410, 322, 4549, 4060, 310, 23134, 363, 20278, 29892, 1749, 29889, 13, 9782, 3136, 315, 5315, 6938, 448, 25911, 15825, 13, 9782, 3136, 3732, 21083, 8688, 363, 8543, 29892, 12091, 29899, 6707, 9850, 29889, 12037, 287, 491, 2902, 1372, 297, 1009, 350, 483, 261, 29892, 4810, 26463, 322, 26606, 9528, 373, 1855, 714, 17433, 9850, 12359, 19544, 29892, 5345, 3136, 9316, 526, 23926, 411, 4129, 366, 817, 411, 3078, 366, 1016, 29915, 29873, 1094, 1760, 27562, 338, 263, 7343, 29892, 5566, 11407, 2058, 304, 664, 322, 1749, 2551, 16410, 322, 10614, 411, 1749, 5969, 14927, 3815, 310, 17182, 322, 10489, 6351, 1338, 29889, 1334, 526, 5279, 15678, 1749, 6931, 322, 5622, 373, 777, 310, 278, 24842, 3902, 12418, 322, 5802, 18066, 267, 297, 2401, 284, 496, 423, 607, 2794, 591, 505, 263, 9377, 12875, 310, 6413, 28602, 1907, 3625, 297, 12585, 29889, 512, 6124, 304, 670, 6297, 472, 5345, 3136, 29892, 26408, 338, 385, 28841, 15944, 472, 6650, 9321, 27562, 313, 29954, 1955, 29889, 3289, 29990, 29897, 322, 5318, 263, 282, 440, 7288, 6297, 297, 278, 10952, 322, 11828, 6503, 5849, 310, 278, 3186, 770, 5430, 29891, 406, 6650, 897, 1066, 277, 313, 29953, 29889, 29953, 29924, 2112, 8407, 29897, 607, 5279, 1391, 22543, 14235, 29871, 29941, 29900, 29900, 29892, 29900, 29900, 29900, 2112, 8407, 639, 385, 1949, 13620, 12779, 29915, 29879, 360, 387, 929, 297, 16535, 292, 470, 4475, 1746, 29889, 29871, 29945, 29974, 2440, 29915, 7271, 297, 278, 10643, 310, 18161, 6757, 29892, 18161, 848, 7418, 29892, 322, 12990, 11407, 29889, 6175, 293, 13396, 297, 7783, 10803, 29892, 4451, 6914, 322, 11028, 29936, 29287, 25078, 297, 7783, 11388, 313, 29886, 11002, 6131, 29892, 2778, 2710, 29892, 5825, 1883, 29892, 24148, 26760, 29897, 402, 798, 292, 8004, 310, 278, 15031, 2280, 310, 29889, 13, 9782, 3136, 7983, 29889, 422, 292, 3111, 29871, 29906, 29955, 584, 13981, 402, 5963, 448, 525, 16107, 887, 4286, 422, 292, 5468, 29871, 29929, 584, 450, 2921, 265, 18574, 448, 525, 29924, 381, 729, 1944, 4286, 28846, 360, 562, 375, 448, 525, 11184, 13987, 29915, 448, 4451, 2567, 29889, 422, 292, 5468, 29871, 29906, 29941, 584, 360, 1718, 17557, 22027, 448, 525, 5592, 19647, 4286, 341, 29881, 283, 4546, 312, 279, 448, 525, 29909, 24361, 7229, 603, 29915, 448, 4451, 2567, 29889, 383, 2707, 287, 5020, 448, 525, 19504, 422, 267, 1763, 4634, 29915, 29871, 29896, 29900, 386, 530, 1240, 27547, 17138, 29889, 2739, 819, 22652, 448, 11143, 29889, 27562, 3160, 29892, 297, 22968, 936, 1797, 29901, 16146, 293, 25228, 292, 1334, 674, 1207, 1854, 366, 679, 278, 4413, 366, 817, 408 ]
1,333,649
4,096
CommonCrawl
15
4
a freshman. In April the Matador Advising Hub will begin contacting students to schedule advising appointments to help you select your fall 2021 courses. Advising appointments for new students generally start in late May Job Postings Recruiter. Location Reston, VA; Type Contract to Hire; Commitment Part-time; Posted: 07/30/2021 Consulting firm that supports government contractors seeking a part-time, virtual Recruiter with government contracting experience External Career Applicants California State University Matador Creators is built for photographers, filmmakers, influencers, videographers, and producers. Open Opportunities. Matador is accepting pitches on fashion. Contributor Opportunities. Pays $80-100 USD. Apply. Matador is accepting pitches on wellness and health. Contributor Opportunities Mr. Lothamer joined Matador Resources Company in 2018. Prior to joining Matador Resources Company, Mr. Lothamer worked for Southcross Energy, LLC for 8 years having spent the majority of the his tenure serving as the Vice President of Gas Supply, Marketing, and Business Development. Mr Through three private Lime Rock Resources funds and LRR Energy, Lime Rock Resources acquires, operates, and improves producing U.S. oil and gas properties Mount Miguel High School is joining Michelle Obama and her @reachhigher & @bettermakeroom initiatives and are celebrating our Matadors who are going on to college or enlisting in the military. •. Happy Virtual College & Career Signing Week 2021! @mmhsmatadors @themountasb @guhsd_collegecareerreadiness. • Shares of Matador Resources Inc (NYSE:MTDR) rose by 7% from the previous closing price.A Form 4 filing filed with the SEC on Wednesday, November 18 showed that Ehrman Monika U bought 1,123 shares. Pursuant to the Matador Resources Company 2019 Long-Term Incentive Plan days prior to or twelve (12) months following a Change in Control (as defined in the Employment Agreement), the Participant incurs a Termination of Service by the Company without Just Cause (as defined in the Employment Agreement) or by the Participant with [or without. Funk has previously served on the boards of Westport Resources (2000 to 2004), Matador Resources Company (2003 to 2008), and Superior Energy Services, Inc. (2016 to 2021). Mr. Funk received a B.A. degree in Geology from Wittenberg University, a M.S. in Geology from the University of Connecticut, and a PhD in Geology from the University of Kansas Matador offers its own set of ESL resources, including The Insider's Guide to Teaching English In Asia, The Eight Hidden Benefits of Teaching English Abroad, Top Ten Places for Teaching English Abroad, and the classic Meet Your ESL Coworkers Job Postings Recruiting Coordinator. Location Arlington, VA; Type Contract to Hire; Commitment Part-time; Posted: 07/09/2021 Government contractor in Arlington, VA seeks part-time, virtual Recruiting Coordinator to support the DIrector of Human Resources Mount Miguel High School is a public, comprehensive high school located in Spring Valley, California and serves over 1,400 students in grades nine through twelve Matador Resources Co. is a holding company, which engages in the exploration, development, production, and acquisition of oil and natural gas resources. It operates through the following segments. Benchmarking study for (Matador Resources Co (MTDR:NYS)) includes growth forecast for its primary industry to the year 2027. The purpose of this report is to provide vital corporate-specific benchmarks, comparing the Subject Company to its top competitors (on a company-by-company basis) and to the averages within its primary industry for all. Matador Resources (MTDR): Q2 Non-GAAP EPS of $1.02 beats by $0.23; GAAP EPS of $0.89 beats by $0.10.Revenue of $357.43M (+468.1% Y
-1.300761
-0.741609
-1.147274
-0.784578
[ -1.2952824543723418, -1.306239857804332 ]
[ -1.2877507638105743, -0.19546732921164603 ]
[ -1.0762593816695727, -1.2182888790910917 ]
[ -1.2651813308198419, -0.3039750167004011 ]
1,024
[ 512, 512 ]
[ 263, 10849, 1171, 29889, 512, 3786, 278, 5345, 3136, 2087, 1730, 292, 14533, 674, 3380, 6958, 292, 8041, 304, 20410, 25228, 292, 8167, 1860, 304, 1371, 366, 1831, 596, 6416, 29871, 29906, 29900, 29906, 29896, 21888, 29889, 2087, 1730, 292, 8167, 1860, 363, 716, 8041, 6892, 1369, 297, 5683, 2610, 17163, 4918, 886, 3599, 582, 1524, 29889, 17015, 11654, 265, 29892, 478, 29909, 29936, 5167, 2866, 1461, 304, 379, 533, 29936, 1876, 277, 358, 3455, 29899, 2230, 29936, 4918, 287, 29901, 29871, 29900, 29955, 29914, 29941, 29900, 29914, 29906, 29900, 29906, 29896, 2138, 499, 292, 9226, 393, 11286, 5874, 8078, 943, 25738, 263, 760, 29899, 2230, 29892, 6901, 3599, 582, 1524, 411, 5874, 8078, 292, 7271, 13, 25865, 15825, 2401, 506, 1934, 8046, 4306, 3014, 13, 9782, 3136, 6760, 4097, 338, 4240, 363, 17739, 414, 29892, 2706, 29885, 21079, 29892, 13787, 22543, 29892, 18900, 1946, 414, 29892, 322, 1391, 22543, 29889, 4673, 438, 3016, 348, 1907, 29889, 5345, 3136, 338, 25967, 15905, 267, 373, 13460, 29889, 2866, 1091, 3406, 438, 3016, 348, 1907, 29889, 15867, 395, 29947, 29900, 29899, 29896, 29900, 29900, 3148, 29928, 29889, 2401, 368, 29889, 5345, 3136, 338, 25967, 15905, 267, 373, 1532, 2264, 322, 9045, 29889, 2866, 1091, 3406, 438, 3016, 348, 1907, 3237, 29889, 365, 720, 4183, 8772, 5345, 3136, 27562, 6938, 297, 29871, 29906, 29900, 29896, 29947, 29889, 22096, 304, 22960, 5345, 3136, 27562, 6938, 29892, 3237, 29889, 365, 720, 4183, 3796, 363, 4275, 19128, 24836, 29892, 365, 12182, 363, 29871, 29947, 2440, 2534, 10398, 278, 13638, 310, 278, 670, 3006, 545, 16330, 408, 278, 21400, 7178, 310, 19141, 9179, 368, 29892, 4485, 15133, 29892, 322, 15197, 14650, 29889, 3237, 17044, 2211, 2024, 365, 603, 8027, 27562, 29199, 322, 365, 29934, 29934, 24836, 29892, 365, 603, 8027, 27562, 10695, 2658, 29892, 1751, 1078, 29892, 322, 4857, 1960, 20811, 501, 29889, 29903, 29889, 17182, 322, 10489, 4426, 13, 27648, 16682, 5057, 4523, 338, 22960, 3375, 1808, 4250, 3304, 322, 902, 732, 276, 496, 9812, 261, 669, 732, 6878, 8489, 557, 1489, 290, 14511, 5056, 322, 526, 10894, 1218, 1749, 5345, 24549, 1058, 526, 2675, 373, 304, 12755, 470, 427, 1761, 292, 297, 278, 9121, 29889, 10266, 29889, 28569, 19181, 6346, 669, 15825, 9954, 292, 15511, 29871, 29906, 29900, 29906, 29896, 29991, 732, 4317, 9499, 2922, 24549, 732, 386, 331, 792, 294, 29890, 732, 2543, 29882, 4928, 29918, 1054, 4424, 18020, 261, 949, 3335, 29889, 10266, 1383, 5114, 310, 5345, 3136, 27562, 9266, 313, 29940, 29979, 1660, 29901, 11490, 8353, 29897, 11492, 491, 29871, 29955, 29995, 515, 278, 3517, 14382, 8666, 29889, 29909, 3812, 29871, 29946, 977, 292, 934, 29881, 411, 278, 3725, 29907, 373, 15050, 4515, 3250, 29892, 3979, 29871, 29896, 29947, 10018, 393, 29245, 1171, 2598, 4106, 501, 18093, 29871, 29896, 29892, 29896, 29906, 29941, 29358, 29889, 349, 1295, 29884, 424, 304, 278, 5345, 3136, 27562, 6938, 29871, 29906, 29900, 29896, 29929, 6242, 29899, 14343, 512, 1760, 573, 8402, 3841, 7536, 304, 470, 17680, 313, 29896, 29906, 29897, 7378, 1494, 263, 10726, 297, 11264, 313, 294, 3342, 297, 278, 7361, 22812, 4059, 276, 882, 511, 278, 3455, 12654, 424, 5528, 1295, 263, 11814, 3381, 310, 6692, 491, 278, 6938, 1728, 3387, 315, 1071, 313, 294, 3342, 297, 278, 7361, 22812, 4059, 276, 882, 29897, 470, 491, 278, 3455, 12654, 424, 411, 518, 272, 1728, 29889, 383, 2960, 756, 9251, 6766, 373, 278, 1045, 3163, 310, 3122, 637, 27562, 313, 29906, 29900, 29900, 29900, 304, 29871, 29906, 29900, 29900, 29946, 511, 5345, 3136, 27562, 6938, 313, 29906, 29900, 29900, 29941, 304, 29871, 29906, 29900, 29900, 29947, 511, 322, 5670, 1611, 24836, 15538, 29892, 9266, 29889, 313, 29906, 29900, 29896, 29953, 304, 29871, 29906, 29900, 29906, 29896, 467, 3237, 29889, 383, 2960, 4520, 263, 350, 29889, 29909, 29889, 7426, 297, 1879, 3002, 515, 399, 16097, 2552, 3014, 29892, 263, 341, 29889, 29903, 29889, 297, 1879, 3002, 515, 278, 3014, 310, 27230, 29892, 322, 263, 1963, 29928, 297, 1879, 3002, 515, 278, 3014, 310, 20029, 5345, 3136, 16688, 967, 1914, 731, 310, 382, 12750, 7788, 29892, 3704, 450, 13377, 1241, 29915, 29879, 16886, 304, 1920, 9733, 4223, 512, 14325, 29892, 450, 382, 523, 379, 4215, 4111, 1389, 1169, 310, 1920, 9733, 4223, 1976, 9972, 29892, 7488, 12444, 23178, 363, 1920, 9733, 4223, 1976, 9972, 29892, 322, 278, 22037, 2191, 300, 3575, 382, 12750, 21638, 548, 414, 13, 11947, 4918, 886, 3599, 9216, 292, 3189, 4194, 1061, 29889, 17015, 826, 1847, 880, 29892, 478, 29909, 29936, 5167, 2866, 1461, 304, 379, 533, 29936, 1876, 277, 358, 3455, 29899, 2230, 29936, 4918, 287, 29901, 29871, 29900, 29955, 29914, 29900, 29929, 29914, 29906, 29900, 29906, 29896, 10354, 8078, 272, 297, 826, 1847, 880, 29892, 478, 29909, 1074, 2039, 760, 29899, 2230, 29892, 6901, 3599, 9216, 292, 3189, 4194, 1061, 304, 2304, 278, 22471, 1621, 272, 310, 12968, 27562, 8040, 16682, 5057, 4523, 338, 263, 970, 29892, 15171, 6270, 1880, 3762, 5982, 297, 7206, 13939, 29892, 8046, 322, 19700, 975, 29871, 29896, 29892, 29946, 29900, 29900, 8041, 297, 867, 3076, 14183, 1549, 17680, 5345, 3136, 27562, 3189, 29889, 338, 263, 13587, 5001, 29892, 607, 3033, 1179, 297, 278, 3902, 12418, 29892, 5849, 29892, 5802, 29892, 322, 1274, 23493, 310, 17182, 322, 5613, 10489, 7788, 29889, 739, 1751, 1078, 1549, 278, 1494, 24611, 29889, 4111, 16580, 292, 6559, 363, 313, 9782, 3136, 27562, 3189, 313, 11490, 8353, 29901, 29940, 21554, 876, 7805, 14321, 29821, 579, 363, 967, 7601, 13661, 304, 278, 1629, 29871, 29906, 29900, 29906, 29955, 29889, 450, 6437, 310, 445, 3461, 338, 304, 3867, 27131, 17266, 403, 29899, 14940, 23513, 29879, 29892, 17420, 278, 3323, 622, 6938, 304, 967, 2246, 5100, 17259, 313, 265, 263, 5001, 29899, 1609, 29899, 14518, 8405, 29897, 322, 304, 278, 4759, 1179, 2629, 967, 7601, 13661, 363, 599, 29889, 13, 9782, 3136, 27562, 313, 11490, 8353, 1125, 660, 29906, 10050, 29899, 12739, 3301, 382, 7024, 310, 395, 29896, 29889, 29900, 29906, 367, 1446, 491, 395, 29900, 29889, 29906, 29941, 29936, 402, 29909, 3301, 382, 7024, 310, 395, 29900, 29889, 29947, 29929, 367, 1446, 491, 395, 29900, 29889, 29896, 29900, 29889, 1123, 9947, 310, 395, 29941, 29945, 29955, 29889, 29946, 29941, 29924, 20532, 29946, 29953, 29947, 29889, 29896, 29995, 612 ]
1,333,649
5,120
CommonCrawl
15
4
/Y) beats by $1.25M.Press Release Javascript is Disabled Your. Food processing careers encompass a variety of job opportunities beyond plant management, quality control, food science and sales. So, whether you have a degree in accounting, human resources or are looking to spread your wings in a career in maintenance, marketing or environmental health and safety, the food manufacturing industry could be the. Matador Resources ( MTDR -1.3%) shares slide into the red after MKM Partners downgrades shares to Neutral from Buy, noting the stock has appreciated over 50% since late March and now reflects fair. Matador Resources cut at MKM in valuation call after 50% run-up Matador Resources Firing On All Cylinders Matador Resources EPS beats by $0.29, beats on revenu Comstock Resources is a leading independent natural gas producer with operations focused on the development of the Haynesville Shale in North Louisiana and East Texas. Earnings and Operations Update Call. August 4th, 2021 11:00 AM EST Dial-in: 844-776-784 If they do continue, the current estimated yields on annualized basis would be 5.45% for Exxon Mobil Corp, 0.33% for Matador Resources Co, and 7.33% for PBF Logistics LP. In Monday trading, Exxon. Matador is an independent energy company engaged in the exploration, development, production and acquisition of oil and natural gas resources in the United States, with an emphasis on oil and natural gas shale and other unconventional plays July 2021. Mt Miguel High School is beginning a new process to generate a facilities request beginning the 2020-2021 school year. All school events will be placed on the Master Calendar. This includes but is not limited to; field trips, athletic competitions, athletic practices, performing arts practices, performing arts events, testing. Matador Resources Co Q1 2021 Earnings Call Apr 30, 2021, 10:00 p.m. ET. Contents: Prepared Remarks; Questions and Answers; Call Participants; Prepared Remarks: Operator. Good morning, ladies and. 1.Grant of Award.Pursuant to the Matador Resources Company Amended and Restated 2012 Long-Term Incentive Plan (the Plan) for Employees, Contractors, and Outside Directors of Matador Resources Company, a Texas corporation (the Company), the Company grants t About Matador Resources Company. Matador is an independent energy company engaged in the exploration, development, production and acquisition of oil and natural gas resources in the United States. Transcripts-Records. Due to the COVID-19 crisis, temperature checks, face masks, and social distancing are required when on campus. 504: Fax request to 619-697-0794, Attn. Mrs. Panarisi. IEP and SPED records: Fax request to 619-697-0794, Attn. Mrs. Munoz. Assessments and Test Records: Fax request to 619-465-9744, Attn. Mrs. Ustaszewski Tuesday's top analyst upgrades and downgrades included Bilibili, Constellation Brands, FedEx, Harley-Davidson, Matador Resources, Twilio and Yandex View Matador Resources Company MTDR investment & stock information. Get the latest Matador Resources Company MTDR detailed stock quotes, stock data, Real-Time ECN, charts, stats and more 2009 Chevrolet Impala price. Lulan wedding Photography. Show Yourself piano notes. Kaichou wa maid sama episodes. Benadryl challenge dose. Apollo 16 facts. Mokan Baseball Teams Looking for players. Enter the text shown below meaning in Punjabi. HP laptop under 20000 in Pakistan. Can t lie baby down after feeding. Bret Michaels wife now 2020. 2002 Hyundai Sonata timing belt or chain. AWS EC2 Instance pricing. American Zoetrope Screenplay Contest 2021
-1.892461
-1.51337
-1.60887
-1.553933
[ -1.7007063813559748, -2.0842155014756276 ]
[ -1.1874755632572302, -1.8392643668539679 ]
[ -1.4719129816295187, -1.7458270123710196 ]
[ -1.1871402227722552, -1.9207266384195687 ]
1,024
[ 512, 512 ]
[ 29914, 29979, 29897, 367, 1446, 491, 395, 29896, 29889, 29906, 29945, 29924, 29889, 10923, 23708, 12728, 338, 3295, 3606, 3575, 29889, 25453, 9068, 2562, 414, 427, 2388, 465, 263, 12875, 310, 4982, 28602, 1907, 8724, 8024, 10643, 29892, 11029, 2761, 29892, 9687, 10466, 322, 16538, 29889, 1105, 29892, 3692, 366, 505, 263, 7426, 297, 3633, 292, 29892, 5199, 7788, 470, 526, 3063, 304, 9677, 596, 24745, 297, 263, 6413, 297, 25413, 29892, 9999, 292, 470, 29380, 9045, 322, 15332, 29892, 278, 9687, 12012, 3864, 13661, 1033, 367, 278, 29889, 5345, 3136, 27562, 313, 341, 29911, 8353, 448, 29896, 29889, 29941, 10997, 29358, 20343, 964, 278, 2654, 1156, 341, 29968, 29924, 3455, 8397, 1623, 629, 3076, 29358, 304, 2448, 329, 1705, 515, 5373, 29891, 29892, 451, 292, 278, 10961, 756, 7556, 975, 29871, 29945, 29900, 29995, 1951, 5683, 4779, 322, 1286, 9432, 29879, 6534, 29889, 5345, 3136, 27562, 5700, 472, 341, 29968, 29924, 297, 17134, 362, 1246, 1156, 29871, 29945, 29900, 29995, 1065, 29899, 786, 5345, 3136, 27562, 383, 8491, 1551, 2178, 315, 2904, 513, 414, 5345, 3136, 27562, 382, 7024, 367, 1446, 491, 395, 29900, 29889, 29906, 29929, 29892, 367, 1446, 373, 20957, 29884, 422, 17712, 27562, 338, 263, 8236, 7417, 5613, 10489, 14297, 411, 6931, 21309, 373, 278, 5849, 310, 278, 11389, 4515, 4909, 1383, 744, 297, 4644, 28838, 322, 6932, 10319, 29889, 382, 2753, 886, 322, 6607, 800, 10318, 8251, 29889, 3111, 29871, 29946, 386, 29892, 29871, 29906, 29900, 29906, 29896, 29871, 29896, 29896, 29901, 29900, 29900, 13862, 382, 1254, 360, 616, 29899, 262, 29901, 29871, 29947, 29946, 29946, 29899, 29955, 29955, 29953, 29899, 29955, 29947, 29946, 13, 3644, 896, 437, 6773, 29892, 278, 1857, 15899, 17498, 373, 17568, 1891, 8405, 723, 367, 29871, 29945, 29889, 29946, 29945, 29995, 363, 1222, 29916, 265, 341, 12213, 2994, 29886, 29892, 29871, 29900, 29889, 29941, 29941, 29995, 363, 5345, 3136, 27562, 3189, 29892, 322, 29871, 29955, 29889, 29941, 29941, 29995, 363, 349, 28062, 4522, 6765, 23671, 29889, 512, 27822, 3534, 292, 29892, 1222, 29916, 265, 29889, 5345, 3136, 338, 385, 7417, 5864, 5001, 17785, 297, 278, 3902, 12418, 29892, 5849, 29892, 5802, 322, 1274, 23493, 310, 17182, 322, 5613, 10489, 7788, 297, 278, 3303, 3900, 29892, 411, 385, 19310, 275, 373, 17182, 322, 5613, 10489, 528, 744, 322, 916, 443, 535, 794, 1848, 13582, 5468, 29871, 29906, 29900, 29906, 29896, 29889, 341, 29873, 16682, 5057, 4523, 338, 6763, 263, 716, 1889, 304, 5706, 263, 23330, 2009, 6763, 278, 29871, 29906, 29900, 29906, 29900, 29899, 29906, 29900, 29906, 29896, 3762, 1629, 29889, 2178, 3762, 4959, 674, 367, 7180, 373, 278, 9082, 26431, 29889, 910, 7805, 541, 338, 451, 9078, 304, 29936, 1746, 3367, 567, 29892, 28563, 293, 5100, 2187, 29892, 28563, 293, 23274, 29892, 15859, 16930, 23274, 29892, 15859, 16930, 4959, 29892, 6724, 29889, 5345, 3136, 27562, 3189, 660, 29896, 29871, 29906, 29900, 29906, 29896, 382, 2753, 886, 8251, 319, 558, 29871, 29941, 29900, 29892, 29871, 29906, 29900, 29906, 29896, 29892, 29871, 29896, 29900, 29901, 29900, 29900, 282, 29889, 29885, 29889, 382, 29911, 29889, 2866, 1237, 29901, 349, 3445, 1965, 5240, 17862, 29936, 894, 29879, 322, 530, 5956, 29936, 8251, 3455, 12654, 1934, 29936, 349, 3445, 1965, 5240, 17862, 29901, 6607, 1061, 29889, 7197, 7250, 29892, 22281, 322, 29889, 29871, 29896, 29889, 3338, 424, 310, 7526, 29889, 29925, 1295, 29884, 424, 304, 278, 5345, 3136, 27562, 6938, 1913, 2760, 322, 11654, 630, 29871, 29906, 29900, 29896, 29906, 6242, 29899, 14343, 512, 1760, 573, 8402, 313, 1552, 8402, 29897, 363, 7361, 2376, 12712, 29892, 2866, 1461, 943, 29892, 322, 4451, 2975, 8797, 943, 310, 5345, 3136, 27562, 6938, 29892, 263, 10319, 17266, 362, 313, 1552, 6938, 511, 278, 6938, 867, 1934, 260, 13, 28173, 5345, 3136, 27562, 6938, 29889, 5345, 3136, 338, 385, 7417, 5864, 5001, 17785, 297, 278, 3902, 12418, 29892, 5849, 29892, 5802, 322, 1274, 23493, 310, 17182, 322, 5613, 10489, 7788, 297, 278, 3303, 3900, 29889, 4103, 924, 29879, 29899, 4789, 4339, 29889, 16809, 304, 278, 19937, 29899, 29896, 29929, 24161, 29892, 10430, 12747, 29892, 3700, 11105, 29879, 29892, 322, 5264, 1320, 19985, 526, 3734, 746, 373, 24165, 29889, 29871, 29945, 29900, 29946, 29901, 383, 1165, 2009, 304, 29871, 29953, 29896, 29929, 29899, 29953, 29929, 29955, 29899, 29900, 29955, 29929, 29946, 29892, 6212, 29876, 29889, 6285, 29889, 6518, 279, 10770, 29889, 7159, 29925, 322, 10937, 3352, 6475, 29901, 383, 1165, 2009, 304, 29871, 29953, 29896, 29929, 29899, 29953, 29929, 29955, 29899, 29900, 29955, 29929, 29946, 29892, 6212, 29876, 29889, 6285, 29889, 13564, 2112, 29889, 4007, 404, 1860, 322, 4321, 7983, 29901, 383, 1165, 2009, 304, 29871, 29953, 29896, 29929, 29899, 29946, 29953, 29945, 29899, 29929, 29955, 29946, 29946, 29892, 6212, 29876, 29889, 6285, 29889, 501, 303, 12617, 809, 2574, 323, 1041, 3250, 29915, 29879, 2246, 3483, 858, 701, 629, 3076, 322, 1623, 629, 3076, 5134, 350, 15943, 2638, 29892, 5798, 514, 362, 1771, 4167, 29892, 17972, 1252, 29892, 3536, 2330, 29899, 19504, 1100, 29892, 5345, 3136, 27562, 29892, 8168, 14876, 322, 23094, 1390, 4533, 5345, 3136, 27562, 6938, 341, 29911, 8353, 13258, 358, 669, 10961, 2472, 29889, 3617, 278, 9281, 5345, 3136, 27562, 6938, 341, 29911, 8353, 13173, 10961, 11839, 29892, 10961, 848, 29892, 8195, 29899, 2481, 382, 13778, 29892, 24469, 29892, 22663, 322, 901, 13, 29906, 29900, 29900, 29929, 6561, 29894, 307, 1026, 14305, 2883, 8666, 29889, 13, 29931, 352, 273, 14837, 8497, 19040, 5275, 29889, 13, 8964, 3575, 1311, 11914, 11486, 29889, 13, 29968, 29874, 436, 283, 11324, 611, 333, 269, 3304, 23238, 29889, 13, 20841, 328, 719, 29880, 18766, 437, 344, 29889, 13, 29909, 3733, 417, 29871, 29896, 29953, 17099, 29889, 13, 29924, 554, 273, 23185, 23570, 21223, 363, 10769, 29889, 13, 10399, 278, 1426, 4318, 2400, 6593, 297, 349, 348, 29926, 19266, 29889, 13, 3954, 19022, 1090, 29871, 29906, 29900, 29900, 29900, 29900, 297, 21215, 29889, 13, 6028, 260, 3804, 24354, 1623, 1156, 8343, 292, 29889, 13, 29933, 2267, 3375, 29874, 1379, 6532, 1286, 29871, 29906, 29900, 29906, 29900, 29889, 13, 29906, 29900, 29900, 29906, 9665, 870, 1794, 5791, 532, 28750, 1339, 29873, 470, 9704, 29889, 13, 29909, 7811, 17522, 29906, 2799, 749, 544, 18499, 29889, 13, 14689, 17421, 29551, 412, 22666, 1456, 2866, 342, 29871, 29906, 29900, 29906, 29896 ]
1,333,649
6,144
CommonCrawl
15
4
How Covid-19 is reshaping African governance January 9, 2021ByadminInAfrica News COMMENT As the sun set on 2020, a year primarily defined by the Covid-19 pandemic, all segments of society in Africa have been affected. Some areas suffered more than others, but none have been spared. In the democracy and good governance space, analysts, civil society groups, donors, and implementers worried that the onset of the... Incumbent wins Central African Republic election Central African Republic (CAR) President Faustin Archange Touadéra has won an outright election victory after a tense first round of voting in the country, the electoral commission announced this week. The December 27 presidential election, which coincided with legislative polls, took place as a coalition of armed rebel groups renewed an offensive that left thousands... African Blogtable: Start of the 2020-21 NBA season December 24, 2020ByadminInAfrica News What would it take for LeBron James and the Lakers to go back-to-back and raise the Larry O'Brien Trophy in July? What Christmas Day matchup are you looking forward to the most? Refiloe Seiboko, Mail & Guardian (South Africa): The Lakers were already such a strong team and their offseason moves have not only maintained... Debt forgiveness will top the African agenda in 2021 COMMENT The year 2020 will, of course, be remembered for the Covid-19 pandemic. Many African countries have handled the public health effects of coronavirus well compared with neighbouring continents, with some 55 000 related deaths and 2 million recovered out of a population of just over a billion. This can be credited to quick action... Yet another treaty aims to protect African women. But how will it be enforced? December 9, 2020ByadminInAfrica News COMMENT In his 2020 International Women's Day address, President Cyril Ramaphosa said that, through South Africa's chairship of the African Union, he will be advocating for the adoption of an African Union Convention on Violence Against Women. To this end, the South African department of women, youth and persons with disabilities has put together a... Eskom's emissions are not compatible with the South African constitution November 20, 2020ByadminInAfrica News The World Health Organisation (WHO) considers air pollution to be the greatest environmental risk to people's health. In South Africa, where everyone has the constitutional right to an environment not harmful to their health, the residents of the Mpumalanga highveld are enveloped by a deadly concoction of air pollutants on a daily basis. This is... African leaders must continue to press for talks: Ethiopia is too big to fail COMMENT In the days following the start of the conflict between Ethiopia's federal government and Tigray region's leadership, Sudanese Prime Minister Abdalla Hamdok, as head of East African regional bloc, the Intergovernmental Agency for Development (Igad), called his Ethiopian counterpart Abiy Ahmed, offering to mediate. But the Ethiopian leader resisted Hamdok's offer and similar ones... African Blogtable: It all comes down to this October 10, 2020ByadminInAfrica News Prior to Game 4, LeBron James texted his teammates to provide an additional source of motivation and make sure that everyone stayed focused and understood the importance of the game in front of them. If you were Jimmy Butler, what would you text your team before they take the floor tonight? And if you were... African Blogtable: A bad day at the office for the Lakers, or a sign of things to come? October 7, 2020ByadminInAfrica News Amine El Amri, Le Matin (Morocco): The Miami Heat have all the right to dream. Especially now, after winning such a decisive game three against the Los Angeles Lakers. With an exception of Jimmy Butler, the Heat looked like a totally different team from the one that took the court in game two. And that's... Three digital transformation priorities for African healthcare organisations
0.136114
-0.119478
0.122115
-0.538525
[ 0.3784609198641435, -0.10623297257279285 ]
[ -0.2100161864347875, -0.028938871149842203 ]
[ 0.19186113102256197, 0.052367874626427176 ]
[ -0.6137413106747016, -0.46330894563089026 ]
1,024
[ 512, 512 ]
[ 1128, 25669, 333, 29899, 29896, 29929, 338, 620, 29882, 21430, 11715, 4095, 749, 13, 29967, 15623, 653, 29871, 29929, 29892, 29871, 29906, 29900, 29906, 29896, 2059, 6406, 797, 29909, 18961, 10130, 13, 3217, 7428, 3919, 1094, 278, 6575, 731, 373, 29871, 29906, 29900, 29906, 29900, 29892, 263, 1629, 19434, 3342, 491, 278, 25669, 333, 29899, 29896, 29929, 7243, 24552, 29892, 599, 24611, 310, 12459, 297, 10557, 505, 1063, 15201, 29889, 3834, 10161, 17654, 901, 1135, 4045, 29892, 541, 5642, 505, 1063, 805, 1965, 29889, 512, 278, 1261, 25804, 322, 1781, 4095, 749, 2913, 29892, 3483, 858, 29879, 29892, 7631, 12459, 6471, 29892, 1016, 943, 29892, 322, 2334, 414, 6365, 1255, 393, 278, 373, 842, 310, 278, 856, 13, 797, 29883, 3774, 296, 21614, 8068, 11715, 8063, 8271, 13, 23369, 1705, 11715, 8063, 313, 29907, 1718, 29897, 7178, 7748, 504, 262, 2595, 927, 323, 283, 328, 6947, 756, 2113, 385, 714, 1266, 8271, 15354, 1156, 263, 260, 1947, 937, 4513, 310, 28931, 297, 278, 4234, 29892, 278, 3546, 11251, 12969, 9326, 445, 4723, 29889, 450, 5846, 29871, 29906, 29955, 6673, 616, 8271, 29892, 607, 22819, 2618, 411, 13332, 1230, 1248, 3137, 29892, 3614, 2058, 408, 263, 17148, 654, 310, 23926, 337, 6596, 6471, 23011, 287, 385, 1283, 6270, 393, 2175, 17202, 856, 13, 29909, 1341, 2185, 350, 1188, 2371, 29901, 7370, 310, 278, 29871, 29906, 29900, 29906, 29900, 29899, 29906, 29896, 21517, 4259, 13, 6185, 1096, 29871, 29906, 29946, 29892, 29871, 29906, 29900, 29906, 29900, 2059, 6406, 797, 29909, 18961, 10130, 13, 5618, 723, 372, 2125, 363, 951, 29933, 1617, 5011, 322, 278, 365, 21079, 304, 748, 1250, 29899, 517, 29899, 1627, 322, 12020, 278, 26977, 438, 29915, 29933, 19112, 8316, 11461, 297, 5468, 29973, 1724, 17661, 8373, 1993, 786, 526, 366, 3063, 6375, 304, 278, 1556, 29973, 830, 1777, 7297, 922, 747, 15218, 29892, 18623, 669, 29429, 313, 29903, 2438, 10557, 1125, 450, 365, 21079, 892, 2307, 1316, 263, 4549, 3815, 322, 1009, 1283, 25682, 16229, 505, 451, 871, 19949, 856, 13, 10251, 29873, 18879, 20193, 674, 2246, 278, 11715, 946, 8395, 297, 29871, 29906, 29900, 29906, 29896, 13, 3217, 7428, 3919, 450, 1629, 29871, 29906, 29900, 29906, 29900, 674, 29892, 310, 3236, 29892, 367, 21832, 363, 278, 25669, 333, 29899, 29896, 29929, 7243, 24552, 29889, 9267, 11715, 10916, 505, 16459, 278, 970, 9045, 9545, 310, 25082, 485, 22693, 1532, 9401, 411, 17647, 292, 2145, 1237, 29892, 411, 777, 29871, 29945, 29945, 29871, 29900, 29900, 29900, 4475, 4892, 29879, 322, 29871, 29906, 7284, 24776, 714, 310, 263, 4665, 310, 925, 975, 263, 24464, 29889, 910, 508, 367, 6625, 1573, 304, 4996, 3158, 856, 13, 29979, 300, 1790, 7539, 29891, 263, 9893, 304, 12566, 11715, 5866, 29889, 1205, 920, 674, 372, 367, 24555, 1133, 29973, 13, 6185, 1096, 29871, 29929, 29892, 29871, 29906, 29900, 29906, 29900, 2059, 6406, 797, 29909, 18961, 10130, 13, 3217, 7428, 3919, 512, 670, 29871, 29906, 29900, 29906, 29900, 4623, 10152, 29915, 29879, 8373, 3211, 29892, 7178, 8045, 4115, 8292, 12451, 3628, 1497, 393, 29892, 1549, 4275, 10557, 29915, 29879, 11774, 3527, 310, 278, 11715, 7761, 29892, 540, 674, 367, 22545, 1218, 363, 278, 594, 3385, 310, 385, 11715, 7761, 26774, 373, 10630, 324, 663, 11454, 303, 10152, 29889, 1763, 445, 1095, 29892, 278, 4275, 11715, 14311, 310, 5866, 29892, 12397, 322, 12407, 411, 766, 11614, 756, 1925, 4208, 263, 856, 13, 29923, 808, 290, 29915, 29879, 953, 6847, 526, 451, 15878, 411, 278, 4275, 11715, 16772, 13, 25363, 1096, 29871, 29906, 29900, 29892, 29871, 29906, 29900, 29906, 29900, 2059, 6406, 797, 29909, 18961, 10130, 13, 1576, 2787, 15202, 25783, 313, 29956, 8187, 29897, 1136, 11376, 4799, 21180, 918, 304, 367, 278, 14176, 29380, 12045, 304, 2305, 29915, 29879, 9045, 29889, 512, 4275, 10557, 29892, 988, 14332, 756, 278, 16772, 284, 1492, 304, 385, 5177, 451, 10311, 1319, 304, 1009, 9045, 29892, 278, 24060, 310, 278, 341, 29886, 398, 284, 12686, 1880, 955, 29881, 526, 427, 1830, 287, 491, 263, 7123, 368, 378, 1111, 428, 310, 4799, 21180, 329, 1934, 373, 263, 14218, 8405, 29889, 910, 338, 856, 13, 29909, 1341, 2185, 20251, 1818, 6773, 304, 3965, 363, 5969, 2039, 29901, 13772, 21260, 423, 338, 2086, 4802, 304, 4418, 13, 3217, 7428, 3919, 512, 278, 3841, 1494, 278, 1369, 310, 278, 14529, 1546, 13772, 21260, 423, 29915, 29879, 17097, 5874, 322, 24834, 764, 5120, 29915, 29879, 26001, 29892, 8383, 273, 968, 15512, 7668, 17860, 9864, 7904, 29881, 554, 29892, 408, 2343, 310, 6932, 11715, 14014, 289, 2029, 29892, 278, 4124, 29887, 6170, 358, 284, 29353, 363, 14650, 313, 28600, 328, 511, 2000, 670, 13772, 21260, 713, 6795, 1595, 1976, 19881, 9070, 2168, 29892, 27032, 304, 14457, 403, 29889, 1205, 278, 13772, 21260, 713, 11822, 9241, 287, 7904, 29881, 554, 29915, 29879, 5957, 322, 2788, 6743, 856, 13, 29909, 1341, 2185, 350, 1188, 2371, 29901, 739, 599, 5304, 1623, 304, 445, 13, 25375, 4950, 29871, 29896, 29900, 29892, 29871, 29906, 29900, 29906, 29900, 2059, 6406, 797, 29909, 18961, 10130, 13, 29925, 13479, 304, 8448, 29871, 29946, 29892, 951, 29933, 1617, 5011, 1426, 287, 670, 3815, 29885, 1078, 304, 3867, 385, 5684, 2752, 310, 17385, 362, 322, 1207, 1854, 393, 14332, 27661, 21309, 322, 11098, 278, 13500, 310, 278, 3748, 297, 4565, 310, 963, 29889, 960, 366, 892, 20636, 29384, 29892, 825, 723, 366, 1426, 596, 3815, 1434, 896, 2125, 278, 11904, 15243, 523, 29973, 1126, 565, 366, 892, 856, 13, 29909, 1341, 2185, 350, 1188, 2371, 29901, 319, 4319, 2462, 472, 278, 8034, 363, 278, 365, 21079, 29892, 470, 263, 1804, 310, 2712, 304, 2041, 29973, 13, 25375, 4950, 29871, 29955, 29892, 29871, 29906, 29900, 29906, 29900, 2059, 6406, 797, 29909, 18961, 10130, 13, 6833, 457, 1260, 1913, 374, 29892, 951, 5345, 262, 313, 28581, 542, 1111, 1125, 450, 23740, 940, 271, 505, 599, 278, 1492, 304, 12561, 29889, 3423, 25009, 1286, 29892, 1156, 15613, 1316, 263, 22442, 573, 3748, 2211, 2750, 278, 4602, 10722, 365, 21079, 29889, 2973, 385, 3682, 310, 20636, 29384, 29892, 278, 940, 271, 5148, 763, 263, 14909, 1422, 3815, 515, 278, 697, 393, 3614, 278, 8973, 297, 3748, 1023, 29889, 1126, 393, 29915, 29879, 856, 13, 28575, 13436, 13852, 7536, 1907, 363, 11715, 9045, 18020, 17459, 800 ]
1,333,650
0
CommonCrawl
6
2
This past May there was much ado about a wine event taking place in Healdsburg called the Seven % Solution, highlighting wines made from grapes other than the 93% (such as Cabernet Sauvignon, Merlot, Chardonnay, etc.) to which most of California's vineyards are planted. Although the emphasis of Seven % Solution was on the products of wineries sourcing from California's North Coast, the grapes that were celebrated happened to be grapes that are also planted extensively in Lodi: including Sémillon, Montepulciano, Chenin Blanc, Picpoul, Grenache, Grenache Blanc, Mourvèdre, Vermentino, Counoise, Barbera, Cinsaut, Carignan, St. Laurent, Albarinõ, Tinta Cão, Tourigna Nacional, and Verdelho. Does your taste in wine run with the "seven" percenters? If so, you might be interested to know that Jillian Johnson, owner/winemaker of tiny Onesta Wines, has just released her two wines made from the Cinsaut (also spelled Cinsault) grape; both sourced from the Bechthold Vineyard: the Lodi AVA's oldest continuously farmed single vineyard, originally planted in 1886 by Joseph Spenker. Cinsaut is a grape that is grown all over its native Southern France, and is used almost exclusively (in blends with Grenache) to produce the most eponymous of French wines: dry style rosé. The 2012 Onesta Bechthold Vineyard Lodi Cinsault Rosé ($18) should be a seven-percenter's dream: a delicately pink wine bursting with strawberry guava-like fruit, with faint suggestions of drippy white peach; bone dry, yet soft, lush, creamy, almost voluptuously textured in the mouth, finishing smooth as a Stephen Curry stroke. Although Cinsaut is a black skinned grape, its combination of typically large berries and fairly thin skin is the reason why it is never used to make red wine in France (if it goes into red wines at all, it is only as a small percentage in blends with sturdier grapes). This is what makes wines like the 2011 Onesta Bechthold Vineyard Lodi Cinsault ($28) so unusual, even exotic – coming from vines so ancient that they can, and usually do, produce a stand-alone red Cinsaut unlike any in the world. A Bechthold red typically comes across with the delicacy of a Pinot Noir, the wild berry character of Zinfandel, and the subtle spice reminiscent of Grenache. Onesta's 2011 Bechthold red hits on all cylinders: teeming with strawberry and kitchen spiced rhubarb pie-like fruit, couched in a soft medium-full body, soft, long and viscous in the mouth – think Keira Knightley in a pixie skirt, bouncing on a bed of Bings. Bechthold Vineyard is Lodi's ultimate "old vine" planting, despite the fact that one of the most unregulated, bandied about terms commonly used on wine labels is "old vine." Yes, this refers to wines made from vines that have been in the ground for a long time, but for how long? Some say anything over 30 years is "old" – which is fair to say, since in the U.S. as well as in European wine regions most vineyards are torn out and replanted after 30, 35 years. Because grape production of vines of that age is significantly reduced, it always makes sense to start all over. Why the last stipulation? Many old vineyards – including numerous pre-sixties plantings in Lodi – are inter-planted in proportions of over a third or even half with younger vines, planted over the years to replace dead or dying plants. The 25-acre Bechthold Vineyard is owned by Al and Wanda Woock Bechthold. It was Wanda's great grandfather who originally planted the vineyard on the west side of Lodi's Mokelumne River AVA, just north of what is now the Jessie'
1.553642
1.663205
0.202006
0.269627
[ 1.455025807057169, 1.6522590688329906 ]
[ 1.6775301668383196, 1.6488801095373642 ]
[ 0.21215105922563612, 0.19186113102256197 ]
[ 0.09273394920816375, 0.446520305690556 ]
1,024
[ 512, 512 ]
[ 910, 4940, 2610, 727, 471, 1568, 594, 29877, 1048, 263, 19006, 1741, 5622, 2058, 297, 940, 2741, 29879, 3074, 2000, 278, 26647, 1273, 24380, 29892, 12141, 292, 281, 1475, 1754, 515, 330, 2390, 267, 916, 1135, 278, 29871, 29929, 29941, 29995, 313, 14565, 408, 11680, 824, 300, 23863, 29894, 29582, 29892, 4702, 8276, 29892, 678, 538, 3409, 388, 29892, 2992, 1846, 304, 607, 1556, 310, 8046, 29915, 29879, 325, 457, 29891, 3163, 526, 8024, 287, 29889, 13, 2499, 3592, 278, 19310, 275, 310, 26647, 1273, 24380, 471, 373, 278, 9316, 310, 281, 4983, 583, 269, 473, 3277, 515, 8046, 29915, 29879, 4644, 17700, 29892, 278, 330, 2390, 267, 393, 892, 26301, 9559, 304, 367, 330, 2390, 267, 393, 526, 884, 8024, 287, 21103, 3598, 297, 365, 12143, 29901, 3704, 317, 2249, 12794, 29892, 11240, 29886, 352, 455, 1562, 29892, 21589, 262, 3164, 4564, 29892, 14612, 29886, 5059, 29892, 13042, 1829, 29892, 13042, 1829, 3164, 4564, 29892, 341, 473, 29894, 30000, 29881, 276, 29892, 1798, 358, 1789, 29892, 19565, 1217, 895, 29892, 2261, 495, 29874, 29892, 315, 1144, 1300, 29892, 1704, 647, 273, 29892, 624, 29889, 27011, 29892, 838, 1646, 262, 30084, 29892, 323, 15073, 315, 1368, 29892, 6371, 647, 29874, 8468, 29892, 322, 1798, 6144, 1251, 29889, 13, 25125, 596, 21779, 297, 19006, 1065, 411, 278, 376, 344, 854, 29908, 10151, 414, 29973, 960, 577, 29892, 366, 1795, 367, 8852, 304, 1073, 393, 435, 453, 713, 11717, 29892, 12271, 29914, 5080, 331, 5790, 310, 21577, 1551, 4405, 399, 1475, 29892, 756, 925, 5492, 902, 1023, 281, 1475, 1754, 515, 278, 315, 1144, 1300, 313, 15189, 805, 14356, 315, 1144, 1292, 29897, 2646, 412, 29936, 1716, 269, 473, 1133, 515, 278, 1522, 305, 386, 1025, 478, 457, 19852, 29901, 278, 365, 12143, 16884, 29909, 29915, 29879, 23947, 3133, 5794, 2215, 2168, 2323, 325, 457, 19852, 29892, 10437, 8024, 287, 297, 29871, 29896, 29947, 29947, 29953, 491, 6936, 1706, 264, 3946, 29889, 13, 29907, 1144, 1300, 338, 263, 2646, 412, 393, 338, 21633, 599, 975, 967, 7531, 14234, 3444, 29892, 322, 338, 1304, 4359, 13489, 3598, 313, 262, 1999, 1975, 411, 13042, 1829, 29897, 304, 7738, 278, 1556, 321, 1112, 962, 681, 310, 5176, 281, 1475, 29901, 15589, 3114, 14652, 29948, 29889, 450, 29871, 29906, 29900, 29896, 29906, 1551, 4405, 1522, 305, 386, 1025, 478, 457, 19852, 365, 12143, 315, 1144, 1292, 5678, 29948, 3255, 29896, 29947, 29897, 881, 367, 263, 9881, 29899, 546, 5064, 29915, 29879, 12561, 29901, 263, 628, 293, 2486, 282, 682, 19006, 20887, 292, 411, 380, 1610, 16344, 1410, 879, 29899, 4561, 15774, 29892, 411, 24732, 10529, 310, 10293, 23717, 4796, 1236, 496, 29936, 289, 650, 15589, 29892, 3447, 4964, 29892, 301, 1878, 29892, 907, 25934, 29892, 4359, 1700, 21245, 29884, 5794, 1426, 2955, 297, 278, 13394, 29892, 28321, 10597, 408, 263, 14317, 10837, 719, 19782, 29889, 13, 2499, 3592, 315, 1144, 1300, 338, 263, 4628, 2071, 27464, 2646, 412, 29892, 967, 10296, 310, 12234, 2919, 7655, 2722, 322, 12558, 16835, 19309, 338, 278, 2769, 2020, 372, 338, 2360, 1304, 304, 1207, 2654, 19006, 297, 3444, 313, 361, 372, 5771, 964, 2654, 281, 1475, 472, 599, 29892, 372, 338, 871, 408, 263, 2319, 19649, 297, 1999, 1975, 411, 380, 18245, 631, 330, 2390, 267, 467, 13, 4013, 338, 825, 3732, 281, 1475, 763, 278, 29871, 29906, 29900, 29896, 29896, 1551, 4405, 1522, 305, 386, 1025, 478, 457, 19852, 365, 12143, 315, 1144, 1292, 3255, 29906, 29947, 29897, 577, 22910, 29892, 1584, 429, 13574, 785, 6421, 515, 325, 1475, 577, 12297, 393, 896, 508, 29892, 322, 5491, 437, 29892, 7738, 263, 2317, 29899, 18785, 2654, 315, 1144, 1300, 25531, 738, 297, 278, 3186, 29889, 319, 1522, 305, 386, 1025, 2654, 12234, 5304, 4822, 411, 278, 628, 293, 4135, 310, 263, 17434, 327, 1939, 381, 29892, 278, 8775, 7655, 719, 2931, 310, 796, 7192, 392, 295, 29892, 322, 278, 12059, 280, 805, 625, 1083, 262, 275, 1760, 310, 13042, 1829, 29889, 1551, 4405, 29915, 29879, 29871, 29906, 29900, 29896, 29896, 1522, 305, 386, 1025, 2654, 19572, 373, 599, 20396, 513, 414, 29901, 734, 331, 292, 411, 380, 1610, 16344, 322, 29181, 805, 7612, 18178, 431, 279, 29890, 5036, 29899, 4561, 15774, 29892, 274, 3222, 287, 297, 263, 4964, 18350, 29899, 8159, 3573, 29892, 4964, 29892, 1472, 322, 1998, 29883, 681, 297, 278, 13394, 785, 1348, 4813, 3055, 22980, 2330, 297, 263, 9277, 347, 2071, 2728, 29892, 289, 1309, 3277, 373, 263, 6592, 310, 350, 886, 29889, 13, 3629, 305, 386, 1025, 478, 457, 19852, 338, 365, 12143, 29915, 29879, 8494, 6490, 376, 1025, 325, 457, 29908, 8024, 292, 29892, 15020, 278, 2114, 393, 697, 310, 278, 1556, 443, 1727, 7964, 29892, 3719, 1000, 1048, 4958, 15574, 1304, 373, 19006, 11073, 338, 376, 1025, 325, 457, 1213, 3869, 29892, 445, 14637, 304, 281, 1475, 1754, 515, 325, 1475, 393, 505, 1063, 297, 278, 5962, 363, 263, 1472, 931, 29892, 541, 363, 920, 1472, 29973, 3834, 1827, 3099, 975, 29871, 29941, 29900, 2440, 338, 376, 1025, 29908, 785, 607, 338, 6534, 304, 1827, 29892, 1951, 297, 278, 501, 29889, 29903, 29889, 408, 1532, 408, 297, 7824, 19006, 12786, 1556, 325, 457, 29891, 3163, 526, 10146, 714, 322, 337, 572, 9714, 1156, 29871, 29941, 29900, 29892, 29871, 29941, 29945, 2440, 29889, 7311, 2646, 412, 5802, 310, 325, 1475, 310, 393, 5046, 338, 16951, 12212, 29892, 372, 2337, 3732, 4060, 304, 1369, 599, 975, 29889, 13, 11008, 278, 1833, 380, 666, 2785, 29973, 9267, 2030, 325, 457, 29891, 3163, 785, 3704, 12727, 758, 29899, 1039, 486, 583, 8024, 886, 297, 365, 12143, 785, 526, 1006, 29899, 572, 9714, 297, 12098, 1080, 310, 975, 263, 4654, 470, 1584, 4203, 411, 20023, 325, 1475, 29892, 8024, 287, 975, 278, 2440, 304, 5191, 7123, 470, 27116, 18577, 29889, 13, 1576, 29871, 29906, 29945, 29899, 21160, 1522, 305, 386, 1025, 478, 457, 19852, 338, 15205, 491, 838, 322, 399, 5863, 14962, 1698, 1522, 305, 386, 1025, 29889, 739, 471, 399, 5863, 29915, 29879, 2107, 4595, 22212, 1058, 10437, 8024, 287, 278, 325, 457, 19852, 373, 278, 5833, 2625, 310, 365, 12143, 29915, 29879, 341, 554, 295, 398, 484, 6163, 16884, 29909, 29892, 925, 6641, 310, 825, 338, 1286, 278, 23010, 347, 29915 ]
1,333,651
0
C4
1
6
'Band Hero' Commercial Behind the Scenes Video Our friends at Activision have sent us a cool behind the scenes video showing what it's like to shoot a TV commercial for the game Band Hero, which hits stores today. It features artists such as Taylor Swift, Pete Wentz and Travis Barker, but don't let that stop you from taking a look anyway. I kid. I kid because I care. In all seriousness, I worked on a lot of commercials over the years and I can tell you that very few of them were ever this cool to shoot or, in the end, to watch. So, leave your preconceptions at the door and take a look at this video. Who knows, you might just enjoy it. Plus, you'll also get more of a taste of Band Hero, a game I just know you're anxious to try — especially if you're a fan of Guitar Hero. As I may have mentioned, the game hits stores today for Wii, DS, Xbox 360, PS3 and PS2. Enjoy. Band HeroGuitar HeroPete WentzPS2PS3Taylor SwiftTravis BarkerWiiXbox 360 By Chris Ullrich Chris Ullrich Archives Select Month February 2023 January 2023 December 2022 November 2022 October 2022 September 2022 August 2022 July 2022 June 2022 May 2022 April 2022 March 2022 February 2022 January 2022 December 2021 November 2021 October 2021 September 2021 August 2021 July 2021 June 2021 May 2021 April 2021 March 2021 February 2021 January 2021 December 2020 November 2020 October 2020 September 2020 August 2020 October 2017 September 2017 August 2017 July 2017 June 2017 May 2017 April 2017 March 2017 February 2017 January 2017 December 2016 November 2016 August 2016 July 2016 June 2016 May 2016 April 2016 March 2016 February 2016 January 2016 December 2015 November 2015 October 2015 September 2015 August 2015 July 2015 June 2015 May 2015 April 2015 March 2015 February 2015 January 2015 December 2014 November 2014 October 2014 September 2014 August 2014 July 2014 June 2014 May 2014 April 2014 March 2014 February 2014 January 2014 December 2013 November 2013 October 2013 September 2013 August 2013 July 2013 June 2013 May 2013 April 2013 March 2013 February 2013 January 2013 December 2012 November 2012 October 2012 September 2012 August 2012 July 2012 June 2012 May 2012 April 2012 March 2012 February 2012 January 2012 December 2011 November 2011 October 2011 September 2011 August 2011 July 2011 June 2011 May 2011 April 2011 March 2011 February 2011 January 2011 December 2010 November 2010 October 2010 September 2010 August 2010 July 2010 June 2010 May 2010 April 2010 March 2010 February 2010 January
-1.046686
-1.687061
-1.745827
-2.482623
[ -0.31596452263822805, -1.7774082053799054 ]
[ -1.054969048240311, -2.3191528266449724 ]
[ -1.4922029098325928, -1.9994511149094465 ]
[ -2.3265404002670187, -2.6387048324573645 ]
1,024
[ 512, 512 ]
[ 525, 29933, 392, 22167, 29915, 422, 1050, 1455, 1522, 16887, 278, 2522, 25487, 13987, 13, 29949, 332, 7875, 472, 21775, 2459, 505, 2665, 502, 263, 12528, 5742, 278, 20407, 4863, 6445, 825, 372, 29915, 29879, 763, 304, 15049, 263, 5648, 12128, 363, 278, 3748, 5158, 22167, 29892, 607, 19572, 14422, 9826, 29889, 739, 5680, 17906, 1316, 408, 12537, 14156, 29892, 349, 2650, 399, 296, 29920, 322, 3201, 1730, 350, 935, 261, 29892, 541, 1016, 29915, 29873, 1235, 393, 5040, 366, 515, 5622, 263, 1106, 8763, 29889, 13, 29902, 26397, 29889, 306, 26397, 1363, 306, 2562, 29889, 512, 599, 10676, 2264, 29892, 306, 3796, 373, 263, 3287, 310, 7825, 455, 1338, 975, 278, 2440, 322, 306, 508, 2649, 366, 393, 1407, 2846, 310, 963, 892, 3926, 445, 12528, 304, 15049, 470, 29892, 297, 278, 1095, 29892, 304, 6505, 29889, 1105, 29892, 5967, 596, 758, 535, 1441, 29879, 472, 278, 3050, 322, 2125, 263, 1106, 472, 445, 4863, 29889, 13, 22110, 9906, 29892, 366, 1795, 925, 13389, 372, 29889, 15113, 29892, 366, 29915, 645, 884, 679, 901, 310, 263, 21779, 310, 5158, 22167, 29892, 263, 3748, 306, 925, 1073, 366, 29915, 276, 24937, 304, 1018, 813, 7148, 565, 366, 29915, 276, 263, 13524, 310, 2088, 3673, 22167, 29889, 1094, 306, 1122, 505, 5276, 29892, 278, 3748, 19572, 14422, 9826, 363, 399, 2236, 29892, 360, 29903, 29892, 1060, 1884, 29871, 29941, 29953, 29900, 29892, 11323, 29941, 322, 11323, 29906, 29889, 1174, 2212, 29891, 29889, 13, 29933, 392, 22167, 29954, 3121, 279, 22167, 29925, 2650, 399, 296, 29920, 7024, 29906, 7024, 29941, 29911, 11017, 14156, 5323, 1730, 350, 935, 261, 29956, 2236, 29990, 1884, 29871, 29941, 29953, 29900, 13, 2059, 12821, 501, 645, 4018, 13, 11626, 275, 501, 645, 4018, 13, 13197, 3145, 7605, 23471, 6339, 29871, 29906, 29900, 29906, 29941, 5490, 29871, 29906, 29900, 29906, 29941, 5846, 29871, 29906, 29900, 29906, 29906, 3979, 29871, 29906, 29900, 29906, 29906, 5533, 29871, 29906, 29900, 29906, 29906, 3839, 29871, 29906, 29900, 29906, 29906, 3111, 29871, 29906, 29900, 29906, 29906, 5468, 29871, 29906, 29900, 29906, 29906, 5306, 29871, 29906, 29900, 29906, 29906, 2610, 29871, 29906, 29900, 29906, 29906, 3786, 29871, 29906, 29900, 29906, 29906, 4779, 29871, 29906, 29900, 29906, 29906, 6339, 29871, 29906, 29900, 29906, 29906, 5490, 29871, 29906, 29900, 29906, 29906, 5846, 29871, 29906, 29900, 29906, 29896, 3979, 29871, 29906, 29900, 29906, 29896, 5533, 29871, 29906, 29900, 29906, 29896, 3839, 29871, 29906, 29900, 29906, 29896, 3111, 29871, 29906, 29900, 29906, 29896, 5468, 29871, 29906, 29900, 29906, 29896, 5306, 29871, 29906, 29900, 29906, 29896, 2610, 29871, 29906, 29900, 29906, 29896, 3786, 29871, 29906, 29900, 29906, 29896, 4779, 29871, 29906, 29900, 29906, 29896, 6339, 29871, 29906, 29900, 29906, 29896, 5490, 29871, 29906, 29900, 29906, 29896, 5846, 29871, 29906, 29900, 29906, 29900, 3979, 29871, 29906, 29900, 29906, 29900, 5533, 29871, 29906, 29900, 29906, 29900, 3839, 29871, 29906, 29900, 29906, 29900, 3111, 29871, 29906, 29900, 29906, 29900, 5533, 29871, 29906, 29900, 29896, 29955, 3839, 29871, 29906, 29900, 29896, 29955, 3111, 29871, 29906, 29900, 29896, 29955, 5468, 29871, 29906, 29900, 29896, 29955, 5306, 29871, 29906, 29900, 29896, 29955, 2610, 29871, 29906, 29900, 29896, 29955, 3786, 29871, 29906, 29900, 29896, 29955, 4779, 29871, 29906, 29900, 29896, 29955, 6339, 29871, 29906, 29900, 29896, 29955, 5490, 29871, 29906, 29900, 29896, 29955, 5846, 29871, 29906, 29900, 29896, 29953, 3979, 29871, 29906, 29900, 29896, 29953, 3111, 29871, 29906, 29900, 29896, 29953, 5468, 29871, 29906, 29900, 29896, 29953, 5306, 29871, 29906, 29900, 29896, 29953, 2610, 29871, 29906, 29900, 29896, 29953, 3786, 29871, 29906, 29900, 29896, 29953, 4779, 29871, 29906, 29900, 29896, 29953, 6339, 29871, 29906, 29900, 29896, 29953, 5490, 29871, 29906, 29900, 29896, 29953, 5846, 29871, 29906, 29900, 29896, 29945, 3979, 29871, 29906, 29900, 29896, 29945, 5533, 29871, 29906, 29900, 29896, 29945, 3839, 29871, 29906, 29900, 29896, 29945, 3111, 29871, 29906, 29900, 29896, 29945, 5468, 29871, 29906, 29900, 29896, 29945, 5306, 29871, 29906, 29900, 29896, 29945, 2610, 29871, 29906, 29900, 29896, 29945, 3786, 29871, 29906, 29900, 29896, 29945, 4779, 29871, 29906, 29900, 29896, 29945, 6339, 29871, 29906, 29900, 29896, 29945, 5490, 29871, 29906, 29900, 29896, 29945, 5846, 29871, 29906, 29900, 29896, 29946, 3979, 29871, 29906, 29900, 29896, 29946, 5533, 29871, 29906, 29900, 29896, 29946, 3839, 29871, 29906, 29900, 29896, 29946, 3111, 29871, 29906, 29900, 29896, 29946, 5468, 29871, 29906, 29900, 29896, 29946, 5306, 29871, 29906, 29900, 29896, 29946, 2610, 29871, 29906, 29900, 29896, 29946, 3786, 29871, 29906, 29900, 29896, 29946, 4779, 29871, 29906, 29900, 29896, 29946, 6339, 29871, 29906, 29900, 29896, 29946, 5490, 29871, 29906, 29900, 29896, 29946, 5846, 29871, 29906, 29900, 29896, 29941, 3979, 29871, 29906, 29900, 29896, 29941, 5533, 29871, 29906, 29900, 29896, 29941, 3839, 29871, 29906, 29900, 29896, 29941, 3111, 29871, 29906, 29900, 29896, 29941, 5468, 29871, 29906, 29900, 29896, 29941, 5306, 29871, 29906, 29900, 29896, 29941, 2610, 29871, 29906, 29900, 29896, 29941, 3786, 29871, 29906, 29900, 29896, 29941, 4779, 29871, 29906, 29900, 29896, 29941, 6339, 29871, 29906, 29900, 29896, 29941, 5490, 29871, 29906, 29900, 29896, 29941, 5846, 29871, 29906, 29900, 29896, 29906, 3979, 29871, 29906, 29900, 29896, 29906, 5533, 29871, 29906, 29900, 29896, 29906, 3839, 29871, 29906, 29900, 29896, 29906, 3111, 29871, 29906, 29900, 29896, 29906, 5468, 29871, 29906, 29900, 29896, 29906, 5306, 29871, 29906, 29900, 29896, 29906, 2610, 29871, 29906, 29900, 29896, 29906, 3786, 29871, 29906, 29900, 29896, 29906, 4779, 29871, 29906, 29900, 29896, 29906, 6339, 29871, 29906, 29900, 29896, 29906, 5490, 29871, 29906, 29900, 29896, 29906, 5846, 29871, 29906, 29900, 29896, 29896, 3979, 29871, 29906, 29900, 29896, 29896, 5533, 29871, 29906, 29900, 29896, 29896, 3839, 29871, 29906, 29900, 29896, 29896, 3111, 29871, 29906, 29900, 29896, 29896, 5468, 29871, 29906, 29900, 29896, 29896, 5306, 29871, 29906, 29900, 29896, 29896, 2610, 29871, 29906, 29900, 29896, 29896, 3786, 29871, 29906, 29900, 29896, 29896, 4779, 29871, 29906, 29900, 29896, 29896, 6339, 29871, 29906, 29900, 29896, 29896, 5490, 29871, 29906, 29900, 29896, 29896, 5846, 29871, 29906, 29900, 29896, 29900, 3979, 29871, 29906, 29900, 29896, 29900, 5533, 29871, 29906, 29900, 29896, 29900, 3839, 29871, 29906, 29900, 29896, 29900, 3111, 29871, 29906, 29900, 29896, 29900, 5468, 29871, 29906, 29900, 29896, 29900, 5306, 29871, 29906, 29900, 29896, 29900, 2610, 29871, 29906, 29900, 29896, 29900, 3786, 29871, 29906, 29900, 29896, 29900, 4779, 29871, 29906, 29900, 29896, 29900, 6339, 29871, 29906, 29900, 29896, 29900, 5490 ]
1,333,654
0
CommonCrawl
0
3
Blend used to be the King of the Whisky world. So much so that the thought of a successful single malt was scoffed at. But those days are past and the blend now has to share its platform with a range of Whisky categories, with many believing single malt to be the best kind of Scotch Whisky. Single malt is one of the most talked about categories of Scotch Whisky, especially among Whisky drinkers themselves, but blends are still the biggest sellers with Johnnie Walker, Chivas Regal and Ballantine's continually popping up in best sellers lists. There are also countless independent blenders producing some incredible drams. Douglas Laing, Whyte & Mackay and Gordon & MacPhail are all big names within the industry and have created award-winning blends alongside their single malt ranges. What is a blended Whisky exactly? A blend is exactly what it says on the tin. It is a mix of many different grains and malts from many different distilleries. It is made up of grain and malt Whiskies, with the grain being used to bolster the flavour. While they do not give the blend depth themselves, they allow the malts to bounce off them, revealing the depths of the malts. They act as a softer background for the rich and complex malts to show themselves, rather than overpowering them with more and more malts. Grain Whiskies may not be as intricate, but they act as a sort of sounding board for the malts to shout against, so they can be heard in all their glory. They also make blends less pricey than their single malt counterparts as grain Whiskies are cheaper to produce since their ingredients are more readily available and not as dear as barley. The use of grain Whiskies also make blends an easy target for critics who regard them as cheap, but the grain actually contributes to the flavour by making it better, not worse. This is because it acts as a foundation, allowing the complexities of the malts to be accented against a softer background. Blends differ from single malts mainly because they need to be tasted constantly throughout the blending process to ensure there is consistency and that the different Whiskies all work together. They are the result of years of craftsmanship and dedication. A master blender does not simply wake up one day with a profound ability to create a cohesive and enjoyable liquid. From nosing the liquid to working out quantities of each different grain and malt to go into the blend, a master blender can take years, if not decades, to train. Like a master distiller, they must have a good nose, to be able to work out all the different flavours and tasting notes that will contribute to the final product. Read the interview with Billy Leighton, Master Blender for Jameson and tens of other Whiskeys, to get a better idea of what the job is like. This makes them time consuming to make and a lot of skill is needed. If anyone ever asks why distilling is called an art, it's because creating blends requires creativity and ability. What makes a good blended Whisky? Consistency is a pretty big one here. Achieving consistency with single malts can be hard enough, but with blends the level of difficulty rises with the number of barrels. Wooden casks are so easily influenced by their surroundings, including air and weather, that it can be hard to reproduce the same liquid every time. It is up to a master blender to go through every cask and ensure that each is consistent with the last. This can be harder for bigger brands, as they attempt to deal with huge global demand for the same liquid. Bigger brands also face the threat of shortages. Since Whiskies need to be matured for a certain number of years, a sudden rise in demand can easily lead to a shortage. This is made even more complicated for blends, since liquids of varying ages are used, so each Whisky, no matter what the age must be fully mature, whether that be for 12 or 25 years, before it can be used in a blend. This can therefore cause a shortage as blenders are waiting on certain Whiskies maturing. It means they must be careful about maintaining adequate levels of each different Whisky needed in a blend so the blend can still be made while more Whisky matures. These things can be overcome with some for
1.112607
0.85026
0.973023
0.138258
[ 0.9674213543336104, 1.2577925452813477 ]
[ 0.6389655896786829, 1.0615539348677765 ]
[ 0.5773697668809709, 1.368676966800863 ]
[ -0.1439907452028487, 0.42050660300802717 ]
1,024
[ 512, 512 ]
[ 3164, 355, 1304, 304, 367, 278, 4088, 310, 278, 806, 275, 3459, 3186, 29889, 1105, 1568, 577, 393, 278, 2714, 310, 263, 9150, 2323, 286, 1997, 471, 885, 2696, 287, 472, 29889, 13, 6246, 1906, 3841, 526, 4940, 322, 278, 1999, 355, 1286, 756, 304, 6232, 967, 7481, 411, 263, 3464, 310, 806, 275, 3459, 13997, 29892, 411, 1784, 1339, 15387, 2323, 286, 1997, 304, 367, 278, 1900, 2924, 310, 11032, 305, 806, 275, 3459, 29889, 13, 15771, 286, 1997, 338, 697, 310, 278, 1556, 24867, 1048, 13997, 310, 11032, 305, 806, 275, 3459, 29892, 7148, 4249, 806, 275, 3459, 13748, 414, 6053, 29892, 541, 1999, 1975, 526, 1603, 278, 24842, 19417, 414, 411, 2259, 2786, 19512, 29892, 678, 19701, 2169, 284, 322, 13402, 20578, 29915, 29879, 2145, 1474, 772, 3262, 701, 297, 1900, 19417, 414, 8857, 29889, 13, 8439, 526, 884, 2302, 2222, 7417, 1999, 21043, 20811, 777, 29811, 1821, 4192, 2232, 29889, 16721, 997, 292, 29892, 3750, 371, 669, 21343, 388, 322, 16965, 669, 4326, 4819, 737, 526, 599, 4802, 2983, 2629, 278, 13661, 322, 505, 2825, 9862, 29899, 5080, 1076, 1999, 1975, 19963, 1009, 2323, 286, 1997, 20238, 29889, 13, 5618, 338, 263, 1999, 2760, 806, 275, 3459, 3721, 29973, 13, 29909, 1999, 355, 338, 3721, 825, 372, 4083, 373, 278, 27773, 29889, 739, 338, 263, 6837, 310, 1784, 1422, 2646, 1144, 322, 4439, 1372, 515, 1784, 1422, 1320, 5495, 583, 29889, 13, 3112, 338, 1754, 701, 310, 2646, 262, 322, 286, 1997, 806, 3873, 583, 29892, 411, 278, 2646, 262, 1641, 1304, 304, 15772, 2475, 278, 21054, 473, 29889, 5806, 896, 437, 451, 2367, 278, 1999, 355, 10809, 6053, 29892, 896, 2758, 278, 4439, 1372, 304, 289, 21543, 1283, 963, 29892, 10320, 12818, 278, 10809, 29879, 310, 278, 4439, 1372, 29889, 2688, 1044, 408, 263, 577, 906, 3239, 363, 278, 8261, 322, 4280, 4439, 1372, 304, 1510, 6053, 29892, 3265, 1135, 975, 13519, 292, 963, 411, 901, 322, 901, 4439, 1372, 29889, 13, 29954, 6038, 806, 3873, 583, 1122, 451, 367, 408, 11158, 9593, 29892, 541, 896, 1044, 408, 263, 2656, 310, 6047, 292, 7613, 363, 278, 4439, 1372, 304, 21272, 2750, 29892, 577, 896, 508, 367, 6091, 297, 599, 1009, 26080, 29889, 13, 15597, 884, 1207, 1999, 1975, 3109, 8666, 29891, 1135, 1009, 2323, 286, 1997, 6795, 20895, 408, 2646, 262, 806, 3873, 583, 526, 923, 7202, 304, 7738, 1951, 1009, 2348, 1127, 10070, 526, 901, 28520, 3625, 322, 451, 408, 9425, 408, 2594, 2330, 29889, 450, 671, 310, 2646, 262, 806, 3873, 583, 884, 1207, 1999, 1975, 385, 4780, 3646, 363, 28431, 1058, 4880, 963, 408, 28773, 29892, 541, 278, 2646, 262, 2869, 640, 5026, 304, 278, 21054, 473, 491, 3907, 372, 2253, 29892, 451, 15029, 29889, 910, 338, 1363, 372, 14741, 408, 263, 22778, 29892, 14372, 278, 4280, 1907, 310, 278, 4439, 1372, 304, 367, 1035, 14927, 2750, 263, 577, 906, 3239, 29889, 13, 10358, 1975, 1163, 515, 2323, 4439, 1372, 14364, 1363, 896, 817, 304, 367, 260, 28470, 21003, 10106, 278, 1999, 2548, 1889, 304, 9801, 727, 338, 5718, 3819, 322, 393, 278, 1422, 806, 3873, 583, 599, 664, 4208, 29889, 13, 15597, 526, 278, 1121, 310, 2440, 310, 25554, 3844, 550, 4034, 322, 8856, 362, 29889, 319, 5835, 1999, 1581, 947, 451, 3763, 281, 1296, 701, 697, 2462, 411, 263, 2600, 618, 11509, 304, 1653, 263, 16165, 267, 573, 322, 13389, 519, 23904, 29889, 3645, 7814, 292, 278, 23904, 304, 1985, 714, 26855, 310, 1269, 1422, 2646, 262, 322, 286, 1997, 304, 748, 964, 278, 1999, 355, 29892, 263, 5835, 1999, 1581, 508, 2125, 2440, 29892, 565, 451, 1602, 3076, 29892, 304, 7945, 29889, 13, 27552, 263, 5835, 1320, 5495, 29892, 896, 1818, 505, 263, 1781, 26414, 29892, 304, 367, 2221, 304, 664, 714, 599, 278, 1422, 21054, 2470, 322, 260, 579, 292, 11486, 393, 674, 29126, 304, 278, 2186, 3234, 29889, 7523, 278, 15593, 411, 18299, 951, 523, 265, 29892, 9082, 3164, 1581, 363, 5011, 265, 322, 25187, 310, 916, 806, 275, 8149, 29892, 304, 679, 263, 2253, 2969, 310, 825, 278, 4982, 338, 763, 29889, 13, 4013, 3732, 963, 931, 1136, 9929, 304, 1207, 322, 263, 3287, 310, 19911, 338, 4312, 29889, 960, 5019, 3926, 19514, 2020, 1320, 8873, 338, 2000, 385, 1616, 29892, 372, 29915, 29879, 1363, 4969, 1999, 1975, 6858, 907, 28157, 322, 11509, 29889, 13, 5618, 3732, 263, 1781, 1999, 2760, 806, 275, 3459, 29973, 13, 13696, 391, 3819, 338, 263, 5051, 4802, 697, 1244, 29889, 15542, 15387, 5718, 3819, 411, 2323, 4439, 1372, 508, 367, 2898, 3307, 29892, 541, 411, 1999, 1975, 278, 3233, 310, 14656, 364, 4637, 411, 278, 1353, 310, 2594, 2674, 29879, 29889, 13, 29956, 2092, 264, 274, 1278, 29879, 526, 577, 5948, 28482, 491, 1009, 8388, 618, 886, 29892, 3704, 4799, 322, 14826, 29892, 393, 372, 508, 367, 2898, 304, 18532, 278, 1021, 23904, 1432, 931, 29889, 739, 338, 701, 304, 263, 5835, 1999, 1581, 304, 748, 1549, 1432, 274, 1278, 322, 9801, 393, 1269, 338, 13747, 411, 278, 1833, 29889, 910, 508, 367, 22622, 363, 16600, 1506, 4167, 29892, 408, 896, 4218, 304, 5376, 411, 12176, 5534, 9667, 363, 278, 1021, 23904, 29889, 13, 29933, 3567, 1506, 4167, 884, 3700, 278, 28469, 310, 3273, 1179, 29889, 4001, 806, 3873, 583, 817, 304, 367, 286, 1535, 29881, 363, 263, 3058, 1353, 310, 2440, 29892, 263, 8327, 14451, 297, 9667, 508, 5948, 3275, 304, 263, 3273, 482, 29889, 910, 338, 1754, 1584, 901, 12092, 363, 1999, 1975, 29892, 1951, 15617, 4841, 310, 24099, 24646, 526, 1304, 29892, 577, 1269, 806, 275, 3459, 29892, 694, 4383, 825, 278, 5046, 1818, 367, 8072, 286, 1535, 29892, 3692, 393, 367, 363, 29871, 29896, 29906, 470, 29871, 29906, 29945, 2440, 29892, 1434, 372, 508, 367, 1304, 297, 263, 1999, 355, 29889, 13, 4013, 508, 5480, 4556, 263, 3273, 482, 408, 1999, 21043, 526, 10534, 373, 3058, 806, 3873, 583, 286, 19021, 29889, 739, 2794, 896, 1818, 367, 16010, 1048, 7344, 292, 19967, 339, 403, 11174, 310, 1269, 1422, 806, 275, 3459, 4312, 297, 263, 1999, 355, 577, 278, 1999, 355, 508, 1603, 367, 1754, 1550, 901, 806, 275, 3459, 286, 3698, 29889, 4525, 2712, 508, 367, 25688, 411, 777, 363 ]
1,333,658
0
C4
4
1
Dollar ended last week broadly higher except versus the Japanese Yen. While economic data from the US were generally disappointing, they were not bad enough to alter Fed's path of three rate hikes this year. Just that, the data didn't add to the chance of the fourth hike in December. On the other hand, data from Eurozone and UK re-confirmed the slowdown in Q1 and the lack of solid momentum in the rebound in Q2. Such development added to the case for ECB to exit stimulus later, and for BoE to delay the next rate hike. The change in ECB and BoE expectations continued to be reflected in France, Germany and UK stock markets. And equally importantly, German bund yield and UK Gilt yield ended deeply lower. Together with retreat in US treasury yields, they provided the boost to Yen, which ended as the strongest one. And not surprisingly, Sterling and Euro were the biggest losers last week. To recap, US headline PCE accelerated from 1.7% yoy to 2.0% yoy in March. Core PCE also accelerated from 1.6% yoy to 1.9% yoy. That was the main positive set of data last week. ISM manufacturing dropped to from 59.3 to 57.3 in April. ISM services dropped to 56.8, down from 58.8 and missed expectation of 58.1. Finally, non-farm payrolls reports showed only 164k job growth in April, below expectation of 194k. Unemployment rate did drop from 4.0% to 3.9%. But wage growth was disappointing, with average hourly earnings risen merely 0.1% mom versus expectation of 0.2% mom. Nonetheless, the FOMC statement showed slightly more hawkish tone on inflation. Fed noted that "both overall inflation and inflation for items other than food and energy have moved close to 2%". That's somewhat an upgrade fro March description that those barometers "have continued to run below 2%". Additionally, the members judged that "Inflation on a 12-month basis is expected to run near the Committee's symmetric 2% objective over the medium- term". In March, they expected inflation to "move up in coming months" and "to stabilize around the Committee's 2% objective over the medium- term". They viewed the risks are "roughly balance" in both meetings. Yet, the reference that "the Committee is monitoring inflation developments closely" was removed in May. This evidenced the members growing confidence that inflation would reach the target as expected. After a week of heavy weight events, Fed fund futures are still pricing in 100% odds of a June Fed hike. Chances priced in for September and December rates are largely unchanged. September odd at around 73-4%, December odd at only around 42-43%. 10 year yield extended the pull back from 3.035 short term top as expected. And thus, it provided little support to Dollar over the week. Stocks were also mainly driven by earnings as DOW engaged in very volatile trading inside recently established range. The pattern from 3.035 so far argues that it's only in a near term correction. That is, we're now leaning towards the case of strong support from 55 day EMA (now at 2.845), which is also close to channel support, to contain downside. Retest of 3.036 (2013 high) key resistance could be seen earlier then we originally thought. Dollar index's solid rally last week was mainly driven by selloff in EUR/USD. But after all, the firm break of 100% projection of 88.25 to 90.29 from 89.22 at 91.90 argues that rise from 88.25 is an impulsive move. That adds to the case of medium term trend reversal. The loss of momentum in some dollar pairs suggests that a near term retreat is possibly due in greenback. But in any case, near term outlook in DXY will remains bullish as long as 90.93 resistance turned support holds. We'd expect further rise ahead to 161.8% projection at 93.55 next. That could hinge on the April CPI figures to be
0.135857
0.028473
-0.534138
0.386689
[ 0.3866789724381361, -0.11496465343265995 ]
[ 0.2808398734167391, -0.22389355793993782 ]
[ -0.31158271251621544, -0.7566930124711547 ]
[ 0.44131756515405024, 0.33206001388742906 ]
1,024
[ 512, 512 ]
[ 360, 26810, 9698, 1833, 4723, 7300, 368, 6133, 5174, 23797, 278, 10369, 612, 264, 29889, 5806, 17407, 848, 515, 278, 3148, 892, 6892, 23451, 292, 29892, 896, 892, 451, 4319, 3307, 304, 10551, 17972, 29915, 29879, 2224, 310, 2211, 6554, 298, 29379, 445, 1629, 29889, 3387, 393, 29892, 278, 848, 3282, 29915, 29873, 788, 304, 278, 8825, 310, 278, 11582, 7251, 446, 297, 5846, 29889, 1551, 278, 916, 1361, 29892, 848, 515, 11652, 8028, 322, 10261, 337, 29899, 5527, 381, 2168, 278, 5232, 3204, 297, 660, 29896, 322, 278, 10225, 310, 7773, 19399, 297, 278, 337, 9917, 297, 660, 29906, 29889, 10506, 5849, 2715, 304, 278, 1206, 363, 17522, 29933, 304, 6876, 20436, 14999, 2678, 29892, 322, 363, 1952, 29923, 304, 9055, 278, 2446, 6554, 7251, 446, 29889, 450, 1735, 297, 17522, 29933, 322, 1952, 29923, 2149, 800, 7572, 304, 367, 25312, 297, 3444, 29892, 9556, 322, 10261, 10961, 2791, 1691, 29889, 1126, 18018, 4100, 368, 29892, 5332, 22813, 7709, 322, 10261, 402, 2782, 7709, 9698, 24344, 5224, 29889, 323, 12966, 411, 22162, 271, 297, 3148, 2578, 294, 2857, 17498, 29892, 896, 4944, 278, 14505, 304, 612, 264, 29892, 607, 9698, 408, 278, 4549, 342, 697, 29889, 1126, 451, 26800, 368, 29892, 28588, 1847, 322, 11652, 892, 278, 24842, 1232, 414, 1833, 4723, 29889, 13, 1762, 1162, 481, 29892, 3148, 2343, 1220, 349, 4741, 15592, 630, 515, 29871, 29896, 29889, 29955, 29995, 343, 12602, 304, 29871, 29906, 29889, 29900, 29995, 343, 12602, 297, 4779, 29889, 10239, 349, 4741, 884, 15592, 630, 515, 29871, 29896, 29889, 29953, 29995, 343, 12602, 304, 29871, 29896, 29889, 29929, 29995, 343, 12602, 29889, 2193, 471, 278, 1667, 6374, 731, 310, 848, 1833, 4723, 29889, 8519, 29924, 12012, 3864, 13700, 304, 515, 29871, 29945, 29929, 29889, 29941, 304, 29871, 29945, 29955, 29889, 29941, 297, 3786, 29889, 8519, 29924, 5786, 13700, 304, 29871, 29945, 29953, 29889, 29947, 29892, 1623, 515, 29871, 29945, 29947, 29889, 29947, 322, 13726, 23227, 310, 29871, 29945, 29947, 29889, 29896, 29889, 9788, 29892, 1661, 29899, 29888, 2817, 5146, 1245, 29879, 13676, 10018, 871, 29871, 29896, 29953, 29946, 29895, 4982, 14321, 297, 3786, 29892, 2400, 23227, 310, 29871, 29896, 29929, 29946, 29895, 29889, 853, 3451, 22812, 6554, 1258, 5768, 515, 29871, 29946, 29889, 29900, 29995, 304, 29871, 29941, 29889, 29929, 15543, 1205, 281, 482, 14321, 471, 23451, 292, 29892, 411, 6588, 7234, 368, 2326, 11753, 5161, 264, 13586, 29871, 29900, 29889, 29896, 29995, 16823, 23797, 23227, 310, 29871, 29900, 29889, 29906, 29995, 16823, 29889, 13, 12283, 621, 6393, 29892, 278, 383, 6488, 29907, 3229, 10018, 10029, 901, 447, 29893, 29895, 728, 16225, 373, 4414, 362, 29889, 17972, 11682, 393, 376, 20313, 12463, 4414, 362, 322, 4414, 362, 363, 4452, 916, 1135, 9687, 322, 5864, 505, 6153, 3802, 304, 29871, 29906, 29995, 1642, 2193, 29915, 29879, 10579, 385, 14955, 14671, 4779, 6139, 393, 1906, 2594, 290, 2699, 376, 17532, 7572, 304, 1065, 2400, 29871, 29906, 29995, 1642, 19814, 29892, 278, 5144, 6577, 3192, 393, 376, 15403, 362, 373, 263, 29871, 29896, 29906, 29899, 10874, 8405, 338, 3806, 304, 1065, 2978, 278, 12930, 29915, 29879, 18348, 29871, 29906, 29995, 12091, 975, 278, 18350, 29899, 1840, 1642, 512, 4779, 29892, 896, 3806, 4414, 362, 304, 376, 11631, 701, 297, 6421, 7378, 29908, 322, 376, 517, 16160, 675, 2820, 278, 12930, 29915, 29879, 29871, 29906, 29995, 12091, 975, 278, 18350, 29899, 1840, 1642, 2688, 24774, 278, 5161, 2039, 526, 376, 10573, 368, 17346, 29908, 297, 1716, 5870, 886, 29889, 15175, 29892, 278, 3407, 393, 376, 1552, 12930, 338, 29652, 4414, 362, 2693, 1860, 16467, 29908, 471, 6206, 297, 2610, 29889, 910, 3415, 3615, 1133, 278, 5144, 15678, 16420, 393, 4414, 362, 723, 6159, 278, 3646, 408, 3806, 29889, 13, 13555, 263, 4723, 310, 9416, 7688, 4959, 29892, 17972, 5220, 3105, 1973, 526, 1603, 544, 18499, 297, 29871, 29896, 29900, 29900, 29995, 7736, 29879, 310, 263, 5306, 17972, 7251, 446, 29889, 678, 2925, 544, 7612, 297, 363, 3839, 322, 5846, 19257, 526, 18425, 443, 15033, 29889, 3839, 7736, 472, 2820, 29871, 29955, 29941, 29899, 29946, 13667, 5846, 7736, 472, 871, 2820, 29871, 29946, 29906, 29899, 29946, 29941, 15543, 13, 29896, 29900, 1629, 7709, 10410, 278, 8206, 1250, 515, 29871, 29941, 29889, 29900, 29941, 29945, 3273, 1840, 2246, 408, 3806, 29889, 1126, 4550, 29892, 372, 4944, 2217, 2304, 304, 360, 26810, 975, 278, 4723, 29889, 6639, 4684, 892, 884, 14364, 18225, 491, 2326, 11753, 408, 360, 9806, 17785, 297, 1407, 1700, 24285, 3534, 292, 2768, 10325, 7841, 3464, 29889, 450, 4766, 515, 29871, 29941, 29889, 29900, 29941, 29945, 577, 2215, 1852, 1041, 393, 372, 29915, 29879, 871, 297, 263, 2978, 1840, 26385, 29889, 2193, 338, 29892, 591, 29915, 276, 1286, 20793, 292, 7113, 278, 1206, 310, 4549, 2304, 515, 29871, 29945, 29945, 2462, 382, 1529, 313, 3707, 472, 29871, 29906, 29889, 29947, 29946, 29945, 511, 607, 338, 884, 3802, 304, 8242, 2304, 29892, 304, 1712, 1623, 2975, 29889, 4649, 342, 310, 29871, 29941, 29889, 29900, 29941, 29953, 313, 29906, 29900, 29896, 29941, 1880, 29897, 1820, 17711, 1033, 367, 3595, 8859, 769, 591, 10437, 2714, 29889, 13, 29928, 26810, 2380, 29915, 29879, 7773, 364, 635, 1833, 4723, 471, 14364, 18225, 491, 269, 3156, 600, 297, 382, 4574, 29914, 3308, 29928, 29889, 1205, 1156, 599, 29892, 278, 9226, 2867, 310, 29871, 29896, 29900, 29900, 29995, 18246, 310, 29871, 29947, 29947, 29889, 29906, 29945, 304, 29871, 29929, 29900, 29889, 29906, 29929, 515, 29871, 29947, 29929, 29889, 29906, 29906, 472, 29871, 29929, 29896, 29889, 29929, 29900, 1852, 1041, 393, 14451, 515, 29871, 29947, 29947, 29889, 29906, 29945, 338, 385, 2411, 7273, 573, 4337, 29889, 2193, 12778, 304, 278, 1206, 310, 18350, 1840, 534, 355, 18764, 284, 29889, 450, 6410, 310, 19399, 297, 777, 11232, 279, 11000, 14661, 393, 263, 2978, 1840, 22162, 271, 338, 10075, 2861, 297, 7933, 1627, 29889, 1205, 297, 738, 1206, 29892, 2978, 1840, 714, 6914, 297, 360, 18454, 674, 9242, 289, 913, 728, 408, 1472, 408, 29871, 29929, 29900, 29889, 29929, 29941, 17711, 6077, 2304, 8640, 29889, 1334, 29915, 29881, 2149, 4340, 14451, 14432, 304, 29871, 29896, 29953, 29896, 29889, 29947, 29995, 18246, 472, 29871, 29929, 29941, 29889, 29945, 29945, 2446, 29889, 2193, 1033, 298, 19144, 373, 278, 3786, 315, 2227, 13994, 304, 367 ]
1,333,667
0
C4
15
4
David Stamford Ballantyne (1913-1990) Family Background The War Years Home & Family > Music & Poetry > Commemorative Pottery Garden Pottery Studio Pottery Domestic Use Pottery Architectural Ceramics & Tiles Pottery for Ian Hamilton Finlay Evenlode village school Katharine Elizabeth Harris was born in Bexley, Kent, on 17th October 1915, the second of three daughters of Albert and Charity (née Lucas) Harris; their youngest child, a son, died in infancy. Her father's family had been in service, while her mother came from a farming family, with origins in Warwickshire and North Devon. However both had moved away from these backgrounds; Charity into teaching and Albert into the civil service, hence their then residence near his work in London. After falling under a tram in Croydon while cycling to work, Albert lost a finger and took early retirement to the Cotswolds, managing a smallholding in Evenlode, near Moreton-in-Marsh. Here he earned an income from the sale of produce (cider apples, perry pears and honey) as well as keeping ducks and goats for home consumption. Charity became headmistress of Evenlode village school, where all grades were taught in two classrooms. Mary, Kate and Marg, Sennen Cove, Cornwall The Harris sisters, Margaret, Katharine and Rosemary, attended Chipping Camden Grammar School, each winning several prizes. Their mother Charity died while the girls were in their teens or early twenties, an event which deeply affected them all; the sisters remained close throughout their lives. They learned early on to be independent (they drove themselves to school, for example, in the early days of the motor-car, before the introduction of driving tests) and, following in their mother's footsteps, all three trained as teachers, Kate after taking a degree in French at Reading University, Margaret and Mary specializing in domestic science. David's pencil drawing of Kate Katharine spent a year studying in Lille as part of her degree. Her first job was teaching French at Wellingborough Grammar School, and it was here that she and David met, drawn to each other in the first instance by a shared interest in the French language and French culture. Albert Harris was not overjoyed at his daughter marrying a conscientious objector. German himself on his mother's side, Albert lived through the two great wars struggling to reconcile himself to his German heritage and ruing the accident that had prevented him from joining the British army himself. Yet the two men came to accept and respect each other. After leaving Wellingborough, David and Katharine took up a joint position with Oxford House as helpers in their schools for evacuee children, until the war ended. Katharine in her 20s While their four children were small, Katharine left teaching for full-time motherhood, taking it up again (initially part-time) after her youngest daughter Candy started nursery school. As a French teacher she inspired hundreds of children (including her own children and grandchildren) to love the language, while also instilling a respect for its rules. Lessons in Mrs Ballantyne's class at Fernhill Manor School in New Milton were active and fun, yet there was no backsliding over grammar! As she described in her remarks at David's memorial gathering, the lessons the children liked best were the ones in which she inserted (carefully rationed) stories of one Monsieur Ballantyne an absent-minded professor (alias David, of course), whose adventures never failed to arouse much laughter. Goddess head with plant arrangement Katharine played an active role in David's work both as teacher and as artist. In addition to caring for their children, she gave him inspiration and encouragement, was a generous hostess to his colleagues and students, and created a home environment which became the backdrop to his pottery and design work. Katharine had an unrivalled eye for style, much of it drawn from her experience of living in France as a student and her interest in French culture – and indeed her curiosity about other cultures generally - and David's creativity flourished in the setting they created together. In preparation for the move to the new house in Chewton Farm Road, David and Katharine worked together to develop the design brief
1.682392
0.975604
1.429547
-0.107572
[ 0.792102899421769, 2.5726809571201574 ]
[ 0.9111411340377601, 1.0400663918920598 ]
[ 1.1860676129731955, 1.6730258898469752 ]
[ -0.3442962558583208, 0.12915313296370412 ]
1,024
[ 512, 512 ]
[ 4699, 624, 314, 4006, 13402, 424, 29891, 484, 313, 29896, 29929, 29896, 29941, 29899, 29896, 29929, 29929, 29900, 29897, 13, 27104, 16585, 13, 1576, 3362, 23857, 13, 11184, 669, 14662, 1405, 13, 21238, 669, 3929, 27184, 1405, 13, 5261, 28927, 1230, 10173, 22005, 13, 29954, 7879, 10173, 22005, 13, 28867, 10173, 22005, 13, 11096, 15931, 4803, 10173, 22005, 13, 13197, 4496, 3631, 10580, 314, 1199, 669, 323, 5475, 13, 29925, 327, 22005, 363, 22291, 12372, 4231, 8387, 13, 29923, 854, 29880, 356, 5720, 3762, 13, 29968, 493, 279, 457, 13061, 20349, 471, 6345, 297, 350, 735, 2330, 29892, 13272, 29892, 373, 29871, 29896, 29955, 386, 5533, 29871, 29896, 29929, 29896, 29945, 29892, 278, 1473, 310, 2211, 29215, 310, 10537, 322, 2896, 537, 313, 24697, 24243, 29897, 20349, 29936, 1009, 4123, 342, 2278, 29892, 263, 1487, 29892, 6423, 297, 3041, 6906, 29889, 13, 18650, 4783, 29915, 29879, 3942, 750, 1063, 297, 2669, 29892, 1550, 902, 5637, 2996, 515, 263, 2215, 4056, 3942, 29892, 411, 1677, 1144, 297, 3362, 6669, 11750, 322, 4644, 9481, 265, 29889, 2398, 1716, 750, 6153, 3448, 515, 1438, 3239, 29879, 29936, 2896, 537, 964, 18819, 322, 10537, 964, 278, 7631, 2669, 29892, 8151, 1009, 769, 25488, 2978, 670, 664, 297, 4517, 29889, 13, 13555, 20327, 1090, 263, 19183, 297, 8764, 2941, 265, 1550, 5094, 19914, 304, 664, 29892, 10537, 5714, 263, 19917, 322, 3614, 4688, 3240, 19211, 304, 278, 315, 1862, 29893, 3361, 29892, 767, 6751, 263, 2319, 8948, 292, 297, 7753, 29880, 356, 29892, 2978, 3879, 20666, 29899, 262, 29899, 7083, 845, 29889, 13, 10605, 540, 20591, 385, 17869, 515, 278, 14686, 310, 7738, 313, 29883, 1241, 623, 793, 29892, 639, 719, 282, 15451, 322, 298, 4992, 29897, 408, 1532, 408, 12515, 868, 4684, 322, 748, 1446, 363, 3271, 27430, 29889, 2896, 537, 3897, 2343, 29885, 391, 1253, 310, 7753, 29880, 356, 5720, 3762, 29892, 988, 599, 867, 3076, 892, 16187, 297, 1023, 770, 18901, 29889, 13, 29924, 653, 29892, 23738, 322, 11649, 29892, 317, 18723, 315, 994, 29892, 11655, 11358, 13, 1576, 20349, 9883, 29879, 29892, 18364, 29892, 19663, 279, 457, 322, 5678, 331, 653, 29892, 14283, 678, 17347, 5500, 1145, 16878, 3034, 4523, 29892, 1269, 15613, 3196, 3691, 10947, 29889, 11275, 5637, 2896, 537, 6423, 1550, 278, 14000, 892, 297, 1009, 734, 575, 470, 4688, 3252, 296, 583, 29892, 385, 1741, 607, 24344, 15201, 963, 599, 29936, 278, 9883, 29879, 9488, 3802, 10106, 1009, 12080, 29889, 13, 15597, 10972, 4688, 373, 304, 367, 7417, 313, 19562, 26603, 6053, 304, 3762, 29892, 363, 1342, 29892, 297, 278, 4688, 3841, 310, 278, 10992, 29899, 4287, 29892, 1434, 278, 18707, 310, 19500, 6987, 29897, 322, 29892, 1494, 297, 1009, 5637, 29915, 29879, 3661, 24530, 29892, 599, 2211, 16370, 408, 27335, 29892, 23738, 1156, 5622, 263, 7426, 297, 5176, 472, 21439, 3014, 29892, 18364, 322, 6182, 4266, 5281, 297, 21849, 10466, 29889, 13, 19504, 29915, 29879, 282, 3977, 309, 11580, 310, 23738, 13, 29968, 493, 279, 457, 10398, 263, 1629, 23382, 297, 365, 1924, 408, 760, 310, 902, 7426, 29889, 2439, 937, 4982, 471, 18819, 5176, 472, 5674, 292, 22187, 16878, 3034, 4523, 29892, 322, 372, 471, 1244, 393, 1183, 322, 4699, 1539, 29892, 12061, 304, 1269, 916, 297, 278, 937, 2777, 491, 263, 7258, 4066, 297, 278, 5176, 4086, 322, 5176, 9257, 29889, 13, 2499, 2151, 20349, 471, 451, 975, 2212, 28133, 472, 670, 8750, 20479, 292, 263, 1136, 15566, 2738, 1203, 272, 29889, 5332, 3654, 373, 670, 5637, 29915, 29879, 2625, 29892, 10537, 10600, 1549, 278, 1023, 2107, 29129, 20042, 304, 8265, 21873, 3654, 304, 670, 5332, 902, 16639, 322, 5796, 292, 278, 11423, 393, 750, 5557, 287, 1075, 515, 22960, 278, 4908, 9987, 3654, 29889, 15175, 278, 1023, 1757, 2996, 304, 3544, 322, 3390, 1269, 916, 29889, 13, 13555, 10124, 5674, 292, 22187, 29892, 4699, 322, 19663, 279, 457, 3614, 701, 263, 14002, 2602, 411, 11045, 5619, 408, 1371, 414, 297, 1009, 12462, 363, 3415, 562, 434, 29872, 4344, 29892, 2745, 278, 1370, 9698, 29889, 13, 29968, 493, 279, 457, 297, 902, 29871, 29906, 29900, 29879, 13, 8809, 488, 1009, 3023, 4344, 892, 2319, 29892, 19663, 279, 457, 2175, 18819, 363, 2989, 29899, 2230, 5637, 6614, 29892, 5622, 372, 701, 1449, 313, 11228, 368, 760, 29899, 2230, 29897, 1156, 902, 4123, 342, 8750, 315, 13910, 4687, 5595, 643, 29891, 3762, 29889, 1094, 263, 5176, 15703, 1183, 20603, 21006, 310, 4344, 313, 18271, 902, 1914, 4344, 322, 4595, 11991, 29897, 304, 5360, 278, 4086, 29892, 1550, 884, 832, 8873, 263, 3390, 363, 967, 6865, 29889, 13, 29931, 404, 787, 297, 6285, 13402, 424, 29891, 484, 29915, 29879, 770, 472, 7139, 29131, 2315, 272, 4523, 297, 1570, 3833, 880, 892, 6136, 322, 2090, 29892, 3447, 727, 471, 694, 1250, 2536, 4821, 975, 25437, 29991, 1094, 1183, 5439, 297, 902, 29360, 472, 4699, 29915, 29879, 2626, 9020, 11705, 292, 29892, 278, 3109, 787, 278, 4344, 23289, 1900, 892, 278, 6743, 297, 607, 1183, 15478, 313, 18020, 3730, 364, 362, 287, 29897, 15874, 310, 697, 28529, 13402, 424, 29891, 484, 385, 29207, 29899, 24021, 287, 12251, 313, 19973, 4699, 29892, 310, 3236, 511, 5069, 17623, 1973, 2360, 5229, 304, 564, 1709, 1568, 10569, 357, 29889, 13, 29954, 397, 19521, 2343, 411, 8024, 24628, 13, 29968, 493, 279, 457, 5318, 385, 6136, 6297, 297, 4699, 29915, 29879, 664, 1716, 408, 15703, 322, 408, 7664, 29889, 512, 6124, 304, 1559, 292, 363, 1009, 4344, 29892, 1183, 4846, 1075, 8681, 12232, 322, 18443, 882, 29892, 471, 263, 1176, 681, 3495, 404, 304, 670, 23056, 21628, 322, 8041, 29892, 322, 2825, 263, 3271, 5177, 607, 3897, 278, 1250, 8865, 304, 670, 3104, 22005, 322, 2874, 664, 29889, 13, 29968, 493, 279, 457, 750, 385, 443, 15081, 839, 10977, 363, 3114, 29892, 1568, 310, 372, 12061, 515, 902, 7271, 310, 8471, 297, 3444, 408, 263, 8368, 322, 902, 4066, 297, 5176, 9257, 785, 322, 6200, 902, 27742, 1048, 916, 4185, 1973, 6892, 448, 322, 4699, 29915, 29879, 907, 28157, 1652, 473, 3276, 297, 278, 4444, 896, 2825, 4208, 29889, 512, 10223, 362, 363, 278, 4337, 304, 278, 716, 3699, 297, 6561, 29893, 880, 23354, 9321, 29892, 4699, 322, 19663, 279, 457, 3796, 4208, 304, 2693, 278, 2874, 11473 ]
1,333,668
0
CommonCrawl
21
17
Words cannot impress God but from the heart I first acknowledge His omnipotence, omniscience and omnipresence. God is a wonderful, loving and merciful God. He is not just A God but He is THE God. I thank God for saving my life; for not consuming me in His wrath and for not giving me over to my enemies. There is power in the blood of Jesus. There is power in the mighty name of Jesus. This testimony I haven't shared with much people but I wish to take the time out with joy and gladness to share my testimony to bless others. God is Healer; Deliverer; Saviour; Protector and Provider. He is our Everything. He is our All in all. There is much to say but I don't think I can write all that has happened to me. I was a very young child. Everything seemed happy with my little family but then my eyes opened up to see that all was not well. I remember during Hurricane Ivan that the yard was flooded but daddy still managed to pass through the flood, he left and I didn't see Him in a long while. My mother was hurting. Her marriage with my father was ruining. Daddy had finally left us for another family. Mom was heartbroken. She was not working and daddy was hardly around to give my sister and I lunch money to go to school [we were in Primary School at that time]. We were dependent on him for everything. There were nights that we went to bed hungry. When we called him, it was either we didn't get through to him or he promised he would show up but he never did. Sometimes we didn't have lunch money to go to school but mom ensured that we were never absent for she sacrificed everything. We kept the faith. This all continued until my mother met a guy who at first seemed as if he would be the continuation of what my father broke off. We were happy with him and he, with us until the responsibility of being the household's bread winner was upon me. He changed. He would curse us and use our father's situation against us. If he had ever done anything for us, he would curse us and demand back his money, if he bought food or took care of the utilities or even if he gave us lunch money to go to school. It would have been better if he cursed us privately but he would tell everyone what he did-embarrassing us. Situation got more intense and heartbroken when he started physically abusing my mother. He would punch her with all his might all over her, especially in her face; kicked her; squeezed her throat as if he intended to kill her and cursed all of us, telling us the worse things ever. And this happened repeatedly as if it were a cycle. I lost all hope. I felt like I never belonged. I felt inferior and unhappy. I struggled with my self-image and esteem because he cursed me and yelled at me saying that I was good for nothing or I didn't serve any purpose or I was useless and worthless. My sister and I endured the same thing. The worst part about it was that at one point, as if she was helpless to defend us and stand up for us, our mother joined forces with him and they cursed us and undermined us in everything that we did. I began hating them both very much. He would tell lies on us for mom to beat us and curse us for him. It seemed as if he wanted mom to abandon us for him. When he bought food and brought it into the household, he told us not to touch his stuffs or if he ever found out that we ate anything of his, he would force his hand down our stomachs and withdraw his food. We couldn't use the light to do homework for he was the one paying the bill; we couldn't spend time showering properly for he was the one taking care of the bill; we couldn't go near his furniture for he was the one who bought them. We were devastated and depressed. I had to use candles in the nights and do homework and study. I still came in the top 3! Thanks be to God!!! Oh, how my eyes strained! Surprisingly, I still have 20/20 vision. We were hungry, as I recall one day, when we went inside the house to ask for something to eat when he forced us out of the house with his harsh words, telling us to "grange the green mangoes on the trees up in the hills". I always believed in God but one Saturday when I
0.29628
-1.017366
-0.597227
-0.548179
[ 0.8249751097177394, -0.23241432146930363 ]
[ -1.2232881348834246, -0.8114435611821892 ]
[ -0.4656593548083098, -0.7287943611919278 ]
[ -0.7117398062490407, -0.3846174950162405 ]
1,024
[ 512, 512 ]
[ 399, 4339, 2609, 21210, 4177, 541, 515, 278, 5192, 306, 937, 18145, 5485, 3600, 2703, 29876, 666, 327, 663, 29892, 2703, 6994, 15277, 322, 2703, 1240, 4569, 663, 29889, 4177, 338, 263, 20695, 29892, 12355, 292, 322, 16856, 6845, 4177, 29889, 940, 338, 451, 925, 319, 4177, 541, 940, 338, 6093, 4177, 29889, 306, 6452, 4177, 363, 14238, 590, 2834, 29936, 363, 451, 1136, 9929, 592, 297, 3600, 2358, 493, 322, 363, 451, 6820, 592, 975, 304, 590, 22595, 29889, 1670, 338, 3081, 297, 278, 10416, 310, 13825, 29889, 1670, 338, 3081, 297, 278, 27977, 1024, 310, 13825, 29889, 910, 28523, 2592, 306, 7359, 29915, 29873, 7258, 411, 1568, 2305, 541, 306, 6398, 304, 2125, 278, 931, 714, 411, 15331, 322, 10932, 2264, 304, 6232, 590, 28523, 2592, 304, 17065, 4045, 29889, 4177, 338, 940, 18362, 29936, 5556, 2147, 261, 29936, 9583, 8975, 29936, 14409, 2801, 322, 1019, 5489, 29889, 940, 338, 1749, 17296, 29889, 940, 338, 1749, 2178, 297, 599, 29889, 13, 8439, 338, 1568, 304, 1827, 541, 306, 1016, 29915, 29873, 1348, 306, 508, 2436, 599, 393, 756, 9559, 304, 592, 29889, 306, 471, 263, 1407, 4123, 2278, 29889, 17296, 6140, 9796, 411, 590, 2217, 3942, 541, 769, 590, 5076, 6496, 701, 304, 1074, 393, 599, 471, 451, 1532, 29889, 306, 6456, 2645, 379, 1038, 26655, 16560, 393, 278, 29413, 471, 5685, 6797, 541, 270, 25644, 1603, 8745, 304, 1209, 1549, 278, 5685, 397, 29892, 540, 2175, 322, 306, 3282, 29915, 29873, 1074, 18136, 297, 263, 1472, 1550, 29889, 1619, 5637, 471, 12166, 1259, 29889, 2439, 13718, 411, 590, 4783, 471, 5796, 2827, 29889, 360, 25644, 750, 7146, 2175, 502, 363, 1790, 3942, 29889, 341, 290, 471, 5192, 6729, 1717, 29889, 2296, 471, 451, 1985, 322, 270, 25644, 471, 15155, 2820, 304, 2367, 590, 9883, 322, 306, 301, 3322, 6909, 304, 748, 304, 3762, 518, 705, 892, 297, 28267, 4523, 472, 393, 931, 1822, 1334, 892, 14278, 373, 1075, 363, 4129, 29889, 1670, 892, 4646, 29879, 393, 591, 3512, 304, 6592, 9074, 14793, 29889, 1932, 591, 2000, 1075, 29892, 372, 471, 2845, 591, 3282, 29915, 29873, 679, 1549, 304, 1075, 470, 540, 22399, 540, 723, 1510, 701, 541, 540, 2360, 1258, 29889, 18512, 591, 3282, 29915, 29873, 505, 301, 3322, 6909, 304, 748, 304, 3762, 541, 16823, 5662, 2955, 393, 591, 892, 2360, 29207, 363, 1183, 26285, 287, 4129, 29889, 1334, 8126, 278, 10847, 29889, 13, 4013, 599, 7572, 2745, 590, 5637, 1539, 263, 1410, 29891, 1058, 472, 937, 6140, 408, 565, 540, 723, 367, 278, 3133, 362, 310, 825, 590, 4783, 14455, 1283, 29889, 1334, 892, 9796, 411, 1075, 322, 540, 29892, 411, 502, 2745, 278, 23134, 310, 1641, 278, 22329, 29915, 29879, 18423, 19576, 471, 2501, 592, 29889, 940, 3939, 29889, 940, 723, 3151, 344, 502, 322, 671, 1749, 4783, 29915, 29879, 6434, 2750, 502, 29889, 960, 540, 750, 3926, 2309, 3099, 363, 502, 29892, 540, 723, 3151, 344, 502, 322, 9667, 1250, 670, 6909, 29892, 565, 540, 18093, 9687, 470, 3614, 2562, 310, 278, 3667, 1907, 470, 1584, 565, 540, 4846, 502, 301, 3322, 6909, 304, 748, 304, 3762, 29889, 739, 723, 505, 1063, 2253, 565, 540, 18580, 287, 502, 5999, 2486, 541, 540, 723, 2649, 14332, 825, 540, 1258, 29899, 1590, 2749, 465, 292, 502, 29889, 23920, 362, 2355, 901, 17818, 344, 322, 5192, 6729, 1717, 746, 540, 4687, 4824, 1711, 633, 4746, 590, 5637, 29889, 940, 723, 282, 3322, 902, 411, 599, 670, 1795, 599, 975, 902, 29892, 7148, 297, 902, 3700, 29936, 413, 17840, 902, 29936, 269, 802, 6096, 287, 902, 20961, 271, 408, 565, 540, 9146, 304, 12088, 902, 322, 18580, 287, 599, 310, 502, 29892, 14509, 502, 278, 15029, 2712, 3926, 29889, 1126, 445, 9559, 28424, 408, 565, 372, 892, 263, 11412, 29889, 306, 5714, 599, 4966, 29889, 306, 7091, 763, 306, 2360, 28911, 29889, 306, 7091, 20773, 322, 28859, 14862, 29889, 306, 10205, 839, 411, 590, 1583, 29899, 3027, 322, 4404, 331, 1363, 540, 18580, 287, 592, 322, 343, 14356, 472, 592, 5934, 393, 306, 471, 1781, 363, 3078, 470, 306, 3282, 29915, 29873, 9080, 738, 6437, 470, 306, 471, 19315, 322, 7088, 2222, 29889, 1619, 9883, 322, 306, 1095, 2955, 278, 1021, 2655, 29889, 450, 17322, 760, 1048, 372, 471, 393, 472, 697, 1298, 29892, 408, 565, 1183, 471, 1081, 572, 404, 304, 24663, 502, 322, 2317, 701, 363, 502, 29892, 1749, 5637, 8772, 8249, 411, 1075, 322, 896, 18580, 287, 502, 322, 563, 837, 1312, 502, 297, 4129, 393, 591, 1258, 29889, 306, 4689, 298, 1218, 963, 1716, 1407, 1568, 29889, 940, 723, 2649, 12185, 373, 502, 363, 16823, 304, 16646, 502, 322, 3151, 344, 502, 363, 1075, 29889, 739, 6140, 408, 565, 540, 5131, 16823, 304, 11807, 502, 363, 1075, 29889, 1932, 540, 18093, 9687, 322, 6296, 372, 964, 278, 22329, 29892, 540, 5429, 502, 451, 304, 6023, 670, 6433, 29879, 470, 565, 540, 3926, 1476, 714, 393, 591, 263, 371, 3099, 310, 670, 29892, 540, 723, 4889, 670, 1361, 1623, 1749, 380, 290, 496, 29879, 322, 28679, 670, 9687, 29889, 1334, 8496, 29915, 29873, 671, 278, 3578, 304, 437, 3271, 1287, 363, 540, 471, 278, 697, 5146, 292, 278, 11118, 29936, 591, 8496, 29915, 29873, 18864, 931, 1510, 3241, 6284, 363, 540, 471, 278, 697, 5622, 2562, 310, 278, 11118, 29936, 591, 8496, 29915, 29873, 748, 2978, 670, 15252, 17252, 363, 540, 471, 278, 697, 1058, 18093, 963, 29889, 1334, 892, 2906, 579, 630, 322, 316, 13120, 29889, 306, 750, 304, 671, 23794, 793, 297, 278, 4646, 29879, 322, 437, 3271, 1287, 322, 6559, 29889, 306, 1603, 2996, 297, 278, 2246, 29871, 29941, 29991, 1834, 367, 304, 4177, 21004, 6439, 29892, 920, 590, 5076, 5312, 1312, 29991, 6298, 558, 5921, 368, 29892, 306, 1603, 505, 29871, 29906, 29900, 29914, 29906, 29900, 18551, 29889, 1334, 892, 9074, 14793, 29892, 408, 306, 17386, 697, 2462, 29892, 746, 591, 3512, 2768, 278, 3699, 304, 2244, 363, 1554, 304, 17545, 746, 540, 11826, 502, 714, 310, 278, 3699, 411, 670, 4023, 845, 3838, 29892, 14509, 502, 304, 376, 629, 927, 278, 7933, 286, 4524, 267, 373, 278, 10697, 701, 297, 278, 22696, 1642, 306, 2337, 13112, 297, 4177, 541, 697, 24211, 746, 306 ]
1,333,673
0
C4
19
18
decided to worship Him, he came forcefully and took my Bible and threw it away. Knowing me, I always wanted to defend myself in everything; I cried and cried and told him that God saw him and will handle him. That was all I could do. I felt helpless. Things transpired when my mom became pregnant with his child. He bought household stuffs and told my sister and me that we weren't supposed to touch his stuffs. We had to wait until he was away for us to eat something. I would cry myself to sleep. I began asking God why!!!!! "Why did You create me? I hate myself!" were some of the things I would say to God. I would repeatedly wished I wasn't born, and then I began believing everything my step-dad cursed me and told me. Even when mom was pregnant he would beat her. He enjoyed hitting her in the face. Right now, one of her eyes is badly damaged, that she has to do surgery on her pupil each year. He would cheat on her. He used her. He abused her. And the cycle would continue. One evening when he seemed to be killing her during a fight, I couldn't watch him hurt her anymore so I intervened and began hitting him with a broom. He left her and approached me with a machete, mean while he squeezed my throat, and he told me he would kill me. I was so scared and frightened. It pained me to watch my mother suffered so much. It took years for us to be finally delivered; when God saw that it was enough, that mom applied for an overseas work programme alongside a group of people and she was the only one to get through at the embassy. She was given only a few months but she ran off so that she could send us throughout high school and now in college. So, we were delivered. We moved and stayed with family members but things were only nice for a little time there. My sister and I thought we were finally happy until family members started using us and mistreating us. I had sleepless nights and constant headaches. I was happy and eager to leave the house but when time near approached for me to go back home, I became depressed and terribly sad. They told lies on us; robbed us; used us to do hard chores and the like. Mom was trying to help us and so my sister and I encouraged each other that bright and sunny days will be coming our way. We endured the sufferings and hardships for some years until again God saw that it was enough. We moved several times from house to house and from community to community. I remember when we lived in a small, feeble, boarded house and a gun man tried to break in to harm us and rob us. Mom was pregnant at the time and our step-dad was with another woman. It was by the grace of God why we weren't harmed and I know God was with us because the door wasn't strong enough to withstand the pressure and force at which the gun man tried to bring it down, yet still the gun man was not strong enough to do so because God held it up. Satan tried to kill me several times, one of which I was in a very terrible car accident. I was supposed to be dead but GOD-MY GOD has a plan for my life. All those times that I struggled and I suffered; felt inferior; insignificant; rejected and neglected, yet still here I am. God chose me. I believe. I am blessed. I still struggle with my self-image and self-esteem but God will make a way out for me. People wouldn't understand how much my heart was shattered in pieces but here I still am alive and well and going on. God healed me; saved me; protected me; stood by me; delivered me and comforted me when I was hurting and felt alone. He gave me the strength to forgive each person that oppressed me. Yes! I forgave my daddy, my step-dad and family members. The devil wants to see me fail and he wants me desperately to fall but I am a warrior! I am a conqueror in the name of the Lord! Other than all that I have mentioned above, that I have been through, there were a lot more that transpired but I didn't die. I made it! You all will rise and make it too! Only God can turn a mess into a message and a test into a testimony, like what He did through me. Be of good courage! Jesus is there for us and with us. Never ask God to take you out of a
0.13055
-0.916195
-0.567268
-0.542651
[ -0.213238865463321, 0.47433819989405673 ]
[ -0.5446399025670412, -1.2877507638105743 ]
[ -0.6412940458161704, -0.4932409759593637 ]
[ -0.17520718842188332, -0.9100942892033231 ]
1,024
[ 512, 512 ]
[ 8459, 304, 26320, 18136, 29892, 540, 2996, 4889, 3730, 322, 3614, 590, 21958, 322, 18318, 372, 3448, 29889, 19320, 292, 592, 29892, 306, 2337, 5131, 304, 24663, 6142, 297, 4129, 29936, 306, 10680, 322, 10680, 322, 5429, 1075, 393, 4177, 4446, 1075, 322, 674, 4386, 1075, 29889, 2193, 471, 599, 306, 1033, 437, 29889, 306, 7091, 1081, 572, 404, 29889, 13, 1349, 886, 1301, 29886, 2859, 746, 590, 16823, 3897, 758, 5138, 424, 411, 670, 2278, 29889, 940, 18093, 22329, 6433, 29879, 322, 5429, 590, 9883, 322, 592, 393, 591, 2949, 264, 29915, 29873, 7424, 304, 6023, 670, 6433, 29879, 29889, 1334, 750, 304, 4480, 2745, 540, 471, 3448, 363, 502, 304, 17545, 1554, 29889, 306, 723, 10901, 6142, 304, 8709, 29889, 306, 4689, 6721, 4177, 2020, 6824, 21004, 376, 11008, 1258, 887, 1653, 592, 29973, 306, 26277, 6142, 3850, 892, 777, 310, 278, 2712, 306, 723, 1827, 304, 4177, 29889, 306, 723, 28424, 20024, 306, 9007, 29915, 29873, 6345, 29892, 322, 769, 306, 4689, 1339, 15387, 4129, 590, 4331, 29899, 29881, 328, 18580, 287, 592, 322, 5429, 592, 29889, 7753, 746, 16823, 471, 758, 5138, 424, 540, 723, 16646, 902, 29889, 940, 27849, 29425, 902, 297, 278, 3700, 29889, 10428, 1286, 29892, 697, 310, 902, 5076, 338, 28042, 5625, 4063, 29892, 393, 1183, 756, 304, 437, 25300, 708, 373, 902, 23449, 309, 1269, 1629, 29889, 940, 723, 923, 271, 373, 902, 29889, 940, 1304, 902, 29889, 940, 633, 3880, 902, 29889, 1126, 278, 11412, 723, 6773, 29889, 3118, 11005, 746, 540, 6140, 304, 367, 23393, 902, 2645, 263, 8589, 29892, 306, 8496, 29915, 29873, 6505, 1075, 21682, 902, 15128, 577, 306, 26314, 287, 322, 4689, 29425, 1075, 411, 263, 2545, 290, 29889, 940, 2175, 902, 322, 26733, 592, 411, 263, 7672, 2650, 29892, 2099, 1550, 540, 269, 802, 6096, 287, 590, 20961, 271, 29892, 322, 540, 5429, 592, 540, 723, 12088, 592, 29889, 306, 471, 577, 885, 1965, 322, 22739, 6419, 29889, 739, 6788, 287, 592, 304, 6505, 590, 5637, 17654, 577, 1568, 29889, 13, 3112, 3614, 2440, 363, 502, 304, 367, 7146, 20115, 29936, 746, 4177, 4446, 393, 372, 471, 3307, 29892, 393, 16823, 7436, 363, 385, 975, 344, 294, 664, 19607, 19963, 263, 2318, 310, 2305, 322, 1183, 471, 278, 871, 697, 304, 679, 1549, 472, 278, 7232, 465, 29891, 29889, 2296, 471, 2183, 871, 263, 2846, 7378, 541, 1183, 6350, 1283, 577, 393, 1183, 1033, 3638, 502, 10106, 1880, 3762, 322, 1286, 297, 12755, 29889, 1105, 29892, 591, 892, 20115, 29889, 1334, 6153, 322, 27661, 411, 3942, 5144, 541, 2712, 892, 871, 7575, 363, 263, 2217, 931, 727, 29889, 1619, 9883, 322, 306, 2714, 591, 892, 7146, 9796, 2745, 3942, 5144, 4687, 773, 502, 322, 5862, 276, 1218, 502, 29889, 306, 750, 12844, 29872, 572, 404, 4646, 29879, 322, 4868, 2343, 14520, 29889, 306, 471, 9796, 322, 19888, 304, 5967, 278, 3699, 541, 746, 931, 2978, 26733, 363, 592, 304, 748, 1250, 3271, 29892, 306, 3897, 316, 13120, 322, 1935, 1091, 368, 14610, 29889, 2688, 5429, 12185, 373, 502, 29936, 696, 1327, 287, 502, 29936, 1304, 502, 304, 437, 2898, 521, 2361, 322, 278, 763, 29889, 341, 290, 471, 1811, 304, 1371, 502, 322, 577, 590, 9883, 322, 306, 18443, 287, 1269, 916, 393, 11785, 322, 6575, 1460, 3841, 674, 367, 6421, 1749, 982, 29889, 1334, 1095, 2955, 278, 8812, 886, 322, 2898, 9981, 363, 777, 2440, 2745, 1449, 4177, 4446, 393, 372, 471, 3307, 29889, 13, 4806, 6153, 3196, 3064, 515, 3699, 304, 3699, 322, 515, 7881, 304, 7881, 29889, 306, 6456, 746, 591, 10600, 297, 263, 2319, 29892, 27684, 569, 29892, 7613, 287, 3699, 322, 263, 13736, 767, 1898, 304, 2867, 297, 304, 10311, 502, 322, 10832, 502, 29889, 341, 290, 471, 758, 5138, 424, 472, 278, 931, 322, 1749, 4331, 29899, 29881, 328, 471, 411, 1790, 6114, 29889, 739, 471, 491, 278, 17659, 310, 4177, 2020, 591, 2949, 264, 29915, 29873, 4023, 2168, 322, 306, 1073, 4177, 471, 411, 502, 1363, 278, 3050, 9007, 29915, 29873, 4549, 3307, 304, 411, 1689, 278, 12959, 322, 4889, 472, 607, 278, 13736, 767, 1898, 304, 6963, 372, 1623, 29892, 3447, 1603, 278, 13736, 767, 471, 451, 4549, 3307, 304, 437, 577, 1363, 4177, 4934, 372, 701, 29889, 12178, 273, 1898, 304, 12088, 592, 3196, 3064, 29892, 697, 310, 607, 306, 471, 297, 263, 1407, 16403, 1559, 11423, 29889, 306, 471, 7424, 304, 367, 7123, 541, 402, 13668, 29899, 17870, 402, 13668, 756, 263, 3814, 363, 590, 2834, 29889, 2178, 1906, 3064, 393, 306, 10205, 839, 322, 306, 17654, 29936, 7091, 20773, 29936, 1663, 647, 928, 424, 29936, 22225, 322, 22851, 287, 29892, 3447, 1603, 1244, 306, 626, 29889, 4177, 12784, 592, 29889, 306, 4658, 29889, 306, 626, 1999, 11517, 29889, 306, 1603, 21117, 411, 590, 1583, 29899, 3027, 322, 1583, 29899, 4196, 331, 541, 4177, 674, 1207, 263, 982, 714, 363, 592, 29889, 11647, 7656, 29915, 29873, 2274, 920, 1568, 590, 5192, 471, 528, 2620, 287, 297, 12785, 541, 1244, 306, 1603, 626, 18758, 322, 1532, 322, 2675, 373, 29889, 4177, 540, 7943, 592, 29936, 7160, 592, 29936, 6364, 592, 29936, 8389, 491, 592, 29936, 20115, 592, 322, 13016, 287, 592, 746, 306, 471, 12166, 1259, 322, 7091, 7432, 29889, 940, 4846, 592, 278, 9324, 304, 18879, 573, 1269, 2022, 393, 4575, 1253, 287, 592, 29889, 3869, 29991, 306, 18879, 1351, 590, 270, 25644, 29892, 590, 4331, 29899, 29881, 328, 322, 3942, 5144, 29889, 450, 29754, 10753, 304, 1074, 592, 4418, 322, 540, 10753, 592, 553, 546, 2486, 304, 6416, 541, 306, 626, 263, 1370, 13479, 29991, 306, 626, 263, 26474, 272, 297, 278, 1024, 310, 278, 6171, 29991, 5901, 1135, 599, 393, 306, 505, 5276, 2038, 29892, 393, 306, 505, 1063, 1549, 29892, 727, 892, 263, 3287, 901, 393, 1301, 29886, 2859, 541, 306, 3282, 29915, 29873, 762, 29889, 306, 1754, 372, 29991, 887, 599, 674, 14451, 322, 1207, 372, 2086, 29991, 9333, 4177, 508, 2507, 263, 4473, 964, 263, 2643, 322, 263, 1243, 964, 263, 28523, 2592, 29892, 763, 825, 940, 1258, 1549, 592, 29889, 1522, 310, 1781, 19872, 29991, 13825, 338, 727, 363, 502, 322, 411, 502, 29889, 12391, 2244, 4177, 304, 2125, 366, 714, 310, 263 ]
1,333,673
1,024
C4
19
18
Exit Glacier, Kenai Fjords National Park Gary Zimmerman, Part 2 This is a continuation of an interview with Gary Zimmerman by Don Callaway, Rachel Mason, Karen Brewster, and Shannon Kovac on April 10, 2010 at the Van Gilder Hotel in Seward, Alaska. In this part of the interview, Gary talks about riding snowmachines on the Harding Icefield and near Exit Glacier, and ensuring that snowmachining continues to be an allowed use in Kenai Fjords National Park. Project: Exit Glacier, Kenai Fjords National Park Date of Interview: Apr 10, 2010 Narrator(s): Gary Zimmerman Interviewer(s): Don Callaway, Rachel Mason, Karen Brewster Transcriber: Carol McCue People Present: Shannon Kovac Seward, Alaska Gary Zimmerman's Slideshow Changes in Exit Glacier, Changes in Wildlife Populations, Establishment of Kenai Fjords National Park, Hunting, Park Management Issues, Snowmachines Exit Glacier, Seward Alaska Preserving the ice field Friends he rides snowmachines with First snowmachines in Seward Snowmachining on Exit Glacier Road Snowmachine etiquette Effects on hunting from the establishment of Kenai Fjords National Park His father's guiding business and loss of hunting cabin Filming of a commerical at Aialik Bay Snowmaching in the Exit Glacier area before there was a road Educational and work history Fishing boat accident Vision saving his life when drowning Other family members in the Seward area Working as oil driller and workplace accident Snowmachine season Overflow on the routes Changes in Exit Glacier Snowmachining on Exit Glacier Wanting to keep the Park area open to everyone and equality in use and permit fees GARY ZIMMERMAN: I want to see it -- I want to see that ice field, and I'm -- I'm a very strict snowmobiler. I mean, I -- there's nobody -- you won't find anybody in the state of Alaska that loves snowmobiling more than I do. I mean, I want to meet that fellow and let's go riding. But I want that ice field reserved -- preserved and reserved just like it is today, just like when I left it. Now, you go up there today, I guarantee it, you won't see one track up there, because it snows. I mean, every time we go back there we can't believe it because we were just here and we thought we had it tracked up. And it doesn't. And I -- you know, I mean, if we have a belt problem, we don't leave any spare belts. Yeah, because if you blow a belt, you know, it kind of turns into a pile of nothing. Well, like in my sled, I have two garbage bags, so -- and I haven't blown a belt up there yet, but when I do -- and it will happen -- we'll -- we take out our product. Now, I know this hasn't happened on the ice field, but we was up Snow River here, you know, last year, year before, and I was with a friend, and it's the first time I've actually seen this on the snow, where he had one of his radiator hoses -- because we have antifreeze -- actually had a hole in it, and when we stopped, he leaks out a bunch of antifreeze. Well, we was able to repair the hose. And when he pulls ahead, I break out my shovel and my garbage bag, and I -- and, hey, you know, alls you had to do was just kick some frigging snow over it and who's going to know. But the thing is, I know. You know. So I take my antifreeze. And I think -- I wished everybody had the same attitude as I do about snowmobiling. Let's take care of our environment so, you know, they -- you know, because, I mean, alls you have to do is take the Park Service up there or something, have them fly over there, and there's a great big green blotch
-0.480326
-0.17398
-0.383866
-1.073655
[ -0.31459484720922926, -0.6460563010269292 ]
[ 0.5780842179141524, -0.9260437903860113 ]
[ 0.5215724643225169, -1.2893036278018513 ]
[ -0.6688171968228681, -1.4784936928165784 ]
1,024
[ 512, 512 ]
[ 25954, 19798, 13241, 29892, 10015, 1794, 383, 29926, 4339, 3086, 4815, 13, 29954, 653, 796, 6727, 3504, 29892, 3455, 29871, 29906, 13, 4013, 338, 263, 3133, 362, 310, 385, 15593, 411, 23529, 796, 6727, 3504, 491, 3872, 3037, 433, 1582, 29892, 23647, 295, 28095, 29892, 3467, 264, 350, 3973, 2475, 29892, 322, 1383, 23453, 476, 586, 562, 373, 3786, 29871, 29896, 29900, 29892, 29871, 29906, 29900, 29896, 29900, 472, 278, 6556, 402, 2700, 16923, 297, 317, 809, 538, 29892, 838, 16191, 29889, 512, 445, 760, 310, 278, 15593, 29892, 23529, 5969, 2039, 1048, 364, 4821, 15007, 29885, 496, 1475, 373, 278, 10999, 292, 26998, 2671, 322, 2978, 25954, 19798, 13241, 29892, 322, 5662, 3864, 393, 15007, 29885, 496, 2827, 18172, 304, 367, 385, 6068, 671, 297, 10015, 1794, 383, 29926, 4339, 3086, 4815, 29889, 13, 7653, 29901, 25954, 19798, 13241, 29892, 10015, 1794, 383, 29926, 4339, 3086, 4815, 13, 2539, 310, 4124, 1493, 29901, 319, 558, 29871, 29896, 29900, 29892, 29871, 29906, 29900, 29896, 29900, 13, 29940, 2749, 1061, 29898, 29879, 1125, 23529, 796, 6727, 3504, 13, 4074, 29894, 15580, 29898, 29879, 1125, 3872, 3037, 433, 1582, 29892, 23647, 295, 28095, 29892, 3467, 264, 350, 3973, 2475, 13, 4300, 699, 495, 29901, 8562, 15612, 434, 13, 15666, 1991, 4360, 296, 29901, 1383, 23453, 476, 586, 562, 13, 29903, 809, 538, 29892, 838, 16191, 13, 29954, 653, 796, 6727, 3504, 29915, 29879, 14866, 2247, 3525, 13, 21459, 297, 25954, 19798, 13241, 29892, 678, 6916, 297, 11821, 19264, 6977, 8250, 29892, 2661, 370, 1674, 358, 310, 10015, 1794, 383, 29926, 4339, 3086, 4815, 29892, 16899, 1259, 29892, 4815, 15057, 16982, 1041, 29892, 24392, 29885, 496, 1475, 13, 24365, 19798, 13241, 29892, 317, 809, 538, 838, 16191, 13, 13504, 29530, 278, 14890, 1746, 13, 27034, 1975, 540, 364, 2247, 15007, 29885, 496, 1475, 411, 13, 6730, 15007, 29885, 496, 1475, 297, 317, 809, 538, 13, 29903, 3707, 29885, 496, 2827, 373, 25954, 19798, 13241, 9321, 13, 29903, 3707, 23523, 634, 8105, 2353, 13, 13971, 29879, 373, 29826, 515, 278, 25012, 310, 10015, 1794, 383, 29926, 4339, 3086, 4815, 13, 29950, 275, 4783, 29915, 29879, 1410, 4821, 5381, 322, 6410, 310, 29826, 28830, 13, 3434, 4056, 310, 263, 7825, 936, 472, 319, 616, 638, 6211, 13, 29903, 3707, 29885, 9733, 297, 278, 25954, 19798, 13241, 4038, 1434, 727, 471, 263, 6520, 13, 29923, 700, 29883, 1288, 322, 664, 4955, 13, 29943, 14424, 13006, 11423, 13, 29963, 2459, 14238, 670, 2834, 746, 270, 798, 1076, 13, 16107, 3942, 5144, 297, 278, 317, 809, 538, 4038, 13, 5531, 292, 408, 17182, 4192, 5495, 322, 664, 6689, 11423, 13, 29903, 3707, 23523, 4259, 13, 23773, 373, 278, 12049, 13, 21459, 297, 25954, 19798, 13241, 13, 29903, 3707, 29885, 496, 2827, 373, 25954, 19798, 13241, 13, 29956, 424, 292, 304, 3013, 278, 4815, 4038, 1722, 304, 14332, 322, 17193, 297, 671, 322, 14257, 1238, 267, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 306, 864, 304, 1074, 372, 1192, 306, 864, 304, 1074, 393, 14890, 1746, 29892, 322, 306, 29915, 29885, 1192, 306, 29915, 29885, 263, 1407, 9406, 15007, 29885, 711, 3955, 29889, 306, 2099, 29892, 306, 1192, 727, 29915, 29879, 23196, 1192, 366, 2113, 29915, 29873, 1284, 16357, 297, 278, 2106, 310, 838, 16191, 393, 12355, 267, 15007, 29885, 711, 6504, 901, 1135, 306, 437, 29889, 13, 29902, 2099, 29892, 306, 864, 304, 5870, 393, 10404, 322, 1235, 29915, 29879, 748, 364, 4821, 29889, 1205, 306, 864, 393, 14890, 1746, 21676, 1192, 21634, 322, 21676, 925, 763, 372, 338, 9826, 29892, 925, 763, 746, 306, 2175, 372, 29889, 13, 10454, 29892, 366, 748, 701, 727, 9826, 29892, 306, 18818, 372, 29892, 366, 2113, 29915, 29873, 1074, 697, 5702, 701, 727, 29892, 1363, 372, 5807, 1242, 29889, 306, 2099, 29892, 1432, 931, 591, 748, 1250, 727, 591, 508, 29915, 29873, 4658, 372, 1363, 591, 892, 925, 1244, 322, 591, 2714, 591, 750, 372, 5702, 287, 701, 29889, 13, 2855, 372, 1838, 29915, 29873, 29889, 1126, 306, 1192, 366, 1073, 29892, 306, 2099, 29892, 565, 591, 505, 263, 1339, 29873, 1108, 29892, 591, 1016, 29915, 29873, 5967, 738, 29337, 1339, 1372, 29889, 15011, 29892, 1363, 565, 366, 13031, 263, 1339, 29873, 29892, 366, 1073, 29892, 372, 2924, 310, 12169, 964, 263, 282, 488, 310, 3078, 29889, 13, 11284, 29892, 763, 297, 590, 269, 839, 29892, 306, 505, 1023, 25861, 289, 810, 29892, 577, 1192, 322, 306, 7359, 29915, 29873, 13031, 29876, 263, 1339, 29873, 701, 727, 3447, 29892, 541, 746, 306, 437, 1192, 322, 372, 674, 3799, 1192, 591, 29915, 645, 1192, 591, 2125, 714, 1749, 3234, 29889, 13, 10454, 29892, 306, 1073, 445, 22602, 29915, 29873, 9559, 373, 278, 14890, 1746, 29892, 541, 591, 471, 701, 24392, 6163, 1244, 29892, 366, 1073, 29892, 1833, 1629, 29892, 1629, 1434, 29892, 322, 306, 471, 411, 263, 5121, 29892, 322, 372, 29915, 29879, 278, 937, 931, 306, 29915, 345, 2869, 3595, 445, 373, 278, 15007, 29892, 988, 540, 750, 697, 310, 670, 17937, 1061, 298, 15806, 1192, 1363, 591, 505, 3677, 361, 929, 911, 1192, 2869, 750, 263, 16188, 297, 372, 29892, 322, 746, 591, 11084, 29892, 540, 454, 10327, 714, 263, 14928, 310, 3677, 361, 929, 911, 29889, 13, 11284, 29892, 591, 471, 2221, 304, 26032, 278, 298, 852, 29889, 1126, 746, 540, 8206, 29879, 14432, 29892, 306, 2867, 714, 590, 528, 586, 295, 322, 590, 25861, 19548, 29892, 322, 306, 1192, 322, 29892, 540, 29891, 29892, 366, 1073, 29892, 599, 29879, 366, 750, 304, 437, 471, 925, 24817, 777, 1424, 335, 3460, 15007, 975, 372, 322, 1058, 29915, 29879, 2675, 304, 1073, 29889, 13, 6246, 278, 2655, 338, 29892, 306, 1073, 29889, 887, 1073, 29889, 1105, 306, 2125, 590, 3677, 361, 929, 911, 29889, 13, 2855, 306, 1348, 1192, 306, 20024, 26077, 750, 278, 1021, 26309, 408, 306, 437, 1048, 15007, 29885, 711, 6504, 29889, 13, 12024, 29915, 29879, 2125, 2562, 310, 1749, 5177, 577, 29892, 366, 1073, 29892, 896, 1192, 366, 1073, 29892, 1363, 29892, 306, 2099, 29892, 599, 29879, 366, 505, 304, 437, 338, 2125, 278, 4815, 6692, 701, 727, 470, 1554, 29892, 505, 963, 11340, 975, 727, 29892, 322, 727, 29915, 29879, 263, 2107, 4802, 7933, 1999, 327, 305 ]
1,333,675
0
CommonCrawl
4
1
on the ice field, well, there's your first legit excuse, we need to cut them boys off. Well, if them boys are taking care of the area, then there's no reason to cut them off. And I know the whole group I ride with has the same mentality. As a matter of fact, that's probably the same with the Kenai bunch because there's a dozen guys in Kenai that come over here once in awhile. As a matter of fact, they were up at Nellie Juan yesterday riding with us, and they had the same mentality. We take out everything. You know. DON CALLAWAY: Could you itemize your group here within Seward, the guys you ride with. GARY ZIMMERMAN: You mean how many there is? DON CALLAWAY: Yeah, or just their names. GARY ZIMMERMAN: Well, the main -- the main guys I ride with is my cousin Phil Zimmerman; Jimmer Dick. When I was an Arctic Cat dealer, he was -- he raced for me for years, or with me and for me. And you got Warren Albertson, he rides with me all the time. He's a real nice fellow. And then you've got my other cousin, Perry Zimmerman, he moved to Anchorage, and his boy Jake. And Jake's friend Brad comes with us quite a bit. Then you've got Dave, Dave's a UPS guy. He's a steady goer. He's -- he's got quite a few snowmobiles, got quite a few kids. He's got about a dozen snowmachines out there. DON CALLAWAY: Really, wow. GARY ZIMMERMAN: And then we've got Mark Clemons at the Fish House. He doesn't get to go very much anymore because he's the coach of one of the basketball teams in town so he's always busy. And then you've got Ed Merritt. Ed's a commercial fisherman. He -- I've been riding with him and Jimmer probably the most this year. RACHEL MASON: Is Jimmer related to Packy Dick? GARY ZIMMERMAN: Yeah. Yeah. That's Jimmer Dick. That Louis' son. RACHEL MASON: Oh. GARY ZIMMERMAN: And then you've got all the guys at No Sweat Auto. You've got Jessie Sweat, Tom Shay. Oh, jeez. There's Jason. I can't remember what Jason's last name is, and I should, his uncle worked for me for years. Then you've got all the guys at Terry's Tire & Lube. And then there's a bunch of -- and I only know one of them, but his group went with us a couple times. Travis. I don't know what his last name is but I've known him for years, and he's working on the AVTEC building over here. And as a matter of fact, I just seen him before I come up there, he said he's heading for Lost Lake this afternoon. And you've got Jason Lang, Benton Groom, they're State of Alaska boys at -- at the Highway Department, they're -- most of them are riders. Couple of them have backed off. Gary Ackerson, I think he's 70, close to 70. He still rides. We've got a guy out of Girdwood, and I'll have to think of his name. But he's 75, and he rides an old Polaris and he drags a scoop shovel, like you know you shovel -- you're shoveling corn, one of those big ones they've got for snow. Yeah, you see him going across, he's always a couple miles behind. But he's 75, you know, we give him all the grace he needs. But you can always spot him because from dragging that shovel, it looks like there's a -- you know, the snow's always flying about 10, 15 feet in the air. So, I mean, there he goes. Oh, God, I can see his name, but I'm -- I'm missing it. RACHEL MASON: That's a long way to drive from Girdwood.
-1.415814
-0.850837
-1.613942
-1.710016
[ -1.1637936131884608, -1.6678341710600046 ]
[ -0.7398184179298005, -0.9618563620122056 ]
[ -1.3095935560049254, -1.91829140209715 ]
[ -1.5825485035466937, -1.8374827898354764 ]
1,024
[ 512, 512 ]
[ 373, 278, 14890, 1746, 29892, 1532, 29892, 727, 29915, 29879, 596, 937, 25204, 5566, 1509, 29892, 591, 817, 304, 5700, 963, 12544, 1283, 29889, 13, 11284, 29892, 565, 963, 12544, 526, 5622, 2562, 310, 278, 4038, 29892, 769, 727, 29915, 29879, 694, 2769, 304, 5700, 963, 1283, 29889, 13, 2855, 306, 1073, 278, 3353, 2318, 306, 22203, 411, 756, 278, 1021, 6042, 2877, 29889, 1094, 263, 4383, 310, 2114, 29892, 393, 29915, 29879, 3117, 278, 1021, 411, 278, 10015, 1794, 14928, 1363, 727, 29915, 29879, 263, 24231, 18239, 297, 10015, 1794, 393, 2041, 975, 1244, 2748, 297, 263, 8000, 29889, 13, 2887, 263, 4383, 310, 2114, 29892, 896, 892, 701, 472, 26450, 347, 8699, 22600, 364, 4821, 411, 502, 29892, 322, 896, 750, 278, 1021, 6042, 2877, 29889, 1334, 2125, 714, 4129, 29889, 887, 1073, 29889, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 6527, 366, 2944, 675, 596, 2318, 1244, 2629, 317, 809, 538, 29892, 278, 18239, 366, 22203, 411, 29889, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 887, 2099, 920, 1784, 727, 338, 29973, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 15011, 29892, 470, 925, 1009, 2983, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 5674, 29892, 278, 1667, 1192, 278, 1667, 18239, 306, 22203, 411, 338, 590, 22618, 5241, 796, 6727, 3504, 29936, 8507, 1050, 12488, 29889, 1932, 306, 471, 385, 826, 20009, 10459, 5376, 261, 29892, 540, 471, 1192, 540, 11021, 287, 363, 592, 363, 2440, 29892, 470, 411, 592, 322, 363, 592, 29889, 13, 2855, 366, 2355, 24511, 10537, 1100, 29892, 540, 364, 2247, 411, 592, 599, 278, 931, 29889, 940, 29915, 29879, 263, 1855, 7575, 10404, 29889, 13, 2855, 769, 366, 29915, 345, 2355, 590, 916, 22618, 29892, 28376, 796, 6727, 3504, 29892, 540, 6153, 304, 530, 305, 6022, 29892, 322, 670, 8023, 435, 1296, 29889, 1126, 435, 1296, 29915, 29879, 5121, 15862, 5304, 411, 502, 3755, 263, 2586, 29889, 13, 11760, 366, 29915, 345, 2355, 17841, 29892, 17841, 29915, 29879, 263, 501, 7024, 1410, 29891, 29889, 940, 29915, 29879, 263, 27357, 748, 261, 29889, 13, 3868, 29915, 29879, 1192, 540, 29915, 29879, 2355, 3755, 263, 2846, 15007, 29885, 711, 5475, 29892, 2355, 3755, 263, 2846, 413, 4841, 29889, 940, 29915, 29879, 2355, 1048, 263, 24231, 15007, 29885, 496, 1475, 714, 727, 29889, 360, 1164, 315, 1964, 4375, 12982, 29979, 29901, 830, 635, 29892, 281, 340, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 1126, 769, 591, 29915, 345, 2355, 4485, 315, 2409, 787, 472, 278, 12030, 5619, 29889, 940, 1838, 29915, 29873, 679, 304, 748, 1407, 1568, 15128, 1363, 540, 29915, 29879, 278, 11182, 310, 697, 310, 278, 20305, 10907, 297, 4726, 577, 540, 29915, 29879, 2337, 19587, 29889, 13, 2855, 769, 366, 29915, 345, 2355, 2155, 4702, 12123, 29889, 2155, 29915, 29879, 263, 12128, 9427, 3504, 29889, 940, 1192, 306, 29915, 345, 1063, 364, 4821, 411, 1075, 322, 8507, 1050, 3117, 278, 1556, 445, 1629, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 1317, 8507, 1050, 4475, 304, 18744, 29891, 12488, 29973, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 15011, 29889, 2193, 29915, 29879, 8507, 1050, 12488, 29889, 2193, 5899, 29915, 1487, 29889, 390, 2477, 29950, 6670, 14861, 3094, 29901, 6439, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 1126, 769, 366, 29915, 345, 2355, 599, 278, 18239, 472, 1939, 317, 705, 271, 11133, 29889, 887, 29915, 345, 2355, 23010, 347, 317, 705, 271, 29892, 4335, 1383, 388, 29889, 6439, 29892, 1444, 6096, 29889, 1670, 29915, 29879, 21776, 29889, 306, 508, 29915, 29873, 6456, 825, 21776, 29915, 29879, 1833, 1024, 338, 29892, 322, 306, 881, 29892, 670, 22169, 3796, 363, 592, 363, 2440, 29889, 13, 11760, 366, 29915, 345, 2355, 599, 278, 18239, 472, 27571, 29915, 29879, 323, 533, 669, 365, 4003, 29889, 1126, 769, 727, 29915, 29879, 263, 14928, 310, 1192, 322, 306, 871, 1073, 697, 310, 963, 29892, 541, 670, 2318, 3512, 411, 502, 263, 7303, 3064, 29889, 13, 5323, 1730, 29889, 306, 1016, 29915, 29873, 1073, 825, 670, 1833, 1024, 338, 541, 306, 29915, 345, 2998, 1075, 363, 2440, 29892, 322, 540, 29915, 29879, 1985, 373, 278, 16884, 4330, 29907, 5214, 975, 1244, 29889, 13, 2855, 408, 263, 4383, 310, 2114, 29892, 306, 925, 3595, 1075, 1434, 306, 2041, 701, 727, 29892, 540, 1497, 540, 29915, 29879, 28435, 363, 25133, 9459, 445, 17724, 29889, 13, 2855, 366, 29915, 345, 2355, 21776, 10476, 29892, 27079, 265, 6070, 290, 29892, 896, 29915, 276, 4306, 310, 838, 16191, 12544, 472, 1192, 472, 278, 22080, 10317, 29892, 896, 29915, 276, 1192, 1556, 310, 963, 526, 8177, 414, 29889, 19565, 552, 310, 963, 505, 1250, 287, 1283, 29889, 13, 29954, 653, 319, 384, 1330, 29892, 306, 1348, 540, 29915, 29879, 29871, 29955, 29900, 29892, 3802, 304, 29871, 29955, 29900, 29889, 940, 1603, 364, 2247, 29889, 13, 4806, 29915, 345, 2355, 263, 1410, 29891, 714, 310, 402, 1823, 6115, 29892, 322, 306, 29915, 645, 505, 304, 1348, 310, 670, 1024, 29889, 1205, 540, 29915, 29879, 29871, 29955, 29945, 29892, 322, 540, 364, 2247, 385, 2030, 2043, 12260, 322, 540, 8338, 29879, 263, 885, 26793, 528, 586, 295, 29892, 763, 366, 1073, 366, 528, 586, 295, 1192, 366, 29915, 276, 528, 586, 14067, 26343, 29892, 697, 310, 1906, 4802, 6743, 896, 29915, 345, 2355, 363, 15007, 29889, 13, 29979, 29872, 801, 29892, 366, 1074, 1075, 2675, 4822, 29892, 540, 29915, 29879, 2337, 263, 7303, 7800, 5742, 29889, 1205, 540, 29915, 29879, 29871, 29955, 29945, 29892, 366, 1073, 29892, 591, 2367, 1075, 599, 278, 17659, 540, 4225, 29889, 13, 6246, 366, 508, 2337, 9758, 1075, 1363, 515, 8338, 3460, 393, 528, 586, 295, 29892, 372, 3430, 763, 727, 29915, 29879, 263, 1192, 366, 1073, 29892, 278, 15007, 29915, 29879, 2337, 22764, 1048, 29871, 29896, 29900, 29892, 29871, 29896, 29945, 6900, 297, 278, 4799, 29889, 13, 6295, 29892, 306, 2099, 29892, 727, 540, 5771, 29889, 6439, 29892, 4177, 29892, 306, 508, 1074, 670, 1024, 29892, 541, 306, 29915, 29885, 1192, 306, 29915, 29885, 4567, 372, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 2193, 29915, 29879, 263, 1472, 982, 304, 7899, 515, 402, 1823, 6115, 29889, 13 ]
1,333,675
1,024
CommonCrawl
4
1
GARY ZIMMERMAN: Yeah. He comes down here quite a bit. And, of course, then you've got Jim Cooper and you've got the Coast Guard fellows off the Mustang, there's a bunch of them. I think there's -- I seen as many as, I think, four -- 14 of them. As a matter of fact, I just came off Exit Glacier one day from up there, and I had my niece with me. Both my nieces ride and their boyfriends. But there's these Coast Guard guys come pulling in there, and so I'm shooting the breeze with them, you know, I've seen them. So anyway, they were -- they were heading up there. So yeah, there -- there's quite a few snowmobilers in town. I mean that's probably the main circle that I run with, but just my exact main circle is probably my cousin Phil and Jimmer and Warren. You know. Like yesterday, we had all five, six of us up there. Well, Dave's actually the new guy now, but the five of the six of us, well, we've been riding together since 1969. That's how long I've been riding with those guys. KAREN BREWSTER: So that operation your dad and Joe Stanton were doing in '69, was that kind of the first use of snow machines around Seward? GARY ZIMMERMAN: They'd been around -- yeah. That was pretty close. But they'd been around. You know, snow machines have been around since probably the '60s, but then I think they probably started getting popular here, I'd say about '65, '66. Yeah. Yeah. We had a guy named Mark Moore was the Scorpion dealer, and this guy named -- oh, man, Bill Richart (phonetic) out at Mile 5 was a Ski Doo dealer. And then my dad was actually a Yamaha dealer in about '72 or '3 for a little bit. And we were working -- actually, I think he was working with that Jim Arness. Yeah. KAREN BREWSTER: Now, do people snow machine up the Exit Glacier Road, you know, past where it's closed? Do people just go out on the road? GARY ZIMMERMAN: Yeah. That's a real good place to take your new drivers. And that's a -- that's such a great family area. It's just amazing. You go up there on probably any weekend, and you'll see men, women, and children, you know, with their snowmobiles towing an inner tube or a car hood. And you know, that's a lot of fun riding a car hood. I don't think you'd be brave enough to get behind my rig, but... RACHEL MASON: I don't think so. GARY ZIMMERMAN: I really wouldn't recommend it either, but you know, you see them up there. And that's -- that's some of the little positive things. You know, if -- if it was up to me, which it ain't, I would close the -- I would shut down the park thing, just because -- and the reason that is, is because I'm a little bit scared that one of these days they are going to tell us we can't go. And that ain't right. So as long as they keep it like it is, we'll get along. But I remember when I was a kid, you know, and I got pictures of that, too, of me and Rosco Livingston, I was in the sixth grade and we are up there playing and, well, we couldn't get on the glacier. Tried to get on the glacier with this little 10 horse Ski Doo. So for the kids and families, Exit Glacier and going up to the bottom of Exit Glacier, playing around in that little valley and the next valley over and on the riverbed is a -- is -- is one of the greatest spots around. That and Summit Lake Lodge out at Mile 40 is another great spot. Carter Lake is a great spot to take your families because it's a real short trail, and the ice fishing is fabulous. And the hills, there's a lot of beginners hills, the kids just play and go nuts. But Exit Glacier is --
-1.133661
-0.656107
-1.253796
-1.81407
[ -1.4760796110001781, -0.791241896500798 ]
[ -0.4577944163735198, -0.8544186471336225 ]
[ -1.5835075867464263, -0.9240849201465164 ]
[ -1.644981389984763, -1.983159524857638 ]
1,024
[ 512, 512 ]
[ 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 940, 5304, 1623, 1244, 3755, 263, 2586, 29889, 1126, 29892, 310, 3236, 29892, 769, 366, 29915, 345, 2355, 8507, 21851, 322, 366, 29915, 345, 2355, 278, 17700, 13211, 8379, 1242, 1283, 278, 19928, 574, 29892, 727, 29915, 29879, 263, 14928, 310, 963, 29889, 13, 29902, 1348, 727, 29915, 29879, 1192, 306, 3595, 408, 1784, 408, 29892, 306, 1348, 29892, 3023, 1192, 29871, 29896, 29946, 310, 963, 29889, 1094, 263, 4383, 310, 2114, 29892, 306, 925, 2996, 1283, 25954, 19798, 13241, 697, 2462, 515, 701, 727, 29892, 322, 306, 750, 590, 4930, 346, 411, 592, 29889, 13, 29933, 720, 590, 4930, 778, 22203, 322, 1009, 8023, 7932, 1975, 29889, 13, 6246, 727, 29915, 29879, 1438, 17700, 13211, 18239, 2041, 28420, 297, 727, 29892, 322, 577, 306, 29915, 29885, 27904, 278, 289, 929, 911, 411, 963, 29892, 366, 1073, 29892, 306, 29915, 345, 3595, 963, 29889, 13, 6295, 8763, 29892, 896, 892, 1192, 896, 892, 28435, 701, 727, 29889, 1105, 21915, 29892, 727, 1192, 727, 29915, 29879, 3755, 263, 2846, 15007, 29885, 12213, 414, 297, 4726, 29889, 306, 2099, 393, 29915, 29879, 3117, 278, 1667, 8607, 393, 306, 1065, 411, 29892, 541, 925, 590, 2684, 1667, 8607, 338, 3117, 590, 22618, 5241, 322, 8507, 1050, 322, 24511, 29889, 887, 1073, 29889, 13, 27552, 22600, 29892, 591, 750, 599, 5320, 29892, 4832, 310, 502, 701, 727, 29889, 5674, 29892, 17841, 29915, 29879, 2869, 278, 716, 1410, 29891, 1286, 29892, 541, 278, 5320, 310, 278, 4832, 310, 502, 29892, 1532, 29892, 591, 29915, 345, 1063, 364, 4821, 4208, 1951, 29871, 29896, 29929, 29953, 29929, 29889, 2193, 29915, 29879, 920, 1472, 306, 29915, 345, 1063, 364, 4821, 411, 1906, 18239, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1105, 393, 5858, 596, 270, 328, 322, 11131, 624, 11960, 892, 2599, 297, 525, 29953, 29929, 29892, 471, 393, 2924, 310, 278, 937, 671, 310, 15007, 14884, 2820, 317, 809, 538, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 2688, 29915, 29881, 1063, 2820, 1192, 21915, 29889, 2193, 471, 5051, 3802, 29889, 1205, 896, 29915, 29881, 1063, 2820, 29889, 887, 1073, 29892, 15007, 14884, 505, 1063, 2820, 1951, 3117, 278, 525, 29953, 29900, 29879, 29892, 541, 769, 306, 1348, 896, 3117, 4687, 2805, 5972, 1244, 29892, 306, 29915, 29881, 1827, 1048, 525, 29953, 29945, 29892, 525, 29953, 29953, 29889, 15011, 29889, 15011, 29889, 13, 4806, 750, 263, 1410, 29891, 4257, 4485, 18588, 471, 278, 2522, 26423, 291, 5376, 261, 29892, 322, 445, 1410, 29891, 4257, 1192, 9360, 29892, 767, 29892, 6682, 4385, 442, 313, 17607, 7492, 29897, 714, 472, 341, 488, 29871, 29945, 471, 263, 28551, 1938, 29877, 5376, 261, 29889, 13, 2855, 769, 590, 270, 328, 471, 2869, 263, 22740, 25613, 5376, 261, 297, 1048, 525, 29955, 29906, 470, 525, 29941, 363, 263, 2217, 2586, 29889, 13, 2855, 591, 892, 1985, 1192, 2869, 29892, 306, 1348, 540, 471, 1985, 411, 393, 8507, 826, 2264, 29889, 15011, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 2567, 29892, 437, 2305, 15007, 4933, 701, 278, 25954, 19798, 13241, 9321, 29892, 366, 1073, 29892, 4940, 988, 372, 29915, 29879, 5764, 29973, 1938, 2305, 925, 748, 714, 373, 278, 6520, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 2193, 29915, 29879, 263, 1855, 1781, 2058, 304, 2125, 596, 716, 18563, 29889, 1126, 393, 29915, 29879, 263, 1192, 393, 29915, 29879, 1316, 263, 2107, 3942, 4038, 29889, 13, 3112, 29915, 29879, 925, 21863, 292, 29889, 887, 748, 701, 727, 373, 3117, 738, 4723, 355, 29892, 322, 366, 29915, 645, 1074, 1757, 29892, 5866, 29892, 322, 4344, 29892, 366, 1073, 29892, 411, 1009, 15007, 29885, 711, 5475, 304, 16958, 385, 6426, 260, 4003, 470, 263, 1559, 298, 2092, 29889, 13, 2855, 366, 1073, 29892, 393, 29915, 29879, 263, 3287, 310, 2090, 364, 4821, 263, 1559, 298, 2092, 29889, 306, 1016, 29915, 29873, 1348, 366, 29915, 29881, 367, 26565, 3307, 304, 679, 5742, 590, 12912, 29892, 541, 856, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 306, 1016, 29915, 29873, 1348, 577, 29889, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 306, 2289, 7656, 29915, 29873, 6907, 372, 2845, 29892, 541, 366, 1073, 29892, 366, 1074, 963, 701, 727, 29889, 1126, 393, 29915, 29879, 1192, 393, 29915, 29879, 777, 310, 278, 2217, 6374, 2712, 29889, 13, 3492, 1073, 29892, 565, 1192, 565, 372, 471, 701, 304, 592, 29892, 607, 372, 7216, 29915, 29873, 29892, 306, 723, 3802, 278, 1192, 306, 723, 12522, 1623, 278, 14089, 2655, 29892, 925, 1363, 1192, 322, 278, 2769, 393, 338, 29892, 338, 1363, 306, 29915, 29885, 263, 2217, 2586, 885, 1965, 393, 697, 310, 1438, 3841, 896, 526, 2675, 304, 2649, 502, 591, 508, 29915, 29873, 748, 29889, 13, 2855, 393, 7216, 29915, 29873, 1492, 29889, 1105, 408, 1472, 408, 896, 3013, 372, 763, 372, 338, 29892, 591, 29915, 645, 679, 3412, 29889, 1205, 306, 6456, 746, 306, 471, 263, 26397, 29892, 366, 1073, 29892, 322, 306, 2355, 14956, 310, 393, 29892, 2086, 29892, 310, 592, 322, 5678, 1111, 26176, 7352, 29892, 306, 471, 297, 278, 25963, 19468, 322, 591, 526, 701, 727, 8743, 322, 29892, 1532, 29892, 591, 8496, 29915, 29873, 679, 373, 278, 14751, 13241, 29889, 13, 29911, 1255, 304, 679, 373, 278, 14751, 13241, 411, 445, 2217, 29871, 29896, 29900, 10435, 28551, 1938, 29877, 29889, 1105, 363, 278, 413, 4841, 322, 13175, 29892, 25954, 19798, 13241, 322, 2675, 701, 304, 278, 5970, 310, 25954, 19798, 13241, 29892, 8743, 2820, 297, 393, 2217, 19599, 322, 278, 2446, 19599, 975, 322, 373, 278, 8580, 2580, 338, 263, 1192, 338, 1192, 338, 697, 310, 278, 14176, 805, 1862, 2820, 29889, 13, 7058, 322, 6991, 2415, 9459, 365, 17979, 714, 472, 341, 488, 29871, 29946, 29900, 338, 1790, 2107, 9758, 29889, 22264, 9459, 338, 263, 2107, 9758, 304, 2125, 596, 13175, 1363, 372, 29915, 29879, 263, 1855, 3273, 26203, 29892, 322, 278, 14890, 9427, 292, 338, 10135, 352, 681, 29889, 13, 2855, 278, 22696, 29892, 727, 29915, 29879, 263, 3287, 310, 1812, 16697, 22696, 29892, 278, 413, 4841, 925, 1708, 322, 748, 302, 8842, 29889, 13, 6246, 25954, 19798, 13241, 338, 1192 ]
1,333,675
2,048
CommonCrawl
4
1
it's used by everybody. Like the other day, this is probably a week ago, I come down that road, there was people snowshoeing, cross country skiing, hiking, and a dog team, and us, all using the same place. And if you have good etiquette with your snowmobile, when you come across -- when you -- let's say you're going down the road doing 50 or whatever, and when you see somebody, you slow down, you know, to 5, 10 miles an hour, ease around them, 20 miles an hour, give them their space, wave at them. If you don't know them, you know, if they look happy, you stop, you take your helmet off. Because, see, it's like if a SWAT team comes at you, all these people, I mean, you're scared to death. Well, it's just like a snowmobiler. If you're not used to being around the snowmobile, and the guy is coming down the road 50 miles an hour and blows by you, well, that's not a good deal and that's a bad experience. But even when I was a dealer, and what -- what we've tried teaching even our young people that ride here, you know, the 20 ish group, that when you come across these people that are hiking and -- and driving, you know, stop. And even if you don't like them, it doesn't matter if you like them or not. Stop, and take your helmet off so that they can see that you're a human being, and ask them, how are you doing? Hey, do you need a hand? Are you in a bind? I mean, you know, do you have a broken arm? Like I went up to Lost Lake here six weeks ago. It snowed a bunch, and I went up the night before the trail opened. The closed sign was -- wasn't on the board, or I didn't see it. So I go -- well, it snowed a bunch, there was a foot of fresh snow there, I know there's 3, 4 feet, it's a moonlit night, so I go fireballing up through there by myself just to go to the cabin. That's usually as far as I go. Well, I got halfway up the trail, there was this lady, a skinny little thing just sitting there by the trail. Oh man. And when I seen her, I go, man, she looks like she's in a bind. So I pull up there, stop, take my helmet off. How ya doin', ma'am? Well, she wasn't very happy. Do you know this trail's closed? Well, I guess it ain't for me tonight, but yeah, I'm just checking on you to see if you're all right. And I didn't see that, when I went back down, there was not a sign on there; and, of course, the Forest Service, we talked to them the next day and they informed us that we need to use a phone-in method. But still, the point was that she looked like she was in a bind. And -- and so when I came back down the hill, she was still walking out, and so I stopped and she seemed a lot happier the second time I seen her. You know. But, you know, some -- some groups start thinking that they own the trail versus it's a multiuse trail. And it's just like that Lost Lake Trail. That was mainly put in, in about -- from '67 to '70. And Joe Stanton flew that -- that trail with his airplane, and let toilet paper out, you know, where they thought they should cut the trail, and Warren Albertson and Jimmer's dad, Packy Louis, was the first two guys to start building that trail to Lost Lake the way it goes now. KAREN BREWSTER: The winter -- the Winter Trail? GARY ZIMMERMAN: The Winter Trail. Yeah. RACHEL MASON: Going back to what you said about the -- the moose line, can you tell us a little bit more about what the effects of -- you mentioned when Jimmy Carter came in -- GARY ZIMMERMAN: Well, you know, I'm not a Jimmy Carter fan. So I don't know how deep you want to go there. RACHEL MASON: Yeah. That's okay. But just
-0.876162
-0.889336
-0.84673
-1.514913
[ -0.8789011239567186, -0.8734224222407236 ]
[ -1.1194316771674608, -0.6592401317708632 ]
[ -0.8429252073342198, -0.8505339304103726 ]
[ -1.5669402819371763, -1.462885471207061 ]
1,024
[ 512, 512 ]
[ 372, 29915, 29879, 1304, 491, 26077, 29889, 8502, 278, 916, 2462, 29892, 445, 338, 3117, 263, 4723, 8020, 29892, 306, 2041, 1623, 393, 6520, 29892, 727, 471, 2305, 15007, 845, 7297, 292, 29892, 4891, 4234, 14993, 292, 29892, 298, 638, 292, 29892, 322, 263, 11203, 3815, 29892, 322, 502, 29892, 599, 773, 278, 1021, 2058, 29889, 13, 2855, 565, 366, 505, 1781, 634, 8105, 2353, 411, 596, 15007, 16769, 29892, 746, 366, 2041, 4822, 1192, 746, 366, 1192, 1235, 29915, 29879, 1827, 366, 29915, 276, 2675, 1623, 278, 6520, 2599, 29871, 29945, 29900, 470, 6514, 29892, 322, 746, 366, 1074, 18462, 29892, 366, 5232, 1623, 29892, 366, 1073, 29892, 304, 29871, 29945, 29892, 29871, 29896, 29900, 7800, 385, 7234, 29892, 16326, 2820, 963, 29892, 29871, 29906, 29900, 7800, 385, 7234, 29892, 2367, 963, 1009, 2913, 29892, 10742, 472, 963, 29889, 13, 3644, 366, 1016, 29915, 29873, 1073, 963, 29892, 366, 1073, 29892, 565, 896, 1106, 9796, 29892, 366, 5040, 29892, 366, 2125, 596, 1081, 2527, 1283, 29889, 13, 29933, 5658, 29892, 1074, 29892, 372, 29915, 29879, 763, 565, 263, 25289, 1299, 3815, 5304, 472, 366, 29892, 599, 1438, 2305, 29892, 306, 2099, 29892, 366, 29915, 276, 885, 1965, 304, 4892, 29889, 13, 11284, 29892, 372, 29915, 29879, 925, 763, 263, 15007, 29885, 711, 3955, 29889, 960, 366, 29915, 276, 451, 1304, 304, 1641, 2820, 278, 15007, 16769, 29892, 322, 278, 1410, 29891, 338, 6421, 1623, 278, 6520, 29871, 29945, 29900, 7800, 385, 7234, 322, 13031, 29879, 491, 366, 29892, 1532, 29892, 393, 29915, 29879, 451, 263, 1781, 5376, 322, 393, 29915, 29879, 263, 4319, 7271, 29889, 13, 6246, 1584, 746, 306, 471, 263, 5376, 261, 29892, 322, 825, 1192, 825, 591, 29915, 345, 1898, 18819, 1584, 1749, 4123, 2305, 393, 22203, 1244, 29892, 366, 1073, 29892, 278, 29871, 29906, 29900, 338, 29882, 2318, 29892, 393, 746, 366, 2041, 4822, 1438, 2305, 393, 526, 298, 638, 292, 322, 1192, 322, 19500, 29892, 366, 1073, 29892, 5040, 29889, 13, 2855, 1584, 565, 366, 1016, 29915, 29873, 763, 963, 29892, 372, 1838, 29915, 29873, 4383, 565, 366, 763, 963, 470, 451, 29889, 22303, 29892, 322, 2125, 596, 1081, 2527, 1283, 577, 393, 896, 508, 1074, 393, 366, 29915, 276, 263, 5199, 1641, 29892, 322, 2244, 963, 29892, 920, 526, 366, 2599, 29973, 13, 29950, 1032, 29892, 437, 366, 817, 263, 1361, 29973, 4683, 366, 297, 263, 7868, 29973, 306, 2099, 29892, 366, 1073, 29892, 437, 366, 505, 263, 9391, 5075, 29973, 13, 27552, 306, 3512, 701, 304, 25133, 9459, 1244, 4832, 11405, 8020, 29889, 739, 15007, 287, 263, 14928, 29892, 322, 306, 3512, 701, 278, 4646, 1434, 278, 26203, 6496, 29889, 13, 1576, 5764, 1804, 471, 1192, 9007, 29915, 29873, 373, 278, 7613, 29892, 470, 306, 3282, 29915, 29873, 1074, 372, 29889, 1105, 306, 748, 1192, 1532, 29892, 372, 15007, 287, 263, 14928, 29892, 727, 471, 263, 3661, 310, 10849, 15007, 727, 29892, 306, 1073, 727, 29915, 29879, 29871, 29941, 29892, 29871, 29946, 6900, 29892, 372, 29915, 29879, 263, 18786, 19411, 4646, 29892, 577, 306, 748, 3974, 2135, 292, 701, 1549, 727, 491, 6142, 925, 304, 748, 304, 278, 28830, 29889, 13, 7058, 29915, 29879, 5491, 408, 2215, 408, 306, 748, 29889, 5674, 29892, 306, 2355, 4203, 1582, 701, 278, 26203, 29892, 727, 471, 445, 11379, 29892, 263, 19309, 1460, 2217, 2655, 925, 16246, 727, 491, 278, 26203, 29889, 13, 9048, 767, 29889, 1126, 746, 306, 3595, 902, 29892, 306, 748, 29892, 767, 29892, 1183, 3430, 763, 1183, 29915, 29879, 297, 263, 7868, 29889, 1105, 306, 8206, 701, 727, 29892, 5040, 29892, 2125, 590, 1081, 2527, 1283, 29889, 13, 5328, 9343, 437, 262, 742, 611, 29915, 314, 29973, 5674, 29892, 1183, 9007, 29915, 29873, 1407, 9796, 29889, 1938, 366, 1073, 445, 26203, 29915, 29879, 5764, 29973, 13, 11284, 29892, 306, 4140, 372, 7216, 29915, 29873, 363, 592, 15243, 523, 29892, 541, 21915, 29892, 306, 29915, 29885, 925, 8454, 373, 366, 304, 1074, 565, 366, 29915, 276, 599, 1492, 29889, 1126, 306, 3282, 29915, 29873, 1074, 393, 29892, 746, 306, 3512, 1250, 1623, 29892, 727, 471, 451, 263, 1804, 373, 727, 29936, 322, 29892, 310, 3236, 29892, 278, 17300, 6692, 29892, 591, 24867, 304, 963, 278, 2446, 2462, 322, 896, 23388, 502, 393, 591, 817, 304, 671, 263, 9008, 29899, 262, 1158, 29889, 13, 6246, 1603, 29892, 278, 1298, 471, 393, 1183, 5148, 763, 1183, 471, 297, 263, 7868, 29889, 1126, 1192, 322, 577, 746, 306, 2996, 1250, 1623, 278, 17306, 29892, 1183, 471, 1603, 22049, 714, 29892, 322, 577, 306, 11084, 322, 1183, 6140, 263, 3287, 2250, 631, 278, 1473, 931, 306, 3595, 902, 29889, 13, 3492, 1073, 29889, 1205, 29892, 366, 1073, 29892, 777, 1192, 777, 6471, 1369, 7291, 393, 896, 1914, 278, 26203, 23797, 372, 29915, 29879, 263, 2473, 1509, 26203, 29889, 13, 2855, 372, 29915, 29879, 925, 763, 393, 25133, 9459, 3201, 309, 29889, 2193, 471, 14364, 1925, 297, 29892, 297, 1048, 1192, 515, 525, 29953, 29955, 304, 525, 29955, 29900, 29889, 13, 2855, 11131, 624, 11960, 9115, 29893, 393, 1192, 393, 26203, 411, 670, 4799, 22116, 29892, 322, 1235, 304, 488, 29873, 5650, 714, 29892, 366, 1073, 29892, 988, 896, 2714, 896, 881, 5700, 278, 26203, 29892, 322, 24511, 10537, 1100, 322, 8507, 1050, 29915, 29879, 270, 328, 29892, 18744, 29891, 5899, 29892, 471, 278, 937, 1023, 18239, 304, 1369, 5214, 393, 26203, 304, 25133, 9459, 278, 982, 372, 5771, 1286, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 450, 13851, 1192, 278, 12267, 3201, 309, 29973, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 450, 12267, 3201, 309, 29889, 15011, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 2921, 292, 1250, 304, 825, 366, 1497, 1048, 278, 1192, 278, 2730, 852, 1196, 29892, 508, 366, 2649, 502, 263, 2217, 2586, 901, 1048, 825, 278, 9545, 310, 1192, 366, 5276, 746, 20636, 22264, 2996, 297, 1192, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 5674, 29892, 366, 1073, 29892, 306, 29915, 29885, 451, 263, 20636, 22264, 13524, 29889, 1105, 306, 1016, 29915, 29873, 1073, 920, 6483, 366, 864, 304, 748, 727, 29889, 390, 2477, 29950, 6670, 14861, 3094, 29901, 15011, 29889, 2193, 29915, 29879, 20759, 29889, 1205, 925 ]
1,333,675
3,072
CommonCrawl
4
1
-- GARY ZIMMERMAN: Well, you know. RACHEL MASON: -- just what the impact was. GARY ZIMMERMAN: Well, you know, it made our job a lot more difficult. And we actually -- that was probably one of the reasons why we quit hunting up in there. Because every time we went sheep hunting up there up on the Harding Icefield, we listened -- we had -- we sold a 10 day hunt, which was two weeks. And we always told the client you have to plan to be weathered in for two weeks, so this is going to be a four week deal. So if you only got two weeks off and that's all you can spend here, this is not the place to come. But if you want a nice ram, a fairly easy hunt compared to what sheep hunting goes, this is the place you want to be. And so with that moose range line cutting across the front of that glacier, it's either 2 or 3 miles, well, you had to use sleds to get across the glacier, well, see -- RACHEL MASON: You can mark on there where it is. GARY ZIMMERMAN: Well, it's way down here. RACHEL MASON: Oh -- oh, it's off. GARY ZIMMERMAN: It's way down in this area. RACHEL MASON: Oh, okay. GARY ZIMMERMAN: But if you -- if you -- when you get that window of opportunity, you cannot break camp fast enough, pack up your gear, everything, and get back because when you go out -- going in is a lot easier. When you come out, you have to come out of this big wind blown snow cave type thing and then go up the glacier, and this was difficult. I mean, it was -- it was -- it was not -- getting out of there was -- it was very extreme. KAREN BREWSTER: Especially if you had sled loads full of meat. GARY ZIMMERMAN: Right. Yeah, we had sheep, we had carcasses, you know, yeah. But then when you're up there for six weeks, six guys can devour a whole sheep pretty quickly. And as a matter of fact, the last time that we were weathered in, the first thing we did when that plane land was drain 5 gallons of gas out of his wing for -- for cooking. Because we were down to our last quart of av gas -- I mean, of Blazo fuel on the -- on the day we got picked up. But before we even started loading stuff up, man, we just had these 5 gallon Blazo cans, first thing we did is we filled up because there's no trees. There's no way to make a fire. You know, if you ain't got heat inside that tent to cook, you know, now we start talking about walking out or at least walking down to the tree line and, you know, now we're getting into some kind of a Daniel Boone type expedition, you know. And I think because the severity of it, you know. I mean, it was my recommendation -- people can go where they want. I -- I personally, myself, feel that I could go up there and do a sheep hunt just because the experience I had with my father and I know what to expect and -- and I know being weathered in for a month doesn't -- doesn't freak me out, doesn't bother me. I mean, it bothers you, but it's -- it's not that big of a deal. As long as you're prepared for it. RACHEL MASON: But just so I understand, is it because the area of hunting was restricted? GARY ZIMMERMAN: No. They just drew the line. I don't think anybody even to this day knows there's sheep in there except for me and a few others. When they built -- when they put that moose range line in, they just went down there and drew a line, you know. And they didn't -- KAREN BREWSTER: And now there's no hunting on that line? GARY ZIMMERMAN: Well, you can hunt, but not with motorized vehicles. DON CALLAWAY: But motorized vehicles are not permitted. GARY ZIMMERMAN: Yeah. And see, when we were hunting from the cabin, when the weather -- when the weather was -- you know, we
-1.103528
-0.822187
-1.173905
-1.230063
[ -1.1364001046084855, -1.070655684016545 ]
[ -0.9797626478253028, -0.6646120175147923 ]
[ -1.099085550898031, -1.248723771395703 ]
[ -1.0908895228468987, -1.3692361415499572 ]
1,024
[ 512, 512 ]
[ 1192, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 5674, 29892, 366, 1073, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 1192, 925, 825, 278, 10879, 471, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 5674, 29892, 366, 1073, 29892, 372, 1754, 1749, 4982, 263, 3287, 901, 5189, 29889, 1126, 591, 2869, 1192, 393, 471, 3117, 697, 310, 278, 9590, 2020, 591, 23283, 29826, 701, 297, 727, 29889, 13, 29933, 5658, 1432, 931, 591, 3512, 29735, 29826, 701, 727, 701, 373, 278, 10999, 292, 26998, 2671, 29892, 591, 29616, 1192, 591, 750, 1192, 591, 5239, 263, 29871, 29896, 29900, 2462, 298, 1657, 29892, 607, 471, 1023, 11405, 29889, 13, 2855, 591, 2337, 5429, 278, 3132, 366, 505, 304, 3814, 304, 367, 14826, 287, 297, 363, 1023, 11405, 29892, 577, 445, 338, 2675, 304, 367, 263, 3023, 4723, 5376, 29889, 13, 6295, 565, 366, 871, 2355, 1023, 11405, 1283, 322, 393, 29915, 29879, 599, 366, 508, 18864, 1244, 29892, 445, 338, 451, 278, 2058, 304, 2041, 29889, 1205, 565, 366, 864, 263, 7575, 13472, 29892, 263, 12558, 4780, 298, 1657, 9401, 304, 825, 29735, 29826, 5771, 29892, 445, 338, 278, 2058, 366, 864, 304, 367, 29889, 13, 2855, 577, 411, 393, 2730, 852, 3464, 1196, 28967, 4822, 278, 4565, 310, 393, 14751, 13241, 29892, 372, 29915, 29879, 2845, 29871, 29906, 470, 29871, 29941, 7800, 29892, 1532, 29892, 366, 750, 304, 671, 269, 839, 29879, 304, 679, 4822, 278, 14751, 13241, 29892, 1532, 29892, 1074, 1192, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 887, 508, 2791, 373, 727, 988, 372, 338, 29889, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 5674, 29892, 372, 29915, 29879, 982, 1623, 1244, 29889, 390, 2477, 29950, 6670, 14861, 3094, 29901, 6439, 1192, 9360, 29892, 372, 29915, 29879, 1283, 29889, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 739, 29915, 29879, 982, 1623, 297, 445, 4038, 29889, 390, 2477, 29950, 6670, 14861, 3094, 29901, 6439, 29892, 20759, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 1205, 565, 366, 1192, 565, 366, 1192, 746, 366, 679, 393, 3474, 310, 15130, 29892, 366, 2609, 2867, 4242, 5172, 3307, 29892, 4870, 701, 596, 330, 799, 29892, 4129, 29892, 322, 679, 1250, 1363, 746, 366, 748, 714, 1192, 2675, 297, 338, 263, 3287, 6775, 29889, 13, 10401, 366, 2041, 714, 29892, 366, 505, 304, 2041, 714, 310, 445, 4802, 8805, 13031, 29876, 15007, 24230, 1134, 2655, 322, 769, 748, 701, 278, 14751, 13241, 29892, 322, 445, 471, 5189, 29889, 306, 2099, 29892, 372, 471, 1192, 372, 471, 1192, 372, 471, 451, 1192, 2805, 714, 310, 727, 471, 1192, 372, 471, 1407, 18677, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 3423, 25009, 565, 366, 750, 269, 839, 15376, 2989, 310, 27654, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 10428, 29889, 15011, 29892, 591, 750, 29735, 29892, 591, 750, 1559, 29883, 465, 267, 29892, 366, 1073, 29892, 21915, 29889, 1205, 769, 746, 366, 29915, 276, 701, 727, 363, 4832, 11405, 29892, 4832, 18239, 508, 2906, 473, 263, 3353, 29735, 5051, 9098, 29889, 13, 2855, 408, 263, 4383, 310, 2114, 29892, 278, 1833, 931, 393, 591, 892, 14826, 287, 297, 29892, 278, 937, 2655, 591, 1258, 746, 393, 10694, 2982, 471, 270, 6038, 29871, 29945, 11798, 787, 310, 10489, 714, 310, 670, 21612, 363, 1192, 363, 7984, 292, 29889, 13, 29933, 5658, 591, 892, 1623, 304, 1749, 1833, 10256, 310, 1029, 10489, 1192, 306, 2099, 29892, 310, 10465, 2502, 26413, 373, 278, 1192, 373, 278, 2462, 591, 2355, 18691, 701, 29889, 13, 6246, 1434, 591, 1584, 4687, 8363, 6433, 701, 29892, 767, 29892, 591, 925, 750, 1438, 29871, 29945, 11798, 265, 10465, 2502, 508, 29879, 29892, 937, 2655, 591, 1258, 338, 591, 10423, 701, 1363, 727, 29915, 29879, 694, 10697, 29889, 13, 8439, 29915, 29879, 694, 982, 304, 1207, 263, 3974, 29889, 887, 1073, 29892, 565, 366, 7216, 29915, 29873, 2355, 12871, 2768, 393, 12033, 304, 7984, 29892, 366, 1073, 29892, 1286, 591, 1369, 9963, 1048, 22049, 714, 470, 472, 3203, 22049, 1623, 304, 278, 5447, 1196, 322, 29892, 366, 1073, 29892, 1286, 591, 29915, 276, 2805, 964, 777, 2924, 310, 263, 8432, 1952, 650, 1134, 24431, 29892, 366, 1073, 29889, 13, 2855, 306, 1348, 1363, 278, 2775, 537, 310, 372, 29892, 366, 1073, 29889, 306, 2099, 29892, 372, 471, 590, 29303, 1192, 2305, 508, 748, 988, 896, 864, 29889, 13, 29902, 1192, 306, 22345, 29892, 6142, 29892, 4459, 393, 306, 1033, 748, 701, 727, 322, 437, 263, 29735, 298, 1657, 925, 1363, 278, 7271, 306, 750, 411, 590, 4783, 322, 306, 1073, 825, 304, 2149, 322, 1192, 322, 306, 1073, 1641, 14826, 287, 297, 363, 263, 4098, 1838, 29915, 29873, 1192, 1838, 29915, 29873, 3005, 557, 592, 714, 29892, 1838, 29915, 29873, 24738, 592, 29889, 13, 29902, 2099, 29892, 372, 1716, 414, 366, 29892, 541, 372, 29915, 29879, 1192, 372, 29915, 29879, 451, 393, 4802, 310, 263, 5376, 29889, 1094, 1472, 408, 366, 29915, 276, 13240, 363, 372, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 1205, 925, 577, 306, 2274, 29892, 338, 372, 1363, 278, 4038, 310, 29826, 471, 22078, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 1939, 29889, 2688, 925, 15010, 278, 1196, 29889, 306, 1016, 29915, 29873, 1348, 16357, 1584, 304, 445, 2462, 9906, 727, 29915, 29879, 29735, 297, 727, 5174, 363, 592, 322, 263, 2846, 4045, 29889, 1932, 896, 4240, 1192, 746, 896, 1925, 393, 2730, 852, 3464, 1196, 297, 29892, 896, 925, 3512, 1623, 727, 322, 15010, 263, 1196, 29892, 366, 1073, 29889, 1126, 896, 3282, 29915, 29873, 1192, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1126, 1286, 727, 29915, 29879, 694, 29826, 373, 393, 1196, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 5674, 29892, 366, 508, 298, 1657, 29892, 541, 451, 411, 10992, 1891, 24413, 29889, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 1205, 10992, 1891, 24413, 526, 451, 21905, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 1126, 1074, 29892, 746, 591, 892, 29826, 515, 278, 28830, 29892, 746, 278, 14826, 1192, 746, 278, 14826, 471, 1192, 366, 1073, 29892, 591 ]
1,333,675
4,096
CommonCrawl
4
1
'd go back and forth to the cabin. So you had a good shelter, you had a good means of transportation, you could drive your snowmobile in there, it was only a little 12 horse Ski Doo. And so if you see the weather start to blow in, you cranked it up, you went back to the cabin. Well, once they -- once they put the moose range line in, okay, now you don't have the advantage of having -- to be able to drive in there. So by, you know -- RACHEL MASON: You'd have to haul it out. GARY ZIMMERMAN: You'd haul it all in and you haul it all out. And then the weather. I mean, when it blows up there, you know, I mean, it's -- it's really -- it's whipping. They've got that weather station in up there, we go up -- as a matter of fact, that weather station is right here -- let's see, where am I? At Bear Glacier. Yeah, there's a weather station about right -- might be right here. DON CALLAWAY: Let's put a mark right there -- GARY ZIMMERMAN: Yeah, right -- well, make sure I'm not -- oh, no, it's right here. DON CALLAWAY: I thought this was Bear Glacier. GARY ZIMMERMAN: This is Bear Glacier. And there's a weather station down low, maybe it might be right here. Yeah, I bet it is right here. This would be a weather station. We go there all the time, too, because they built it on -- it must always blow because there's always rocks there. So we go there and have a sandwich there all the time, too. But -- DON CALLAWAY: So this is, what, early '80s when you stopped guiding out there? GARY ZIMMERMAN: Yeah, I would say probably '78 or '80 was the last time we went in there. Yeah, we -- we switched to more of a -- well, caribou hunting and grizzly hunting, brown bear hunting. We didn't ever -- that's our -- and then we did a lot of -- a lot of goat hunting, too, especially -- well, we used to do a lot of goat hunting out at Aialik Bay. As a matter of fact, down on Aialik Bay, we had a -- where that -- well, I don't know if it's Park Service or Forest Service. What is it, Park's have a cabin out there? RACHEL MASON: I think it is Park Service. GARY ZIMMERMAN: Yeah. Well, before that Park Service cabin was there, in that same spot, that's where my dad's hunting cabin was. And the Park Service comes in there when they thought they owned everything, which is sore feelings on the Zimmerman family, burns our cabin down to the ground, didn't pay us for it, and built that cabin in the same exact spot. Now, I don't know what -- what -- I mean, why don't you just, like -- why don't you just take it and use that cabin? I mean, what was the point of actually burning it down? And that always was a pretty sore spot with my dad because we did a lot of -- that's a real good area for hunting. Well, back then it was a real good area for goats and black bear. You know, we did a lot of hunting in Aialik Bay. And it's a beautiful place, too. That was a great place to take clients because you had Aialik Glacier, you had Holgate Glacier, and then from that cabin, if you've ever spent the night out there, you could hear that -- those glaciers rumble all night long. It's pretty fantastic. A matter of fact, they made a -- I was in on this, too, about -- might have been '72, they made a Contact commercial out there. It was 1972. Yeah. The cold Contact pills. RACHEL MASON: Yeah. GARY ZIMMERMAN: Well, anyway, they are -- these guys are filming and Kimo (phonetic) Knighten, which was Keith Knighten's kid, that was one of the pilots that always flew up here. They are making
-1.035044
-0.625666
-1.301985
-1.334118
[ -1.1583149114724658, -0.9117733342526889 ]
[ -0.7863747610438532, -0.4649569306987587 ]
[ -1.248723771395703, -1.3552458944618422 ]
[ -1.2729854416246005, -1.395249844232486 ]
1,024
[ 512, 512 ]
[ 29915, 29881, 748, 1250, 322, 11483, 304, 278, 28830, 29889, 13, 6295, 366, 750, 263, 1781, 27709, 29892, 366, 750, 263, 1781, 2794, 310, 8608, 362, 29892, 366, 1033, 7899, 596, 15007, 16769, 297, 727, 29892, 372, 471, 871, 263, 2217, 29871, 29896, 29906, 10435, 28551, 1938, 29877, 29889, 13, 2855, 577, 565, 366, 1074, 278, 14826, 1369, 304, 13031, 297, 29892, 366, 274, 10003, 287, 372, 701, 29892, 366, 3512, 1250, 304, 278, 28830, 29889, 13, 11284, 29892, 2748, 896, 1192, 2748, 896, 1925, 278, 2730, 852, 3464, 1196, 297, 29892, 20759, 29892, 1286, 366, 1016, 29915, 29873, 505, 278, 10631, 310, 2534, 1192, 304, 367, 2221, 304, 7899, 297, 727, 29889, 1105, 491, 29892, 366, 1073, 1192, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 887, 29915, 29881, 505, 304, 447, 352, 372, 714, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 887, 29915, 29881, 447, 352, 372, 599, 297, 322, 366, 447, 352, 372, 599, 714, 29889, 1126, 769, 278, 14826, 29889, 306, 2099, 29892, 746, 372, 13031, 29879, 701, 727, 29892, 366, 1073, 29892, 306, 2099, 29892, 372, 29915, 29879, 1192, 372, 29915, 29879, 2289, 1192, 372, 29915, 29879, 377, 17347, 29889, 13, 15597, 29915, 345, 2355, 393, 14826, 5073, 297, 701, 727, 29892, 591, 748, 701, 1192, 408, 263, 4383, 310, 2114, 29892, 393, 14826, 5073, 338, 1492, 1244, 1192, 1235, 29915, 29879, 1074, 29892, 988, 626, 306, 29973, 2180, 23606, 19798, 13241, 29889, 15011, 29892, 727, 29915, 29879, 263, 14826, 5073, 1048, 1492, 1192, 1795, 367, 1492, 1244, 29889, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 2803, 29915, 29879, 1925, 263, 2791, 1492, 727, 1192, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29892, 1492, 1192, 1532, 29892, 1207, 1854, 306, 29915, 29885, 451, 1192, 9360, 29892, 694, 29892, 372, 29915, 29879, 1492, 1244, 29889, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 306, 2714, 445, 471, 23606, 19798, 13241, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 910, 338, 23606, 19798, 13241, 29889, 1126, 727, 29915, 29879, 263, 14826, 5073, 1623, 4482, 29892, 5505, 372, 1795, 367, 1492, 1244, 29889, 13, 29979, 29872, 801, 29892, 306, 1010, 372, 338, 1492, 1244, 29889, 910, 723, 367, 263, 14826, 5073, 29889, 1334, 748, 727, 599, 278, 931, 29892, 2086, 29892, 1363, 896, 4240, 372, 373, 1192, 372, 1818, 2337, 13031, 1363, 727, 29915, 29879, 2337, 23150, 727, 29889, 1105, 591, 748, 727, 322, 505, 263, 11982, 16416, 727, 599, 278, 931, 29892, 2086, 29889, 1205, 1192, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 1105, 445, 338, 29892, 825, 29892, 4688, 525, 29947, 29900, 29879, 746, 366, 11084, 1410, 4821, 714, 727, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29892, 306, 723, 1827, 3117, 525, 29955, 29947, 470, 525, 29947, 29900, 471, 278, 1833, 931, 591, 3512, 297, 727, 29889, 13, 29979, 29872, 801, 29892, 591, 1192, 591, 26263, 304, 901, 310, 263, 1192, 1532, 29892, 1559, 747, 283, 29826, 322, 330, 374, 5617, 368, 29826, 29892, 17354, 11460, 29826, 29889, 13, 4806, 3282, 29915, 29873, 3926, 1192, 393, 29915, 29879, 1749, 1192, 322, 769, 591, 1258, 263, 3287, 310, 1192, 263, 3287, 310, 748, 271, 29826, 29892, 2086, 29892, 7148, 1192, 1532, 29892, 591, 1304, 304, 437, 263, 3287, 310, 748, 271, 29826, 714, 472, 319, 616, 638, 6211, 29889, 13, 2887, 263, 4383, 310, 2114, 29892, 1623, 373, 319, 616, 638, 6211, 29892, 591, 750, 263, 1192, 988, 393, 1192, 1532, 29892, 306, 1016, 29915, 29873, 1073, 565, 372, 29915, 29879, 4815, 6692, 470, 17300, 6692, 29889, 1724, 338, 372, 29892, 4815, 29915, 29879, 505, 263, 28830, 714, 727, 29973, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 306, 1348, 372, 338, 4815, 6692, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 5674, 29892, 1434, 393, 4815, 6692, 28830, 471, 727, 29892, 297, 393, 1021, 9758, 29892, 393, 29915, 29879, 988, 590, 270, 328, 29915, 29879, 29826, 28830, 471, 29889, 13, 2855, 278, 4815, 6692, 5304, 297, 727, 746, 896, 2714, 896, 15205, 4129, 29892, 607, 338, 269, 487, 21737, 373, 278, 796, 6727, 3504, 3942, 29892, 12138, 29879, 1749, 28830, 1623, 304, 278, 5962, 29892, 3282, 29915, 29873, 5146, 502, 363, 372, 29892, 322, 4240, 393, 28830, 297, 278, 1021, 2684, 9758, 29889, 13, 10454, 29892, 306, 1016, 29915, 29873, 1073, 825, 1192, 825, 1192, 306, 2099, 29892, 2020, 1016, 29915, 29873, 366, 925, 29892, 763, 1192, 2020, 1016, 29915, 29873, 366, 925, 2125, 372, 322, 671, 393, 28830, 29973, 306, 2099, 29892, 825, 471, 278, 1298, 310, 2869, 25535, 372, 1623, 29973, 13, 2855, 393, 2337, 471, 263, 5051, 269, 487, 9758, 411, 590, 270, 328, 1363, 591, 1258, 263, 3287, 310, 1192, 393, 29915, 29879, 263, 1855, 1781, 4038, 363, 29826, 29889, 5674, 29892, 1250, 769, 372, 471, 263, 1855, 1781, 4038, 363, 748, 1446, 322, 4628, 11460, 29889, 13, 3492, 1073, 29892, 591, 1258, 263, 3287, 310, 29826, 297, 319, 616, 638, 6211, 29889, 1126, 372, 29915, 29879, 263, 9560, 2058, 29892, 2086, 29889, 2193, 471, 263, 2107, 2058, 304, 2125, 13154, 1363, 366, 750, 319, 616, 638, 19798, 13241, 29892, 366, 750, 4168, 17062, 19798, 13241, 29892, 322, 769, 515, 393, 28830, 29892, 565, 366, 29915, 345, 3926, 10398, 278, 4646, 714, 727, 29892, 366, 1033, 8293, 393, 1192, 1906, 14751, 455, 414, 364, 15563, 599, 4646, 1472, 29889, 739, 29915, 29879, 5051, 13568, 6288, 29889, 13, 29909, 4383, 310, 2114, 29892, 896, 1754, 263, 1192, 306, 471, 297, 373, 445, 29892, 2086, 29892, 1048, 1192, 1795, 505, 1063, 525, 29955, 29906, 29892, 896, 1754, 263, 22387, 12128, 714, 727, 29889, 739, 471, 29871, 29896, 29929, 29955, 29906, 29889, 15011, 29889, 450, 11220, 22387, 282, 6090, 29889, 390, 2477, 29950, 6670, 14861, 3094, 29901, 15011, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 5674, 29892, 8763, 29892, 896, 526, 1192, 1438, 18239, 526, 2706, 292, 322, 476, 4200, 313, 17607, 7492, 29897, 22980, 264, 29892, 607, 471, 27179, 22980, 264, 29915, 29879, 26397, 29892, 393, 471, 697, 310, 278, 8230, 1862, 393, 2337, 9115, 29893, 701, 1244, 29889, 13, 15597, 526, 3907 ]
1,333,675
5,120
CommonCrawl
4
1
this commercial, and a great, big iceberg comes and falls off the glacier, makes this mini -- mini tidal wave, washes a bunch of people into the ocean. I'm talking like they are going to die. And Kimo Knighten dives in. Kimo Knighten was the center of our basketball team, he was like 6 foot 7, and he hardly ever wore shoes and he was tough as nails, he was like a Grizzly Adams. I mean, he was a bad ass. And he just dives in the water and saves these people. Yeah. And it's a pretty fantastic story. RACHEL MASON: These are the ones in the commercial? GARY ZIMMERMAN: No. Kimo, I don't even know what Kimo was doing out there. He was like a guy who packed these bags or something, you know. He was like a laborer, I guess. And anyway, they had these people out there and they are making this Contact commercial. The ice falls off, like I told you, makes this tidal wave, and they are standing on this rock and the water comes over, drives them off into the bay, and Kimo Knighten, I don't know, well, we'll just say comes out of nowhere, dives in there and saves these people. RACHEL MASON: Good thing he was there. GARY ZIMMERMAN: Yeah. That's a -- that's an Aialik Bay thing. Yeah, he was pretty popular around town for a while. KAREN BREWSTER: So on the people who -- I'm wondering about snow machining up the valley before Exit Glacier Road was there. Did people snow machine up the valley? GARY ZIMMERMAN: Oh, yeah, you went right up the river. KAREN BREWSTER: And the river's safe enough to travel? GARY ZIMMERMAN: Oh, yeah, you'd cross the river because it's way low. It's water skipping. See, you can cross a lot of water with a snowmobile. You can take -- if your snowmobile is sealed up, you can take your snowmobile and run across this bay and back. Of course, you can't stop and you don't want to hit a wake because you -- but once you get moving. But yeah, like I say, I've got lots of pictures of Rosco Livingston and myself, we was up there a long time. He's in Fairbanks, he's a retired teacher. And anyway, I got lots of pictures of us being up there as kids. KAREN BREWSTER: So you would just go up the valley before the road was there, you would just snow machine up there? GARY ZIMMERMAN: Just go right up the riverbed. You know, right -- well, I mean, it's just like right now, if you go out and throw your snow machine out at Medco, let's say. I don't know how much snow is out there, but, well, you can go up to where they got the road closed. And if the road wasn't there, we'd drop there and just water skip across them rivers and just go right up there. KAREN BREWSTER: Were other people doing it or just -- GARY ZIMMERMAN: Oh, no, there were lots of people back then. Yeah. Every -- oh, everybody, well, we were a smaller town. I think, we had 12 , 1500 people here, but snowmobiling is -- has always been a real popular sport around here. Yeah. Yeah. DON CALLAWAY: Could you -- could we go back and talk a little bit about your life history. You moved here when you were in the fourth grade. What year, again? GARY ZIMMERMAN: That would be -- we showed up here early '69. DON CALLAWAY: '69? GARY ZIMMERMAN: Yeah. Then, well, I went to Seward -- I went to school in Seward. And I went to AVTEC. I was in the very first state of Alaska oil tech program. And that's -- they brought a -- they brought a rig up from Oklahoma, and a guy named Hal Corbin was a lead instructor, I would imagine you'd call him. And they put on a oil technology program. That was involved with
-1.172012
-0.595225
-1.199267
-1.652786
[ -1.0103899651405996, -1.3336333663843072 ]
[ -0.21785018647801752, -0.9726001335000639 ]
[ -1.1802452637103276, -1.2182888790910917 ]
[ -1.4576827306705553, -1.8478882709084878 ]
1,024
[ 512, 512 ]
[ 445, 12128, 29892, 322, 263, 2107, 29892, 4802, 14890, 2552, 5304, 322, 20074, 1283, 278, 14751, 13241, 29892, 3732, 445, 20629, 1192, 20629, 10668, 284, 10742, 29892, 471, 13244, 263, 14928, 310, 2305, 964, 278, 23474, 29889, 306, 29915, 29885, 9963, 763, 896, 526, 2675, 304, 762, 29889, 13, 2855, 476, 4200, 22980, 264, 1933, 267, 297, 29889, 476, 4200, 22980, 264, 471, 278, 4818, 310, 1749, 20305, 3815, 29892, 540, 471, 763, 29871, 29953, 3661, 29871, 29955, 29892, 322, 540, 15155, 3926, 26758, 17394, 267, 322, 540, 471, 260, 820, 408, 302, 2234, 29892, 540, 471, 763, 263, 402, 374, 5617, 368, 20359, 29889, 306, 2099, 29892, 540, 471, 263, 4319, 1223, 29889, 13, 2855, 540, 925, 1933, 267, 297, 278, 4094, 322, 27401, 1438, 2305, 29889, 15011, 29889, 1126, 372, 29915, 29879, 263, 5051, 13568, 6288, 5828, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 4525, 526, 278, 6743, 297, 278, 12128, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 1939, 29889, 476, 4200, 29892, 306, 1016, 29915, 29873, 1584, 1073, 825, 476, 4200, 471, 2599, 714, 727, 29889, 940, 471, 763, 263, 1410, 29891, 1058, 4870, 287, 1438, 289, 810, 470, 1554, 29892, 366, 1073, 29889, 940, 471, 763, 263, 10212, 261, 29892, 306, 4140, 29889, 13, 2855, 8763, 29892, 896, 750, 1438, 2305, 714, 727, 322, 896, 526, 3907, 445, 22387, 12128, 29889, 450, 14890, 20074, 1283, 29892, 763, 306, 5429, 366, 29892, 3732, 445, 10668, 284, 10742, 29892, 322, 896, 526, 13407, 373, 445, 7679, 322, 278, 4094, 5304, 975, 29892, 25100, 963, 1283, 964, 278, 23041, 29892, 322, 476, 4200, 22980, 264, 29892, 306, 1016, 29915, 29873, 1073, 29892, 1532, 29892, 591, 29915, 645, 925, 1827, 5304, 714, 310, 1286, 4150, 29892, 1933, 267, 297, 727, 322, 27401, 1438, 2305, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 7197, 2655, 540, 471, 727, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 2193, 29915, 29879, 263, 1192, 393, 29915, 29879, 385, 319, 616, 638, 6211, 2655, 29889, 15011, 29892, 540, 471, 5051, 5972, 2820, 4726, 363, 263, 1550, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1105, 373, 278, 2305, 1058, 1192, 306, 29915, 29885, 9873, 1048, 15007, 7672, 2827, 701, 278, 19599, 1434, 25954, 19798, 13241, 9321, 471, 727, 29889, 7440, 2305, 15007, 4933, 701, 278, 19599, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 6439, 29892, 21915, 29892, 366, 3512, 1492, 701, 278, 8580, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1126, 278, 8580, 29915, 29879, 9109, 3307, 304, 9850, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 6439, 29892, 21915, 29892, 366, 29915, 29881, 4891, 278, 8580, 1363, 372, 29915, 29879, 982, 4482, 29889, 739, 29915, 29879, 4094, 14993, 3262, 29889, 2823, 29892, 366, 508, 4891, 263, 3287, 310, 4094, 411, 263, 15007, 16769, 29889, 13, 3492, 508, 2125, 1192, 565, 596, 15007, 16769, 338, 409, 7943, 701, 29892, 366, 508, 2125, 596, 15007, 16769, 322, 1065, 4822, 445, 23041, 322, 1250, 29889, 13, 2776, 3236, 29892, 366, 508, 29915, 29873, 5040, 322, 366, 1016, 29915, 29873, 864, 304, 7124, 263, 281, 1296, 1363, 366, 1192, 541, 2748, 366, 679, 8401, 29889, 13, 6246, 21915, 29892, 763, 306, 1827, 29892, 306, 29915, 345, 2355, 14568, 310, 14956, 310, 5678, 1111, 26176, 7352, 322, 6142, 29892, 591, 471, 701, 727, 263, 1472, 931, 29889, 940, 29915, 29879, 297, 13822, 29890, 1331, 29892, 540, 29915, 29879, 263, 16528, 15703, 29889, 1126, 8763, 29892, 306, 2355, 14568, 310, 14956, 310, 502, 1641, 701, 727, 408, 413, 4841, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1105, 366, 723, 925, 748, 701, 278, 19599, 1434, 278, 6520, 471, 727, 29892, 366, 723, 925, 15007, 4933, 701, 727, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 3387, 748, 1492, 701, 278, 8580, 2580, 29889, 887, 1073, 29892, 1492, 1192, 1532, 29892, 306, 2099, 29892, 372, 29915, 29879, 925, 763, 1492, 1286, 29892, 565, 366, 748, 714, 322, 3183, 596, 15007, 4933, 714, 472, 3436, 1111, 29892, 1235, 29915, 29879, 1827, 29889, 306, 1016, 29915, 29873, 1073, 920, 1568, 15007, 338, 714, 727, 29892, 541, 29892, 1532, 29892, 366, 508, 748, 701, 304, 988, 896, 2355, 278, 6520, 5764, 29889, 13, 2855, 565, 278, 6520, 9007, 29915, 29873, 727, 29892, 591, 29915, 29881, 5768, 727, 322, 925, 4094, 14383, 4822, 963, 27515, 322, 925, 748, 1492, 701, 727, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 399, 406, 916, 2305, 2599, 372, 470, 925, 1192, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 6439, 29892, 694, 29892, 727, 892, 14568, 310, 2305, 1250, 769, 29889, 15011, 29889, 7569, 1192, 9360, 29892, 26077, 29892, 1532, 29892, 591, 892, 263, 7968, 4726, 29889, 306, 1348, 29892, 591, 750, 29871, 29896, 29906, 1919, 29871, 29896, 29945, 29900, 29900, 2305, 1244, 29892, 541, 15007, 29885, 711, 6504, 338, 1192, 756, 2337, 1063, 263, 1855, 5972, 7980, 2820, 1244, 29889, 15011, 29889, 15011, 29889, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 6527, 366, 1192, 1033, 591, 748, 1250, 322, 5193, 263, 2217, 2586, 1048, 596, 2834, 4955, 29889, 887, 6153, 1244, 746, 366, 892, 297, 278, 11582, 19468, 29889, 1724, 1629, 29892, 1449, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 2193, 723, 367, 1192, 591, 10018, 701, 1244, 4688, 525, 29953, 29929, 29889, 360, 1164, 315, 1964, 4375, 12982, 29979, 29901, 525, 29953, 29929, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 1987, 29892, 1532, 29892, 306, 3512, 304, 317, 809, 538, 1192, 306, 3512, 304, 3762, 297, 317, 809, 538, 29889, 1126, 306, 3512, 304, 16884, 4330, 29907, 29889, 13, 29902, 471, 297, 278, 1407, 937, 2106, 310, 838, 16191, 17182, 734, 305, 1824, 29889, 1126, 393, 29915, 29879, 1192, 896, 6296, 263, 1192, 896, 6296, 263, 12912, 701, 515, 27879, 29892, 322, 263, 1410, 29891, 4257, 8142, 2994, 2109, 471, 263, 3275, 18690, 272, 29892, 306, 723, 14034, 366, 29915, 29881, 1246, 1075, 29889, 13, 2855, 896, 1925, 373, 263, 17182, 15483, 1824, 29889, 2193, 471, 9701, 411 ]
1,333,675
6,144
CommonCrawl
4
1
all the components of a rig. They gave us an EMT course, we had welding courses. It was a great school. Before I went to -- did that, I was working for Ray Anderson down here by the waterfall. That used to be Anderson Seafood. And we were building that warehouse that's there now, that's been up and down a couple times since then. And so anyway, I -- I went into the unemployment office, and Shirley Reynolds -- Dave Reynolds was one of our basketball players -- she was the unemployment lady. And I say, yeah, I want to draw unemployment. And she goes, hey, do you want to go to an oil technology program? And I go, no, no, I don't want to. I was, like, 17 years old, and I was going, no, I don't think so, you know. Or 18, right in there. And I go -- she goes, yeah, but we'll pay you. Oh, yeah? Well, what do you mean you'll pay me? She goes, well, we'll give you, like, I think it was $350 bucks a week, and you can draw unemployment, too. I'm going, like, jeez, that's 5 , 600 bucks a week for, like, going to hang out in class. And I go, yeah, okay, I'll do it. So anyway, I go out to AVTEC and I showed up three days late, because that's how the process worked, and I walked in there and I seen this Hal Corbin. Well, I seen -- I knew Hal Corbin because on one of those explorations out of the ice field, my dad had a real serious heart attack. So I actually got out of school at the end of my sophomore year and went to work in the woods over in Anchor Point, logging. I was driving log truck at 15 years old in the woods, and run -- run skidder. And at 16, I was driving on -- I was actually running a three axle tractor trailer on the highway. And -- and I used to be the milkman at Matanuska Maid. I'd go out and get all the dairy products. And then when they were bringing in the pipeline equipment, I hauled a bunch of stuff for Lynden Transports through Harry McDonald. We were Whitewater Enterprises then, but now you guys will recognize the name, he's Carlile. So Harry McDonald is Carlile. I was actually his third driver he ever hired. He hired me at 15. And I see Harry every now and again and I ask him to this day, I says, hey, how many other 16 year olds have you put out on the highway? He goes, you're my first and you're my last. So he gave me some big breaks there. And my brother Ed was working for him. And I went -- like I say, I went to the oil tech program and got out of there, and then I was -- went to work for -- went up and did some interviews, and Hal Corbin gave me this card from Chad Chatterman (phonetic) of Rowan Drilling, he was the president of the Alaska division, and so I went up there and went into his office, and I was sitting there. And this little old man was sitting behind the desk, and he goes, well, can I help you out there, young fellow? And I go, yeah, I'm looking for Mr. Chad Chatterman (phonetic). And he goes, well, that's me. And I go, well, Hal Corbin said you'd hire me. I went to the oil tech school. And so anyway, they interviewed me, and they told me if my folks would sign a release, I could go to work on Thursday. So I didn't have a driver's license then. I mean, I had one but I didn't have one that moment. And so I took a cab out to Seward Highway and I hitchhiked down to Seward, and my folks signed the release, and got a bunch of gear together, and flew to Prudhoe in October of '77. DON CALLAWAY: You were 18 then? GARY ZIMMERMAN: 17. DON CALLAWAY: 17.
-1.103528
-0.484878
-1.092745
-1.288594
[ -1.196665823484431, -1.0103899651405996 ]
[ -0.6180556744007396, -0.35169967293091897 ]
[ -0.9266211611719007, -1.2588687354972399 ]
[ -1.3120059956483938, -1.2651813308198419 ]
1,024
[ 512, 512 ]
[ 599, 278, 7117, 310, 263, 12912, 29889, 2688, 4846, 502, 385, 382, 11490, 3236, 29892, 591, 750, 281, 2495, 292, 21888, 29889, 739, 471, 263, 2107, 3762, 29889, 13, 18743, 306, 3512, 304, 1192, 1258, 393, 29892, 306, 471, 1985, 363, 9596, 17483, 1623, 1244, 491, 278, 4094, 11950, 29889, 2193, 1304, 304, 367, 17483, 14070, 1181, 397, 29889, 1126, 591, 892, 5214, 393, 281, 598, 8697, 393, 29915, 29879, 727, 1286, 29892, 393, 29915, 29879, 1063, 701, 322, 1623, 263, 7303, 3064, 1951, 769, 29889, 13, 2855, 577, 8763, 29892, 306, 1192, 306, 3512, 964, 278, 443, 3451, 22812, 8034, 29892, 322, 1383, 381, 2330, 28555, 3361, 1192, 17841, 28555, 3361, 471, 697, 310, 1749, 20305, 10769, 1192, 1183, 471, 278, 443, 3451, 22812, 11379, 29889, 1126, 306, 1827, 29892, 21915, 29892, 306, 864, 304, 4216, 443, 3451, 22812, 29889, 13, 2855, 1183, 5771, 29892, 540, 29891, 29892, 437, 366, 864, 304, 748, 304, 385, 17182, 15483, 1824, 29973, 13, 2855, 306, 748, 29892, 694, 29892, 694, 29892, 306, 1016, 29915, 29873, 864, 304, 29889, 306, 471, 29892, 763, 29892, 29871, 29896, 29955, 2440, 2030, 29892, 322, 306, 471, 2675, 29892, 694, 29892, 306, 1016, 29915, 29873, 1348, 577, 29892, 366, 1073, 29889, 1394, 29871, 29896, 29947, 29892, 1492, 297, 727, 29889, 1126, 306, 748, 1192, 1183, 5771, 29892, 21915, 29892, 541, 591, 29915, 645, 5146, 366, 29889, 13, 9048, 29892, 21915, 29973, 5674, 29892, 825, 437, 366, 2099, 366, 29915, 645, 5146, 592, 29973, 2296, 5771, 29892, 1532, 29892, 591, 29915, 645, 2367, 366, 29892, 763, 29892, 306, 1348, 372, 471, 395, 29941, 29945, 29900, 1321, 4684, 263, 4723, 29892, 322, 366, 508, 4216, 443, 3451, 22812, 29892, 2086, 29889, 13, 29902, 29915, 29885, 2675, 29892, 763, 29892, 1444, 6096, 29892, 393, 29915, 29879, 29871, 29945, 1919, 29871, 29953, 29900, 29900, 1321, 4684, 263, 4723, 363, 29892, 763, 29892, 2675, 304, 13958, 714, 297, 770, 29889, 1126, 306, 748, 29892, 21915, 29892, 20759, 29892, 306, 29915, 645, 437, 372, 29889, 13, 6295, 8763, 29892, 306, 748, 714, 304, 16884, 4330, 29907, 322, 306, 10018, 701, 2211, 3841, 5683, 29892, 1363, 393, 29915, 29879, 920, 278, 1889, 3796, 29892, 322, 306, 17096, 297, 727, 322, 306, 3595, 445, 8142, 2994, 2109, 29889, 13, 11284, 29892, 306, 3595, 1192, 306, 6363, 8142, 2994, 2109, 1363, 373, 697, 310, 1906, 3902, 272, 800, 714, 310, 278, 14890, 1746, 29892, 590, 270, 328, 750, 263, 1855, 10676, 5192, 5337, 29889, 13, 6295, 306, 2869, 2355, 714, 310, 3762, 472, 278, 1095, 310, 590, 269, 3021, 290, 487, 1629, 322, 3512, 304, 664, 297, 278, 25013, 975, 297, 530, 8420, 8984, 29892, 12183, 29889, 306, 471, 19500, 1480, 534, 2707, 472, 29871, 29896, 29945, 2440, 2030, 297, 278, 25013, 29892, 322, 1065, 1192, 1065, 2071, 333, 672, 29889, 13, 2855, 472, 29871, 29896, 29953, 29892, 306, 471, 19500, 373, 1192, 306, 471, 2869, 2734, 263, 2211, 4853, 280, 1020, 2801, 1020, 3955, 373, 278, 29469, 29889, 1126, 1192, 322, 306, 1304, 304, 367, 278, 27274, 1171, 472, 5345, 24514, 1335, 3219, 333, 29889, 306, 29915, 29881, 748, 714, 322, 679, 599, 278, 1146, 16129, 9316, 29889, 13, 2855, 769, 746, 896, 892, 20794, 297, 278, 16439, 21083, 29892, 306, 447, 29884, 839, 263, 14928, 310, 6433, 363, 8626, 299, 264, 4103, 4011, 1549, 10686, 4052, 28080, 29889, 1334, 892, 8037, 13405, 9041, 558, 4637, 769, 29892, 541, 1286, 366, 18239, 674, 18720, 278, 1024, 29892, 540, 29915, 29879, 8965, 488, 29889, 13, 6295, 10686, 4052, 28080, 338, 8965, 488, 29889, 306, 471, 2869, 670, 4654, 7156, 540, 3926, 298, 2859, 29889, 940, 298, 2859, 592, 472, 29871, 29896, 29945, 29889, 13, 2855, 306, 1074, 10686, 1432, 1286, 322, 1449, 322, 306, 2244, 1075, 304, 445, 2462, 29892, 306, 4083, 29892, 540, 29891, 29892, 920, 1784, 916, 29871, 29896, 29953, 1629, 2030, 29879, 505, 366, 1925, 714, 373, 278, 29469, 29973, 13, 3868, 5771, 29892, 366, 29915, 276, 590, 937, 322, 366, 29915, 276, 590, 1833, 29889, 1105, 540, 4846, 592, 777, 4802, 16706, 727, 29889, 1126, 590, 8099, 2155, 471, 1985, 363, 1075, 29889, 13, 2855, 306, 3512, 1192, 763, 306, 1827, 29892, 306, 3512, 304, 278, 17182, 734, 305, 1824, 322, 2355, 714, 310, 727, 29892, 322, 769, 306, 471, 1192, 3512, 304, 664, 363, 1192, 3512, 701, 322, 1258, 777, 1006, 7406, 29892, 322, 8142, 2994, 2109, 4846, 592, 445, 5881, 515, 678, 328, 678, 2620, 1171, 313, 17607, 7492, 29897, 310, 11438, 273, 4942, 8873, 29892, 540, 471, 278, 6673, 310, 278, 838, 16191, 8542, 29892, 322, 577, 306, 3512, 701, 727, 322, 3512, 964, 670, 8034, 29892, 322, 306, 471, 16246, 727, 29889, 13, 2855, 445, 2217, 2030, 767, 471, 16246, 5742, 278, 553, 29895, 29892, 322, 540, 5771, 29892, 1532, 29892, 508, 306, 1371, 366, 714, 727, 29892, 4123, 10404, 29973, 1126, 306, 748, 29892, 21915, 29892, 306, 29915, 29885, 3063, 363, 3237, 29889, 678, 328, 678, 2620, 1171, 313, 17607, 7492, 467, 13, 2855, 540, 5771, 29892, 1532, 29892, 393, 29915, 29879, 592, 29889, 1126, 306, 748, 29892, 1532, 29892, 8142, 2994, 2109, 1497, 366, 29915, 29881, 298, 533, 592, 29889, 306, 3512, 304, 278, 17182, 734, 305, 3762, 29889, 13, 2855, 577, 8763, 29892, 896, 15593, 287, 592, 29892, 322, 896, 5429, 592, 565, 590, 900, 2039, 723, 1804, 263, 6507, 29892, 306, 1033, 748, 304, 664, 373, 498, 1295, 3250, 29889, 13, 6295, 306, 3282, 29915, 29873, 505, 263, 7156, 29915, 29879, 19405, 769, 29889, 306, 2099, 29892, 306, 750, 697, 541, 306, 3282, 29915, 29873, 505, 697, 393, 3256, 29889, 1126, 577, 306, 3614, 263, 7776, 714, 304, 317, 809, 538, 22080, 322, 306, 298, 2335, 29882, 638, 287, 1623, 304, 317, 809, 538, 29892, 322, 590, 900, 2039, 8794, 278, 6507, 29892, 322, 2355, 263, 14928, 310, 330, 799, 4208, 29892, 322, 9115, 29893, 304, 1588, 566, 1251, 29872, 297, 5533, 310, 525, 29955, 29955, 29889, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 887, 892, 29871, 29896, 29947, 769, 29973, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 29871, 29896, 29955, 29889, 360, 1164, 315, 1964, 4375, 12982, 29979, 29901, 29871, 29896, 29955, 29889, 13 ]
1,333,675
7,168
CommonCrawl
4
1
GARY ZIMMERMAN: My folks had to sign a release. And so anyway, I worked on Rowan 26 and 35 and Rowan 34 and Rowan 41. And I worked for them, oh, a couple of years, maybe. And then I went to work for Arctic Alaska Drilling and we went to Bakersfield, California. And we built our first rig, a great big rig, an ice rig, in Bakersfield, and then transported it back to Alaska. Stayed with them a couple years, then their name changed. Brinkerhoff took them over and I worked for Brinkerhoff Drilling for a couple years. Then they got slow, and then I went to work for Alaska United, and Alaska United had three different names, so it isn't like I worked for three different companies, but we were Vanguard, Alaska United, and I can't -- the other one skips. And then I went back to work for Pool Arctic Alaska in the oil field, and then whenever there wasn't a rig running -- you know, you don't -- the longest I've ever spent on one rig was five years. And anyway, when I wasn't working, then I'd go commercial fishing. My brother in law, Harold Porter, he's passed on, he was a driller for Nabors Well Service on 1 ES, and a commercial fisherman. So I've gillnetted in Cook Inlet, I've fished herring in Wells Bay and -- and Prince William Sound and Togiak and Cook Inlet. And I've gill netted in Cook Inlet for salmon. And I was also, I've salmon seined in the Sound as a skiff man. I've worked Chignik, and I've worked Kodiak. I've crab fished in Kodiak. And we were chicken farmers. Me and my dad built a chicken farm in 1980. We were Alaska Fresh Greatland Eggs. DON CALLAWAY: Here -- here in Seward? GARY ZIMMERMAN: Yeah. We had 22,000 layers on at Mile 7. We built it from the ground up. We got an agriculture loan from the State of Alaska, we did that, also. You know, so, I mean, you just got to do what you got to do to make a living. But in Seward, I mean, I've -- I've lived a few other places. When my mother got elderly, we moved her to Kentucky because the weather's nicer and I had a sister there. And I've drilled gas wells in Colorado. I've pushed tools in Colorado. I was a field superintendent in Colorado for a while, but most -- you know, it just kind of overlaps. You know, sometimes you're taking -- like if it looks like it's going to be a big summer, I'd take the summer off, you know, because we're working 2 and 2. The first seven years I worked at Prudhoe Bay we worked 2 and 1, and then they switched to 2 and 2, so a lot of times you could get the summer off, you'd -- or you take a six week stretch off, but, like, you'd take your vacation nonpaid, for -- so you'd end up with six weeks off and so you'd go commercial fishing. And me and my dad had a halibut boat. We used to long line. As a matter of fact, I had a boat called the "Allons," it was built in World War II. And it was a wood tender that would go from ship to ship, and we found it and it was thrashed, but the wood looked pretty solid. So we went and got -- this guy's name was Clay, Mike Clay's dad, I can't think of his name, but he was an old Norwegian wood boat builder. And -- or he'd been around it a lot. I wouldn't say he was a builder. Anyway, so he kind of supervised us and keep us going in the right direction. And before that, we -- we'd built -- we'd commercial fished in two smaller boats. I've been on a boat sinking 25 miles off Aialik Bay. We was in the water for 2 hours on a halibut opener --
-1.144618
0.065908
-1.083868
-0.988135
[ -1.1528362097564708, -1.1364001046084855 ]
[ 0.4133463884336583, -0.28152941540084436 ]
[ -1.1016217919234153, -1.0661144175680355 ]
[ -0.744907277169265, -1.2313635173325543 ]
1,024
[ 512, 512 ]
[ 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 1619, 900, 2039, 750, 304, 1804, 263, 6507, 29889, 1126, 577, 8763, 29892, 306, 3796, 373, 11438, 273, 29871, 29906, 29953, 322, 29871, 29941, 29945, 322, 11438, 273, 29871, 29941, 29946, 322, 11438, 273, 29871, 29946, 29896, 29889, 13, 2855, 306, 3796, 363, 963, 29892, 9360, 29892, 263, 7303, 310, 2440, 29892, 5505, 29889, 1126, 769, 306, 3512, 304, 664, 363, 826, 20009, 838, 16191, 4942, 8873, 322, 591, 3512, 304, 350, 21079, 2671, 29892, 8046, 29889, 13, 2855, 591, 4240, 1749, 937, 12912, 29892, 263, 2107, 4802, 12912, 29892, 385, 14890, 12912, 29892, 297, 350, 21079, 2671, 29892, 322, 769, 8608, 287, 372, 1250, 304, 838, 16191, 29889, 13, 855, 388, 287, 411, 963, 263, 7303, 2440, 29892, 769, 1009, 1024, 3939, 29889, 1771, 682, 261, 29327, 3614, 963, 975, 322, 306, 3796, 363, 1771, 682, 261, 29327, 4942, 8873, 363, 263, 7303, 2440, 29889, 13, 11760, 896, 2355, 5232, 29892, 322, 769, 306, 3512, 304, 664, 363, 838, 16191, 3303, 29892, 322, 838, 16191, 3303, 750, 2211, 1422, 2983, 29892, 577, 372, 3508, 29915, 29873, 763, 306, 3796, 363, 2211, 1422, 14582, 29892, 541, 591, 892, 478, 2375, 538, 29892, 838, 16191, 3303, 29892, 322, 306, 508, 29915, 29873, 1192, 278, 916, 697, 14993, 567, 29889, 13, 2855, 769, 306, 3512, 1250, 304, 664, 363, 28625, 826, 20009, 838, 16191, 297, 278, 17182, 1746, 29892, 322, 769, 10940, 727, 9007, 29915, 29873, 263, 12912, 2734, 1192, 366, 1073, 29892, 366, 1016, 29915, 29873, 1192, 278, 27217, 306, 29915, 345, 3926, 10398, 373, 697, 12912, 471, 5320, 2440, 29889, 13, 2855, 8763, 29892, 746, 306, 9007, 29915, 29873, 1985, 29892, 769, 306, 29915, 29881, 748, 12128, 9427, 292, 29889, 1619, 8099, 297, 4307, 29892, 25422, 7102, 357, 29892, 540, 29915, 29879, 4502, 373, 29892, 540, 471, 263, 4192, 5495, 363, 405, 370, 943, 5674, 6692, 373, 29871, 29896, 17956, 29892, 322, 263, 12128, 9427, 3504, 29889, 13, 6295, 306, 29915, 345, 330, 453, 1212, 9446, 297, 17278, 512, 1026, 29892, 306, 29915, 345, 285, 3276, 902, 5393, 297, 5674, 29879, 6211, 322, 1192, 322, 10787, 4667, 14976, 322, 323, 468, 24061, 322, 17278, 512, 1026, 29889, 1126, 306, 29915, 345, 330, 453, 302, 1803, 287, 297, 17278, 512, 1026, 363, 4497, 3712, 29889, 13, 2855, 306, 471, 884, 29892, 306, 29915, 345, 4497, 3712, 409, 1312, 297, 278, 14976, 408, 263, 2071, 2593, 767, 29889, 306, 29915, 345, 3796, 678, 647, 638, 29892, 322, 306, 29915, 345, 3796, 476, 397, 24061, 29889, 306, 29915, 345, 274, 4201, 285, 3276, 297, 476, 397, 24061, 29889, 13, 2855, 591, 892, 521, 21475, 2215, 13269, 29889, 2191, 322, 590, 270, 328, 4240, 263, 521, 21475, 17888, 297, 29871, 29896, 29929, 29947, 29900, 29889, 1334, 892, 838, 16191, 383, 3781, 7027, 1049, 382, 1505, 29879, 29889, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 2266, 1192, 1244, 297, 317, 809, 538, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 1334, 750, 29871, 29906, 29906, 29892, 29900, 29900, 29900, 15359, 373, 472, 341, 488, 29871, 29955, 29889, 1334, 4240, 372, 515, 278, 5962, 701, 29889, 13, 4806, 2355, 385, 18032, 545, 24806, 515, 278, 4306, 310, 838, 16191, 29892, 591, 1258, 393, 29892, 884, 29889, 887, 1073, 29892, 577, 29892, 306, 2099, 29892, 366, 925, 2355, 304, 437, 825, 366, 2355, 304, 437, 304, 1207, 263, 8471, 29889, 1205, 297, 317, 809, 538, 29892, 306, 2099, 29892, 306, 29915, 345, 1192, 306, 29915, 345, 10600, 263, 2846, 916, 7600, 29889, 13, 10401, 590, 5637, 2355, 27008, 368, 29892, 591, 6153, 902, 304, 24043, 1363, 278, 14826, 29915, 29879, 16588, 261, 322, 306, 750, 263, 9883, 727, 29889, 13, 2855, 306, 29915, 345, 270, 4115, 839, 10489, 1532, 29879, 297, 21137, 29889, 306, 29915, 345, 18760, 8492, 297, 21137, 29889, 306, 471, 263, 1746, 2428, 524, 3906, 297, 21137, 363, 263, 1550, 29892, 541, 1556, 1192, 366, 1073, 29892, 372, 925, 2924, 310, 975, 14128, 29889, 13, 3492, 1073, 29892, 6041, 366, 29915, 276, 5622, 1192, 763, 565, 372, 3430, 763, 372, 29915, 29879, 2675, 304, 367, 263, 4802, 11801, 29892, 306, 29915, 29881, 2125, 278, 11801, 1283, 29892, 366, 1073, 29892, 1363, 591, 29915, 276, 1985, 29871, 29906, 322, 29871, 29906, 29889, 13, 1576, 937, 9881, 2440, 306, 3796, 472, 1588, 566, 1251, 29872, 6211, 591, 3796, 29871, 29906, 322, 29871, 29896, 29892, 322, 769, 896, 26263, 304, 29871, 29906, 322, 29871, 29906, 29892, 577, 263, 3287, 310, 3064, 366, 1033, 679, 278, 11801, 1283, 29892, 366, 29915, 29881, 1192, 470, 366, 2125, 263, 4832, 4723, 16116, 1283, 29892, 541, 29892, 763, 29892, 366, 29915, 29881, 2125, 596, 11757, 362, 1661, 3274, 333, 29892, 363, 1192, 577, 366, 29915, 29881, 1095, 701, 411, 4832, 11405, 1283, 322, 577, 366, 29915, 29881, 748, 12128, 9427, 292, 29889, 13, 2855, 592, 322, 590, 270, 328, 750, 263, 8870, 747, 329, 13006, 29889, 1334, 1304, 304, 1472, 1196, 29889, 1094, 263, 4383, 310, 2114, 29892, 306, 750, 263, 13006, 2000, 278, 376, 3596, 787, 1699, 372, 471, 4240, 297, 2787, 3362, 1944, 29889, 13, 2855, 372, 471, 263, 8112, 22707, 393, 723, 748, 515, 7751, 304, 7751, 29892, 322, 591, 1476, 372, 322, 372, 471, 1468, 25936, 29892, 541, 278, 8112, 5148, 5051, 7773, 29889, 13, 6295, 591, 3512, 322, 2355, 1192, 445, 1410, 29891, 29915, 29879, 1024, 471, 26234, 29892, 12828, 26234, 29915, 29879, 270, 328, 29892, 306, 508, 29915, 29873, 1348, 310, 670, 1024, 29892, 541, 540, 471, 385, 2030, 27990, 8112, 13006, 12856, 29889, 13, 2855, 1192, 470, 540, 29915, 29881, 1063, 2820, 372, 263, 3287, 29889, 306, 7656, 29915, 29873, 1827, 540, 471, 263, 12856, 29889, 18110, 29892, 577, 540, 2924, 310, 2428, 11292, 502, 322, 3013, 502, 2675, 297, 278, 1492, 5305, 29889, 13, 2855, 1434, 393, 29892, 591, 1192, 591, 29915, 29881, 4240, 1192, 591, 29915, 29881, 12128, 285, 3276, 297, 1023, 7968, 25462, 29889, 306, 29915, 345, 1063, 373, 263, 13006, 269, 18159, 29871, 29906, 29945, 7800, 1283, 319, 616, 638, 6211, 29889, 13, 4806, 471, 297, 278, 4094, 363, 29871, 29906, 6199, 373, 263, 8870, 747, 329, 1015, 759, 1192 ]
1,333,675
8,192
CommonCrawl
4
1
well, probably about an hour and a half. And we got -- we got hit by -- the weather was really bad and it was -- it was deck loaded with fish and we had the boat go down. And we all survived that. As a matter of fact, the driller superintendent for Nabors Drilling, Dan Hebert, he's still our superintendent, he was one of our deckhands at that time. So we've had a -- RACHEL MASON: How did you get rescued, or -- GARY ZIMMERMAN: Well, my dad -- well, the boat swamped. And I just thought it was -- I had the engine going and the pumps going, so we was looking good, and then we got hit by another wave, but we was in really rough seas. It wasn't like a rogue wave or something, we were just getting pounded. And anyway, my dad says, put on your survival suit. And I go, no, I can get it going, I can do it, I can do it. And I looked up at him and here's dad and my Dan -- Dan Hebert standing there in survival suits. I figured it was time. So I just got my survival suit on, and he was calling mayday, and I guess they heard it in Valdez. And Valdez got ahold of Kodiak, and we cut the raft off. And when he said jump, and the boat was starting to roll and go down. We jumped off and we're in the water. You know, there was no more water. I mean, there was no more boat. There was lots of water, believe me. And then -- and then it ain't nothing like they try and teach you in one of those classes. I ain't saying the classes are useless but they are pretty useless. You know, I mean, you don't bob around like a cork. Every time you start to feel your body raise up, you better get all the air you can because you're going under. I don't care how big your survival suit is. RACHEL MASON: Oh, wow. GARY ZIMMERMAN: It sucks. RACHEL MASON: Yeah. GARY ZIMMERMAN: And anyway, yeah, I remember seeing a C130 flew over us, and then a Coast Guard auxiliary boat picked us up. And that was more horrifying than actually having to jump in the water. And I was warm the whole time. I was not cold, chilly one bit. I was perfectly fine in the survival suit. But the thing was, is that's the people that might need some lessons, because what they do -- well, I'm not saying they do it. It is -- of course, that was a boat sinking in '87, so I'm sure it's new and improved since then. But those people, they tried to come alongside you and grab you. Well, that's not a good thing. When they start to come alongside you, you think about that poster, I mean, this is what happened to me. I actually thought about that poster in the boat harbor where it shows that guy all chewed up by the prop. And that's the only time that I could actually swim. When I was in my survival suit, you know, and I was a lot younger than I am now, and that -- real quick, it seemed like we were a hundred yards apart. And I'm trying to swim to that raft and I couldn't make it. So I figured, well, okay, I'll lay on my back. Well, then, you know, you get hit by a couple waves, that don't work. So then when you're laying on your back and then you try and get your feet back underneath you, where you're kind of buoyant, and that's the trouble, when you get your feet underneath you -- if you've got more than one person, you want to lay on your back and make like a little -- like a -- like a piece of driftwood, you know, floating around. But when you're by yourself, it's -- it's -- it's pretty intense. RACHEL MASON: It was lucky you guys had got into your survival gear. GARY ZIMMERMAN: Yeah, it was very lucky. But that guy that's trying to pick me up, he was
-1.103528
-0.813234
-1.146006
-1.26258
[ -1.2021445252004261, -1.0049112634246047 ]
[ -0.7756309895559949, -0.850837389971003 ]
[ -1.1066942739741839, -1.1853177457610962 ]
[ -1.327614217257911, -1.1975457038452668 ]
1,024
[ 512, 512 ]
[ 1532, 29892, 3117, 1048, 385, 7234, 322, 263, 4203, 29889, 13, 2855, 591, 2355, 1192, 591, 2355, 7124, 491, 1192, 278, 14826, 471, 2289, 4319, 322, 372, 471, 1192, 372, 471, 19810, 7500, 411, 9427, 322, 591, 750, 278, 13006, 748, 1623, 29889, 13, 2855, 591, 599, 10503, 2347, 393, 29889, 1094, 263, 4383, 310, 2114, 29892, 278, 4192, 5495, 2428, 524, 3906, 363, 405, 370, 943, 4942, 8873, 29892, 3951, 940, 2151, 29892, 540, 29915, 29879, 1603, 1749, 2428, 524, 3906, 29892, 540, 471, 697, 310, 1749, 19810, 3179, 29879, 472, 393, 931, 29889, 1105, 591, 29915, 345, 750, 263, 1192, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 1128, 1258, 366, 679, 620, 4979, 287, 29892, 470, 1192, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 5674, 29892, 590, 270, 328, 1192, 1532, 29892, 278, 13006, 2381, 1160, 287, 29889, 1126, 306, 925, 2714, 372, 471, 1192, 306, 750, 278, 6012, 2675, 322, 278, 282, 17204, 2675, 29892, 577, 591, 471, 3063, 1781, 29892, 322, 769, 591, 2355, 7124, 491, 1790, 10742, 29892, 541, 591, 471, 297, 2289, 12164, 409, 294, 29889, 13, 3112, 9007, 29915, 29873, 763, 263, 696, 13000, 10742, 470, 1554, 29892, 591, 892, 925, 2805, 282, 7261, 29889, 1126, 8763, 29892, 590, 270, 328, 4083, 29892, 1925, 373, 596, 10503, 2561, 14726, 29889, 13, 2855, 306, 748, 29892, 694, 29892, 306, 508, 679, 372, 2675, 29892, 306, 508, 437, 372, 29892, 306, 508, 437, 372, 29889, 1126, 306, 5148, 701, 472, 1075, 322, 1244, 29915, 29879, 270, 328, 322, 590, 3951, 1192, 3951, 940, 2151, 13407, 727, 297, 10503, 2561, 480, 1169, 29889, 13, 29902, 14788, 372, 471, 931, 29889, 1105, 306, 925, 2355, 590, 10503, 2561, 14726, 373, 29892, 322, 540, 471, 5432, 1122, 3250, 29892, 322, 306, 4140, 896, 6091, 372, 297, 2630, 311, 29920, 29889, 13, 2855, 2630, 311, 29920, 2355, 263, 8948, 310, 476, 397, 24061, 29892, 322, 591, 5700, 278, 1153, 615, 1283, 29889, 1126, 746, 540, 1497, 12500, 29892, 322, 278, 13006, 471, 6257, 304, 9679, 322, 748, 1623, 29889, 13, 4806, 12500, 287, 1283, 322, 591, 29915, 276, 297, 278, 4094, 29889, 887, 1073, 29892, 727, 471, 694, 901, 4094, 29889, 306, 2099, 29892, 727, 471, 694, 901, 13006, 29889, 1670, 471, 14568, 310, 4094, 29892, 4658, 592, 29889, 13, 2855, 769, 1192, 322, 769, 372, 7216, 29915, 29873, 3078, 763, 896, 1018, 322, 6860, 366, 297, 697, 310, 1906, 4413, 29889, 306, 7216, 29915, 29873, 5934, 278, 4413, 526, 19315, 541, 896, 526, 5051, 19315, 29889, 13, 3492, 1073, 29892, 306, 2099, 29892, 366, 1016, 29915, 29873, 289, 711, 2820, 763, 263, 274, 548, 29889, 7569, 931, 366, 1369, 304, 4459, 596, 3573, 12020, 701, 29892, 366, 2253, 679, 599, 278, 4799, 366, 508, 1363, 366, 29915, 276, 2675, 1090, 29889, 306, 1016, 29915, 29873, 2562, 920, 4802, 596, 10503, 2561, 14726, 338, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 6439, 29892, 281, 340, 29889, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 739, 480, 4684, 29889, 390, 2477, 29950, 6670, 14861, 3094, 29901, 15011, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 1126, 8763, 29892, 21915, 29892, 306, 6456, 8790, 263, 315, 29896, 29941, 29900, 9115, 29893, 975, 502, 29892, 322, 769, 263, 17700, 13211, 29587, 653, 13006, 18691, 502, 701, 29889, 13, 2855, 393, 471, 901, 4029, 29878, 9215, 1135, 2869, 2534, 304, 12500, 297, 278, 4094, 29889, 1126, 306, 471, 14294, 278, 3353, 931, 29889, 306, 471, 451, 11220, 29892, 521, 9403, 697, 2586, 29889, 13, 29902, 471, 7970, 2691, 297, 278, 10503, 2561, 14726, 29889, 1205, 278, 2655, 471, 29892, 338, 393, 29915, 29879, 278, 2305, 393, 1795, 817, 777, 3109, 787, 29892, 1363, 825, 896, 437, 1192, 1532, 29892, 306, 29915, 29885, 451, 5934, 896, 437, 372, 29889, 13, 3112, 338, 1192, 310, 3236, 29892, 393, 471, 263, 13006, 269, 18159, 297, 525, 29947, 29955, 29892, 577, 306, 29915, 29885, 1854, 372, 29915, 29879, 716, 322, 16710, 1951, 769, 29889, 13, 6246, 1906, 2305, 29892, 896, 1898, 304, 2041, 19963, 366, 322, 17229, 366, 29889, 5674, 29892, 393, 29915, 29879, 451, 263, 1781, 2655, 29889, 1932, 896, 1369, 304, 2041, 19963, 366, 29892, 366, 1348, 1048, 393, 10368, 29892, 306, 2099, 29892, 445, 338, 825, 9559, 304, 592, 29889, 13, 29902, 2869, 2714, 1048, 393, 10368, 297, 278, 13006, 4023, 4089, 988, 372, 3697, 393, 1410, 29891, 599, 923, 8734, 701, 491, 278, 3107, 29889, 1126, 393, 29915, 29879, 278, 871, 931, 393, 306, 1033, 2869, 2381, 326, 29889, 13, 10401, 306, 471, 297, 590, 10503, 2561, 14726, 29892, 366, 1073, 29892, 322, 306, 471, 263, 3287, 20023, 1135, 306, 626, 1286, 29892, 322, 393, 1192, 1855, 4996, 29892, 372, 6140, 763, 591, 892, 263, 6893, 17454, 12435, 29889, 13, 2855, 306, 29915, 29885, 1811, 304, 2381, 326, 304, 393, 1153, 615, 322, 306, 8496, 29915, 29873, 1207, 372, 29889, 1105, 306, 14788, 29892, 1532, 29892, 20759, 29892, 306, 29915, 645, 6568, 373, 590, 1250, 29889, 13, 11284, 29892, 769, 29892, 366, 1073, 29892, 366, 679, 7124, 491, 263, 7303, 20037, 29892, 393, 1016, 29915, 29873, 664, 29889, 13, 6295, 769, 746, 366, 29915, 276, 6568, 292, 373, 596, 1250, 322, 769, 366, 1018, 322, 679, 596, 6900, 1250, 1090, 484, 493, 366, 29892, 988, 366, 29915, 276, 2924, 310, 1321, 12602, 424, 29892, 322, 393, 29915, 29879, 278, 7458, 29892, 746, 366, 679, 596, 6900, 1090, 484, 493, 366, 1192, 565, 366, 29915, 345, 2355, 901, 1135, 697, 2022, 29892, 366, 864, 304, 6568, 373, 596, 1250, 322, 1207, 763, 263, 2217, 1192, 763, 263, 1192, 763, 263, 8424, 310, 4192, 2027, 6115, 29892, 366, 1073, 29892, 16526, 2820, 29889, 13, 6246, 746, 366, 29915, 276, 491, 7535, 29892, 372, 29915, 29879, 1192, 372, 29915, 29879, 1192, 372, 29915, 29879, 5051, 17818, 344, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 739, 471, 9885, 29891, 366, 18239, 750, 2355, 964, 596, 10503, 2561, 330, 799, 29889, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29892, 372, 471, 1407, 9885, 29891, 29889, 13, 6246, 393, 1410, 29891, 393, 29915, 29879, 1811, 304, 5839, 592, 701, 29892, 540, 471 ]
1,333,675
9,216
CommonCrawl
4
1
trying to come -- come alongside me, and that's the only time I actually did swim, and I was -- I was swimming away from him for, like, my dear life. Because I figure, this son of a gun's going to run me over. You know, so he's -- yeah, I didn't like it. But it was sure nice to be on his boat when we got on. RACHEL MASON: I bet. GARY ZIMMERMAN: Yeah. KAREN BREWSTER: So when did your dad pass away? GARY ZIMMERMAN: '91. Yeah. DON CALLAWAY: So when you're working in Prudhoe and you had your 2 off, would you come back to Seward? GARY ZIMMERMAN: Yeah. 90 percent of the time. Yeah. DON CALLAWAY: They fly you back to Anchorage and then -- GARY ZIMMERMAN: Yeah, they fly you to Anchorage and then you're free to go. We used to fly mostly the BP charter, but now they have a lot of the -- some of the jobs like when we were working for Conoco when they first got started up there, and we flew commercial, that was -- that was nice. You know. Yeah. And then when we flew for Rowen -- when we worked for Rowen, we used to fly the BP charter, and then Rowen bought their helicopters. And anyway, then they decided that they needed to fly us up there with some airplanes. And they was a lot smaller, they weren't a jet, and that was not comfortable at all. You'd have to fly around Mount McKinley, and we -- we had three or four real bad experiences with that, and so, you know, we -- they finally switched back to a commercial flight. Yeah. DON CALLAWAY: So during this process, you know, can you -- I assume you got married during this time? GARY ZIMMERMAN: Yeah, I've been married -- well, this is my second marriage. Yeah, I got married -- I got married to this real nice, beautiful woman, and she was from California, and I think, oh, somewhere around '84, and we parted ways in '87. Yeah. As a matter of fact, I don't know if I should really tell this part, but that -- she actually saved my life in that boat sinking because what happened is I kept going under the water, and it's just the honest god's truth, you know, but anyway, I was going under the water, and I'd open up my eyes and I'd be looking out and I'd see all this water, and going, man, I'm not going to make it. I mean, you know. And I -- you know. And I'm Catholic, so I'm -- like I'm repenting and stuff, and man, I -- I should repent today. You know, I mean, I try and stay up on that because you never know if you're going to get whacked, you know. So I'm re -- I mean, I actually had time to repent. And so anyway, finally I was -- like, I was in the water probably maybe an hour or so, and I was just exhausted, and this big old wave comes over and pounds me, and I'm way under and I look up and I -- I think, you know, maybe there's 20 feet of water above me, and I thought, that's it, man. This is it. I'm -- I'm going to pass away. I'm dead. You know. And in this -- her face flashed in my mind. And I thought, if I die, she's going to get my Corvette. Her name was still on the title. And man, I tell you what, I came alive. And that's the honest truth. RACHEL MASON: Oh, I thought it was going to be like you saw her beautiful face. GARY ZIMMERMAN: No. Hell, no, because she was mean. I mean, you know. Yeah. No, everything was fine. RACHEL MASON: Her meaness saved your life. GARY ZIMMERMAN: Well, yeah. She would, too. She'd a took that Corvette. And I said, I ain't dying today if I have to swim
-1.09531
-1.506207
-1.910683
-1.66059
[ -1.0268260702885847, -1.1637936131884608 ]
[ -1.3593759070629632, -1.653038994397757 ]
[ -1.6494498534064175, -2.1719155046355767 ]
[ -1.6761978332037974, -1.644981389984763 ]
1,024
[ 512, 512 ]
[ 1811, 304, 2041, 1192, 2041, 19963, 592, 29892, 322, 393, 29915, 29879, 278, 871, 931, 306, 2869, 1258, 2381, 326, 29892, 322, 306, 471, 1192, 306, 471, 2381, 25217, 3448, 515, 1075, 363, 29892, 763, 29892, 590, 9425, 2834, 29889, 13, 29933, 5658, 306, 4377, 29892, 445, 1487, 310, 263, 13736, 29915, 29879, 2675, 304, 1065, 592, 975, 29889, 887, 1073, 29892, 577, 540, 29915, 29879, 1192, 21915, 29892, 306, 3282, 29915, 29873, 763, 372, 29889, 1205, 372, 471, 1854, 7575, 304, 367, 373, 670, 13006, 746, 591, 2355, 373, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 306, 1010, 29889, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1105, 746, 1258, 596, 270, 328, 1209, 3448, 29973, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 525, 29929, 29896, 29889, 15011, 29889, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 1105, 746, 366, 29915, 276, 1985, 297, 1588, 566, 1251, 29872, 322, 366, 750, 596, 29871, 29906, 1283, 29892, 723, 366, 2041, 1250, 304, 317, 809, 538, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 29871, 29929, 29900, 10151, 310, 278, 931, 29889, 15011, 29889, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 2688, 11340, 366, 1250, 304, 530, 305, 6022, 322, 769, 1192, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29892, 896, 11340, 366, 304, 530, 305, 6022, 322, 769, 366, 29915, 276, 3889, 304, 748, 29889, 1334, 1304, 304, 11340, 11149, 278, 350, 29925, 1373, 357, 29892, 541, 1286, 896, 505, 263, 3287, 310, 278, 1192, 777, 310, 278, 17643, 763, 746, 591, 892, 1985, 363, 1281, 6235, 746, 896, 937, 2355, 4687, 701, 727, 29892, 322, 591, 9115, 29893, 12128, 29892, 393, 471, 1192, 393, 471, 7575, 29889, 13, 3492, 1073, 29889, 15011, 29889, 1126, 769, 746, 591, 9115, 29893, 363, 11438, 264, 1192, 746, 591, 3796, 363, 11438, 264, 29892, 591, 1304, 304, 11340, 278, 350, 29925, 1373, 357, 29892, 322, 769, 11438, 264, 18093, 1009, 1081, 293, 459, 2153, 29889, 13, 2855, 8763, 29892, 769, 896, 8459, 393, 896, 4312, 304, 11340, 502, 701, 727, 411, 777, 4799, 9018, 267, 29889, 1126, 896, 471, 263, 3287, 7968, 29892, 896, 2949, 264, 29915, 29873, 263, 22588, 29892, 322, 393, 471, 451, 25561, 472, 599, 29889, 13, 3492, 29915, 29881, 505, 304, 11340, 2820, 8040, 24053, 262, 2330, 29892, 322, 591, 1192, 591, 750, 2211, 470, 3023, 1855, 4319, 27482, 411, 393, 29892, 322, 577, 29892, 366, 1073, 29892, 591, 1192, 896, 7146, 26263, 1250, 304, 263, 12128, 16286, 29889, 15011, 29889, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 1105, 2645, 445, 1889, 29892, 366, 1073, 29892, 508, 366, 1192, 306, 5251, 366, 2355, 8300, 2645, 445, 931, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29892, 306, 29915, 345, 1063, 8300, 1192, 1532, 29892, 445, 338, 590, 1473, 13718, 29889, 15011, 29892, 306, 2355, 8300, 1192, 306, 2355, 8300, 304, 445, 1855, 7575, 29892, 9560, 6114, 29892, 322, 1183, 471, 515, 8046, 29892, 322, 306, 1348, 29892, 9360, 29892, 9051, 2820, 525, 29947, 29946, 29892, 322, 591, 760, 287, 5837, 297, 525, 29947, 29955, 29889, 15011, 29889, 13, 2887, 263, 4383, 310, 2114, 29892, 306, 1016, 29915, 29873, 1073, 565, 306, 881, 2289, 2649, 445, 760, 29892, 541, 393, 1192, 1183, 2869, 7160, 590, 2834, 297, 393, 13006, 269, 18159, 1363, 825, 9559, 338, 306, 8126, 2675, 1090, 278, 4094, 29892, 322, 372, 29915, 29879, 925, 278, 15993, 7339, 29915, 29879, 8760, 29892, 366, 1073, 29892, 541, 8763, 29892, 306, 471, 2675, 1090, 278, 4094, 29892, 322, 306, 29915, 29881, 1722, 701, 590, 5076, 322, 306, 29915, 29881, 367, 3063, 714, 322, 306, 29915, 29881, 1074, 599, 445, 4094, 29892, 322, 2675, 29892, 767, 29892, 306, 29915, 29885, 451, 2675, 304, 1207, 372, 29889, 13, 29902, 2099, 29892, 366, 1073, 29889, 1126, 306, 1192, 366, 1073, 29889, 1126, 306, 29915, 29885, 11865, 29892, 577, 306, 29915, 29885, 1192, 763, 306, 29915, 29885, 1634, 296, 292, 322, 6433, 29892, 322, 767, 29892, 306, 1192, 306, 881, 1634, 296, 9826, 29889, 887, 1073, 29892, 306, 2099, 29892, 306, 1018, 322, 7952, 701, 373, 393, 1363, 366, 2360, 1073, 565, 366, 29915, 276, 2675, 304, 679, 377, 547, 287, 29892, 366, 1073, 29889, 1105, 306, 29915, 29885, 337, 1192, 306, 2099, 29892, 306, 2869, 750, 931, 304, 1634, 296, 29889, 13, 2855, 577, 8763, 29892, 7146, 306, 471, 1192, 763, 29892, 306, 471, 297, 278, 4094, 3117, 5505, 385, 7234, 470, 577, 29892, 322, 306, 471, 925, 18782, 16656, 29892, 322, 445, 4802, 2030, 10742, 5304, 975, 322, 24261, 592, 29892, 322, 306, 29915, 29885, 982, 1090, 322, 306, 1106, 701, 322, 306, 1192, 306, 1348, 29892, 366, 1073, 29892, 5505, 727, 29915, 29879, 29871, 29906, 29900, 6900, 310, 4094, 2038, 592, 29892, 322, 306, 2714, 29892, 393, 29915, 29879, 372, 29892, 767, 29889, 13, 4013, 338, 372, 29889, 306, 29915, 29885, 1192, 306, 29915, 29885, 2675, 304, 1209, 3448, 29889, 306, 29915, 29885, 7123, 29889, 887, 1073, 29889, 1126, 297, 445, 1192, 902, 3700, 11013, 287, 297, 590, 3458, 29889, 13, 2855, 306, 2714, 29892, 565, 306, 762, 29892, 1183, 29915, 29879, 2675, 304, 679, 590, 2994, 29894, 2353, 29889, 2439, 1024, 471, 1603, 373, 278, 3611, 29889, 1126, 767, 29892, 306, 2649, 366, 825, 29892, 306, 2996, 18758, 29889, 1126, 393, 29915, 29879, 278, 15993, 8760, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 6439, 29892, 306, 2714, 372, 471, 2675, 304, 367, 763, 366, 4446, 902, 9560, 3700, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 1939, 29889, 19339, 29892, 694, 29892, 1363, 1183, 471, 2099, 29889, 306, 2099, 29892, 366, 1073, 29889, 15011, 29889, 1939, 29892, 4129, 471, 2691, 29889, 390, 2477, 29950, 6670, 14861, 3094, 29901, 2439, 2099, 404, 7160, 596, 2834, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 5674, 29892, 21915, 29889, 2296, 723, 29892, 2086, 29889, 2296, 29915, 29881, 263, 3614, 393, 2994, 29894, 2353, 29889, 13, 2855, 306, 1497, 29892, 306, 7216, 29915, 29873, 27116, 9826, 565, 306, 505, 304, 2381, 326 ]
1,333,675
10,240
CommonCrawl
4
1
to town. And man, every time a wave was coming up, and I was all fired up, I mean, I wasn't going down. There was no chance of me drowning that day. Yeah. But I was -- I mean, I was just wore out. And so she gave me the second wind. RACHEL MASON: That's good. GARY ZIMMERMAN:And I seen her -- I hadn't seen her for a long time, and I seen her a couple years ago, oh, about seven or eight years ago, she came to Seward. She calls me up. And so she wanted to go have coffee. And so, ok, I said, yeah, that sounds safe. You know. And anyway, I told her that story. I said, yeah, you remember when we sunk that boat? She goes, yeah. I says, yeah, your name was still on that title, and you saved my life. There was no way I was giving up that Vette. RACHEL MASON: Did she see the humor in that? GARY ZIMMERMAN: Yeah, she did. Yeah. She's actually -- you know, she's a -- she's really a nice gal. We were just young and wild and, you know, I mean, I was working in the oil field, I was probably a derrick man or something back then, or a loader operator, and, you know, that's -- those kind of stories can't go on tape, of what when on on the North Slope, you know. RACHEL MASON: Oh, yeah. GARY ZIMMERMAN: But she -- but yeah, she turned out. She's fantastic. She's got great kids, you know, they're very well mannered. Yeah. I'm glad for her, actually. KAREN BREWSTER: When did you get married to your current wife? GARY ZIMMERMAN: We got married about seven years ago. And I've known her for 30 years, too. Yeah. She -- I'm -- Laura and my sister Peggy used to be flight attendants for Reeves Aleutian Airlines. So I was, like, 17 or 18 years old, and I was working for that Rowen, and I'm sitting in my sister's apartment off of Wisconsin in Anchorage. And I hear a knock on the door. She comes in. Those Reeves Aleutian gals, they used to give them this real nice red parka, kind of a Russian style, or Eskimo style parka, zipper, with this beautiful wolf thing on top, you know, wolf tail or whatever. She walks through the door, and I'm going -- man, I was just smitten. You know, I couldn't hardly speak. DON CALLAWAY: Thunderbolt. GARY ZIMMERMAN: Yeah. So anyway, you know, I didn't say nothing. And so when she walks out the door, I thought, well, I better go ask her if she wants to go to the movie. I got brave then. And I did. And I says to my sister, I said, well, what's that gal's story? Oh, she's going out with a pilot. And I'm thinking, well, roughneck at Rowan Drilling, airline pilot, ah, what's the use. It's out of my league, you know. But anyway, but the funny thing was my sister and her have always been friends, and I bumped into her on and off over the years. And we actually were visiting on the phone. And anyway, her -- her husband didn't work out after 20 years. And so when Peg told me that she'd been divorced, I figured, well, I'll just call her up. I'm a little braver nowadays. Funny, that pilot didn't work out so good. You know, so yeah. My -- my wife, she's beautiful. She's a little bitty thing. She's been with Alaska Airlines for 30 years. You know. She's -- she loves snowmobiling. She doesn't fish, she doesn't hunt, and I like that part, gives us a little space in that area. But if she did, she could go whenever she wanted. But we enjoy a lot of camping, we have
-0.620032
-1.207172
-1.616479
-1.811469
[ -0.7364548793408475, -0.5036100564110582 ]
[ -1.2447756778591412, -1.1695692774441329 ]
[ -1.4617680175279815, -1.7711894226248623 ]
[ -1.863496492518005, -1.7594416817878897 ]
1,024
[ 512, 512 ]
[ 304, 4726, 29889, 1126, 767, 29892, 1432, 931, 263, 10742, 471, 6421, 701, 29892, 322, 306, 471, 599, 17285, 701, 29892, 306, 2099, 29892, 306, 9007, 29915, 29873, 2675, 1623, 29889, 13, 8439, 471, 694, 8825, 310, 592, 270, 798, 1076, 393, 2462, 29889, 13, 29979, 29872, 801, 29889, 1205, 306, 471, 1192, 306, 2099, 29892, 306, 471, 925, 26758, 714, 29889, 1126, 577, 1183, 4846, 592, 278, 1473, 8805, 29889, 390, 2477, 29950, 6670, 14861, 3094, 29901, 2193, 29915, 29879, 1781, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 2855, 306, 3595, 902, 1192, 306, 27222, 29915, 29873, 3595, 902, 363, 263, 1472, 931, 29892, 322, 306, 3595, 902, 263, 7303, 2440, 8020, 29892, 9360, 29892, 1048, 9881, 470, 9475, 2440, 8020, 29892, 1183, 2996, 304, 317, 809, 538, 29889, 13, 13468, 5717, 592, 701, 29889, 1126, 577, 1183, 5131, 304, 748, 505, 26935, 29889, 1126, 577, 29892, 3431, 29892, 306, 1497, 29892, 21915, 29892, 393, 10083, 9109, 29889, 887, 1073, 29889, 1126, 8763, 29892, 306, 5429, 902, 393, 5828, 29889, 13, 29902, 1497, 29892, 21915, 29892, 366, 6456, 746, 591, 269, 2960, 393, 13006, 29973, 2296, 5771, 29892, 21915, 29889, 13, 29902, 4083, 29892, 21915, 29892, 596, 1024, 471, 1603, 373, 393, 3611, 29892, 322, 366, 7160, 590, 2834, 29889, 1670, 471, 694, 982, 306, 471, 6820, 701, 393, 478, 2353, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 7440, 1183, 1074, 278, 27448, 297, 393, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29892, 1183, 1258, 29889, 15011, 29889, 2296, 29915, 29879, 2869, 1192, 366, 1073, 29892, 1183, 29915, 29879, 263, 1192, 1183, 29915, 29879, 2289, 263, 7575, 6898, 29889, 13, 4806, 892, 925, 4123, 322, 8775, 322, 29892, 366, 1073, 29892, 306, 2099, 29892, 306, 471, 1985, 297, 278, 17182, 1746, 29892, 306, 471, 3117, 263, 589, 9131, 767, 470, 1554, 1250, 769, 29892, 470, 263, 23466, 5455, 29892, 322, 29892, 366, 1073, 29892, 393, 29915, 29879, 1192, 1906, 2924, 310, 15874, 508, 29915, 29873, 748, 373, 260, 4085, 29892, 310, 825, 746, 373, 373, 278, 4644, 16275, 412, 29892, 366, 1073, 29889, 390, 2477, 29950, 6670, 14861, 3094, 29901, 6439, 29892, 21915, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 1205, 1183, 1192, 541, 21915, 29892, 1183, 6077, 714, 29889, 2296, 29915, 29879, 13568, 6288, 29889, 2296, 29915, 29879, 2355, 2107, 413, 4841, 29892, 366, 1073, 29892, 896, 29915, 276, 1407, 1532, 8214, 287, 29889, 15011, 29889, 306, 29915, 29885, 10932, 363, 902, 29892, 2869, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1932, 1258, 366, 679, 8300, 304, 596, 1857, 6532, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 1334, 2355, 8300, 1048, 9881, 2440, 8020, 29889, 1126, 306, 29915, 345, 2998, 902, 363, 29871, 29941, 29900, 2440, 29892, 2086, 29889, 13, 29979, 29872, 801, 29889, 2296, 1192, 306, 29915, 29885, 1192, 21671, 322, 590, 9883, 27281, 1927, 1304, 304, 367, 16286, 14333, 1934, 363, 830, 29872, 1960, 7801, 329, 713, 29718, 29889, 13, 6295, 306, 471, 29892, 763, 29892, 29871, 29896, 29955, 470, 29871, 29896, 29947, 2440, 2030, 29892, 322, 306, 471, 1985, 363, 393, 11438, 264, 29892, 322, 306, 29915, 29885, 16246, 297, 590, 9883, 29915, 29879, 263, 8076, 1283, 310, 22581, 297, 530, 305, 6022, 29889, 13, 2855, 306, 8293, 263, 18232, 373, 278, 3050, 29889, 2296, 5304, 297, 29889, 16025, 830, 29872, 1960, 7801, 329, 713, 330, 1338, 29892, 896, 1304, 304, 2367, 963, 445, 1855, 7575, 2654, 610, 1335, 29892, 2924, 310, 263, 10637, 3114, 29892, 470, 382, 808, 4200, 3114, 610, 1335, 29892, 503, 29875, 2496, 29892, 411, 445, 9560, 281, 4369, 2655, 373, 2246, 29892, 366, 1073, 29892, 281, 4369, 12464, 470, 6514, 29889, 13, 13468, 17042, 2039, 1549, 278, 3050, 29892, 322, 306, 29915, 29885, 2675, 1192, 767, 29892, 306, 471, 925, 1560, 16097, 29889, 887, 1073, 29892, 306, 8496, 29915, 29873, 15155, 7726, 29889, 360, 1164, 315, 1964, 4375, 12982, 29979, 29901, 498, 5062, 2095, 29873, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 1105, 8763, 29892, 366, 1073, 29892, 306, 3282, 29915, 29873, 1827, 3078, 29889, 1126, 577, 746, 1183, 17042, 2039, 714, 278, 3050, 29892, 306, 2714, 29892, 1532, 29892, 306, 2253, 748, 2244, 902, 565, 1183, 10753, 304, 748, 304, 278, 14064, 29889, 306, 2355, 26565, 769, 29889, 1126, 306, 1258, 29889, 13, 2855, 306, 4083, 304, 590, 9883, 29892, 306, 1497, 29892, 1532, 29892, 825, 29915, 29879, 393, 6898, 29915, 29879, 5828, 29973, 6439, 29892, 1183, 29915, 29879, 2675, 714, 411, 263, 19840, 29889, 13, 2855, 306, 29915, 29885, 7291, 29892, 1532, 29892, 12164, 484, 384, 472, 11438, 273, 4942, 8873, 29892, 4799, 1220, 19840, 29892, 21023, 29892, 825, 29915, 29879, 278, 671, 29889, 739, 29915, 29879, 714, 310, 590, 13225, 29892, 366, 1073, 29889, 13, 6246, 8763, 29892, 541, 278, 2090, 1460, 2655, 471, 590, 9883, 322, 902, 505, 2337, 1063, 7875, 29892, 322, 306, 289, 3427, 287, 964, 902, 373, 322, 1283, 975, 278, 2440, 29889, 13, 2855, 591, 2869, 892, 6493, 292, 373, 278, 9008, 29889, 1126, 8763, 29892, 902, 1192, 902, 10216, 3282, 29915, 29873, 664, 714, 1156, 29871, 29906, 29900, 2440, 29889, 13, 2855, 577, 746, 27281, 5429, 592, 393, 1183, 29915, 29881, 1063, 25074, 1133, 29892, 306, 14788, 29892, 1532, 29892, 306, 29915, 645, 925, 1246, 902, 701, 29889, 306, 29915, 29885, 263, 2217, 4105, 369, 1286, 328, 1036, 29889, 13, 25394, 1460, 29892, 393, 19840, 3282, 29915, 29873, 664, 714, 577, 1781, 29889, 887, 1073, 29892, 577, 21915, 29889, 1619, 1192, 590, 6532, 29892, 1183, 29915, 29879, 9560, 29889, 2296, 29915, 29879, 263, 2217, 289, 986, 29891, 2655, 29889, 2296, 29915, 29879, 1063, 411, 838, 16191, 29718, 363, 29871, 29941, 29900, 2440, 29889, 13, 3492, 1073, 29889, 2296, 29915, 29879, 1192, 1183, 12355, 267, 15007, 29885, 711, 6504, 29889, 2296, 1838, 29915, 29873, 9427, 29892, 1183, 1838, 29915, 29873, 298, 1657, 29892, 322, 306, 763, 393, 760, 29892, 4076, 502, 263, 2217, 2913, 297, 393, 4038, 29889, 13, 6246, 565, 1183, 1258, 29892, 1183, 1033, 748, 10940, 1183, 5131, 29889, 1205, 591, 13389, 263, 3287, 310, 4242, 292, 29892, 591, 505 ]
1,333,675
11,264
CommonCrawl
4
1
a beautiful camper. We have a Keystone Raptor down there in Kentucky, so we tow around and we go -- it's a toy hauler so we've got four wheelers in the back of that and bicycles. And we like going to the national parks. We -- and we like going to NASCAR races, like we've been to Daniel Boone State Park, for example, or Cumberland Gap, and you know, we've been all over the East Coast. Shiloh Battlefield, we do a lot of things like that, too. But yeah, she's pretty energetic. RACHEL MASON: That's great. Is she from around here? GARY ZIMMERMAN: No. She's -- she was born and pretty much raised in Seattle. RACHEL MASON: Oh. GARY ZIMMERMAN: Yeah. Yeah. As a matter of fact, that's where she lives. RACHEL MASON: Oh. GARY ZIMMERMAN: Yeah. DON CALLAWAY: And how about brothers or cousins in the area? GARY ZIMMERMAN: Both my brothers are deceased. My brother Eddie died in Togiak spotting herring. It was a midair conclusion with Dick Moll. Margaret Anderson's husband Ray was in that plane wreck, too. My brother was flying for him. DON CALLAWAY: When was that, again? GARY ZIMMERMAN: Jeez, you know, I think it was '80; 1980 or '82, somewhere right in there. Then my little brother died out here at Nash Road in a one car car wreck. A mysterious wheel come off his truck. And so that's -- we won't go too far there. And then I had a little sister that passed away in 1969, so the only ones that are left is my sister Peggy. She lives in Kentucky, her husband's a UPS mechanic. He works on the composite bodies, and is a jet engine mechanic, too, so he's worked for Rolls Royce and a few of those companies. And my sister Joan, she lives in Nikiski, and she's married to a nice fellow, his name's Bill, Bill Boutalair. And he's an avid hunter, snowmobiler, and he's got more of a utility type sled. And he's a lineman. And has been a commercial fisherman. Her first husband, Harold, I think he died in right around 1980, in a -- he hit a tree with a snow machine. It was a freak accident. And so anyway, that's what killed him. So then she remarried this guy. And I have nieces -- it's funny, my sister's kids in Kentucky moved up here. One's living with me now and one lives downtown. And two of my sister's kids in Kenai moved to Elizabethtown, so they kind of swapped kids, I guess. Adult kids. And my cousins, my cousin Phil is probably one of my best friends. He lives out here at Mile 7. He's got G & P Enterprises, he's self employed. And my other cousin Perry, he works for -- used to be the phone company manager, been with this GTE back then for many years. He lives in Anchorage. I don't see him very often. So that's probably my -- the main family that I -- we have lots of family in Wisconsin, you know, or in Michigan, Wisconsin, Iowa, Illinois area. You know, you see them every 10 years once or twice, you know, that's -- yeah, but to see them on the street, I probably wouldn't recognize them. DON CALLAWAY: And what do you do now? What -- GARY ZIMMERMAN: I work for -- right now I'm off work, but I was -- I was injured with working for Aurora Well Service. A hose came out of there, weighed a couple thousand pounds, and crushed part of my skull. It happened to me three years ago. So I went -- you know, I was off work four or five days, or whatever, and went back to work, and anyway, I've been fighting a case of severe vertigo. And anyway, I quit working for
-1.232277
-0.603731
-1.707783
-1.637177
[ -1.196665823484431, -1.2678889457923666 ]
[ -0.507036702359537, -0.7004245891409867 ]
[ -1.7559719764725568, -1.6595948175079545 ]
[ -1.7386307196418667, -1.5357238387181418 ]
1,024
[ 512, 512 ]
[ 263, 9560, 3949, 546, 29889, 13, 4806, 505, 263, 4813, 858, 650, 390, 2156, 272, 1623, 727, 297, 24043, 29892, 577, 591, 304, 29893, 2820, 322, 591, 748, 1192, 372, 29915, 29879, 263, 304, 29891, 447, 8584, 577, 591, 29915, 345, 2355, 3023, 18875, 414, 297, 278, 1250, 310, 393, 322, 289, 4245, 7799, 29889, 13, 2855, 591, 763, 2675, 304, 278, 4797, 610, 2039, 29889, 1334, 1192, 322, 591, 763, 2675, 304, 16938, 29907, 1718, 19830, 29892, 763, 591, 29915, 345, 1063, 304, 8432, 1952, 650, 4306, 4815, 29892, 363, 1342, 29892, 470, 315, 2807, 1049, 402, 481, 29892, 322, 366, 1073, 29892, 591, 29915, 345, 1063, 599, 975, 278, 6932, 17700, 29889, 13, 2713, 309, 1148, 12788, 2671, 29892, 591, 437, 263, 3287, 310, 2712, 763, 393, 29892, 2086, 29889, 1205, 21915, 29892, 1183, 29915, 29879, 5051, 4527, 657, 293, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 2193, 29915, 29879, 2107, 29889, 1317, 1183, 515, 2820, 1244, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 1939, 29889, 2296, 29915, 29879, 1192, 1183, 471, 6345, 322, 5051, 1568, 10425, 297, 27689, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 6439, 29889, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 15011, 29889, 1094, 263, 4383, 310, 2114, 29892, 393, 29915, 29879, 988, 1183, 12080, 29889, 390, 2477, 29950, 6670, 14861, 3094, 29901, 6439, 29889, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 1126, 920, 1048, 21383, 470, 274, 681, 1144, 297, 278, 4038, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 9134, 590, 21383, 526, 23332, 1463, 29889, 1619, 8099, 20861, 347, 6423, 297, 323, 468, 24061, 9758, 1259, 902, 5393, 29889, 739, 471, 263, 286, 1458, 381, 15997, 411, 12488, 341, 3028, 29889, 18364, 17483, 29915, 29879, 10216, 9596, 471, 297, 393, 10694, 281, 18217, 29892, 2086, 29889, 1619, 8099, 471, 22764, 363, 1075, 29889, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 1932, 471, 393, 29892, 1449, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 2581, 6096, 29892, 366, 1073, 29892, 306, 1348, 372, 471, 525, 29947, 29900, 29936, 29871, 29896, 29929, 29947, 29900, 470, 525, 29947, 29906, 29892, 9051, 1492, 297, 727, 29889, 13, 11760, 590, 2217, 8099, 6423, 714, 1244, 472, 24848, 9321, 297, 263, 697, 1559, 1559, 281, 18217, 29889, 13, 29909, 22277, 2738, 18875, 2041, 1283, 670, 534, 2707, 29889, 1126, 577, 393, 29915, 29879, 1192, 591, 2113, 29915, 29873, 748, 2086, 2215, 727, 29889, 13, 2855, 769, 306, 750, 263, 2217, 9883, 393, 4502, 3448, 297, 29871, 29896, 29929, 29953, 29929, 29892, 577, 278, 871, 6743, 393, 526, 2175, 338, 590, 9883, 27281, 1927, 29889, 2296, 12080, 297, 24043, 29892, 902, 10216, 29915, 29879, 263, 501, 7024, 7208, 293, 29889, 13, 3868, 1736, 373, 278, 20842, 17873, 29892, 322, 338, 263, 22588, 6012, 7208, 293, 29892, 2086, 29892, 577, 540, 29915, 29879, 3796, 363, 21809, 29879, 15793, 346, 322, 263, 2846, 310, 1906, 14582, 29889, 13, 2855, 590, 9883, 19317, 29892, 1183, 12080, 297, 11535, 275, 1984, 29892, 322, 1183, 29915, 29879, 8300, 304, 263, 7575, 10404, 29892, 670, 1024, 29915, 29879, 6682, 29892, 6682, 350, 449, 284, 1466, 29889, 13, 2855, 540, 29915, 29879, 385, 1029, 333, 298, 8428, 29892, 15007, 29885, 711, 3955, 29892, 322, 540, 29915, 29879, 2355, 901, 310, 263, 19725, 1134, 269, 839, 29889, 1126, 540, 29915, 29879, 263, 6276, 11422, 29889, 1126, 756, 1063, 263, 12128, 9427, 3504, 29889, 13, 18650, 937, 10216, 29892, 25422, 29892, 306, 1348, 540, 6423, 297, 1492, 2820, 29871, 29896, 29929, 29947, 29900, 29892, 297, 263, 1192, 540, 7124, 263, 5447, 411, 263, 15007, 4933, 29889, 739, 471, 263, 3005, 557, 11423, 29889, 13, 2855, 577, 8763, 29892, 393, 29915, 29879, 825, 9445, 1075, 29889, 1105, 769, 1183, 1083, 279, 1255, 445, 1410, 29891, 29889, 13, 2855, 306, 505, 4930, 778, 1192, 372, 29915, 29879, 2090, 1460, 29892, 590, 9883, 29915, 29879, 413, 4841, 297, 24043, 6153, 701, 1244, 29889, 3118, 29915, 29879, 8471, 411, 592, 1286, 322, 697, 12080, 16611, 593, 776, 29889, 1126, 1023, 310, 590, 9883, 29915, 29879, 413, 4841, 297, 10015, 1794, 6153, 304, 12457, 13176, 400, 776, 29892, 577, 896, 2924, 310, 2381, 17280, 413, 4841, 29892, 306, 4140, 29889, 2087, 499, 413, 4841, 29889, 13, 2855, 590, 274, 681, 1144, 29892, 590, 22618, 5241, 338, 3117, 697, 310, 590, 1900, 7875, 29889, 940, 12080, 714, 1244, 472, 341, 488, 29871, 29955, 29889, 13, 3868, 29915, 29879, 2355, 402, 669, 349, 9041, 558, 4637, 29892, 540, 29915, 29879, 1583, 15723, 29889, 1126, 590, 916, 22618, 28376, 29892, 540, 1736, 363, 1192, 1304, 304, 367, 278, 9008, 5001, 8455, 29892, 1063, 411, 445, 402, 4330, 1250, 769, 363, 1784, 2440, 29889, 13, 3868, 12080, 297, 530, 305, 6022, 29889, 306, 1016, 29915, 29873, 1074, 1075, 1407, 4049, 29889, 1105, 393, 29915, 29879, 3117, 590, 1192, 278, 1667, 3942, 393, 306, 1192, 591, 505, 14568, 310, 3942, 297, 22581, 29892, 366, 1073, 29892, 470, 297, 17098, 29892, 22581, 29892, 25327, 29892, 17066, 4038, 29889, 13, 3492, 1073, 29892, 366, 1074, 963, 1432, 29871, 29896, 29900, 2440, 2748, 470, 8951, 29892, 366, 1073, 29892, 393, 29915, 29879, 1192, 21915, 29892, 541, 304, 1074, 963, 373, 278, 11952, 29892, 306, 3117, 7656, 29915, 29873, 18720, 963, 29889, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 1126, 825, 437, 366, 437, 1286, 29973, 1724, 1192, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 306, 664, 363, 1192, 1492, 1286, 306, 29915, 29885, 1283, 664, 29892, 541, 306, 471, 1192, 306, 471, 28606, 411, 1985, 363, 23266, 2207, 5674, 6692, 29889, 319, 298, 852, 2996, 714, 310, 727, 29892, 591, 25398, 263, 7303, 10405, 24261, 29892, 322, 2181, 15392, 760, 310, 590, 2071, 913, 29889, 13, 3112, 9559, 304, 592, 2211, 2440, 8020, 29889, 1105, 306, 3512, 1192, 366, 1073, 29892, 306, 471, 1283, 664, 3023, 470, 5320, 3841, 29892, 470, 6514, 29892, 322, 3512, 1250, 304, 664, 29892, 322, 8763, 29892, 306, 29915, 345, 1063, 17770, 263, 1206, 310, 22261, 4837, 5973, 29889, 13, 2855, 8763, 29892, 306, 23283, 1985, 363 ]
1,333,675
12,288
CommonCrawl
4
1
Aurora, and that's when I went to Colorado, and I was drilling for Patterson Drilling down there, we were drilling for oil and gas -- well, yeah, gas wells, by the -- by the Grand Junction area. DON CALLOWAY: Right. And so anyway, I started having -- about every three weeks after I was slammed on the head, I'd have a -- I have these electrical shorts. And it feels like -- I can feel them coming on, and I can see you and I can hear you, but while I'm having this short, I can't respond, and it feels like you're getting nicked by electricity. And so, you know, I was having these once every three, four weeks, and I was not really too concerned about it, you know, because I always had a warning. And, you know, I mean, I've always been -- which is maybe wrong, but I was always taught, you know, you're a man, you need to work; man up and go to work. Well, when I was working in as -- I made it as field superintendent, I was talking to a friend of mine at Nabors, which I've worked for Nabors on and off since 1984. And so we're talking about it, and I sent him a couple good hands that wanted to go to Alaska. And so anyway, old Don calls me up and we're talking and I told him I was field superintendent, and he goes, you know, if you're up here, he says, we'll -- we could put you pushing out here. And, well, it's the first time in my oil field career I asked, well, what do you pay? Because I was figuring, you know, if it's good pay, it was a check, big checks. And the check was about a good 30 percent more than what I'm making in Colorado, and I'm making good money in Colorado. So I talked -- it's the first time I ever even talked it over with the wife because she usually just lets me go with it. You know, if I think that's what we need to do, that's what we do, just we don't try and make an issue out of it. So we came back to work for Nabors a year ago this July. And I'm drilling for them on Rig 16, we're doing a modification, and my vertigo was -- in the last three years has been subsiding. But, you know, but -- and I don't tell people I really have a vertigo problem. And so anyway, in December, Nabors shut down a bunch of rigs that were unexpected, and they sent me out to 19 AC and they offered me a job as assistant driller and motorman. See, now, that's good jobs. Pay is good. Well, then, as a working person, I was working every day, and then on my days off, we had bought an automated wood splitter, it was called a Chomper. We could -- we could cut -- we could process up to five and a half cords of firewood an hour. It's all automated, kind of. And so I was working for Nabors as a motorman, so let's say, I started in January, it was actually before that, and then cutting wood on my days off. Well, the vertigo started getting worse, and I started having more of these electrical shorts. Well, then, by July, July 14th, I went to supper, come back from supper, at 6:00, and I was really feeling bad, so I sat down on the steps in the motor room that goes up to the air compressor room, and I lost about three hours. So I went to the medic, the toolpusher, and he comes out and was -- and I told him I was sick and I barely could get to the medic. He said, oh yeah, you've got a flu or dehydrated. Well, I wasn't getting any better. So I went to town and they -- since then they've done a bunch of testing on me and they -- they've found out underneath my brain here, where I got hit on the head, I've got a big dent up there, it forced my brain down on my brain stem and caused inner ear damage to where there's problems in there. And I have -- where your brain lays in there, I have microtears
-1.287064
-1.198219
-1.403434
-1.033659
[ -1.454164804136198, -1.1199639994605004 ]
[ -1.5241137365434572, -0.8723249329467196 ]
[ -1.730609566218714, -1.0762593816695727 ]
[ -1.2573772200150832, -0.8099415338755871 ]
1,024
[ 512, 512 ]
[ 23266, 2207, 29892, 322, 393, 29915, 29879, 746, 306, 3512, 304, 21137, 29892, 322, 306, 471, 4192, 8873, 363, 349, 2620, 1100, 4942, 8873, 1623, 727, 29892, 591, 892, 4192, 8873, 363, 17182, 322, 10489, 1192, 1532, 29892, 21915, 29892, 10489, 1532, 29879, 29892, 491, 278, 1192, 491, 278, 6265, 435, 651, 4038, 29889, 13, 29928, 1164, 315, 1964, 3927, 12982, 29979, 29901, 10428, 29889, 1126, 577, 8763, 29892, 306, 4687, 2534, 1192, 1048, 1432, 2211, 11405, 1156, 306, 471, 2243, 28913, 373, 278, 2343, 29892, 306, 29915, 29881, 505, 263, 1192, 306, 505, 1438, 3546, 16888, 3273, 29879, 29889, 13, 2855, 372, 23880, 763, 1192, 306, 508, 4459, 963, 6421, 373, 29892, 322, 306, 508, 1074, 366, 322, 306, 508, 8293, 366, 29892, 541, 1550, 306, 29915, 29885, 2534, 445, 3273, 29892, 306, 508, 29915, 29873, 10049, 29892, 322, 372, 23880, 763, 366, 29915, 276, 2805, 302, 17840, 491, 12646, 537, 29889, 13, 2855, 577, 29892, 366, 1073, 29892, 306, 471, 2534, 1438, 2748, 1432, 2211, 29892, 3023, 11405, 29892, 322, 306, 471, 451, 2289, 2086, 15041, 1048, 372, 29892, 366, 1073, 29892, 1363, 306, 2337, 750, 263, 9177, 29889, 13, 2855, 29892, 366, 1073, 29892, 306, 2099, 29892, 306, 29915, 345, 2337, 1063, 1192, 607, 338, 5505, 2743, 29892, 541, 306, 471, 2337, 16187, 29892, 366, 1073, 29892, 366, 29915, 276, 263, 767, 29892, 366, 817, 304, 664, 29936, 767, 701, 322, 748, 304, 664, 29889, 13, 11284, 29892, 746, 306, 471, 1985, 297, 408, 1192, 306, 1754, 372, 408, 1746, 2428, 524, 3906, 29892, 306, 471, 9963, 304, 263, 5121, 310, 7903, 472, 405, 370, 943, 29892, 607, 306, 29915, 345, 3796, 363, 405, 370, 943, 373, 322, 1283, 1951, 29871, 29896, 29929, 29947, 29946, 29889, 13, 2855, 577, 591, 29915, 276, 9963, 1048, 372, 29892, 322, 306, 2665, 1075, 263, 7303, 1781, 6567, 393, 5131, 304, 748, 304, 838, 16191, 29889, 13, 2855, 577, 8763, 29892, 2030, 3872, 5717, 592, 701, 322, 591, 29915, 276, 9963, 322, 306, 5429, 1075, 306, 471, 1746, 2428, 524, 3906, 29892, 322, 540, 5771, 29892, 366, 1073, 29892, 565, 366, 29915, 276, 701, 1244, 29892, 540, 4083, 29892, 591, 29915, 645, 1192, 591, 1033, 1925, 366, 27556, 714, 1244, 29889, 13, 2855, 29892, 1532, 29892, 372, 29915, 29879, 278, 937, 931, 297, 590, 17182, 1746, 6413, 306, 4433, 29892, 1532, 29892, 825, 437, 366, 5146, 29973, 7311, 306, 471, 2537, 3864, 29892, 366, 1073, 29892, 565, 372, 29915, 29879, 1781, 5146, 29892, 372, 471, 263, 1423, 29892, 4802, 12747, 29889, 13, 2855, 278, 1423, 471, 1048, 263, 1781, 29871, 29941, 29900, 10151, 901, 1135, 825, 306, 29915, 29885, 3907, 297, 21137, 29892, 322, 306, 29915, 29885, 3907, 1781, 6909, 297, 21137, 29889, 13, 6295, 306, 24867, 1192, 372, 29915, 29879, 278, 937, 931, 306, 3926, 1584, 24867, 372, 975, 411, 278, 6532, 1363, 1183, 5491, 925, 16869, 592, 748, 411, 372, 29889, 887, 1073, 29892, 565, 306, 1348, 393, 29915, 29879, 825, 591, 817, 304, 437, 29892, 393, 29915, 29879, 825, 591, 437, 29892, 925, 591, 1016, 29915, 29873, 1018, 322, 1207, 385, 2228, 714, 310, 372, 29889, 13, 6295, 591, 2996, 1250, 304, 664, 363, 405, 370, 943, 263, 1629, 8020, 445, 5468, 29889, 1126, 306, 29915, 29885, 4192, 8873, 363, 963, 373, 390, 335, 29871, 29896, 29953, 29892, 591, 29915, 276, 2599, 263, 21733, 29892, 322, 590, 4837, 5973, 471, 1192, 297, 278, 1833, 2211, 2440, 756, 1063, 11684, 4821, 29889, 13, 6246, 29892, 366, 1073, 29892, 541, 1192, 322, 306, 1016, 29915, 29873, 2649, 2305, 306, 2289, 505, 263, 4837, 5973, 1108, 29889, 13, 2855, 577, 8763, 29892, 297, 5846, 29892, 405, 370, 943, 12522, 1623, 263, 14928, 310, 12912, 29879, 393, 892, 15668, 29892, 322, 896, 2665, 592, 714, 304, 29871, 29896, 29929, 14614, 322, 896, 12520, 592, 263, 4982, 408, 20255, 4192, 5495, 322, 3184, 555, 273, 29889, 13, 13393, 29892, 1286, 29892, 393, 29915, 29879, 1781, 17643, 29889, 14617, 338, 1781, 29889, 5674, 29892, 769, 29892, 408, 263, 1985, 2022, 29892, 306, 471, 1985, 1432, 2462, 29892, 322, 769, 373, 590, 3841, 1283, 29892, 591, 750, 18093, 385, 3345, 630, 8112, 6219, 357, 29892, 372, 471, 2000, 263, 678, 290, 546, 29889, 1334, 1033, 1192, 591, 1033, 5700, 1192, 591, 1033, 1889, 701, 304, 5320, 322, 263, 4203, 274, 4339, 310, 3974, 6115, 385, 7234, 29889, 13, 3112, 29915, 29879, 599, 3345, 630, 29892, 2924, 310, 29889, 1126, 577, 306, 471, 1985, 363, 405, 370, 943, 408, 263, 3184, 555, 273, 29892, 577, 1235, 29915, 29879, 1827, 29892, 306, 4687, 297, 5490, 29892, 372, 471, 2869, 1434, 393, 29892, 322, 769, 28967, 8112, 373, 590, 3841, 1283, 29889, 5674, 29892, 278, 4837, 5973, 4687, 2805, 15029, 29892, 322, 306, 4687, 2534, 901, 310, 1438, 3546, 16888, 3273, 29879, 29889, 13, 11284, 29892, 769, 29892, 491, 5468, 29892, 5468, 29871, 29896, 29946, 386, 29892, 306, 3512, 304, 1462, 261, 29892, 2041, 1250, 515, 1462, 261, 29892, 472, 29871, 29953, 29901, 29900, 29900, 29892, 322, 306, 471, 2289, 11223, 4319, 29892, 577, 306, 3290, 1623, 373, 278, 6576, 297, 278, 10992, 5716, 393, 5771, 701, 304, 278, 4799, 27122, 272, 5716, 29892, 322, 306, 5714, 1048, 2211, 6199, 29889, 13, 6295, 306, 3512, 304, 278, 13589, 29892, 278, 5780, 5910, 261, 29892, 322, 540, 5304, 714, 322, 471, 1192, 322, 306, 5429, 1075, 306, 471, 17319, 322, 306, 16079, 368, 1033, 679, 304, 278, 13589, 29889, 940, 1497, 29892, 9360, 21915, 29892, 366, 29915, 345, 2355, 263, 20501, 470, 316, 29882, 2941, 29878, 630, 29889, 5674, 29892, 306, 9007, 29915, 29873, 2805, 738, 2253, 29889, 13, 6295, 306, 3512, 304, 4726, 322, 896, 1192, 1951, 769, 896, 29915, 345, 2309, 263, 14928, 310, 6724, 373, 592, 322, 896, 1192, 896, 29915, 345, 1476, 714, 1090, 484, 493, 590, 17294, 1244, 29892, 988, 306, 2355, 7124, 373, 278, 2343, 29892, 306, 29915, 345, 2355, 263, 4802, 12042, 701, 727, 29892, 372, 11826, 590, 17294, 1623, 373, 590, 17294, 20805, 322, 8581, 6426, 2326, 18658, 304, 988, 727, 29915, 29879, 4828, 297, 727, 29889, 13, 2855, 306, 505, 1192, 988, 596, 17294, 301, 1036, 297, 727, 29892, 306, 505, 9200, 371, 1503 ]
1,333,675
13,312
CommonCrawl
4
1
in my brain. So when I work at a consistent basis, it causes these electrical shorts to get more active. And so they were supposed to do surgery on me on March 13 and 15th. DON CALLAWAY: Of this year? GARY ZIMMERMAN: Yeah. But right before the -- I was ready to go, you know, if you guys think you can do something for me, you don't have to explain it, just do it. You know. And so anyway, the insurance company calls me up and they go, well, we want to have another opinion. Well, we've already had about 10 of them. And so then I was a little bit upset about that at first, but then I talked to this other workmen's comp lady friend of mine, Tammy Lindsey, who is an expert. She said, no, this is a good thing. And she looked to where they was going to send me to a place in Portland and another place in Seattle to have another -- another -- DON CALLAWAY: Another workup. GARY ZIMMERMAN: Another workup. There you go. So right now, I'm just -- my two neurologists, my inner ear guy, and Dr. Lord, who used to be in Seward, they just say they -- just be as active as you can be and we'll work on it. So I says, well, does that include riding my snowmobile? And they go, yeah. But he says, if you go riding for two days, then you need to take two days off. And so riding my snowmobile and ice fishing and waiting to be healed. Yeah. That's what I'm doing now. Yeah. So when they don't let us go riding snowmobiles, then I'll have to go out here in the Gulf of Alaska and chase halibut. KAREN BREWSTER: So when does the snow machine season end for getting up on the ice field? GARY ZIMMERMAN: Well -- KAREN BREWSTER: -- on average. I'm sure it varies from year to year. GARY ZIMMERMAN: Well, I think this year you can go up there until May 15th. You know, it depends how fast -- well, it depends if the Park Service gets picky. Because if they open up that road and then we can park up there by the turn around by the bridge, well, that would extend it a long ways. But do they want you sitting there? I don't know. We'll have to find out. But I'd say, you know, May 1st is what the Forest Service says for Lost Lake unless we have extreme amount of snow. And that's not going to be this year. That trail's pretty thin right now. But you know, and when you walk up the trail, it looks bad, like at Lost Lake, but if you was to walk up there in the summer, the mud and stuff that you see on Lost Lake Trail is actually sitting on a big rock anyway, so it isn't like you're ruining out causing -- KAREN BREWSTER: But going up to Exit Glacier you're on the river and then up that valley. GARY ZIMMERMAN: Up the valley. But see, this valley is all full of snow. KAREN BREWSTER: Right. GARY ZIMMERMAN: So you can go around. There's -- there's one, there's one creek crossing about here, right where this line is, and that creek's real shallow, so you can go in and out of that creek. And this other creek crossing, we don't even go through that. We drive around through the woods, through -- we -- we just zigzag through the trails and went around this loop here, it's about a mile detour. So yeah, May 1st, you know, I would say. You know. RACHEL MASON: Why do you not go on that, that creek crossing? GARY ZIMMERMAN: Well, because it's a nice spot, but when you go cross the creek, the bank's real steep, and then you've got to make -- right when you go up the bank, it's maybe 6 foot high, then you've got to make an immediate left because there's
-1.350069
-1.203591
-1.121912
-1.325013
[ -1.4815583127161733, -1.2185806303484112 ]
[ -1.3450508784124853, -1.0621315625655499 ]
[ -1.279158663700314, -0.9646647765526648 ]
[ -1.2755868118928533, -1.374438882086463 ]
1,024
[ 512, 512 ]
[ 297, 590, 17294, 29889, 1105, 746, 306, 664, 472, 263, 13747, 8405, 29892, 372, 9946, 1438, 3546, 16888, 3273, 29879, 304, 679, 901, 6136, 29889, 13, 2855, 577, 896, 892, 7424, 304, 437, 25300, 708, 373, 592, 373, 4779, 29871, 29896, 29941, 322, 29871, 29896, 29945, 386, 29889, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 4587, 445, 1629, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 1205, 1492, 1434, 278, 1192, 306, 471, 7960, 304, 748, 29892, 366, 1073, 29892, 565, 366, 18239, 1348, 366, 508, 437, 1554, 363, 592, 29892, 366, 1016, 29915, 29873, 505, 304, 5649, 372, 29892, 925, 437, 372, 29889, 887, 1073, 29889, 13, 2855, 577, 8763, 29892, 278, 1663, 18541, 5001, 5717, 592, 701, 322, 896, 748, 29892, 1532, 29892, 591, 864, 304, 505, 1790, 9426, 29889, 5674, 29892, 591, 29915, 345, 2307, 750, 1048, 29871, 29896, 29900, 310, 963, 29889, 13, 2855, 577, 769, 306, 471, 263, 2217, 2586, 24081, 300, 1048, 393, 472, 937, 29892, 541, 769, 306, 24867, 304, 445, 916, 664, 1527, 29915, 29879, 752, 11379, 5121, 310, 7903, 29892, 16939, 1357, 17277, 7759, 29892, 1058, 338, 385, 17924, 29889, 13, 13468, 1497, 29892, 694, 29892, 445, 338, 263, 1781, 2655, 29889, 1126, 1183, 5148, 304, 988, 896, 471, 2675, 304, 3638, 592, 304, 263, 2058, 297, 3371, 1049, 322, 1790, 2058, 297, 27689, 304, 505, 1790, 1192, 1790, 1192, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 7280, 664, 786, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 7280, 664, 786, 29889, 1670, 366, 748, 29889, 13, 6295, 1492, 1286, 29892, 306, 29915, 29885, 925, 1192, 590, 1023, 452, 2192, 1188, 2879, 29892, 590, 6426, 2326, 1410, 29891, 29892, 322, 4942, 29889, 6171, 29892, 1058, 1304, 304, 367, 297, 317, 809, 538, 29892, 896, 925, 1827, 896, 1192, 925, 367, 408, 6136, 408, 366, 508, 367, 322, 591, 29915, 645, 664, 373, 372, 29889, 13, 6295, 306, 4083, 29892, 1532, 29892, 947, 393, 3160, 364, 4821, 590, 15007, 16769, 29973, 1126, 896, 748, 29892, 21915, 29889, 13, 6246, 540, 4083, 29892, 565, 366, 748, 364, 4821, 363, 1023, 3841, 29892, 769, 366, 817, 304, 2125, 1023, 3841, 1283, 29889, 13, 2855, 577, 364, 4821, 590, 15007, 16769, 322, 14890, 9427, 292, 322, 10534, 304, 367, 540, 7943, 29889, 15011, 29889, 2193, 29915, 29879, 825, 306, 29915, 29885, 2599, 1286, 29889, 15011, 29889, 13, 6295, 746, 896, 1016, 29915, 29873, 1235, 502, 748, 364, 4821, 15007, 29885, 711, 5475, 29892, 769, 306, 29915, 645, 505, 304, 748, 714, 1244, 297, 278, 402, 16302, 310, 838, 16191, 322, 521, 559, 8870, 747, 329, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1105, 746, 947, 278, 15007, 4933, 4259, 1095, 363, 2805, 701, 373, 278, 14890, 1746, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 5674, 1192, 476, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1192, 373, 6588, 29889, 306, 29915, 29885, 1854, 372, 722, 583, 515, 1629, 304, 1629, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 5674, 29892, 306, 1348, 445, 1629, 366, 508, 748, 701, 727, 2745, 2610, 29871, 29896, 29945, 386, 29889, 887, 1073, 29892, 372, 7111, 920, 5172, 1192, 1532, 29892, 372, 7111, 565, 278, 4815, 6692, 4947, 5839, 29891, 29889, 13, 29933, 5658, 565, 896, 1722, 701, 393, 6520, 322, 769, 591, 508, 14089, 701, 727, 491, 278, 2507, 2820, 491, 278, 12945, 29892, 1532, 29892, 393, 723, 10985, 372, 263, 1472, 5837, 29889, 13, 6246, 437, 896, 864, 366, 16246, 727, 29973, 306, 1016, 29915, 29873, 1073, 29889, 1334, 29915, 645, 505, 304, 1284, 714, 29889, 13, 6246, 306, 29915, 29881, 1827, 29892, 366, 1073, 29892, 2610, 29871, 29896, 303, 338, 825, 278, 17300, 6692, 4083, 363, 25133, 9459, 6521, 591, 505, 18677, 5253, 310, 15007, 29889, 13, 2855, 393, 29915, 29879, 451, 2675, 304, 367, 445, 1629, 29889, 2193, 26203, 29915, 29879, 5051, 16835, 1492, 1286, 29889, 1205, 366, 1073, 29892, 322, 746, 366, 6686, 701, 278, 26203, 29892, 372, 3430, 4319, 29892, 763, 472, 25133, 9459, 29892, 541, 565, 366, 471, 304, 6686, 701, 727, 297, 278, 11801, 29892, 278, 17439, 322, 6433, 393, 366, 1074, 373, 25133, 9459, 3201, 309, 338, 2869, 16246, 373, 263, 4802, 7679, 8763, 29892, 577, 372, 3508, 29915, 29873, 763, 366, 29915, 276, 5796, 2827, 714, 10805, 1192, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1205, 2675, 701, 304, 25954, 19798, 13241, 366, 29915, 276, 373, 278, 8580, 322, 769, 701, 393, 19599, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 5020, 278, 19599, 29889, 1205, 1074, 29892, 445, 19599, 338, 599, 2989, 310, 15007, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 10428, 29889, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 1105, 366, 508, 748, 2820, 29889, 13, 8439, 29915, 29879, 1192, 727, 29915, 29879, 697, 29892, 727, 29915, 29879, 697, 907, 1416, 24067, 1048, 1244, 29892, 1492, 988, 445, 1196, 338, 29892, 322, 393, 907, 1416, 29915, 29879, 1855, 4091, 340, 29892, 577, 366, 508, 748, 297, 322, 714, 310, 393, 907, 1416, 29889, 13, 2855, 445, 916, 907, 1416, 24067, 29892, 591, 1016, 29915, 29873, 1584, 748, 1549, 393, 29889, 1334, 7899, 2820, 1549, 278, 25013, 29892, 1549, 1192, 591, 1192, 591, 925, 503, 335, 29920, 351, 1549, 278, 1020, 2719, 322, 3512, 2820, 445, 2425, 1244, 29892, 372, 29915, 29879, 1048, 263, 17967, 1439, 473, 29889, 13, 6295, 21915, 29892, 2610, 29871, 29896, 303, 29892, 366, 1073, 29892, 306, 723, 1827, 29889, 887, 1073, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 3750, 437, 366, 451, 748, 373, 393, 29892, 393, 907, 1416, 24067, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 5674, 29892, 1363, 372, 29915, 29879, 263, 7575, 9758, 29892, 541, 746, 366, 748, 4891, 278, 907, 1416, 29892, 278, 9124, 29915, 29879, 1855, 1886, 1022, 29892, 322, 769, 366, 29915, 345, 2355, 304, 1207, 1192, 1492, 746, 366, 748, 701, 278, 9124, 29892, 372, 29915, 29879, 5505, 29871, 29953, 3661, 1880, 29892, 769, 366, 29915, 345, 2355, 304, 1207, 385, 16800, 2175, 1363, 727, 29915, 29879 ]
1,333,675
14,336
CommonCrawl
4
1
a rock there. So if you got all ambitious or something where you got bounced wrong and you pinned it, you could slam into that rock and cause, you know, physical damage or damage to the sled. But now, if you -- we haven't been doing it, but when you come back down, you could go shooting across it because it's real easy. But you know, I mean, I'm anti-water, so I just prefer to go through the woods, even though it takes longer. KAREN BREWSTER: Do you have problems with overflow on any of your routes? GARY ZIMMERMAN: No. No overflow. That's mainly a lake issue. Yeah. Like Bear Lake is real bad for overflow. Carter Lake -- not Carter Lake, but Crescent Lake is up there at Mile 30 is real bad for overflow. Trail Lake, another real bad one. Yeah. I don't like the overflow. That's just bad news. RACHEL MASON: Has that overflow situation changed over the years? Is it more -- is it more of a problem now than it used to be? GARY ZIMMERMAN: I think Bear Lake -- well, this year they had -- they didn't have overflow, but there was so much rain, they had a bunch of rain on the lake, so that was an issue. But no, I -- I don't really see any change in that. There's a -- if you go up Snug Harbor Road, and I don't know what the name of that lake is where that dam's at, that lake is a real bad lake for overflow and I don't know why. But, you know, we just stay completely away from that area. KAREN BREWSTER: Now, what about all the years you've been going up on the ice field and you've looked at Exit Glacier, have you seen the glacier changing? GARY ZIMMERMAN: You know -- you know, boy. If you look at my 1970 pictures when we were playing up there with the snow machines, you know -- you know, I don't know, that's -- I might not be a good one to ask there. I think those signs are pretty funky, myself. To say the glacier was here in 1970 or '60, and I'm going, well, I don't think so. I don't think it was much farther than where it is right now. But I -- I'd definitely tell you it's changed because I know this wall of ice has changed big time, and I know Exit Glacier has changed. I think it's easier now than what it was. I think the crevasses were wider and deeper, and I think the pictures that I have, you know, would show you that. But it has definitely receded. Has it receded as much as the signs? I don't know. I think that's a tourist thing. You know, I mean, that would be good. The glacier was here in 1970s. Well, no, wrong, I don't think it was there. But you know, yeah, it's definitely receded, though. KAREN BREWSTER: You guys never snow machined actually on Exit Glacier? GARY ZIMMERMAN: No, we didn't have enough horsepower. Yeah, you have a 20 horse Scorpion, that's all, you ain't going far. KAREN BREWSTER: And now you can go -- GARY ZIMMERMAN: Oh, I can go right up through there. KAREN BREWSTER: Up the glacier. GARY ZIMMERMAN: Oh, yeah. I could go up there this morning. I could go up there this afternoon and give you a thrill. I'd just blow -- I'd just blow right up through there. I mean, it'd just be -- KAREN BREWSTER: So there's enough snow it fills in the crevasses? GARY ZIMMERMAN: Yeah. I mean, you want to stay on the ridge, too, especially when I've seen that guy on that snowshoe. If you snowshoe up in there, I will take my snowmobile. You know. KAREN BREWSTER: So can you put on the map where you would go? GARY ZIMMERMAN:
-1.292543
-0.520914
-1.028071
-1.335418
[ -1.448686102420203, -1.1364001046084855 ]
[ -0.6198463029820493, -0.4219818447473254 ]
[ -1.03314328423804, -1.022998320136503 ]
[ -1.395249844232486, -1.2755868118928533 ]
1,024
[ 512, 512 ]
[ 263, 7679, 727, 29889, 13, 6295, 565, 366, 2355, 599, 626, 2966, 2738, 470, 1554, 988, 366, 2355, 289, 20979, 2743, 322, 366, 282, 27464, 372, 29892, 366, 1033, 2243, 314, 964, 393, 7679, 322, 4556, 29892, 366, 1073, 29892, 9128, 18658, 470, 18658, 304, 278, 269, 839, 29889, 13, 6246, 1286, 29892, 565, 366, 1192, 591, 7359, 29915, 29873, 1063, 2599, 372, 29892, 541, 746, 366, 2041, 1250, 1623, 29892, 366, 1033, 748, 27904, 4822, 372, 1363, 372, 29915, 29879, 1855, 4780, 29889, 1205, 366, 1073, 29892, 306, 2099, 29892, 306, 29915, 29885, 9418, 29899, 13405, 29892, 577, 306, 925, 5821, 304, 748, 1549, 278, 25013, 29892, 1584, 2466, 372, 4893, 5520, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1938, 366, 505, 4828, 411, 11969, 373, 738, 310, 596, 12049, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 1939, 29889, 1939, 11969, 29889, 2193, 29915, 29879, 14364, 263, 19437, 2228, 29889, 15011, 29889, 8502, 23606, 9459, 338, 1855, 4319, 363, 11969, 29889, 13, 29907, 4254, 9459, 1192, 451, 22264, 9459, 29892, 541, 315, 690, 1760, 9459, 338, 701, 727, 472, 341, 488, 29871, 29941, 29900, 338, 1855, 4319, 363, 11969, 29889, 13, 5323, 309, 9459, 29892, 1790, 1855, 4319, 697, 29889, 15011, 29889, 306, 1016, 29915, 29873, 763, 278, 11969, 29889, 2193, 29915, 29879, 925, 4319, 9763, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 11699, 393, 11969, 6434, 3939, 975, 278, 2440, 29973, 1317, 372, 901, 1192, 338, 372, 901, 310, 263, 1108, 1286, 1135, 372, 1304, 304, 367, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 306, 1348, 23606, 9459, 1192, 1532, 29892, 445, 1629, 896, 750, 1192, 896, 3282, 29915, 29873, 505, 11969, 29892, 541, 727, 471, 577, 1568, 17251, 29892, 896, 750, 263, 14928, 310, 17251, 373, 278, 19437, 29892, 577, 393, 471, 385, 2228, 29889, 13, 6246, 694, 29892, 306, 1192, 306, 1016, 29915, 29873, 2289, 1074, 738, 1735, 297, 393, 29889, 1670, 29915, 29879, 263, 1192, 565, 366, 748, 701, 22639, 688, 3536, 4089, 9321, 29892, 322, 306, 1016, 29915, 29873, 1073, 825, 278, 1024, 310, 393, 19437, 338, 988, 393, 5625, 29915, 29879, 472, 29892, 393, 19437, 338, 263, 1855, 4319, 19437, 363, 11969, 322, 306, 1016, 29915, 29873, 1073, 2020, 29889, 13, 6246, 29892, 366, 1073, 29892, 591, 925, 7952, 6446, 3448, 515, 393, 4038, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 2567, 29892, 825, 1048, 599, 278, 2440, 366, 29915, 345, 1063, 2675, 701, 373, 278, 14890, 1746, 322, 366, 29915, 345, 5148, 472, 25954, 19798, 13241, 29892, 505, 366, 3595, 278, 14751, 13241, 6480, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 887, 1073, 1192, 366, 1073, 29892, 8023, 29889, 960, 366, 1106, 472, 590, 29871, 29896, 29929, 29955, 29900, 14956, 746, 591, 892, 8743, 701, 727, 411, 278, 15007, 14884, 29892, 366, 1073, 1192, 366, 1073, 29892, 306, 1016, 29915, 29873, 1073, 29892, 393, 29915, 29879, 1192, 306, 1795, 451, 367, 263, 1781, 697, 304, 2244, 727, 29889, 13, 29902, 1348, 1906, 18906, 526, 5051, 2090, 3459, 29892, 6142, 29889, 1763, 1827, 278, 14751, 13241, 471, 1244, 297, 29871, 29896, 29929, 29955, 29900, 470, 525, 29953, 29900, 29892, 322, 306, 29915, 29885, 2675, 29892, 1532, 29892, 306, 1016, 29915, 29873, 1348, 577, 29889, 306, 1016, 29915, 29873, 1348, 372, 471, 1568, 26645, 1135, 988, 372, 338, 1492, 1286, 29889, 13, 6246, 306, 1192, 306, 29915, 29881, 11630, 2649, 366, 372, 29915, 29879, 3939, 1363, 306, 1073, 445, 10090, 310, 14890, 756, 3939, 4802, 931, 29892, 322, 306, 1073, 25954, 19798, 13241, 756, 3939, 29889, 306, 1348, 372, 29915, 29879, 6775, 1286, 1135, 825, 372, 471, 29889, 306, 1348, 278, 907, 29894, 465, 267, 892, 25734, 322, 25871, 29892, 322, 306, 1348, 278, 14956, 393, 306, 505, 29892, 366, 1073, 29892, 723, 1510, 366, 393, 29889, 13, 6246, 372, 756, 11630, 337, 1133, 287, 29889, 11699, 372, 337, 1133, 287, 408, 1568, 408, 278, 18906, 29973, 306, 1016, 29915, 29873, 1073, 29889, 306, 1348, 393, 29915, 29879, 263, 6282, 391, 2655, 29889, 13, 3492, 1073, 29892, 306, 2099, 29892, 393, 723, 367, 1781, 29889, 450, 14751, 13241, 471, 1244, 297, 29871, 29896, 29929, 29955, 29900, 29879, 29889, 5674, 29892, 694, 29892, 2743, 29892, 306, 1016, 29915, 29873, 1348, 372, 471, 727, 29889, 1205, 366, 1073, 29892, 21915, 29892, 372, 29915, 29879, 11630, 337, 1133, 287, 29892, 2466, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 887, 18239, 2360, 15007, 7672, 1312, 2869, 373, 25954, 19798, 13241, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 1939, 29892, 591, 3282, 29915, 29873, 505, 3307, 10435, 13519, 29889, 15011, 29892, 366, 505, 263, 29871, 29906, 29900, 10435, 2522, 26423, 291, 29892, 393, 29915, 29879, 599, 29892, 366, 7216, 29915, 29873, 2675, 2215, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1126, 1286, 366, 508, 748, 1192, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 6439, 29892, 306, 508, 748, 1492, 701, 1549, 727, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 5020, 278, 14751, 13241, 29889, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 6439, 29892, 21915, 29889, 306, 1033, 748, 701, 727, 445, 7250, 29889, 306, 1033, 748, 701, 727, 445, 17724, 322, 2367, 366, 263, 1468, 453, 29889, 306, 29915, 29881, 925, 13031, 1192, 306, 29915, 29881, 925, 13031, 1492, 701, 1549, 727, 29889, 306, 2099, 29892, 372, 29915, 29881, 925, 367, 1192, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1105, 727, 29915, 29879, 3307, 15007, 372, 27793, 297, 278, 907, 29894, 465, 267, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 306, 2099, 29892, 366, 864, 304, 7952, 373, 278, 364, 5525, 29892, 2086, 29892, 7148, 746, 306, 29915, 345, 3595, 393, 1410, 29891, 373, 393, 15007, 845, 7297, 29889, 960, 366, 15007, 845, 7297, 701, 297, 727, 29892, 306, 674, 2125, 590, 15007, 16769, 29889, 887, 1073, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1105, 508, 366, 1925, 373, 278, 2910, 988, 366, 723, 748, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901 ]
1,333,675
15,360
CommonCrawl
4
1
Well, no, this -- this ain't detailed enough. But you would -- you would have to -- well, right here, you just go right up to where I seen that snow -- that snowshoer, looked like he came up partway, and then he went this way, and then, of course, his tracks get out of sight. KAREN BREWSTER: Right. GARY ZIMMERMAN: But that would not -- if they said -- but, you know, there's -- there's two ways to look at this, going up Exit Glacier. If -- if one person seeing my track go up there, you know, then do I want you riding a sled up there? I'm not sure. You know, I'm not trying to say that I'm better than anybody else, but I know I have lots of experience. So would I want an inexperienced crowd trying to drive up Exit Glacier to get on the ice field? You know, well, if I was going to be honest with myself, I'd say no. Unless, you know, I just -- but, like, from my group or -- or a Seward guy, yeah, I'd say go for it. Because you can ride that ridge. It's like going up Trail Glacier out at Moose Pass. You go up to Hunter, up where the tracks are at, if you take a right at Hunter and you go up to Trail Glacier, you go up there and you go -- you got to go straight on that ridge. And I mean on the ridge. I mean, don't you be going 50 yards to the right and the left because alls you've got to do is fly that glacier in the summer and you'll see why you stay on the ridge. And it's very tempting because you're going up the ridge, it's a long glacier to get up into Upper Paradise, but you look at them big fields out there and all them crevasses are closed, yeah, I'm not going out there. That's why this summer I'm going to fly this ice field with Steve Schafer or somebody, and I just want to see if them expansion cracks come back, see if, you know, the winter thing just fooled me. KAREN BREWSTER: Well yeah, to me, looking at it, standing at the bottom of Exit Glacier, you know, in the summer, imagining that somebody could get up that by snow machine is pretty phenomenal. GARY ZIMMERMAN: Yeah. Well, I -- KAREN BREWSTER: Because you look at it and you go, I don't see how that's possible, but I've never seen it in the winter. GARY ZIMMERMAN: Well, if she gives me permission, I'll go up this afternoon and I'll show you how it's done. SHANNON KOVAK: It's not up to me. KAREN BREWSTER: But, yeah, it looks like it would be pretty treacherous. GARY ZIMMERMAN: Yeah. You need a -- you need a high horsepower rig, you know, you need at least, you know, an M8, and all. I mean, because -- well, once the guy makes a track and goes up through there and then you come back on the track, well, that's -- you've got yourself a road. KAREN BREWSTER: Yeah. GARY ZIMMERMAN: You know. KAREN BREWSTER: And everybody's going to follow it. GARY ZIMMERMAN: Yeah. And that's -- and that's -- you know, and for me to even suggest, you know, that you shouldn't ride on that glacier, you know, I feel that you're trampling on people's rights. You know. DON CALLAWAY: But for safety reasons. GARY ZIMMERMAN: For safety reasons, you know. And then, you know, and how are you going to sit there and tell, yeah, Warren, you can go; or Phil, go ahead; yeah, Gary, knock yourself out. And then let's say you get some people down from Anchorage and say, no, you can't go. Well, you know, heck, they might even be better riders than us. DON CALLAWAY: Well, but -- GARY Z
-1.043262
-1.130175
-1.038216
-1.202748
[ -1.0651769823005501, -1.0213473685725898 ]
[ -1.0907816198665052, -1.1695692774441329 ]
[ -0.9545198124511277, -1.1219117201264894 ]
[ -1.0986936336516573, -1.306803255111888 ]
1,024
[ 512, 512 ]
[ 5674, 29892, 694, 29892, 445, 1192, 445, 7216, 29915, 29873, 13173, 3307, 29889, 1205, 366, 723, 1192, 366, 723, 505, 304, 1192, 1532, 29892, 1492, 1244, 29892, 366, 925, 748, 1492, 701, 304, 988, 306, 3595, 393, 15007, 1192, 393, 15007, 845, 29877, 261, 29892, 5148, 763, 540, 2996, 701, 760, 1582, 29892, 322, 769, 540, 3512, 445, 982, 29892, 322, 769, 29892, 310, 3236, 29892, 670, 16257, 679, 714, 310, 11126, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 10428, 29889, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 1205, 393, 723, 451, 1192, 565, 896, 1497, 1192, 541, 29892, 366, 1073, 29892, 727, 29915, 29879, 1192, 727, 29915, 29879, 1023, 5837, 304, 1106, 472, 445, 29892, 2675, 701, 25954, 19798, 13241, 29889, 13, 3644, 1192, 565, 697, 2022, 8790, 590, 5702, 748, 701, 727, 29892, 366, 1073, 29892, 769, 437, 306, 864, 366, 364, 4821, 263, 269, 839, 701, 727, 29973, 306, 29915, 29885, 451, 1854, 29889, 13, 3492, 1073, 29892, 306, 29915, 29885, 451, 1811, 304, 1827, 393, 306, 29915, 29885, 2253, 1135, 16357, 1683, 29892, 541, 306, 1073, 306, 505, 14568, 310, 7271, 29889, 1105, 723, 306, 864, 385, 297, 735, 546, 819, 1133, 19174, 1811, 304, 7899, 701, 25954, 19798, 13241, 304, 679, 373, 278, 14890, 1746, 29973, 13, 3492, 1073, 29892, 1532, 29892, 565, 306, 471, 2675, 304, 367, 15993, 411, 6142, 29892, 306, 29915, 29881, 1827, 694, 29889, 25870, 29892, 366, 1073, 29892, 306, 925, 1192, 541, 29892, 763, 29892, 515, 590, 2318, 470, 1192, 470, 263, 317, 809, 538, 1410, 29891, 29892, 21915, 29892, 306, 29915, 29881, 1827, 748, 363, 372, 29889, 13, 29933, 5658, 366, 508, 22203, 393, 364, 5525, 29889, 739, 29915, 29879, 763, 2675, 701, 3201, 309, 19798, 13241, 714, 472, 4546, 852, 6978, 29889, 13, 3492, 748, 701, 304, 25703, 29892, 701, 988, 278, 16257, 526, 472, 29892, 565, 366, 2125, 263, 1492, 472, 25703, 322, 366, 748, 701, 304, 3201, 309, 19798, 13241, 29892, 366, 748, 701, 727, 322, 366, 748, 1192, 366, 2355, 304, 748, 7812, 373, 393, 364, 5525, 29889, 13, 2855, 306, 2099, 373, 278, 364, 5525, 29889, 306, 2099, 29892, 1016, 29915, 29873, 366, 367, 2675, 29871, 29945, 29900, 17454, 304, 278, 1492, 322, 278, 2175, 1363, 599, 29879, 366, 29915, 345, 2355, 304, 437, 338, 11340, 393, 14751, 13241, 297, 278, 11801, 322, 366, 29915, 645, 1074, 2020, 366, 7952, 373, 278, 364, 5525, 29889, 13, 2855, 372, 29915, 29879, 1407, 25782, 292, 1363, 366, 29915, 276, 2675, 701, 278, 364, 5525, 29892, 372, 29915, 29879, 263, 1472, 14751, 13241, 304, 679, 701, 964, 24929, 24829, 895, 29892, 541, 366, 1106, 472, 963, 4802, 4235, 714, 727, 322, 599, 963, 907, 29894, 465, 267, 526, 5764, 29892, 21915, 29892, 306, 29915, 29885, 451, 2675, 714, 727, 29889, 13, 7058, 29915, 29879, 2020, 445, 11801, 306, 29915, 29885, 2675, 304, 11340, 445, 14890, 1746, 411, 13981, 1102, 29874, 571, 470, 18462, 29892, 322, 306, 925, 864, 304, 1074, 565, 963, 13184, 12220, 4684, 2041, 1250, 29892, 1074, 565, 29892, 366, 1073, 29892, 278, 13851, 2655, 925, 7953, 839, 592, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 5674, 21915, 29892, 304, 592, 29892, 3063, 472, 372, 29892, 13407, 472, 278, 5970, 310, 25954, 19798, 13241, 29892, 366, 1073, 29892, 297, 278, 11801, 29892, 6382, 2827, 393, 18462, 1033, 679, 701, 393, 491, 15007, 4933, 338, 5051, 27791, 284, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 5674, 29892, 306, 1192, 476, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 7311, 366, 1106, 472, 372, 322, 366, 748, 29892, 306, 1016, 29915, 29873, 1074, 920, 393, 29915, 29879, 1950, 29892, 541, 306, 29915, 345, 2360, 3595, 372, 297, 278, 13851, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 5674, 29892, 565, 1183, 4076, 592, 10751, 29892, 306, 29915, 645, 748, 701, 445, 17724, 322, 306, 29915, 645, 1510, 366, 920, 372, 29915, 29879, 2309, 29889, 13, 7068, 2190, 29940, 1164, 476, 29949, 20449, 29968, 29901, 739, 29915, 29879, 451, 701, 304, 592, 29889, 476, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1205, 29892, 21915, 29892, 372, 3430, 763, 372, 723, 367, 5051, 2578, 11665, 681, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 887, 817, 263, 1192, 366, 817, 263, 1880, 10435, 13519, 12912, 29892, 366, 1073, 29892, 366, 817, 472, 3203, 29892, 366, 1073, 29892, 385, 341, 29947, 29892, 322, 599, 29889, 306, 2099, 29892, 1363, 1192, 1532, 29892, 2748, 278, 1410, 29891, 3732, 263, 5702, 322, 5771, 701, 1549, 727, 322, 769, 366, 2041, 1250, 373, 278, 5702, 29892, 1532, 29892, 393, 29915, 29879, 1192, 366, 29915, 345, 2355, 7535, 263, 6520, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 15011, 29889, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 887, 1073, 29889, 476, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1126, 26077, 29915, 29879, 2675, 304, 1101, 372, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 1126, 393, 29915, 29879, 1192, 322, 393, 29915, 29879, 1192, 366, 1073, 29892, 322, 363, 592, 304, 1584, 4368, 29892, 366, 1073, 29892, 393, 366, 9273, 29915, 29873, 22203, 373, 393, 14751, 13241, 29892, 366, 1073, 29892, 306, 4459, 393, 366, 29915, 276, 19183, 10335, 373, 2305, 29915, 29879, 10462, 29889, 887, 1073, 29889, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 1205, 363, 15332, 9590, 29889, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 1152, 15332, 9590, 29892, 366, 1073, 29889, 13, 2855, 769, 29892, 366, 1073, 29892, 322, 920, 526, 366, 2675, 304, 7845, 727, 322, 2649, 29892, 21915, 29892, 24511, 29892, 366, 508, 748, 29936, 470, 5241, 29892, 748, 14432, 29936, 21915, 29892, 23529, 29892, 18232, 7535, 714, 29889, 13, 2855, 769, 1235, 29915, 29879, 1827, 366, 679, 777, 2305, 1623, 515, 530, 305, 6022, 322, 1827, 29892, 694, 29892, 366, 508, 29915, 29873, 748, 29889, 5674, 29892, 366, 1073, 29892, 540, 384, 29892, 896, 1795, 1584, 367, 2253, 8177, 414, 1135, 502, 29889, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 5674, 29892, 541, 1192, 402, 19926, 796 ]
1,333,675
16,384
CommonCrawl
4
1
IMMERMAN: Yeah, I wouldn't be afraid to -- RACHEL MASON: Or they might not know anything. GARY ZIMMERMAN: Yeah. And that's the whole point, you know, like on any glacier, you know. It's just like this little valley here, Avalanche Alley. Like when I took my father-in-law up there -- that's our -- our nickname for it. When I took my father-in-law up there, when he flew up here, I told Ray, before he even came up here, there is -- you're not going to pressure me. We're not going up there just because you're here. I don't care if it costs you 500 bucks or a thousand dollars to get here or 10,000 or a hundred thousand, it's -- we are going to go up there and we're going to stop. And we're going to sit there and we're going to look through our lenses and zoom it in, make sure all that stuff's avalanched out because you get a foot, you want that snow on the bottom of the hill. You know. RACHEL MASON: When did your father-in-law come up here? GARY ZIMMERMAN: Oh, it was like last -- well, he just -- he just went home yesterday. So he's been here since Tuesday. RACHEL MASON: Oh, okay. GARY ZIMMERMAN: Yeah, Tuesday. I took him up there Wednesday, and then he thought he was going to go riding on Thursday, but that Wednesday's ride was all he could really -- wanted to take. RACHEL MASON: Uh hum. GARY ZIMMERMAN: Yeah. 82 years old. RACHEL MASON: That's cool. GARY ZIMMERMAN: I know. Yeah, it just amazes me. Yeah. RACHEL MASON: Okay. Well, you've told us a whole lot about the glacier and about your experiences. Have -- do you have anything else that you'd like to make sure that we know about? GARY ZIMMERMAN: Well, you know, I know this will be my little political statement, but I think that -- you know, I hope that they don't ever close this to snowmobilers. And I think -- DON CALLAWAY: By "this," you mean here, but also the recreation area, right? GARY ZIMMERMAN: Right. Oh, yeah, that would be horrible. You know, if they -- if they start pulling that maneuver, you know, the people will come out, just like -- they've had other meetings here where they are going to close some area, and people get pretty fired up about it. You know. Like you've got, like, Oscar Watsjold, he just had his birthday, 90 some -- years old, Monty Richardson, those -- those might be two guys you want to talk to. They were -- they were skiing and hiking up through there, you know, in the '50s and '60s. You know, I mean, it should be open to everybody. But the only thing that I would like to see change is everybody that cross country skis across that ice field, they should have to pay a user fee just like the snowmobilers. You know. And I'm serious. Because they charge me $35 bucks a year to register my snowmobile. Okay. If you've got a pair of skis -- and I got two snowmobiles. So that's 70. Dave Hettick, he's got 10 or 12. So look what it costs him for his kids to ride. So if you're a skier, you should have to register your skis and they put the sticker on your skis just like they do my snowmobile. And if you're a hiker, you wear one of those ski pass things like they got at Alyeska. You know, fits on your zipper. Well, I paid my 35 bucks. And move that ski pass from coat to coat. And -- and I think that would be fair. But right now, all the snowmobilers, you know, nationwide are paying their state fee, or whatever it is, to ride in the areas, where
-1.028196
-1.183894
-0.965616
-1.618968
[ -0.7994599490747906, -1.2569315423603764 ]
[ -1.0657128197281693, -1.3020757924610522 ]
[ -0.636855624021748, -1.2943761098526196 ]
[ -1.618967687302234, -1.618967687302234 ]
1,024
[ 512, 512 ]
[ 29902, 7428, 1001, 27616, 29901, 15011, 29892, 306, 7656, 29915, 29873, 367, 13421, 304, 1192, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 1394, 896, 1795, 451, 1073, 3099, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 1126, 393, 29915, 29879, 278, 3353, 1298, 29892, 366, 1073, 29892, 763, 373, 738, 14751, 13241, 29892, 366, 1073, 29889, 739, 29915, 29879, 925, 763, 445, 2217, 19599, 1244, 29892, 319, 791, 20372, 838, 2330, 29889, 13, 27552, 746, 306, 3614, 590, 4783, 29899, 262, 29899, 10653, 701, 727, 1192, 393, 29915, 29879, 1749, 1192, 1749, 25985, 978, 363, 372, 29889, 1932, 306, 3614, 590, 4783, 29899, 262, 29899, 10653, 701, 727, 29892, 746, 540, 9115, 29893, 701, 1244, 29892, 306, 5429, 9596, 29892, 1434, 540, 1584, 2996, 701, 1244, 29892, 727, 338, 1192, 366, 29915, 276, 451, 2675, 304, 12959, 592, 29889, 13, 4806, 29915, 276, 451, 2675, 701, 727, 925, 1363, 366, 29915, 276, 1244, 29889, 306, 1016, 29915, 29873, 2562, 565, 372, 21544, 366, 29871, 29945, 29900, 29900, 1321, 4684, 470, 263, 10405, 17208, 304, 679, 1244, 470, 29871, 29896, 29900, 29892, 29900, 29900, 29900, 470, 263, 6893, 10405, 29892, 372, 29915, 29879, 1192, 591, 526, 2675, 304, 748, 701, 727, 322, 591, 29915, 276, 2675, 304, 5040, 29889, 13, 2855, 591, 29915, 276, 2675, 304, 7845, 727, 322, 591, 29915, 276, 2675, 304, 1106, 1549, 1749, 301, 11259, 322, 19342, 372, 297, 29892, 1207, 1854, 599, 393, 6433, 29915, 29879, 263, 791, 14588, 287, 714, 1363, 366, 679, 263, 3661, 29892, 366, 864, 393, 15007, 373, 278, 5970, 310, 278, 17306, 29889, 887, 1073, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 1932, 1258, 596, 4783, 29899, 262, 29899, 10653, 2041, 701, 1244, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 6439, 29892, 372, 471, 763, 1833, 1192, 1532, 29892, 540, 925, 1192, 540, 925, 3512, 3271, 22600, 29889, 1105, 540, 29915, 29879, 1063, 1244, 1951, 323, 1041, 3250, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 6439, 29892, 20759, 29889, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29892, 323, 1041, 3250, 29889, 13, 29902, 3614, 1075, 701, 727, 15050, 4515, 3250, 29892, 322, 769, 540, 2714, 540, 471, 2675, 304, 748, 364, 4821, 373, 498, 1295, 3250, 29892, 541, 393, 15050, 4515, 3250, 29915, 29879, 22203, 471, 599, 540, 1033, 2289, 1192, 5131, 304, 2125, 29889, 390, 2477, 29950, 6670, 14861, 3094, 29901, 501, 29882, 3165, 29889, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 15011, 29889, 29871, 29947, 29906, 2440, 2030, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 2193, 29915, 29879, 12528, 29889, 402, 19926, 796, 29902, 7428, 1001, 27616, 29901, 306, 1073, 29889, 15011, 29892, 372, 925, 21863, 267, 592, 29889, 15011, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 20419, 29889, 5674, 29892, 366, 29915, 345, 5429, 502, 263, 3353, 3287, 1048, 278, 14751, 13241, 322, 1048, 596, 27482, 29889, 13, 25559, 1192, 437, 366, 505, 3099, 1683, 393, 366, 29915, 29881, 763, 304, 1207, 1854, 393, 591, 1073, 1048, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 5674, 29892, 366, 1073, 29892, 306, 1073, 445, 674, 367, 590, 2217, 8604, 3229, 29892, 541, 306, 1348, 393, 1192, 366, 1073, 29892, 306, 4966, 393, 896, 1016, 29915, 29873, 3926, 3802, 445, 304, 15007, 29885, 12213, 414, 29889, 1126, 306, 1348, 1192, 13, 29928, 1164, 315, 1964, 4375, 12982, 29979, 29901, 2648, 376, 1366, 1699, 366, 2099, 1244, 29892, 541, 884, 278, 28709, 362, 4038, 29892, 1492, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 10428, 29889, 6439, 29892, 21915, 29892, 393, 723, 367, 4029, 11710, 29889, 887, 1073, 29892, 565, 896, 1192, 565, 896, 1369, 28420, 393, 767, 12932, 369, 29892, 366, 1073, 29892, 278, 2305, 674, 2041, 714, 29892, 925, 763, 1192, 896, 29915, 345, 750, 916, 5870, 886, 1244, 988, 896, 526, 2675, 304, 3802, 777, 4038, 29892, 322, 2305, 679, 5051, 17285, 701, 1048, 372, 29889, 887, 1073, 29889, 13, 27552, 366, 29915, 345, 2355, 29892, 763, 29892, 19054, 399, 1446, 29926, 1025, 29892, 540, 925, 750, 670, 12060, 3250, 29892, 29871, 29929, 29900, 777, 1192, 2440, 2030, 29892, 4526, 29891, 6123, 1100, 29892, 1906, 1192, 1906, 1795, 367, 1023, 18239, 366, 864, 304, 5193, 304, 29889, 2688, 892, 1192, 896, 892, 14993, 292, 322, 298, 638, 292, 701, 1549, 727, 29892, 366, 1073, 29892, 297, 278, 525, 29945, 29900, 29879, 322, 525, 29953, 29900, 29879, 29889, 13, 3492, 1073, 29892, 306, 2099, 29892, 372, 881, 367, 1722, 304, 26077, 29889, 1205, 278, 871, 2655, 393, 306, 723, 763, 304, 1074, 1735, 338, 26077, 393, 4891, 4234, 2071, 275, 4822, 393, 14890, 1746, 29892, 896, 881, 505, 304, 5146, 263, 1404, 27684, 925, 763, 278, 15007, 29885, 12213, 414, 29889, 13, 3492, 1073, 29889, 1126, 306, 29915, 29885, 10676, 29889, 7311, 896, 8323, 592, 395, 29941, 29945, 1321, 4684, 263, 1629, 304, 6036, 590, 15007, 16769, 29889, 20419, 29889, 960, 366, 29915, 345, 2355, 263, 5101, 310, 2071, 275, 1192, 322, 306, 2355, 1023, 15007, 29885, 711, 5475, 29889, 13, 6295, 393, 29915, 29879, 29871, 29955, 29900, 29889, 17841, 379, 1803, 860, 29892, 540, 29915, 29879, 2355, 29871, 29896, 29900, 470, 29871, 29896, 29906, 29889, 1105, 1106, 825, 372, 21544, 1075, 363, 670, 413, 4841, 304, 22203, 29889, 13, 6295, 565, 366, 29915, 276, 263, 2071, 631, 29892, 366, 881, 505, 304, 6036, 596, 2071, 275, 322, 896, 1925, 278, 380, 6541, 373, 596, 2071, 275, 925, 763, 896, 437, 590, 15007, 16769, 29889, 13, 2855, 565, 366, 29915, 276, 263, 298, 5603, 29892, 366, 19531, 697, 310, 1906, 14993, 1209, 2712, 763, 896, 2355, 472, 319, 368, 267, 1335, 29889, 887, 1073, 29892, 23994, 373, 596, 503, 29875, 2496, 29889, 5674, 29892, 306, 12530, 590, 29871, 29941, 29945, 1321, 4684, 29889, 13, 2855, 4337, 393, 14993, 1209, 515, 24296, 304, 24296, 29889, 1126, 1192, 322, 306, 1348, 393, 723, 367, 6534, 29889, 1205, 1492, 1286, 29892, 599, 278, 15007, 29885, 12213, 414, 29892, 366, 1073, 29892, 5233, 8157, 526, 5146, 292, 1009, 2106, 27684, 29892, 470, 6514, 372, 338, 29892, 304, 22203, 297, 278, 10161, 29892, 988 ]
1,333,675
17,408
CommonCrawl
4
1
cross country skiers, snowshoers, dog mushers, and hikers, they don't pay nothing. KAREN BREWSTER: Is that for even on the Exit Glacier Road? GARY ZIMMERMAN: Well, yeah, I think if -- yeah, I think if you're cross country skiing anywhere. KAREN BREWSTER: But for you as a snow machiner, if you just wanted to go on the road, could -- GARY ZIMMERMAN: Oh, yeah. If I take my snowmobile and I take it out to Bear Lake, which is -- I take it on Bear Lake Road, or I take it on a road that's not -- let's go back in the Caribou Hills, that's not a road, that's just old seismograph trails. Okay. I've got to spend 35 bucks to register my snowmobile. And now they've gotten so picky about it, if you buy a new snowmobile, they register them for you right there at the dealer. And, you know, I'm not complaining about 35 bucks because they say, which I think it's to interpretation, that 80 percent of the money or 70 percent of the money for your register fee goes to maintain trails and fix things up is what the original spiel was about 10 years ago when they started doing it in Alaska. But I'm just saying, you're on Lost Lake Trail, and you're a skier, and I have no problem with that. I will stop just about every time to check on your wellbeing. But I want to see a sticker on your skis where you paid 35 bucks. Or let's say, okay, let's say they pay 15 bucks, or it's 5 bucks. But it's one person, so I'm one person on a snowmobile, they charge me 35, I'd like to see them charge everybody 35, and that would actually -- not only I would have a good schnicker off it, but the more money that we would get because not only -- I think they say there's 40,000 snowmobilers in the state of Alaska. So that's 40,000 $35 bills. Well, let's say there's 40,000 skiers. Now, let's take their 35 bucks; and let's say there's a thousand dog mushers, let's get their money; and, you know, your snowshoers and your hikers, if you're going to hike up Lost Lake Trail or, you know -- you know, you see people running up this trail in the winter in their little jogging suits. That's cool, but I want to see that tag that they paid their 35 bucks to use that trail and that will bring in more money to maintain these trails. If it's actually true where 70 or 80 percent of the money goes to work on the trails. You know. And, you know, and as far as, like, search and rescue is one other thing I'd like to mention a little bit. Whenever somebody's lost in the Seward area -- my dad started Bear Creek Fire Department is another thing he did. And we put the search and rescue in out there, my dad did, and my uncle George. Anyway, whenever somebody's lost and a call goes out, there's not a snowmobiler in town that is not out there on the search and rescue. And we don't care if you're a dog musher, a hiker, or whatever. We go look. And you know, and that's one thing that I always like to throw in there. You know, when the -- when the call's out for help, you ain't going to find a better group of people than your snowmobilers to go -- go searching. Yeah. That's pretty much about it. RACHEL MASON: Okay. DON CALLAWAY: Shannon, do you have any questions or anything? SHANNON KOVAK: No, it's like Gary just read my mind. Every question I had, you just addressed it, so, yeah. RACHEL MASON: Okay. You said you've got another question? KAREN BREWSTER: No, we
-1.098049
-0.483087
-0.868724
-1.449879
[ -1.2788463492243567, -0.9172520359686839 ]
[ -0.7720497323933754, -0.19412435777566375 ]
[ -1.1726365406341748, -0.564810527394426 ]
[ -1.395249844232486, -1.504507395499107 ]
1,024
[ 512, 512 ]
[ 4891, 4234, 14993, 414, 29892, 15007, 845, 29877, 414, 29892, 11203, 286, 1878, 414, 29892, 322, 298, 638, 414, 29892, 896, 1016, 29915, 29873, 5146, 3078, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1317, 393, 363, 1584, 373, 278, 25954, 19798, 13241, 9321, 29973, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 5674, 29892, 21915, 29892, 306, 1348, 565, 1192, 21915, 29892, 306, 1348, 565, 366, 29915, 276, 4891, 4234, 14993, 292, 12214, 29889, 13, 29968, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1205, 363, 366, 408, 263, 15007, 7672, 4983, 29892, 565, 366, 925, 5131, 304, 748, 373, 278, 6520, 29892, 1033, 1192, 13, 29954, 19926, 796, 29902, 7428, 1001, 27616, 29901, 6439, 29892, 21915, 29889, 960, 306, 2125, 590, 15007, 16769, 322, 306, 2125, 372, 714, 304, 23606, 9459, 29892, 607, 338, 1192, 306, 2125, 372, 373, 23606, 9459, 9321, 29892, 470, 306, 2125, 372, 373, 263, 6520, 393, 29915, 29879, 451, 1192, 1235, 29915, 29879, 748, 1250, 297, 278, 1704, 747, 283, 24128, 29892, 393, 29915, 29879, 451, 263, 6520, 29892, 393, 29915, 29879, 925, 2030, 409, 1608, 1946, 1020, 2719, 29889, 13, 20434, 388, 29889, 306, 29915, 345, 2355, 304, 18864, 29871, 29941, 29945, 1321, 4684, 304, 6036, 590, 15007, 16769, 29889, 1126, 1286, 896, 29915, 345, 2355, 841, 577, 5839, 29891, 1048, 372, 29892, 565, 366, 15649, 263, 716, 15007, 16769, 29892, 896, 6036, 963, 363, 366, 1492, 727, 472, 278, 5376, 261, 29889, 13, 2855, 29892, 366, 1073, 29892, 306, 29915, 29885, 451, 15313, 2827, 1048, 29871, 29941, 29945, 1321, 4684, 1363, 896, 1827, 29892, 607, 306, 1348, 372, 29915, 29879, 304, 19854, 29892, 393, 29871, 29947, 29900, 10151, 310, 278, 6909, 470, 29871, 29955, 29900, 10151, 310, 278, 6909, 363, 596, 6036, 27684, 5771, 304, 7344, 1020, 2719, 322, 2329, 2712, 701, 338, 825, 278, 2441, 14024, 471, 1048, 29871, 29896, 29900, 2440, 8020, 746, 896, 4687, 2599, 372, 297, 838, 16191, 29889, 13, 6246, 306, 29915, 29885, 925, 5934, 29892, 366, 29915, 276, 373, 25133, 9459, 3201, 309, 29892, 322, 366, 29915, 276, 263, 2071, 631, 29892, 322, 306, 505, 694, 1108, 411, 393, 29889, 306, 674, 5040, 925, 1048, 1432, 931, 304, 1423, 373, 596, 1532, 915, 292, 29889, 13, 6246, 306, 864, 304, 1074, 263, 380, 6541, 373, 596, 2071, 275, 988, 366, 12530, 29871, 29941, 29945, 1321, 4684, 29889, 1394, 1235, 29915, 29879, 1827, 29892, 20759, 29892, 1235, 29915, 29879, 1827, 896, 5146, 29871, 29896, 29945, 1321, 4684, 29892, 470, 372, 29915, 29879, 29871, 29945, 1321, 4684, 29889, 13, 6246, 372, 29915, 29879, 697, 2022, 29892, 577, 306, 29915, 29885, 697, 2022, 373, 263, 15007, 16769, 29892, 896, 8323, 592, 29871, 29941, 29945, 29892, 306, 29915, 29881, 763, 304, 1074, 963, 8323, 26077, 29871, 29941, 29945, 29892, 322, 393, 723, 2869, 1192, 451, 871, 306, 723, 505, 263, 1781, 1364, 29876, 6541, 1283, 372, 29892, 541, 278, 901, 6909, 393, 591, 723, 679, 1363, 451, 871, 1192, 306, 1348, 896, 1827, 727, 29915, 29879, 29871, 29946, 29900, 29892, 29900, 29900, 29900, 15007, 29885, 12213, 414, 297, 278, 2106, 310, 838, 16191, 29889, 13, 6295, 393, 29915, 29879, 29871, 29946, 29900, 29892, 29900, 29900, 29900, 395, 29941, 29945, 289, 6090, 29889, 5674, 29892, 1235, 29915, 29879, 1827, 727, 29915, 29879, 29871, 29946, 29900, 29892, 29900, 29900, 29900, 14993, 414, 29889, 2567, 29892, 1235, 29915, 29879, 2125, 1009, 29871, 29941, 29945, 1321, 4684, 29936, 322, 1235, 29915, 29879, 1827, 727, 29915, 29879, 263, 10405, 11203, 286, 1878, 414, 29892, 1235, 29915, 29879, 679, 1009, 6909, 29936, 322, 29892, 366, 1073, 29892, 596, 15007, 845, 29877, 414, 322, 596, 298, 638, 414, 29892, 565, 366, 29915, 276, 2675, 304, 7251, 446, 701, 25133, 9459, 3201, 309, 470, 29892, 366, 1073, 1192, 366, 1073, 29892, 366, 1074, 2305, 2734, 701, 445, 26203, 297, 278, 13851, 297, 1009, 2217, 16812, 3460, 480, 1169, 29889, 13, 7058, 29915, 29879, 12528, 29892, 541, 306, 864, 304, 1074, 393, 4055, 393, 896, 12530, 1009, 29871, 29941, 29945, 1321, 4684, 304, 671, 393, 26203, 322, 393, 674, 6963, 297, 901, 6909, 304, 7344, 1438, 1020, 2719, 29889, 960, 372, 29915, 29879, 2869, 1565, 988, 29871, 29955, 29900, 470, 29871, 29947, 29900, 10151, 310, 278, 6909, 5771, 304, 664, 373, 278, 1020, 2719, 29889, 887, 1073, 29889, 13, 2855, 29892, 366, 1073, 29892, 322, 408, 2215, 408, 29892, 763, 29892, 2740, 322, 26429, 338, 697, 916, 2655, 306, 29915, 29881, 763, 304, 3585, 263, 2217, 2586, 29889, 13, 10401, 1310, 18462, 29915, 29879, 5714, 297, 278, 317, 809, 538, 4038, 1192, 590, 270, 328, 4687, 23606, 15594, 6438, 10317, 338, 1790, 2655, 540, 1258, 29889, 13, 2855, 591, 1925, 278, 2740, 322, 26429, 297, 714, 727, 29892, 590, 270, 328, 1258, 29892, 322, 590, 22169, 5122, 29889, 18110, 29892, 10940, 18462, 29915, 29879, 5714, 322, 263, 1246, 5771, 714, 29892, 727, 29915, 29879, 451, 263, 15007, 29885, 711, 3955, 297, 4726, 393, 338, 451, 714, 727, 373, 278, 2740, 322, 26429, 29889, 13, 2855, 591, 1016, 29915, 29873, 2562, 565, 366, 29915, 276, 263, 11203, 286, 1878, 261, 29892, 263, 298, 5603, 29892, 470, 6514, 29889, 1334, 748, 1106, 29889, 1126, 366, 1073, 29892, 322, 393, 29915, 29879, 697, 2655, 393, 306, 2337, 763, 304, 3183, 297, 727, 29889, 887, 1073, 29892, 746, 278, 1192, 746, 278, 1246, 29915, 29879, 714, 363, 1371, 29892, 366, 7216, 29915, 29873, 2675, 304, 1284, 263, 2253, 2318, 310, 2305, 1135, 596, 15007, 29885, 12213, 414, 304, 748, 1192, 748, 11975, 29889, 13, 29979, 29872, 801, 29889, 2193, 29915, 29879, 5051, 1568, 1048, 372, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 20419, 29889, 360, 1164, 315, 1964, 4375, 12982, 29979, 29901, 1383, 23453, 29892, 437, 366, 505, 738, 5155, 470, 3099, 29973, 13, 7068, 2190, 29940, 1164, 476, 29949, 20449, 29968, 29901, 1939, 29892, 372, 29915, 29879, 763, 23529, 925, 1303, 590, 3458, 29889, 7569, 1139, 306, 750, 29892, 366, 925, 20976, 372, 29892, 577, 29892, 21915, 29889, 13, 29934, 2477, 29950, 6670, 14861, 3094, 29901, 20419, 29889, 887, 1497, 366, 29915, 345, 2355, 1790, 1139, 29973, 476, 1718, 1430, 350, 1525, 29956, 1254, 1001, 29901, 1939, 29892, 591 ]
1,333,675
18,432
CommonCrawl
4
1
Racist Robots? Seriously? Tom Stark Send an email August 13, 2019 Facebook Twitter Pinterest Reddit Share via Email Print A recent article reports on a "study" that claims to show that there is inherent bias or racist in the fact that a large majority of the robots produced that appear human-like in appearance are white rather than some other color that might depict under-represented minority groups. Have we really fallen that far into the dark pit of cynicism? Apparently, some have. The organization conducting this research is Human Interface Technology Laboratory in New Zealand. A read through their "About" and "Partners" page makes it apparent that it's heavily backed by European and American academia as well as commercial interests. As most of America should know and understand, academia – especially in this country – has been nearly completely taken over by the left. That should be obvious from the title of the article. Who else would be so insanely fixated on the issue of race that they would attribute the finish on a robot being influenced by racial bias? The very idea is ridiculous. White is a neutral color that does not represent anything other than a choice that will bother the fewest potential customers because of its neutrality. Most people have a favorite color. If a company happens to choose a less popular color for its robots, they risk losing that first impression that can make or break a customer from choosing their product over another than is better suited to their tastes. Now that proposition may seem a little thin on scientific evidence, but no more so that to suggest that the producers of robots that appear humanoid in appearance choose the color white for their robots from some sort of subliminal message that a white robot is "better" than a "robot of color." This same sort of logic seems to be in play with virtually every aspect of the leftists' agenda these days. Set aside the robots for a moment. They, at least, can be turned off. Just look at the many issues that make the headlines these days. There are far too many occurrences that have been automatically labeled as racially tainted or biased simply because that is the "issue de jour" that seems to be the go-to for the left when attempting to undermine anything that even remotely resembles support for a conservative view of the issue in question. Don't agree with affirmative action? Racist! Don't agree with the continuation of the welfare state as it stands today? Racist! Don't agree with something else the left supports? Racist! Does Trump like it? He's racist!! Are we seeing a pattern here? When was the last time, if ever, you can honestly state that a conservative individual accused someone of racism just because they didn't agree with a position on a given issue? Likely seldom to never. Perhaps the left just needs to start doing some research and coming up with some facts that support their positions instead of resorting to false flag issues and accusing their opposition of being racist, sexist, misogynistic, homophobic, or any other derogatory label they happen to spew from their mouths constantly. A solution to the problem of robots being too white? Why bother, 98% of the world cannot afford to have one anyway, so who really cares? Apparently, CNN Business. They're the ones that came up with the headline that reads, "Robot racism? Yes, says a study showing humans' biases extend to robots." Is anyone surprised? Tom Stark Tom Stark's career began with Air Force service, including a year in Thailand and Vietnam, and progressed through a variety of manufacturing and service positions to Manager of Security, Safety, and Transportation for the Orange County (FL) Convention Center. He graduated from Barry University in 1994 and soon after embarked on a second career building custom furniture as an entrepreneur for the last 20 years. He unsuccessfully ran as a Tea Party candidate in the 2010 Congressional race (WV-01). Tom currently writes and advocates for smaller more prudent and less intrusive government, strengthening families and protecting life while building free market principles that make America stronger. He is now 70, retired, and residing with his wife in Weston, West Virginia. Michael Ingmire, Seven Years After Benghazi: David Meet Goliath Daniel Greenfield: Medicare For All Destroys Medicare Sanders Supp
-0.604966
-0.851733
-0.811222
-0.628984
[ -0.46525914439909294, -0.7446729319148401 ]
[ -0.6843089319091992, -1.0191564766141166 ]
[ -0.6501708894050153, -0.9722734996288176 ]
[ -0.5566331040044625, -0.7013343251760291 ]
1,024
[ 512, 512 ]
[ 390, 562, 391, 6417, 1862, 29973, 1816, 17365, 29973, 13, 21599, 624, 935, 15076, 385, 4876, 3111, 29871, 29896, 29941, 29892, 29871, 29906, 29900, 29896, 29929, 13, 23360, 2909, 20147, 349, 1639, 342, 4367, 27423, 26849, 3025, 22608, 13905, 13, 29909, 7786, 4274, 13676, 373, 263, 376, 18082, 29891, 29908, 393, 16726, 304, 1510, 393, 727, 338, 7846, 296, 24003, 470, 11021, 391, 297, 278, 2114, 393, 263, 2919, 13638, 310, 278, 10832, 1862, 7371, 393, 2615, 5199, 29899, 4561, 297, 10097, 526, 4796, 3265, 1135, 777, 916, 2927, 393, 1795, 1401, 919, 1090, 29899, 276, 6338, 287, 9461, 537, 6471, 29889, 13, 25559, 591, 2289, 19225, 393, 2215, 964, 278, 6501, 22754, 310, 274, 948, 293, 1608, 29973, 27466, 2705, 29892, 777, 505, 29889, 450, 13013, 7512, 292, 445, 5925, 338, 12968, 25796, 17968, 16715, 7606, 297, 1570, 13450, 29889, 319, 1303, 1549, 1009, 376, 28173, 29908, 322, 376, 7439, 8397, 29908, 1813, 3732, 372, 20295, 393, 372, 29915, 29879, 20365, 1250, 287, 491, 7824, 322, 3082, 16274, 423, 408, 1532, 408, 12128, 20017, 29889, 13, 2887, 1556, 310, 6813, 881, 1073, 322, 2274, 29892, 16274, 423, 785, 7148, 297, 445, 4234, 785, 756, 1063, 8886, 6446, 4586, 975, 491, 278, 2175, 29889, 2193, 881, 367, 6924, 515, 278, 3611, 310, 278, 4274, 29889, 11644, 1683, 723, 367, 577, 1663, 273, 873, 2329, 630, 373, 278, 2228, 310, 8175, 393, 896, 723, 5352, 278, 8341, 373, 263, 19964, 1641, 28482, 491, 1153, 1455, 24003, 29973, 450, 1407, 2969, 338, 8177, 12906, 681, 29889, 8037, 338, 263, 21104, 2927, 393, 947, 451, 2755, 3099, 916, 1135, 263, 7348, 393, 674, 24738, 278, 2846, 342, 7037, 20330, 1363, 310, 967, 21104, 537, 29889, 7849, 2305, 505, 263, 25448, 2927, 29889, 960, 263, 5001, 5930, 304, 6755, 263, 3109, 5972, 2927, 363, 967, 10832, 1862, 29892, 896, 12045, 19035, 393, 937, 17188, 393, 508, 1207, 470, 2867, 263, 11962, 515, 23906, 1009, 3234, 975, 1790, 1135, 338, 2253, 480, 1573, 304, 1009, 260, 579, 267, 29889, 13, 10454, 393, 26619, 1122, 2833, 263, 2217, 16835, 373, 16021, 10757, 29892, 541, 694, 901, 577, 393, 304, 4368, 393, 278, 1391, 22543, 310, 10832, 1862, 393, 2615, 3165, 1562, 333, 297, 10097, 6755, 278, 2927, 4796, 363, 1009, 10832, 1862, 515, 777, 2656, 310, 1014, 2576, 979, 2643, 393, 263, 4796, 19964, 338, 376, 6878, 357, 29908, 1135, 263, 376, 307, 7451, 310, 2927, 1213, 13, 4013, 1021, 2656, 310, 5900, 2444, 304, 367, 297, 1708, 411, 4610, 1474, 1432, 9565, 310, 278, 2175, 2879, 29915, 946, 8395, 1438, 3841, 29889, 3789, 17786, 278, 10832, 1862, 363, 263, 3256, 29889, 2688, 29892, 472, 3203, 29892, 508, 367, 6077, 1283, 29889, 3387, 1106, 472, 278, 1784, 5626, 393, 1207, 278, 2343, 9012, 1438, 3841, 29889, 1670, 526, 2215, 2086, 1784, 13920, 2063, 393, 505, 1063, 6336, 301, 24025, 408, 1153, 5584, 260, 2365, 287, 470, 4768, 1463, 3763, 1363, 393, 338, 278, 376, 15118, 316, 8694, 29908, 393, 2444, 304, 367, 278, 748, 29899, 517, 363, 278, 2175, 746, 15661, 304, 563, 837, 457, 3099, 393, 1584, 1083, 327, 873, 620, 1590, 793, 2304, 363, 263, 8976, 1230, 1776, 310, 278, 2228, 297, 1139, 29889, 13, 10310, 29915, 29873, 8661, 411, 2756, 3568, 1230, 3158, 29973, 390, 562, 391, 29991, 3872, 29915, 29873, 8661, 411, 278, 3133, 362, 310, 278, 281, 761, 598, 2106, 408, 372, 15028, 9826, 29973, 390, 562, 391, 29991, 3872, 29915, 29873, 8661, 411, 1554, 1683, 278, 2175, 11286, 29973, 390, 562, 391, 29991, 5538, 27504, 763, 372, 29973, 940, 29915, 29879, 11021, 391, 6824, 13, 17506, 591, 8790, 263, 4766, 1244, 29973, 1932, 471, 278, 1833, 931, 29892, 565, 3926, 29892, 366, 508, 15993, 368, 2106, 393, 263, 8976, 1230, 5375, 28886, 4856, 310, 11021, 1608, 925, 1363, 896, 3282, 29915, 29873, 8661, 411, 263, 2602, 373, 263, 2183, 2228, 29973, 365, 638, 873, 269, 2495, 290, 304, 2360, 29889, 13, 5894, 4252, 278, 2175, 925, 4225, 304, 1369, 2599, 777, 5925, 322, 6421, 701, 411, 777, 17099, 393, 2304, 1009, 11909, 2012, 310, 25362, 292, 304, 2089, 7353, 5626, 322, 1035, 4746, 1009, 19626, 310, 1641, 11021, 391, 29892, 7916, 391, 29892, 3984, 468, 948, 4695, 29892, 3632, 3021, 711, 293, 29892, 470, 738, 916, 589, 468, 7606, 3858, 896, 3799, 304, 961, 29893, 515, 1009, 13394, 29879, 21003, 29889, 13, 29909, 1650, 304, 278, 1108, 310, 10832, 1862, 1641, 2086, 4796, 29973, 3750, 24738, 29892, 29871, 29929, 29947, 29995, 310, 278, 3186, 2609, 21750, 304, 505, 697, 8763, 29892, 577, 1058, 2289, 1559, 267, 29973, 27466, 2705, 29892, 29696, 15197, 29889, 2688, 29915, 276, 278, 6743, 393, 2996, 701, 411, 278, 2343, 1220, 393, 13623, 29892, 376, 21860, 327, 11021, 1608, 29973, 3869, 29892, 4083, 263, 6559, 6445, 25618, 29915, 4768, 2129, 10985, 304, 10832, 1862, 1213, 1317, 5019, 18014, 29973, 13, 21599, 624, 935, 13, 21599, 624, 935, 29915, 29879, 6413, 4689, 411, 5593, 11004, 2669, 29892, 3704, 263, 1629, 297, 498, 26517, 322, 18444, 29892, 322, 6728, 287, 1549, 263, 12875, 310, 12012, 3864, 322, 2669, 11909, 304, 15629, 310, 14223, 29892, 14795, 3305, 29892, 322, 15710, 362, 363, 278, 26048, 5127, 313, 10536, 29897, 26774, 7817, 29889, 940, 23588, 515, 23032, 3014, 297, 29871, 29896, 29929, 29929, 29946, 322, 4720, 1156, 7232, 935, 287, 373, 263, 1473, 6413, 5214, 2888, 15252, 17252, 408, 385, 23440, 1600, 332, 363, 278, 1833, 29871, 29906, 29900, 2440, 29889, 940, 443, 8698, 3730, 6350, 408, 263, 1920, 29874, 9173, 14020, 297, 278, 29871, 29906, 29900, 29896, 29900, 6005, 29878, 15750, 8175, 313, 29956, 29963, 29899, 29900, 29896, 467, 4335, 5279, 15873, 322, 22545, 1078, 363, 7968, 901, 544, 10385, 322, 3109, 11158, 375, 573, 5874, 29892, 9324, 8333, 13175, 322, 12566, 292, 2834, 1550, 5214, 3889, 9999, 18671, 393, 1207, 6813, 23505, 29889, 940, 338, 1286, 29871, 29955, 29900, 29892, 16528, 29892, 322, 620, 4821, 411, 670, 6532, 297, 3122, 265, 29892, 3122, 11653, 29889, 13, 24083, 22607, 29885, 533, 29892, 26647, 23857, 2860, 20781, 29882, 18861, 29901, 4699, 2191, 300, 402, 5079, 493, 13, 29866, 7646, 2671, 29901, 22247, 598, 1152, 2178, 15435, 307, 952, 22247, 598, 13, 29903, 392, 414, 9179 ]
1,333,678
0
CommonCrawl
18
15
Roy E. Killgore (Soil Science '64) co-ran a successful produce, sales, packing and processing company called San Ysidro Farms. He fondly remembers celebrating his 65th birthday by cycling across the U.S. with his former Cal Poly roommate, Stan Rose. John Huston (Soil Science '72) served for more than 21 years in the field artillery and transportation branches of the U.S. Army and retired in July of 1993 as a lieutenant colonel. He went on to work in real estate, farm in western Pennsylvania, and eventually became director of transportation for a school district before retiring in 2011. Dean Cardoza (Agricultural Management '78) was recently promoted to the head of the agribusiness division for Bank of the West. Mary Jean Stevenson (Food Industries '79) holds bachelor's degrees in food industries and dietetics as well as a master's degree in arts in health science education. She enlisted in the Air Force as a clinical lab technician and diet therapist and later went on to work as a health technician and a public school teacher of physical science. Since 2010, she has been an instructor of humanities and sciences for the University of Phoenix. In her free time, she volunteers with the Comfort Pets organization and visits hospitals, nursing facilities and universities. Laurie Best (City & Regional Planning '80) traveled from the Central Coast to the Colorado Rockies, working with municipalities on a variety of meaningful public projects and policies. She currently lives in a ski town in Colorado and works to develop workforce housing and preserve the community character of the town. Bernard Aguilar (Natural Resources Management '82) works as an environmental scientist with the California Department of Fish and Wildlife. He is responsible for biodiversity management in the Trinity Alps Wilderness Area. Kevin Bumen (Recreation, Parks and Tourism Administration '96) is the director of airports for the county of San Luis Obispo and recently led the opening of the new airport terminal in SLO. The $40 million project created an entirely new terminal with six gates, an outdoor courtyard and large bag claim area. Heidi Herrmann (Ornamental Horticulture '96) teaches native plant restoration at Sonoma State University and various sustainable agriculture courses at Santa Rosa Junior College. She also runs her own seaweed harvesting company and sells to chefs in the Bay Area. Leslie Sklena (Animal Science '04) received her doctorate of veterinary medicine from the Atlantic Veterinary College in Prince Edward Island, Canada in 2009. She worked for several years in animal shelters in San Diego County and has also volunteered for veterinary causes on reservations and internationally. In June, she returned to SLO to work as director of veterinary services at Woods Humane Society. Andrew Dixon (Nutrition Science '05) went to Ross University Medical School and completed a residency in anesthesiology at the University of New Mexico. In 2016, he returned to SLO with his wife and daughter and is practicing medicine. Tara Black (Animal Science '06) worked for a large animal veterinarian in North County for two years before attending Washington State University veterinary program in 2008. She balanced a pregnancy with her clinical rotations and is now happily working as a mixed animal veterinarian on the Olympic Peninsula. Sarah Nisse (Nutrition and Food Science '08) started her own holistic healing business and now leads global retreats. She feels lucky to have worked with a herd of 55 elephants in Sumatra, orangutans in Borneo and the big five game animals in South Africa. Margaret Leonardi and Brian Pruett (Agriculture Business '09) were married in 2017. They met on their first day at Cal Poly in AGB 101. They currently reside in Santa Rosa, Calif. Margaret is a winemaker at Fetzer Vineyards in Hopland and Brian is assistant winemaker at Dry Creek Vineyard in Healdsburg. They are both active in the North Bay Alumni Chapter where Margaret serves as treasurer. Kathryn
0.292171
0.921885
0.478456
-0.739705
[ 0.244232727822265, 0.3401100078521782 ]
[ 0.9469537056639544, 0.8968161053872823 ]
[ 0.3541805566471552, 0.6027321771348135 ]
[ -0.7650678967482248, -0.7143411765172936 ]
1,024
[ 512, 512 ]
[ 15793, 382, 29889, 29021, 29887, 487, 313, 6295, 309, 9327, 525, 29953, 29946, 29897, 1302, 29899, 661, 263, 9150, 7738, 29892, 16538, 29892, 4870, 292, 322, 9068, 5001, 2000, 3087, 612, 29879, 333, 307, 8413, 1516, 29889, 940, 6299, 368, 1083, 13415, 10894, 1218, 670, 29871, 29953, 29945, 386, 12060, 3250, 491, 5094, 19914, 4822, 278, 501, 29889, 29903, 29889, 411, 670, 4642, 3037, 21755, 696, 3011, 403, 29892, 7813, 14008, 29889, 13, 11639, 379, 504, 265, 313, 6295, 309, 9327, 525, 29955, 29906, 29897, 6766, 363, 901, 1135, 29871, 29906, 29896, 2440, 297, 278, 1746, 1616, 19486, 322, 8608, 362, 14202, 310, 278, 501, 29889, 29903, 29889, 8811, 322, 16528, 297, 5468, 310, 29871, 29896, 29929, 29929, 29941, 408, 263, 25097, 8104, 295, 29889, 940, 3512, 373, 304, 664, 297, 1855, 19989, 29892, 17888, 297, 15782, 16636, 29892, 322, 10201, 3897, 8881, 310, 8608, 362, 363, 263, 3762, 6474, 1434, 3240, 8491, 297, 29871, 29906, 29900, 29896, 29896, 29889, 13, 2772, 273, 315, 6491, 1362, 313, 29909, 629, 3953, 3631, 15057, 525, 29955, 29947, 29897, 471, 10325, 21201, 304, 278, 2343, 310, 278, 946, 1091, 375, 3335, 8542, 363, 10253, 310, 278, 3122, 29889, 13, 29924, 653, 4581, 26287, 265, 313, 29943, 2092, 12157, 2722, 525, 29955, 29929, 29897, 8640, 289, 496, 12779, 29915, 29879, 14496, 297, 9687, 6397, 2722, 322, 652, 300, 300, 1199, 408, 1532, 408, 263, 5835, 29915, 29879, 7426, 297, 16930, 297, 9045, 10466, 9793, 29889, 2296, 427, 1761, 287, 297, 278, 5593, 11004, 408, 263, 24899, 936, 9775, 5722, 8910, 322, 652, 300, 29220, 481, 391, 322, 2678, 3512, 373, 304, 664, 408, 263, 9045, 5722, 8910, 322, 263, 970, 3762, 15703, 310, 9128, 10466, 29889, 4001, 29871, 29906, 29900, 29896, 29900, 29892, 1183, 756, 1063, 385, 18690, 272, 310, 5199, 1907, 322, 21195, 363, 278, 3014, 310, 29715, 29889, 512, 902, 3889, 931, 29892, 1183, 27886, 414, 411, 278, 422, 3921, 349, 1691, 13013, 322, 1998, 1169, 29418, 277, 1338, 29892, 302, 1295, 292, 23330, 322, 4946, 1907, 29889, 13, 5661, 332, 347, 6407, 313, 16885, 669, 16208, 1858, 9450, 525, 29947, 29900, 29897, 1020, 345, 839, 515, 278, 8068, 17700, 304, 278, 21137, 8027, 583, 29892, 1985, 411, 11677, 1907, 373, 263, 12875, 310, 6593, 1319, 970, 9279, 322, 24833, 29889, 2296, 5279, 12080, 297, 263, 14993, 4726, 297, 21137, 322, 1736, 304, 2693, 664, 10118, 27261, 322, 19905, 278, 7881, 2931, 310, 278, 4726, 29889, 13, 29933, 824, 538, 24106, 2327, 313, 29940, 18771, 27562, 15057, 525, 29947, 29906, 29897, 1736, 408, 385, 29380, 9638, 391, 411, 278, 8046, 10317, 310, 12030, 322, 11821, 19264, 29889, 940, 338, 14040, 363, 289, 2660, 24974, 10643, 297, 278, 1605, 13593, 838, 567, 399, 2700, 2264, 18320, 29889, 13, 9598, 3845, 350, 14170, 313, 4789, 276, 362, 29892, 4815, 29879, 322, 6371, 1608, 23303, 525, 29929, 29953, 29897, 338, 278, 8881, 310, 4799, 4011, 363, 278, 15178, 310, 3087, 12583, 4250, 275, 1129, 322, 10325, 5331, 278, 8718, 310, 278, 716, 4799, 637, 8638, 297, 317, 3927, 29889, 450, 395, 29946, 29900, 7284, 2060, 2825, 385, 9186, 716, 8638, 411, 4832, 29341, 29892, 385, 714, 17433, 2085, 1017, 538, 322, 2919, 19548, 5995, 4038, 29889, 13, 3868, 8819, 2439, 1758, 812, 313, 2816, 29876, 11491, 379, 441, 3953, 545, 525, 29929, 29953, 29897, 6860, 267, 7531, 8024, 1791, 12418, 472, 5791, 4125, 4306, 3014, 322, 5164, 15075, 475, 519, 18032, 545, 21888, 472, 7510, 21974, 15897, 6346, 29889, 2296, 884, 6057, 902, 1914, 7205, 705, 287, 4023, 10147, 292, 5001, 322, 269, 10071, 304, 923, 5847, 297, 278, 6211, 18320, 29889, 13, 24560, 3197, 4971, 29880, 2386, 313, 2744, 3039, 9327, 525, 29900, 29946, 29897, 4520, 902, 11619, 403, 310, 25808, 3821, 26602, 515, 278, 19948, 478, 1308, 3821, 6346, 297, 10787, 9300, 7935, 29892, 7400, 297, 29871, 29906, 29900, 29900, 29929, 29889, 2296, 3796, 363, 3196, 2440, 297, 13019, 528, 295, 2153, 297, 3087, 16879, 5127, 322, 756, 884, 27886, 14561, 363, 25808, 3821, 9946, 373, 620, 6972, 800, 322, 2836, 362, 635, 29889, 512, 5306, 29892, 1183, 4133, 304, 317, 3927, 304, 664, 408, 8881, 310, 25808, 3821, 5786, 472, 10180, 29879, 13863, 1662, 7765, 29889, 13, 2855, 3973, 360, 28778, 313, 29940, 329, 29878, 654, 9327, 525, 29900, 29945, 29897, 3512, 304, 13693, 3014, 20795, 4523, 322, 8676, 263, 620, 3615, 1270, 297, 385, 342, 29882, 10100, 3002, 472, 278, 3014, 310, 1570, 12568, 29889, 512, 29871, 29906, 29900, 29896, 29953, 29892, 540, 4133, 304, 317, 3927, 411, 670, 6532, 322, 8750, 322, 338, 4120, 18499, 26602, 29889, 13, 29911, 2518, 6054, 313, 2744, 3039, 9327, 525, 29900, 29953, 29897, 3796, 363, 263, 2919, 13019, 25808, 262, 13956, 297, 4644, 5127, 363, 1023, 2440, 1434, 1098, 2548, 7660, 4306, 3014, 25808, 3821, 1824, 297, 29871, 29906, 29900, 29900, 29947, 29889, 2296, 6411, 8362, 263, 758, 5138, 6906, 411, 902, 24899, 936, 5731, 800, 322, 338, 1286, 2250, 2354, 1985, 408, 263, 12849, 13019, 25808, 262, 13956, 373, 278, 19025, 7363, 1144, 2497, 29889, 13, 29903, 279, 801, 405, 5582, 313, 29940, 329, 29878, 654, 322, 25453, 9327, 525, 29900, 29947, 29897, 4687, 902, 1914, 8753, 4695, 540, 12818, 5381, 322, 1286, 11981, 5534, 22162, 1446, 29889, 2296, 23880, 9885, 29891, 304, 505, 3796, 411, 263, 902, 29881, 310, 29871, 29945, 29945, 4552, 561, 1934, 297, 6991, 16546, 29892, 470, 574, 329, 550, 297, 6780, 11496, 322, 278, 4802, 5320, 3748, 15006, 297, 4275, 10557, 29889, 13, 29924, 1191, 10474, 10255, 18015, 322, 15733, 349, 582, 1803, 313, 29909, 629, 3953, 545, 15197, 525, 29900, 29929, 29897, 892, 8300, 297, 29871, 29906, 29900, 29896, 29955, 29889, 2688, 1539, 373, 1009, 937, 2462, 472, 3037, 21755, 297, 319, 7210, 29871, 29896, 29900, 29896, 29889, 2688, 5279, 620, 680, 297, 7510, 21974, 29892, 3037, 361, 29889, 18364, 338, 263, 5401, 331, 5790, 472, 383, 300, 3298, 478, 457, 29891, 3163, 297, 20727, 1049, 322, 15733, 338, 20255, 5401, 331, 5790, 472, 360, 719, 15594, 478, 457, 19852, 297, 940, 2741, 29879, 3074, 29889, 2688, 526, 1716, 6136, 297, 278, 4644, 6211, 838, 1227, 29875, 23040, 988, 18364, 19700, 408, 2578, 294, 9945, 29889, 13, 29968, 493, 719, 29876 ]
1,333,682
0
C4
17
12
Pgl3 Luciferase Reporter Vectors Protocol Chathur Chandrasoorya Pgl3 Luciferase Reporter Vectors types with restriction sites and genes present salvareSalvați Pgl3 Luciferase Reporter Vectors Protocol pentru mai târziu 16s Ribosomal.... biotech1.pdf Bio 108 Lec 3 FullBook Publisher GY300 Dtype E Application of Molecular Techniques to the Study of Hospital Infection Stimulation of Reductive Glycerol Metabolism by Ov tretraciclinas Does Science Have Enough Knowledge (1) (PDF) Mcqs in microbiology _ Mohammed Bilal - Academia.edu.pdf Amplification, Cloning, And Expression of an Exonuclease III Gene From a Thermophilic Bacterium Without Culturing 01 Intro to Bioeng DNA to Music Process 2011 Boyle & Trakman, 2004 - Members of a Novel Family of Mammalian Protein Kinases Nanosensors_for_cancer_detection.pdf ExtincaoMemoriasDNA.pdf pGL3 Luciferase Reporter Instructions For Use of Products E1741, E1751, E1761 and E1771 Revised 6/15 pGL3 Luciferase Reporter Vectors All technical literature is available at: www.promega.com/protocols/ Visit the web site to verify that you are using the most current version of this Technical Manual. E-mail Promega Technical Services if you have questions on use of this system: [email protected] 1. Description.......................................................................................................................................... 2 2. Product Components and Storage Conditions......................................................................................... 2 3. pGL3 Vector Maps and Sequence Reference Points................................................................................. 2 3.A. pGL3-Basic Vector....................................................................................................................... 3 3.B. pGL3-Enhancer Vector................................................................................................................. 4 3.C. pGL3-Promoter Vector................................................................................................................. 5 3.D. pGL3-Control Vector................................................................................................................... 6 4. Cloning Methods.................................................................................................................................. 7 4.A. Cloning Strategies....................................................................................................................... 7 4.B. Preparation of pGL3 Vectors and Insert DNA for Cloning............................................................... 8 4.C. Transformation Protocols for pGL3 Vectors................................................................................... 8 4.D. Isolation of Plasmid DNA............................................................................................................. 8 5. Transfection of Mammalian Cells.......................................................................................................... 9 6. Assay of Luciferase Activity................................................................................................................... 9 7. Sequencing of Luciferase Reporter Vectors........................................................................................... 11 8. Appendix........................................................................................................................................... 12 8.A. Common Structural Elements of the pGL3 Luciferase Reporter Vectors......................................... 12 8.B. Advantages of the pGL3 Vectors.................................................................................................. 13 8.C. The pGL3 Vectors luc+ Gene....................................................................................................... 14 8.D. Mapping Genetic Elements Located Within DNA Fragments......................................................... 16 8.E. Composition of Buffers and Solutions.......................................................................................... 16 8.F. References................................................................................................................................ 17 8.G. pGL3-Basic Vector Restriction Sites............................................................................................ 18 8.H. pGL3-Enhancer Vector Restriction Sites ..................................................................................... 20 8.I. pGL3-Promoter Vector Restriction Sites ..................................................................................... 23 8.J. pGL3-Control Vector Restriction
-1.782887
-0.023567
0.765052
0.67284
[ -1.8869822396998064, -1.6787915744919948 ]
[ -0.3387176157164235, 0.2915836449045974 ]
[ 0.5063550181702113, 1.0237481873486023 ]
[ 0.23841068423032524, 1.1072683538267887 ]
1,024
[ 512, 512 ]
[ 349, 3820, 29941, 10315, 9633, 559, 830, 18505, 478, 11142, 1019, 5770, 13, 1451, 493, 332, 678, 392, 3417, 29877, 706, 29874, 13, 29925, 3820, 29941, 10315, 9633, 559, 830, 18505, 478, 11142, 4072, 411, 24345, 11840, 322, 2531, 267, 2198, 13, 19585, 5280, 20392, 1564, 10037, 349, 3820, 29941, 10315, 9633, 559, 830, 18505, 478, 11142, 1019, 5770, 13250, 5530, 260, 28726, 2526, 29884, 13, 29896, 29953, 29879, 27461, 359, 290, 284, 3045, 13, 5365, 866, 305, 29896, 29889, 5140, 13, 29933, 601, 29871, 29896, 29900, 29947, 365, 687, 29871, 29941, 13, 13658, 10967, 12904, 261, 13, 29954, 29979, 29941, 29900, 29900, 360, 1853, 382, 13, 4873, 310, 341, 1772, 16637, 1920, 6387, 1912, 304, 278, 29301, 310, 15967, 512, 20309, 13, 855, 326, 2785, 310, 4367, 5313, 573, 402, 368, 2265, 324, 4737, 19388, 1608, 491, 438, 29894, 13, 29873, 2267, 945, 293, 1915, 294, 13, 25125, 9327, 6975, 1174, 820, 19320, 5485, 13, 29898, 29896, 29897, 313, 8493, 29897, 4052, 29939, 29879, 297, 9200, 5365, 3002, 903, 12929, 28913, 20347, 284, 448, 26336, 29889, 6085, 29889, 5140, 13, 6833, 572, 2450, 29892, 2233, 28259, 29892, 1126, 21444, 310, 385, 1222, 265, 1682, 1511, 4786, 15350, 3645, 263, 498, 837, 3021, 309, 293, 350, 5761, 1974, 13932, 7965, 3864, 13, 29900, 29896, 3159, 307, 304, 21184, 996, 13, 29928, 3521, 304, 6125, 10554, 29871, 29906, 29900, 29896, 29896, 13, 8431, 1508, 669, 3201, 29895, 1171, 29892, 29871, 29906, 29900, 29900, 29946, 448, 341, 13415, 310, 263, 2864, 295, 14662, 310, 341, 4850, 284, 713, 14409, 262, 20311, 2129, 13, 29940, 16469, 575, 943, 29918, 1454, 29918, 3068, 2265, 29918, 29881, 2650, 428, 29889, 5140, 13, 5647, 262, 1113, 29877, 11442, 272, 3173, 29928, 3521, 29889, 5140, 13, 29886, 7239, 29941, 10315, 9633, 559, 830, 18505, 13, 3379, 582, 1953, 1152, 4803, 310, 10969, 29879, 13, 29923, 29896, 29955, 29946, 29896, 29892, 382, 29896, 29955, 29945, 29896, 29892, 382, 29896, 29955, 29953, 29896, 322, 382, 29896, 29955, 29955, 29896, 13, 1123, 11292, 29871, 29953, 29914, 29896, 29945, 13, 29886, 7239, 29941, 10315, 9633, 559, 830, 18505, 478, 11142, 13, 3596, 16905, 12845, 338, 3625, 472, 29901, 7821, 29889, 14032, 2442, 29889, 510, 29914, 20464, 29879, 29914, 13, 6116, 277, 278, 1856, 3268, 304, 11539, 393, 366, 526, 773, 278, 1556, 1857, 1873, 310, 445, 8364, 936, 2315, 950, 29889, 13, 29923, 29899, 2549, 9705, 2442, 8364, 936, 15538, 565, 366, 505, 5155, 373, 671, 310, 445, 1788, 29901, 734, 305, 2140, 29992, 14032, 2442, 29889, 510, 13, 29896, 29889, 12, 9868, 25285, 25285, 25285, 25285, 25285, 25285, 25285, 25285, 11296, 636, 29871, 29906, 13, 29906, 29889, 12, 7566, 422, 9340, 322, 26162, 11790, 2187, 25285, 25285, 25285, 25285, 25285, 3045, 18598, 29871, 29906, 13, 29941, 29889, 12, 29886, 7239, 29941, 16510, 25846, 322, 922, 3910, 12105, 8984, 29879, 25285, 25285, 25285, 25285, 11296, 3045, 18598, 29871, 29906, 13, 29941, 29889, 29909, 29889, 12, 29886, 7239, 29941, 29899, 16616, 16510, 25285, 25285, 25285, 25285, 25285, 25285, 25285, 3045, 856, 29871, 29941, 13, 29941, 29889, 29933, 29889, 12, 29886, 7239, 29941, 29899, 2369, 5403, 2265, 16510, 25285, 25285, 25285, 25285, 25285, 25285, 11296, 3045, 18598, 29871, 29946, 13, 29941, 29889, 29907, 29889, 12, 29886, 7239, 29941, 29899, 18571, 17084, 16510, 25285, 25285, 25285, 25285, 25285, 25285, 11296, 3045, 18598, 29871, 29945, 13, 29941, 29889, 29928, 29889, 12, 29886, 7239, 29941, 29899, 4809, 16510, 25285, 25285, 25285, 25285, 25285, 25285, 25285, 856, 29871, 29953, 13, 29946, 29889, 12, 6821, 28259, 8108, 29879, 25285, 25285, 25285, 25285, 25285, 25285, 25285, 25285, 636, 29871, 29955, 13, 29946, 29889, 29909, 29889, 12, 6821, 28259, 3767, 1845, 583, 25285, 25285, 25285, 25285, 25285, 25285, 25285, 3045, 856, 29871, 29955, 13, 29946, 29889, 29933, 29889, 12, 6572, 862, 362, 310, 282, 7239, 29941, 478, 11142, 322, 24505, 25348, 363, 2233, 28259, 25285, 25285, 25285, 11296, 3045, 856, 29871, 29947, 13, 29946, 29889, 29907, 29889, 12, 4300, 5404, 1019, 5770, 29879, 363, 282, 7239, 29941, 478, 11142, 25285, 25285, 25285, 25285, 25285, 856, 29871, 29947, 13, 29946, 29889, 29928, 29889, 12, 29902, 2929, 362, 310, 1858, 294, 6563, 25348, 25285, 25285, 25285, 25285, 25285, 25285, 11296, 18598, 29871, 29947, 13, 29945, 29889, 12, 4300, 20309, 310, 341, 4850, 284, 713, 315, 10071, 25285, 25285, 25285, 25285, 25285, 25285, 11296, 636, 29871, 29929, 13, 29953, 29889, 12, 7900, 388, 310, 10315, 9633, 559, 13414, 25285, 25285, 25285, 25285, 25285, 25285, 25285, 856, 29871, 29929, 13, 29955, 29889, 12, 16941, 16750, 310, 10315, 9633, 559, 830, 18505, 478, 11142, 25285, 25285, 25285, 25285, 25285, 11296, 856, 29871, 29896, 29896, 13, 29947, 29889, 12, 18277, 861, 25285, 25285, 25285, 25285, 25285, 25285, 25285, 25285, 11296, 856, 29871, 29896, 29906, 13, 29947, 29889, 29909, 29889, 12, 18877, 28771, 3631, 10619, 29879, 310, 278, 282, 7239, 29941, 10315, 9633, 559, 830, 18505, 478, 11142, 25285, 25285, 3045, 18598, 29871, 29896, 29906, 13, 29947, 29889, 29933, 29889, 12, 3253, 29894, 19771, 310, 278, 282, 7239, 29941, 478, 11142, 25285, 25285, 25285, 25285, 25285, 25285, 636, 29871, 29896, 29941, 13, 29947, 29889, 29907, 29889, 12, 1576, 282, 7239, 29941, 478, 11142, 21626, 29974, 15350, 25285, 25285, 25285, 25285, 25285, 25285, 3045, 856, 29871, 29896, 29946, 13, 29947, 29889, 29928, 29889, 12, 15845, 5739, 7492, 10619, 29879, 5976, 630, 23732, 25348, 383, 1431, 1860, 25285, 25285, 25285, 3045, 18598, 29871, 29896, 29953, 13, 29947, 29889, 29923, 29889, 12, 1523, 3283, 310, 22274, 414, 322, 4956, 17925, 25285, 25285, 25285, 25285, 25285, 11296, 636, 29871, 29896, 29953, 13, 29947, 29889, 29943, 29889, 12, 1123, 10662, 25285, 25285, 25285, 25285, 25285, 25285, 25285, 25285, 29871, 29896, 29955, 13, 29947, 29889, 29954, 29889, 12, 29886, 7239, 29941, 29899, 16616, 16510, 11654, 19902, 317, 3246, 25285, 25285, 25285, 25285, 25285, 11296, 3045, 29871, 29896, 29947, 13, 29947, 29889, 29950, 29889, 12, 29886, 7239, 29941, 29899, 2369, 5403, 2265, 16510, 11654, 19902, 317, 3246, 29871, 25285, 25285, 25285, 25285, 25285, 18598, 29871, 29906, 29900, 13, 29947, 29889, 29902, 29889, 12, 29886, 7239, 29941, 29899, 18571, 17084, 16510, 11654, 19902, 317, 3246, 29871, 25285, 25285, 25285, 25285, 25285, 18598, 29871, 29906, 29941, 13, 29947, 29889, 29967, 29889, 12, 29886, 7239, 29941, 29899, 4809, 16510, 11654, 19902 ]
1,333,688
0
CommonCrawl
22
21
Sites ........................................................................................ 26 8.K. Related Products....................................................................................................................... 28 9. Summary of Changes.......................................................................................................................... 29 Promega Corporation 2800 Woods Hollow Road Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 608-274-4330 Fax 608-277-2516 www.promega.com TM033 Revised 6/15 1. Description The pGL3 Luciferase Reporter Vectors(a) provide a basis for the quantitative analysis of factors that potentially regulate mammalian gene expression. These factors may be cis-acting, such as promoters and enhancers, or trans-acting, such as various DNA-binding factors. The backbone of the pGL3 Luciferase Reporter Vectors is designed for increased expression, and contains a modified coding region for firefly (Photinus pyralis) luciferase that has been optimized for monitoring transcriptional activity in transfected eukaryotic cells. The assay of this genetic reporter is rapid, sensitive and quantitative. In addition, these Luciferase Reporter Vectors contain numerous features aiding in the structural characterization of the putative regulatory sequences under investigation. Product Components and Storage Conditions C A T. # pGL3-Control Vector pGL3-Basic Vector pGL3-Promoter Vector pGL3-Enhancer Vector Information on related products, including the Luciferase Assay System, is provided in Sections 47 and 8.K. Storage Conditions: Store the pGL3 Luciferase Reporter Vectors at 20C. pGL3 Vector Maps and Sequence Reference Points The listings of restriction sites for the pGL3 Luciferase Reporter Vectors are provided in Section 8.GJ. Note: The specific transcriptional characteristics of the pGL3 Vectors will vary for different cell types. This may be particularly true for COS cells, which contain the SV40 large T antigen. The SV40 large T antigen promotes replication from the SV40 origin, which is found in the promoter of the pGL3-Promoter and pGL3-Control Vectors. The combination of large T antigen and SV40 origin will result in a higher copy number of these vectors in COS cells, which in turn may result in increased expression of the reporter gene compared to other cell and vector combinations. 3.A. pGL3-Basic Vector The pGL3-Basic Vector lacks eukaryotic promoter and enhancer sequences, allowing maximum flexibility in cloning putative regulatory sequences. Expression of luciferase activity in cells transfected with this plasmid depends on insertion and proper orientation of a functional promoter upstream from luc+. Potential enhancer elements can also be inserted upstream of the promoter or in the BamHI or SalI sites downstream of the luc+ gene. Synthetic poly(A) signal / transcriptional pause site (for background reduction) Ampr MluI NheI XhoI BgIII HindIII f1 ori pGL3-Basic (4818bp) NcoI 86 luc+ NarI 121 0746VA08_4A 2010 SalI 2004 BamHI SV40 late poly(A) signal (for luc+ reporter) HpaI 1902 XbaI 1742 Figure 1. pGL3-Basic Vector circle map. Additional description: luc+, cDNA encoding the modified firefly luciferase; Ampr, gene conferring ampicillin resistance in E. coli; f1 ori, origin of replication derived from filamentous phage; ori, origin of replication in E. coli. Arrows within luc+ and the Ampr gene indicate the direction of transcription; the arrow in the f1 ori indicates the direction of ssDNA strand synthesis. pGL3-Basic Vector Sequence
-0.92547
0.109835
0.668674
0.629917
[ -1.1637936131884608, -0.6871465638968921 ]
[ -0.35125201578559156, 0.5709217035889135 ]
[ 0.4150503412563777, 0.9222985463332315 ]
[ -0.07635511822827373, 1.3361889374330425 ]
1,024
[ 512, 512 ]
[ 317, 3246, 29871, 25285, 25285, 25285, 25285, 25285, 11296, 29871, 29906, 29953, 13, 29947, 29889, 29968, 29889, 12, 9662, 630, 10969, 29879, 25285, 25285, 25285, 25285, 25285, 25285, 25285, 3045, 856, 29871, 29906, 29947, 13, 29929, 29889, 12, 26289, 310, 678, 6916, 25285, 25285, 25285, 25285, 25285, 25285, 25285, 11296, 636, 29871, 29906, 29929, 13, 18571, 2442, 15025, 29871, 29906, 29947, 29900, 29900, 10180, 29879, 379, 2952, 9321, 4104, 2285, 29892, 399, 29902, 29871, 29945, 29941, 29955, 29896, 29896, 29899, 29945, 29941, 29929, 29929, 8278, 323, 3028, 12362, 297, 8278, 29871, 29947, 29900, 29900, 29899, 29941, 29945, 29953, 29899, 29929, 29945, 29906, 29953, 29871, 29953, 29900, 29947, 29899, 29906, 29955, 29946, 29899, 29946, 29941, 29941, 29900, 383, 1165, 29871, 29953, 29900, 29947, 29899, 29906, 29955, 29955, 29899, 29906, 29945, 29896, 29953, 13, 1636, 29889, 14032, 2442, 29889, 510, 13, 23081, 29900, 29941, 29941, 830, 11292, 29871, 29953, 29914, 29896, 29945, 13, 29896, 29889, 12, 9868, 13, 1576, 282, 7239, 29941, 10315, 9633, 559, 830, 18505, 478, 11142, 29898, 29874, 29897, 3867, 263, 8405, 363, 278, 4323, 23378, 7418, 310, 13879, 393, 19998, 1072, 5987, 13, 29885, 4850, 284, 713, 18530, 4603, 29889, 4525, 13879, 1122, 367, 274, 275, 29899, 627, 292, 29892, 1316, 408, 2504, 327, 414, 322, 26371, 4564, 414, 29892, 470, 13, 3286, 29899, 627, 292, 29892, 1316, 408, 5164, 25348, 29899, 19672, 13879, 29889, 450, 1250, 15933, 310, 278, 282, 7239, 29941, 10315, 9633, 559, 830, 18505, 478, 11142, 338, 8688, 13, 1454, 11664, 4603, 29892, 322, 3743, 263, 9120, 14137, 5120, 363, 3974, 17652, 313, 4819, 327, 13419, 11451, 1705, 275, 29897, 21626, 9633, 559, 393, 756, 1063, 13, 20640, 1891, 363, 29652, 1301, 3395, 284, 6354, 297, 1301, 3647, 287, 321, 2679, 653, 13574, 9101, 29889, 450, 1223, 388, 310, 445, 2531, 7492, 1634, 9555, 338, 13, 2390, 333, 29892, 20502, 322, 4323, 23378, 29889, 512, 6124, 29892, 1438, 10315, 9633, 559, 830, 18505, 478, 11142, 1712, 12727, 5680, 263, 4821, 297, 13, 1552, 2281, 3631, 2931, 2133, 310, 278, 1925, 1230, 24378, 7606, 15602, 1090, 22522, 29889, 13, 7566, 422, 9340, 322, 26162, 11790, 2187, 13, 29907, 319, 323, 29889, 396, 13, 29886, 7239, 29941, 29899, 4809, 16510, 13, 29886, 7239, 29941, 29899, 16616, 16510, 13, 29886, 7239, 29941, 29899, 18571, 17084, 16510, 13, 29886, 7239, 29941, 29899, 2369, 5403, 2265, 16510, 13, 20350, 373, 4475, 9316, 29892, 3704, 278, 10315, 9633, 559, 4007, 388, 2184, 29892, 338, 4944, 297, 922, 1953, 29871, 29946, 29955, 322, 29871, 29947, 29889, 29968, 29889, 13, 10486, 11790, 2187, 29901, 14491, 278, 282, 7239, 29941, 10315, 9633, 559, 830, 18505, 478, 11142, 472, 29871, 29906, 29900, 29907, 29889, 13, 29886, 7239, 29941, 16510, 25846, 322, 922, 3910, 12105, 8984, 29879, 13, 1576, 1051, 886, 310, 24345, 11840, 363, 278, 282, 7239, 29941, 10315, 9633, 559, 830, 18505, 478, 11142, 526, 4944, 297, 9779, 29871, 29947, 29889, 29954, 29967, 29889, 13, 9842, 29901, 450, 2702, 1301, 3395, 284, 21862, 310, 278, 282, 7239, 29941, 478, 11142, 674, 13100, 363, 1422, 3038, 4072, 29889, 910, 1122, 367, 13, 1595, 16311, 368, 1565, 363, 315, 3267, 9101, 29892, 607, 1712, 278, 13955, 29946, 29900, 2919, 323, 3677, 2101, 29889, 450, 13955, 29946, 29900, 2919, 323, 3677, 2101, 2504, 4769, 1634, 1414, 13, 3166, 278, 13955, 29946, 29900, 3978, 29892, 607, 338, 1476, 297, 278, 2504, 17084, 310, 278, 282, 7239, 29941, 29899, 18571, 17084, 322, 282, 7239, 29941, 29899, 4809, 478, 11142, 29889, 450, 13, 510, 2109, 362, 310, 2919, 323, 3677, 2101, 322, 13955, 29946, 29900, 3978, 674, 1121, 297, 263, 6133, 3509, 1353, 310, 1438, 12047, 297, 315, 3267, 9101, 29892, 607, 13, 262, 2507, 1122, 1121, 297, 11664, 4603, 310, 278, 1634, 9555, 18530, 9401, 304, 916, 3038, 322, 4608, 18240, 29889, 13, 29941, 29889, 29909, 29889, 12, 29886, 7239, 29941, 29899, 16616, 16510, 13, 1576, 282, 7239, 29941, 29899, 16616, 16510, 425, 4684, 321, 2679, 653, 13574, 2504, 17084, 322, 427, 5403, 2265, 15602, 29892, 14372, 7472, 8525, 4127, 297, 1067, 28259, 13, 649, 1230, 24378, 7606, 15602, 29889, 21444, 310, 21626, 9633, 559, 6354, 297, 9101, 1301, 3647, 287, 411, 445, 715, 294, 6563, 7111, 373, 13, 7851, 291, 322, 1571, 19843, 310, 263, 13303, 2504, 17084, 701, 5461, 515, 21626, 29974, 29889, 10173, 2556, 427, 5403, 2265, 3161, 508, 884, 367, 13, 7851, 287, 701, 5461, 310, 278, 2504, 17084, 470, 297, 278, 350, 314, 17628, 470, 3956, 29902, 11840, 1623, 5461, 310, 278, 21626, 29974, 18530, 29889, 13, 29216, 386, 7492, 15680, 29898, 29909, 29897, 13, 25436, 847, 1301, 3395, 284, 13, 29886, 1071, 3268, 13, 29898, 1454, 3239, 13, 9313, 428, 29897, 13, 6833, 558, 13, 29924, 6092, 29902, 13, 29940, 354, 29902, 13, 29990, 1251, 29902, 13, 29933, 29887, 5287, 13, 29950, 513, 5287, 13, 29888, 29896, 470, 29875, 13, 29886, 7239, 29941, 29899, 16616, 13, 29898, 29946, 29947, 29896, 29947, 25288, 29897, 13, 29940, 1111, 29902, 29871, 29947, 29953, 13, 29880, 1682, 29974, 13, 29940, 279, 29902, 29871, 29896, 29906, 29896, 13, 29900, 29955, 29946, 29953, 20449, 29900, 29947, 29918, 29946, 29909, 13, 29906, 29900, 29896, 29900, 3956, 29902, 13, 29906, 29900, 29900, 29946, 350, 314, 17628, 13, 7597, 29946, 29900, 5683, 13, 22678, 29898, 29909, 29897, 7182, 13, 29898, 1454, 21626, 29974, 1634, 9555, 29897, 13, 29950, 3274, 29902, 29871, 29896, 29929, 29900, 29906, 13, 29990, 2291, 29902, 29871, 29896, 29955, 29946, 29906, 13, 13080, 545, 29871, 29896, 29889, 282, 7239, 29941, 29899, 16616, 16510, 8607, 2910, 29889, 3462, 3245, 6139, 29901, 21626, 29974, 29892, 274, 29928, 3521, 8025, 278, 9120, 3974, 17652, 13, 29880, 1682, 9633, 559, 29936, 1913, 558, 29892, 18530, 21388, 5393, 626, 16447, 453, 262, 17711, 297, 382, 29889, 784, 29875, 29936, 285, 29896, 470, 29875, 29892, 3978, 310, 1634, 1414, 10723, 515, 977, 1166, 681, 13, 561, 482, 29936, 470, 29875, 29892, 3978, 310, 1634, 1414, 297, 382, 29889, 784, 29875, 29889, 826, 5727, 2629, 21626, 29974, 322, 278, 1913, 558, 18530, 12266, 278, 5305, 310, 1301, 3395, 29936, 13, 1552, 16578, 297, 278, 285, 29896, 470, 29875, 14088, 278, 5305, 310, 17971, 29928, 3521, 851, 392, 14710, 6656, 29889, 13, 29886, 7239, 29941, 29899, 16616, 16510, 922, 3910 ]
1,333,688
1,024
CommonCrawl
22
21
Reference Points: Promoter (none) Enhancer (none) Multiple cloning region Luciferase gene (luc+) 881740 GLprimer2 binding site SV40 late poly(A) signal RVprimer4 binding site ColE1-derived plasmid replication origin -lactamase gene (Amp ) 30803940 f1 origin upstream poly(A) signal 3.B. pGL3-Enhancer Vector The pGL3-Enhancer Vector contains an SV40 enhancer located downstream of luc+ and the poly(A) signal. This aids in the verification of functional promoter elements because the presence of an enhancer will often result in transcription of luc+ at higher levels. pGL3-Enhancer SV40 Enhancer Figure 2. The pGL3-Enhancer Vector circle map. Additional description: luc+, cDNA encoding the modified firefly luciferase; Ampr, gene conferring ampicillin resistance in E. coli; f1 ori, origin of replication derived from filamentous phage; ori, origin of plasmid replication in E. coli. Arrows within luc+ and the Ampr gene indicate the direction of transcription; the arrow in f1 ori indicates the direction of ssDNA strand synthesis. pGL3-Enhancer Vector Sequence Reference Points: Enhancer 20132249 3.C. pGL3-Promoter Vector The pGL3-Promoter Vector contains an SV40 promoter upstream of the luciferase gene. DNA fragments containing putative enhancer elements can be inserted either upstream or downstream of the promoter-luc+ transcriptional unit. pGL3-Promoter SV40 Promoter HindIII 245 NcoI 278 Figure 3. The pGL3-Promoter Vector circle map. Additional description: luc+, cDNA encoding the modified pGL3-Promoter Vector Sequence Reference Points: Promoter 48250 GLprimer2 binding region Luciferase gene (luc+) 2801932 RVprimer4 binding region 3.D. pGL3-Control Vector The pGL3-Control Vector contains SV40 promoter and enhancer sequences, resulting in strong expression of luc+ in many types of mammalian cells. This plasmid is useful in monitoring transfection efficiency, in general, and is a convenient internal standard for promoter and enhancer activities expressed by pGL3 recombinants. pGL3-Control HpaI 2094 XbaI 1934 Figure 4. pGL3-Control Vector circle map. Additional description: luc+, cDNA encoding the modified firefly phage; ori, origin of plasmid replication in E. coli. Arrows within luc+ and the Ampr gene indicate the direction of transcription; the arrow in f1 ori indicates the direction of ssDNA strand synthesis. pGL3-Control Vector Sequence Reference Points: RVprimer3 5 . . . CTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCTATCGATA GGTACCGAGCTCTTACGCGTGCTAGCCCGGGCTCGAGATCTGCGATCTAAGTAAGCTTGG . . . Acc65I XmaI BglII luc+ Coding Region CATTCCGGTACTGTTGGTAAAGCCACCATGGAAGACGCCAAAAACATAAAG . . . (1892bp) . . . GGATCCGTCGAC BamHI GLprimer2 CGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTC . . . 3 0756MA08_4A NcoI Figure 5. pGL3 Vector multiple cloning regions. Shown are the upstream and downstream cloning sites and the locations of the sequencing primers (GLprimer2, RVprimer3 and
-1.281586
0.520784
0.39476
1.024025
[ -1.2514528406443814, -1.311718559520327 ]
[ 0.6604531326543994, 0.3811150739700834 ]
[ 0.5012825361194428, 0.2882382899871642 ]
[ 1.076051910607754, 0.9719970998776386 ]
1,024
[ 512, 512 ]
[ 12105, 8984, 29879, 29901, 13, 18571, 17084, 12, 29898, 9290, 29897, 13, 2369, 5403, 2265, 12, 29898, 9290, 29897, 13, 15329, 552, 1067, 28259, 5120, 13, 29931, 1682, 9633, 559, 18530, 313, 29880, 1682, 28135, 12, 29947, 29947, 29896, 29955, 29946, 29900, 13, 7239, 558, 4193, 29906, 9956, 3268, 13, 7597, 29946, 29900, 5683, 15680, 29898, 29909, 29897, 7182, 13, 29934, 29963, 558, 4193, 29946, 9956, 3268, 13, 1625, 29923, 29896, 29899, 672, 2347, 715, 294, 6563, 1634, 1414, 3978, 13, 29899, 433, 312, 314, 559, 18530, 313, 29909, 1526, 1723, 12, 29941, 29900, 29947, 29900, 29941, 29929, 29946, 29900, 13, 29888, 29896, 3978, 13, 786, 5461, 15680, 29898, 29909, 29897, 7182, 13, 29941, 29889, 29933, 29889, 12, 29886, 7239, 29941, 29899, 2369, 5403, 2265, 16510, 13, 1576, 282, 7239, 29941, 29899, 2369, 5403, 2265, 16510, 3743, 385, 13955, 29946, 29900, 427, 5403, 2265, 5982, 1623, 5461, 310, 21626, 29974, 322, 278, 15680, 29898, 29909, 29897, 7182, 29889, 910, 263, 4841, 297, 13, 1552, 1147, 2450, 310, 13303, 2504, 17084, 3161, 1363, 278, 10122, 310, 385, 427, 5403, 2265, 674, 4049, 1121, 297, 1301, 3395, 13, 974, 21626, 29974, 472, 6133, 11174, 29889, 13, 29886, 7239, 29941, 29899, 2369, 5403, 2265, 13, 7597, 29946, 29900, 1174, 5403, 2265, 13, 13080, 545, 29871, 29906, 29889, 450, 282, 7239, 29941, 29899, 2369, 5403, 2265, 16510, 8607, 2910, 29889, 3462, 3245, 6139, 29901, 21626, 29974, 29892, 274, 29928, 3521, 8025, 278, 9120, 13, 8696, 17652, 21626, 9633, 559, 29936, 1913, 558, 29892, 18530, 21388, 5393, 626, 16447, 453, 262, 17711, 297, 382, 29889, 784, 29875, 29936, 285, 29896, 470, 29875, 29892, 3978, 310, 1634, 1414, 10723, 515, 13, 1777, 1166, 681, 1374, 482, 29936, 470, 29875, 29892, 3978, 310, 715, 294, 6563, 1634, 1414, 297, 382, 29889, 784, 29875, 29889, 826, 5727, 2629, 21626, 29974, 322, 278, 1913, 558, 18530, 12266, 278, 13, 20845, 310, 1301, 3395, 29936, 278, 16578, 297, 285, 29896, 470, 29875, 14088, 278, 5305, 310, 17971, 29928, 3521, 851, 392, 14710, 6656, 29889, 13, 29886, 7239, 29941, 29899, 2369, 5403, 2265, 16510, 922, 3910, 12105, 8984, 29879, 29901, 13, 2369, 5403, 2265, 12, 29906, 29900, 29896, 29941, 29906, 29906, 29946, 29929, 13, 29941, 29889, 29907, 29889, 12, 29886, 7239, 29941, 29899, 18571, 17084, 16510, 13, 1576, 282, 7239, 29941, 29899, 18571, 17084, 16510, 3743, 385, 13955, 29946, 29900, 2504, 17084, 701, 5461, 310, 278, 21626, 9633, 559, 18530, 29889, 25348, 22370, 6943, 13, 649, 1230, 427, 5403, 2265, 3161, 508, 367, 15478, 2845, 701, 5461, 470, 1623, 5461, 310, 278, 2504, 17084, 29899, 29880, 1682, 29974, 1301, 3395, 284, 5190, 29889, 13, 29886, 7239, 29941, 29899, 18571, 17084, 13, 7597, 29946, 29900, 9705, 17084, 13, 29950, 513, 5287, 29871, 29906, 29946, 29945, 13, 29940, 1111, 29902, 29871, 29906, 29955, 29947, 13, 13080, 545, 29871, 29941, 29889, 450, 282, 7239, 29941, 29899, 18571, 17084, 16510, 8607, 2910, 29889, 3462, 3245, 6139, 29901, 21626, 29974, 29892, 274, 29928, 3521, 8025, 278, 9120, 13, 29886, 7239, 29941, 29899, 18571, 17084, 16510, 922, 3910, 12105, 8984, 29879, 29901, 13, 18571, 17084, 12, 29946, 29947, 29906, 29945, 29900, 13, 7239, 558, 4193, 29906, 9956, 5120, 13, 29931, 1682, 9633, 559, 18530, 313, 29880, 1682, 28135, 12, 29906, 29947, 29900, 29896, 29929, 29941, 29906, 13, 29934, 29963, 558, 4193, 29946, 9956, 5120, 13, 29941, 29889, 29928, 29889, 12, 29886, 7239, 29941, 29899, 4809, 16510, 13, 1576, 282, 7239, 29941, 29899, 4809, 16510, 3743, 13955, 29946, 29900, 2504, 17084, 322, 427, 5403, 2265, 15602, 29892, 9819, 297, 4549, 4603, 310, 21626, 29974, 297, 13, 13011, 4072, 310, 286, 4850, 284, 713, 9101, 29889, 910, 715, 294, 6563, 338, 5407, 297, 29652, 1301, 20309, 19201, 29892, 297, 2498, 29892, 322, 338, 263, 13, 535, 854, 993, 7463, 3918, 363, 2504, 17084, 322, 427, 5403, 2265, 14188, 13384, 491, 282, 7239, 29941, 27878, 2109, 1934, 29889, 13, 29886, 7239, 29941, 29899, 4809, 13, 29950, 3274, 29902, 29871, 29906, 29900, 29929, 29946, 1060, 2291, 29902, 29871, 29896, 29929, 29941, 29946, 13, 13080, 545, 29871, 29946, 29889, 282, 7239, 29941, 29899, 4809, 16510, 8607, 2910, 29889, 3462, 3245, 6139, 29901, 21626, 29974, 29892, 274, 29928, 3521, 8025, 278, 9120, 3974, 17652, 13, 561, 482, 29936, 470, 29875, 29892, 3978, 310, 715, 294, 6563, 1634, 1414, 297, 382, 29889, 784, 29875, 29889, 826, 5727, 2629, 21626, 29974, 322, 278, 1913, 558, 18530, 12266, 278, 5305, 310, 13, 3286, 3395, 29936, 278, 16578, 297, 285, 29896, 470, 29875, 14088, 278, 5305, 310, 17971, 29928, 3521, 851, 392, 14710, 6656, 29889, 13, 29886, 7239, 29941, 29899, 4809, 16510, 922, 3910, 12105, 8984, 29879, 29901, 13, 29934, 29963, 558, 4193, 29941, 13, 29945, 869, 869, 869, 315, 16881, 5454, 6344, 8254, 26788, 1783, 23799, 4174, 4174, 10051, 29911, 29954, 5454, 10051, 29911, 29954, 5454, 29954, 23799, 29954, 4174, 10051, 29909, 2477, 1299, 19988, 1783, 1783, 1299, 11135, 8254, 13, 26788, 8687, 11135, 10051, 1783, 1783, 8687, 8766, 23799, 29954, 1783, 10051, 4174, 11135, 26788, 1783, 11135, 10051, 1299, 1783, 8766, 29954, 1299, 1783, 6344, 29954, 6040, 10051, 1783, 29911, 26788, 869, 869, 869, 13, 7504, 29953, 29945, 29902, 13, 29990, 655, 29902, 13, 29933, 3820, 2687, 13, 29880, 1682, 29974, 315, 3689, 11069, 13, 23972, 29911, 4174, 26788, 6040, 1783, 29954, 19988, 26788, 6040, 6344, 29954, 4174, 2477, 23972, 26788, 6344, 29954, 2477, 29954, 4174, 23184, 2477, 1299, 6344, 10051, 869, 869, 869, 313, 29896, 29947, 29929, 29906, 25288, 29897, 869, 869, 869, 402, 29954, 1299, 4174, 29954, 9472, 29954, 2477, 13, 29933, 314, 17628, 13, 7239, 558, 4193, 29906, 13, 11135, 1299, 29954, 4174, 1783, 29911, 29954, 10051, 29909, 8766, 1783, 29911, 5454, 2477, 4174, 10051, 29911, 5454, 29954, 1783, 29907, 1783, 29911, 4174, 29954, 23799, 26788, 8766, 8766, 26788, 29954, 8766, 1299, 12739, 1783, 1299, 11135, 9472, 869, 869, 869, 29871, 29941, 13, 29900, 29955, 29945, 29953, 1529, 29900, 29947, 29918, 29946, 29909, 13, 29940, 1111, 29902, 13, 13080, 545, 29871, 29945, 29889, 282, 7239, 29941, 16510, 2999, 1067, 28259, 12786, 29889, 1383, 776, 526, 278, 701, 5461, 322, 1623, 5461, 1067, 28259, 11840, 322, 13, 1552, 14354, 310, 278, 8617, 16750, 1903, 414, 313, 7239, 558, 4193, 29906, 29892, 390, 29963, 558, 4193, 29941, 322 ]
1,333,688
2,048
CommonCrawl
22
21
RVprimer4). The large primer arrows indicate the direction of sequencing. The positions of the promoter (in the pGL3-Promoter and pGL3-Control Vectors) and the enhancer (in the pGL3-Enhancer and pGL3-Control Vectors) are shown as insertions into the sequence of the pGL3-Basic Vector. (Note that the promoter replaces four bases [AAGT] of the pGL3-Basic Vector.) The sequence shown is of the DNA strand generated from the f1 ori. Cloning Methods 4.A. Cloning Strategies The restriction sites for XhoI and SalI have compatible ends, as do BglII and BamHI. Therefore, cloning into the XhoI or BglII sites upstream of luc+, or the downstream SalI or BamHI sites, allows easy interchange of DNA inserts between upstream and downstream positions relative to the luciferase reporter gene. Thus, positional effects of a putative genetic element may be readily tested. Cloning fragments into a single site will generally yield both possible orientations relative to the reporter gene, making these effects also readily testable. The other upstream restriction sites may be used for cloning. However, note that some of the sites are required for generating nested deletions (see Section 8.D). Specifically, the KpnI or SacI site is needed to generate a 3 overhang upstream of the insert. Please refer to Sections 8.GJ for additional information on XhoI digestion. 4.B. Preparation of pGL3 Vectors and Insert DNA for Cloning The fragment and vector DNA should be digested with restriction enzymes that will generate compatible ends for cloning. In some cases, the ends of the DNA fragment may require modification, either by using synthetic linkers, by a PCR amplification using primers containing sites for appropriate restriction enzymes, or by filling in the restriction site overhangs. It may be advantageous to treat the vector DNA with calf intestinal alkaline phosphatase (CIAP; Cat.# M2825) or TSAP Thermosensitive Alkaline Phosphatase (Cat.# M9910) to remove 5 phosphate groups, thus preventing reclosure of the vector on itself without an insert. Sufficient DNA should be prepared to perform control reactions for digestion, ligation and transformation steps. To ensure capture of the correct insert DNA, the desired restriction fragment can be purified by electrophoresis on an acrylamide or agarose gel and then recovered from the gel by one of several methods, such as using the Wizard PCR Preps DNA Purification System Technical Bulletin #TB118. Alternatively, unfractionated restriction fragments can be cloned into the target plasmid, and the desired recombinant then can be identified by gel electrophoresis of plasmid Protocols for restriction digestion, alkaline phosphatase treatment, linker ligation and transformation of competent cells can be found in Molecular Cloning, A Laboratory Manual (1). 4.C. Transformation Protocols for pGL3 Vectors Because the Luciferase Reporter Vectors are supplied as modified DNA, E. coli hosts may be either restriction + or restriction . The use of a recA host such as JM109 is preferred because this prevents undesirable recombination between the insert and the host chromosomal DNA. A strain that has an F episome is required for ssDNA production. Grow JM109 on minimal plates (M-9) supplemented with 1.0mM thiamine-HCl prior to preparation of competent cells and transformation. This selects for the presence of the F episome. 4.D. Isolation of Plasmid DNA The Wizard Plus SV Minipreps DNAPurification System (Cat.# A1340, A1470) may be used for small-scale preparation of plasmid DNA for screening clones. DNA suitable for transfection may be purified using the PureYield Plasmid Midipreps System (Cat.# A2492, A2495). Transfection of Mammalian Cells Transfection of DNA into eukaryotic cells may be mediated by cation
-0.763848
0.250399
1.079545
1.29977
[ -0.8186354050807731, -0.7090613707608724 ]
[ 0.2127959873269698, 0.288002387741978 ]
[ 0.993313295043991, 1.1657776847701213 ]
[ 1.2841615320679847, 1.3153779752870194 ]
1,024
[ 512, 512 ]
[ 390, 29963, 558, 4193, 29946, 467, 450, 2919, 7130, 564, 5727, 12266, 13, 1552, 5305, 310, 8617, 16750, 29889, 450, 11909, 310, 278, 2504, 17084, 313, 262, 278, 282, 7239, 29941, 29899, 18571, 17084, 322, 282, 7239, 29941, 29899, 4809, 478, 11142, 29897, 322, 13, 1552, 427, 5403, 2265, 313, 262, 278, 282, 7239, 29941, 29899, 2369, 5403, 2265, 322, 282, 7239, 29941, 29899, 4809, 478, 11142, 29897, 526, 4318, 408, 4635, 1080, 964, 278, 5665, 310, 278, 13, 29886, 7239, 29941, 29899, 16616, 16510, 29889, 313, 9842, 393, 278, 2504, 17084, 1634, 6048, 3023, 22561, 518, 6344, 23799, 29962, 310, 278, 282, 7239, 29941, 29899, 16616, 16510, 1846, 450, 5665, 13, 845, 776, 338, 310, 278, 25348, 851, 392, 5759, 515, 278, 285, 29896, 470, 29875, 29889, 13, 6821, 28259, 8108, 29879, 13, 29946, 29889, 29909, 29889, 12, 6821, 28259, 3767, 1845, 583, 13, 1576, 24345, 11840, 363, 1060, 1251, 29902, 322, 3956, 29902, 505, 15878, 10614, 29892, 408, 437, 350, 3820, 2687, 322, 350, 314, 17628, 29889, 7857, 29892, 1067, 28259, 964, 278, 1060, 1251, 29902, 13, 272, 350, 3820, 2687, 11840, 701, 5461, 310, 21626, 29974, 29892, 470, 278, 1623, 5461, 3956, 29902, 470, 350, 314, 17628, 11840, 29892, 6511, 4780, 1006, 3167, 310, 25348, 13534, 1372, 13, 14811, 701, 5461, 322, 1623, 5461, 11909, 6198, 304, 278, 21626, 9633, 559, 1634, 9555, 18530, 29889, 6549, 29892, 2602, 284, 9545, 310, 263, 13, 649, 1230, 2531, 7492, 1543, 1122, 367, 28520, 9528, 29889, 2233, 28259, 22370, 964, 263, 2323, 3268, 674, 6892, 7709, 1716, 1950, 13, 12236, 800, 6198, 304, 278, 1634, 9555, 18530, 29892, 3907, 1438, 9545, 884, 28520, 1243, 519, 29889, 13, 1576, 916, 701, 5461, 24345, 11840, 1122, 367, 1304, 363, 1067, 28259, 29889, 2398, 29892, 4443, 393, 777, 310, 278, 11840, 526, 3734, 363, 13, 4738, 1218, 9322, 7374, 1080, 313, 4149, 9779, 29871, 29947, 29889, 29928, 467, 26321, 29892, 278, 476, 21257, 29902, 470, 15573, 29902, 3268, 338, 4312, 304, 5706, 263, 29871, 29941, 975, 11895, 13, 786, 5461, 310, 278, 4635, 29889, 13, 12148, 2737, 304, 922, 1953, 29871, 29947, 29889, 29954, 29967, 363, 5684, 2472, 373, 1060, 1251, 29902, 4697, 602, 29889, 13, 29946, 29889, 29933, 29889, 12, 6572, 862, 362, 310, 282, 7239, 29941, 478, 11142, 322, 24505, 25348, 363, 2233, 28259, 13, 1576, 9376, 322, 4608, 25348, 881, 367, 4697, 2868, 411, 24345, 427, 14022, 267, 393, 674, 5706, 15878, 10614, 363, 13, 695, 28259, 29889, 512, 777, 4251, 29892, 278, 10614, 310, 278, 25348, 9376, 1122, 1996, 21733, 29892, 2845, 491, 773, 14710, 7492, 1544, 414, 29892, 491, 13, 29874, 9609, 29934, 20563, 2450, 773, 1903, 414, 6943, 11840, 363, 8210, 24345, 427, 14022, 267, 29892, 470, 491, 27523, 297, 278, 24345, 13, 2746, 975, 11895, 29879, 29889, 739, 1122, 367, 10631, 681, 304, 7539, 278, 4608, 25348, 411, 1208, 29888, 938, 342, 979, 394, 11311, 457, 1374, 25715, 271, 559, 313, 8426, 3301, 29936, 13, 9694, 29889, 29937, 341, 29906, 29947, 29906, 29945, 29897, 470, 323, 29903, 3301, 498, 837, 359, 575, 3321, 838, 11311, 457, 1963, 25715, 271, 559, 313, 9694, 29889, 29937, 341, 29929, 29929, 29896, 29900, 29897, 304, 3349, 29871, 29945, 1374, 25715, 403, 6471, 29892, 4550, 13, 18921, 292, 337, 25071, 310, 278, 4608, 373, 3528, 1728, 385, 4635, 29889, 2166, 4543, 25348, 881, 367, 13240, 304, 2189, 2761, 13, 5638, 1953, 363, 4697, 602, 29892, 14172, 362, 322, 13852, 6576, 29889, 13, 1762, 9801, 10446, 310, 278, 1959, 4635, 25348, 29892, 278, 7429, 24345, 9376, 508, 367, 3708, 2164, 491, 3546, 19783, 2361, 275, 373, 385, 13, 562, 719, 5288, 680, 470, 946, 279, 852, 9127, 322, 769, 24776, 515, 278, 9127, 491, 697, 310, 3196, 3519, 29892, 1316, 408, 773, 278, 399, 17909, 9609, 29934, 13, 6572, 567, 25348, 15247, 2450, 2184, 8364, 936, 8313, 27106, 396, 24895, 29896, 29896, 29947, 29889, 20360, 29892, 29395, 13857, 630, 24345, 22370, 508, 367, 13, 695, 22367, 964, 278, 3646, 715, 294, 6563, 29892, 322, 278, 7429, 27878, 2109, 424, 769, 508, 367, 15659, 491, 9127, 3546, 19783, 2361, 275, 310, 715, 294, 6563, 13, 17830, 29879, 363, 24345, 4697, 602, 29892, 394, 11311, 457, 1374, 25715, 271, 559, 14502, 29892, 29060, 14172, 362, 322, 13852, 310, 5100, 296, 13, 3729, 29879, 508, 367, 1476, 297, 341, 1772, 16637, 2233, 28259, 29892, 319, 16715, 7606, 2315, 950, 313, 29896, 467, 13, 29946, 29889, 29907, 29889, 12, 4300, 5404, 1019, 5770, 29879, 363, 282, 7239, 29941, 478, 11142, 13, 29933, 5658, 278, 10315, 9633, 559, 830, 18505, 478, 11142, 526, 19056, 408, 9120, 25348, 29892, 382, 29889, 784, 29875, 18982, 1122, 367, 2845, 24345, 718, 470, 13, 5060, 19902, 869, 450, 671, 310, 263, 1162, 29909, 3495, 1316, 408, 435, 29924, 29896, 29900, 29929, 338, 16389, 1363, 445, 28057, 563, 267, 27797, 27878, 2109, 362, 13, 14811, 278, 4635, 322, 278, 3495, 25173, 359, 290, 284, 25348, 29889, 319, 5312, 262, 393, 756, 385, 383, 6010, 608, 338, 3734, 363, 17971, 29928, 3521, 5802, 29889, 13, 29954, 798, 435, 29924, 29896, 29900, 29929, 373, 13114, 715, 1078, 313, 29924, 29899, 29929, 29897, 1462, 944, 287, 411, 29871, 29896, 29889, 29900, 29885, 29924, 266, 2829, 457, 29899, 29950, 6821, 7536, 304, 10223, 362, 310, 5100, 296, 13, 3729, 29879, 322, 13852, 29889, 910, 27778, 363, 278, 10122, 310, 278, 383, 6010, 608, 29889, 13, 29946, 29889, 29928, 29889, 12, 29902, 2929, 362, 310, 1858, 294, 6563, 25348, 13, 1576, 399, 17909, 15113, 13955, 3080, 666, 276, 567, 360, 29940, 3301, 332, 2450, 2184, 313, 9694, 29889, 29937, 319, 29896, 29941, 29946, 29900, 29892, 319, 29896, 29946, 29955, 29900, 29897, 1122, 367, 1304, 363, 2319, 29899, 7052, 13, 1457, 862, 362, 310, 715, 294, 6563, 25348, 363, 4315, 292, 1067, 2873, 29889, 25348, 13907, 363, 1301, 20309, 1122, 367, 3708, 2164, 773, 278, 349, 545, 29979, 969, 13, 3247, 294, 6563, 13370, 666, 276, 567, 2184, 313, 9694, 29889, 29937, 319, 29906, 29946, 29929, 29906, 29892, 319, 29906, 29946, 29929, 29945, 467, 13, 4300, 20309, 310, 341, 4850, 284, 713, 315, 10071, 13, 4300, 20309, 310, 25348, 964, 321, 2679, 653, 13574, 9101, 1122, 367, 14457, 630, 491, 274, 362 ]
1,333,688
3,072
CommonCrawl
22
21
ic lipid compounds (2), calcium phosphate (3,4), DEAE-dextran (3,5), or electroporation (4). Transfection systems based on cationic lipids (TransFast Transfection Reagent, Transfectam Reagent and Tfx Reagents) and calcium phosphate (Profection Mammalian Transfection System) are available from Promega. For more information on these transfection reagents, please request the TransFast Transfection Reagent Technical Bulletin (#TB260), the Transfectam Reagent Technical Bulletin (#TB116), the Tfx-Reagents Technical Bulletin (#TB216) or the ProFection Mammalian Transfection System Technical Manual (#TM012). All of these documents are available on our web site at: www.promega.com/protocols/ Assay of Luciferase Activity Experimental strategies using firefly luciferase may involve the analysis of a few samples per day or as many as several thousand samples per hour, and equipment used to measure luminescence may vary from inexpensive, single-sample luminometers to high-end CCD luminometers. To support this wide range of applications, we have developed three luciferase assays with different, but complementary, characteristics: Luciferase Assay System (Cat.# E1500), Bright-Glo Luciferase Assay System (Cat.# E2610), Steady-Glo Luciferase Assay System (Cat.# E2510), and ONE-Glo Luciferase Assay System (Cat.# E6110). Reagent choice depends on the relative importance of experimental format, assay sensitivity, and luminescence duration. Table 1. Characteristics of Promega Luciferase Assay Reagents. Bright-Glo Steady-Glo NH or H batch or continuous Number of Steps Signal Half-Life Cell Lysis Time Luciferase Assay ONE-Glo ~2 minutes NH = nonhomogeneous (first create a lysate); H = homogeneous; NA = not applicable Assay of Luciferase Activity (continued) The Luciferase Assay System has long been the standard reagent for routine laboratory analysis. Before using this reagent, cells from which the luciferase is to be measured must be washed and lysed. This reagent was optimized for high sensitivity in nonhomogeneous, single-sample measurements. The Luciferase Assay System requires a luminometer fitted with injectors to efficiently measure luminescence in 96-well plates. The Bright-Glo, Steady-Glo and ONE-Glo Reagents were developed to perform assay reactions within multiwell plates and in the presence of complete cell culture medium: no cell preparation steps such as washing or lysing are required before the luminescence reaction is initiated. All of these are single-step reagents, requiring only addition of the reagent before measuring luminescence. This makes them ideal reagents for efficient and precise quantitation in 96-, 384- and 1536-well plates. The Bright-Glo and Steady-Glo Reagents are complementary in their characteristics based on the inverse relationship between luminescence duration and assay sensitivity (6). Generally, as the half-life of the luminescence increases, assay sensitivity decreases. The Steady-Glo Reagent provides long luminescence duration (changing only about 10% per hour); however, to achieve this long luminescence duration, the assay sensitivity must be reduced. This reagent was designed for experiments in which many microplates are processed as a batch. In contrast, the Bright-Glo Reagent provides high assay sensitivity with shorter luminescence duration (<10% decrease per 5 minutes). This reagent is designed for general research applications and for experiments using robotics for continuous sample processing. Furthermore, as a result of increased sample capacity, the Bright-Glo Reagent provides greater assay sensitivity than the Luciferase Assay Reagent in most applications (6). The ONE-Glo Reagent provides the ultimate performance for luciferase assays. It features a high-
-0.615581
0.151019
0.978096
0.951186
[ -0.9720390531286344, -0.2591229923347795 ]
[ 0.18772718718863374, 0.11431141535493529 ]
[ 0.7802690489117124, 1.1759226488716583 ]
[ 0.9199696945125809, 0.9824025809506501 ]
1,024
[ 512, 512 ]
[ 293, 619, 5935, 752, 3885, 313, 29906, 511, 15835, 398, 1374, 25715, 403, 313, 29941, 29892, 29946, 511, 13, 2287, 16036, 29899, 311, 486, 661, 313, 29941, 29892, 29945, 511, 470, 3546, 1336, 12418, 313, 29946, 467, 4103, 20309, 6757, 2729, 373, 274, 362, 293, 17441, 4841, 313, 4300, 29943, 579, 4103, 20309, 13, 1123, 14748, 29892, 4103, 3647, 314, 830, 14748, 322, 323, 11093, 830, 351, 1237, 29897, 322, 15835, 398, 1374, 25715, 403, 313, 1184, 20309, 341, 4850, 284, 713, 4103, 20309, 13, 3924, 29897, 526, 3625, 515, 9705, 2442, 29889, 1152, 901, 2472, 373, 1438, 1301, 20309, 337, 351, 1237, 29892, 3113, 2009, 278, 13, 4300, 29943, 579, 4103, 20309, 830, 14748, 8364, 936, 8313, 27106, 313, 29937, 24895, 29906, 29953, 29900, 511, 278, 4103, 3647, 314, 830, 14748, 8364, 936, 8313, 27106, 13, 29898, 29937, 24895, 29896, 29896, 29953, 511, 278, 323, 11093, 29899, 1123, 351, 1237, 8364, 936, 8313, 27106, 313, 29937, 24895, 29906, 29896, 29953, 29897, 470, 278, 1019, 8263, 428, 341, 4850, 284, 713, 4103, 20309, 2184, 13, 7141, 3049, 936, 2315, 950, 313, 29937, 23081, 29900, 29896, 29906, 467, 2178, 310, 1438, 10701, 526, 3625, 373, 1749, 1856, 3268, 472, 29901, 13, 1636, 29889, 14032, 2442, 29889, 510, 29914, 20464, 29879, 29914, 13, 7900, 388, 310, 10315, 9633, 559, 13414, 13, 1252, 27910, 16650, 583, 773, 3974, 17652, 21626, 9633, 559, 1122, 25135, 278, 7418, 310, 263, 2846, 11916, 639, 2462, 470, 408, 1784, 408, 3196, 13, 386, 681, 392, 11916, 639, 7234, 29892, 322, 21083, 1304, 304, 5645, 19703, 1475, 29883, 663, 1122, 13100, 515, 297, 4548, 6270, 29892, 2323, 29899, 11249, 13, 29880, 9735, 290, 2699, 304, 1880, 29899, 355, 315, 6530, 301, 9735, 290, 2699, 29889, 1763, 2304, 445, 9377, 3464, 310, 8324, 29892, 591, 505, 8906, 2211, 13, 29880, 1682, 9633, 559, 1223, 1036, 411, 1422, 29892, 541, 19595, 653, 29892, 21862, 29901, 10315, 9633, 559, 4007, 388, 2184, 313, 9694, 29889, 29937, 382, 29896, 29945, 29900, 29900, 511, 13, 29933, 1266, 29899, 29954, 417, 10315, 9633, 559, 4007, 388, 2184, 313, 9694, 29889, 29937, 382, 29906, 29953, 29896, 29900, 511, 2443, 3714, 29899, 29954, 417, 10315, 9633, 559, 4007, 388, 2184, 313, 9694, 29889, 29937, 382, 29906, 29945, 29896, 29900, 511, 322, 13, 12413, 29899, 29954, 417, 10315, 9633, 559, 4007, 388, 2184, 313, 9694, 29889, 29937, 382, 29953, 29896, 29896, 29900, 467, 830, 14748, 7348, 7111, 373, 278, 6198, 13500, 310, 13, 735, 27910, 3402, 29892, 1223, 388, 4771, 24858, 29892, 322, 19703, 1475, 29883, 663, 14385, 29889, 13, 3562, 29871, 29896, 29889, 26804, 6765, 310, 9705, 2442, 10315, 9633, 559, 4007, 388, 830, 351, 1237, 29889, 13, 29933, 1266, 29899, 29954, 417, 13, 7789, 3714, 29899, 29954, 417, 13, 29940, 29950, 470, 379, 13, 16175, 470, 9126, 13, 4557, 310, 2443, 567, 13, 10140, 284, 28144, 29899, 26754, 13, 4617, 365, 4848, 5974, 13, 29931, 1682, 9633, 559, 4007, 388, 13, 12413, 29899, 29954, 417, 13, 30022, 29906, 6233, 13, 29940, 29950, 353, 1661, 9706, 23724, 313, 4102, 1653, 263, 301, 952, 403, 416, 379, 353, 3632, 23724, 29936, 8598, 353, 451, 22903, 13, 7900, 388, 310, 10315, 9633, 559, 13414, 313, 1285, 262, 6742, 29897, 13, 1576, 10315, 9633, 559, 4007, 388, 2184, 756, 1472, 1063, 278, 3918, 337, 14748, 363, 26529, 10212, 7606, 7418, 29889, 10949, 773, 445, 13, 276, 14748, 29892, 9101, 515, 607, 278, 21626, 9633, 559, 338, 304, 367, 17005, 1818, 367, 471, 17143, 322, 301, 952, 287, 29889, 910, 337, 14748, 471, 27545, 363, 13, 9812, 4771, 24858, 297, 1661, 9706, 23724, 29892, 2323, 29899, 11249, 20398, 29889, 450, 10315, 9633, 559, 4007, 388, 2184, 6858, 263, 13, 29880, 9735, 8328, 25890, 411, 11658, 943, 304, 29497, 5645, 19703, 1475, 29883, 663, 297, 29871, 29929, 29953, 29899, 5872, 715, 1078, 29889, 13, 1576, 29258, 29899, 29954, 417, 29892, 2443, 3714, 29899, 29954, 417, 322, 6732, 29923, 29899, 29954, 417, 830, 351, 1237, 892, 8906, 304, 2189, 1223, 388, 337, 7387, 2629, 2473, 5872, 13, 9884, 322, 297, 278, 10122, 310, 4866, 3038, 9257, 18350, 29901, 694, 3038, 10223, 362, 6576, 1316, 408, 471, 2790, 470, 301, 952, 292, 526, 13, 12403, 1434, 278, 19703, 1475, 29883, 663, 19848, 338, 14511, 630, 29889, 2178, 310, 1438, 526, 2323, 29899, 10568, 337, 351, 1237, 29892, 26795, 871, 6124, 310, 13, 1552, 337, 14748, 1434, 7540, 3864, 19703, 1475, 29883, 663, 29889, 910, 3732, 963, 10839, 337, 351, 1237, 363, 8543, 322, 18378, 4323, 7018, 297, 13, 29929, 29953, 15767, 29871, 29941, 29947, 29946, 29899, 322, 29871, 29896, 29945, 29941, 29953, 29899, 5872, 715, 1078, 29889, 13, 1576, 29258, 29899, 29954, 417, 322, 2443, 3714, 29899, 29954, 417, 830, 351, 1237, 526, 19595, 653, 297, 1009, 21862, 2729, 373, 278, 16402, 13, 2674, 800, 4034, 1546, 19703, 1475, 29883, 663, 14385, 322, 1223, 388, 4771, 24858, 313, 29953, 467, 3251, 635, 29892, 408, 278, 4203, 29899, 19264, 310, 278, 19703, 1475, 29883, 663, 13, 262, 1037, 2129, 29892, 1223, 388, 4771, 24858, 9263, 2129, 29889, 450, 2443, 3714, 29899, 29954, 417, 830, 14748, 8128, 1472, 19703, 1475, 29883, 663, 14385, 313, 305, 9776, 871, 13, 12717, 29871, 29896, 29900, 29995, 639, 7234, 416, 3138, 29892, 304, 6176, 445, 1472, 19703, 1475, 29883, 663, 14385, 29892, 278, 1223, 388, 4771, 24858, 1818, 367, 12212, 29889, 910, 13, 276, 14748, 471, 8688, 363, 15729, 297, 607, 1784, 9200, 9884, 526, 19356, 408, 263, 9853, 29889, 13, 797, 12814, 29892, 278, 29258, 29899, 29954, 417, 830, 14748, 8128, 1880, 1223, 388, 4771, 24858, 411, 20511, 19703, 1475, 29883, 663, 14385, 13, 29898, 29966, 29896, 29900, 29995, 23806, 639, 29871, 29945, 6233, 467, 910, 337, 14748, 338, 8688, 363, 2498, 5925, 8324, 322, 363, 15729, 773, 13, 307, 7451, 1199, 363, 9126, 4559, 9068, 29889, 16478, 29892, 408, 263, 1121, 310, 11664, 4559, 13284, 29892, 278, 29258, 29899, 29954, 417, 13, 1123, 14748, 8128, 7621, 1223, 388, 4771, 24858, 1135, 278, 10315, 9633, 559, 4007, 388, 830, 14748, 297, 1556, 8324, 313, 29953, 467, 13, 1576, 6732, 29923, 29899, 29954, 417, 830, 14748, 8128, 278, 8494, 6490, 4180, 363, 21626, 9633, 559, 1223, 1036, 29889, 739, 5680, 263, 1880, 29899 ]
1,333,688
4,096
CommonCrawl
22
21
sensitivity assay with extended duration. The ONE-Glo Reagent also demonstrates more robust performance and provides reagent handling enhancements. The Luciferase Assay System, Bright-Glo Reagent, Steady-Glo Reagent and ONE-Glo Reagent provide the highest standards in assay quantitation, sensitivity and convenience. Since these reagents are based on the same underlying design principles, different reagents can be used as experimental needs change. For more information, request the Luciferase Assay System Technical Bulletin #TB281, the Steady-Glo Luciferase Assay System Technical Manual #TM051, the Bright-Glo Luciferase Assay System Technical Manual #TM052, or the ONE-Glo Luciferase Assay System Technical Manual #TM292. When studying promoter functionalities, it is often desirable to include a second reporter (e.g., Renilla luciferase) as an internal control for normalization. Plasmids derived from pGL3 or pGL4 vectors can be co-transfected with Renilla luciferase vectors, such as phRL-TK, and assayed using the Dual-Luciferase Reporter Assay System (Cat.# E1910) or the Dual-Glo Luciferase Assay System (Cat.# E2920). Table 2. Characteristics of Promega Dual-Luciferase Assays. Dual-Luciferase Assay Dual-Glo Assay Signal Half-Lifefirefly Signal Half-LifeRenilla ~10 minutes maximum NH = nonhomogeneous (first create a lysate); H = homogeneous Sequencing of Luciferase Reporter Vectors You may desire to sequence the DNA inserted into the Luciferase Reporter Vectors. Two examples of such applications are to determine the exact position of generated deletions and to confirm production of a site-specific mutation. Three primers are available for sequencing the pGL3 Vectors: RVprimer3 (Reporter Vector Primer 3) for sequencing clockwise across the upstream cloning sites, RVprimer4 for sequencing counterclockwise across the BamHI and SalI cloning sites downstream of luc+, and GLprimer2 for sequencing counterclockwise upstream of luc+. RVprimer3 5-CTAGCAAAATAGGCTGTCCC-3 RVprimer4 5-GACGATAGTCATGCCCCGCG-3 GLprimer2 5-CTTTATGTTTTTGGCGTCTTCCA-3 RVprimer3 is especially useful for identifying positions of nested deletions. Note: All three primers can be used for dsDNA sequencing, but only RVprimer4 and GLprimer2 also may be used for ssDNA sequencing. 8.A. Common Structural Elements of the pGL3 Luciferase Reporter Vectors Except for the inclusion of promoters and enhancers, the four pGL3 Luciferase Reporter Vectors are structurally identical. Each plasmids distinguishing features are summarized in Section 3. The pGL3 Vectors each contain a high-copy-number prokaryotic origin of replication for maintenance in E. coli, an ampicillin-resistance gene for selection, and a filamentous phage origin of replication (f1 ori) for single-stranded DNA (ssDNA) production. Restriction sites for insertion of DNA fragments are located upstream and downstream of the luciferase gene. Two of the upstream sites (XhoI and BglII) yield cohesive ends compatible with the downstream sites (SalI and BamHI, respectively), allowing the interchange of the DNA insert for rapid analysis of positional effects. Improved Expression Level with the pGL3-Control Vector Average Relative Light Units Construct Transfected Figure 6. Comparison of luciferase activities expressed in HeLa cells transfected with the pGL2-Control and pGL3-Control Reporter Vectors. The expression level of luc+ is dramatically higher with the pGL3-Control Vectors. In repeated experiments with several cell lines, we observed 20- to 100-fold higher
-0.534428
0.501087
1.018676
1.117674
[ -0.3460973820762008, -0.7227581250508599 ]
[ 0.43841518857199435, 0.5637591892636746 ]
[ 1.0541830796532135, 0.9831683309424539 ]
[ 1.003213543096673, 1.232134126702927 ]
1,024
[ 512, 512 ]
[ 23149, 24858, 1223, 388, 13, 2541, 10410, 14385, 29889, 450, 6732, 29923, 29899, 29954, 417, 830, 14748, 884, 9004, 1078, 901, 16424, 4180, 322, 8128, 337, 14748, 13, 3179, 1847, 26371, 4564, 4110, 29889, 13, 1576, 10315, 9633, 559, 4007, 388, 2184, 29892, 29258, 29899, 29954, 417, 830, 14748, 29892, 2443, 3714, 29899, 29954, 417, 830, 14748, 322, 6732, 29923, 29899, 29954, 417, 830, 14748, 3867, 278, 9939, 13, 1689, 3163, 297, 1223, 388, 4323, 7018, 29892, 4771, 24858, 322, 29703, 29889, 4001, 1438, 337, 351, 1237, 526, 2729, 373, 278, 1021, 14407, 13, 13892, 18671, 29892, 1422, 337, 351, 1237, 508, 367, 1304, 408, 17986, 4225, 1735, 29889, 1152, 901, 2472, 29892, 2009, 278, 13, 29931, 1682, 9633, 559, 4007, 388, 2184, 8364, 936, 8313, 27106, 396, 24895, 29906, 29947, 29896, 29892, 278, 2443, 3714, 29899, 29954, 417, 10315, 9633, 559, 4007, 388, 2184, 8364, 936, 2315, 950, 13, 29937, 23081, 29900, 29945, 29896, 29892, 278, 29258, 29899, 29954, 417, 10315, 9633, 559, 4007, 388, 2184, 8364, 936, 2315, 950, 396, 23081, 29900, 29945, 29906, 29892, 470, 278, 6732, 29923, 29899, 29954, 417, 10315, 9633, 559, 4007, 388, 13, 3924, 8364, 936, 2315, 950, 396, 23081, 29906, 29929, 29906, 29889, 13, 10401, 23382, 2504, 17084, 13303, 1907, 29892, 372, 338, 4049, 553, 27797, 304, 3160, 263, 1473, 1634, 9555, 313, 29872, 29889, 29887, 1696, 7493, 2911, 21626, 9633, 559, 29897, 408, 385, 13, 7564, 2761, 363, 4226, 2133, 29889, 1858, 11625, 4841, 10723, 515, 282, 7239, 29941, 470, 282, 7239, 29946, 12047, 508, 367, 1302, 29899, 3286, 3647, 287, 411, 7493, 2911, 13, 29880, 1682, 9633, 559, 12047, 29892, 1316, 408, 1374, 2241, 29899, 29911, 29968, 29892, 322, 1223, 388, 287, 773, 278, 360, 950, 29899, 29931, 1682, 9633, 559, 830, 18505, 4007, 388, 2184, 313, 9694, 29889, 29937, 382, 29896, 29929, 29896, 29900, 29897, 470, 13, 1552, 360, 950, 29899, 29954, 417, 10315, 9633, 559, 4007, 388, 2184, 313, 9694, 29889, 29937, 382, 29906, 29929, 29906, 29900, 467, 13, 3562, 29871, 29906, 29889, 26804, 6765, 310, 9705, 2442, 360, 950, 29899, 29931, 1682, 9633, 559, 4007, 1036, 29889, 13, 29928, 950, 29899, 29931, 1682, 9633, 559, 4007, 388, 13, 29928, 950, 29899, 29954, 417, 4007, 388, 13, 10140, 284, 28144, 29899, 29931, 361, 1389, 533, 17652, 13, 10140, 284, 28144, 29899, 26754, 29934, 264, 2911, 13, 30022, 29896, 29900, 6233, 7472, 13, 29940, 29950, 353, 1661, 9706, 23724, 313, 4102, 1653, 263, 301, 952, 403, 416, 379, 353, 3632, 23724, 13, 16941, 16750, 310, 10315, 9633, 559, 830, 18505, 478, 11142, 13, 3492, 1122, 13521, 304, 5665, 278, 25348, 15478, 964, 278, 10315, 9633, 559, 830, 18505, 478, 11142, 29889, 7803, 6455, 310, 1316, 8324, 13, 598, 304, 8161, 278, 2684, 2602, 310, 5759, 7374, 1080, 322, 304, 9659, 5802, 310, 263, 3268, 29899, 14940, 5478, 362, 29889, 12753, 13, 9469, 414, 526, 3625, 363, 8617, 16750, 278, 282, 7239, 29941, 478, 11142, 29901, 390, 29963, 558, 4193, 29941, 313, 5612, 9555, 16510, 1588, 4193, 29871, 29941, 29897, 363, 8617, 16750, 13, 13058, 3538, 4822, 278, 701, 5461, 1067, 28259, 11840, 29892, 390, 29963, 558, 4193, 29946, 363, 8617, 16750, 6795, 13058, 3538, 4822, 278, 350, 314, 17628, 322, 3956, 29902, 13, 695, 28259, 11840, 1623, 5461, 310, 21626, 29974, 29892, 322, 12729, 558, 4193, 29906, 363, 8617, 16750, 6795, 13058, 3538, 701, 5461, 310, 21626, 29974, 29889, 13, 29934, 29963, 558, 4193, 29941, 12, 29945, 29899, 1783, 10051, 5454, 6344, 8254, 26788, 1783, 23799, 4174, 29907, 29899, 29941, 13, 29934, 29963, 558, 4193, 29946, 12, 29945, 29899, 29954, 2477, 29954, 8254, 29954, 9472, 1299, 29954, 4174, 4174, 8766, 29954, 29899, 29941, 13, 7239, 558, 4193, 29906, 12, 29945, 29899, 1783, 19988, 1299, 29954, 19988, 19988, 29911, 29954, 8766, 23799, 1783, 29911, 4174, 29909, 29899, 29941, 13, 29934, 29963, 558, 4193, 29941, 338, 7148, 5407, 363, 2893, 9215, 11909, 310, 9322, 7374, 1080, 29889, 13, 9842, 29901, 2178, 2211, 1903, 414, 508, 367, 1304, 363, 18031, 29928, 3521, 8617, 16750, 29892, 541, 871, 390, 29963, 558, 4193, 29946, 322, 12729, 558, 4193, 29906, 884, 1122, 367, 1304, 363, 13, 893, 29928, 3521, 8617, 16750, 29889, 13, 29947, 29889, 29909, 29889, 12, 18877, 28771, 3631, 10619, 29879, 310, 278, 282, 7239, 29941, 10315, 9633, 559, 830, 18505, 478, 11142, 13, 1252, 1547, 363, 278, 28694, 310, 2504, 327, 414, 322, 26371, 4564, 414, 29892, 278, 3023, 282, 7239, 29941, 10315, 9633, 559, 830, 18505, 478, 11142, 526, 2281, 332, 635, 13, 1693, 936, 29889, 7806, 715, 11625, 4841, 10121, 14424, 5680, 526, 19138, 1891, 297, 9779, 29871, 29941, 29889, 450, 282, 7239, 29941, 478, 11142, 1269, 1712, 263, 13, 9812, 29899, 8552, 29899, 4537, 410, 29895, 653, 13574, 3978, 310, 1634, 1414, 363, 25413, 297, 382, 29889, 784, 29875, 29892, 385, 626, 16447, 453, 262, 29899, 690, 21558, 18530, 363, 13, 21731, 29892, 322, 263, 977, 1166, 681, 1374, 482, 3978, 310, 1634, 1414, 313, 29888, 29896, 470, 29875, 29897, 363, 2323, 29899, 710, 392, 287, 25348, 313, 893, 29928, 3521, 29897, 5802, 29889, 13, 15078, 19902, 11840, 363, 4635, 291, 310, 25348, 22370, 526, 5982, 701, 5461, 322, 1623, 5461, 310, 278, 21626, 9633, 559, 18530, 29889, 13, 13985, 310, 278, 701, 5461, 11840, 313, 29990, 1251, 29902, 322, 350, 3820, 2687, 29897, 7709, 16165, 267, 573, 10614, 15878, 411, 278, 1623, 5461, 11840, 313, 20392, 29902, 322, 13, 29933, 314, 17628, 29892, 8307, 511, 14372, 278, 1006, 3167, 310, 278, 25348, 4635, 363, 10952, 7418, 310, 2602, 284, 9545, 29889, 13, 1888, 771, 1490, 21444, 21597, 13, 2541, 278, 282, 7239, 29941, 29899, 4809, 16510, 13, 29909, 19698, 6376, 1230, 12790, 28386, 13, 1168, 4984, 4103, 3647, 287, 13, 13080, 545, 29871, 29953, 29889, 422, 20941, 310, 21626, 9633, 559, 14188, 13384, 297, 940, 5661, 9101, 1301, 3647, 287, 411, 278, 282, 7239, 29906, 29899, 4809, 13, 392, 282, 7239, 29941, 29899, 4809, 830, 18505, 478, 11142, 29889, 450, 4603, 3233, 310, 21626, 29974, 338, 8541, 19574, 6133, 411, 278, 282, 7239, 29941, 29899, 4809, 13, 29963, 11142, 29889, 512, 10324, 15729, 411, 3196, 3038, 3454, 29892, 591, 8900, 29871, 29906, 29900, 29899, 304, 29871, 29896, 29900, 29900, 29899, 8771, 6133 ]
1,333,688
5,120
CommonCrawl
22
21
luciferase activity from cells transfected with pGL3-Control. Luciferase activity was measured with a Turner Designs luminometer. (Absolute light values and relative expression profiles may vary between different cell types.) pGL2 Vector Series pGL2pGL2pGL2pGL2Control Basic Enhancer Promoter pGL3Control pGL3pGL3pGL3Basic Enhancer Promoter Figure 7. A representative experiment comparing luciferase activities expressed in HeLa cells transfected with the pGL2 and pGL3 Vector series. The increase in luciferase expression observed with these new vectors provides greater sensitivity, while maintaining relatively low background luciferase expression. 8.B. Advantages of the pGL3 Vectors The pGL3 Reporter Vectors contain a modified firefly luciferase cDNA designated luc+ and a redesigned vector backbone. These changes were made to increase luciferase expression, improve in vivo vector stability, and provide greater flexibility in performing genetic manipulations. The modified reporter vectors have resulted in luciferase expression levels dramatically higher than those obtained with pGL2 Reporter Vectors (Figure 6), while maintaining relatively low background luciferase expression (Figure 7). The substantial increase in the expression of luciferase observed with the pGL3 Vectors provides greater sensitivity. It may now be possible to obtain measurable luciferase expression in cell types that are difficult to transfect or when studying weak promoter elements. Users of the pGL2 and pGL3 Vectors should be aware, however, that absolute light unit values and relative expression profiles vary between different cell types (7). Therefore, it is important to include the appropriate control vectors in all experiments. Further refinements have been made since the pGL3 Vectors became available. Our newest series of luciferase reporter vectors, the pGL4 Luciferase Vectors, provide additional features and benefits as compared to the pGL3 Vectors. For more information, see the pGL4 Luciferase Reporter Vectors Technical Manual #TM259 available at: 8.C. The pGL3 Vectors luc+ Gene Modifications that distinguish the luc+ gene from the native luciferase gene generally fall into four categories: i) the C-terminal tripeptide has been removed to eliminate peroxisome targeting of the expressed protein; ii) codon usage was improved for expression in plant and animal cells; iii) two potential sites of N-glycosylation were removed; and iv) several DNA sequence changes were made to disrupt extended palindromes, remove internal restriction sites, and eliminate consensus sequences recognized by genetic regulatory binding proteins, thus helping to ensure that the reporter gene itself is unaffected by spurious host transcriptional signals. (For a detailed description of the modifications to the luc+ gene, see reference 8.) Four major modifications were made to the vector backbone: i) the SV40 early poly(A) signal has been replaced with the SV40 late poly(A) signal to increase the efficiency of transcription termination and polyadenylation of the luciferase transcripts (9); ii) a synthetic poly(A) and transcriptional pause site (10,11) have been placed upstream of the multiple cloning site to terminate spurious transcription, which may initiate within the vector backbone; iii) the small T intron has been removed to prevent reduced reporter gene expression due to cryptic RNA splicing (12,13); and iv) a Kozak consensus sequence (14) has been inserted to increase the efficiency of translation initiation of the luciferase gene (7; There is a newer luciferase gene available, luc2. The luc2 gene not only shares the same features as luc+, but the sequence was codon-optimized for expression in mammalian cells. For further information about the luc2 gene present in the pGL4 Luciferase Vectors, see Technical Manual #TM259 available at: www.promega.com/protocols/ Table 3. Changes Made to the pGL3 Vectors. Changes Made Purpose of Modification Modifications made to the luciferase gene (luc to luc+). Changes eliminate peroxisome targeting of expressed protein, eliminate consensus binding sequences for
-0.237379
0.758938
1.317952
1.367405
[ -0.09168017113968102, -0.3830786186591673 ]
[ 0.4133463884336583, 1.1045290208192098 ]
[ 1.5005615001208448, 1.1353427924655102 ]
[ 1.0240245052426962, 1.7107862560614577 ]
1,024
[ 512, 512 ]
[ 21626, 9633, 559, 6354, 515, 9101, 13, 3286, 3647, 287, 411, 282, 7239, 29941, 29899, 4809, 29889, 10315, 9633, 559, 6354, 471, 17005, 411, 263, 24215, 12037, 29879, 301, 9735, 8328, 29889, 313, 4920, 14977, 3578, 13, 5975, 322, 6198, 4603, 28723, 1122, 13100, 1546, 1422, 3038, 4072, 1846, 13, 29886, 7239, 29906, 16510, 10488, 13, 29886, 7239, 29906, 29886, 7239, 29906, 29886, 7239, 29906, 29886, 7239, 29906, 4809, 13, 16616, 1174, 5403, 2265, 9705, 17084, 13, 29886, 7239, 29941, 4809, 13, 29886, 7239, 29941, 29886, 7239, 29941, 29886, 7239, 29941, 16616, 1174, 5403, 2265, 9705, 17084, 13, 13080, 545, 29871, 29955, 29889, 319, 21097, 7639, 17420, 21626, 9633, 559, 14188, 13384, 297, 940, 5661, 9101, 1301, 3647, 287, 13, 2541, 278, 282, 7239, 29906, 322, 282, 7239, 29941, 16510, 3652, 29889, 450, 7910, 297, 21626, 9633, 559, 4603, 8900, 411, 1438, 716, 12047, 8128, 13, 7979, 1008, 4771, 24858, 29892, 1550, 7344, 292, 13774, 4482, 3239, 21626, 9633, 559, 4603, 29889, 13, 29947, 29889, 29933, 29889, 12, 3253, 29894, 19771, 310, 278, 282, 7239, 29941, 478, 11142, 13, 1576, 282, 7239, 29941, 830, 18505, 478, 11142, 1712, 263, 9120, 3974, 17652, 21626, 9633, 559, 274, 29928, 3521, 25373, 21626, 29974, 322, 263, 2654, 267, 12961, 4608, 13, 1627, 15933, 29889, 4525, 3620, 892, 1754, 304, 7910, 21626, 9633, 559, 4603, 29892, 11157, 297, 325, 4243, 4608, 25806, 29892, 322, 3867, 13, 7979, 1008, 8525, 4127, 297, 15859, 2531, 7492, 11525, 8250, 29889, 450, 9120, 1634, 9555, 12047, 505, 20601, 297, 21626, 9633, 559, 13, 17471, 11174, 8541, 19574, 6133, 1135, 1906, 7625, 411, 282, 7239, 29906, 830, 18505, 478, 11142, 313, 13080, 545, 29871, 29953, 511, 1550, 7344, 292, 13, 2674, 6703, 4482, 3239, 21626, 9633, 559, 4603, 313, 13080, 545, 29871, 29955, 467, 13, 1576, 23228, 7910, 297, 278, 4603, 310, 21626, 9633, 559, 8900, 411, 278, 282, 7239, 29941, 478, 11142, 8128, 7621, 4771, 24858, 29889, 13, 3112, 1122, 1286, 367, 1950, 304, 4017, 7540, 21115, 21626, 9633, 559, 4603, 297, 3038, 4072, 393, 526, 5189, 304, 1301, 3647, 470, 746, 13, 18082, 5414, 8062, 2504, 17084, 3161, 29889, 23861, 310, 278, 282, 7239, 29906, 322, 282, 7239, 29941, 478, 11142, 881, 367, 9543, 29892, 3138, 29892, 393, 8380, 3578, 13, 5441, 1819, 322, 6198, 4603, 28723, 13100, 1546, 1422, 3038, 4072, 313, 29955, 467, 7857, 29892, 372, 338, 4100, 304, 3160, 13, 1552, 8210, 2761, 12047, 297, 599, 15729, 29889, 13, 29943, 332, 721, 2143, 262, 4110, 505, 1063, 1754, 1951, 278, 282, 7239, 29941, 478, 11142, 3897, 3625, 29889, 8680, 716, 342, 3652, 310, 21626, 9633, 559, 1634, 9555, 13, 345, 14359, 29892, 278, 282, 7239, 29946, 10315, 9633, 559, 478, 11142, 29892, 3867, 5684, 5680, 322, 23633, 408, 9401, 304, 278, 282, 7239, 29941, 478, 11142, 29889, 1152, 13, 5514, 2472, 29892, 1074, 278, 282, 7239, 29946, 10315, 9633, 559, 830, 18505, 478, 11142, 8364, 936, 2315, 950, 396, 23081, 29906, 29945, 29929, 3625, 472, 29901, 13, 29947, 29889, 29907, 29889, 12, 1576, 282, 7239, 29941, 478, 11142, 21626, 29974, 15350, 13, 2111, 8232, 393, 20820, 278, 21626, 29974, 18530, 515, 278, 7531, 21626, 9633, 559, 18530, 6892, 6416, 964, 3023, 13997, 29901, 474, 29897, 278, 13, 29907, 29899, 8489, 979, 3367, 412, 415, 680, 756, 1063, 6206, 304, 27399, 639, 2251, 275, 608, 3646, 292, 310, 278, 13384, 26823, 29936, 13607, 29897, 15234, 265, 8744, 13, 11102, 16710, 363, 4603, 297, 8024, 322, 13019, 9101, 29936, 474, 2236, 29897, 1023, 7037, 11840, 310, 405, 29899, 16808, 3944, 2904, 362, 892, 6206, 29936, 322, 13, 440, 29897, 3196, 25348, 5665, 3620, 892, 1754, 304, 766, 6685, 10410, 5112, 513, 456, 267, 29892, 3349, 7463, 24345, 11840, 29892, 322, 13, 295, 8332, 403, 1136, 8841, 15602, 14831, 491, 2531, 7492, 24378, 7606, 9956, 3279, 1144, 29892, 4550, 19912, 304, 9801, 393, 278, 13, 276, 18505, 18530, 3528, 338, 1185, 7161, 287, 491, 805, 332, 2738, 3495, 1301, 3395, 284, 18470, 29889, 313, 2831, 263, 13173, 6139, 310, 278, 13, 1545, 8232, 304, 278, 21626, 29974, 18530, 29892, 1074, 3407, 29871, 29947, 1846, 13, 29943, 473, 4655, 26278, 892, 1754, 304, 278, 4608, 1250, 15933, 29901, 474, 29897, 278, 13955, 29946, 29900, 4688, 15680, 29898, 29909, 29897, 7182, 756, 1063, 8611, 411, 13, 1552, 13955, 29946, 29900, 5683, 15680, 29898, 29909, 29897, 7182, 304, 7910, 278, 19201, 310, 1301, 3395, 1840, 3381, 322, 15680, 4858, 2904, 362, 310, 278, 21626, 9633, 559, 13, 3286, 924, 29879, 313, 29929, 416, 13607, 29897, 263, 14710, 7492, 15680, 29898, 29909, 29897, 322, 1301, 3395, 284, 19957, 3268, 313, 29896, 29900, 29892, 29896, 29896, 29897, 505, 1063, 7180, 701, 5461, 310, 278, 2999, 13, 695, 28259, 3268, 304, 29504, 805, 332, 2738, 1301, 3395, 29892, 607, 1122, 14511, 403, 2629, 278, 4608, 1250, 15933, 29936, 474, 2236, 29897, 278, 2319, 323, 11158, 265, 13, 5349, 1063, 6206, 304, 5557, 12212, 1634, 9555, 18530, 4603, 2861, 304, 24941, 293, 390, 3521, 805, 506, 292, 313, 29896, 29906, 29892, 29896, 29941, 416, 322, 20444, 29897, 263, 476, 2112, 557, 13, 3200, 8841, 5665, 313, 29896, 29946, 29897, 756, 1063, 15478, 304, 7910, 278, 19201, 310, 13962, 2069, 11685, 310, 278, 21626, 9633, 559, 18530, 313, 29955, 29936, 13, 8439, 338, 263, 20687, 21626, 9633, 559, 18530, 3625, 29892, 21626, 29906, 29889, 450, 21626, 29906, 18530, 451, 871, 29358, 278, 1021, 5680, 408, 21626, 29974, 29892, 541, 278, 13, 16506, 471, 15234, 265, 29899, 20640, 1891, 363, 4603, 297, 286, 4850, 284, 713, 9101, 29889, 1152, 4340, 2472, 1048, 278, 21626, 29906, 18530, 2198, 13, 262, 278, 282, 7239, 29946, 10315, 9633, 559, 478, 11142, 29892, 1074, 8364, 936, 2315, 950, 396, 23081, 29906, 29945, 29929, 3625, 472, 29901, 7821, 29889, 14032, 2442, 29889, 510, 29914, 20464, 29879, 29914, 13, 3562, 29871, 29941, 29889, 678, 6916, 18266, 304, 278, 282, 7239, 29941, 478, 11142, 29889, 13, 21459, 18266, 13, 29925, 332, 4220, 310, 3382, 2450, 13, 2111, 8232, 1754, 304, 278, 21626, 9633, 559, 13, 29887, 1600, 313, 29880, 1682, 304, 21626, 29974, 467, 13, 21459, 27399, 639, 2251, 275, 608, 3646, 292, 310, 13, 735, 13120, 26823, 29892, 27399, 1136, 8841, 9956, 13, 6831, 2063, 363 ]
1,333,688
6,144
CommonCrawl
22
21
various genetic regulatory proteins, improve codon usage for mammalian and plant cells, and provide convenient restriction sites. A unique NcoI site created at 5 end of luc+ gene. NcoI sites removed from SV40 enhancer and promoter regions. Ability to create N-terminal gene fusions with luc+ using unique NcoI site. Intron from SV40 small T antigen Intron from SV40 small T antigen can reduce expression when placed 3 of certain genes due to cryptic splicing. Poly(A) site for back-ground reduction changed from SV40 early site to a synthetic poly(A) and transcriptional pause site. Avoids possible recombination between two SV40 poly(A) sequences in the same plasmid. Poly(A) signal for luc+ changed from early to late SV40 poly(A) signal. Late SV40 poly(A) signal is more efficient than early SV40 poly(A). Kozak consensus sequence created immediately 5 of the luc+ gene. Provides optimal translation efficiency. Unique XbaI site created just downstream of the luc+ gene. User convenience; facilitates subcloning of the luc+ gene. SmaI site moved to internal position in multiple cloning region. User convenience; blunt-ended inserts can now be cleaved on either side by restriction endonucleases. 8.D. Mapping Genetic Elements Located Within DNA Fragments The locations of functional elements within a DNA fragment are often determined by making a set of unidirectional nested deletions following the method of Henikoff (15) and then assaying for changes in biological activity. This method takes advantage of the unique properties of Exonuclease III (Exo III), which will digest 5 overhangs but not 3 overhangs or -phosphorothioate nucleotide filled-in overhangs. Nested deletions of an insert DNA can be made directly in the pGL3 family of Reporter Vectors using this method, eliminating the need for subcloning steps. The multiple cloning region of the pGL3 Vectors contains upstream KpnI and SacI restriction sites, which can be used to generate the 3 overhangs resistant to Exo III (Figures 15). After treatment with Exo III, S1 nuclease is added to remove the resulting ssDNA overhangs, and T4 DNA ligase is added to reclose the vectors. Deletion clones can be screened by gel electrophoresis of miniprep DNA, and the precise deletion endpoints within the promoter region can be determined by DNA sequencing using primers designed for the Luciferase Reporter Vectors. 8.E. Composition of Buffers and Solutions M-9 plates (1 liter) 15g agarose 5X M-9 salts (1 liter) 34g Na2HPO4 Add 15g agarose to 750ml water and autoclave. Cool to 50C. Add: 2.0ml 1M MgSO4 0.1ml 1M CaCl2 10.0ml 20% glucose (filter sterilized) 1.0ml 1M thiamine-HCl 200ml 5X M-9 salts Dissolve in deionized water. Divide into 200ml aliquots and autoclave. 15g KH2PO4 2.5g NaCl 5g NH4Cl 8.F. References Sambrook, J. et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Schenborn, E. and Goiffon, V. (1991) Optimization of Transfectam-mediated transfection using a luciferase reporter system. Promega Notes 33, 811. Cullen, B.R. (1987) Use of eukaryotic expression technology in the functional analysis of cloned genes. Methods Enzymol. 152
-0.644002
1.036485
1.15056
1.403825
[ -0.4858042758340743, -0.802199299932788 ]
[ 1.6488801095373642, 0.4240901599215166 ]
[ 1.368676966800863, 0.9324435104347686 ]
[ 1.5755150021123077, 1.232134126702927 ]
1,024
[ 512, 512 ]
[ 5164, 2531, 7492, 24378, 7606, 3279, 1144, 29892, 13, 326, 771, 345, 15234, 265, 8744, 363, 286, 4850, 284, 713, 322, 8024, 13, 3729, 29879, 29892, 322, 3867, 19192, 24345, 11840, 29889, 13, 29909, 5412, 405, 1111, 29902, 3268, 2825, 472, 29871, 29945, 1095, 310, 13, 29880, 1682, 29974, 18530, 29889, 405, 1111, 29902, 11840, 6206, 515, 13, 7597, 29946, 29900, 427, 5403, 2265, 322, 2504, 17084, 12786, 29889, 13, 4920, 1793, 304, 1653, 405, 29899, 8489, 979, 18530, 16451, 1080, 411, 21626, 29974, 13, 4746, 5412, 405, 1111, 29902, 3268, 29889, 13, 797, 509, 265, 515, 13955, 29946, 29900, 2319, 323, 3677, 2101, 13, 797, 509, 265, 515, 13955, 29946, 29900, 2319, 323, 3677, 2101, 508, 10032, 13, 17471, 746, 7180, 29871, 29941, 310, 3058, 2531, 267, 2861, 304, 13, 29883, 4641, 293, 805, 506, 292, 29889, 13, 7713, 29891, 29898, 29909, 29897, 3268, 363, 1250, 29899, 2057, 20376, 13, 15033, 515, 13955, 29946, 29900, 4688, 3268, 304, 263, 13, 19274, 386, 7492, 15680, 29898, 29909, 29897, 322, 1301, 3395, 284, 13, 29886, 1071, 3268, 29889, 13, 29909, 1365, 4841, 1950, 27878, 2109, 362, 1546, 1023, 13955, 29946, 29900, 13, 22678, 29898, 29909, 29897, 15602, 297, 278, 1021, 715, 294, 6563, 29889, 13, 7713, 29891, 29898, 29909, 29897, 7182, 363, 21626, 29974, 3939, 515, 13, 799, 368, 304, 5683, 13955, 29946, 29900, 15680, 29898, 29909, 29897, 7182, 29889, 13, 29931, 403, 13955, 29946, 29900, 15680, 29898, 29909, 29897, 7182, 338, 901, 8543, 1135, 13, 799, 368, 13955, 29946, 29900, 15680, 29898, 29909, 467, 13, 29968, 2112, 557, 1136, 8841, 5665, 2825, 13, 326, 4210, 2486, 29871, 29945, 310, 278, 21626, 29974, 18530, 29889, 13, 1184, 29894, 2247, 14413, 13962, 19201, 29889, 13, 8110, 802, 1060, 2291, 29902, 3268, 2825, 925, 13, 3204, 5461, 310, 278, 21626, 29974, 18530, 29889, 13, 2659, 29703, 29936, 16089, 277, 1078, 1014, 695, 28259, 310, 278, 13, 29880, 1682, 29974, 18530, 29889, 13, 29903, 655, 29902, 3268, 6153, 304, 7463, 2602, 297, 13, 20787, 1067, 28259, 5120, 29889, 13, 2659, 29703, 29936, 1999, 1657, 29899, 2760, 13534, 1372, 508, 1286, 367, 13, 2841, 10511, 373, 2845, 2625, 491, 24345, 13, 355, 265, 1682, 17836, 29889, 13, 29947, 29889, 29928, 29889, 12, 15845, 5739, 7492, 10619, 29879, 5976, 630, 23732, 25348, 383, 1431, 1860, 13, 1576, 14354, 310, 13303, 3161, 2629, 263, 25348, 9376, 526, 4049, 10087, 491, 3907, 263, 731, 310, 443, 333, 8684, 284, 13, 27420, 7374, 1080, 1494, 278, 1158, 310, 4114, 638, 2696, 313, 29896, 29945, 29897, 322, 769, 1223, 388, 292, 363, 3620, 297, 4768, 5996, 6354, 29889, 910, 13, 5696, 4893, 10631, 310, 278, 5412, 4426, 310, 1222, 265, 1682, 1511, 4786, 313, 1252, 29877, 4786, 511, 607, 674, 4697, 342, 29871, 29945, 975, 11895, 29879, 541, 451, 13, 29941, 975, 11895, 29879, 470, 448, 561, 25715, 272, 720, 601, 403, 22699, 327, 680, 10423, 29899, 262, 975, 11895, 29879, 29889, 405, 2868, 7374, 1080, 310, 385, 4635, 25348, 508, 367, 1754, 13, 11851, 368, 297, 278, 282, 7239, 29941, 3942, 310, 830, 18505, 478, 11142, 773, 445, 1158, 29892, 10397, 1218, 278, 817, 363, 1014, 695, 28259, 6576, 29889, 450, 13, 20787, 1067, 28259, 5120, 310, 278, 282, 7239, 29941, 478, 11142, 3743, 701, 5461, 476, 21257, 29902, 322, 15573, 29902, 24345, 11840, 29892, 607, 508, 367, 1304, 304, 13, 17158, 278, 29871, 29941, 975, 11895, 29879, 9241, 424, 304, 1222, 29877, 4786, 313, 13080, 1973, 29871, 29896, 29945, 467, 2860, 14502, 411, 1222, 29877, 4786, 29892, 317, 29896, 11205, 1511, 338, 2715, 304, 13, 5992, 278, 9819, 17971, 29928, 3521, 975, 11895, 29879, 29892, 322, 323, 29946, 25348, 14172, 559, 338, 2715, 304, 1162, 2226, 278, 12047, 29889, 897, 1026, 291, 1067, 2873, 508, 367, 13, 10525, 287, 491, 9127, 3546, 19783, 2361, 275, 310, 1375, 666, 3445, 25348, 29892, 322, 278, 18378, 7374, 291, 1095, 9748, 2629, 278, 2504, 17084, 5120, 508, 13, 915, 10087, 491, 25348, 8617, 16750, 773, 1903, 414, 8688, 363, 278, 10315, 9633, 559, 830, 18505, 478, 11142, 29889, 13, 29947, 29889, 29923, 29889, 12, 1523, 3283, 310, 22274, 414, 322, 4956, 17925, 13, 29924, 29899, 29929, 715, 1078, 313, 29896, 4631, 29897, 13, 29896, 29945, 29887, 12, 28641, 852, 13, 29945, 29990, 341, 29899, 29929, 4497, 1372, 313, 29896, 4631, 29897, 13, 29941, 29946, 29887, 12, 13695, 29906, 3954, 29949, 29946, 13, 2528, 29871, 29896, 29945, 29887, 946, 279, 852, 304, 29871, 29955, 29945, 29900, 828, 4094, 322, 1120, 542, 18398, 29889, 13, 29907, 1507, 304, 29871, 29945, 29900, 29907, 29889, 3462, 29901, 13, 29906, 29889, 29900, 828, 12, 29896, 29924, 341, 29887, 6156, 29946, 13, 29900, 29889, 29896, 828, 12, 29896, 29924, 9243, 6821, 29906, 13, 29896, 29900, 29889, 29900, 828, 12, 29906, 29900, 29995, 3144, 1682, 852, 313, 4572, 16864, 309, 1891, 29897, 13, 29896, 29889, 29900, 828, 12, 29896, 29924, 266, 2829, 457, 29899, 29950, 6821, 13, 29906, 29900, 29900, 828, 12, 29945, 29990, 341, 29899, 29929, 4497, 1372, 13, 29928, 790, 324, 345, 297, 316, 291, 1891, 4094, 29889, 4910, 680, 964, 29871, 29906, 29900, 29900, 828, 13, 2606, 339, 1862, 322, 1120, 542, 18398, 29889, 13, 29896, 29945, 29887, 12, 29968, 29950, 29906, 13152, 29946, 13, 29906, 29889, 29945, 29887, 12, 13695, 6821, 13, 29945, 29887, 12, 29940, 29950, 29946, 6821, 13, 29947, 29889, 29943, 29889, 12, 1123, 10662, 13, 29903, 1117, 307, 554, 29892, 435, 29889, 634, 394, 29889, 313, 29896, 29929, 29947, 29929, 29897, 341, 1772, 16637, 2233, 28259, 29892, 319, 16715, 7606, 2315, 950, 29892, 26731, 7206, 3536, 4089, 5254, 29892, 26731, 7206, 13, 21972, 4089, 29892, 23526, 29889, 13, 29903, 2724, 4939, 29892, 382, 29889, 322, 2921, 2593, 265, 29892, 478, 29889, 313, 29896, 29929, 29929, 29896, 29897, 20693, 326, 2133, 310, 4103, 3647, 314, 29899, 4210, 630, 1301, 20309, 773, 263, 21626, 9633, 559, 13, 276, 18505, 1788, 29889, 9705, 2442, 8695, 29871, 29941, 29941, 29892, 29871, 29947, 29896, 29896, 29889, 13, 29907, 913, 264, 29892, 350, 29889, 29934, 29889, 313, 29896, 29929, 29947, 29955, 29897, 4803, 310, 321, 2679, 653, 13574, 4603, 15483, 297, 278, 13303, 7418, 310, 1067, 22367, 2531, 267, 29889, 8108, 29879, 13, 2369, 14022, 324, 29889, 29871, 29896, 29945, 29906 ]
1,333,688
7,168
CommonCrawl
22
21
, 684704. Ausubel, F.M. et al. (1988) Current Protocols in Molecular Biology, John Wiley and Sons, NY. Rosenthal, N. (1987) Identification of regulatory elements of cloned genes with functional assays. Methods Enzymol. 152, 70420. Hawkins, E., Butler, B. and Wood, K.V. (2000) Bright-Glo and Steady-Glo Luciferase Assay Systems: Reagents for academic and industrial applications. Promega Notes 75, 36. Groskreutz, D.J. et al. (1995) Increased expression and convenience with the new pGL3 Luciferase Reporter Vectors. Promega Notes 50, 28. Sherf, B.A. and Wood, K.V. (1994) Firefly luciferase engineered for improved genetic reporting. Promega Notes Carswell, S. and Alwine, J.C. (1989) Efficiency of utilization of the simian virus 40 late polyadenylation site: Effects of upstream sequences. Mol. Cell. Biol. 9, 424858. 10. Levitt, N. et al. (1989) Definition of an efficient synthetic poly(A) site. Genes and Dev. 3, 101925. 11. Enriquez-Harris, P. et al. (1991) A pause site for RNA polymerase II is associated with termination of transcription. EMBO J. 10, 183342. 12. Evans, M.J. and Scarpulla, R.C. (1989) Introns in the 3 untranslated region can inhibit chimeric CAT and beta-galactosidase gene expression. Gene 84, 13542. 13. Huang, M.T.F. and Gorman, C.M. (1990) The simian virus 40 small-t intron, present in many common expression vectors, leads to aberrant splicing. Mol. Cell. Biol. 10, 180510. 14. Kozak, M. (1989) The scanning model for translation: An update. J. Cell Biol. 108, 22941. 15. Henikoff, S. (1987) Unidirectional digestion with exonuclease III in DNA sequence analysis. Methods Enzymol. 8.G. pGL3-Basic Vector Restriction Sites The following restriction enzyme tables were constructed using DNASTAR sequence analysis software. Please note that we have not verified this information by restriction digestion with each enzyme listed. The location given specifies the 3 end of the cut DNA (the base to the left of the cut site). For more information on the cut sites of these enzymes, or if you identify a discrepancy, please contact your local Promega Branch or Distributor. In the U.S., contact Promega Technical Services at 800-356-9526. Vector sequences are also available in the GenBank database (GenBank/EMBL Accession Number U47295) and on the Internet at: www.promega.com/vectors/ Table 4. Restriction Enzymes That Cut the pGL3-Basic Vector Between 1 and 5 Times. AccIII AcyI AflIII Alw26I AlwNI AspHI AvaII BanII BbeI BbsI BbuI BclI BglI BsaI BsaAI BsaBI BsaHI BsaMI BspHI # of Sites 95, 121, 1514, 3690 15, 581, 2260 11, 1553, 2578, 3739, 3824
-1.382942
0.660453
0.453094
0.925172
[ -1.1418788063244807, -1.6240045573320443 ]
[ 0.8180284478096547, 0.5028778174991442 ]
[ 0.7599791207086383, 0.14620879256564515 ]
[ 0.9824025809506501, 0.8679422891475232 ]
1,024
[ 512, 512 ]
[ 29892, 29871, 29953, 29947, 29946, 29955, 29900, 29946, 29889, 13, 18306, 431, 295, 29892, 383, 29889, 29924, 29889, 634, 394, 29889, 313, 29896, 29929, 29947, 29947, 29897, 9626, 1019, 5770, 29879, 297, 341, 1772, 16637, 3457, 3002, 29892, 2259, 399, 15168, 322, 317, 787, 29892, 23526, 29889, 13, 29934, 359, 296, 4077, 29892, 405, 29889, 313, 29896, 29929, 29947, 29955, 29897, 13355, 2450, 310, 24378, 7606, 3161, 310, 1067, 22367, 2531, 267, 411, 13303, 1223, 1036, 29889, 8108, 29879, 13, 2369, 14022, 324, 29889, 29871, 29896, 29945, 29906, 29892, 29871, 29955, 29900, 29946, 29906, 29900, 29889, 13, 29950, 1450, 11335, 29892, 382, 1696, 29384, 29892, 350, 29889, 322, 10180, 29892, 476, 29889, 29963, 29889, 313, 29906, 29900, 29900, 29900, 29897, 29258, 29899, 29954, 417, 322, 2443, 3714, 29899, 29954, 417, 10315, 9633, 559, 4007, 388, 23985, 29901, 13, 1123, 351, 1237, 363, 21567, 322, 18408, 8324, 29889, 9705, 2442, 8695, 29871, 29955, 29945, 29892, 29871, 29941, 29953, 29889, 13, 29954, 307, 808, 276, 7427, 29892, 360, 29889, 29967, 29889, 634, 394, 29889, 313, 29896, 29929, 29929, 29945, 29897, 512, 1037, 1463, 4603, 322, 29703, 411, 278, 716, 282, 7239, 29941, 10315, 9633, 559, 830, 18505, 13, 29963, 11142, 29889, 9705, 2442, 8695, 29871, 29945, 29900, 29892, 29871, 29906, 29947, 29889, 13, 29903, 2276, 29888, 29892, 350, 29889, 29909, 29889, 322, 10180, 29892, 476, 29889, 29963, 29889, 313, 29896, 29929, 29929, 29946, 29897, 6438, 17652, 21626, 9633, 559, 6012, 14561, 363, 16710, 2531, 7492, 23415, 29889, 9705, 2442, 8695, 13, 29907, 1503, 5872, 29892, 317, 29889, 322, 838, 29893, 457, 29892, 435, 29889, 29907, 29889, 313, 29896, 29929, 29947, 29929, 29897, 382, 2416, 13396, 310, 3667, 2133, 310, 278, 1027, 713, 24424, 29871, 29946, 29900, 5683, 15680, 4858, 2904, 362, 3268, 29901, 13, 13971, 29879, 310, 701, 5461, 15602, 29889, 10750, 29889, 19413, 29889, 3457, 324, 29889, 29871, 29929, 29892, 29871, 29946, 29906, 29946, 29947, 29945, 29947, 29889, 13, 29896, 29900, 29889, 12, 3226, 29894, 986, 29892, 405, 29889, 634, 394, 29889, 313, 29896, 29929, 29947, 29929, 29897, 21940, 310, 385, 8543, 14710, 7492, 15680, 29898, 29909, 29897, 3268, 29889, 5739, 267, 322, 9481, 29889, 29871, 29941, 29892, 29871, 29896, 29900, 29896, 29929, 29906, 29945, 29889, 13, 29896, 29896, 29889, 12, 2369, 14090, 29920, 29899, 29950, 2749, 275, 29892, 349, 29889, 634, 394, 29889, 313, 29896, 29929, 29929, 29896, 29897, 319, 19957, 3268, 363, 390, 3521, 24324, 261, 559, 1944, 338, 6942, 411, 1840, 3381, 310, 13, 3286, 3395, 29889, 27295, 8456, 435, 29889, 29871, 29896, 29900, 29892, 29871, 29896, 29947, 29941, 29941, 29946, 29906, 29889, 13, 29896, 29906, 29889, 12, 29923, 29894, 550, 29892, 341, 29889, 29967, 29889, 322, 2522, 6834, 21797, 29892, 390, 29889, 29907, 29889, 313, 29896, 29929, 29947, 29929, 29897, 512, 509, 787, 297, 278, 29871, 29941, 443, 3286, 29880, 630, 5120, 508, 297, 6335, 277, 521, 4193, 293, 315, 1299, 322, 13, 3571, 29899, 23014, 627, 359, 333, 559, 18530, 4603, 29889, 15350, 29871, 29947, 29946, 29892, 29871, 29896, 29941, 29945, 29946, 29906, 29889, 13, 29896, 29941, 29889, 12, 29950, 29884, 574, 29892, 341, 29889, 29911, 29889, 29943, 29889, 322, 402, 555, 273, 29892, 315, 29889, 29924, 29889, 313, 29896, 29929, 29929, 29900, 29897, 450, 1027, 713, 24424, 29871, 29946, 29900, 2319, 29899, 29873, 11158, 265, 29892, 2198, 297, 1784, 3619, 13, 17471, 12047, 29892, 11981, 304, 6126, 21867, 805, 506, 292, 29889, 10750, 29889, 19413, 29889, 3457, 324, 29889, 29871, 29896, 29900, 29892, 29871, 29896, 29947, 29900, 29945, 29896, 29900, 29889, 13, 29896, 29946, 29889, 12, 29968, 2112, 557, 29892, 341, 29889, 313, 29896, 29929, 29947, 29929, 29897, 450, 885, 9450, 1904, 363, 13962, 29901, 530, 2767, 29889, 435, 29889, 19413, 3457, 324, 29889, 29871, 29896, 29900, 29947, 29892, 29871, 29906, 29906, 29929, 29946, 29896, 29889, 13, 29896, 29945, 29889, 12, 24030, 638, 2696, 29892, 317, 29889, 313, 29896, 29929, 29947, 29955, 29897, 853, 333, 8684, 284, 4697, 602, 411, 429, 265, 1682, 1511, 4786, 297, 25348, 5665, 7418, 29889, 8108, 29879, 1174, 14022, 324, 29889, 13, 29947, 29889, 29954, 29889, 12, 29886, 7239, 29941, 29899, 16616, 16510, 11654, 19902, 317, 3246, 13, 1576, 1494, 24345, 427, 14022, 29872, 6131, 892, 13319, 773, 25348, 1254, 1718, 5665, 7418, 7047, 29889, 3529, 4443, 13, 5747, 591, 505, 451, 26834, 445, 2472, 491, 24345, 4697, 602, 411, 1269, 427, 14022, 29872, 9904, 29889, 450, 4423, 2183, 1580, 11057, 13, 1552, 29871, 29941, 1095, 310, 278, 5700, 25348, 313, 1552, 2967, 304, 278, 2175, 310, 278, 5700, 3268, 467, 1152, 901, 2472, 373, 278, 5700, 11840, 310, 1438, 427, 14022, 267, 29892, 13, 272, 565, 366, 12439, 263, 766, 1037, 29886, 6906, 29892, 3113, 6958, 596, 1887, 9705, 2442, 25889, 470, 6652, 1091, 3406, 29889, 512, 278, 501, 29889, 29903, 1696, 6958, 9705, 2442, 13, 7141, 3049, 936, 15538, 472, 29871, 29947, 29900, 29900, 29899, 29941, 29945, 29953, 29899, 29929, 29945, 29906, 29953, 29889, 16510, 15602, 526, 884, 3625, 297, 278, 5739, 29933, 804, 2566, 313, 15462, 29933, 804, 29914, 29923, 9486, 29931, 13, 7504, 1211, 9681, 501, 29946, 29955, 29906, 29929, 29945, 29897, 322, 373, 278, 4685, 472, 29901, 7821, 29889, 14032, 2442, 29889, 510, 29914, 345, 14359, 29914, 13, 3562, 29871, 29946, 29889, 11654, 19902, 1174, 14022, 267, 2193, 315, 329, 278, 282, 7239, 29941, 29899, 16616, 16510, 21674, 29871, 29896, 322, 29871, 29945, 10277, 29889, 13, 7504, 5287, 13, 29909, 1270, 29902, 13, 29909, 1579, 5287, 13, 2499, 29893, 29906, 29953, 29902, 13, 2499, 29893, 12916, 13, 29909, 1028, 17628, 13, 29909, 1564, 2687, 13, 29933, 273, 2687, 13, 29933, 915, 29902, 13, 29933, 5824, 29902, 13, 29933, 2423, 29902, 13, 29933, 695, 29902, 13, 29933, 3820, 29902, 13, 29933, 4977, 29902, 13, 29933, 4977, 23869, 13, 29933, 4977, 12809, 13, 29933, 4977, 17628, 13, 29933, 4977, 10403, 13, 29933, 1028, 17628, 13, 29937, 310, 317, 3246, 13, 29929, 29945, 29892, 29871, 29896, 29906, 29896, 29892, 29871, 29896, 29945, 29896, 29946, 29892, 29871, 29941, 29953, 29929, 29900, 13, 29896, 29945, 29892, 29871, 29945, 29947, 29896, 29892, 29871, 29906, 29906, 29953, 29900, 13, 29896, 29896, 29892, 29871, 29896, 29945, 29945, 29941, 29892, 29871, 29906, 29945, 29955, 29947, 29892, 29871, 29941, 29955, 29941, 29929, 29892, 29871, 29941, 29947, 29906, 29946, 13 ]
1,333,688
8,192
CommonCrawl
9
22
11, 33, 1112, 4231 98, 1376, 1492, 2089 60, 1823, 1916 Enzyme # of Sites BspMI BsrGI BssSI BstZI ClaI Csp45I DraI DraII DraIII DrdI EaeI EagI EclHKI Eco47III Eco52I EcoICRI EcoNI EheI FseI FspI HincII HindII Hsp92I 1755,1759, 4651 Note: The enzymes listed in boldface type are available from Promega. NaeI NgoMIV NspI PaeR7I PpuMI PshAI Psp5II PspAI PvuI SgrAI SphI SrfI SspI StyI VspI XbaI XcmI XhoI* XmnI *Due to the extent of supercoiling in this vector, the XhoI site has proven difficult to cut to completion under standard restriction digest conditions. For single XhoI digests, we recommend digesting the vector for a minimum of 2 hours using 20 units of enzyme per microgram of DNA at 37C to ensure complete digestion. If performing a double digest with XhoI and another enzyme, linearize the vector using the companion enzyme prior to carrying out the XhoI digest. Under these conditions, XhoI will cut the vector following standard reactions conditions. Table 5. Restriction Enzymes That Do Not Cut the pGL3-Basic Vector. AatII AccB7I AflII AgeI AvrII BbrPI BlpI Bpu1102 I Bsp120I BssHII Bst1107I Bst98I BstEII BstXI Bsu36I CspI EcoRI EcoRV I-PpoI NdeI NruI NsiI PflMI PinAI PmeI PmlI Ppu10I PstI PvuII RsrII SacII SgfI SnaBI SplI Sse8387I StuI SwaI Tth111I 8.G. pGL3-Basic Vector Restriction Sites (continued) Table 6. Restriction Enzymes That Cut the pGL3-Basic Vector 6 or More Times. AciI AluI BbvI BsaOI BsaJI Bsp1286I BsrI BsrSI BstOI BstUI CfoI Cfr10I DdeI DpnI DpnII EarI Fnu4HI HaeII HaeIII HgaI HhaI HinfI HpaII HphI Hsp92II MaeI MaeII MaeIII MboI MboII MnlI MspI MspA1I NciI NdeII NlaIII NlaIV PleI Sau3AI Sau96I ScrFI SfaNI TaqI Tru9I XhoII 8.H. pGL3-Enhancer Vector Restriction Sites Table 7. Restriction Enzymes that cut the pGL3-Enhancer Vector Between 1 and 5 Times. 15, 581 ,2506 751, 2108, 2180, 2510 8.H. pGL3-Enhancer Vector Restriction Sites (continued) Table 8. Restriction Enzymes That Do Not Cut the pGL3-Enhancer Vector. Bpu1102I Table 9. Restriction Enzymes That Cut the p
-2.144481
0.250847
-0.398766
0.360675
[ -2.0623006946116478, -2.226661746091499 ]
[ 0.5386903891253386, -0.036996699765735934 ]
[ -0.39274242532851206, -0.40478957019908735 ]
[ 0.15516683564623296, 0.5661833380301886 ]
1,024
[ 512, 512 ]
[ 29896, 29896, 29892, 29871, 29941, 29941, 29892, 29871, 29896, 29896, 29896, 29906, 29892, 29871, 29946, 29906, 29941, 29896, 13, 29929, 29947, 29892, 29871, 29896, 29941, 29955, 29953, 29892, 29871, 29896, 29946, 29929, 29906, 29892, 29871, 29906, 29900, 29947, 29929, 13, 29953, 29900, 29892, 29871, 29896, 29947, 29906, 29941, 29892, 29871, 29896, 29929, 29896, 29953, 13, 2369, 14022, 29872, 396, 310, 317, 3246, 13, 29933, 1028, 10403, 13, 29933, 21935, 29954, 29902, 13, 29933, 893, 5425, 13, 29933, 303, 29999, 29902, 13, 20216, 29902, 13, 29907, 1028, 29946, 29945, 29902, 13, 24515, 29902, 13, 24515, 2687, 13, 24515, 5287, 13, 29928, 5499, 29902, 13, 29923, 3660, 29902, 13, 29923, 351, 29902, 13, 29923, 695, 29950, 29968, 29902, 13, 29923, 1111, 29946, 29955, 5287, 13, 29923, 1111, 29945, 29906, 29902, 13, 29923, 1111, 2965, 3960, 13, 29923, 1111, 12916, 13, 29923, 354, 29902, 13, 29943, 344, 29902, 13, 29943, 1028, 29902, 13, 29950, 3742, 2687, 13, 29950, 513, 2687, 13, 29950, 1028, 29929, 29906, 29902, 13, 29896, 29955, 29945, 29945, 29892, 29896, 29955, 29945, 29929, 29892, 29871, 29946, 29953, 29945, 29896, 13, 9842, 29901, 450, 427, 14022, 267, 9904, 297, 14288, 2161, 1134, 526, 3625, 515, 9705, 2442, 29889, 13, 29940, 3660, 29902, 13, 29940, 1484, 29924, 5667, 13, 29940, 1028, 29902, 13, 29925, 3660, 29934, 29955, 29902, 13, 29925, 3746, 10403, 13, 29925, 845, 23869, 13, 29925, 1028, 29945, 2687, 13, 29925, 1028, 23869, 13, 29925, 24845, 29902, 13, 29903, 629, 23869, 13, 29903, 561, 29902, 13, 29903, 9600, 29902, 13, 29903, 1028, 29902, 13, 855, 29891, 29902, 13, 29963, 1028, 29902, 13, 29990, 2291, 29902, 13, 29990, 4912, 29902, 13, 29990, 1251, 29902, 29930, 13, 29990, 23521, 29902, 13, 29930, 29928, 434, 304, 278, 15834, 310, 2428, 1111, 6504, 297, 445, 4608, 29892, 278, 1060, 1251, 29902, 3268, 756, 16413, 5189, 304, 5700, 304, 13285, 1090, 3918, 13, 5060, 19902, 4697, 342, 5855, 29889, 1152, 2323, 1060, 1251, 29902, 4697, 9197, 29892, 591, 6907, 4697, 342, 292, 278, 4608, 363, 263, 9212, 310, 29871, 29906, 6199, 13, 4746, 29871, 29906, 29900, 10340, 310, 427, 14022, 29872, 639, 9200, 1393, 310, 25348, 472, 29871, 29941, 29955, 29907, 304, 9801, 4866, 4697, 602, 29889, 960, 15859, 263, 3765, 4697, 342, 13, 2541, 1060, 1251, 29902, 322, 1790, 427, 14022, 29872, 29892, 5608, 675, 278, 4608, 773, 278, 18708, 427, 14022, 29872, 7536, 304, 19436, 714, 278, 1060, 1251, 29902, 4697, 342, 29889, 13, 29177, 1438, 5855, 29892, 1060, 1251, 29902, 674, 5700, 278, 4608, 1494, 3918, 337, 7387, 5855, 29889, 13, 3562, 29871, 29945, 29889, 11654, 19902, 1174, 14022, 267, 2193, 1938, 2216, 315, 329, 278, 282, 7239, 29941, 29899, 16616, 16510, 29889, 13, 29909, 271, 2687, 13, 7504, 29933, 29955, 29902, 13, 29909, 1579, 2687, 13, 22406, 29902, 13, 12810, 29878, 2687, 13, 29933, 1182, 2227, 13, 10358, 29886, 29902, 13, 29933, 3746, 29896, 29896, 29900, 29906, 306, 13, 29933, 1028, 29896, 29906, 29900, 29902, 13, 29933, 893, 29950, 2687, 13, 29933, 303, 29896, 29896, 29900, 29955, 29902, 13, 29933, 303, 29929, 29947, 29902, 13, 29933, 303, 29923, 2687, 13, 29933, 303, 29990, 29902, 13, 29933, 2146, 29941, 29953, 29902, 13, 29907, 1028, 29902, 13, 29923, 1111, 3960, 13, 29923, 1111, 29934, 29963, 13, 29902, 29899, 29925, 1129, 29902, 13, 29940, 311, 29902, 13, 29940, 582, 29902, 13, 29940, 1039, 29902, 13, 29925, 1579, 10403, 13, 29925, 262, 23869, 13, 29925, 1004, 29902, 13, 29925, 828, 29902, 13, 29925, 3746, 29896, 29900, 29902, 13, 29925, 303, 29902, 13, 29925, 24845, 2687, 13, 29934, 21935, 2687, 13, 29903, 562, 2687, 13, 29903, 29887, 29888, 29902, 13, 29903, 1056, 12809, 13, 29903, 572, 29902, 13, 29903, 344, 29947, 29941, 29947, 29955, 29902, 13, 855, 29884, 29902, 13, 29903, 2766, 29902, 13, 29911, 386, 29896, 29896, 29896, 29902, 13, 29947, 29889, 29954, 29889, 12, 29886, 7239, 29941, 29899, 16616, 16510, 11654, 19902, 317, 3246, 313, 1285, 262, 6742, 29897, 13, 3562, 29871, 29953, 29889, 11654, 19902, 1174, 14022, 267, 2193, 315, 329, 278, 282, 7239, 29941, 29899, 16616, 16510, 29871, 29953, 470, 5853, 10277, 29889, 13, 29909, 455, 29902, 13, 2499, 29884, 29902, 13, 29933, 29890, 29894, 29902, 13, 29933, 4977, 29949, 29902, 13, 29933, 4977, 29967, 29902, 13, 29933, 1028, 29896, 29906, 29947, 29953, 29902, 13, 29933, 21935, 29902, 13, 29933, 21935, 5425, 13, 29933, 303, 29949, 29902, 13, 29933, 303, 3120, 13, 29907, 1181, 29902, 13, 29907, 1341, 29896, 29900, 29902, 13, 29928, 311, 29902, 13, 29928, 21257, 29902, 13, 29928, 21257, 2687, 13, 29923, 279, 29902, 13, 29943, 3433, 29946, 17628, 13, 29950, 3660, 2687, 13, 29950, 3660, 5287, 13, 29950, 3249, 29902, 13, 29950, 2350, 29902, 13, 29950, 7192, 29902, 13, 29950, 3274, 2687, 13, 29950, 561, 29902, 13, 29950, 1028, 29929, 29906, 2687, 13, 29924, 3660, 29902, 13, 29924, 3660, 2687, 13, 29924, 3660, 5287, 13, 29924, 833, 29902, 13, 29924, 833, 2687, 13, 29924, 12938, 29902, 13, 29924, 1028, 29902, 13, 29924, 1028, 29909, 29896, 29902, 13, 29940, 455, 29902, 13, 29940, 311, 2687, 13, 29940, 433, 5287, 13, 29940, 433, 5667, 13, 29925, 280, 29902, 13, 29903, 585, 29941, 23869, 13, 29903, 585, 29929, 29953, 29902, 13, 4421, 29878, 3738, 13, 29903, 5444, 12916, 13, 29911, 29874, 29939, 29902, 13, 29911, 582, 29929, 29902, 13, 29990, 1251, 2687, 13, 29947, 29889, 29950, 29889, 12, 29886, 7239, 29941, 29899, 2369, 5403, 2265, 16510, 11654, 19902, 317, 3246, 13, 3562, 29871, 29955, 29889, 11654, 19902, 1174, 14022, 267, 393, 5700, 278, 282, 7239, 29941, 29899, 2369, 5403, 2265, 16510, 21674, 29871, 29896, 322, 29871, 29945, 10277, 29889, 13, 29896, 29945, 29892, 29871, 29945, 29947, 29896, 1919, 29906, 29945, 29900, 29953, 13, 29955, 29945, 29896, 29892, 29871, 29906, 29896, 29900, 29947, 29892, 29871, 29906, 29896, 29947, 29900, 29892, 29871, 29906, 29945, 29896, 29900, 13, 29947, 29889, 29950, 29889, 12, 29886, 7239, 29941, 29899, 2369, 5403, 2265, 16510, 11654, 19902, 317, 3246, 313, 1285, 262, 6742, 29897, 13, 3562, 29871, 29947, 29889, 11654, 19902, 1174, 14022, 267, 2193, 1938, 2216, 315, 329, 278, 282, 7239, 29941, 29899, 2369, 5403, 2265, 16510, 29889, 13, 29933, 3746, 29896, 29896, 29900, 29906, 29902, 13, 3562, 29871, 29929, 29889, 11654, 19902, 1174, 14022, 267, 2193, 315, 329, 278, 282 ]
1,333,688
9,216
CommonCrawl
22
21
GL3-Enhancer Vector 6 or More Times. 8.I. pGL3-Promoter Vector Restriction Sites Table 10. Restriction Enzymes That Cut the pGL3-Promoter Vector Between 1 and 5 Times. 8.I. pGL3-Promoter Vector Restriction Sites (continued) Table 10. Restriction Enzymes That Cut the pGL3-Promoter Vector Between 1 and 5 Times (continued). Table 11. Restriction Enzymes That Do Not Cut the pGL3-Promoter Vector. Table 12. Restriction Enzymes That Cut the pGL3-Promoter Vector 6 or More Times. 8.J. pGL3-Control Vector Restriction Sites that this information has not been verified by restriction digestion with each enzyme listed. The location given specifies or if you identify a discrepancy, please contact your local Promega Branch or Distributor. Vector sequences are also available in the GenBank database (GenBank/EMBL Accession Number U47296) and on the Internet at: www.promega.com/vectors/ Table 13. Restriction Enzymes That Cut the pGL3-Control Vector Between 1 and 5 Times. Table 13. Restriction Enzymes That Cut the pGL3-Control Vector Between 1 and 5 Times (continued). Table 14. Restriction Enzymes That Do Not Cut the pGL3-Control Vector. 8.J. pGL3-Control Vector Restriction Sites (continued) Table 15. Restriction Enzymes That Cut the pGL3-Control Vector 6 or More Times. 8.K. Related Products RVprimer3 (clockwise) RVprimer4 (counter clockwise) 100 preps PureYield Plasmid Midiprep System Luciferase Assay Systems Luciferase Assay System 100 assays Bright-Glo Luciferase Assay System Steady-Glo Luciferase Assay System Dual-Luciferase Reporter Assay System Dual-Glo Luciferase Assay System ONE-Glo Luciferase Assay System Available in additional sizes. GloMax 96 Microplate Luminometer GloMax 20/20 Luminometer Available with single or dual injectors. pGL4 Luciferase Vectors pGL4.10[luc2] Vector pGL4.11[luc2P] Vector pGL4.12[luc2CP] Vector pGL4.13[luc2/SV40] Vector pGL4.14[luc2/Hygro] Vector pGL4.17[luc2/Neo] Vector pGL4.20[luc2/Puro] Vector pGL4.23[luc2/minP] Vector pGL4.26[luc2/minP/Hygro] Vector pGL4.29[luc2P/CRE/Hygro] Vector pGL4.30[luc2P/NFAT-RE/Hygro] Vector pGL4.31[luc2P/Gal4UAS/Hygro] Vector The complete listing of pGL4 Luciferase Vectors can be found at: www.promega.com/pgl4/ Summary of Changes The following change was made to the 6/15 revision of this document: The patent information was updated to remove expired statements. READ THIS FIRST BEFORE OPENING PRODUCT BY USE OF THIS PRODUCT, RESEARCHER AGREES TO BE BOUND BY THE TERMS OF THIS LIMITED USE LABEL LICENSE. If the researcher is not willing to accept the terms of this label license, and the product is unused, Promega will accept return of the unused product and provide the researcher with a full refund. Researchers may use this product for research use only, no commercial use is allowed. Commercial use means any and all uses of this product and derivatives by a party for money or other consideration and may include but is not limited
-1.739057
-0.334661
-0.233593
0.308648
[ -2.0403858877476675, -1.437728698988213 ]
[ -0.41660995900339626, -0.2527114866703911 ]
[ -0.18096629970892558, -0.28622030226237277 ]
[ 0.5193586732016368, 0.09793668974466951 ]
1,024
[ 512, 512 ]
[ 7239, 29941, 29899, 2369, 5403, 2265, 16510, 29871, 29953, 470, 5853, 10277, 29889, 13, 29947, 29889, 29902, 29889, 12, 29886, 7239, 29941, 29899, 18571, 17084, 16510, 11654, 19902, 317, 3246, 13, 3562, 29871, 29896, 29900, 29889, 11654, 19902, 1174, 14022, 267, 2193, 315, 329, 278, 282, 7239, 29941, 29899, 18571, 17084, 16510, 21674, 29871, 29896, 322, 29871, 29945, 10277, 29889, 13, 29947, 29889, 29902, 29889, 12, 29886, 7239, 29941, 29899, 18571, 17084, 16510, 11654, 19902, 317, 3246, 313, 1285, 262, 6742, 29897, 13, 3562, 29871, 29896, 29900, 29889, 11654, 19902, 1174, 14022, 267, 2193, 315, 329, 278, 282, 7239, 29941, 29899, 18571, 17084, 16510, 21674, 29871, 29896, 322, 29871, 29945, 10277, 313, 1285, 262, 6742, 467, 13, 3562, 29871, 29896, 29896, 29889, 11654, 19902, 1174, 14022, 267, 2193, 1938, 2216, 315, 329, 278, 282, 7239, 29941, 29899, 18571, 17084, 16510, 29889, 13, 3562, 29871, 29896, 29906, 29889, 11654, 19902, 1174, 14022, 267, 2193, 315, 329, 278, 282, 7239, 29941, 29899, 18571, 17084, 16510, 29871, 29953, 470, 5853, 10277, 29889, 13, 29947, 29889, 29967, 29889, 12, 29886, 7239, 29941, 29899, 4809, 16510, 11654, 19902, 317, 3246, 13, 5747, 445, 2472, 756, 451, 1063, 26834, 491, 24345, 4697, 602, 411, 1269, 427, 14022, 29872, 9904, 29889, 450, 4423, 2183, 1580, 11057, 13, 272, 565, 366, 12439, 263, 766, 1037, 29886, 6906, 29892, 3113, 6958, 596, 1887, 9705, 2442, 25889, 470, 6652, 1091, 3406, 29889, 16510, 15602, 526, 884, 13, 16515, 297, 278, 5739, 29933, 804, 2566, 313, 15462, 29933, 804, 29914, 29923, 9486, 29931, 4831, 1211, 9681, 501, 29946, 29955, 29906, 29929, 29953, 29897, 322, 373, 278, 4685, 472, 29901, 13, 1636, 29889, 14032, 2442, 29889, 510, 29914, 345, 14359, 29914, 13, 3562, 29871, 29896, 29941, 29889, 11654, 19902, 1174, 14022, 267, 2193, 315, 329, 278, 282, 7239, 29941, 29899, 4809, 16510, 21674, 29871, 29896, 322, 29871, 29945, 10277, 29889, 13, 3562, 29871, 29896, 29941, 29889, 11654, 19902, 1174, 14022, 267, 2193, 315, 329, 278, 282, 7239, 29941, 29899, 4809, 16510, 21674, 29871, 29896, 322, 29871, 29945, 10277, 313, 1285, 262, 6742, 467, 13, 3562, 29871, 29896, 29946, 29889, 11654, 19902, 1174, 14022, 267, 2193, 1938, 2216, 315, 329, 278, 282, 7239, 29941, 29899, 4809, 16510, 29889, 13, 29947, 29889, 29967, 29889, 12, 29886, 7239, 29941, 29899, 4809, 16510, 11654, 19902, 317, 3246, 313, 1285, 262, 6742, 29897, 13, 3562, 29871, 29896, 29945, 29889, 11654, 19902, 1174, 14022, 267, 2193, 315, 329, 278, 282, 7239, 29941, 29899, 4809, 16510, 29871, 29953, 470, 5853, 10277, 29889, 13, 29947, 29889, 29968, 29889, 12, 9662, 630, 10969, 29879, 13, 29934, 29963, 558, 4193, 29941, 313, 13058, 3538, 29897, 13, 29934, 29963, 558, 4193, 29946, 313, 11808, 12006, 3538, 29897, 13, 29896, 29900, 29900, 758, 567, 13, 29925, 545, 29979, 969, 1858, 294, 6563, 13370, 666, 3445, 2184, 13, 29931, 1682, 9633, 559, 4007, 388, 23985, 13, 29931, 1682, 9633, 559, 4007, 388, 2184, 13, 29896, 29900, 29900, 1223, 1036, 13, 29933, 1266, 29899, 29954, 417, 10315, 9633, 559, 4007, 388, 2184, 13, 7789, 3714, 29899, 29954, 417, 10315, 9633, 559, 4007, 388, 2184, 13, 29928, 950, 29899, 29931, 1682, 9633, 559, 830, 18505, 4007, 388, 2184, 13, 29928, 950, 29899, 29954, 417, 10315, 9633, 559, 4007, 388, 2184, 13, 12413, 29899, 29954, 417, 10315, 9633, 559, 4007, 388, 2184, 13, 27635, 297, 5684, 15786, 29889, 13, 29954, 417, 7976, 29871, 29929, 29953, 20140, 2341, 365, 9735, 8328, 13, 29954, 417, 7976, 29871, 29906, 29900, 29914, 29906, 29900, 365, 9735, 8328, 13, 27635, 411, 2323, 470, 14581, 11658, 943, 29889, 13, 29886, 7239, 29946, 10315, 9633, 559, 478, 11142, 13, 29886, 7239, 29946, 29889, 29896, 29900, 29961, 29880, 1682, 29906, 29962, 16510, 13, 29886, 7239, 29946, 29889, 29896, 29896, 29961, 29880, 1682, 29906, 29925, 29962, 16510, 13, 29886, 7239, 29946, 29889, 29896, 29906, 29961, 29880, 1682, 29906, 6271, 29962, 16510, 13, 29886, 7239, 29946, 29889, 29896, 29941, 29961, 29880, 1682, 29906, 29914, 7597, 29946, 29900, 29962, 16510, 13, 29886, 7239, 29946, 29889, 29896, 29946, 29961, 29880, 1682, 29906, 29914, 29950, 4790, 307, 29962, 16510, 13, 29886, 7239, 29946, 29889, 29896, 29955, 29961, 29880, 1682, 29906, 29914, 8139, 29877, 29962, 16510, 13, 29886, 7239, 29946, 29889, 29906, 29900, 29961, 29880, 1682, 29906, 29914, 29925, 2192, 29962, 16510, 13, 29886, 7239, 29946, 29889, 29906, 29941, 29961, 29880, 1682, 29906, 29914, 1195, 29925, 29962, 16510, 13, 29886, 7239, 29946, 29889, 29906, 29953, 29961, 29880, 1682, 29906, 29914, 1195, 29925, 29914, 29950, 4790, 307, 29962, 16510, 13, 29886, 7239, 29946, 29889, 29906, 29929, 29961, 29880, 1682, 29906, 29925, 29914, 22245, 29914, 29950, 4790, 307, 29962, 16510, 13, 29886, 7239, 29946, 29889, 29941, 29900, 29961, 29880, 1682, 29906, 29925, 29914, 22498, 1299, 29899, 1525, 29914, 29950, 4790, 307, 29962, 16510, 13, 29886, 7239, 29946, 29889, 29941, 29896, 29961, 29880, 1682, 29906, 29925, 29914, 29954, 284, 29946, 29965, 3289, 29914, 29950, 4790, 307, 29962, 16510, 13, 1576, 4866, 18028, 310, 282, 7239, 29946, 10315, 9633, 559, 478, 11142, 508, 367, 1476, 472, 29901, 7821, 29889, 14032, 2442, 29889, 510, 29914, 29886, 3820, 29946, 29914, 13, 26289, 310, 678, 6916, 13, 1576, 1494, 1735, 471, 1754, 304, 278, 29871, 29953, 29914, 29896, 29945, 26554, 310, 445, 1842, 29901, 13, 1576, 2373, 296, 2472, 471, 4784, 304, 3349, 1518, 2859, 9506, 29889, 13, 16310, 3446, 3235, 383, 8193, 1254, 20700, 5800, 1525, 6418, 1430, 4214, 13756, 14849, 1783, 13, 22716, 501, 1660, 8079, 3446, 3235, 13756, 14849, 1783, 29892, 5195, 1660, 1718, 3210, 1001, 16369, 1525, 2890, 7495, 20700, 16437, 18783, 6770, 6093, 323, 1001, 4345, 8079, 3446, 3235, 27848, 3352, 501, 1660, 365, 2882, 6670, 365, 2965, 1430, 1660, 29889, 960, 278, 5925, 261, 338, 451, 17762, 304, 13, 16044, 278, 4958, 310, 445, 3858, 19405, 29892, 322, 278, 3234, 338, 443, 3880, 29892, 9705, 2442, 674, 3544, 736, 310, 278, 443, 3880, 3234, 322, 3867, 278, 5925, 261, 411, 263, 13, 8159, 2143, 870, 29889, 13, 1666, 2842, 414, 1122, 671, 445, 3234, 363, 5925, 671, 871, 29892, 694, 12128, 671, 338, 6068, 29889, 422, 1050, 1455, 671, 2794, 738, 322, 599, 3913, 310, 445, 3234, 322, 13, 672, 440, 5056, 491, 263, 6263, 363, 6909, 470, 916, 19220, 322, 1122, 3160, 541, 338, 451, 9078 ]
1,333,688
10,240
CommonCrawl
12
5
to use in: (1) product manufacture; and (2) to provide a service, information or data; and/or resale of the product or its derivatives, whether or not such product or derivatives are resold for use in research. Researchers shall have no right to modify or otherwise create variations of the nucleotide sequence of the luciferase gene except that researchers may: (1) create fused gene sequences provided that the coding sequence of the resulting luciferase gene has no more than four deoxynucleotides missing at the affected terminus compared to the intact luciferase gene sequence, and (2) insert and remove nucleic acid sequences in splicing research predicated on the inactivation or reconstitution of the luminescence of the encoded luciferase. No other use or transfer of this product or derivatives is authorized without the prior express written consent of Promega. In addition, researchers must either: (1) use luminescent assay reagents purchased from Promega for all determinations of luminescence activity of this product and its derivatives; or (2) contact Promega to obtain a license for use of the product and its derivatives. Researchers may transfer derivatives to others for research use provided that at the time of transfer a copy of this label license is given to the recipients and recipients agree to be bound by the terms of this label license. With respect to any uses outside this label license, including any diagnostic, therapeutic or prophylactic uses, please contact Promega for supply and licensing information. PROMEGA MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING FOR MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE WITH REGARDS TO THE PRODUCT. The terms of this label license shall be governed under the laws of the State of Wisconsin, USA. This label license relates to Promega patents and/or patent applications on improvements to the luciferase gene. 19942015 Promega Corporation. All Rights Reserved. Dual-Glo, Dual-Luciferase, GloMax, ProFection, Steady-Glo, Transfectam and Wizard are registered trademarks of Promega Corporation. Bright-Glo, ONE-Glo, PureYield, Tfx and TransFast are trademarks of Promega Corporation. DNASTAR is a registered trademark of of DNASTAR, Inc. GenBank is a registered trademark of the U.S. Dept. of Health and Human Services. Products may be covered by pending or issued patents or may have certain limitations. Please visit our Web site for more information. All prices and specifications are subject to change without prior notice. Product claims are subject to change. Please contact Promega Technical Services or access the Promega online catalog for the most up-to-date information on Promega products. Plasmida Clonare moleculară genă Expresia genelor Promotor (Genetică) Documente similare cu Pgl3 Luciferase Reporter Vectors Protocol olamicro Patrice Gratuito ヅ Kitkat Alorro chirag kumar NikolaP 3demons thuanguyen elvete1 S.Srinivasan ('Chinu'); Renu Khanna M Adnan Patrick Valdez Alireza Hemmati David Moura Kalpana Saravana Kumar Marcelo Henklain Silvia Andreea Bârsan ms-ls3-1 notes 03-16-08 OEN-The Kaolinovy Creature_Is It Alien or Human (On Mark Welkie Doc. AP Bio~ FRQ Biotech KEY.pdf Michael Junior Genetics Study Guide Answers 1 (1) phpxg6cXd Continuing Education at the University of Vermont 2006 Collet Et All Julio César Chávez Galarza Complete Study Question 07-1 MARY THREE Schumann Et Al 2003 - Bsubttilis Heat Shock Stimulon tiagosantoli Cuper Ingles Tecmnnico Lucio Farfan The Development of a MRNA Multiplex RT-PCR
-1.413075
-0.491481
-0.358503
0.105416
[ -0.8624650188087335, -1.963684063723737 ]
[ -0.2610491010021145, -0.7219121321167034 ]
[ 0.1817161669210249, -0.8987225098926738 ]
[ 0.6754408892968098, -0.4646096307650167 ]
1,024
[ 512, 512 ]
[ 304, 671, 297, 29901, 313, 29896, 29897, 3234, 12012, 545, 29936, 322, 313, 29906, 29897, 304, 3867, 263, 13, 5509, 29892, 2472, 470, 848, 29936, 322, 29914, 272, 620, 744, 310, 278, 3234, 470, 967, 25748, 29892, 3692, 470, 451, 1316, 3234, 470, 25748, 526, 620, 1025, 363, 671, 297, 5925, 29889, 13, 1666, 2842, 414, 4091, 505, 694, 1492, 304, 6623, 470, 6467, 1653, 21833, 310, 278, 22699, 327, 680, 5665, 310, 278, 21626, 9633, 559, 18530, 5174, 393, 5925, 414, 1122, 29901, 13, 29898, 29896, 29897, 1653, 285, 3880, 18530, 15602, 4944, 393, 278, 14137, 5665, 310, 278, 9819, 21626, 9633, 559, 18530, 756, 694, 901, 1135, 3023, 316, 2251, 948, 1682, 280, 327, 2247, 4567, 472, 13, 1552, 15201, 6624, 375, 9401, 304, 278, 938, 627, 21626, 9633, 559, 18530, 5665, 29892, 322, 313, 29906, 29897, 4635, 322, 3349, 22699, 293, 22193, 15602, 297, 805, 506, 292, 5925, 13, 11965, 293, 630, 373, 278, 297, 11236, 362, 470, 17789, 5008, 310, 278, 19703, 1475, 29883, 663, 310, 278, 18511, 21626, 9633, 559, 29889, 1939, 916, 671, 470, 6782, 310, 445, 3234, 470, 25748, 338, 13, 8921, 1891, 1728, 278, 7536, 4653, 3971, 20218, 310, 9705, 2442, 29889, 512, 6124, 29892, 5925, 414, 1818, 2845, 29901, 313, 29896, 29897, 671, 19703, 1475, 1760, 1223, 388, 337, 351, 1237, 20848, 13, 3166, 9705, 2442, 363, 599, 11806, 800, 310, 19703, 1475, 29883, 663, 6354, 310, 445, 3234, 322, 967, 25748, 29936, 470, 313, 29906, 29897, 6958, 9705, 2442, 304, 4017, 263, 19405, 363, 671, 310, 13, 1552, 3234, 322, 967, 25748, 29889, 10550, 414, 1122, 6782, 25748, 304, 4045, 363, 5925, 671, 4944, 393, 472, 278, 931, 310, 6782, 263, 3509, 310, 445, 3858, 13, 506, 1947, 338, 2183, 304, 278, 23957, 10070, 322, 23957, 10070, 8661, 304, 367, 3216, 491, 278, 4958, 310, 445, 3858, 19405, 29889, 2973, 3390, 304, 738, 3913, 5377, 445, 3858, 19405, 29892, 13, 18271, 738, 652, 21780, 29892, 266, 1572, 412, 329, 293, 470, 410, 11461, 433, 20009, 3913, 29892, 3113, 6958, 9705, 2442, 363, 11421, 322, 7794, 575, 292, 2472, 29889, 13756, 2303, 12739, 14861, 29968, 2890, 11698, 13, 1525, 15094, 29903, 3919, 8098, 29903, 6323, 399, 1718, 29934, 13566, 29059, 8079, 13764, 29979, 476, 22255, 29892, 382, 1806, 4448, 8528, 15094, 29903, 1660, 29928, 6323, 306, 3580, 5265, 3352, 29892, 2672, 6154, 15789, 4214, 15842, 341, 1001, 3210, 13566, 2882, 6227, 11937, 6323, 383, 1806, 8186, 1799, 15842, 319, 349, 8322, 2965, 13309, 1718, 13, 29925, 4574, 13152, 1660, 22659, 5195, 29954, 1718, 8452, 7495, 6093, 13756, 14849, 1783, 29889, 450, 4958, 310, 445, 3858, 19405, 4091, 367, 4095, 287, 1090, 278, 14243, 310, 278, 4306, 310, 22581, 29892, 8278, 29889, 910, 3858, 13, 506, 1947, 1104, 1078, 304, 9705, 2442, 2373, 1237, 322, 29914, 272, 2373, 296, 8324, 373, 28473, 304, 278, 21626, 9633, 559, 18530, 29889, 13, 29896, 29929, 29929, 29946, 29906, 29900, 29896, 29945, 9705, 2442, 15025, 29889, 2178, 26863, 2538, 9841, 29889, 13, 29928, 950, 29899, 29954, 417, 29892, 360, 950, 29899, 29931, 1682, 9633, 559, 29892, 21806, 7976, 29892, 1019, 8263, 428, 29892, 2443, 3714, 29899, 29954, 417, 29892, 4103, 3647, 314, 322, 399, 17909, 526, 15443, 1020, 2310, 17862, 310, 9705, 2442, 15025, 29889, 29258, 29899, 29954, 417, 29892, 13, 12413, 29899, 29954, 417, 29892, 349, 545, 29979, 969, 29892, 323, 11093, 322, 4103, 29943, 579, 526, 1020, 2310, 17862, 310, 9705, 2442, 15025, 29889, 13, 29928, 3521, 1254, 1718, 338, 263, 15443, 1020, 2310, 935, 310, 310, 25348, 1254, 1718, 29892, 9266, 29889, 5739, 29933, 804, 338, 263, 15443, 1020, 2310, 935, 310, 278, 501, 29889, 29903, 29889, 897, 415, 29889, 310, 15202, 322, 12968, 15538, 29889, 13, 25767, 1122, 367, 10664, 491, 28235, 470, 16610, 2373, 1237, 470, 1122, 505, 3058, 27028, 29889, 3529, 6493, 1749, 2563, 3268, 363, 901, 2472, 29889, 13, 3596, 26094, 322, 2702, 800, 526, 4967, 304, 1735, 1728, 7536, 8369, 29889, 13, 7566, 16726, 526, 4967, 304, 1735, 29889, 3529, 6958, 9705, 2442, 8364, 936, 15538, 470, 2130, 278, 9705, 2442, 7395, 16653, 363, 278, 1556, 701, 29899, 517, 29899, 1256, 13, 19678, 373, 9705, 2442, 9316, 29889, 13, 3247, 11625, 1458, 13, 6821, 265, 598, 13206, 16637, 30035, 13, 1885, 30035, 13, 1252, 4569, 423, 2531, 12779, 13, 18571, 327, 272, 313, 15462, 7492, 30035, 29897, 13, 6268, 29872, 1027, 309, 598, 2723, 349, 3820, 29941, 10315, 9633, 559, 830, 18505, 478, 11142, 1019, 5770, 13, 324, 314, 2357, 13, 29925, 17417, 1632, 8088, 2049, 29871, 230, 134, 136, 13, 13117, 29895, 271, 838, 272, 307, 13, 4161, 1431, 413, 24540, 13, 29940, 638, 2963, 29925, 13, 29941, 2310, 787, 13, 386, 29884, 2375, 11771, 13, 295, 29894, 2650, 29896, 13, 29903, 29889, 29903, 17056, 19701, 273, 6702, 1451, 8675, 2157, 390, 4814, 12217, 9713, 13, 29924, 2087, 13707, 13, 29925, 8141, 860, 2630, 311, 29920, 13, 29909, 15406, 1362, 20863, 29885, 2219, 13, 19504, 29075, 336, 13, 29968, 284, 29886, 1648, 7745, 485, 1648, 476, 24540, 13, 7083, 2242, 29877, 4114, 29895, 7420, 13, 26729, 6071, 1126, 929, 29874, 350, 30057, 2288, 273, 13, 1516, 29899, 3137, 29941, 29899, 29896, 11486, 13, 29900, 29941, 29899, 29896, 29953, 29899, 29900, 29947, 438, 1430, 29899, 1576, 13680, 22878, 15890, 6760, 1535, 29918, 3624, 739, 10785, 264, 470, 12968, 313, 2951, 13, 9802, 10458, 19501, 13, 14526, 29889, 12279, 21184, 30022, 23788, 29984, 3457, 866, 305, 14636, 29889, 5140, 13, 24083, 15897, 13, 15462, 300, 1199, 29301, 16886, 530, 5956, 29871, 29896, 313, 29896, 29897, 13, 561, 1756, 29887, 29953, 29883, 29990, 29881, 13, 1323, 8675, 292, 13151, 472, 278, 3014, 310, 17589, 609, 13, 29906, 29900, 29900, 29953, 1530, 1026, 8748, 2178, 13, 27501, 601, 29655, 678, 29976, 13325, 5208, 279, 1362, 13, 17813, 29301, 894, 29871, 29900, 29955, 29899, 29896, 13, 1529, 13207, 3446, 21661, 13, 4504, 22553, 8748, 838, 29871, 29906, 29900, 29900, 29941, 448, 350, 1491, 698, 23285, 940, 271, 17550, 384, 26256, 352, 265, 13, 2034, 351, 359, 424, 5079, 13, 29907, 14805, 22607, 793, 323, 687, 23521, 15024, 13, 24126, 3934, 8413, 12963, 13, 1576, 14650, 310, 263, 29751, 3521, 14974, 10709, 390, 29911, 29899, 9026, 29934 ]
1,333,688
11,264
CommonCrawl
3
13
@import Social; @implementation SimpleAuthFacebookProvider #pragma mark - SimpleAuthProvider + (NSString *)type { return @"facebook"; } + (NSDictionary *)defaultOptions { return @{ @"permissions" : @[ @"email" ], @"audience" : @[ ACFacebookAudienceOnlyMe ] }; } - (void)authorizeWithCompletion:(SimpleAuthRequestHandler)completion { [[[self systemAccount] flattenMap:^RACStream *(ACAccount *account) { NSArray *signals = @[ [self remoteAccountWithSystemAccount:account], [RACSignal return:account] ]; return [self rac_liftSelector:@selector(dictionaryWithRemoteAccount:systemAccount:) withSignalsFromArray:signals]; }] subscribeNext:^(NSDictionary *response) { completion(response, nil); } error:^(NSError *error) { completion(nil, error); }]; } #pragma mark - Private - (RACSignal *)allSystemAccounts { NSDictionary *options = @{ ACFacebookAppIdKey : self.options[@"app_id"], ACFacebookPermissionsKey : self.options[@"permissions"], ACFacebookAudienceKey: (self.options[@"audience"] ?: ACFacebookAudienceOnlyMe) }; return [ACAccountStore SimpleAuth_accountsWithTypeIdentifier:ACAccountTypeIdentifierFacebook options:options]; } - (RACSignal *)systemAccount { return [[self allSystemAccounts] map:^(NSArray *accounts) { return [accounts lastObject]; }]; } - (RACSignal *)remoteAccountWithSystemAccount:(ACAccount *)account { return [RACSignal createSignal:^RACDisposable *(id<RACSubscriber> subscriber) { NSURL *URL = [NSURL URLWithString:@"https://graph.facebook.com/me"]; SLRequest *request = [SLRequest requestForServiceType:SLServiceTypeFacebook requestMethod:SLRequestMethodGET URL:URL parameters:nil]; request.account = account; [request performRequestWithHandler:^(NSData *data, NSHTTPURLResponse *response, NSError *connectionError) { NSIndexSet *indexSet = [NSIndexSet indexSetWithIndexesInRange:NSMakeRange(200, 99)]; NSInteger statusCode = [response statusCode]; if ([indexSet containsIndex:statusCode] && data) { NSError *parseError = nil; NSDictionary *dictionary = [NSJSONSerialization JSONObjectWithData:data options:kNilOptions error:&parseError]; if (dictionary) { [subscriber sendNext:dictionary]; [subscriber sendCompleted]; } else { [subscriber sendError:parseError]; } } else { [subscriber sendError:connectionError]; } }]; return nil; }]; } - (NSDictionary *)dictionaryWithRemoteAccount:(NSDictionary *)remoteAccount systemAccount:(ACAccount *)systemAccount { NSMutableDictionary *dictionary = [NSMutableDictionary new]; // Provider dictionary[@"provider"] = [[self class] type]; // Credentials dictionary[@"credentials"] = @{ @"token" : systemAccount.credential.oauthToken }; // User ID dictionary[@"uid"] = remoteAccount[@"id"]; // Raw response dictionary[@"extra"] = @{ @"raw_info" : remoteAccount, @"account" : systemAccount }; // Profile image NSString *avatar = [NSString stringWithFormat:@"https://graph.facebook.com/%@/picture?type=large", remoteAccount[@"id"]]; // Location NSString *location = remoteAccount[@"location"][@"name"]; // User info NSMutableDictionary *user = [NSMutableDictionary new]; user[@"nickname"]
-1.098049
-1.17136
-0.575352
0.126552
[ -0.8789011239567186, -1.317197261236322 ]
[ -1.1552442487936552, -1.1874755632572302 ]
[ -0.3318726407192896, -0.8188309175930693 ]
[ 0.3216545328144175, -0.06855100742351508 ]
1,024
[ 512, 512 ]
[ 732, 5215, 10307, 29936, 13, 13, 29992, 21382, 12545, 6444, 23360, 2909, 6980, 13, 13, 29937, 28436, 2791, 448, 12545, 6444, 6980, 13, 13, 29974, 313, 14301, 4748, 1853, 426, 13, 1678, 736, 12490, 15445, 1769, 13, 29913, 13, 13, 13, 29974, 313, 3059, 11513, 4748, 4381, 5856, 426, 13, 1678, 736, 732, 29912, 13, 4706, 12490, 17858, 6847, 29908, 584, 732, 29961, 12490, 5269, 29908, 21251, 13, 4706, 12490, 28863, 663, 29908, 584, 732, 29961, 319, 9207, 815, 2909, 29909, 4749, 663, 11730, 6816, 4514, 13, 1678, 3980, 13, 29913, 13, 13, 13, 29899, 313, 5405, 29897, 8921, 675, 3047, 28958, 5919, 15427, 6444, 3089, 4598, 29897, 5729, 12757, 426, 13, 1678, 5519, 29961, 1311, 1788, 10601, 29962, 13, 268, 1652, 8606, 3388, 29901, 29985, 29934, 2477, 3835, 334, 29898, 2477, 10601, 334, 10149, 29897, 426, 13, 308, 3865, 2588, 334, 4530, 1338, 353, 732, 29961, 13, 632, 518, 1311, 7592, 10601, 3047, 3924, 10601, 29901, 10149, 1402, 13, 632, 518, 29934, 2477, 10140, 284, 736, 29901, 10149, 29962, 13, 308, 12940, 13, 308, 736, 518, 1311, 11021, 29918, 29880, 2027, 10378, 26984, 14357, 29898, 27126, 3047, 20224, 10601, 29901, 5205, 10601, 20925, 411, 10140, 1338, 4591, 2588, 29901, 4530, 1338, 1385, 13, 268, 500, 29962, 13, 268, 1014, 13086, 9190, 29901, 23733, 3059, 11513, 334, 5327, 29897, 426, 13, 308, 13285, 29898, 5327, 29892, 4263, 416, 13, 268, 500, 13, 268, 1059, 29901, 23733, 29940, 29173, 334, 2704, 29897, 426, 13, 308, 13285, 29898, 8834, 29892, 1059, 416, 13, 268, 500, 1385, 13, 29913, 13, 13, 13, 29937, 28436, 2791, 448, 12230, 13, 13, 29899, 313, 29934, 2477, 10140, 284, 4748, 497, 3924, 10601, 29879, 426, 13, 1678, 3865, 11513, 334, 6768, 353, 732, 29912, 13, 4706, 319, 9207, 815, 2909, 2052, 1204, 2558, 584, 1583, 29889, 6768, 29961, 5507, 932, 29918, 333, 12436, 13, 4706, 319, 9207, 815, 2909, 15737, 6847, 2558, 584, 1583, 29889, 6768, 29961, 5507, 17858, 6847, 12436, 13, 308, 13, 4706, 319, 9207, 815, 2909, 29909, 4749, 663, 2558, 29901, 313, 1311, 29889, 6768, 29961, 5507, 28863, 663, 3108, 1577, 29901, 319, 9207, 815, 2909, 29909, 4749, 663, 11730, 6816, 29897, 13, 1678, 3980, 13, 1678, 736, 518, 2477, 10601, 9044, 12545, 6444, 29918, 10149, 29879, 3047, 1542, 12889, 29901, 2477, 10601, 1542, 12889, 23360, 2909, 3987, 29901, 6768, 1385, 13, 29913, 13, 13, 13, 29899, 313, 29934, 2477, 10140, 284, 4748, 5205, 10601, 426, 13, 1678, 736, 5519, 1311, 599, 3924, 10601, 29879, 29962, 2910, 29901, 23733, 3059, 2588, 334, 10149, 29879, 29897, 426, 13, 4706, 736, 518, 10149, 29879, 1833, 2061, 1385, 13, 1678, 500, 1385, 13, 29913, 13, 13, 13, 29899, 313, 29934, 2477, 10140, 284, 4748, 16674, 10601, 3047, 3924, 10601, 5919, 2477, 10601, 4748, 10149, 426, 13, 1678, 736, 518, 29934, 2477, 10140, 284, 1653, 10140, 284, 29901, 29985, 29934, 2477, 4205, 1066, 519, 334, 29898, 333, 29966, 29934, 2477, 4035, 7588, 495, 29958, 21696, 495, 29897, 426, 13, 4706, 3865, 4219, 334, 4219, 353, 518, 29680, 3988, 3047, 1231, 8593, 991, 597, 4262, 29889, 15445, 29889, 510, 29914, 1004, 10370, 13, 4706, 27146, 3089, 334, 3827, 353, 518, 12750, 3089, 2009, 2831, 3170, 1542, 29901, 12750, 3170, 1542, 23360, 2909, 2009, 4062, 29901, 12750, 3089, 4062, 7194, 3988, 29901, 4219, 4128, 29901, 8834, 1385, 13, 4706, 2009, 29889, 10149, 353, 3633, 29936, 13, 4706, 518, 3827, 2189, 3089, 3047, 4598, 29901, 23733, 3059, 1469, 334, 1272, 29892, 3865, 10493, 4219, 5103, 334, 5327, 29892, 405, 29173, 334, 9965, 2392, 29897, 426, 13, 9651, 3865, 3220, 2697, 334, 2248, 2697, 353, 518, 3059, 3220, 2697, 2380, 2697, 3047, 3220, 267, 797, 6069, 29901, 3059, 9984, 6069, 29898, 29906, 29900, 29900, 29892, 29871, 29929, 29929, 27077, 13, 9651, 3865, 7798, 4660, 3399, 353, 518, 5327, 4660, 3399, 1385, 13, 9651, 565, 9310, 2248, 2697, 3743, 3220, 29901, 4882, 3399, 29962, 2607, 848, 29897, 426, 13, 18884, 405, 29173, 334, 5510, 2392, 353, 4263, 29936, 13, 18884, 3865, 11513, 334, 27126, 353, 518, 3059, 7249, 9125, 2133, 4663, 2061, 3047, 1469, 29901, 1272, 3987, 29901, 29895, 27823, 5856, 1059, 29901, 29987, 5510, 2392, 1385, 13, 18884, 565, 313, 27126, 29897, 426, 13, 462, 1678, 518, 1491, 7588, 495, 3638, 9190, 29901, 27126, 1385, 13, 462, 1678, 518, 1491, 7588, 495, 3638, 26010, 1385, 13, 18884, 500, 13, 18884, 1683, 426, 13, 462, 1678, 518, 1491, 7588, 495, 3638, 2392, 29901, 5510, 2392, 1385, 13, 18884, 500, 13, 9651, 500, 13, 9651, 1683, 426, 13, 18884, 518, 1491, 7588, 495, 3638, 2392, 29901, 9965, 2392, 1385, 13, 9651, 500, 13, 4706, 500, 1385, 13, 4706, 736, 4263, 29936, 13, 1678, 500, 1385, 13, 29913, 13, 13, 13, 29899, 313, 3059, 11513, 4748, 27126, 3047, 20224, 10601, 5919, 3059, 11513, 4748, 16674, 10601, 1788, 10601, 5919, 2477, 10601, 4748, 5205, 10601, 426, 13, 1678, 3865, 15211, 11513, 334, 27126, 353, 518, 3059, 15211, 11513, 716, 1385, 13, 268, 13, 1678, 849, 1019, 5489, 13, 1678, 8600, 29961, 5507, 18121, 3108, 353, 5519, 1311, 770, 29962, 1134, 1385, 13, 268, 13, 1678, 849, 24596, 9409, 13, 1678, 8600, 29961, 5507, 11944, 9409, 3108, 353, 732, 29912, 13, 4706, 12490, 6979, 29908, 584, 1788, 10601, 29889, 11944, 2556, 29889, 23106, 6066, 13, 1678, 3980, 13, 268, 13, 1678, 849, 4911, 3553, 13, 1678, 8600, 29961, 5507, 5416, 3108, 353, 7592, 10601, 29961, 5507, 333, 10370, 13, 268, 13, 1678, 849, 22038, 2933, 13, 1678, 8600, 29961, 5507, 17833, 3108, 353, 732, 29912, 13, 4706, 12490, 1610, 29918, 3888, 29908, 584, 7592, 10601, 29892, 13, 4706, 12490, 10149, 29908, 584, 1788, 10601, 13, 1678, 3980, 13, 268, 13, 1678, 849, 20802, 1967, 13, 1678, 15925, 334, 485, 14873, 353, 518, 14301, 1347, 3047, 5809, 8593, 991, 597, 4262, 29889, 15445, 29889, 510, 22584, 29992, 29914, 12095, 29973, 1853, 29922, 16961, 613, 7592, 10601, 29961, 5507, 333, 3108, 1385, 13, 268, 13, 1678, 849, 17015, 13, 1678, 15925, 334, 5479, 353, 7592, 10601, 29961, 5507, 5479, 3108, 29961, 5507, 978, 10370, 13, 268, 13, 1678, 849, 4911, 5235, 13, 1678, 3865, 15211, 11513, 334, 1792, 353, 518, 3059, 15211, 11513, 716, 1385, 13, 1678, 1404, 29961, 5507, 19254, 978, 3108 ]
1,333,691
0
Github
-1
-1
Major Charles Huguenot Waterhouse1 M, #106381, b. 11 June 1918, d. 15 July 2007 Major Charles Huguenot Waterhouse was born on 11 June 1918.2 He was the son of Captain Rt. Hon. Charles Waterhouse.1 He married Lady Caroline Spencer-Churchill, daughter of Lt.-Col. John Albert Edward William Spencer-Churchill, 10th Duke of Marlborough and Hon. Alexandra Mary Hilda Cadogan, on 5 December 1946.1 He died on 15 July 2007 at age 89 at Rievaulx, Yorkshire, EnglandG.2 Major Charles Huguenot Waterhouse usually went by his middle name of Hugo.2 He gained the rank of Major in the Life Guards.1 Children of Major Charles Huguenot Waterhouse and Lady Caroline Spencer-Churchill Michael Thomas Waterhouse+1 b. 25 May 1949 Elizabeth Ann Waterhouse+1 b. 24 Jun 1951 David Charles Waterhouse1 b. 8 Jul 1956 [S8] BP1999 volume 2, page 1870. See link for full details for this source. Hereinafter cited as. [S8] [S1122] Peerage News, online http://peeragenews.blogspot.co.nz/. Hereinafter cited as Peerage News. Captain Rt. Hon. Charles Waterhouse1 Captain Rt. Hon. Charles Waterhouse was appointed Privy Counsellor (P.C.)1 He held the office of Justice of the Peace (J.P.)1 He held the office of Deputy Lieutenant (D.L.) of Derbyshire.1 He lived at Middleton Hall, Bakewell, Derbyshire, EnglandG.1 He was awarded the Military Cross (M.C.)1 Child of Captain Rt. Hon. Charles Waterhouse Major Charles Huguenot Waterhouse+1 b. 11 Jun 1918, d. 15 Jul 2007 Michael Thomas Waterhouse1 Michael Thomas Waterhouse was born on 25 May 1949.1 He is the son of Major Charles Huguenot Waterhouse and Lady Caroline Spencer-Churchill.1 He married Lucinda Ileene Hastings, daughter of Lt.-Col. Robin Hood William Stewart Hastings and Jean Suzanne Palethorpe, in 1983.1 He was educated at Eton College, Windsor, Berkshire, EnglandG.1 He was educated at Trinity College, Cambridge University, Cambridge, Cambridgeshire, EnglandG.1 He lived in 1999 at Middleton Hall, Bakewell, Derbyshire, EnglandG.1 Children of Michael Thomas Waterhouse and Lucinda Ileene Hastings Robin Hood E. T. Waterhouse1 b. 1987 Marcus Charles Waterhouse1 b. 1990 Lucinda Ileene Hastings1 F, #106384, b. 15 July 1955 Lucinda Ileene Hastings was born on 15 July 1955.2 She is the daughter of Lt.-Col. Robin Hood William Stewart Hastings and Jean Suzanne Palethorpe.2,1 She married Michael Thomas Waterhouse, son of Major Charles Huguenot Waterhouse and Lady Caroline Spencer-Churchill, in 1983.1 She lived in 2003 at Middleton Hall, Bakewell, Derbyshire, EnglandG.2 Children of Lucinda Ileene Hastings and Michael Thomas Waterhouse Lt.-Col. Robin Hood William Stewart Hastings1 M, #106385, b. 16 January 1917, d. 28 March 1990 Lt.-Col. Robin Hood William Stewart Hastings was born on 16 January 1917.2 He was the son of Hon. Osmond William Toome Westenra Hastings and Mary Caroline Campbell Tarratt.2 He married Jean Suzanne Palethorpe, daughter of Henry Palethorpe, on 25 May 1950.2
-0.919991
-0.124793
-1.390753
-0.522409
[ -0.8734224222407236, -0.9665603514126393 ]
[ -0.02177635682460333, -0.22781055796155283 ]
[ -1.4617680175279815, -1.3197385201064624 ]
[ -0.45095243685668907, -0.5938652159688319 ]
1,024
[ 512, 512 ]
[ 11019, 5322, 379, 688, 3837, 327, 13062, 8697, 29896, 13, 29924, 29892, 396, 29896, 29900, 29953, 29941, 29947, 29896, 29892, 289, 29889, 29871, 29896, 29896, 5306, 29871, 29896, 29929, 29896, 29947, 29892, 270, 29889, 29871, 29896, 29945, 5468, 29871, 29906, 29900, 29900, 29955, 13, 29924, 1175, 272, 5322, 379, 688, 3837, 327, 13062, 8697, 471, 6345, 373, 29871, 29896, 29896, 5306, 29871, 29896, 29929, 29896, 29947, 29889, 29906, 940, 471, 278, 1487, 310, 10842, 390, 29873, 29889, 7906, 29889, 5322, 13062, 8697, 29889, 29896, 940, 8300, 10040, 26980, 1706, 22687, 29899, 1451, 2458, 453, 29892, 8750, 310, 365, 29873, 9229, 1625, 29889, 2259, 10537, 9300, 4667, 1706, 22687, 29899, 1451, 2458, 453, 29892, 29871, 29896, 29900, 386, 13484, 310, 1085, 29880, 22187, 322, 7906, 29889, 4827, 10738, 6182, 379, 25949, 21542, 468, 273, 29892, 373, 29871, 29945, 5846, 29871, 29896, 29929, 29946, 29953, 29889, 29896, 940, 6423, 373, 29871, 29896, 29945, 5468, 29871, 29906, 29900, 29900, 29955, 472, 5046, 29871, 29947, 29929, 472, 390, 347, 1564, 352, 29916, 29892, 3088, 11750, 29892, 5408, 29954, 29889, 29906, 13, 29924, 1175, 272, 5322, 379, 688, 3837, 327, 13062, 8697, 5491, 3512, 491, 670, 7256, 1024, 310, 20650, 29889, 29906, 940, 17515, 278, 7115, 310, 11019, 297, 278, 4634, 2088, 3163, 29889, 29896, 13, 19334, 310, 11019, 5322, 379, 688, 3837, 327, 13062, 8697, 322, 10040, 26980, 1706, 22687, 29899, 1451, 2458, 453, 13, 24083, 5569, 13062, 8697, 29974, 29896, 289, 29889, 29871, 29906, 29945, 2610, 29871, 29896, 29929, 29946, 29929, 13, 6489, 466, 9394, 8081, 13062, 8697, 29974, 29896, 289, 29889, 29871, 29906, 29946, 8378, 29871, 29896, 29929, 29945, 29896, 13, 19504, 5322, 13062, 8697, 29896, 289, 29889, 29871, 29947, 2739, 29871, 29896, 29929, 29945, 29953, 13, 29961, 29903, 29947, 29962, 350, 29925, 29896, 29929, 29929, 29929, 7977, 29871, 29906, 29892, 1813, 29871, 29896, 29947, 29955, 29900, 29889, 2823, 1544, 363, 2989, 4902, 363, 445, 2752, 29889, 2266, 1099, 906, 274, 1573, 408, 29889, 518, 29903, 29947, 29962, 13, 29961, 29903, 29896, 29896, 29906, 29906, 29962, 3938, 261, 482, 10130, 29892, 7395, 1732, 597, 412, 261, 5370, 809, 29879, 29889, 7312, 17500, 29889, 1111, 29889, 29876, 29920, 6294, 2266, 1099, 906, 274, 1573, 408, 3938, 261, 482, 10130, 29889, 13, 21133, 475, 390, 29873, 29889, 7906, 29889, 5322, 13062, 8697, 29896, 13, 21133, 475, 390, 29873, 29889, 7906, 29889, 5322, 13062, 8697, 471, 10658, 18936, 29891, 6237, 29879, 514, 272, 313, 29925, 29889, 29907, 1846, 29896, 940, 4934, 278, 8034, 310, 17181, 310, 278, 24819, 313, 29967, 29889, 29925, 1846, 29896, 940, 4934, 278, 8034, 310, 26721, 29891, 20445, 313, 29928, 29889, 29931, 1846, 310, 29520, 11750, 29889, 29896, 940, 10600, 472, 14253, 880, 6573, 29892, 350, 1296, 5872, 29892, 29520, 11750, 29892, 5408, 29954, 29889, 29896, 940, 471, 15074, 278, 20080, 11189, 313, 29924, 29889, 29907, 1846, 29896, 13, 5938, 310, 10842, 390, 29873, 29889, 7906, 29889, 5322, 13062, 8697, 13, 29924, 1175, 272, 5322, 379, 688, 3837, 327, 13062, 8697, 29974, 29896, 289, 29889, 29871, 29896, 29896, 8378, 29871, 29896, 29929, 29896, 29947, 29892, 270, 29889, 29871, 29896, 29945, 2739, 29871, 29906, 29900, 29900, 29955, 13, 24083, 5569, 13062, 8697, 29896, 13, 24083, 5569, 13062, 8697, 471, 6345, 373, 29871, 29906, 29945, 2610, 29871, 29896, 29929, 29946, 29929, 29889, 29896, 940, 338, 278, 1487, 310, 11019, 5322, 379, 688, 3837, 327, 13062, 8697, 322, 10040, 26980, 1706, 22687, 29899, 1451, 2458, 453, 29889, 29896, 940, 8300, 10315, 11054, 306, 280, 1600, 379, 579, 886, 29892, 8750, 310, 365, 29873, 9229, 1625, 29889, 13104, 379, 2092, 4667, 22389, 379, 579, 886, 322, 4581, 2166, 29920, 11276, 26412, 386, 272, 412, 29892, 297, 29871, 29896, 29929, 29947, 29941, 29889, 29896, 13, 3868, 471, 27729, 472, 382, 880, 6346, 29892, 399, 12772, 272, 29892, 2292, 29895, 11750, 29892, 5408, 29954, 29889, 29896, 940, 471, 27729, 472, 1605, 13593, 6346, 29892, 12585, 3014, 29892, 12585, 29892, 9287, 2429, 2710, 14812, 29892, 5408, 29954, 29889, 29896, 940, 10600, 297, 29871, 29896, 29929, 29929, 29929, 472, 14253, 880, 6573, 29892, 350, 1296, 5872, 29892, 29520, 11750, 29892, 5408, 29954, 29889, 29896, 13, 19334, 310, 5765, 5569, 13062, 8697, 322, 10315, 11054, 306, 280, 1600, 379, 579, 886, 13, 21860, 262, 379, 2092, 382, 29889, 323, 29889, 13062, 8697, 29896, 289, 29889, 29871, 29896, 29929, 29947, 29955, 13, 29924, 5666, 375, 5322, 13062, 8697, 29896, 289, 29889, 29871, 29896, 29929, 29929, 29900, 13, 29931, 1682, 11054, 306, 280, 1600, 379, 579, 886, 29896, 13, 29943, 29892, 396, 29896, 29900, 29953, 29941, 29947, 29946, 29892, 289, 29889, 29871, 29896, 29945, 5468, 29871, 29896, 29929, 29945, 29945, 13, 29931, 1682, 11054, 306, 280, 1600, 379, 579, 886, 471, 6345, 373, 29871, 29896, 29945, 5468, 29871, 29896, 29929, 29945, 29945, 29889, 29906, 2296, 338, 278, 8750, 310, 365, 29873, 9229, 1625, 29889, 13104, 379, 2092, 4667, 22389, 379, 579, 886, 322, 4581, 2166, 29920, 11276, 26412, 386, 272, 412, 29889, 29906, 29892, 29896, 2296, 8300, 5765, 5569, 13062, 8697, 29892, 1487, 310, 11019, 5322, 379, 688, 3837, 327, 13062, 8697, 322, 10040, 26980, 1706, 22687, 29899, 1451, 2458, 453, 29892, 297, 29871, 29896, 29929, 29947, 29941, 29889, 29896, 13, 13468, 10600, 297, 29871, 29906, 29900, 29900, 29941, 472, 14253, 880, 6573, 29892, 350, 1296, 5872, 29892, 29520, 11750, 29892, 5408, 29954, 29889, 29906, 13, 19334, 310, 10315, 11054, 306, 280, 1600, 379, 579, 886, 322, 5765, 5569, 13062, 8697, 13, 29931, 29873, 9229, 1625, 29889, 13104, 379, 2092, 4667, 22389, 379, 579, 886, 29896, 13, 29924, 29892, 396, 29896, 29900, 29953, 29941, 29947, 29945, 29892, 289, 29889, 29871, 29896, 29953, 5490, 29871, 29896, 29929, 29896, 29955, 29892, 270, 29889, 29871, 29906, 29947, 4779, 29871, 29896, 29929, 29929, 29900, 13, 29931, 29873, 9229, 1625, 29889, 13104, 379, 2092, 4667, 22389, 379, 579, 886, 471, 6345, 373, 29871, 29896, 29953, 5490, 29871, 29896, 29929, 29896, 29955, 29889, 29906, 940, 471, 278, 1487, 310, 7906, 29889, 438, 3844, 898, 4667, 1763, 608, 26582, 336, 379, 579, 886, 322, 6182, 26980, 22163, 323, 2749, 1131, 29889, 29906, 940, 8300, 4581, 2166, 29920, 11276, 26412, 386, 272, 412, 29892, 8750, 310, 6498, 26412, 386, 272, 412, 29892, 373, 29871, 29906, 29945, 2610, 29871, 29896, 29929, 29945, 29900, 29889, 29906 ]
1,333,692
0
CommonCrawl
0
3
He died on 28 March 1990 at age 73 at Alresford, Hampshire, England.2,3 He was educated at Stowe School, Buckingham, Buckinghamshire, EnglandG.2 He was educated at Christ Church, Oxford University, Oxford, Oxfordshire, EnglandG.2 He fought in the Second World War, where he was wounded, and was mentioned in despatches twice.2 He was awarded the Military Cross (M.C.)1 He was awarded the Companion, Distinguished Service Order (D.S.O.) in 1944 and bar (1945).1 He gained the rank of Lieutenant-Colonel in the Rifle Brigade.2 He was appointed Officer, Order of the British Empire (O.B.E.) in 1945.1 He lived at Bramdean Manor, Alresford, Hampshire, EnglandG.2 Child of Lt.-Col. Robin Hood William Stewart Hastings and Jean Suzanne Palethorpe Lucinda Ileene Hastings+1 b. 15 Jul 1955 [S266] World War II Unit Histories - Officers, online http://www.unithistories.com/units_index/default.asp?file=../officers/personsx.html. Hereinafter cited as World War II Unit Histories - Officers. Robin Hood E. T. Waterhouse1 Robin Hood E. T. Waterhouse was born in 1987.1 He is the son of Michael Thomas Waterhouse and Lucinda Ileene Hastings.1 Marcus Charles Waterhouse1 Marcus Charles Waterhouse was born in 1990.1 He is the son of Michael Thomas Waterhouse and Lucinda Ileene Hastings.1 David Charles Waterhouse1 M, #106388, b. 8 July 1956 David Charles Waterhouse was born on 8 July 1956.1 He is the son of Major Charles Huguenot Waterhouse and Lady Caroline Spencer-Churchill.1 He was educated in 1968 at Eton College, Windsor, Berkshire, EnglandG.1 Elizabeth Ann Waterhouse1 F, #106389, b. 24 June 1951 Elizabeth Ann Waterhouse was born on 24 June 1951.1 She is the daughter of Major Charles Huguenot Waterhouse and Lady Caroline Spencer-Churchill.1 She married Sir Richard Gervase Beckett, 3rd Bt., son of Sir Martyn Gervase Beckett, 2nd Bt. and Hon. Priscilla Léonie Helen Brett, on 17 December 1976.2 From 17 December 1976, her married name became Beckett.2 Children of Elizabeth Ann Waterhouse and Sir Richard Gervase Beckett, 3rd Bt. Willa Marjorie Beckett2 b. 27 Aug 1977 Molly Rachel Beckett2 b. 17 Apr 1979 Catherine Rose Beckett2 b. 3 May 1983 Walter Gervase Beckett2 b. 16 Jan 1987 Lady Rosemary Mildred Spencer-Churchill1 Last Edited=4 May 2011 Lady Rosemary Muir2 Lady Rosemary Mildred Spencer-Churchill was born on 24 July 1929.1 She is the daughter of Lt.-Col. John Albert Edward William Spencer-Churchill, 10th Duke of Marlborough and Hon. Alexandra Mary Hilda Cadogan.1 She married Charles Robert Muir, son of Rowland Huntly Muir, on 26 June 1953.1 From 26 June 1953, her married name became Muir. She lived in 1999 at Orange Hill House, Binfield, Bracknell, Berkshire, EnglandG.1 Children of Lady Rosemary Mildred Spencer-Churchill and Charles Robert Muir Alexander Pepys Muir1 b. 8 Nov 1954 Simon Huntly Muir+1 b. 3 Jul 1959 Mary Arabella Muir+1 b. 16 Jan 1
-0.79946
0.151691
-1.19039
-0.463228
[ -0.928209439400674, -0.670710458748907 ]
[ 0.47422776019818874, -0.1708461862186374 ]
[ -0.9646647765526648, -1.4161156790710647 ]
[ -0.294870220761516, -0.6315850848584987 ]
1,024
[ 512, 512 ]
[ 940, 6423, 373, 29871, 29906, 29947, 4779, 29871, 29896, 29929, 29929, 29900, 472, 5046, 29871, 29955, 29941, 472, 838, 690, 4006, 29892, 7904, 28401, 29892, 5408, 29889, 29906, 29892, 29941, 13, 3868, 471, 27729, 472, 624, 4657, 4523, 29892, 16281, 16094, 29892, 16281, 16094, 11750, 29892, 5408, 29954, 29889, 29906, 940, 471, 27729, 472, 2819, 6291, 29892, 11045, 3014, 29892, 11045, 29892, 11045, 11750, 29892, 5408, 29954, 29889, 29906, 940, 20722, 297, 278, 6440, 2787, 3362, 29892, 988, 540, 471, 19747, 29892, 322, 471, 5276, 297, 553, 5041, 267, 8951, 29889, 29906, 940, 471, 15074, 278, 20080, 11189, 313, 29924, 29889, 29907, 1846, 29896, 940, 471, 15074, 278, 3831, 273, 291, 29892, 6652, 6202, 3276, 6692, 8170, 313, 29928, 29889, 29903, 29889, 29949, 1846, 297, 29871, 29896, 29929, 29946, 29946, 322, 2594, 313, 29896, 29929, 29946, 29945, 467, 29896, 940, 17515, 278, 7115, 310, 20445, 29899, 1625, 11064, 297, 278, 390, 361, 280, 23896, 29889, 29906, 940, 471, 10658, 28288, 29892, 8170, 310, 278, 4908, 13378, 313, 29949, 29889, 29933, 29889, 29923, 1846, 297, 29871, 29896, 29929, 29946, 29945, 29889, 29896, 940, 10600, 472, 1771, 314, 311, 273, 2315, 272, 29892, 838, 690, 4006, 29892, 7904, 28401, 29892, 5408, 29954, 29889, 29906, 13, 5938, 310, 365, 29873, 9229, 1625, 29889, 13104, 379, 2092, 4667, 22389, 379, 579, 886, 322, 4581, 2166, 29920, 11276, 26412, 386, 272, 412, 13, 29931, 1682, 11054, 306, 280, 1600, 379, 579, 886, 29974, 29896, 289, 29889, 29871, 29896, 29945, 2739, 29871, 29896, 29929, 29945, 29945, 13, 29961, 29903, 29906, 29953, 29953, 29962, 2787, 3362, 1944, 13223, 4731, 583, 448, 20339, 414, 29892, 7395, 1732, 597, 1636, 29889, 348, 389, 2118, 583, 29889, 510, 29914, 348, 1169, 29918, 2248, 29914, 4381, 29889, 4692, 29973, 1445, 29922, 6995, 29877, 2416, 414, 29914, 6774, 787, 29916, 29889, 1420, 29889, 2266, 1099, 906, 274, 1573, 408, 2787, 3362, 1944, 13223, 4731, 583, 448, 20339, 414, 29889, 13, 21860, 262, 379, 2092, 382, 29889, 323, 29889, 13062, 8697, 29896, 13, 21860, 262, 379, 2092, 382, 29889, 323, 29889, 13062, 8697, 471, 6345, 297, 29871, 29896, 29929, 29947, 29955, 29889, 29896, 940, 338, 278, 1487, 310, 5765, 5569, 13062, 8697, 322, 10315, 11054, 306, 280, 1600, 379, 579, 886, 29889, 29896, 13, 29924, 5666, 375, 5322, 13062, 8697, 29896, 13, 29924, 5666, 375, 5322, 13062, 8697, 471, 6345, 297, 29871, 29896, 29929, 29929, 29900, 29889, 29896, 940, 338, 278, 1487, 310, 5765, 5569, 13062, 8697, 322, 10315, 11054, 306, 280, 1600, 379, 579, 886, 29889, 29896, 13, 19504, 5322, 13062, 8697, 29896, 13, 29924, 29892, 396, 29896, 29900, 29953, 29941, 29947, 29947, 29892, 289, 29889, 29871, 29947, 5468, 29871, 29896, 29929, 29945, 29953, 13, 19504, 5322, 13062, 8697, 471, 6345, 373, 29871, 29947, 5468, 29871, 29896, 29929, 29945, 29953, 29889, 29896, 940, 338, 278, 1487, 310, 11019, 5322, 379, 688, 3837, 327, 13062, 8697, 322, 10040, 26980, 1706, 22687, 29899, 1451, 2458, 453, 29889, 29896, 13, 3868, 471, 27729, 297, 29871, 29896, 29929, 29953, 29947, 472, 382, 880, 6346, 29892, 399, 12772, 272, 29892, 2292, 29895, 11750, 29892, 5408, 29954, 29889, 29896, 13, 6489, 466, 9394, 8081, 13062, 8697, 29896, 13, 29943, 29892, 396, 29896, 29900, 29953, 29941, 29947, 29929, 29892, 289, 29889, 29871, 29906, 29946, 5306, 29871, 29896, 29929, 29945, 29896, 13, 6489, 466, 9394, 8081, 13062, 8697, 471, 6345, 373, 29871, 29906, 29946, 5306, 29871, 29896, 29929, 29945, 29896, 29889, 29896, 2296, 338, 278, 8750, 310, 11019, 5322, 379, 688, 3837, 327, 13062, 8697, 322, 10040, 26980, 1706, 22687, 29899, 1451, 2458, 453, 29889, 29896, 2296, 8300, 6290, 6123, 5681, 29894, 559, 19573, 1803, 29892, 29871, 29941, 5499, 350, 29873, 1696, 1487, 310, 6290, 3760, 948, 5681, 29894, 559, 19573, 1803, 29892, 29871, 29906, 299, 350, 29873, 29889, 322, 7906, 29889, 1588, 10669, 2911, 16306, 9599, 21758, 5826, 698, 29892, 373, 29871, 29896, 29955, 5846, 29871, 29896, 29929, 29955, 29953, 29889, 29906, 13, 4591, 29871, 29896, 29955, 5846, 29871, 29896, 29929, 29955, 29953, 29892, 902, 8300, 1024, 3897, 19573, 1803, 29889, 29906, 13, 19334, 310, 13061, 8081, 13062, 8697, 322, 6290, 6123, 5681, 29894, 559, 19573, 1803, 29892, 29871, 29941, 5499, 350, 29873, 29889, 13, 29956, 2911, 1085, 3418, 347, 19573, 1803, 29906, 289, 29889, 29871, 29906, 29955, 22333, 29871, 29896, 29929, 29955, 29955, 13, 29924, 18368, 23647, 295, 19573, 1803, 29906, 289, 29889, 29871, 29896, 29955, 319, 558, 29871, 29896, 29929, 29955, 29929, 13, 29907, 16490, 14008, 19573, 1803, 29906, 289, 29889, 29871, 29941, 2610, 29871, 29896, 29929, 29947, 29941, 13, 29956, 13794, 5681, 29894, 559, 19573, 1803, 29906, 289, 29889, 29871, 29896, 29953, 2627, 29871, 29896, 29929, 29947, 29955, 13, 29931, 3714, 5678, 331, 653, 341, 789, 1127, 1706, 22687, 29899, 1451, 2458, 453, 29896, 13, 8897, 2155, 1573, 29922, 29946, 2610, 29871, 29906, 29900, 29896, 29896, 13, 29931, 3714, 5678, 331, 653, 8229, 381, 29906, 13, 29931, 3714, 5678, 331, 653, 341, 789, 1127, 1706, 22687, 29899, 1451, 2458, 453, 471, 6345, 373, 29871, 29906, 29946, 5468, 29871, 29896, 29929, 29906, 29929, 29889, 29896, 2296, 338, 278, 8750, 310, 365, 29873, 9229, 1625, 29889, 2259, 10537, 9300, 4667, 1706, 22687, 29899, 1451, 2458, 453, 29892, 29871, 29896, 29900, 386, 13484, 310, 1085, 29880, 22187, 322, 7906, 29889, 4827, 10738, 6182, 379, 25949, 21542, 468, 273, 29889, 29896, 2296, 8300, 5322, 4755, 8229, 381, 29892, 1487, 310, 11438, 1049, 379, 1657, 368, 8229, 381, 29892, 373, 29871, 29906, 29953, 5306, 29871, 29896, 29929, 29945, 29941, 29889, 29896, 13, 4591, 29871, 29906, 29953, 5306, 29871, 29896, 29929, 29945, 29941, 29892, 902, 8300, 1024, 3897, 8229, 381, 29889, 2296, 10600, 297, 29871, 29896, 29929, 29929, 29929, 472, 26048, 9143, 5619, 29892, 27662, 2671, 29892, 5032, 384, 18437, 29892, 2292, 29895, 11750, 29892, 5408, 29954, 29889, 29896, 13, 19334, 310, 10040, 5678, 331, 653, 341, 789, 1127, 1706, 22687, 29899, 1451, 2458, 453, 322, 5322, 4755, 8229, 381, 13, 17406, 3825, 349, 1022, 952, 8229, 381, 29896, 289, 29889, 29871, 29947, 2864, 29871, 29896, 29929, 29945, 29946, 13, 8942, 265, 379, 1657, 368, 8229, 381, 29974, 29896, 289, 29889, 29871, 29941, 2739, 29871, 29896, 29929, 29945, 29929, 13, 29924, 653, 10387, 3547, 8229, 381, 29974, 29896, 289, 29889, 29871, 29896, 29953, 2627, 29871, 29896 ]
1,333,692
1,024
CommonCrawl
0
3
Shoe's or boot even playing sneakers and shoe's can be broken for so many reasons. They can break by water damage, maximum use, more pressure, forcing them to get fit etc. What would you do if one of your friend drop drink on your shoe and you realise that your shoe sole or shoe body is getting damaged for that? Would you stop talking to him or you would throw your favourite pair of shoe? None of them you need to do. What you need to do is repairing them when they would start breaking or break completely. You can do it in shoe repair store easily. Being honest it would cost you a good amount of money to repair it. My point of saying that why should you spends more money whereas you can do it in a home by having a shoe glue in your collection. Believe me as much as money shoe repairer would charge you for to repair one pair of shoe you can buy at least two or three shoe glue on its price. Now you may think about the pro finish off the work. I must say here as much as the care you will do for your shoes nobody would have done that much care. Gear aid is excellent shoe glue which is a perfect solution for all kind of shoe and boot repair. It's a complete Urethane based shoe repair adhesive which will give you a pro finish after application. This shoe glue will permanently re-attach soles to boots and shoes, repairs rands, toe caps and worn soles. This shoe glue will help your shoe to not get affected by desert heat or arctic cold, Free sole dries to a tough, flexible urethane that will not crack. The free sole is also ideal for repairing torn gaiters and under-boot straps. If you are enough with the annoying sole flapping! Use free sole to reattach and rebuild the soles of your boots and shoes. This shoe glue is Durable, flexible, and shock-absorbing, the Free sole is made from the same material as most shoe soles, so it can quickly reattach soles, rebuild worn heel and toe areas, and create tough toe caps. The free sole is part of a comprehensive line of Care and Repair products from Gear Aid. With Gear Aid, anyone can be a master of gear repair. This shoe glue works on all types of footwear, including boots, athletic shoes, climbing shoes, Rollerblades, and more. I should say, I was incredulous about this stuff. I have several sets of shoes that I adored, yet the sole had broken along the wad of my foot from side to side on one shoe from every pair. I clutched them (persisting much provocation from the spouse) with the expectation that there would be some approach to reestablish their usefulness. I attempted Gorilla Glue, Super Glue, Shoe Goo and a few different sorts of glues, however, none of them would hold. They were either excessively weak or not sufficiently solid. I chose to arrange the Freescale and it's related Cotol-240 Cure Accelerator and it took care of business… what's more, exceptionally well I may include. I utilized the Cotol-240 to clean the region to be stuck, permitted to dry, than blended 1 section Cool to 4 sections Freesole. I connected the cement to the split, then bound it utilizing the smooth side of pressing tape. after 24 hours, I evacuated the tape and connected another layer to fill the discouragements from wear. This time, I essentially propped it topsy turvy and permitted the paste to settle all alone (without quickening agent). Around 4 hours into the curing time, I utilized a plastic card to squeeze grooves into it for footing. The cured urethane is to a great degree extreme and strong. Rehashed flexing of the shoe hints at no splitting, peeling or division. I have worn the shoes for numerous days with no issue. I think the joint and second layer are more grounded than the first sole. The things dispatched speedily and were adequately bundled. I plan to dependably have this around the house, as should be obvious it being valuable for a plenty of repair occupations, not simply shoes. Too awful I can't locate a bigger amount. I exceptionally suggest this! If you want to make a quality repair that will last a
-0.826169
-0.931416
-0.715004
-1.37574
[ -1.3007611560883368, -0.3515760837921958 ]
[ -1.3378883640872465, -0.5249429881726343 ]
[ -0.939302366298822, -0.4907047349339795 ]
[ -1.4993046549626015, -1.2521744794785774 ]
1,024
[ 512, 512 ]
[ 17550, 29872, 29915, 29879, 470, 6579, 1584, 8743, 269, 484, 21079, 322, 528, 7297, 29915, 29879, 508, 367, 9391, 363, 577, 1784, 9590, 29889, 2688, 508, 2867, 491, 4094, 18658, 29892, 7472, 671, 29892, 901, 12959, 29892, 28172, 963, 304, 679, 6216, 2992, 29889, 1724, 723, 366, 437, 565, 697, 310, 596, 5121, 5768, 13748, 373, 596, 528, 7297, 322, 366, 1855, 895, 393, 596, 528, 7297, 14419, 470, 528, 7297, 3573, 338, 2805, 5625, 4063, 363, 393, 29973, 10878, 366, 5040, 9963, 304, 1075, 470, 366, 723, 3183, 596, 15381, 568, 5101, 310, 528, 7297, 29973, 6213, 310, 963, 366, 817, 304, 437, 29889, 1724, 366, 817, 304, 437, 338, 26032, 292, 963, 746, 896, 723, 1369, 16679, 470, 2867, 6446, 29889, 887, 508, 437, 372, 297, 528, 7297, 26032, 3787, 5948, 29889, 28265, 15993, 372, 723, 3438, 366, 263, 1781, 5253, 310, 6909, 304, 26032, 372, 29889, 1619, 1298, 310, 5934, 393, 2020, 881, 366, 805, 1975, 901, 6909, 13452, 366, 508, 437, 372, 297, 263, 3271, 491, 2534, 263, 528, 7297, 3144, 434, 297, 596, 4333, 29889, 3741, 2418, 592, 408, 1568, 408, 6909, 528, 7297, 26032, 261, 723, 8323, 366, 363, 304, 26032, 697, 5101, 310, 528, 7297, 366, 508, 15649, 472, 3203, 1023, 470, 2211, 528, 7297, 3144, 434, 373, 967, 8666, 29889, 2567, 366, 1122, 1348, 1048, 278, 410, 8341, 1283, 278, 664, 29889, 306, 1818, 1827, 1244, 408, 1568, 408, 278, 2562, 366, 674, 437, 363, 596, 17394, 267, 23196, 723, 505, 2309, 393, 1568, 2562, 29889, 13, 29954, 799, 16226, 338, 15129, 528, 7297, 3144, 434, 607, 338, 263, 4922, 1650, 363, 599, 2924, 310, 528, 7297, 322, 6579, 26032, 29889, 739, 29915, 29879, 263, 4866, 501, 276, 386, 1662, 2729, 528, 7297, 26032, 594, 13244, 573, 607, 674, 2367, 366, 263, 410, 8341, 1156, 2280, 29889, 910, 528, 7297, 3144, 434, 674, 9410, 2705, 337, 29899, 14930, 899, 267, 304, 1045, 1862, 322, 17394, 267, 29892, 1634, 7121, 364, 4167, 29892, 29363, 26091, 322, 28043, 899, 267, 29889, 910, 528, 7297, 3144, 434, 674, 1371, 596, 528, 7297, 304, 451, 679, 15201, 491, 18197, 12871, 470, 564, 20009, 11220, 29892, 12362, 14419, 270, 2722, 304, 263, 260, 820, 29892, 25706, 318, 276, 386, 1662, 393, 674, 451, 26755, 29889, 450, 3889, 14419, 338, 884, 10839, 363, 26032, 292, 10146, 330, 1249, 414, 322, 1090, 29899, 4777, 5312, 567, 29889, 960, 366, 526, 3307, 411, 278, 12327, 5414, 14419, 17422, 3262, 29991, 4803, 3889, 14419, 304, 337, 14930, 322, 337, 4282, 278, 899, 267, 310, 596, 1045, 1862, 322, 17394, 267, 29889, 910, 528, 7297, 3144, 434, 338, 7073, 519, 29892, 25706, 29892, 322, 19253, 29899, 6897, 272, 10549, 29892, 278, 12362, 14419, 338, 1754, 515, 278, 1021, 5518, 408, 1556, 528, 7297, 899, 267, 29892, 577, 372, 508, 9098, 337, 14930, 899, 267, 29892, 337, 4282, 28043, 540, 295, 322, 29363, 10161, 29892, 322, 1653, 260, 820, 29363, 26091, 29889, 450, 3889, 14419, 338, 760, 310, 263, 15171, 6270, 1196, 310, 10057, 322, 10088, 1466, 9316, 515, 402, 799, 319, 333, 29889, 2973, 402, 799, 319, 333, 29892, 5019, 508, 367, 263, 5835, 310, 330, 799, 26032, 29889, 910, 528, 7297, 3144, 434, 1736, 373, 599, 4072, 310, 3661, 705, 279, 29892, 3704, 1045, 1862, 29892, 28563, 293, 17394, 267, 29892, 10784, 10549, 17394, 267, 29892, 8731, 1358, 2204, 3076, 29892, 322, 901, 29889, 13, 29902, 881, 1827, 29892, 306, 471, 29811, 352, 681, 1048, 445, 6433, 29889, 306, 505, 3196, 6166, 310, 17394, 267, 393, 306, 594, 4395, 29892, 3447, 278, 14419, 750, 9391, 3412, 278, 281, 328, 310, 590, 3661, 515, 2625, 304, 2625, 373, 697, 528, 7297, 515, 1432, 5101, 29889, 306, 1067, 10519, 287, 963, 313, 6774, 15423, 1568, 1326, 10610, 515, 278, 805, 1709, 29897, 411, 278, 23227, 393, 727, 723, 367, 777, 2948, 304, 337, 342, 370, 1674, 1009, 5407, 2264, 29889, 306, 16388, 18686, 2911, 8467, 434, 29892, 5670, 8467, 434, 29892, 17550, 29872, 2921, 29877, 322, 263, 2846, 1422, 23551, 310, 3144, 1041, 29892, 3138, 29892, 5642, 310, 963, 723, 4808, 29889, 2688, 892, 2845, 19163, 3598, 8062, 470, 451, 18430, 7773, 29889, 13, 29902, 12784, 304, 564, 3881, 278, 3878, 9977, 744, 322, 372, 29915, 29879, 4475, 26783, 324, 29899, 29906, 29946, 29900, 315, 545, 4831, 7367, 1061, 322, 372, 3614, 2562, 310, 5381, 30098, 825, 29915, 29879, 901, 29892, 3682, 635, 1532, 306, 1122, 3160, 29889, 306, 3667, 1891, 278, 26783, 324, 29899, 29906, 29946, 29900, 304, 5941, 278, 5120, 304, 367, 10771, 29892, 21905, 304, 15589, 29892, 1135, 1999, 2760, 29871, 29896, 4004, 315, 1507, 304, 29871, 29946, 13926, 3878, 267, 1772, 29889, 306, 6631, 278, 274, 882, 304, 278, 6219, 29892, 769, 3216, 372, 3667, 5281, 278, 10597, 2625, 310, 24795, 260, 4085, 29889, 1156, 29871, 29906, 29946, 6199, 29892, 306, 3415, 22061, 630, 278, 260, 4085, 322, 6631, 1790, 7546, 304, 5445, 278, 2313, 283, 1431, 4110, 515, 19531, 29889, 910, 931, 29892, 306, 13674, 410, 2986, 372, 304, 567, 29891, 7013, 13308, 322, 21905, 278, 11417, 304, 3604, 280, 599, 7432, 313, 14037, 4996, 8333, 10823, 467, 826, 618, 29871, 29946, 6199, 964, 278, 3151, 292, 931, 29892, 306, 3667, 1891, 263, 715, 6288, 5881, 304, 269, 802, 29872, 911, 4071, 586, 267, 964, 372, 363, 3661, 292, 29889, 13, 1576, 274, 2955, 318, 276, 386, 1662, 338, 304, 263, 2107, 7426, 18677, 322, 4549, 29889, 830, 8568, 287, 8525, 292, 310, 278, 528, 7297, 26085, 472, 694, 24368, 29892, 1236, 14067, 470, 8542, 29889, 306, 505, 28043, 278, 17394, 267, 363, 12727, 3841, 411, 694, 2228, 29889, 306, 1348, 278, 14002, 322, 1473, 7546, 526, 901, 5962, 287, 1135, 278, 937, 14419, 29889, 13, 1576, 2712, 13916, 287, 6210, 2354, 322, 892, 19967, 339, 2486, 22813, 839, 29889, 306, 3814, 304, 8839, 2197, 505, 445, 2820, 278, 3699, 29892, 408, 881, 367, 6924, 372, 1641, 21114, 363, 263, 20947, 310, 26032, 6919, 800, 29892, 451, 3763, 17394, 267, 29889, 1763, 29877, 28893, 306, 508, 29915, 29873, 26694, 263, 16600, 5253, 29889, 306, 3682, 635, 4368, 445, 29991, 13, 3644, 366, 864, 304, 1207, 263, 11029, 26032, 393, 674, 1833, 263 ]
1,333,694
0
C4
12
5