text
stringlengths 18
152k
| meta
dict |
|---|---|
This invention relates to a method for applying normally dry relatively large particle size (granular) fertilizers to crops, such as lawns. Lawn fertilizers are available in various forms including solutions of nutrients in water, dispersions (suspensions) of fine powders (70-80 mesh and smaller) in an aqueous medium, dry powders and dry granules. In some cases, the nutrient materials are supported on an inert carrier, e.g. sand or clay.
Both liquid fertilizers and dispersions of fine powders in aqueous mediums are usually spray applied using conventional types of liquid solution fertilizer spraying equipment. A typical example of a spray applied dispersion of a powdered fertilizer material is illustrated by the U.S. Pat. No. to Funk 4,036,627. This patent discloses a high analysis fertilizer formulaton of low bulk density powdered ureaformaldehyde having soluble and insoluble portions combined with soluble monopotassium phosphate in which the resultant mixture is a dry homogeneous blend, free of fillers and binding agents, and which may be carried in a liquid medium for application to surface or subsurface areas by conventional liquid solution fertilizer applying equipment. The suspension generally has a fairly high concentration of the fine powder particles in the liquid medium.
Dry fertilizers in the powder form or the granular form are conventionally applied by dry spreaders. Numerous examples of dry powdered and granular fertilizer compositions are well known to those skilled in the art. Recently, these have begun to be formulated with provisions for timed (slow) release of the nutrients to avoid "burning" the crop and to reduce the number of applications in a growing season.
Each of the various physical forms of fertilizer compositions has its advantages and disadvantages. Spray applied liquid fertilizer solutions and dispersions of powdered nutrient materials are characterized by the ability to be applied evenly and from a tank truck, for example. These fertilizer forms usually provide nutrients which are immediately available to the lawn, and therefore enable quick response of the lawn to the application, i.e. quick "greening" of the lawn. However, such liquid solutions are often too rich in immediately available nutrients, particularly nitrogen. A solution which is too rich in nutrients can cause "burning" of the lawn. Additionally, insect and fungus growth may be accelerated. Still further, liquid solution type fertilizers do not often possess long life on or in the ground and their effect is quickly lost. Frequent application is required to maintain a desired nutrient level in the soil during a growing season.
With the finely divided powder or dispersion, a principal problem is retention on the leaves or blades of grass. This can also cause burning. Additionally, ambient conditions and normal lawn care procedures may result in loss of a significant value of the fertilizer. For example, application of dry powder is usually accompanied by considerable dusting and wind loss. Moreover, when the lawn is cut, and the clippings collected, a substantial portion of a powdered fertilizer, whether dry or dispersion applied, is carried away and lost. With a rotary lawn mower, dusting of a powdered fertilizer can also be a problem.
Granular fertilizers which are spread on the lawn in a dry condition, do not generally have the foregoing types of application problems encountered with powdered fertilizers. Because of the larger particle size, dusting is not a problem. Further, retention on the blades of grass or on leaves is not generally a problem with granular fertilizers. Thus, loss on removal of grass clippings is negligible. However, like any spreader applied fertilizer, application is usually uneven because of turns at the end of a row, skips, overlaps, etc. Without care, overfertilizing can occur in certain areas and under fertilizing in others. A blotchy appearance results. Furthermore, the immediate nutrient availability of granular fertilizers may be lost due to leaching. Thus, with granular fertilizers obtaining quick "greening" can be a problem. Thus, as can be seen from the foregoing discussion the problems which are often encountered in the application of liquid, liquid dispersion or dry spread granular fertilizers are also manifested in the quality of performance of the fertilizer. | {
"pile_set_name": "USPTO Backgrounds"
} |
United States Court of Appeals
For the Eighth Circuit
___________________________
No. 12-3842
___________________________
Barbara Hager
lllllllllllllllllllll Plaintiff - Appellee
v.
Arkansas Department of Health; Namvar Zohoori, individually and in his official capacity
lllllllllllllllllllll Defendants - Appellants
____________
Appeal from United States District Court
for the Eastern District of Arkansas - Little Rock
____________
Submitted: September 24, 2013
Filed: November 14, 2013
____________
Before LOKEN, COLLOTON, and BENTON, Circuit Judges.
____________
BENTON, Circuit Judge.
Barbara Hager was fired from the Arkansas Department of Health by her
supervisor, Dr. Namvar Zohoori. Hager sued Dr. Zohoori and the Department for
statutory and constitutional violations. The district court granted, in part, their
motion to dismiss. They appeal. Having jurisdiction under 28 U.S.C. § 1291 over
Dr. Zohoori’s appeal, this court reverses and remands.
I.
Hager claims that in May 2011, her branch chief and supervisor, Dr. Zohoori,
instructed her to cancel a doctor’s appointment (necessary, she says, to prevent
cataracts) in order to discuss a report. When she refused, she alleges Dr. Zohoori
became irritated and falsely claimed she was insubordinate and disrespectful. Four
days later, he terminated her without explanation.
Hager sued Dr. Zohoori, in his individual and official capacities, and the
Department alleging violations of Title VII of the Civil Rights Act of 1964, the Equal
Protection and Due Process Clauses of the Constitution (§ 1983 claim), the Age
Discrimination and Employment Act, the Rehabilitation Act, and the Family and
Medical Leave Act (FMLA).
Dr. Zohoori and the Department moved to dismiss for failure to state a claim
and sovereign immunity. The district court denied their motion in part, allowing three
claims against Dr. Zohoori in his individual capacity (§ 1983 gender discrimination,
FMLA “interference,” and FMLA “retaliation”) and two claims against the
Department (Title VII and Rehabilitation Act). They appeal.
II.
Hager objects to this court’s jurisdiction over Dr. Zohoori’s appeal, arguing it
turns on issues of factual sufficiency. A denial of qualified immunity is an appealable
“final decision” only “to the extent it turns on an issue of law.” Mitchell v. Forsyth,
472 U.S. 511, 530 (1985). Hager relies on cases reviewing a denial of summary
judgment based on qualified immunity. See Johnson v. Jones, 515 U.S. 304, 313-14
(1995) (holding that where a district court’s summary judgment order on qualified
immunity turns on the issue of evidence sufficiency—“which facts a party may, or
-2-
may not, be able to prove at trial”—the order is not appealable); Powell v. Johnson,
405 F.3d 652, 654-55 (8th Cir. 2005). In Ashcroft v. Iqbal, the Supreme Court
determined the jurisdiction of a court of appeals in a case like Hager’s—denial of a
motion to dismiss based on qualified immunity:
As a general matter, the collateral-order doctrine may have expanded
beyond the limits dictated by its internal logic and the strict application
of the criteria set out in Cohen. But the applicability of the doctrine in
the context of qualified-immunity claims is well established; and this
Court has been careful to say that a district court’s order rejecting
qualified immunity at the motion-to-dismiss stage of a proceeding is a
“final decision” within the meaning of § 1291. Behrens, 516 U.S., at
307, 116 S. Ct. 834.
Applying these principles, we conclude that the Court of Appeals had
jurisdiction to hear petitioners’ appeal. The District Court’s order
denying petitioners’ motion to dismiss turned on an issue of law and
rejected the defense of qualified immunity. It was therefore a final
decision “subject to immediate appeal.” Ibid. Respondent says that “a
qualified immunity appeal based solely on the complaint’s failure to
state a claim, and not on the ultimate issues relevant to the qualified
immunity defense itself, is not a proper subject of interlocutory
jurisdiction.” Brief for Respondent Iqbal 15 (hereinafter Iqbal Brief).
In other words, respondent contends the Court of Appeals had
jurisdiction to determine whether his complaint avers a clearly
established constitutional violation but that it lacked jurisdiction to pass
on the sufficiency of his pleadings. Our opinions, however, make clear
that appellate jurisdiction is not so strictly confined.
Iqbal, 556 U.S. 662, 672-73 (2009).
-3-
Here, Dr. Zohoori challenges the sufficiency of Hager’s pleadings to state §
1983, FMLA “interference,” and FMLA “retaliation” claims. This is an issue of law
over which this court has jurisdiction. See id. at 672-74; Bradford v. Huckabee, 394
F.3d 1012, 1015 (8th Cir. 2005). See also Rondigo, L.L.C. v. Township of
Richmond, 641 F.3d 673, 679 (6th Cir. 2011).
III.
This court reviews de novo the denial of a motion to dismiss on the basis of
qualified immunity. Bradford, 394 F.3d at 1015. A complaint must “state a claim
to relief that is plausible on its face.” Bell Atlantic Corp. v. Twombly, 550 U.S. 544,
570 (2007). Under Federal Rule of Civil Procedure 12(b)(6), the factual allegations
in the complaint are accepted as true and viewed most favorably to the plaintiff.
Gross v. Weber, 186 F.3d 1089, 1090 (8th Cir. 1999). Courts must not presume the
truth of legal conclusions couched as factual allegations. Papasan v. Allain, 478 U.S.
265, 286 (1986). Courts should dismiss complaints based on “labels and conclusions,
and a formulaic recitation of the elements of a cause of action.” Twombly, 550 U.S.
at 555.
Under the doctrine of qualified immunity, a court must dismiss a complaint
against a government official in his individual capacity that fails to state a claim for
violation of “clearly established statutory or constitutional rights of which a
reasonable person would have known.” Harlow v. Fitzgerald, 457 U.S. 800, 818
(1982). See also Iqbal, 556 U.S. at 685; Mitchell, 472 U.S. at 526 (“Unless the
plaintiff’s allegations state a claim of violation of clearly established law, a defendant
pleading qualified immunity is entitled to dismissal before the commencement of
discovery.”). A court considers whether the plaintiff has stated a plausible claim for
violation of a constitutional or statutory right and whether the right was clearly
established at the time of the alleged infraction. Powell, 405 F.3d at 654-55. See
Pearson v. Callahan, 555 U.S. 223, 236 (2009) (“[D]istrict courts and the courts of
-4-
appeals should be permitted to exercise their sound discretion in deciding which of
the two prongs of the qualified immunity analysis should be addressed first in light
of the circumstances in the particular case at hand.”).
A.
The § 1983 claim against Dr. Zohoori individually (Count I) alleges that Hager
was “a victim of gender discrimination . . . and has been denied her right of equal
protection of the law and due process of the law.” Specifically, she contends she
“was discharged under circumstances summarily [sic] situated nondisabled males .
. . were not.”
“[T]he Equal Protection Clause requires that the government treat such
similarly situated persons alike.” Keevan v. Smith, 100 F.3d 644, 648 (8th Cir.
1996), citing City of Cleburne v. Cleburne Living Ctr., Inc., 473 U.S. 432, 439
(1985); Klinger v. Department of Corrs., 31 F.3d 727, 731 (8th Cir. 1994). Absent
evidence of direct discrimination, courts apply the McDonnell Douglas burden-
shifting analysis to claims of employment discrimination under the Equal Protection
Clause. Lockridge v. Board of Trs. of Univ. of Arkansas, 315 F.3d 1005, 1010 (8th
Cir. 2003) (en banc). Under McDonnell Douglas, a prima facie case of discrimination
requires that a plaintiff prove: “(1) membership in a protected group; (2)
qualification for the job in question; (3) an adverse employment action; and (4)
circumstances that support an inference of discrimination.” Swierkiewicz v. Sorema
N. A., 534 U.S. 506, 510 (2002), citing McDonnell Douglas Corp. v. Green, 411 U.S.
792, 801 (1973).
Dr. Zohoori argues that Hager does not state a § 1983 claim for gender
discrimination because her allegation—that she “was discharged under circumstances
summarily [sic] situated nondisabled males, younger people, or those that did not
require leave or accommodation were not”—is a legal conclusion. Hager contends
-5-
her “similarly situated” allegation is sufficient because McDonnell Douglas is “an
evidentiary standard, not a pleading requirement.” Swierkiewicz, 534 U.S. at 510;
Ring v. First Interstate Mortg., 984 F.2d 924, 926 (8th Cir. 1993).
Under Swierkiewicz, a plaintiff need not plead facts establishing a prima facie
case of discrimination under McDonnell Douglas in order to defeat a motion to
dismiss. Swierkiewicz, 534 U.S. at 510-11. The complaint “must contain only ‘a
short and plain statement of the claim showing the pleader is entitled to relief.’” Id.
at 508. “Such a statement must simply ‘give the defendant fair notice of what the
plaintiff’s claim is and the grounds upon which it rests.’” Id. at 512, citing Conley
v. Gibson, 355 U.S. 41, 47 (1957).
In Twombly, the Supreme Court stated that Swierkiewicz did not change the law
of pleading. Twombly, 550 U.S. at 569. Rather, courts need “not require heightened
fact pleading of specifics, but only enough facts to state a claim to relief that is
plausible on its face.” Id. at 570. “[L]egal conclusions can provide the framework
of a complaint” but “must be supported by factual allegations,” Iqbal, 556 U.S. at
679, that “raise a right to relief above the speculative level.” Twombly, 550 U.S. at
555. Thus, this court applies “the ordinary rules for assessing the sufficiency of a
complaint,” Swierkiewicz, 534 U.S. at 511, to consider whether Hager states a § 1983
claim for gender discrimination. See Twombly, 550 U.S. at 570.
Hager relies primarily on Swierkiewicz. However, her complaint has far fewer
factual allegations than the complaint there. In Swierkiewicz, the complaint for age
and nationality discrimination alleged: the plaintiff was demoted and replaced by a
younger employee of the employer’s nationality; the replacement was inexperienced;
in promoting the younger, inexperienced employee, the employer wanted to
“energize” the department; the employer excluded and isolated plaintiff from business
decisions and meetings; plaintiff sent a memo outlining his grievances and tried to
-6-
meet with the employer to discuss his discontent; and plaintiff was fired.
Swierkiewicz, 534 U.S. at 508-09.
Hager makes only two conclusory allegations of gender discrimination: (1) she
“is a victim of gender discrimination;” and (2) she “was discharged under
circumstances summarily [sic] situated nondisabled males . . . were not.” She does
not allege any gender-related comments or conduct before her termination. See
Rondigo, 641 F.3d at 682 (granting qualified immunity in part because the complaint
contained no allegations of gender-based discriminatory actions). She also does not
allege facts showing that similarly situated employees were treated differently. See
Coleman v. Maryland Court of Appeals, 626 F.3d 187, 190-91 (4th Cir. 2010)
(plaintiff’s conclusory allegation that he “was treated differently as a result of his race
than whites”—even where plaintiff identified an alleged comparator—was
insufficient to sustain a Title VII claim because no factual allegations plausibly
suggested the comparator was similarly situated). See also Keevan, 100 F.3d at 648
(“To establish a gender-based claim under the Equal Protection Clause, the appellants
must, as a threshold matter, demonstrate that they have been treated differently by a
state actor than others who are similarly situated simply because appellants belong
to a particular protected class.”).
In sum, Hager does not state a § 1983 claim for gender discrimination. Hager’s
allegation that she is the victim of gender discrimination fails to give Dr. Zohoori fair
notice of the claim and the grounds upon which it rests. See Swierkiewicz, 534 U.S.
at 512. Hager’s conclusory assertion that she was discharged under circumstances
similarly situated men were not imports legal language couched as a factual allegation
and fails to raise a right to relief above the speculative level. See Twombly, 550 U.S.
at 555. The district court erred in denying Dr. Zohoori’s motion to dismiss the § 1983
claim.
-7-
B.
Hager alleges a claim for “interfering with exercise of Plaintiff’s rights under
the FMLA.” Under the categorization in Pulczinski v. Trinity Structural Towers, Inc.,
691 F.3d 996 (8th Cir. 2012), Hager’s “interference” claim is an entitlement claim.
Pulczinski, 691 F.3d at 1005-06. “The FMLA entitles an employee to twelve
workweeks of leave during any twelve-month period if he or she has a ‘serious health
condition that makes the employee unable to perform the functions of the position of
such employee.’” Sisk v. Picture People, Inc., 669 F.3d 896, 899 (8th Cir. 2012),
quoting Wierman v. Casey’s Gen. Stores, 638 F.3d 984, 999 (8th Cir. 2011), quoting
29 U.S.C. § 2612(a)(1)(D). An FMLA entitlement claim arises when an employer
denies or interferes with an employee’s substantive FMLA rights. Scobey v. Nucor
Steel-Arkansas, 580 F.3d 781, 785 (8th Cir. 2009).
An employee seeking FMLA leave must give the employer notice of the need
for leave and indicate when she anticipates returning to work. Id. at 785-86. See also
Rynders v. Williams, 650 F.3d 1188, 1196-97 (8th Cir. 2011) (plaintiff must prove
she gave timely notice to defendant himself). Although the notice need not
specifically invoke the FMLA, an employee “must provide information to suggest
that [her] health condition could be serious.” Scobey, 580 F.3d at 786. When the
leave is foreseeable, the employee must give at least thirty days notice. 29 C.F.R. §
825.302. When the leave is not foreseeable, “an employee must provide notice to the
employer as soon as practicable under the facts and circumstances of the particular
case.” 29 C.F.R. § 825.303.
Hager alleges that she “saw a physician regularly for her cataracts,” but “[o]n
May 13, 2011, [Dr. Zohoori] instructed her to cancel the doctor’s appointment so she
and he could discuss a report.” She also avers that she explained “the reason she
needed to go to the doctor,” that “she could not cancel the appointment,” and why she
could not cancel. These allegations do not state an FMLA entitlement claim. While
-8-
Hager alleges that she provided information suggesting a serious health condition, she
does not allege that she provided timely notice. Hager’s pleadings at best suggest Dr.
Zohoori was aware of her leave request immediately prior to the appointment. They
do not assert that she provided notice within thirty days or “as soon as practicable
under the circumstances.” Nor do they assert that she indicated when she would
return. See generally Bosley v. Cargill Meat Solutions Corp., 705 F.3d 777, 780 (8th
Cir. 2013) (there is a “rigorous notice standard for employees seeking to use FMLA
leave for absences”).
The district court erred in denying Dr. Zohoori’s motion to dismiss the FMLA
entitlement claim.
C.
Hager also alleges a claim for “retaliating against her.” Under the
categorization in Pulczinski, Hager’s “retaliation” claim is a discrimination claim.
Pulczinski, 691 F.3d at 1006. In a discrimination claim, “the employee alleges that
the employer discriminated against her for exercising her FMLA rights.” Sisk, 669
F.3d at 899, quoting Wierman, 638 F.3d at 999. Absent direct evidence, an FMLA
discrimination claim is analyzed under the McDonnell Douglas burden-shifting
framework. Sisk, 669 F.3d at 899. The plaintiff must “show that she exercised rights
afforded by the Act, that she suffered an adverse employment action, and that there
was a causal connection between her exercise of rights and the adverse employment
action.” Phillips v. Mathews, 547 F.3d 905, 912 (8th Cir. 2008), quoting Smith v.
Allen Health Sys., Inc., 302 F.3d 827, 832 (8th Cir. 2002). This is an evidentiary,
not a pleading, standard. Swierkiewicz, 534 U.S. at 510.
Hager alleges that Dr. Zohoori discriminated against her—firing her—because
she exercised her FMLA rights—tried to take leave for a doctor’s appointment, which
was “necessary to insure that [her] condition did not develop into a serious health
-9-
condition, cataracts.” If Hager had properly alleged notice, these allegations would
be sufficient. See Wehrley v. American Family Mut. Ins. Co., 513 Fed. Appx. 733,
742 (10th Cir. 2013) (“Three other circuits have concluded that notifying an employer
of the intent to take FMLA leave is protected activity. . . . We are persuaded to follow
these circuits.”), citing Pereda v. Brookdale Senior Living Communities, Inc., 666
F.3d 1269, 1276 (11th Cir. 2012); Erdman v. Nationwide Ins. Co., 582 F.3d 500, 509
(3d Cir. 2009); Skrjanc v. Great Lakes Power Serv. Co., 272 F.3d 309, 314 (6th Cir.
2001). However, because Hager failed to plead notice of intent to take FMLA leave,
and that she was qualified for that leave, she has not sufficiently alleged that she
exercised FMLA rights. See Nicholson v. Pulte Homes Corp., 690 F.3d 819, 828
(7th Cir. 2012) (“The district court held that because Nicholson did not provide
sufficient notice of the need for FMLA-qualifying leave, she never engaged in any
activity protected by the FMLA. For the reasons we have explained, we agree.”).
The district court erred in denying Dr. Zohoori’s motion to dismiss the FMLA
discrimination claim.
IV.
Although Hager did not move to amend the complaint in the district
court—where the relevant pleadings were found sufficient—she requests remand to
allow an amended complaint for any claims insufficiently pled. Hager should be no
worse off, and no better off, than she would have been if the district court had granted
the motion to dismiss. See Horras v. American Capital Strategies, Ltd., 729 F.3d
798, 804-05 (8th Cir. 2013) (evaluating standards applicable to post-judgment
motions). This court remands for the district court to consider whether to allow
Hager to amend her pleadings. See Zenith Radio Corp. v. Hazeltine Research, Inc.,
401 U.S. 321, 330 (1971) (granting leave to amend is within the discretion of the
district court).
-10-
V.
The Arkansas Department of Health requests that this court exercise its pendent
appellate jurisdiction to review the district court’s partial denial of its motion to
dismiss. See Langford v. Norris, 614 F.3d 445, 457 (8th Cir. 2010) (“[W]hen an
interlocutory appeal is before us . . . as to the defense of qualified immunity, we have
jurisdiction also to decide closely related issues of law, i.e., pendent appellate
claims.”) (internal quotation marks omitted), quoting Kincade v. City of Blue
Springs, Mo., 64 F.3d 389, 394 (8th Cir. 1995). The Department maintains that
Hager’s claims against it are inextricably intertwined with her claims against Dr.
Zohoori. The Department reasons that if Hager’s “similarly situated” allegation does
not sustain her § 1983 and FMLA discrimination claims against Dr. Zohoori, it
cannot sustain her Title VII and Rehabilitation Act claims against the Department.
“[A] pendent appellate claim can be regarded as inextricably intertwined with
a properly reviewable claim on collateral appeal only if the pendent claim is
coterminous with, or subsumed in, the claim before the court on interlocutory
appeal—that is, when the appellate resolution of the collateral appeal necessarily
resolves the pendent claim as well.” Kincade, 64 F.3d at 394, quoting Moore v. City
of Wynnewood, 57 F.3d 924, 930 (10th Cir. 1995). See also Lockridge, 315 F.3d at
1012. Here, resolution of the “similarly situated” issue may illuminate the
Department’s argument that Hager failed to state a claim against it. However, the
Department’s claims are not coterminous with or subsumed in Dr. Zohoori’s claims.
Hager sues under different statutes, and the Department cannot invoke qualified
immunity. This court does not have jurisdiction to hear the Department’s appeal.
*******
-11-
The denial of Dr. Zohoori’s motion to dismiss the § 1983 claim, the FMLA
entitlement claim, and the FMLA discrimination claim is reversed. This case is
remanded for proceedings consistent with this opinion.
______________________________
-12-
| {
"pile_set_name": "FreeLaw"
} |
Q:
Pass method calls to object
I am trying to create a custom swipe gesture recognizer to set allowed angles and distances.
So far it works really well but needs a lot of code in the view controller. So my question is wether it is possible to somehow pass a method call like:
- (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event
in the view controller to my gesture recogniser object so that I don't have to write something like this
- (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event
{
[self.swipeGestureRecognizer touchesBegan:touches withEvent:event];
}
into my view controller. I think the build in UIGestureRecognizer does this somehow but I could not figure out how it works.
I really would appreciate your help.
[EDIT]
Generic example: I have an object A which creates an object B. A has a method c that gets called sometimes. What I want to achieve is that a method d of B gets called when c in A gets called. So to somehow forward or pass this method call.
Specific example: The following method gets called in my view controller every time there is a touch on the screen:
- (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event
but I actually want my GestureRecognizer object to process this information so I have the same method in my GestureRecognizer object and I want this method to get called every time the counterpart in the view controller gets called.
A:
Sub class UIGestureRecognizer and create a class called CustomGestureRecognizer.
Its .m file will look like this
@implementation CustomGestureRecognizer
- (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event {
// do your code here
}
@end
Some where in the subclass you have to change the state of the recognizer to
UIGestureRecognizerStateRecognized
when the current gesture is registered, else change to
UIGestureRecognizerStateFailed
.
Now in the view controller where you want to use this recognizer do :
CustomGestureRecognizer * recognizer = [[CustomGestureRecognizer alloc] initWithTarget:self action:@selector(handleChange:)];
recognizer.delegate = self;
[self.view addGestureRecognizer:recognizer];
Detailed explanation is given here Apple doc, under subclassing.
| {
"pile_set_name": "StackExchange"
} |
/*
* stree.c
*
* Copyright 2010 Alexander Petukhov <devel(at)apetukhov.ru>
*
* This program is free software; you can redistribute it and/or modify
* it under the terms of the GNU General Public License as published by
* the Free Software Foundation; either version 2 of the License, or
* (at your option) any later version.
*
* This program is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
* GNU General Public License for more details.
*
* You should have received a copy of the GNU General Public License
* along with this program; if not, write to the Free Software
* Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston,
* MA 02110-1301, USA.
*/
/*
* Contains function to manipulate stack trace tree view.
*/
#include <stdlib.h>
#include <string.h>
#ifdef HAVE_CONFIG_H
#include "config.h"
#endif
#include <geanyplugin.h>
#include "stree.h"
#include "breakpoints.h"
#include "utils.h"
#include "debug_module.h"
#include "pixbuf.h"
#include "cell_renderers/cellrendererframeicon.h"
/* Tree view columns */
enum
{
S_FRAME, /* the frame if it's a frame, or NULL if it's a thread */
S_THREAD_ID,
S_ACTIVE,
S_N_COLUMNS
};
/* active thread and frame */
static glong active_thread_id = 0;
static int active_frame_index = 0;
/* callbacks */
static select_frame_cb select_frame = NULL;
static select_thread_cb select_thread = NULL;
static move_to_line_cb move_to_line = NULL;
/* tree view, model and store handles */
static GtkWidget *tree = NULL;
static GtkTreeModel *model = NULL;
static GtkTreeStore *store = NULL;
static GtkTreeViewColumn *column_filepath = NULL;
static GtkTreeViewColumn *column_address = NULL;
/* cell renderer for a frame arrow */
static GtkCellRenderer *renderer_arrow = NULL;
static GType frame_get_type (void);
G_DEFINE_BOXED_TYPE(frame, frame, frame_ref, frame_unref)
#define STREE_TYPE_FRAME (frame_get_type ())
/* finds the iter for thread @thread_id */
static gboolean find_thread_iter (gint thread_id, GtkTreeIter *iter)
{
gboolean found = FALSE;
if (gtk_tree_model_get_iter_first(model, iter))
{
do
{
gint existing_thread_id;
gtk_tree_model_get(model, iter, S_THREAD_ID, &existing_thread_id, -1);
if (existing_thread_id == thread_id)
found = TRUE;
}
while (! found && gtk_tree_model_iter_next(model, iter));
}
return found;
}
/*
* frame arrow clicked callback
*/
static void on_frame_arrow_clicked(CellRendererFrameIcon *cell_renderer, gchar *path, gpointer user_data)
{
GtkTreePath *new_active_frame = gtk_tree_path_new_from_string (path);
if (gtk_tree_path_get_indices(new_active_frame)[1] != active_frame_index)
{
GtkTreeIter thread_iter;
GtkTreeIter iter;
GtkTreePath *old_active_frame;
find_thread_iter (active_thread_id, &thread_iter);
old_active_frame = gtk_tree_model_get_path (model, &thread_iter);
gtk_tree_path_append_index(old_active_frame, active_frame_index);
gtk_tree_model_get_iter(model, &iter, old_active_frame);
gtk_tree_store_set (store, &iter, S_ACTIVE, FALSE, -1);
active_frame_index = gtk_tree_path_get_indices(new_active_frame)[1];
select_frame(active_frame_index);
gtk_tree_model_get_iter(model, &iter, new_active_frame);
gtk_tree_store_set (store, &iter, S_ACTIVE, TRUE, -1);
gtk_tree_path_free(old_active_frame);
}
gtk_tree_path_free(new_active_frame);
}
/*
* shows a tooltip for a file name
*/
static gboolean on_query_tooltip(GtkWidget *widget, gint x, gint y, gboolean keyboard_mode, GtkTooltip *tooltip, gpointer user_data)
{
GtkTreePath *tpath = NULL;
GtkTreeViewColumn *column = NULL;
gboolean show = FALSE;
int bx, by;
gtk_tree_view_convert_widget_to_bin_window_coords(GTK_TREE_VIEW(widget), x, y, &bx, &by);
if (gtk_tree_view_get_path_at_pos(GTK_TREE_VIEW(widget), bx, by, &tpath, &column, NULL, NULL))
{
if (2 == gtk_tree_path_get_depth(tpath))
{
gint start_pos, width;
gtk_tree_view_column_cell_get_position(column, renderer_arrow, &start_pos, &width);
if (column == column_filepath)
{
frame *f;
GtkTreeIter iter;
gtk_tree_model_get_iter(model, &iter, tpath);
gtk_tree_model_get(model, &iter, S_FRAME, &f, -1);
gtk_tooltip_set_text(tooltip, f->file);
gtk_tree_view_set_tooltip_row(GTK_TREE_VIEW(widget), tooltip, tpath);
show = TRUE;
frame_unref(f);
}
else if (column == column_address && bx >= start_pos && bx < start_pos + width)
{
gtk_tooltip_set_text(tooltip, gtk_tree_path_get_indices(tpath)[1] == active_frame_index ? _("Active frame") : _("Click an arrow to switch to a frame"));
gtk_tree_view_set_tooltip_row(GTK_TREE_VIEW(widget), tooltip, tpath);
show = TRUE;
}
}
gtk_tree_path_free(tpath);
}
return show;
}
/*
* shows arrow icon for the frame rows, hides renderer for a thread ones
*/
static void on_render_arrow(GtkTreeViewColumn *tree_column, GtkCellRenderer *cell, GtkTreeModel *tree_model,
GtkTreeIter *iter, gpointer data)
{
GtkTreePath *tpath = gtk_tree_model_get_path(model, iter);
g_object_set(cell, "visible", 1 != gtk_tree_path_get_depth(tpath), NULL);
gtk_tree_path_free(tpath);
}
/*
* empty line renderer text for thread row
*/
static void on_render_line(GtkTreeViewColumn *tree_column, GtkCellRenderer *cell, GtkTreeModel *tree_model,
GtkTreeIter *iter, gpointer data)
{
frame *f;
gtk_tree_model_get (model, iter, S_FRAME, &f, -1);
if (! f)
g_object_set(cell, "text", "", NULL);
else
{
GValue value = G_VALUE_INIT;
g_value_init(&value, G_TYPE_INT);
g_value_set_int (&value, f->line);
g_object_set_property (G_OBJECT (cell), "text", &value);
g_value_unset (&value);
frame_unref (f);
}
}
/*
* shows only the file name instead of a full path
*/
static void on_render_filename(GtkTreeViewColumn *tree_column, GtkCellRenderer *cell, GtkTreeModel *tree_model,
GtkTreeIter *iter, gpointer data)
{
frame *f;
gtk_tree_model_get(model, iter, S_FRAME, &f, -1);
if (! f)
g_object_set(cell, "text", "", NULL);
else
{
gchar *name;
name = f->file ? g_path_get_basename(f->file) : NULL;
g_object_set(cell, "text", name ? name : f->file, NULL);
g_free(name);
frame_unref (f);
}
}
/*
* Handles same tree row click to open frame position
*/
static gboolean on_msgwin_button_press(GtkWidget *widget, GdkEventButton *event, gpointer user_data)
{
if (event->type == GDK_BUTTON_PRESS)
{
GtkTreePath *pressed_path = NULL;
GtkTreeViewColumn *column = NULL;
if (gtk_tree_view_get_path_at_pos(GTK_TREE_VIEW(tree), (int)event->x, (int)event->y, &pressed_path, &column, NULL, NULL))
{
if (2 == gtk_tree_path_get_depth(pressed_path))
{
GtkTreePath *selected_path;
gtk_tree_view_get_cursor(GTK_TREE_VIEW(tree), &selected_path, NULL);
if (selected_path && !gtk_tree_path_compare(pressed_path, selected_path))
{
frame *f;
GtkTreeIter iter;
gtk_tree_model_get_iter (
model,
&iter,
pressed_path);
gtk_tree_model_get (model, &iter, S_FRAME, &f, -1);
/* check if file name is not empty and we have source files for the frame */
if (f->have_source)
{
move_to_line(f->file, f->line);
}
frame_unref(f);
}
if (selected_path)
gtk_tree_path_free(selected_path);
}
gtk_tree_path_free(pressed_path);
}
}
return FALSE;
}
/*
* Tree view cursor changed callback
*/
static void on_cursor_changed(GtkTreeView *treeview, gpointer user_data)
{
GtkTreePath *path;
GtkTreeIter iter;
frame *f;
int thread_id;
gtk_tree_view_get_cursor(treeview, &path, NULL);
if (! path)
return;
gtk_tree_model_get_iter (model, &iter, path);
gtk_tree_model_get (model, &iter,
S_FRAME, &f, S_THREAD_ID, &thread_id, -1);
if (f) /* frame */
{
/* check if file name is not empty and we have source files for the frame */
if (f->have_source)
{
move_to_line(f->file, f->line);
}
frame_unref(f);
}
else /* thread */
{
if (thread_id != active_thread_id)
select_thread(thread_id);
}
gtk_tree_path_free(path);
}
static void on_render_function (GtkTreeViewColumn *tree_column, GtkCellRenderer *cell,
GtkTreeModel *tree_model, GtkTreeIter *iter, gpointer data)
{
frame *f;
gtk_tree_model_get (tree_model, iter, S_FRAME, &f, -1);
if (! f)
g_object_set (cell, "text", "", NULL);
else
{
g_object_set (cell, "text", f->function, NULL);
frame_unref (f);
}
}
static void on_render_address (GtkTreeViewColumn *tree_column, GtkCellRenderer *cell,
GtkTreeModel *tree_model, GtkTreeIter *iter, gpointer data)
{
frame *f;
gtk_tree_model_get (tree_model, iter, S_FRAME, &f, -1);
if (f)
{
g_object_set (cell, "text", f->address, NULL);
frame_unref (f);
}
else
{
gint thread_id;
gchar *thread_label;
gtk_tree_model_get (model, iter, S_THREAD_ID, &thread_id, -1);
thread_label = g_strdup_printf(_("Thread %i"), thread_id);
g_object_set (cell, "text", thread_label, NULL);
g_free(thread_label);
}
}
/*
* inits stack trace tree
*/
GtkWidget* stree_init(move_to_line_cb ml, select_thread_cb st, select_frame_cb sf)
{
GtkTreeViewColumn *column;
GtkCellRenderer *renderer;
move_to_line = ml;
select_thread = st;
select_frame = sf;
/* create tree view */
store = gtk_tree_store_new (
S_N_COLUMNS,
STREE_TYPE_FRAME, /* frame */
G_TYPE_INT /* thread ID */,
G_TYPE_BOOLEAN /* active */);
model = GTK_TREE_MODEL(store);
tree = gtk_tree_view_new_with_model (GTK_TREE_MODEL(store));
g_object_unref(store);
/* set tree view properties */
gtk_tree_view_set_headers_visible(GTK_TREE_VIEW(tree), 1);
gtk_widget_set_has_tooltip(tree, TRUE);
gtk_tree_view_set_show_expanders(GTK_TREE_VIEW(tree), FALSE);
/* connect signals */
g_signal_connect(G_OBJECT(tree), "cursor-changed", G_CALLBACK (on_cursor_changed), NULL);
/* for clicking on already selected frame */
g_signal_connect(G_OBJECT(tree), "button-press-event", G_CALLBACK(on_msgwin_button_press), NULL);
g_signal_connect(G_OBJECT(tree), "query-tooltip", G_CALLBACK (on_query_tooltip), NULL);
/* creating columns */
/* address */
column_address = column = gtk_tree_view_column_new();
gtk_tree_view_column_set_title(column, _("Address"));
renderer_arrow = cell_renderer_frame_icon_new ();
g_object_set(renderer_arrow, "pixbuf_active", (gpointer)frame_current_pixbuf, NULL);
g_object_set(renderer_arrow, "pixbuf_highlighted", (gpointer)frame_pixbuf, NULL);
gtk_tree_view_column_pack_start(column, renderer_arrow, TRUE);
gtk_tree_view_column_set_attributes(column, renderer_arrow, "active_frame", S_ACTIVE, NULL);
gtk_tree_view_column_set_cell_data_func(column, renderer_arrow, on_render_arrow, NULL, NULL);
g_signal_connect (G_OBJECT(renderer_arrow), "clicked", G_CALLBACK(on_frame_arrow_clicked), NULL);
renderer = gtk_cell_renderer_text_new ();
gtk_tree_view_column_pack_start(column, renderer, TRUE);
gtk_tree_view_column_set_cell_data_func(column, renderer, on_render_address, NULL, NULL);
gtk_tree_view_append_column (GTK_TREE_VIEW (tree), column);
/* function */
renderer = gtk_cell_renderer_text_new ();
column = gtk_tree_view_column_new_with_attributes (_("Function"), renderer, NULL);
gtk_tree_view_column_set_cell_data_func(column, renderer, on_render_function, NULL, NULL);
gtk_tree_view_column_set_resizable (column, TRUE);
gtk_tree_view_append_column (GTK_TREE_VIEW (tree), column);
/* file */
renderer = gtk_cell_renderer_text_new ();
column_filepath = column = gtk_tree_view_column_new_with_attributes (_("File"), renderer, NULL);
gtk_tree_view_column_set_resizable (column, TRUE);
gtk_tree_view_append_column (GTK_TREE_VIEW (tree), column);
gtk_tree_view_column_set_cell_data_func(column, renderer, on_render_filename, NULL, NULL);
/* line */
renderer = gtk_cell_renderer_text_new ();
column = gtk_tree_view_column_new_with_attributes (_("Line"), renderer, NULL);
gtk_tree_view_column_set_cell_data_func(column, renderer, on_render_line, NULL, NULL);
gtk_tree_view_column_set_resizable (column, TRUE);
gtk_tree_view_append_column (GTK_TREE_VIEW (tree), column);
/* Last invisible column */
column = gtk_tree_view_column_new ();
gtk_tree_view_append_column (GTK_TREE_VIEW (tree), column);
return tree;
}
/*
* add frames to the tree view
*/
void stree_add(GList *frames)
{
GtkTreeIter thread_iter;
GList *item;
g_object_ref (model);
gtk_tree_view_set_model (GTK_TREE_VIEW (tree), NULL);
find_thread_iter (active_thread_id, &thread_iter);
/* prepending is a *lot* faster than appending, so prepend with a reversed data set */
for (item = g_list_last (frames); item; item = item->prev)
{
gtk_tree_store_insert_with_values (store, NULL, &thread_iter, 0,
S_FRAME, item->data, -1);
}
gtk_tree_view_set_model (GTK_TREE_VIEW (tree), model);
g_object_unref (model);
}
/*
* clear tree view completely
*/
void stree_clear(void)
{
gtk_tree_store_clear(store);
}
/*
* select first frame in the stack
*/
void stree_select_first_frame(gboolean make_active)
{
GtkTreeIter thread_iter, frame_iter;
gtk_tree_view_expand_all(GTK_TREE_VIEW(tree));
if (find_thread_iter (active_thread_id, &thread_iter) &&
gtk_tree_model_iter_children(model, &frame_iter, &thread_iter))
{
GtkTreePath* path;
if (make_active)
{
gtk_tree_store_set (store, &frame_iter, S_ACTIVE, TRUE, -1);
active_frame_index = 0;
}
path = gtk_tree_model_get_path(model, &frame_iter);
gtk_tree_view_set_cursor(GTK_TREE_VIEW(tree), path, NULL, FALSE);
gtk_tree_path_free(path);
}
}
/*
* called on plugin exit to free module data
*/
void stree_destroy(void)
{
}
/*
* add new thread to the tree view
*/
void stree_add_thread(int thread_id)
{
GtkTreeIter thread_iter, new_thread_iter;
if (gtk_tree_model_get_iter_first(model, &thread_iter))
{
GtkTreeIter *consecutive = NULL;
do
{
int existing_thread_id;
gtk_tree_model_get(model, &thread_iter, S_THREAD_ID, &existing_thread_id, -1);
if (existing_thread_id > thread_id)
{
consecutive = &thread_iter;
break;
}
}
while(gtk_tree_model_iter_next(model, &thread_iter));
if(consecutive)
{
gtk_tree_store_prepend(store, &new_thread_iter, consecutive);
}
else
{
gtk_tree_store_append(store, &new_thread_iter, NULL);
}
}
else
{
gtk_tree_store_append (store, &new_thread_iter, NULL);
}
gtk_tree_store_set (store, &new_thread_iter,
S_FRAME, NULL,
S_THREAD_ID, thread_id,
-1);
}
/*
* remove a thread from the tree view
*/
void stree_remove_thread(int thread_id)
{
GtkTreeIter iter;
if (find_thread_iter (thread_id, &iter))
gtk_tree_store_remove(store, &iter);
}
/*
* remove all frames
*/
void stree_remove_frames(void)
{
GtkTreeIter child;
GtkTreeIter thread_iter;
if (find_thread_iter (active_thread_id, &thread_iter) &&
gtk_tree_model_iter_children(model, &child, &thread_iter))
{
while(gtk_tree_store_remove(GTK_TREE_STORE(model), &child))
;
}
}
/*
* set current thread id
*/
void stree_set_active_thread_id(int thread_id)
{
active_thread_id = thread_id;
}
| {
"pile_set_name": "Github"
} |
Elisabeth Salom
Elisabeth Salom (born 20 January 1989) is a Spanish group rhythmic gymnast. She represents her nation at international competitions.
She participated at the 2008 Summer Olympics in Beijing. She also competed at world championships, including at the 2007 World Rhythmic Gymnastics Championships.
References
External links
sportcentric.com
Seleccion Española de gimnasia ritmica Conjunto Pekin 2008
Category:1989 births
Category:Living people
Category:Spanish rhythmic gymnasts
Category:Place of birth missing (living people)
Category:Gymnasts at the 2008 Summer Olympics
Category:Olympic gymnasts of Spain | {
"pile_set_name": "Wikipedia (en)"
} |
Estuve encerrado durante 139 días que se dividieron en tres etapas. En la primera etapa, pasé en el hospital casi la mitad del tiempo por una huelga de hambre de 22 días, en la segunda estuve 30 días encerrado por un informe falso o equivocado de los servicios de inteligencia militares y en la tercera, pasé 49 días por afirmar que no participaría nunca en una intervención militar en Catalunya (algo que en cualquier democracia moderna no haría falta ni mencionar y no habría supuesto castigo alguno).
En ese segundo arresto, el provocado por un informe falso o equivocado de los servicios de inteligencia militares, tuve relación con dos suboficiales y un oficial. Uno de los suboficiales llevaba tatuado en la piel el águila franquista en la pierna y el teniente coronel era asiduo escritor en la Fundación Nacional Francisco Franco (en el tercer encierro me aislaron para que no mantuviera relación con nadie). Aquello no podía salir bien y no salió bien.
Había un soldado negro al que denominaban "mono", había una soldado que creían que era lesbiana y hablaban de ella con desprecio calificándola como "híbrido", había otro militar del que uno de los sargentos afirmaba que era gay y se referían al mismo como "marica", la televisión informaba que habían matado a un ultra del Deportivo de la Coruña y se lo merecía o aparecía Pablo Iglesias ("tu amigo, el coletas") y había que pegarle un tiro o un taponazo. Todos reían con esa tranquilidad que da tener al sistema de tu parte.
Fueron muchas las veces que me enfrenté a ellos hasta que decidí informar al jefe del Establecimiento Disciplinario (que se estaban produciendo manifestaciones xenófobas, homófobas y antidemocráticas), pero no hizo nada al respecto. Ni tan siquiera se le dieron credibilidad y eso que, como he dicho antes, uno de los sargentos tenía un tatuaje franquista y el teniente coronel escribía, con mucho orgullo por otra parte, en la Fundación Nacional Francisco Franco.
El día que me liberaron del último encierro recibí notificación de la apertura de un expediente disciplinario para intentar privarme otros 60 días de libertad porque uno de los sargentos, destinado en Badajoz, precisamente el que tenía tatuado un águila franquista en la pierna, informó que yo había hecho manifestaciones contra la bandera y la constitución (¿¿¿???). Lo cierto es que me he manifestado en multitud de ocasiones, pero dudo que nadie me haya oído decir nada contra la bandera o la constitución. No tengo reparos en reconocer que cambiaría la constitución sin dudarlo pero de ahí a manifestarse contra ella... Bien, pues le dieron credibilidad y me llamaron a declarar. Al final no pasó nada porque todos sabían que en breve sería expulsado y las elecciones municipales se acercaban, de no ser así es muy probable que hubiese sido sancionado de nuevo.
Creo que mi experiencia demuestra que los demócratas hemos sido maltratados y expulsados sistemáticamente de las Fuerzas Armadas por hacer manifestaciones progresistas y democráticas mientras que los que han tenido comportamientos o han realizado manifestaciones retrógradas, fascistas o antidemocráticas continúan en ellas. Por ello mismo, no me extraña que simbología como la perteneciente a la división azul se muestre sin ningún tipo de reparo o que exista un teniente que hable orgulloso de Hitler. Y no me extraña porque ellos (los responsables), aun después de esta publicación, seguirán siendo militares. El sistema no solo no los depurará, sino que los protegerá, enviando un mensaje inequívoco a todos los demás: los militares que exhiben orgullosos símbolos o hacen manifestaciones franquistas o fascistas son bienvenidos, pero los militares que hablan de democracia, libertad o derechos son expulsados.
Sabiendo que hay miembros del PP que comparten ideología franquista es normal que muchos militares se sientan potenciados, ya que parece difícil que el gobierno intente erradicar de forma sincera actitudes que miembros de su partido comparten.
Así pues, una parte del problema es que los altos mandos, los oficiales, los jueces militares e, incluso, los políticos de determinados partidos simpatizan con estas ideologías y repudian las contrarias, lo que complica mucho conseguir un cambio real. El sistema lo que intentará es perfeccionarse para que estos comportamientos no trasciendan, no para solucionarlos, porque lo realmente molesto no es que se produzcan, sino que se conozcan. Por tanto, es muy probable que se amenacen, controlen, castiguen y persigan más a los militares, sobre todo a los que hayan podido filtrar la información, que se esfuercen en implementar medidas efectivas para terminar con este problema.
Lo preocupante es que no se trata de un hecho esporádico. En los años ochenta hubo muchos militares que zarandearon, insultaron y amenazaron al general Gutiérrez Mellado y a otros militares que apostaron por la democracia, lo que llevó al general Marcelo Aramendi, que no soportó la presión, a suicidarse. Es sabido también que los militares golpistas fueron tratados más como héroes que como los delincuentes que eran (el mismo rey, D. Juan Carlos I lo auspició), al tiempo que los militares demócratas (UMD) fueron defenestrados. Más recientemente, el expresidente Zapatero y el exministro Bono tuvieron miedo de un "pronunciamiento" (no militar) durante la redacción del Estatut por el escándalo del Teniente General Mena (2006), lo que les hizo intervenir las comunicaciones de muchos altos mandos (no hubo sanciones, ni ceses, ni expulsiones).
La realidad es que nadie ha pagado hasta ahora por conductas y comportamientos marcadamente antidemocráticos, cuando somos muchos los cadáveres en la cuneta de los demócratas (y eso que a ciertos niveles somos considerablemente menos). Es más, como hemos podido ver en la mayoría de las sanciones a los antidemócratas se percibe un enorme carácter protector, incluso con los golpistas encarcelados.
En el lado contrario se puede encontrar el cese del exJEMAD Julio Rodríguez cuando decidió unirse a Podemos. En lugar de recibir el respeto de los políticos y los militares, lo que recibió fue el maltrato de la vicepresidenta, el desprecio del ministro y el ministerio y las cartas, amenazas e insultos de muchos militares. Todo ello innecesario por completo. Sangrante resulta si se compara con el trato recibido por el teniente coronel del cuerpo jurídico, Miguel Ayuso, (y juez militar en activo) cuando llamó bastarda a la constitución, renegó del Rey y calificó la guerra civil de cruzada (en Intereconomía -Televisión-). Quisieron ascenderle a coronel hasta que el escándalo saltó a los medios, momento en el que le volvieron a proteger: le mandaron a la reserva sin cese y sin sanción. Salida diplomática.
Si los mandos militares son capaces de zarandear a un vicepresidente del gobierno sin consecuencias, son tratados como héroes en lugar de como delincuentes cuando dan un golpe de estado, son tratados con cautela en lugar de ser detenidos y puestos a disposición judicial cuando pretendían hacer un pronunciamiento, menosprecian e insultan a un compañero por enrolarse en un partido político o se pretende ascenderlos cuando insultan a la constitución o denominan la guerra civil como una cruzada (en televisión)... Si pasa todo esto sin que se produzcan consecuencias es que ha llegado la hora de hacer lo que tendríamos que haber hecho hace cuarenta años y regenerar la cúpula militar para que sea plural. Ha llegado la hora del cambio.
Luis Gonzalo Segura, exteniente del Ejército de Tierra y autor de las novelas "Código rojo" (2015) y "Un paso al frente" (2014).
Puedes seguirme en Facebook y Twitter.
"Código rojo le echa huevos al asunto y no deja títere con cabeza. Se arriesga, proclamando la verdad a los cuatro vientos, haciendo que prevalezca, por una vez, algo tan denostado hoy en día como la libertad de expresión" ("A golpe de letra" por Sergio Sancor). ¡Consíguela aquí firmada y dedicada! | {
"pile_set_name": "OpenWebText2"
} |
Q:
Azure Javascript - Wait for Function Completion
I'm using Azure Mobile Services and am running a javascript backend. However, since the backend is in node.js, everything is executed asynchronously and I don't know how to halt the execution of a function.
I'm trying to delete a club if there hasn't been a comment in it within the past 24 hours, and here's my code:
var clubs = tables.getTable('Club');
clubs.read(
{
success: function(club){
var now = new Date().getTime();
for(var i=0;i<club.length;i++){
var deleteClub = true;
comments.where({ClubId: club[i].id}).read(
{
success:function(comment){
var timeDiff = (now-comment[i].Time.getTime())/(1000*60*60);
console.log("Comment in table: "+timeDiff);
if(timeDiff<24){
deleteClub=false;
}
}
}
);
if(deleteClub){
console.log("deleting club: "+club[i].Title);
//clubs.del(club[i]);
}else{
console.log("saving club: "+club[i].Title);
}
}
}
}
);
The if statement executes before the delete club variable is updated, so it's always true, but I need the if statement's execution to be delayed until after all of the comments have been looped through.
A:
Since the callback you get is asynchronous, you can't use any information you're getting in that callback in synchronous code after the where call.
Since we want to handle things on a club-by-club basis, first we'll move the handling of clubs into its own function. This avoids the problem that by the time we get our callback from read, i will have been incremented.
Your code seems to assume success is called repeatedly, once for each comment. I don't think that's likely to be the case, more likely it's called once, with a list/array of the matching comments.
If so, then splitting off club handling to its own function and then looping the found comments should do it:
var clubs = tables.getTable('Club');
clubs.read(
{
success: function(allClubs){ // <== Note plural
var now = new Date().getTime();
for (var i = 0; i < allClubs.length; i++) {
handler(now, allClubs[i]); // <== Move handling off to a handler
}
}
}
);
function handler(now, club) { // <== Unlike `i` above, `club` won't change because it's
// a function argument that we never assign to
comments.where({ClubId: club.id}).read(
{
success: function(comments){ // <== Note the plural
var deleteClub = true;
for (var i = 0; i < comments.length; ++i) {
var timeDiff = (now-comments[index].Time.getTime())/(1000*60*60);
console.log("Comment in table: "+timeDiff);
if(timeDiff<24){
deleteClub=false;
}
}
if (deleteClub){
console.log("deleting club: "+club.Title);
//clubs.del(club);
}else{
console.log("saving club: "+club.Title);
}
}
}
);
}
| {
"pile_set_name": "StackExchange"
} |
It is powerful, emotional and true to the characters, but it also confirms how dangerous Sybok is. He may have used his Vulcan telepathy to see McCoy’s pain, but all he did was show it to McCoy. Notice the language used by Sybok. “But that’s not all.” “Tell me what else.” It’s classic cold reading language. Sybok guides McCoy to reach his own closure. A counsellor, perhaps, but with evil motives. The false messiah. McCoy is certainly radicalized at this point, not because of the release but because of the sheer mental exhaustion of his ordeal. Perhaps even a touch of Stockholm Syndrome.
The undoing of Sybok is not with his methods, but with his targets. His next attempt is with Spock, who he believes hides the pain of his dual heritage. In fact, he is utterly wrong – Spock carries the old pain but has long since dealt with it. Sybok’s superficial savior undone by his brother, who sees through the illusion.
Kirk too sees through it, but in a different way. He may not have come to terms with his pain (implied, but not stated, to be the death of his son, or perhaps the death of his brother, which he alludes to later), but he understands its purpose and how it drives him to be better. He needs his pain, as do we all. Radicalization preys on the weak, whether that means intellectually, socio-economically, or emotionally.
In Kirk and Spock we see the failure, whether it be due to strength, wisdom or simply one brother knowing another. In McCoy we see weakness, but an understandable one. That he is not utterly converted is because his ties to Kirk and Spock are stronger. He is not in control of his actions after his ordeal with Sybok, as none are after being preyed on by radicals, but having a support network was a greater anchor than the cool new leader with the easy answers. I’ve been to anti-radicalization training (twice, actually), and this is exactly the strategy that works.
Finally, the encounter. We learn that Sybok’s plan was to steal a starship and take it to God. He has constructed a narrative whereby he is God’s messenger and will deliver all to paradise, literally. The location of God is a problem, however. Firstly, it is beyond The Great Barrier, secondly, it is at the center of the galaxy. The first one evokes the second pilot to the series, “Where No Man Has Gone Before,” and the barrier around the edge of the galaxy that caused Gary Mitchell to develop godlike powers and try to kill everyone. There’s got to be a fan theory in there somewhere (and there are several non-canon novels). The second problem is more difficult to overcome. The novelization mentions Sybok using knowledge from God to modify the Enterprise’s engines, but nothing like that exists in the film (there’s that “first draft” problem again). | {
"pile_set_name": "OpenWebText2"
} |
Q:
ES6 Set, WeakSet, Map and WeakMap
There is already some questions about map and weak maps, like this: What's the difference between ES6 Map and WeakMap? but I would like to ask in which situation should I favor the use of these data structures? Or what should I take in consideration when I favor one over the others?
Examples of the data structures from:https://github.com/lukehoban/es6features
// Sets
var s = new Set();
s.add("hello").add("goodbye").add("hello");
s.size === 2;
s.has("hello") === true;
// Maps
var m = new Map();
m.set("hello", 42);
m.set(s, 34);
m.get(s) == 34;
// Weak Maps
var wm = new WeakMap();
wm.set(s, { extra: 42 });
wm.size === undefined
// Weak Sets
var ws = new WeakSet();
ws.add({ data: 42 });
// Because the added object has no other references, it will not be held in the set
Bonus. Which of the above data structures will produce the same/similar result of doing: let hash = object.create(null); hash[index] = something;
A:
This is covered in §23.3 of the specification:
If an object that is being used as the key of a WeakMap key/value pair is only reachable by following a chain of references that start within that WeakMap, then that key/value pair is inaccessible and is automatically removed from the WeakMap.
So the entries in a weak map, if their keys aren't referenced by anything else, will be reclaimed by garbage collection at some point.
In contrast, a Map holds a strong reference to its keys, preventing them from being garbage-collected if the map is the only thing referencing them.
MDN puts it like this:
The key in a WeakMap is held weakly. What this means is that, if there are no other strong references to the key, then the entire entry will be removed from the WeakMap by the garbage collector.
And WeakSet does the same.
...in which situation should I favor the use of this data structures?
Any situation where you don't want the fact you have a map/set using a key to prevent that key from being garbage-collected.
One example of when you might use this would be to have instance-specific information which was truly private to the instance, which looks like this:
let Thing = (() => {
var privateData = new WeakMap();
class Thing {
constructor() {
privateData[this] = {
foo: "some value"
};
}
doSomething() {
console.log(privateData[this].foo);
}
}
return Thing;
})();
There's no way for code outside that scoping function to access the data in privateData. That data is keyed by the instance itself. You wouldn't do that without a WeakMap because if you did you'd have a memory leak, your Thing instances would never be cleaned up. But WeakMap only holds weak references, and so if your code using a Thing instance is done with it and releases its reference to the instance, the WeakMap doesn't prevent the instance from being garbage-collected; instead, the entry keyed by the instance is removed from the map.
Which of the above data structures will produce the same/similar result of doing: let hash = Object.create(null); hash[index] = something;
That would be nearest to Map, because the string index (the property name) will be held by a strong reference in the object (it and its associated property will not be reclaimed if nothing else references it).
| {
"pile_set_name": "StackExchange"
} |
Economic and Environmental Role of Wetlands
Interview with Nick Davidson, Ramsar Convention’s Deputy Secretary General at CBD, COP11. The key role that rapidly diminishing wetlands play in supporting human life and biodiversity needs to be recognized and integrated into decision-making as a vital component of the transition to a resource-efficient, sustainable world economy, according to a new TEEB report released today.
How cleaner stoves can save lives and tackle climate change
Kenya unveils new plans to tackle rising problem of e-waste
WHO estimates indoor air pollution was linked to 4.3 million deaths in 2012 in households cooking over coal, wood and biomass stoves
GENEVA, 25 March 2014 - In new estimates released today, the World Health Organization (WHO) reports that in 2012 around 7 million people died - one in eight of total global deaths as a result of air pollution exposure. This finding more than doubles previous estimates and confirms that air pollution is now the world's largest single environmental health risk. Reducing air pollution could save millions of lives.
Further Resources
In particular, the new data reveal a stronger link between both indoor and outdoor air pollution exposure and cardiovascular diseases, such as strokes and ischaemic heart disease, as well as between air pollution and cancer. This is in addition to air pollution's role in the development of respiratory diseases, including acute respiratory infections and chronic obstructive pulmonary diseases.
The new estimates are not only based on more knowledge about the diseases caused by air pollution, but also upon better assessment of human exposure to air pollutants through the use of improved measurements and technology. This has enabled scientists to make a more detailed analysis of health risks from a wider demographic spread that now includes rural as well as urban areas.
Regionally, low- and middle-income countries in the WHO South-East Asia and Western Pacific Regions had the largest air pollution-related burden in 2012, with a total of 3.3 million deaths linked to indoor air pollution and 2.6 million deaths related to outdoor air pollution.
"Cleaning up the air we breathe prevents noncommunicable diseases as well as reduces disease risks among women and vulnerable groups, including children and the elderly," says Dr Flavia Bustreo, WHO Assistant Director-General Family, Women and Children's Health. "Poor women and children pay a heavy price from indoor air pollution since they spend more time at home breathing in smoke and soot from leaky coal and wood cook stoves."
Included in the assessment is a breakdown of deaths attributed to specific diseases, underlining that the vast majority of air pollution deaths are due to cardiovascular diseases as follows:
Outdoor air pollution-caused deaths breakdown by disease:
40% - ischaemic heart disease;
40% - stroke;
11% - chronic obstructive pulmonary disease (COPD)
6% - lung cancer;
3% - acute lower respiratory infections in children.
Indoor air pollution-caused deaths breakdown by disease:
34% - stroke;
26% - ischaemic heart disease;
22% - COPD;
12% - acute lower respiratory infections in children;
6% - lung cancer.
The new estimates are based on the latest WHO mortality data from 2012 as well as evidence of health risks from air pollution exposures. Estimates of people's exposure to outdoor air pollution in different parts of the world were formulated through a new global data mapping. This incorporated satellite data, ground-level monitoring measurements and data on pollution emissions from key sources, as well as modelling of how pollution drifts in the air.
"The risks from air pollution are now far greater than previously thought or understood, particularly for heart disease and strokes," says Dr Maria Neira, Director of WHO's Department for Public Health, Environmental and Social Determinants of Health. "Few risks have a greater impact on global health today than air pollution; the evidence signals the need for concerted action to clean up the air we all breathe."
After analysing the risk factors and taking into account revisions in methodology, WHO estimates indoor air pollution was linked to 4.3 million deaths in 2012 in households cooking over coal, wood and biomass stoves. The new estimate is explained by better information about pollution exposures among the estimated 2.9 billion people living in homes using wood, coal or dung as their primary cooking fuel, as well as evidence about air pollution's role in the development of cardiovascular and respiratory diseases, and cancers.
In the case of outdoor air pollution, WHO estimates there were 3.7 million deaths in 2012 from urban and rural sources worldwide.
Many people are exposed to both indoor and outdoor air pollution. Due to this overlap, mortality attributed to the two sources cannot simply be added together, hence the total estimate of around 7 million deaths in 2012.
"Excessive air pollution is often a by-product of unsustainable policies in sectors such as transport, energy, waste management and industry. In most cases, healthier strategies will also be more economical in the long term due to health-care cost savings as well as climate gains," says Dr Carlos Dora, WHO Coordinator for Public Health, Environmental and Social Determinants of Health. "WHO and health sectors have a unique role in translating scientific evidence on air pollution into policies that can deliver impact and improvements that will save lives."
The release of today's data is a significant step in advancing a WHO roadmap for preventing diseases related to air pollution. This involves the development of a WHO-hosted global platform on air quality and health to generate better data on air pollution-related diseases and strengthened support to countries and cities through guidance, information and evidence about health gains from key interventions.
Later this year, WHO will release indoor air quality guidelines on household fuel combustion, as well as country data on outdoor and indoor air pollution exposures and related mortality, plus an update of air quality measurements in 1600 cities from all regions of the world. | {
"pile_set_name": "Pile-CC"
} |
Trench raiding club
Trench raiding clubs were homemade melee weapons used by both the Allies and the Central Powers during World War I. Clubs were used during nighttime trench raiding expeditions as a quiet and effective way of killing or wounding enemy soldiers. The clubs were usually made out of wood. It was common practice to fix a metal object at the striking end (e.g. an empty Mills bomb) in order to maximize the injury inflicted. Another common design comprised a simple stave with the end drilled out and a lead weight inserted, with rows of large hobnails hammered in around its circumference. Most designs had some form of cord or leather strap at the end to wrap around the user's wrist. Bosnian soldiers serving in the Austro-Hungarian army were fond of using maces. They were also used by officers to finish enemy soldiers wounded by poison gas attacks.
Trench clubs were manufactured in bulk by units based behind the lines. Typically, regimental carpenters and metal workers would make large numbers of the same design of club.
They were generally used along with other melee weapons such as trench knives, entrenching tools, bayonets, hatchets, hammers, and pickaxe handles – backed up with handguns, shotguns, submachine guns, and hand grenades.
In popular culture
In the 1986 Vietnam War film Platoon the character Rhah (played by Francesco Quinn) carries a crude wooden staff wrapped in barb wire, which resembles a makeshift trench club.
In the film Defendor, the title character uses a trench club on a chain as his primary weapon and states that it had once belonged to his grandfather.
In the video game Team Fortress 2, a trench club is usable as a melee weapon by the Scout Class, under the name "Boston Basher".
In the video game Battlefield 1, players can use trench clubs as melee weapons.
In the video game Verdun, a trench club is available for use by the Canadian raiders.
In the Netflix television series Stranger Things, the character Steve (played by Joe Keery) carries a trench club made from a baseball bat as his weapon of choice.
In the comic series and its television adaptation The Walking Dead, the character Negan (played by Jeffrey Dean Morgan in the show) carries a baseball bat wrapped in barbed wire, a makeshift trench club he affectionately nicknames "Lucille."
See also
Hand-to-hand combat
Trench warfare
References
External links
Trench clubs from the collection of Imperial War Museums
Photo of hob-nailed trench club in a private collection
Account of a raid where a trench club was used to kill an officer
Category:World War I infantry weapons
Category:Improvised weapons
Category:Clubs (weapon) | {
"pile_set_name": "Wikipedia (en)"
} |
The Wi-Fi monitors all have lower EMF readings than the dedicated options with the lowest average EMF readings being 0.87 for the LeFun C2 720P Wi-Fi and 0.92 for the Nest Cam Indoor Wi-Fi with the reader 6 ft from the camera. The lowest average value for the dedicated monitors at 6 ft is 1.89 for the Infant Optics DXR-8 and 1.91 for the Philips Avent SCD630.
The Nest Cam Indoor Wi-Fi camera is a cool Wi-Fi camera that pairs with your personal device like a smartphone or tablet. This easy to use camera has amazing video, can be viewed anywhere you have a connection and has several useful features. The Nest Cam is good for baby watching, but it can also be used as a nanny cam or for security after your little one is older. We love that the Nest Cam has a reasonable price and can be used for many years to come retaining its value long after the standard monitoring device is no longer useful.
Baby's exposure could potentially be even lower if parents place the camera on a wall at least 15 feet from baby (a distance still good for night vision to work properly with most monitors). Given the sensitivity of baby's developing systems we recommend placing the monitor as far away from the baby as possible while still being able to utilize the night vision as intended and see baby's face to determine if they are awake or sleeping at a glance. For most of the products, this distance is between 10-15 feet from the baby.
Ease of setup and installation factored heavily into our ratings, including whether an account needed to be created and if there were any extra subscription fees necessary. Each unit had cords protruding out of its back, so design wasn't much of a factor in my choice, though parents should take care to keep dangling cords and wires away from their children's reach when setting up a monitor.
Video, Audio, or Both: First-time parents are suckers for high-definition, night-vision baby monitors where they can pick up on exactly how their child’s chest is rising and falling. You will do this dozens of times a night. Past the Sudden Infant Death Syndrome-scare age, you may just want an audio baby monitor (which a lot of video ones double as), because you’ll know an “I’m hungry” cry from an “I lost my sock” whine.
The iBaby M6 Wi-Fi is a Wi-Fi camera designed with nurseries in mind, something not true of the Nest Cam. This camera is easy to use, works with your internet for connectivity anywhere and has features that are baby-centric. The iBaby tied with the Nest Cam Indoor Wi-Fi in our review, but the iBaby is a better option for parents who want a camera designed for watching a baby. The iBaby includes sensors for temperature, humidity, and air-quality (things to watch when setting up best sleep practices). It has different lullabies included, and you can add your own songs, voice, or stories with minimal effort. This option has an intuitive interface and works well on your personal device with continual use even while running other apps. You can even take pictures or video of your little one in action or peacefully dreaming. You get all of this with a list price below the Nest Cam making it a good choice for parents who want a Wi-Fi option but are less concerned with longevity.
The LeFun camera connects to your WiFi, and you use the associated app to watch real-time footage in 750-pixel high definition. Because the product uses WiFi to transmit video, you don’t need to worry about walls obstructing the signal. The camera can pan an impressive 350 degrees and tilt 100 degrees, and it also has night vision that many reviewers say works well.
Video products for monitoring baby is a growing industry, and it feels like every company is jumping on the bandwagon and throwing something into the already overflowing market of monitors. This plethora of products can make sorting through products difficult and attempts to narrow the field daunting. Luckily, we have already done the legwork by doing an initial review of the top products and choosing 9 of the most popular and well-rated options to test and compare. After months of hands-on testing, we feel confident that no matter what you might be looking for in a video product for monitoring baby, that you can find it in one of our award winners or the top-ranked products in this review.
The longest battery life for the dedicated products in our review is the Levana Lila, which ran for 12.75 hours in full use mode. The manufacturer claims this unit will work up to 72 hours in power saving mode, but we only tested the monitors in full use. The Infant Optics DXR-8 came in second place with a shorter run time of closer to 11.5 hours. The Motorola MBP36S earned the lowest score for battery life with a runtime just under 7 hours. While not necessarily a deal breaker, there are plenty of other reasons to dislike the Motorola MBP36S, and the battery life is just a small part of a disappointing overall picture (no pun intended).
Still need help? We understand! There’s a lot to choose from, and given that the baby monitor performs a super important job, we want to help you select the one that provides the ultimate peace of mind when it comes to baby’s safety and security. We’ve rounded up 10 of the best baby monitors on the market, from high-end, do-it-all monitors to affordable but effective audio monitors and everything in between. You’re sure to find your digital nap companion on our list!
If you sleep in the same room as your baby or live in a small enough space that you can always hear or see what your baby is up to, you probably don’t need a monitor. Otherwise, most parents enjoy the convenience a baby monitor provides—instead of needing to stay close to the nursery or constantly checking on your child, you’re free to rest, catch up on Netflix or get things done around the house during naptime. Monitors can also double as a nanny cam to keep an eye on your child and their caretaker. | {
"pile_set_name": "Pile-CC"
} |
An Unmet Need Meets an Untapped Resource: Pharmacist-Led Pathways for Hypertension Management for Emergency Department Patients.
The purpose of this review is to describe the role of the pharmacist in innovative pathways of care for hypertension (HTN) management for emergency department (ED) patients, particularly in under-resourced communities. Due to intersecting socioeconomic and personal health risk factors, these patients bear a disproportionate share of cardiovascular disease, yet often have limited access to high-quality primary care. Recent meta-analyses demonstrate a clear advantage associated with pharmacist-physician collaborative models over traditional physician-only care in achieving blood pressure control. However, no prior study has evaluated use of pharmacist-led follow-up for ED patients with uncontrolled blood pressure (BP). Thus, we developed a pharmacist-driven transitional care clinic (TCC) that utilizes a collaborative practice agreement with ED physicians to improve HTN management for ED patients. We have successfully implemented the TCC in a high-volume urban ED and in a pilot study have shown clinically relevant BP reductions with our collaborative model. The use of pharmacist-led follow-up for HTN management is highly effective. Novel programs such as our TCC, which extend the reach of such a model to ED patients, are promising, and future studies should focus on implementation through larger, multicenter, randomized trials. However, to be most effective, policy advocacy is needed to expand pharmacist prescriptive authority and develop innovative financial models to incentivize this practice. | {
"pile_set_name": "PubMed Abstracts"
} |
1. Field
Exemplary embodiments of the present disclosure relate to a memory system, and more particularly to a memory system having a media quality aware Error-Correcting Code (ECC) decoding selection and operating method thereof.
2. Description of the Related Art
The use of computer systems has been rapidly increased in the digital era. Due to this fact, the reliability of digital data storage, such as a memory system, is critical.
Electrical or magnetic interference inside the computer system can cause a single bit of memory cells of the memory system to spontaneously flip to the opposite state to cause errors and result in internal data corruption.
Bit errors of a memory system can be caused by degradation of internal NAND memory structures from previous repeated accesses. In this case, the NAND is wearing out and not getting high energy particle disturbance like a Synchronous Dynamic Random-Access Memory (SDRAM) type of memory.
The memory system, or storage devices having an ECC controller is a type of computer data storage that can detect and correct the most common kinds of the internal data corruption. The memory system having the ECC controller is used in most computers where data corruption cannot be tolerated under any circumstances.
Typically, the ECC controller maintains the memory system immune to single-bit errors, the data that is read from each word is always the same as the data that has been written to, even if one or more bits actually stored have been flipped to the wrong state. While the memory system having the ECC controller can detect and correct the errors, most non-ECC memory system cannot correct errors although some may support error detection but not correction.
Thus, there remains a need for a memory system having the ECC controller and the operating method thereof. In view of the ever-increasing need to improve performance and security, it is more and more critical that answers be found to these problems. Solutions to these problems have been long sought but prior developments have not taught or suggested any solutions and, thus, solutions to these problems have long eluded those skilled in the art. | {
"pile_set_name": "USPTO Backgrounds"
} |
The objective of this project is to develop the existing gas target neutron source to the point where it is capable of being utilized for patient treatment. Our goal is to provide clinically useful dt neutron beam of 20 rads per minute at 125 cm SSD. To achieve this goal the present source output must be doubled and the system operation modified to increase the unit reliability. The installation of a suitable neutron shield will be followed by construction and installation of a continuously variable collimator. We plan to utilize only a fixed horizontal beam. Pertinent measurements will be made of the resulting neutron beam. The thrust of these measurements will be to form a basis permitting delivery of a radiotherapeutic neutron dose. Characteristic depth dose and isodose curves from the beam will be obtained as well as measurements of the effect source diameter and SSD of the source. Measurements will also be made of the gamma ray contamination and the strength of the neutron source as a function of operating time. Following these physical measurements experiments will be conducted to characterize the radiobiological characteristics of the beam and to permit a comparison with the cyclotron neutrons currently in use. Radiobiology studies will also establish normal tissue tolerance for this particular neutron mean and collimation system. BIBLIOGRAPHIC REFERENCE: DeLuca, P.M., Torti, R., Chenevert, G.M., Tesmer, J.R., and Kelsey, C.A., Radiation Protection Aspects of a High Flux, Fast Neutron Generator, in Ninth Midyear Topical Symposium on Operational Health Physics (Denver, Colorado) 1976, p. 568. | {
"pile_set_name": "NIH ExPorter"
} |
Image caption China has been hit by food scandals, including tainted baby milk formula
Liang Jinfang is lucky her small Beijing apartment has relatively big cupboards.
As a mother of an energetic one-year-old boy nicknamed Huhu, Ms Liang is deeply suspicious of locally produced food in China. Endless food safety scandals have led her to seek the safest possible sources of food for her child.
The result? Every shelf and spare cupboard in the family's apartment is packed with imported food for Huhu, including a year's supply of milk powder shipped from Germany and organic rice cereal from the United States.
"The government hasn't taken any measures to deal with the food scandals," Ms Liang said.
"There is only one answer: you have to pay to find the best food for your child."
Costly solution
This solution is not cheap. Huhu's parents both have solid jobs working as railway engineers, but a large chunk of their earnings go towards imported baby food.
Image caption Toddler Huhu only eats imported food
"We spend so much on milk powder that my parents have to help us with our living costs so we can survive," Liang Jinfang admits.
But it is no wonder these parents and millions like them are worried.
In 2008, six infants died and 300,000 babies were affected with painful kidney stones after drinking tainted milk powder. An industrial chemical, melamine, was added to milk sold by several major Chinese dairies. Melamine falsely boosted the protein content in the milk.
China's leaders have vowed to tighten the country's food safety regulations, but the food crises continue. Almost every item on Chinese store shelves, from rice to candy, has been involved in some sort of food scandal.
Not only do many consumers worry about illegal additives to their food, they also question whether they are buying fake food.
Just this year, more than 900 people were arrested across China for crimes involving imitation meat, including rat illegally substituted for mutton and sold in market stalls.
So many people in China have developed their own coping strategies to deal with nagging worries about their food. Some, like Huhu's parents, hoard imported goods.
Others choose to arm themselves with information. A host of smart phone applications have surfaced in the past year offering daily alerts on the latest food safety scandals.
A cursory check of a single app warns users that a man in China's central Hunan province was arrested for selling bean sprouts that were illegally whitened with bleach.
The next posting, from a user in Beijing, reveals that "black lumps that appeared to be mouse droppings" were found in a packaged pastry from a local grocery store. A photo illustrates each grisly report.
Food tests
Media playback is unsupported on your device Media caption This device tests for contamination in baby formula milk
Some consumers choose to protect themselves by becoming amateur food inspectors. Sales of home food safety tests are soaring online.
The Zhiyunda Science and Technology Company, a private laboratory staffed by former food safety researchers, is doing brisk business.
Originally they planned to develop instant food safety tests to sell to companies and government agencies. But now, at least 30% of their products are bought by individual consumers for use at home.
"Whenever a food safety problem pops up, we produce a matching solution," said the company's deputy general manager, Li Jiangang.
"In the European Union, they have horse meat masked as beef, but we have duck meat that's disguised as lamb. We have testers for that now too."
The lab now sells more than 150 different tests to address a host of Chinese food concerns. Some big sellers look for toxins in cooking oil. Other tests check for excessive pesticides on leafy vegetables such as lettuce.
Image caption Hundreds have been arrested this year for crimes involving imitation meat
The company's most popular product? No surprise - it is a three minute detector that looks for contaminants in baby formula.
"Actually, there are good brands of milk powder in the market, but people have no methods to tell right from wrong," Mr Li says.
"Some mothers use our melamine testers on every bottle of milk they use."
Back on the other side of Beijing, it's hard to imagine a test that would convince Huhu, the toddler's parents, to shop locally. Even the rice - the most Chinese of foods - their son eats is imported from Germany. | {
"pile_set_name": "OpenWebText2"
} |
The molecular basis of hemophilia A.
Due to new, sensitive methodologies, the rate at which factor VIII gene mutations are found is increasing rapidly. The next five years should lead to the discovery of a wide range of defects as well as potential new hot-spots for mutations. Advances in understanding the protein will also provide new insights into the effects of particular mutations. Tremendous strides have been made in carrier detection and prenatal diagnosis. Already diagnosis is possible in 70% of cases with the factor VIII intragenic polymorphisms. Although there is still room for improvement in availability, speed, and cost of the test, many families in the United States and Europe are benefiting from this sensitive detection method. | {
"pile_set_name": "PubMed Abstracts"
} |
La Talaudière
La Talaudière is a commune in the Loire department in central France.
Twin towns
La Talaudière is twinned with:
Sio, Mali
Küssaberg, Germany
See also
Communes of the Loire department
Talaudiere
Category:Loire communes articles needing translation from French Wikipedia | {
"pile_set_name": "Wikipedia (en)"
} |
using System;
using ModuleManager.Progress;
namespace ModuleManager.Patches.PassSpecifiers
{
public class LegacyPassSpecifier : IPassSpecifier
{
public bool CheckNeeds(INeedsChecker needsChecker, IPatchProgress progress)
{
if (needsChecker == null) throw new ArgumentNullException(nameof(needsChecker));
if (progress == null) throw new ArgumentNullException(nameof(progress));
return true;
}
public string Descriptor => ":LEGACY (default)";
}
}
| {
"pile_set_name": "Github"
} |
Thank you for visiting Dick's Sporting Goods. If you need assistance with shopping on our site, please call us at 1-877-846-9997 and a customer care representative will be happy to assist you. Please inform the Customer Service representative that you require assistance.
Product Selection
Suit Up for Your Training: Shop Under Armour®
Engineered for an unbelievable fit, Under Armour® apparel works as hard as you do—each garment is designed with performance-enhancing features to help you make the most of your training.
Shop Under Armour® for men, women and kids. Experience the remarkable fit and feel of technical fabrics that regulate your body temperature, wick away perspiration and support your muscles as you train.
Buying Tips
It’s Under Armour’s® proprietary technologies that set the brand apart. Drag a tire on an autumn morning. Go the extra mile during your evening run. With Under Armour®, there’s a technology designed just for your workout.
Under Armour® reinvented the cotton T-shirt. Pull on a UA Charged Cotton tee for the super-soft feel of cotton that dries faster—and keeps you cooler
Expert Advice
From performance golf and running clothes to the super hero-inspired Alter Ego collection, Under Armour® crafts gear for athletes of all stripes. Pull on Under Armour® baselayers for thermal warmth and layer with soft Under Armour hoodies and zip-up jackets. Take on your training with air-light tees, sleek gym shorts and compression apparel. | {
"pile_set_name": "Pile-CC"
} |
Nikolaos Georgopoulos
Nikolaos Georgopoulos (born 31 January 1937 in Athens) is a Greek former sprinter who competed in the 1960 Summer Olympics.
He was part of Greece's winning 4×400 metres relay team at the 1959 Mediterranean Games. He also represented his country at the European Athletics Championships in 1954 and 1958, and was a 200 metres silver medallist at the 1959 Universiade.
References
Category:1937 births
Category:Living people
Category:Greek male sprinters
Category:Sportspeople from Athens
Category:Olympic athletes of Greece
Category:Athletes (track and field) at the 1960 Summer Olympics
Category:Universiade medalists in athletics (track and field)
Category:Competitors at the 1959 Mediterranean Games
Category:Mediterranean Games gold medalists for Greece
Category:Mediterranean Games medalists in athletics
Category:Universiade silver medalists for Greece | {
"pile_set_name": "Wikipedia (en)"
} |
If you are like the rest of our user community, your IT team is busy. With pressure to deliver on-time projects, you don’t have a lot of time to spend making your management tools work. You need network monitoring tools that work for you. You want tools that makes it easy to find performance issues before your users do and resolve them before they impact the business. That’s why tens of thousands of customers around the world love WhatsUp Gold.
1/2
How many devices do you monitor on your company's network?
Under 25 25-50 51-100 Over100
2/2
One last question before you visit our site:
When do you plan to purchase a network performance monitoring solution?
kses is an HTML/XHTML filter written in PHP. It removes all unwanted HTML elements and attributes, and it also does several checks on attribute values. kses can be used to avoid Cross-Site Scripting (XSS). NOTE: I don't have time for kses right now..
Cloud Toolkit .Net provides many useful and good-looking .Net controls for use with .Net applications (VC++, VC#, VB.Net etc). Update (September 2011): The project has been inactive for a few years and will remain so. No support provided!
This library is meant for high performance calculations for science or 3D games/rasterizers using SIMD instructions of x86 processors to allow an unparalleled level of optimization. This takes advantage of MMX, 3DNow!, 3DNow!+/MMX+, & SSE/SSE2/SSE3/SSSE3
ABSim is an Agent-Object-Relationship (AOR) simulation system based on a Java program library. The development of ABSim has terminated. Its successor is <a href="http://oxygen.informatik.tu-cottbus.de/aor/?q=node/2">AOR-JSim </a>
Codewars is an client-server game. You have to write a robot-program in any programminglanguage, which fights against other robots in an simulated arena. A musst see for fans of artificial intelligence and coding.
CorEngine is a work in progress, OpenGL graphics powered 3D game engine designed to help independent game developers with quick prototyping and game/virtual environment creation.
The engine supports a standard set of features, like skeletal animation, post processing, Lua/C programming, physics powered by Bullet Physics, GUI and 2D/3D Audio.
MsraConsole is a Remote Desktop sharing Tool.
This Project is inactive. The forked Project is MsraCon wich uses Windows Authentication. https://sourceforge.net/projects/msracon/
The Tool could be used as Help Support solution in Classrooms. It shares the Windows Desktop Screen of multiple Computers with some Viewer Computers (Users). The Viewer can take control over the Mouse and Keyboard.
It is only a programming sample, don't use the Software in productive Environments!
It uses the Microsoft Remote Desktop API RDPCOMAPILib and AxRDPCOMAPILib the source Code is in C#. Requires Net Framework 4 or higher to be installed.
Pearl MATE 3.0 (16.04)
!!!!!!! THIS VERSION IS NO LONGER SUPPORTED !!!!!
Please see new location for all versions of Pearl 3.0:
https://sourceforge.net/projects/pearl-os-3-0/files/
>>>>> However <<<<<
You you do prefer this version if you go and comment out our repository and
just use the ubuntu archives for updates. If all you would like to keep is
pretty much the theming etc ... this is probably a good choice.
I am very sorry for this issue... totally my fault...humans geeze..lol..
btw to comment out our repo simply put an # in front of the deb http://..... line in the /etc/apt/sources.list file.
PocketGCC is a port of well-known GNU C/C++ compiler and Binutils for ARM-WinCE-PE platform. Both crosscompiler and native builds are provided, allowing to develop applications for WindowsCE devices with ARM-compatible processor on the go without desktop
ZEngine is designed to provide a powerful yet easy to use 2D game API using OpenGL for fast 2D drawing and SDL for everything else, it is completely cross-platform and the class based design makes it easy to learn and use.
jsXe is the Java Simple XML Editor. Out of the box it provides a tree view, DTD/Schema introspection and validation. It's aim is to provide a framework for XML editing through any number of views that can be loaded at runtime as plugins.
This is the Sokofinity project. The goal of this project is to recreate the classic NES game DuckHunt, only this time in 3D with Virtual Reality. Using an Infinity Box and Flock Of Birds positioning sensors, the game gets a new dimension.
Note: this p
This is the source code repository for my VMLAB User Components. The Project Website contains detailed descriptions of each component. You can also Download Components as pre-compiled DLL files from this site. The "AVR Peripheral" components should be installed to the "mculib" directory; all other components are installed in the "userlib" directory. A few components include a "readme.txt" with additional setup instructions.
Most components are licensed under the LGPLv2 (or higher). A few of the older components are released into the Public Domain.
The Program Killer is a Delphi 6 program that monitors the Process List on Windows 95/98/Me and Windows NT4/2000/XP for unauthorized EXE files (User Definable) and if found, those Processes are Terminated via the Windows API.
AbsoluteX is an open source free class library primarily developed for use with X Window System.
AbsoluteX uses object-oriented design and free software LGPL licensing.
It gives you the ability to develop open software, free software, or even commer
Get latest updates about Open Source Projects, Conferences and News.
Yes, also send me special offers about products & services regarding:
You can contact me via:
Email (required)PhoneSMSPhone
JavaScript is required for this form.
I agree to receive these communications from SourceForge.net. I understand that I can withdraw my consent at anytime. Please refer to our Terms of Use and Privacy Policy or Contact Us for more details.I agree to receive these communications from SourceForge.net via the means indicated above. I understand that I can withdraw my consent at anytime. Please refer to our Terms of Use and Privacy Policy or Contact Us for more details. | {
"pile_set_name": "Pile-CC"
} |
Main menu
Officer Charged After Beating a Man in Handcuffs
WASHINGTON – Isaac White, formerly an officer with the Memphis Police Department, pleaded guilty today in federal court in Memphis, Tenn., to using excessive force and causing bodily injury. White faces up to 10 years in prison for the civil rights violation.
White, 29, admitted in court that on Nov. 1, 2008, he struck a handcuffed arrestee twice in the head, violating the victim’s right to be free from excessive force. White further admitted that he caused his victim substantial pain and bruising.
"It is simply unacceptable for a police officer to beat up a handcuffed arrestee," said Thomas E. Perez, Assistant Attorney General for the Civil Rights Division. "A badge is a sacred trust, not a license to bully."
"The United States Attorney’s Office remains committed to protecting the public from violations of constitutional rights by law enforcement officers who abuse their authority and the public’s trust," said Lawrence J. Laurenzi, U.S. Attorney for the Western District of Tennessee.
Popular Video
A police officer saw a young black couple drive by and pulled them over. What he did next left them stunned:
Popular Video
A police officer saw a young black couple drive by and pulled them over. What he did next left them stunned:
"When a law enforcement officer violates the civil rights of another, he brings shame on the badge and all law enforcement officers," said Special Agent in Charge My Harrison of the FBI Memphis Field Office. "The FBI makes it a priority to bring a law enforcement officer who violates the constitution and the trust of the people to justice."
"Police officers must not betray the trust of our citizens. We take an oath to protect, serve and uphold the laws of the state of Tennessee. When we violate that oath we will be held accountable," said Memphis Police Director Larry A. Godwin. "As police director, it is my priority to see that this department will not tolerate criminal acts by its officers, and we will seek prosecution of any and all officers who choose to do so."
The Civil Rights Division is committed to the vigorous enforcement of every federal criminal civil rights statute, including those laws that prohibit the willful use of excessive force or other acts of misconduct by law enforcement officials.
This case was investigated by the FBI and the Memphis Police Department Sergeant Matt Whittington and Officer Paul Sherman. Assistant U.S. Attorney Steve Parker from the U.S. Attorney’s Office in Memphis and Trial Attorney Jonathan Skrmetti from the Civil Rights Division are prosecuting the case. | {
"pile_set_name": "Pile-CC"
} |
News
At the end of October 2017, BIA Ivory Coast received the visit of Her Royal Highness Astrid of Belgium accompanied by a Belgian delegation of Ministers and Secretaries of State. A major recognition for the BIA Ivory Coast team. It…
Looking for quality used machines ? 2MAT is part of a group with more than 100 years’ experience in the industry. We offer a wide range of machines, always more than 100 machines on yard. Earthmoving machines, compaction, asphalt machines, crushing…
Dear all, The latest issue of the BIA Mag has been published. Please click here to read the English version. Paper versions are also available from our commercial teams. Happy reading! ————— The BIA Mag is written by the BIA…
Is your fleet too big? You could make savings by adapting it. Is your fleet too small? You are probably overloading (and therefore damaging) your equipment. An Application Engineer might be able to help you obtain the right fleet for…
SFTP, a mining subcontractor, has just invested in ten new pieces of equipment including 8 Komatsu machines that will be used for earthworks and to extract gold from the Mako mine in Senegal. A PROSPERING BUSINESS Mr Seydina Diallo, CEO…
SBA is reducing its dependence on aggregate suppliers by opening its own quarry. BIA provided it with the equipment to do this. A NEW PLAYER IN THE WORLD OF AGGREGATE Soukpa Bitume Afrique (SBA) is a sister company of EKDS,…
STDM is taking position as a major player in the aggregates market in Togo, thanks to its new Sandvik fixed crushing and sifting station. LISTENING TO CUSTOMER NEEDS Mr Aliou Adamon was already involved in the construction market with his…
Have you ever wondered where the wood in your floor or your wardrobe came from? It might be from the forest of Mbang or Djoum, in Eastern or Southern Cameroon. We follow the journey of this wood from the forest…
Certification ISO 9001 (2015) in Senegal In September, BIA Dakar received the ISO 9001 (2015) certification for its operations in Dakar and on the mining site of one of its customers in Senegal. This certification is the recognition by an independant organisation of our effective implementation of… | {
"pile_set_name": "Pile-CC"
} |
4D Lorentz electron microscopy imaging: magnetic domain wall nucleation, reversal, and wave velocity.
Magnetization reversal is an important topic of research in the fields of both basic and applied ferromagnetism. For the study of magnetization reversal dynamics and magnetic domain wall (DW) motion in ferromagnetic thin films, imaging techniques are indispensable. Here, we report 4D imaging of DWs by the out-of-focus Fresnel method in Lorentz ultrafast electron microscopy (UEM), with in situ spatial and temporal resolutions. The temporal change in magnetization, as revealed by changes in image contrast, is clocked using an impulsive optical field to produce structural deformation of the specimen, thus modulating magnetic field components in the specimen plane. Directly visualized are DW nucleation and subsequent annihilation and oscillatory reappearance (periods of 32 and 45 ns) in nickel films on two different substrates. For the case of Ni films on a Ti/Si(3)N(4) substrate, under conditions of minimum residual external magnetic field, the oscillation is associated with a unique traveling wave train of periodic magnetization reversal. The velocity of DW propagation in this wave train is measured to be 172 m/s with a wavelength of 7.8 microm. The success of this study demonstrates the promise of Lorentz UEM for real-space imaging of spin switching, ferromagnetic resonance, and laser-induced demagnetization in ferromagnetic nanostructures. | {
"pile_set_name": "PubMed Abstracts"
} |
/*
* Copyright (C) 2016 Apple Inc. All rights reserved.
*
* Redistribution and use in source and binary forms, with or without
* modification, are permitted provided that the following conditions
* are met:
* 1. Redistributions of source code must retain the above copyright
* notice, this list of conditions and the following disclaimer.
* 2. Redistributions in binary form must reproduce the above copyright
* notice, this list of conditions and the following disclaimer in the
* documentation and/or other materials provided with the distribution.
*
* THIS SOFTWARE IS PROVIDED BY APPLE INC. AND ITS CONTRIBUTORS ``AS IS''
* AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO,
* THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
* PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE INC. OR ITS CONTRIBUTORS
* BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
* CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
* SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
* INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
* CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
* ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF
* THE POSSIBILITY OF SUCH DAMAGE.
*/
#include "config.h"
#include "TypedArrayCTest.h"
#include "JavaScript.h"
#include <limits.h>
#include <math.h>
#include <stdio.h>
#include <wtf/Assertions.h>
extern "C" void JSSynchronousGarbageCollectForDebugging(JSContextRef);
static void id(void*, void*) { }
static void freePtr(void* ptr, void*)
{
free(ptr);
}
static const unsigned numLengths = 3;
static const unsigned lengths[numLengths] =
{
0,
1,
10,
};
static const unsigned byteSizes[kJSTypedArrayTypeArrayBuffer] =
{
1, // kJSTypedArrayTypeInt8Array
2, // kJSTypedArrayTypeInt16Array
4, // kJSTypedArrayTypeInt32Array
1, // kJSTypedArrayTypeUint8Array
1, // kJSTypedArrayTypeUint8ClampedArray
2, // kJSTypedArrayTypeUint16Array
4, // kJSTypedArrayTypeUint32Array
4, // kJSTypedArrayTypeFloat32Array
8, // kJSTypedArrayTypeFloat64Array
};
static const char* typeToString[kJSTypedArrayTypeArrayBuffer] =
{
"kJSTypedArrayTypeInt8Array",
"kJSTypedArrayTypeInt16Array",
"kJSTypedArrayTypeInt32Array",
"kJSTypedArrayTypeUint8Array",
"kJSTypedArrayTypeUint8ClampedArray",
"kJSTypedArrayTypeUint16Array",
"kJSTypedArrayTypeUint32Array",
"kJSTypedArrayTypeFloat32Array",
"kJSTypedArrayTypeFloat64Array",
};
inline int unexpectedException(const char* name)
{
fprintf(stderr, "%s FAILED: unexpected exception\n", name);
return 1;
}
static int assertEqualsAsNumber(JSGlobalContextRef context, JSValueRef value, double expectedValue)
{
double number = JSValueToNumber(context, value, nullptr);
if (number != expectedValue && !(isnan(number) && isnan(expectedValue))) {
fprintf(stderr, "assertEqualsAsNumber FAILED: %p, %lf\n", value, expectedValue);
return 1;
}
return 0;
}
static int testAccess(JSGlobalContextRef context, JSObjectRef typedArray, JSTypedArrayType type, unsigned elementLength, void* expectedPtr = nullptr, JSObjectRef expectedBuffer = nullptr, unsigned expectedOffset = 0)
{
JSValueRef exception = nullptr;
// Test typedArray basic functions.
JSTypedArrayType actualType = JSValueGetTypedArrayType(context, typedArray, &exception);
if (type != actualType || exception) {
fprintf(stderr, "TypedArray type FAILED: %p, got: %s, expected: %s\n", typedArray, typeToString[actualType], typeToString[type]);
return 1;
}
unsigned length = JSObjectGetTypedArrayLength(context, typedArray, &exception);
if (elementLength != length || exception) {
fprintf(stderr, "TypedArray length FAILED: %p (%s), got: %d, expected: %d\n", typedArray, typeToString[type], length, elementLength);
return 1;
}
unsigned byteLength = JSObjectGetTypedArrayByteLength(context, typedArray, &exception);
unsigned expectedLength = byteSizes[type] * elementLength;
if (byteLength != expectedLength || exception) {
fprintf(stderr, "TypedArray byteLength FAILED: %p (%s), got: %d, expected: %d\n", typedArray, typeToString[type], byteLength, expectedLength);
return 1;
}
unsigned offset = JSObjectGetTypedArrayByteOffset(context, typedArray, &exception);
if (expectedOffset != offset || exception) {
fprintf(stderr, "TypedArray byteOffset FAILED: %p (%s), got: %d, expected: %d\n", typedArray, typeToString[type], offset, expectedOffset);
return 1;
}
void* ptr = JSObjectGetTypedArrayBytesPtr(context, typedArray, &exception);
if (exception)
return unexpectedException("TypedArray get bytes ptr");
JSObjectRef buffer = JSObjectGetTypedArrayBuffer(context, typedArray, &exception);
if (exception)
return unexpectedException("TypedArray get buffer");
void* bufferPtr = JSObjectGetArrayBufferBytesPtr(context, buffer, &exception);
if (exception)
return unexpectedException("ArrayBuffer get bytes ptr");
if (bufferPtr != ptr) {
fprintf(stderr, "FAIL: TypedArray bytes ptr and ArrayBuffer byte ptr were not the same: %p (%s) TypedArray: %p, ArrayBuffer: %p\n", typedArray, typeToString[type], ptr, bufferPtr);
return 1;
}
if (expectedPtr && ptr != expectedPtr) {
fprintf(stderr, "FAIL: TypedArray bytes ptr and the ptr used to construct the array were not the same: %p (%s) TypedArray: %p, bytes ptr: %p\n", typedArray, typeToString[type], ptr, expectedPtr);
return 1;
}
if (expectedBuffer && expectedBuffer != buffer) {
fprintf(stderr, "FAIL: TypedArray buffer and the ArrayBuffer buffer used to construct the array were not the same: %p (%s) TypedArray buffer: %p, data: %p\n", typedArray, typeToString[type], buffer, expectedBuffer);
return 1;
}
return 0;
}
static int testConstructors(JSGlobalContextRef context, JSTypedArrayType type, unsigned length)
{
int failed = 0;
JSValueRef exception = nullptr;
JSObjectRef typedArray;
// Test create with length.
typedArray = JSObjectMakeTypedArray(context, type, length, &exception);
failed = failed || exception || testAccess(context, typedArray, type, length);
void* ptr = calloc(length, byteSizes[type]); // This is to be freed by data
JSObjectRef data = JSObjectMakeArrayBufferWithBytesNoCopy(context, ptr, length * byteSizes[type], freePtr, nullptr, &exception);
failed = failed || exception;
// Test create with existing ptr.
typedArray = JSObjectMakeTypedArrayWithBytesNoCopy(context, type, ptr, length * byteSizes[type], id, nullptr, &exception);
failed = failed || exception || testAccess(context, typedArray, type, length, ptr);
// Test create with existing ArrayBuffer.
typedArray = JSObjectMakeTypedArrayWithArrayBuffer(context, type, data, &exception);
failed = failed || exception || testAccess(context, typedArray, type, length, ptr, data);
// Test create with existing ArrayBuffer and offset.
typedArray = JSObjectMakeTypedArrayWithArrayBufferAndOffset(context, type, data, 0, length, &exception);
failed = failed || exception || testAccess(context, typedArray, type, length, ptr, data);
typedArray = JSObjectMakeTypedArrayWithArrayBufferAndOffset(context, type, data, byteSizes[type], length-1, &exception);
if (!length)
failed = failed || !exception;
else
failed = failed || testAccess(context, typedArray, type, length-1, ptr, data, byteSizes[type]) || exception;
exception = nullptr;
typedArray = JSObjectMakeTypedArrayWithArrayBufferAndOffset(context, type, data, byteSizes[type], 3, &exception);
if (length < 2)
failed = failed || !exception;
else
failed = failed || testAccess(context, typedArray, type, 3, ptr, data, byteSizes[type]) || exception;
if (byteSizes[type] > 1) {
exception = nullptr;
typedArray = JSObjectMakeTypedArrayWithArrayBufferAndOffset(context, type, data, 1, length-1, &exception);
failed = failed || !exception;
}
typedArray = JSObjectMakeTypedArrayWithArrayBufferAndOffset(context, type, data, byteSizes[type], length, &exception);
failed = failed || !exception;
exception = nullptr;
typedArray = JSObjectMakeTypedArrayWithArrayBufferAndOffset(context, type, data, byteSizes[type], 0, &exception);
if (!length)
failed = failed || !exception;
else
failed = failed || testAccess(context, typedArray, type, 0, ptr, data, byteSizes[type]) || exception;
return failed;
}
template <typename Functor>
static int forEachTypedArrayType(const Functor& functor)
{
int failed = 0;
for (unsigned i = 0; i < kJSTypedArrayTypeArrayBuffer; i++)
failed = failed || functor(static_cast<JSTypedArrayType>(i));
return failed;
}
int testTypedArrayCAPI()
{
int failed = 0;
JSGlobalContextRef context = JSGlobalContextCreate(nullptr);
failed = failed || forEachTypedArrayType([&](JSTypedArrayType type) {
int failed = 0;
for (unsigned i = 0; i < numLengths; i++)
failed = failed || testConstructors(context, type, lengths[i]);
return failed;
});
// Test making a typedArray from scratch length.
volatile JSObjectRef typedArray = JSObjectMakeTypedArray(context, kJSTypedArrayTypeUint32Array, 10, nullptr);
JSObjectRef data = JSObjectGetTypedArrayBuffer(context, typedArray, nullptr);
unsigned* buffer = static_cast<unsigned*>(JSObjectGetArrayBufferBytesPtr(context, data, nullptr));
ASSERT(JSObjectGetTypedArrayLength(context, typedArray, nullptr) == 10);
// Test buffer is connected to typedArray.
buffer[1] = 1;
JSValueRef v = JSObjectGetPropertyAtIndex(context, typedArray, 1, nullptr);
failed = failed || assertEqualsAsNumber(context, v, 1);
// Test passing a buffer from a new array to an old array
typedArray = JSObjectMakeTypedArrayWithBytesNoCopy(context, kJSTypedArrayTypeUint32Array, buffer, 40, id, nullptr, nullptr);
buffer = static_cast<unsigned*>(JSObjectGetTypedArrayBytesPtr(context, typedArray, nullptr));
ASSERT(buffer[1] == 1);
buffer[1] = 20;
ASSERT(((unsigned*)JSObjectGetArrayBufferBytesPtr(context, data, nullptr))[1] == 20);
// Test constructing with data and the data returned are the same even with an offset.
typedArray = JSObjectMakeTypedArrayWithArrayBufferAndOffset(context, kJSTypedArrayTypeUint32Array, data, 4, 9, nullptr);
failed = failed || assertEqualsAsNumber(context, JSObjectGetPropertyAtIndex(context, typedArray, 0, nullptr), 20);
ASSERT(data == JSObjectGetTypedArrayBuffer(context, typedArray, nullptr));
// Test attempting to allocate an array too big for memory.
forEachTypedArrayType([&](JSTypedArrayType type) {
JSValueRef exception = nullptr;
JSObjectMakeTypedArray(context, type, UINT_MAX, &exception);
return !exception;
});
JSGlobalContextRelease(context);
if (!failed)
printf("PASS: Typed Array C API Tests.\n");
else
printf("FAIL: Some Typed Array C API Tests failed.\n");
return failed;
}
| {
"pile_set_name": "Github"
} |
It’s hard to get into the world of the Internet of Things (IoT) without eventually talking about Digital Twins. I was first exposed to the concept of Digital Twins when working with GE. Great concept. But are Digital Twins only relevant to physical machines such as wind turbines, jet engines, and locomotives? What can we learn about the concept of digital twins that we can apply more broadly – to other physical entities (like contracts and agreements) and even humans?
What Is a Digital Twin?A Digital Twin is a digital representation of an industrial asset that enables companies to better understand and predict the performance of their machines, find new revenue streams, and change the way their business operates[1].
GE uses the concept of Digital Twins to create a digital replica of their physical product (e.g., wind turbine, jet engine, locomotive) that captures the asset’s detailed history (from design to build to maintenance to retirement/salvage) that can be mined to provide actionable insights into the product’s operations, maintenance and performance.
The Digital Twin concept seems to work for any entity around which there is ongoing activity or “life”; that is, there is a continuous flow of new information about that entity that can constantly update the condition or “state” of that entity.
The Digital Twin concept is so powerful that it would be a shame to not apply the concept beyond just physical products. So let’s try to apply the Digital Twin concept to another type of common physical entity – contracts or agreements.
Applying Digital Twins to ContractsMany contracts and agreements have a life of their own; they are not just static entities. Many contracts (e.g., warranties, health insurance, automobile insurance, car rental agreements, construction contracts, apartment rental agreements, leasing agreements, personal loans, line of credit, maintenance contracts) once established, have a stream of ongoing interactions, changes, enhancements, additions, enforcements and filings. In fact, the very process of establishing a contract can constitute many interactions with exchanges of information (negotiations) that shape the coverage, agreement, responsibilities and expectations of the contract.
Let’s take a simple home insurance contract. Once the contract is established, there is a steady stream of interactions and enhancements to that contract including:
Payments
Addendums
Claims filings
Changes in terms and conditions
Changes in coverage
Changes in deductibles
Each of these engagements changes the nature of the contract including its value and potential liabilities. The insurance contract looks like a Digital Twin of the physical property for which it insures given the cumulative history of the interactions with and around that contract.
Expanding upon the house insurance contract as a living entity, the insurance company might want to gather other data about the property in order to increase the value of the contract while reducing the contract’s risks, liabilities and obligations. Other data sources that the insurance company might want to integrate with the house insurance contract could include:
Changes in the value of the home (as measured by Zillow and others)
Changes in the value of the nearby homes
Changes in local crime
Changes in local traffic
Changes in the credentials and quality of local schools
Quality of nearby parks
Changes in zoning (the value and liabilities of a house could change if someone constructs a mall nearby)
Changes in utilities (a house with lots of grass might not be as attractive as the price of water starts to increase)
If the goal of the insurance company holding the home insurance policy is to 1) maximize the value of that policy while 2) reducing any potential costs, liabilities and obligations, then creating a Digital Twin via a home insurance contract seems like a smart economic move.
Applying Digital Twins to Humans“Big Data is not about big data; it’s about getting down to the individual!”
One of the keys to data monetization is to understand the behaviors and tendencies of each individual including consumers, students, teachers, patients, doctors, nurses, engineers, technicians, agents, brokers, store managers, baristas, clerks, and athletes. In order to better serve your customers, you need to capture and quantify each individual customer’s preferences, behaviors, tendencies, inclinations, interests, passions, associations and affiliations in the form of actionable insights (such as propensity scores). See Figure 3.
Figure 3: Big Data About Insights at Level of the Individual
These actionable insights can be captured in an Analytic Profile for re-use across a number of use cases including customer acquisition, retention, cross-sell/up-selling, fraud reduction, money laundering, advocacy development and likelihood to recommend (see Figure 3).
SummaryGE uses the concept of Digital Twins to create a digital replica of a physical product that captures the asset’s detailed history (from design to build to maintenance to retirement/salvage) that can be mined to provide actionable insights into the product’s operations, maintenance and performance.
That same Digital Twins concept can be applied to contracts and agreements in order to increase the value of those contracts while minimizing any potential risks and liabilities. And the Digital Twins concept can also be applied to humans in order to better monetize the individual human (customers) across the organization’s value creation process.
As a CTO within Dell EMC’s 2,000+ person consulting organization, he works with organizations to identify where and how to start their big data journeys. He’s written white papers, is an avid blogger and is a frequent speaker on the use of Big Data and data science to power an organization’s key business initiatives. He is a University of San Francisco School of Management (SOM) Executive Fellow where he teaches the “Big Data MBA” course. Bill also just completed a research paper on “Determining The Economic Value of Data”. Onalytica recently ranked Bill as #4 Big Data Influencer worldwide.
Bill has over three decades of experience in data warehousing, BI and analytics. Bill authored the Vision Workshop methodology that links an organization’s strategic business initiatives with their supporting data and analytic requirements. Bill serves on the City of San Jose’s Technology Innovation Board, and on the faculties of The Data Warehouse Institute and Strata.
Previously, Bill was vice president of Analytics at Yahoo where he was responsible for the development of Yahoo’s Advertiser and Website analytics products, including the delivery of “actionable insights” through a holistic user experience. Before that, Bill oversaw the Analytic Applications business unit at Business Objects, including the development, marketing and sales of their industry-defining analytic applications.
Bill holds a Masters Business Administration from University of Iowa and a Bachelor of Science degree in Mathematics, Computer Science and Business Administration from Coe College.
Artificial intelligence (AI) is the intelligence of machines and the branch of computer science which aims to create it. Major AI textbooks define the field as "the study and design of intelligent agents," where an intelligent agent is a system that perceives its environment and takes actions which maximize its chances of success. John McCarthy, who coined the term in 1956,defines it as "the science and engineering of making intelligent machines." The field was founded on the claim that a central property of human beings, intelligence—the sapience of Homo sapiens—can be so precisely described that it can be simulated by a machine.
Cloud Expo
Cloud Computing & All That
It Touches In One Location Cloud Computing - Big Data - Internet of Things
SDDC - WebRTC - DevOps
Cloud computing is become a norm within enterprise IT.
The competition among public cloud providers is red hot, private cloud continues to grab increasing shares of IT budgets, and hybrid cloud strategies are beginning to conquer the enterprise IT world.
Big Data is driving dramatic leaps in resource requirements and capabilities, and now the Internet of Things promises an exponential leap in the size of the Internet and Worldwide Web.
The world of SDX now encompasses Software-Defined Data Centers (SDDCs) as the technology world prepares for the Zettabyte Age.
Add the key topics of WebRTC and DevOps into the mix, and you have three days of pure cloud computing that you simply cannot miss.
Delegates will leave Cloud Expo with dramatically increased understanding the entire scope of the entire cloud computing spectrum from storage to security.
Cloud Expo - the world's most established event - offers a vast selection of 130+ technical and strategic Industry Keynotes, General Sessions, Breakout Sessions, and signature Power Panels. The exhibition floor features 100+ exhibitors offering specific solutions and comprehensive strategies. The floor also features two Demo Theaters that give delegates the opportunity to get even closer to the technology they want to see and the people who offer it.
Attend Cloud Expo. Craft your own custom experience. Learn the latest from the world's best technologists. Find the vendors you want and put them to the test. | {
"pile_set_name": "Pile-CC"
} |
Emma White
Emma White may refer to:
Emma White (singer/songwriter) (born 1988), American singer-songwriter, EmmaWhiteMusic.com
Emma White (cyclist) (born 1997), American racing cyclist
Emma White (gymnast) (born 1990), British artistic gymnast | {
"pile_set_name": "Wikipedia (en)"
} |
A man from Whitechapel in East London has changed his Facebook avatar to a picture of Roger Moore as ‘The Saint’ after noticing that the octagenarian star was looking a bit frail.
Jed Kelly, 58, told us: “I noticed Roger was looking a bit two bob on the telly the other day, so I’ve changed my avatar in case he pegs out at some point in the not too distant future. I mean to say, it pays to be on the safe side doesn’t it? I don’t want to get caught out like I was when Grizzly Adams snuffed it.”
Mr Kelly, unemployed, has changed his avatar to a pic of a dead celebrity 157 times since he opened his account in 2001. “I’ve paid my respects to the lot,” he told us. “Mr Spock, David Bowie, Lemmy out of…
A thousand apologies for my tardy response dear boy. I’m afraid I was run over and killed by a steam roller in Gran Canaria. I’m now working as a tan-coloured doormat in an old people’s home. It’s what my mother would have wanted. | {
"pile_set_name": "Pile-CC"
} |
Frequency of potential azole drug-drug interactions and consequences of potential fluconazole drug interactions.
To assess the frequency of potential azole-drug interactions and consequences of interactions between fluconazole and other drugs in routine inpatient care. We performed a retrospective cohort study of hospitalized patients treated for systemic fungal infections with an oral or intravenous azole medication between July 1997 and June 2001 in a tertiary care hospital. We recorded the concomitant use of medications known to interact with azole antifungals and measured the frequency of potential azole drug interactions, which we considered to be present when both drugs were given together. We then performed a chart review on a random sample of admissions in which patients were exposed to a potential moderate or major drug interaction with fluconazole. The list of azole-interacting medications and the severity of interaction were derived from the DRUGDEX System and Drug Interaction Facts. Among the 4,185 admissions in which azole agents (fluconazole, itraconazole or ketoconazole) were given, 2,941 (70.3%) admissions experienced potential azole-drug interactions, which included 2,716 (92.3%) admissions experiencing potential fluconazole interactions. The most frequent interactions with potential moderate to major severity were co-administration of fluconazole with prednisone (25.3%), midazolam (17.5%), warfarin (14.7%), methylprednisolone (14.1%), cyclosporine (10.7%) and nifedipine (10.1%). Charts were reviewed for 199 admissions in which patients were exposed to potential fluconazole drug interactions. While four adverse drug events (ADEs) caused by fluconazole were found, none was felt to be caused by a drug-drug interaction (DDI), although in one instance fluconazole may have contributed. Potential fluconazole drug interactions were very frequent among hospitalized patients on systemic azole antifungal therapy, but they had few apparent clinical consequences. | {
"pile_set_name": "PubMed Abstracts"
} |
Is the city of Columbus, Ohio playing dirty tricks on Donald Trump?
Less than 24 hours ago, Columbus Mayor Andrew Ginther campaigned with Hillary Clinton during a visit to the city.
He even got a shout out from the candidate herself, with Clinton telling the crowd she was happy to be in his capital city, according to her speech posted on YouTube (17:35).
Ginther posted this photo on his Facebook page, clearly pleased to be aiding Clinton:
“Are you ready to build a future that includes everyone in America?” Ginther said, warming up the crowd, according to the Post-Gazette.
“We are so honored to have such a great outpouring of support for Secretary Clinton in the most important city in the most important state in America. I need a partner in the White House that can deliver.”
Today, Ginther seemingly delivered for Clinton.
The city of Columbus restricted the capacity of Donald Trump’s crowd, leaving a lot of people unable to get inside.
“Hey, maybe they’re a Hillary person,” Trump speculated about city leaders — quite accurately — according to Politico. “Could that be possible? Probably. I don’t think there are too many of them.”
The Columbus Convention Center only allowed 1,000 people inside, despite the cavernous space.
“So have 1,000 people in there. They won’t allow any more,” Trump said. “The fire marshal said he’s not allowed to allow any more even though the building holds many thousands of people. So I just wanted to tell you that. That’s politics at its lowest. You ought to check it out, but it’s really politics at its lowest.”
The fire marshal blamed construction for blocking exits as the reason for the restricted crowd size.
But the mayor? He was probably out campaigning for Hillary again. | {
"pile_set_name": "OpenWebText2"
} |
Two reports describe major new iOS 13 and macOS 10.15 features - pseudolus
https://arstechnica.com/gadgets/2019/04/two-reports-describe-major-new-ios-13-and-macos-10-15-features/
======
xs83
At what point will Apple start innovating again rather than playing catch up?
I can think of only a couple of truly useful and unique things they have on
their phones currently: iMessage and Airdrop.
Meanwhile you have companies like Google & Huawei leveraging both cloud and
on-device AI to improve things like Camera ability and battery life.
~~~
blub
And a modicum of privacy and protection for the scummiest developers which
Android will never have.
| {
"pile_set_name": "HackerNews"
} |
Q:
Count Based on 2 date Ranges for 2 different columns
Having an issue writing a report.
I am trying to count on the number of enquiries Issued and passed, they both have a datetime field
The problem im having is the results are coming back incorrect.
Running this code gives me 126 for passed
SELECT COUNT(*) AS Passed FROM BPS.dbo.tbl_Profile AS p
Inner Join BPS.dbo.tbl_Profile_Mortgage AS pm
ON p.Id = pm.FK_ProfileId
WHERE p.CaseTypeId IN (1,2,9,15) AND CONVERT(DATE,pm.DatePassed,103) BETWEEN @Start AND @End
When i run the issued query I get 223
SELECT COUNT(*) AS Issued FROM BPS.dbo.tbl_Profile AS p
Inner Join BPS.dbo.tbl_Profile_Mortgage AS pm
ON p.Id = pm.FK_ProfileId
WHERE p.CaseTypeId IN (1,2,9,15) AND CONVERT(DATE,pm.DateAppIssued,103) BETWEEN @Start AND @End
These figures are correct so i put it in one query like so.
SELECT COUNT(pm.DateAppIssued) AS Issued,COUNT(pm.DatePassed) AS Passed FROM BPS.dbo.tbl_Profile AS p
Inner Join BPS.dbo.tbl_Profile_Mortgage AS pm
ON p.Id = pm.FK_ProfileId
WHERE p.CaseTypeId IN (1,2,9,15)
AND (CONVERT(DATE,pm.DateAppIssued,103) BETWEEN @Start AND @End
OR CONVERT(DATE,pm.DatePassed,103) BETWEEN @Start AND @End)
This gives me Issued 265 and passed 185
I have tried many different variation but still cant get the correct figures
I hope i have explained this well enough, any help would be much appreciated.
Rusty
A:
Because you have the both the conditions in the where clause with an or condition, you are seeing a different result. Use them in the aggregation itself.
SELECT
COUNT(case when CONVERT(DATE,pm.DateAppIssued,103) BETWEEN @Start AND @End then 1 end) AS Issued,
COUNT(case when CONVERT(DATE,pm.DatePassed,103) BETWEEN @Start AND @End then 1 end) AS Passed
FROM BPS.dbo.tbl_Profile AS p
Inner Join BPS.dbo.tbl_Profile_Mortgage AS pm ON p.Id = pm.FK_ProfileId
WHERE p.CaseTypeId IN (1,2,9,15)
| {
"pile_set_name": "StackExchange"
} |
Tag: Prince Harry
Two years of marriage in and the rest of a lifetime to go for Meghan Markle and Prince Harry.
The famous pair officially rang in their second wedding anniversary on Wednesday while fans recalled their world-famous nuptials inside St. George’s Chapel at Windsor Castle on that picturesque day in May 2018.
And, as royal enthusiasts well know, a lot has happened since the two officially tied the knot and became husband and wife, notably their first child, Archie Harrison, and more recently, their headline-making exit from life as senior royals.
The family of three has since relocated to Calif., reportedly staying in a mansion owned by Tyler Perry. While it’s unclear whether they’re guests or renting the property for the time-being, the two have been keeping a low profile in recent months—particularly after retiring their @SussexRoyal Instagram account in late March—save for occasional glimpses of their ongoing virtual work with their patronages and charitable endeavors.
Considering the nature of life right now amid the coronavirus pandemic, it’s no surprise the couple kept their anniversary celebrations fuss-free.
“They are just powering down,” a royal insider told E! News. “No calls, no Zoom meetings, no work. Just hanging out as a family. Keeping things simple.”
However, that doesn’t mean their anniversary went without gifts.
David Fisher/Shutterstock
“They generally follow traditional anniversary gift giving,” a source shared. “The second year is cotton and they each put their own spin on it. They are very thoughtful and romantic gift givers.”
Cotton material is said to symbolize both comfort and strength and inspires the metaphor of married pairs becoming more woven together over time.
The couple commemorated their first wedding anniversary publicly last year by sharing never-before-seen photos of their milestone day.
“Thank you for all of the love and support from so many of you around the world,” they said in a joint statement on Instagram at the time. “Each of you made this day even more meaningful.”
Prince William and Kate Middleton change their names on social media accounts – and it's praised by fans
“This year, they both gave each other gifts based on cotton,” the insider told People.
“Undoubtedly, it was a very creative and romantic gesture as all their gifts are to one another.
“They love to do their own take on traditional wedding gifts,” the insider added.
Archie's best moments as Prince Harry and Meghan celebrate his first birthday
“The first anniversary was paper, and Meghan wrote out the wedding speech and had it framed for him.”
According to wedding lifestyle website The Knot, cotton represents how close and interconnected a married couple will be in the beginning of their marriage and demonstrates how husbands and wives can become more flexible as they grow.
Paper, meanwhile, represents the fragile beginnings of a marriage, but, if protected, can survive for “a lifetime”.
It comes after reports that the couple are living in a £14.5million home owned by producer and actor Tyler Perry in Los Angeles.
The eight bedroom house in Beverly Hills is owned by Diary Of A Mad Black Woman star Tyler Perry and is believed to cost $18million.
Although Harry and Meghan have never been seen with Tyler, they are thought to have connected with him through their mutual friend Oprah Winfrey.
Read More
Prince Harry and Meghan Markle
Prince Harry and Meghan Markle 'took…
Meghan Markle 'baked strawberries an…
Loose Women stars slam Meghan Markle…
Prince Harry feels 'rudderless' afte…
A source said: "Meghan and Harry have been extremely cautious to keep their base in LA under wraps.
"Their team helped them choose the location for their transition to Los Angeles wisely.
Inside Meghan Markle and Prince Harry's £14.7m LA house they are rumoured to be staying in owned by Tyler Perry
Meghan Markle and Prince Harry set to face huge challenge that'll put their marriage to the test
"Beverly Ridge has its own guarded gate and Tyler's property has a gate of its own which is watched by their security team.
"Beverly Ridge is an excellent place to keep out of view. The neighbours are mostly old money and mega rich business types rather than show business gossips.
"It goes without saying that the location is stunning – just one of the most beautiful and desirable areas in LA," the insider continued to tell Daily Mail TV.
The Duke and Duchess of Sussex have just marked their second wedding anniversary and if last year is anything to go by, Prince Harry was in for a sweet surprise from wife Meghan.
Much was said last year about Harry’s gift to his wife – an eternity ring – but Meghan’s gift was kept a secret, until now.
Prince Harry and Meghan celebrated their second wedding anniversary in Los Angeles
According to PEOPLE, Meghan, who has impeccable handwriting and was once a freelance calligrapher, wrote out their wedding speech and framed it for Harry – what a way to mark their paper wedding anniversary!
Last year was definitely an anniversary to remember, not only was it their first but just weeks before they had welcomed their first child into the world – Archie Harrison.
To mark his birth and their anniversary, Harry gifted Meghan an eternity ring, which she first wore when introducing their son to the world in Windsor Castle.
The couple introduced their first child to the world weeks before their first anniversary
New mum Meghan wore her sparkling accessory next to her Welsh gold wedding band and her three-stone diamond engagement ring.
Eternity rings symbolize everlasting love and are usually given by a spouse to their wife to commemorate a milestone wedding anniversary or to celebrate the welcoming of a new child. The ring is also typically covered in diamonds in an infinite loop around the band.
This year, the pair celebrated their seconf wedding anniversary in Los Angeles, where they are self-isolating with Archie since moving there from Canada in mid-March. The couple are residing at a £15million mansion owned by Tyler Perry in the Beverly Ridge Estate of LA and have been given small sneak peek’s inside.
Most recently, Harry and Meghan showed off one of the mansion’s rooms during a video call with the Crisis Text Line team. Attendee Ricky Neil shared a picture on Instagram of the call and it showed Meghan and Harry sitting next to each other with two large black lamps visible from behind. A large painting could also be seen, as well as wooden panelling on the walls.
Prince Harry and Meghan Markle are thought to be living in luxury inside the Beverly Hills mega-mansion owned by film tycoon Tyler Perry.
It was reported recently that the couple, who relocated to Los Angeles when they stepped down from senior royal duties, have been staying in the Tuscan-style villa that is worth £14.7m ($18m).
Along with eight bedrooms and 12 bathrooms, a glimpse inside the lavish abode provided by the film studio owner's Instagram page reveals that Harry and Meghan could be enjoying such features like a sunken bath, a separate chapel, a nursery and the sweeping views of the LA skyline.
Get exclusive celebrity stories and fabulous photoshoots straight to your inbox with OK's daily newsletter. You can sign up at the top of the page.
Tyler's property sits within a 22-acre plot of land in the ultra-exclusive Beverly Ridge Estates guard-gated community.
And scrolling back through the 50-year-old's feed reveals an incredible insight into the sprawling home that Meghan, 38, and Harry, 35, may possibly have been staying during the coronavirus lockdown.
Back in 2016 when celebrating his son Aman's christening, Tyler welcomed famous faces including his pal Oprah who is his son's godmother, to his specially built chapel.
Meghan Markle's dazzling wedding day jewellery and how she may not be able to borrow from the Queen again
The ceremony took place inside the building which sits within the 22 acres of his property and is a replica of a church his mother attended as a child.
As well as that, there's an enormous pool which has stunning views of the city and surrounding hills. There's also plenty of space to host a soiree with restaurant style seating and umbrellas to protect guests from the LA sunshine.
In another snap of the view, Tyler shared a picture from a terrace area he calls the "back deck" in 2013 of storm clouds gathered above.
In the same year, the film studio owner also proved he had taste when it came to bathing in style, as he took a dip in a sunken bath.
Situated in the middle of one of the 12 bathrooms the circular basin sits in the middle with a huge chandelier hanging above.
There's also a nursery elsewhere in the property, that could be perfect as Archie's room, as it was once set up for Tyler's now 5-year-old son Aman who he shares with wife Gelila Bekele.
Tyler proudly posted about his back garden which was overflowing with flowers and greenery, overlooking LA.
And there's more than space to take his dogs on a long walk without ever leaving the property, which proves perfect for Meghan who has her two pet pooches.
Download OK! magazine's FREE app and get all the latest gossip straight to your phone
Get celebrity exclusives, at home tours, fashion and beauty news and clever cleaning hacks straight to your inbox!
Despite being in lockdown there would be plenty of space to hold a party, as Tyler proved when he invited several of his famous friends round to celebrate his 45th birthday – and had Stevie Wonder play at his piano in his living room.
Meanwhile the Duke and Duchess of Sussex have the option of several cosy nooks in Tyler's property, including a spacious room where the Diary Of A Mad Black Woman star puts up his Christmas tree.
There's the huge kitchen with a centre island that would be the ideal spot for Meghan and Harry to whip up some family dinners.
Especially as it goes largely unused by Tyler, who confessed he needed some cooking lessons when it came to making Thanksgiving dinner.
And when Meghan and Harry are making phone calls as part of their remaining duties to raise spirits during the COVID-19 pandemic, there's a study for them which boasts incredible mahogany furniture and comfy leather chairs.
Although Harry and Meghan have never been seen with Tyler and they have not confirmed they are living there, they are thought to have connected with him through their mutual friend Oprah Winfrey.
A source said: "Meghan and Harry have been extremely cautious to keep their base in LA under wraps. Their team helped them choose the location for their transition to Los Angeles wisely.
"Beverly Ridge has its own guarded gate and Tyler's property has a gate of its own which is watched by their security team. It is an excellent place to keep out of view. The neighbours are mostly old money and mega rich business types rather than show business gossips.
"It goes without saying that the location is stunning – just one of the most beautiful and desirable areas in LA," the insider continued to tell Daily Mail TV.
Meghan Markle and Prince Harry have been secretly volunteering at L.A. based charity Project Angel Food. Here’s how they’re helping the city’s most vulnerable during the COVID-19 pandemic.
On Wednesday, April 15, Prince Harry and Meghan Markle stepped out to deliver meals — and a smile — to some Los Angeles residents living with critical illnesses. But it wasn’t the first time they’ve volunteered at Project Angel Food, a non-profit charity that cooks, prepares and delivers meals to people in need.
“The Duke and Duchess wanted to be of service on Easter, and they decided to volunteer at Project Angel Food and give our drivers a break that day,” Richard Ayoub, Project Angel Food’s executive director, told HollywoodLife EXCLUSIVELY. “They loved the experience so much that they came back on Wednesday, and did more deliveries.”
“I think their whole goal was to be of service,” Richard explained to HL. “That was their main goal, their secondary goal was to relieve our drivers of some of their workload, because our drivers delivered to 50 to 60, people a day. Ant their third goal was to hopefully give someone a smile.”
Richard, who was there to give Meghan and Harry the tour, called the couple “totally down to earth” and told HL that it was all a big surprise. “It was very surprising and really pretty spectacular that this is the first organization, not only in L.A., but in the United States, that they wanted to work with, and that happened to be Project Angel Food.”
“I greeted them on Easter Sunday. It’s the best Easter Sunday I’ve ever had. And I gave them a tour of the kitchen. And they talked to our chefs. And they were very, very highly engaged. They asked questions, they asked about the meal production, about the medically tailored meals, about how many we do a week, who are the clients, and what are they going through. And then they talked to chefs and asked the chefs how long they had worked with us. They were really spectacular.”
“One of the first questions I asked them, before we went into the kitchen, was how would you like to be referred to as Duke and Duchess? And they immediately interrupted me and said no, as Harry and Meghan.”
Not only were they interested in learning all about the charity, they were also very hands on. “They drove in their own vehicle,” Richard told HL. “They took our food, a week’s worth of food delivered to each client. And they also took non perishable food, because we’re delivering it to every client, just in case of emergency and we can’t get to them, that they have food.”
“I think that Meghan wants to show Harry L.A. through the eyes of philanthropy and through the eyes of Project Angel Food. They really are concerned about vulnerable people. You know, especially with COVID. Our clients are the ones who are most prone to get the virus. And if they get it. They may die because most are over the age of 60, and they have heart disease, lung disease, diabetes. And Meghan and Harry, they were really interested in meeting the clients and talking to them and seeing how they were doing.”
Although Meghan was already familiar with Project Angel Food, Richard told HL that it was her mother, Doria Ragland, that suggested they help out at the highly respected charity. “Meghan says that because she lived in L.A. she knew about Project Angel Food. And they wanted to do something to volunteer on Easter, and she was talking to her mother and her mother said Project Angel Food needs help.”
Richard told HL that helping out during COVID-19 is a big concern for the couple. “They really care about people and about making the world a better place. And COVID is going on, and so, I think they thought Project Angel Food takes care of these people, let’s go see some of them. And they were really impressed with the gratitude that they received on behalf of Project Angel Food, people were just gushing about how this service is so important to them right now.
“When they came to see us they didn’t take any pictures or do anything for publicity. I think they just did it because those are the kinds of people they are, that’s what they do. Harry’s whole life has been service and that’s just who they are.”
Although Meghan and Harry didn’t bring their 11-month-old son, Archie Harrison Mountbatten Windsor, along for their volunteering, as soon as they were done they back to playing with there beloved baby. “After Easter they called me and said well we did all our deliveries and we’re gonna go play with Archie now,” Richard told HL.
Since it’s inception in 1989, Project Angel Food as served over 12 million meals to more than 20,000 people. But with COVID-19 the need is even greater. “Right now we’re feeding 1,600 people a day but we are going to be adding 400 more people this month,” Richard told HL, “so we’re really in need of donations right now.”
This website uses cookies to improve your user experience and to provide you with advertisements that are relevant to your interests. By continuing to browse the site you are agreeing to our use of cookies.Ok | {
"pile_set_name": "Pile-CC"
} |
This application claims the benefit of Korean Application No. 2000-46938, filed Aug. 14, 2000, the disclosure of which is hereby incorporated herein by reference.
The present invention relates to semiconductor devices, and more particularly, to duty cycle correction circuits.
Recently, the speed of semiconductor memory devices, for example, dynamic random access memories (DRAMs), has increased to improve the performance of existing systems. However, increasing demand for improved systems may require DRAMs that can process even more data at even higher speeds. Accordingly, synchronous dynamic random access memories (SDRAMs) that operate in synchronization with system clocks have been developed for a high-speed operation, thus significantly increasing data transmission speeds.
There are limitations on the amount of data that may be input to and/or output from a memory device per clock cycle of a system clock. To address these limitations, dual data rate (DDR) SDRAMs have been recently developed in order to further increase the transmission speed of data. DDR SDRAMS input and/or output data in synchronization with both the rising edge and the falling edge of a clock.
Reliable data transmission is possible when the duty cycle of a clock signal is equivalent at 50%, which is ideal, in a DDR SDRAM or a direct rambus dynamic random access memory (RDRAM). Thus, when a signal having a duty cycle that is not equivalent, i.e. greater than or less than 50%, is provided as an input, the signal typically does not perform very well as an input signal. Duty cycle correction circuits have been developed to address this problem.
A block diagram of a conventional duty cycle correction circuit is illustrated in FIG. 1. A duty cycle correction circuit includes a duty cycle corrector 10 and a detection circuit 13. The duty cycle corrector 10 generates a pair of complementary input signals IN and INB, from which distortion is typically removed, in response to first and second complementary clock signals CLK and CLKB, having distortion resulting from nonequivalent duty cycles. The detection circuit 13 feeds back first and second detection signals DETECT and DETECTB obtained by detecting distortion in the duty cycles of the complementary pair of input signals IN and INB of the correction circuit 10 in response to the pair of complementary input signals IN and INB.
Now referring to FIG. 2, a circuit diagram of a conventional detection circuit 13 of FIG. 1 will be discussed. When mismatching exists among diode-connected loads M1 and M4, cross-coupled loads M2 and M3, source coupled pairs M5 and M6, and/or the respective transistors in the detection circuit 13, increased distortion may occur in the duty cycles of the pair of complementary input signals IN and INB due to mismatching of the respective transistors, even though less distortion is present in the duty cycles of the complementary pair of clock signals CLK and CLKB.
Semiconductor devices according to embodiments of the present invention include a duty cycle correction circuit having a duty cycle corrector and a detection circuit. The duty cycle corrector generates a first input signal having a second duty cycle with a higher degree of equivalence than the first duty cycle in response to a first detection signal and a first control signal having a first duty cycle. The detection circuit generates the first detection signal in response to the first input signal. The detection circuit includes a current source having first and second current sources and a bias circuit that is electrically coupled to the first and second current sources and controls a bias of the first and the second current sources responsive to the first input signal.
In some embodiments of the present invention, the duty cycle corrector further generates a second input signal having a fourth duty cycle with a higher degree of equivalence than the third duty cycle in response to a second detection signal and a second control signal having a third duty cycle. The detection circuit, in other embodiments of the present invention, further generates the second detection signal in response to the second input signal.
In further embodiments of the present invention, the duty cycle correction circuit includes a load matching circuit that is electrically coupled to the first and second current sources and matches a load of the bias circuit in response to the second input signal.
In still further embodiments of the present invention, the first control signal is a true clock signal and the second control signal is a complementary clock signal. Furthermore, the first and second input signals are complementary signals and the first and second detection signals are complementary signals.
In some embodiments of the present invention, the duty cycle correction circuit further includes a first output driver circuit that pulls the first detection signal up or down in response to the first input signal and a second output driver circuit that pulls a second detection signal up or down in response to a second input signal. The current generated by the current source is supplied to the first output driver circuit, the second output driver circuit and the bias circuit responsive to a bias voltage. The bias voltage may be a voltage at a first node during a period and is calculated according to the equation VNODB+VNODCxe2x88x92VDDxe2x88x92GND. VNODB is the voltage at a second node, VNODC is the voltage at a third node, VDD is a source voltage, and GND is a ground voltage. | {
"pile_set_name": "USPTO Backgrounds"
} |
Q:
Akka Stream test flow when Supervision.Resume implemented
I recently implemented an akka-stream flow which parse some json messages, validate the presence of a given key (destination_region) and pass to the next stage a case class containing the original message and the destination_region string.
I implemented a custom decider so that in case it face any parsing or key error, it will trigger Supervision.Resume after logging the exception.
A minimalistic implementation would look like:
package com.example.stages
import com.example.helpers.EitherHelpers._
/*
import scala.concurrent.Future
import scala.util.{Failure, Success, Try}
object EitherHelpers {
implicit class ErrorEither[L <: Throwable, R](val either: Either[L, R]) extends AnyVal {
def asFuture: Future[R] = either.fold(Future.failed, Future.successful)
def asTry: Try[R] = either.fold(Failure.apply, Success.apply)
}
}
*/
import scala.concurrent.ExecutionContext
import akka.NotUsed
import akka.stream.scaladsl.Flow
import akka.stream.ActorAttributes.supervisionStrategy
import akka.stream.Supervision
import software.amazon.awssdk.services.sqs.model.Message
import io.circe.parser.parse
import io.circe.{DecodingFailure, ParsingFailure}
object MessageContentValidationFlow {
def apply()(
implicit executionContext: ExecutionContext): Flow[Message, MessageWithRegion, NotUsed] = {
val customDecider: Supervision.Decider = {
case e @ (_: DecodingFailure | _: ParsingFailure) => {
println(e)
Supervision.Resume
}
case _ => Supervision.Stop
}
Flow[Message]
.mapAsync[MessageWithRegion](2) { message =>
println(s"Received message: $message")
val messageWithRegion = for {
parsed <- parse(message.body()).asFuture
region <- parsed.hcursor.downField("destination_region").as[String].asFuture
} yield { MessageWithRegion(message, region) }
messageWithRegion
}
.withAttributes(supervisionStrategy(customDecider))
}
}
case class MessageWithRegion(message: Message, region: String)
I managed to test the case where the message is valid, however I have not clue about how to test the flow in case of ParsingFailure or DecodingFailure. I have tried almost all methods available for sub in the implementation below:
package com.example.stages
import akka.actor.ActorSystem
import akka.stream.ActorMaterializer
import akka.stream.scaladsl.Keep
import akka.stream.testkit.scaladsl.{TestSink, TestSource}
import io.circe.generic.JsonCodec, io.circe.syntax._
import io.circe.generic.auto._
import software.amazon.awssdk.services.sqs.model.Message
import org.scalatest.FlatSpec
@JsonCodec case class MessageBody(destination_region: String)
class MessageContentValidationFlowSpecs extends FlatSpec {
implicit val system = ActorSystem("MessageContentValidationFlow")
implicit val materializer = ActorMaterializer()
implicit val executionContext = system.dispatcher
val (pub, sub) = TestSource.probe[Message]
.via(MessageContentValidationFlow())
.toMat(TestSink.probe[MessageWithRegion])(Keep.both)
.run()
"MessageContentValidationFlow" should "process valid messages" in {
val validRegion = "eu-west-1"
val msgBody = MessageBody(validRegion).asJson.toString()
val validMessage = Message.builder().body(msgBody).build()
sub.request(n = 1)
pub.sendNext(validMessage)
val expectedMessageWithRegion = MessageWithRegion(
message = validMessage,
region = validRegion
)
assert(sub.requestNext() == expectedMessageWithRegion)
}
ignore should "trigger Supervision.Resume with empty messages" in {
val emptyMessage = Message.builder().body("").build()
assert(emptyMessage.body() == "")
sub.request(n = 1)
pub.sendNext(emptyMessage)
sub.expectComplete()
}
}
Does anyone know how to test that Supervision.Resume was triggered and which exception was caught by the custom decider?
A:
Since Supervision.Resume drops erroneous elements and continues processing the stream, one way to test that supervision strategy is to run a stream that contains a mix of "good" and "bad" elements and confirm whether the materialized value consists of only the "good" elements. For example:
import akka.actor._
import akka.stream._
import akka.stream.scaladsl._
import org.scalatest._
import scala.concurrent._
import scala.concurrent.duration._
class MyTest extends FlatSpec with Matchers {
implicit val system = ActorSystem("MyTest")
implicit val materializer = ActorMaterializer()
val resumingFlow = Flow[Int].map {
case 2 => throw new RuntimeException("bad number")
case i => i
}.withAttributes(ActorAttributes.supervisionStrategy(Supervision.resumingDecider))
"resumingFlow" should "drop the number 2" in {
val result: collection.immutable.Seq[Int] =
Await.result(Source((1 to 5).toSeq).via(resumingFlow).runWith(Sink.seq), 5.seconds)
result should be (List(1, 3, 4, 5))
}
}
In your case, create a stream that has valid Message objects and at least one invalid Message object.
| {
"pile_set_name": "StackExchange"
} |
Q:
Grails 3 change default service scope
In grails 3, the default service scope is Singleton, the documents show it's easy to override this by defining
static scope='request'
in the service class. Is it possible to change the default service scope for an application similar to the way it is done for controllers in application.groovy?
The specific issue is a Service class in a plugin is calling application services (which are designed around request scope). This was working in grails 2, but with the upgrade to grails 3 it no longer does.
A:
Is it possible to change the default scope for an application similar
to the way it is done for controllers in application.groovy?
There is no direct support for that, no. You could write a bean definition post processor that could impose that change.
| {
"pile_set_name": "StackExchange"
} |
Background {#Sec1}
==========
Hemangioblastomas (HB) are highly vascular tumors, which account for approximately 3 % of all tumors of the central nervous system (CNS) \[[@CR1]\]. It occurs in a subset of CNS locations, including the cerebellum (37 %), brainstem (10 %), and spinal cord (50 %) \[[@CR1]\]. They are classed as grade one tumors under the World Health Organization\'s classification system. While most of these tumors are low grade and benign, some hemangioblastomas can present aggressive and occasionally malignant behavior. Hemangioblastomas occur as sporadic tumors (75 %) or as a manifestation of an autosomal dominantly inherited disorder, von Hippel-Lindau (VHL) disease (25 %) \[[@CR2]\].
VHL hemangioblastomas are most commonly caused by germline exon deletions or truncating mutations \[[@CR3]\] of the Von Hippel-Lindau *(VHL*) tumor-suppressor gene. The VHL protein, which is the critical part of a ubiquitin ligase protein complex that binds to the hypoxia-inducing factors HIF-1 and HIF-2 transcription factors and targets them for ubiquitination and proteosomal degradation. Dysregulation of this VHL-associated function causes increased expression of a variety of growth factors, including erythropoietin, PDGF, VEGF and TGF. Upregulation of these factors may lead to angiogenesis and tumorigenesis. Additional mechanisms of tumorigenesis have been described outside of the HIF pathway, including alterations in microtubule binding and stabilization, abnormal extracellular matrix composition as well as apoptosis and transcription regulation \[[@CR4]\]. For most VHL disease related hemangioblastomas, the inactivation or loss of both alleles of the VHL gene is required. In addition to the phenotypic variability associated with allelic heterogeneity, genetic modifiers may influence the phenotypic expression of VHL disease. Allelic variants in the *CCND1, MMP1* and *MMP3* genes have been reported to influence hemangioblastoma development \[[@CR5]\]. This reiterates the need for elucidating other genetic alterations specific for hemangioblastoma beside the hits of *VHL* gene. Moreover, in a subset of tumors including mostly sporadic hemangioblastomas, the genetic pathways involved in tumorigenesis have not been defined yet \[[@CR6]\].
Copy number variants (CNVs) are alterations of DNA sections in result of genomic deletions (fewer than the normal number) or duplications (more than the normal number) on certain chromosomes and are common to many human cancers. Comparative genomic hybridization (CGH) by single nucleotide polymorphism (SNP) arrays is a cutting edge technology that allows characterization of CNVs. SNP array karyotyping provides genome-wide assessment of copy number and loss of heterozygosity (LOH) in one assay. SNP array platforms, such as Affymetrix SNP 6.0 (Affymetrix, Santa Clara, CA, USA), often identify amplifications/deletions at a single gene level, which could not have been accomplished by previous methods. Thus, modern SNP arrays offer a powerful method for the discovery of oncogene and tumor suppressor gene involvement in tumors, as well as for improved cancer classification \[[@CR7]\].
In contrast to surveillance of genome wide alterations by CGH arrays it is possible to directly quantify the absolute copy number of specific DNA loci by Droplet Digital PCR (ddPCR). In ddPCR, target sequences are amplified by PCR and the reaction products are partitioned into droplets and amplified to endpoint with TaqMan probes as in qPCR, then their concentrations are determined based on the number of fluorescently positive and negative droplets in a sample well. The absolute number of target and reference DNA molecules is calculated and provides the target copy number variation (CNV) \[[@CR8]\].
In the present study we used high-resolution SNP arrays for the first time to genome wide analysis of aberrations in hemangioblastomas aiming at the identification of novel pathogenetic mechanisms and possible targets for rational therapy. We validated the main reoccurring genetic changes by ddPCR highly precise quantification.
Methods {#Sec2}
=======
Study population {#Sec3}
----------------
A total of 44 hemangioblastoma samples were used for the present study. Thirteen frozen samples obtained from The Sourasky Medical Center, Tel Aviv, Israel were used for the CGH analysis. Additional 32 formalin fixed paraffin embedded (FFPE) samples from Sheba Medical Center, Tel Hashomer, Israel were used as validation group. The study was approved by the ethical review boards of both Sheba and Tel Aviv Sourasky Medical Centers and was consistent with the declaration of Helsinki including informed consents. Clinical parameters, such as sex, age at diagnosis, and pathologic classification were collected from patient records. Clinical information of the patient's cohort is outlined in Table [1](#Tab1){ref-type="table"}.Table 1Cohort characteristicsCharacteristicFrozenParaffinAverage age48.553.5Median age5153Spinal samples43Brain samples829Total number1232
CGH analysis {#Sec4}
------------
DNA was purified from frozen tissues using DNeasy (Qiagen Inc., Valencia, CA). One sample of pooled normal genomic DNA, provided by Affymetrix, was used as experimental positive control. 250 ng of genomic DNA was digested with *Nsp*I (New England Biolabs, Inc) and then ligated to Nsp adaptors. The adaptor-ligated DNA fragments were amplified, fragmented using DNase I, end labelled with a biotinylated nucleotide, and hybridized to a human cytoscan HD array (Affymetrix) at 50 °C for 17 h. After hybridization, the arrays were washed, stained, and finally scanned with a GeneChip scanner 3000 (Affymetrix). All procedures were performed according to the manufacturer's protocols. Array experiments were performed using the high-resolution Affymetrix CytoScan HD microarray (Affymetrix, Inc, Santa Clara, CA) containing 2,696,550 markers of which 1,953,246 are non-polymorphic markers and 750,000 SNPs with over 99 % accuracy to detect accurate breakpoint estimation as well as loss of heterozygosity (LOH) determination. This chip covers 340 International Standards for Cytogenomic Arrays (ISCA) constitutional genes, 526 cancer genes (99.6 %) and 36,121 RefSeq genes. The chip uses marker intervals of 25 markers / 100 kb. Analysis of CEL files from the Affymetrix CytoScan HD Array or Cytogenetics Whole-Genome 2.7 M Array was done with the Chromosome Analysis Suite (ChAS) software for cytogenetic analysis. Signal processing was done by Signal Covariate Adjustment, Fragment Correction, Dual Quantile Normalization and PLIER signal summarization. Dual Quantile Normalization was done to equalize each array's intensity distribution copy number and SNP probes separately. For SNP markers, multiple probes for each allele were summarized to single values. Copy number (CN) was calculated by hidden Markov model copy number segments after log2 calculation, high pass filter image correction, log2 ratio covariate adjustment and systematic residual variables removal. The baseline for CN = 2 (normal autosomal copy number state) was established and used by the analysis software by Affymetrix company using a set of 380 phenotypically normal individuals named as reference. The reference sample includes 186 females and 194 male. For chromosome X, only females were used and for chromosome Y only males were used. Log2 ratios for each marker are calculated relative to the reference signal profile. Results of the summarized Data (CYCHP files) were viewed as chromosomal aberrations in table and graphical formats. We also added visual inspection of probe performance for altered segments. Reference intensity intended to represent the copy normal state (typically 2). Log ratios above 0 mean CN gain, log ratios below 0 mean CN loss and log ratios around 0 represent no change. Abnormal DNA copy numbers are identified automatically using 25 markers for loss/50 markers for gains.
VHL sequencing {#Sec5}
--------------
To screen the *VHL* gene for mutations in our cohort, we performed direct sequencing of the coding region. Exons 1, 2 and 3 of the *VHL* gene and their immediately flanking sequences were amplified by PCR as described previously \[[@CR9]\]. The PCR amplification products were purified by using the QIAquick PCR Purification Kit (Qiagen), according to the manufacturer's instructions. The amplification primers were used as primers in the sequencing reactions, except for exon 1, for which we designed a new cycle sequencing primer (5′CGAAGATACGGAGGTCGA3′). Cycle sequencing was performed using the ABI PRISM Big Dye Terminator Cycle Sequencing Ready reaction kit (Applied Biosystems, Foster City, CA, USA), followed by isopropanol precipitation. The fragments were sequenced by automated sequencing analysis on an ABI Prism 377 sequencer (Applied Biosystems).
Droplet digital PCR {#Sec6}
-------------------
Copy Number validation was done on all samples, frozen and paraffin embedded, hemangioblastoma biopsies. Genomic DNA was purified using QIAamp DNA mini (Qiagen). Copy number variation (CNV) test was performed by droplet digital PCR (ddPCR) as previously described \[[@CR10]\]. In short, 16 ng of genomic DNA samples were added to 2xddPCR supermix (Bio-Rad) with final concentration of 500nM of each primer and 250nM probe in duplex of the tested gene and RNaseP. RNaseP served as a CNV = 2 reference gene. Probes for the tested genes contained a FAM reporter and RNaseP contained HEX. The genomic DNA and PCR reaction mixtures were partitioned into an emulsion of approximately 20,000 droplets using the QX100 droplet generator (Bio-Rad, USA). The droplets were transferred to a 96-well PCR plate, heat sealed, and placed in a conventional thermal cycler. Thermal cycling conditions were: 95oC for 10 min followed by 40 cycles of 94oC for 30 s, 60oC for 60 s and one cycle of 98oC for 10 min and finally 4oC hold. Following PCR, the plates were loaded into QX100 droplet reader (Bio-Rad) and the CNV value was calculated using Quantasoft software (Bio-Rad, USA). Primers and probes for selected areas enlisted in Table [2](#Tab2){ref-type="table"} were designed using Primer Express software (PE Corp, USA) and specificity was verified using NCBI BLAST online tool (National Library of Medicine, USA). RNaseP primers and probes were obtained from Bio-Rad.Table 2Digital PCR primers and probes for selected areasGeneOligonucleotidesSequence (5′-3′)reporter*PTPN11*Forward primerTTAGAGACAGGGTCCCACTCTTG-Reverse primerGCTTGAGGATGCAGTAAGCTATGA-ProbeCCTGGCTGGAGTGCAGTGGCGTFAM*CHECK2*Forward primerCATTTTTCTCTTAGTATCTTTCTGGGAAT-Reverse primerCATTTCTGAGCCCAGCAATACA-ProbeTCACAATCCAGGGCTACAGTAAGACCCATGFAM*PTCH1*Forward primerGCGTGCGAAGGTGGAGACT-Reverse primerTCATTGGCCTCCCACTTGA-ProbeTGTCTTCTCCCCCATGTCGGFAM*EGFR*Forward primerAGGAGGAACAACGTGGAGACA-Reverse primerGAGACACCGGAGCCACAGA-ProbeCCCAGAGGTGGAACGTTGGCCCFAM*RNaseP*Forward primerGATTTGGACCTGCGAGCG-Reverse primerGCGGCTGTCTCCACAAGT-ProbeCTGACCTGAAGGCTCTHex
Results {#Sec7}
=======
SNP array profiling identifies recurrent CNVs {#Sec8}
---------------------------------------------
The systematic genome-wide gain and loss segments based CNVs data detected by SNP profiling in hemagioblastoma is detailed in the karyoview (Fig. [1](#Fig1){ref-type="fig"}). We identified 94 CNVs with a median of 18 CNVs per sample. Twenty-three of them involved noncoding regions in centromeres that are known to harbor spurious CNVs, most of them were less than 100 Kb long, and 56 were found in at least two samples. The most frequently gained regions were on chromosomes 1 (p36.32) and 7 (p11.2). These regions contain the *PRDM16* and *EGFR* genes, respectively. Recurrent losses were located at chromosome 12 (q24.13) which includes the *PTPN11* gene. Pathway analysis revealed that *EGFR*, Notch and HedgeHog signaling were the most frequently altered pathways promoting angiogenesis and proliferation. *Mir 551a* (part of *PRDM16*) gain was detected in seven samples, *miR-196a-2* gain was observed in five samples and *miR-196b* gain was detected in four samples. The list of recurrent CNVs found in at least five specimens (Fisher exact test *p*-value \< 0.05), including type of alteration, involved chromosome, cytobands, and overlapping genes/miRNAs according to the RefSeq database is provided in Table [3](#Tab3){ref-type="table"}. Two samples had LOH affecting the *CHECK2* region (Fig. [2](#Fig2){ref-type="fig"}).Fig. 1Ideogram illustrating genome-wide distribution of DNA amplifications and deletions (copy number variation) on each chromosome. Each line next to the chromosome represents one sample. Gains in copy number are represented by triangles pointing upwards and losses in copy number are represented by triangles pointing downwards with indication of gene in that region. Chromosome numbers are indicated in boxesTable 3Frequent chromosome losses and gains involving single genesNumber of samplesTypeChromo someBandGenemiRNAGV7Gain7p11.2*EGFR*-7Gain1p36.32*PRDM16*hsa-mir-551ahsa-mir-551av7Loss12q24.13*PTPN11*-7Gain2q31.1*HOXD11, HOXD13 HOHOHOXD13 HOXD11HOXD13*v6Loss13q12.2*FLT3*-6Gain9q22.32*PTCH*v5Loss8p11.22*FGFR1*-5Loss3p13*FOXP1*-5GainXq26.2*GPC3*-5Gain12q13.13*HOXC13, HOXC11*hsa-mir-196a-2v5Loss22q13.1*MKL1*v5Loss22q12.1*CHEK2*vThe column "Number of samples" represents the number of patients with a particular genomic abnormality. For each variation the type of variation (gain or loss), location on chromosome and band, the gene located in this locus and miRNAs located in this locus are enlisted. Variants reported in the Database of Genomic Variants (DGV) database in genes are denoted as "v" and if none reported as "-" under the column DGVFig. 2*CHECK2* copy number state. *CHECK2* locus is labeled by centrally located data track with dashed line. The data point scores form a trinomial distribution about the values 2, 0 and −2, where values around 0 represent heterozygous SNPs, while homozygous SNPs have a value of approximately 2 or −2. LOH is located on genomic region with a scarcity of heterozygous SNP calls. **a** Sample 6 and (**b**) Sample 13 exhibit LOH of *CHECK2* region, (**c**) The control sample exhibits normal copy number state
VHL status {#Sec9}
----------
We determined the *VHL* mutation status of our discovery cohort by both DNA sequencing and results from the CGH arrays. In two of the thirteen frozen samples (samples 7 and 10) *VHL* deletions were detected by our CGH analyses. The deletion in sample 7 encompassed 332 kb with 564 markers. The deletion in sample 10 was shorter (135 kb) with 344 markers. Figure [3](#Fig3){ref-type="fig"} illustrates the smooth signal obtained in chromosome band 3p25.3 for these samples. Sequencing based mutational analysis of *VHL* did not reveal any additional mutations. Samples 7 and 10 incurred CNVs similarly to the other samples. The average number of CMVs in the other samples was seven. Sample 7 had 14 of the common CNVs thus had more than the average CNVs but sample 10 had less CNVs (six) which is similar to the average.Fig. 3VHL locus (Ch.3 p25.3) deletion data display. The smooth signal derived from the raw data is displayed. The smooth signal value is calculated using the intensity values of the flanking probes and the data is displayed by a continuous line which is filled down to the x axis. Focusing on VHL locus was done by selecting the specific region of the chromosome and zooming in such that this region spans the entire x-axis. The data points containing the probe values are overlaid on the graph. Smooth signal value can be between zero or four depending on the Log(2) ratio raw values of the surrounding probes. **a** Sample 7 and (**b**) Sample ten smooth signal is one exhibiting deletion in *VHL* locus (labeled with dashed line). Probes around the area are normal (around 2)
CNV validation by digital droplet PCR {#Sec10}
-------------------------------------
We validated our findings in a subset of four genes (*EGFR, CHECK2, PTCH1* and *PTPN11*) in the discovery cohort used for the array CGH and in an additional independent set of 32 FFPE specimens, using copy variation detection by digital droplet PCR (ddPCR) analysis. Samples were partitioned into thousands of nanoliter-sized droplets; single template molecules were amplified on a thermocycler, and counted for fluorescent signal. Absolute copy numbers of target and reference sequences were determined by Poisson algorithms \[[@CR8]\]. The RNase P (Ribonuclease P) amplicon maps within the single exon *RPPH1* gene on 14q11.2 was used as the standard reference assay for copy number analysis \[[@CR11]\]. Validation results were as follows: *EGFR* amplification was detected in 29 of 32 patient samples (Fig. [4](#Fig4){ref-type="fig"}), *PTCH1* was amplified in 18 of 32 patients (Fig. [5](#Fig5){ref-type="fig"}) and *CHEK2* was deleted in 27 of 32 (Fig. [6](#Fig6){ref-type="fig"}). Surprisingly, *PTPN11* was deleted in 7/32 whilst it was amplified in 17/32 specimens (Fig. [7](#Fig7){ref-type="fig"}).Fig. 4*EGFR* Copy number variation (CNV) values for clinical samples and one normal genomic DNA sample. Genomic DNA copy number alterations were assessed via ddPCR. The CNV is shown as the number of copies and the Poisson distribution at 95 % confidence interval. The copy number value of normal diploid sequence has a score of two. Copy number above two means amplification in that region and copy number below two means deletion in that regionFig. 5*PTCH1* Copy number variation (CNV) values for clinical samples and one normal genomic DNA sample. Genomic DNA copy number alterations were assessed via ddPCR. The CNV is shown as the number of copies and the Poisson distribution at 95 % confidence interval. The copy number value of normal diploid sequence has a score of two. Copy number above two means amplification in that region and copy number below two means deletion in that regionFig. 6*CHEK2* Copy number variation (CNV) values for clinical samples and one normal genomic DNA sample. Genomic DNA copy number alterations were assessed via ddPCR. The CNV is shown as the number of copies and the Poisson distribution at 95 % confidence interval. The copy number value of normal diploid sequence has a score of two. Copy number above two means amplification in that region and copy number below two means deletion in that regionFig. 7*PTPN11* Copy number variation (CNV) values for clinical samples and one normal genomic DNA sample. Genomic DNA copy number alterations were assessed via ddPCR. The CNV is shown as the number of copies and the Poisson distribution at 95 % confidence interval. The copy number value of normal diploid sequence has a score of two. Copy number above two means amplification in that region and copy number below two means deletion in that region
It is important to note that in result of normal cell admixture within tumor samples a high CNV means either high fraction of tumor cells with relatively high copy number in each cell or low fraction of tumor cells with very high copy number in each cell. Likewise, low CNV means either high fraction of tumor cells with relatively low copy number in each cell or low fraction of tumor cells with relatively very low copy number in each cell. In short if the fraction of tumor cells is low then the relative copy number (both high and low CNV) is even higher than what is reported. In our cohort, histopathologic assessment by a pathologist determined that 47 percent of samples had more than 95 % tumor, 7 percent had more than 90 % tumor, 29 percent of samples had more than 70--80 % tumor, 14 percent of samples had between 50--70 % tumor and 3 percent had between 40--50 % tumor.
Discussion {#Sec11}
==========
We report here for the first time a genome-wide, high-resolution systematic analysis of chromosomal changes in hemangioblastoma. Using the SNP array 6 (Affymetrix) we analyzed 1.8 million genetic markers genome wide to identify amplifications/deletions up to single gene level. We identified a total of 94 CNVs, 23 of them involved noncoding regions. 56 (31 gains and 25 losses) were found in at least two specimens. The most frequently gained regions were on chromosomes 1 (p36.32) and 7 (p11.2). The most frequently deleted region was on chromosome 12 (q24.13).
Our findings provide the first high-resolution genome-wide view of chromosomal changes in hemangioblastoma and identify 23 common, ie found in 4 or more patients, candidate genes for hemangioblastoma pathogenesis (Table [3](#Tab3){ref-type="table"}): *EGFR, PRDM16, PTPN11, HOXD11, HOXD13, FLT3, PTCH, FGFR1, FOXP1, GPC3, HOXC13, HOXC11, MKL1, CHEK2, IRF4, GPHN, IKZF1, RB1, HOXA9, HOXA11* and several microRNA, including *hsa-mir-196a-2*. We note that some of these microalterations have been reported very rarely previously in tissue samples from healthy subjects (according to Database of Genome Variants (DGV), which are reported in Table [3](#Tab3){ref-type="table"}. However, in our tumor samples these alterations are significantly more common (p \< 0.00001).
Functional annotation analysis by David \[[@CR12]\] reviled that two pathways are prominently affected in the hemangioblastoma samples: the cell proliferation and angiogenesis promoting pathways. The cell proliferation pathway includes the following genes: *CHEK2, EGFR, FGFR, FLT3* and *PTCH1*. The angiogenesis pathway includes the genes *EGFR* and *FGFR*, which are significant because they are also involved in blood vessel formation. Importantly, three of these genes were verified by ddPCR: *EGFR, CHEK2* and *PTCH1*. Furthermore, *PTPN11* was selected for verification as it was lost strikingly often (Table [3](#Tab3){ref-type="table"}).
Epidermal growth factor receptor (*EGFR*) is a tyrosine kinase receptor that has been documented with increased expression in a variety of human cancers such as breast cancer, \[[@CR13]\], early stage non-small-cell lung cancers and gliomas \[[@CR14], [@CR15]\]. Our findings are in line with three prior immunohistochemical studies that found *EGFR* overexpression in hemangioblastomas \[[@CR16]\] \[[@CR17]\] \[[@CR18]\]. Fibroblast growth factor receptor 1 (*FGFR1*) micro deletions have been reported in myeloid and lymphoid neoplasms \[[@CR19]\]. Interestingly we discovered that the *FGFR1* deletion involves the FGFR1 2nd intron (chromosome 8, 38291333--38314367), which according to UCSC genome browser hg19 includes a regulatory site. Checkpoint kinase 2 (*CHEK2*) has been implicated in DNA repair, cell cycle arrest, and apoptosis in response to DNA double-strand breaks \[[@CR20]\]. Mutations in *CHEK2* have been reported to be possibly associated with breast cancer and liposarcoma development \[[@CR21], [@CR22]\]. The protein patched homolog 1 (*PTCH1*) is a sonic hedgehog receptor. Loss of function mutations in *PTCH1* are associated with development of various types of cancers, including medulloblastoma \[[@CR23], [@CR24]\], pancreatic cancer \[[@CR25]\] and colorectal cancer \[[@CR26]\]. In contrast to these observations, we find consistent *PTCH1* gains in our cohort of hemangioblastoma patients (Table [3](#Tab3){ref-type="table"}). In support of our findings there are reports of *PTCH1* also acting as an oncogene in a mouse model of skin basal cell carcinomas \[[@CR27]\].
FMS-like tyrosine kinase 3 (*FLT3*) plays a role in hematopoiesis including early hematologic differentiation and early B and T-cell development \[[@CR28]\] and dendritic cells differentiation \[[@CR29]\]. Activating *FLT3* mutations are some of the most common molecular abnormalities in acute myeloid leukemia (AML) \[[@CR30]\]. Interestingly, in our data, we find losses of *FLT3* (Table [3](#Tab3){ref-type="table"}). Consistent with our findings, others have reported deletions in *FLT3* in AML as well \[[@CR31]\] \[[@CR32]\]. Among the altered genes mapped in many of the recurrently gained regions we recognized several *HOX* genes (Table [3](#Tab3){ref-type="table"}) and microRNAs (miRNAs) residing in the same region. *HOX* genes encode master transcription factors important in development and have been reported to be commonly altered in human solid tumors \[[@CR33]\]. On the other hand, miRNAs are small regulatory RNAs that have recently been implicated in a variety of cancers \[[@CR34]\]. miR-196a-2 and miR-196b gain were the most common miRNA CNV in our patients. Interestingly, miR-196a-2 differs from miR-196b by one nucleotide \[[@CR35]\]. The miR-196 gene family is located in the regions of homeobox (*HOX*) transcription factors that are essential for embryogenesis. Up-regulation of miR-196a has been found in breast cancer, adenocarcinoma, leukemia and esophageal adenocarcinoma \[[@CR35]\]. Accordingly the relevant causative change may actually be altered miRNA expression rather than *HOX* gene expression. Other studies have reported a 12-fold increase in miR-9 and a 15-fold decrease of miR-200a in hemangioblastomas distinguishing hemangioblastomas from metastatic clear cell renal cell carcinomas in the CNS \[[@CR36]\]. *Prdm16* is preferentially expressed by stem cells throughout the nervous and haematopoietic systems and promotes stem cell maintenance \[[@CR37]\]. Megakaryoblastic leukemia protein-1 (*MKL1*), is a transcription factor that regulates many processes, including remodeling of neuronal networks and epithelial-mesenchymal transition \[[@CR38]\]. Moreover, deregulation by genetic alterations and/or altered *MKL1* transcription has been shown to have role in myeloproliferative neoplasms \[[@CR39]\]. Finally and most interestingly, protein tyrosine phosphatase, non-receptor type 11 *(PTPN11*) gene encodes the tyrosine phosphatase SHP2 protein required for RTK signaling and has a role in survival, proliferation and differentiation \[[@CR40]\]. The fact that we find the *PTPN11* gene is deleted in some hemangioblastoma patients and is amplified in others may suggest that these tumors actually originate from different cellular lineages. In fact, we found that spinal tumors were overwhelmingly deleted in the *PTPN11* region: 5 of 7 spinal tumors were deleted whilst 1 was amplified and 1 was chromosomally normal at this locus. In contrast, cerebellar hemangioblastomas were generally amplified: 16 out 37 were indeed amplified. However, 10 cerebellar tumors were deleted and 11 of 37 were normal in this genomic region. Interestingly, differential overexpression or deletion of *PTPN11* has been shown in other tumors. For example, mutations in *PTPN11* has been reported to be associated with development of Juvenile Myelomonocytic Leukemia (JMML) \[[@CR41]\], acute myeloblastic leukemia (AML) \[[@CR42]\], and acute lymphoblastic leukemia (ALL) \[[@CR43]\]. Overexpression in gastric carcinomas has been reported \[[@CR44]\]. In contrast, *PTPN11* has a tumor-suppressor function in liver \[[@CR45]\] and cartilage \[[@CR46]\]. Accordingly, decreased *PTPN11* expression was detected in a subfraction of human hepatocellular carcinoma specimens \[[@CR45]\]. Thus, in contrast to its common pro-oncogenic role in hematopoietic and epithelial cells, *PTPN11* may act as a tumor suppressor in cartilage. Accordingly, we hypothesize that the *PTPN11* gene may act in a cell-specific manner: as a tumor suppressor on one hand in the progenitor cells of spinal hemangioblastomas, whilst it acts as an oncogene in the cells of origin of cerebellar hemangioblastoma tumors.
Previous analysis of six VHL-related CNS hemangioblastomas showed loss of chromosome 3p or the whole of chromosome 3 to be the most common abnormality, which is detected in 70 % and loss of 1p11-p31 in 10 % \[[@CR47]\]. More relevant to our findings, published CGH studies on 10 sporadic cerebellar hemangioblastomas detected losses of chromosomes 3 (70 %), 6 (50 %), 9 (30 %), and 18q (30 %) and a gain of chromosome 19 (30 %) \[[@CR48]\]. We indeed detected losses and gains in these areas but they were not frequent (15-20 %). Chromosome 3 losses were more abundant, mostly on p13 (5 samples *FOXP1*) and p25 (3 samples showed *PPARG* loss and 2 samples showed *VHL* loss). Interestingly, *FOXP1* transcription factor, located on chromosome 3(p13), can function as a tumor suppressor gene. Low expression in glioma \[[@CR49]\] and Hodgkin lymphoma has been shown \[[@CR50]\]. Differences in methodology, sample size and definition of aberration inclusion criteria may account for some of the apparent inconsistencies between previous studies and our findings. For example, previous results were obtained from VHL-related hemangioblastomas using techniques that identify deletions that are larger than 2 Mb. In the current study we used modern CGH microarrays which scan the DNA every 1 kb and thus we were able to identify very subtle genomic changes. One of the most striking observations in our study is that many CNVs affected single genes (Table [3](#Tab3){ref-type="table"}) and revealed candidate genes, which have not been implicated in hemangioblastomas. This represents an important outcome of this study compared with previous investigations using CGH. Some of the new genes identified here as affected by CNVs in hemangioblastoma may serve as targets for future precisely targeted anti- cancer therapy. For example, antiangiogenic therapy can be given to patients with lesions that are not resectable.
Conclusions {#Sec12}
===========
In this study, we have demonstrated in two different tumor cohorts and using two different techniques for copy number alteration detection, SNP and digital PCR, that *Chek2* is deleted and *EGFR*, *PTPN11, Ptch1* amplified in majority of hemangioblastoma patients. EGFR is the only gene that has been previously reported as a candidate gene with hemangioblastoma. Independent of HB tumor location *PTPN11* may act as tumor suppressor or oncogene depending on the tumor cell of origin. These findings have potentially relevant clinical value, as this the first high resolution for chromosomal alteration in HB. Future research should be dedicated to the prospective validation of these alterations and further characterization of tumors that carry the deletions/amplifications, as well as of defining the role of these genes. This may offer insights into hemangioblastoma biology, provide DNA-based markers that can be analyzed by FISH suitable for routine clinical applications and eventually lead to the development of effective targeted therapies for HB.
CNVs
: Copy number variations
HB
: Hemangioblastomas
CNS
: Central nervous system
VHL
: von Hippel-Lindau
CGH
: Comparative genomic hybridization
SNP
: Single nucleotide polymorphism
LOH
: Loss of heterozygosity
ddPCR
: Droplet Digital PCR
CNV
: Copy number variation
FFPE
: Formalin Fixed Paraffin Embedded
RNase P
: Ribonuclease P
*EGFR*
: Epidermal growth factor receptor
*FGFR*
: Fibroblast growth factor receptor 1
*CHEK2*
: Checkpoint kinase 2
*PTCH1*
: Protein patched homolog 1
*FLT3*
: FMS-like tyrosine kinase 3
AML
: Acute myeloid leukemia
miRNA
: microRNA
*MKL1*
: Megakaryoblastic leukemia protein-1
PTPN11
: protein tyrosine phosphatase non-receptor type 11
Michal Yalon, Shlomi Constantini and Amos Toren contributed equally to this work.
**Competing interests**
The authors declare that they have no competing interest.
**Authors' contributions**
RMS conceived, designed and coordinated the study, performed the CGH analysis and drafted the manuscript, IM carried out the droplet digital PCR experiments, IB and DN participated in collecting the FFPE samples, JJ and CD carried out the CGH experiments, JR provided advice and revised the manuscript, MY, SC and AT participated in collecting the frozen samples, designing and coordinating of the study. All authors read and approved the final manuscript.
This research was funded by The Sheba Medical Research fund. We thank Sarah South, PhD, University of Utah, for insightful remarks on Affymetrix CGH analysis.
| {
"pile_set_name": "PubMed Central"
} |
South Korean ladies' soccer dynamo Park Eun-Seon is good at her sport. Real good. Like, man good. At least, according to a cabal of her fellow women's soccer league players, who have threatened to stop playing unless the league subjects Park to a humiliating gender test and releases the results to the public. »11/08/13 3:10pm 11/08/13 3:10pm | {
"pile_set_name": "Pile-CC"
} |
Q:
JPanel does not fill containing JFrame
Hi so I'm writing an simple physics engine to understand object collisions and Java graphics a bit better, and so far I have successfully written the code to add the JPanel to the JFrame and allow them to show up somewhat the correct size, but when I view the actually program, the JPanel seems tobe the right size but it does not start in the upper corner of the window, but rather the upper left of the frame. I seem to have this problem alot where I want something to be at (0, 0) and starts in the upper corner of the frame rather than the panel. Here is my code:
I have an engine class that extends JFrame and contains the main method -->
package io.shparki.PhysicsEngine;
import java.awt.BorderLayout;
import java.awt.Dimension;
import java.awt.Toolkit;
import javax.swing.JFrame;
public class Engine extends JFrame{
public Engine(){
super("Physics Engine and Simulator");
setLayout(new BorderLayout());
add(new EnginePanel(), BorderLayout.CENTER);
pack();
setResizable(false);
setLocationRelativeTo(null);
setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE);
setVisible(true);
}
public static void main(String[] args){
new Engine();
}
}
and this is my second class, the EnginePanel which extends JPanel and implements Runnable -->
package io.shparki.PhysicsEngine;
import java.awt.Color;
import java.awt.Dimension;
import java.awt.Font;
import java.awt.Graphics;
import java.awt.Graphics2D;
import java.awt.Image;
import java.awt.Point;
import java.awt.Toolkit;
import javax.swing.JPanel;
public class EnginePanel extends JPanel implements Runnable{
private static final int WIDTH = 300;
private static final int HEIGHT = WIDTH / 16 * 9;
private static final int SCALE = 4;
public int getWidth() { return WIDTH * SCALE; }
public int getHeight() { return HEIGHT * SCALE; }
@Override
public Dimension getPreferredSize(){ return new Dimension(WIDTH * SCALE, HEIGHT * SCALE); }
private static final int FPS = 85;
private static final int PERIOD = 1000 / FPS;
private int currentFPS = 0;
private Thread animator;
private boolean running = false;
private Graphics dbg;
private Image dbImage = null;
public EnginePanel(){
setMinimumSize(new Dimension(WIDTH * SCALE, HEIGHT * SCALE));
setMaximumSize(new Dimension(WIDTH * SCALE, HEIGHT * SCALE));
setPreferredSize(new Dimension(WIDTH * SCALE, HEIGHT * SCALE));
setVisible(true);
}
public void addNotify(){
super.addNotify();
startEngine();
}
public void startEngine(){
running = true;
animator = new Thread(this, "Animator");
animator.start();
}
public void stopEngine(){
running = false;
}
public void paintComponent(Graphics g){
super.paintComponent(g);
if (dbImage != null){
g.drawImage(dbImage, 0, 0, null);
}
}
public void paintScreen(){
Graphics g;
try{
g = this.getGraphics();
if ( g != null && dbImage != null){
g.drawImage(dbImage, 0, 0, null);
}
Toolkit.getDefaultToolkit().sync();
g.dispose();
} catch(Exception ex) { System.out.println("Graphics Context Error : " + ex); }
}
public void run(){
running = true;
init();
Long beforeTime, timeDiff, sleepTime;
while(running){
beforeTime = System.currentTimeMillis();
updateEngine();
renderEngine();
paintScreen();
timeDiff = System.currentTimeMillis() - beforeTime;
sleepTime = PERIOD - timeDiff;
if (sleepTime <= 0){
sleepTime = 5L;
}
currentFPS = (int) (1000 / (sleepTime + timeDiff));
try{
Thread.sleep(sleepTime);
} catch (InterruptedException ex) { ex.printStackTrace(); }
}
}
private TextField FPSTextField;
public void init(){
FPSTextField = new TextField("Currnet FPS: " + currentFPS, 25, 25);
}
public void updateEngine(){
FPSTextField.setText("Currnet FPS: " + currentFPS);
}
public void renderEngine(){
if (dbImage == null){
dbImage = createImage((int)getWidth(), (int)getHeight());
if (dbImage == null){
System.out.println("Graphical Context Error : DBImage is Null");
return;
} else {
dbg = dbImage.getGraphics();
}
}
Graphics2D g2d = (Graphics2D) dbg;
g2d.setColor(Color.BLACK);
g2d.fillRect(0, 0, getWidth(), getHeight());
FPSTextField.render(g2d, Color.MAGENTA);
}
}
I'm not quite sure why this keeps happening and I have searched for help but can not find the answer. Thanks in advance for all who help :)
EDIT: Added code for the TextField object:
package io.shparki.PhysicsEngine;
import java.awt.Color;
import java.awt.Font;
import java.awt.Graphics;
import java.awt.Graphics2D;
import java.awt.Point;
public class TextField{
private Point location;
public Point getLocation(){ return location; }
public double getX() { return location.getX(); }
public double getY() { return location.getY(); }
private String text;
public void setText(String text) { this.text = text; }
public String getText() { return this.text; }
public TextField(String text, int x, int y){
this.location = new Point(x, y);
this.text = text;
}
public TextField(String text, Point location){
this.location = location;
this.text = text;
}
public void render(Graphics g){
g.drawString(text, (int)location.getX(), (int)location.getY());
}
public void render(Graphics2D g2d){
g2d.drawString(text, (int)location.getX(), (int)location.getY());
}
public void render(Graphics g, Color color){
g.setColor(color);
g.drawString(text, (int)location.getX(), (int)location.getY());
}
public void render(Graphics2D g2d, Color color){
g2d.setColor(color);
g2d.drawString(text, (int)location.getX(), (int)location.getY());
}
public void render(Graphics g, Color color, Font font){
g.setColor(color);
g.setFont(font);
g.drawString(text, (int)location.getX(), (int)location.getY());
}
public void render(Graphics2D g2d, Color color, Font font){
g2d.setColor(color);
g2d.setFont(font);
g2d.drawString(text, (int)location.getX(), (int)location.getY());
}
}
A:
The preferred size of the JPanel EnginePanel restricts the panel from being resized the JFrame is rendered non-resizable. Invoke JFrame#pack after calling setResizable(false). Also move setLocationRelativeTo after pack so that the frame appears centered.
pack();
setLocationRelativeTo(null);
setVisible(true);
| {
"pile_set_name": "StackExchange"
} |
Q:
Rally Rest Api C# ToolKit
I am trying to use the C# toolkit for RallyRest API. I want to display the number of user stories for each release, and the number of tasks by a team. The hierarchical requirement request doesn't return all the data.
Moreover, how can I filter the data based on a particular release and the owner of the User story? Below is my code. Can you please suggest where I should look? I saw the API.
RallyRestApi restApi = new RallyRestApi(username, password, "https://rally1.rallydev.com", "1.40");
bool projectScopingUp = false;
bool projectScopingDown = true;
try
{
Request storyRequest = new Request("HierarchicalRequirement");
storyRequest.Workspace = workspaceRef;
storyRequest.Project = projectRef;
storyRequest.ProjectScopeUp = projectScopingUp;
storyRequest.ProjectScopeDown = projectScopingDown;
storyRequest.Fetch = new List<string>()
{
"Name",
"FormattedID",
"Project",
"Release",
"ScheduleState",
"State",
"Owner",
"Tasks"
};
QueryResult queryStoryResults = restApi.Query(storyRequest);
int totalUS = 0;
foreach (var s in queryStoryResults.Results)
{
if (s["Release"] != null)
{
Release = s["Release"]["Name"];
string word = "July 2014";
if (Release.Equals(word))
{
string tempOwner = s["Owner"]["_refObjectName"];
if (tempOwner.Contains("development")
{
Owner = s["Owner"]["_refObjectName"];
paragraph.AddFormattedText("ID : " + Id + " Name : " + Name + " Owner : " + Owner + "Release :" + Release + "Number of Tasks : " + count, TextFormat.NotBold);
}
}
}
}
A:
Here is an example that filters stories by a particular release and story owner. It also gets the Tasks collection on each story and hydrates it with a separate request.
static void Main(string[] args)
{
int storyCount = 0;
int taskCount = 0;
RallyRestApi restApi;
restApi = new RallyRestApi("[email protected]", "secret", "https://rally1.rallydev.com", "v2.0");
String workspaceRef = "/workspace/1234"; //replace this OID with an OID of your workspace
Request sRequest = new Request("HierarchicalRequirement");
sRequest.Workspace = workspaceRef;
sRequest.Fetch = new List<string>() { "FormattedID", "Name", "Tasks", "Release", "Project", "Owner" };
sRequest.Query = new Query("Release.Name", Query.Operator.Equals, "r1").And(new Query("Owner", Query.Operator.Equals, "[email protected]"));
QueryResult queryResults = restApi.Query(sRequest);
foreach (var s in queryResults.Results)
{
Console.WriteLine("FormattedID: " + s["FormattedID"] + " Name: " + s["Name"] + " Release: " + s["Release"]._refObjectName + " Project: " + s["Project"]._refObjectName + " Owner: " + s["Owner"]._refObjectName);
storyCount++;
Request tasksRequest = new Request(s["Tasks"]);
QueryResult queryTaskResult = restApi.Query(tasksRequest);
foreach (var t in queryTaskResult.Results)
{
Console.WriteLine("Task: " + t["FormattedID"] + " State: " + t["State"]);
taskCount++;
}
}
Console.WriteLine(storyCount + " stories, "+ taskCount + " tasks ");
}
I noticed you are using 1.40 of WS API which is no longer supported. If you have older code it has to be re-factored to work with v2.0. In v2.0 it is not possible to hydrate the collection in the same request. There are many examples on StackOverflow rally tag on this subject, e.g. here Download latest dll for the toolkit here.
| {
"pile_set_name": "StackExchange"
} |
The subject matter disclosed herein generally relates to an aircraft deicing system, and more particularly, to a deicing system for a rotor blade of a rotary wing aircraft.
Rotary wing aircrafts may encounter atmospheric conditions that cause the formation of ice on rotor blades and other surfaces of the aircraft. Accumulated ice, if not removed can add weight to the aircraft and may alter the airfoil configuration, causing undesirable flying characteristics.
A common approach to ice management is thermal deicing. Thermal deicing includes heating portions of the rotor blades, such as the leading edge for example, to loosen accumulated ice. Centrifugal forces acting on the rotor blades, and the airstream passing there over, remove the loosened ice from the rotor blades. Desired portions of the rotor blades are typically heated using electro thermal heating elements arranged at the leading edges of the airfoils, in direct contact with the blade spar. As a result of this direct contact, a malfunction of the electro thermal heating elements, such as by overheating or shorting for example, may damage the spar thereby affecting the structural stability and/or the airfoil of the rotor blade. | {
"pile_set_name": "USPTO Backgrounds"
} |
Stylonurella
Stylonurella is a genus of prehistoric eurypterid. It is classified within the Parastylonuridae family and contains three species, S. arnoldi and S. beecheri from the Devonian of Pennsylvania, United States and S. spinipes from the Silurian of Kip Burn, Scotland.
Description
Stylonurella was a small stylonuroid, possessing a subquadrate prosoma with approximately the same length as width. The midsection was slightly constricted and the eyes were parallel and anteriorly located in the anterior half of the carapace. The metastoma and first two appendages are unknown, the third and fourth prosomal legs are very short and the last two walking legs are very long. The metasoma is very narrow.
Classification
Though one of the earliest described stylonurines, described shortly after the description of Stylonurus itself, it has no close relations to that genus. Indeed, there are numerous and apparent differences. For instance, the eyes of Stylonurus are located on the posterior half of the carapace and those of Stylonurella are on the anterior half. Furthermore, there are noticeable differences between Stylonurella and its closest relative, Parastylonurus, for instance the widely different shapes of the carapaces (quadrate in Stylonurella and subrounded in Parastylonurus).
Species
Stylonurella contains three valid species, with other named species now seen as invalid or as part of other genera.
Stylonurella? arnoldi Ehlers, 1935 - Pennsylvania, USA (Devonian)
Stylonurella? beecheri Hall, 1884 - Pennsylvania, USA (Devonian)
Stylonurella spinipes Page, 1859 - Kip Burn, Scotland (Silurian)
Invalid or reassigned species are listed below:
"Stylonurella" logani Woodward, 1872 - Kip Burn, Scotland (Silurian), synonym of S. spinipes.
"Stylonurella" modestus Clarke & Ruedemann, 1912 - New York, USA (Ordovician), a pseudofossil.
"Stylonurella" otisius Clarke, 1907 - Eastern USA (Silurian), reclassified as a species of Clarkeipterus.
"Stylonurella" ruedemanni Størmer, 1934 - Ringerike, Norway (Silurian), reclassified as a species of Kiaeropterus.
See also
List of eurypterids
References
Category:Stylonuroidea
Category:Silurian arthropods of Europe
Category:Silurian eurypterids
Category:Eurypterids of Europe
Category:Devonian eurypterids
Category:Eurypterids of North America | {
"pile_set_name": "Wikipedia (en)"
} |
Opinion
From the critics
Community Activity
Comment
Sweet story of a janitor who used to sing doo-wop back in the "oldie-but-goodie" days collecting all the shy kids together and teaching them to sing, perform, and find their own music in the everyday. So lovely! | {
"pile_set_name": "Pile-CC"
} |
396 primarily to supply hamburgers for the burger
This is the end of the preview. Sign up
to
access the rest of the document.
Unformatted text preview: s in a state where they have few political allies. Bruce L. Braley, one
of the attorneys in Ferrell v. IBP, told me a great deal about the company’s behavior and sent me stacks of documents pertaining to the case.
“Killing Them Softly: Work in Meatpacking Plants and What It Does to Workers,” by Donald D. Stull and Michael J. Broadway, in Any Way
You Cut It, is one of the best published accounts of America’s most dangerous job. “Here’s the Beef: Underreporting of Injuries, OSHA’s
Policy of Exempting Companies from Programmed Inspections Based on Injury Record, and Unsafe Conditions in the Meatpacking Industry,”
Forty-Second Report by the Committee on Government Operations (Washington, D.C.: U.S. Government Printing Office, 1988), shows the
extraordinary abuses that can occur when an industry is allowed to regulate itself. After the congressional investigation, Christopher Drew
wrote a terrific series of articles on meatpacking, published by the Chicago Tribune in October o...
View Full
Document | {
"pile_set_name": "Pile-CC"
} |
Ian Watson (author)
Ian Watson (born 20 April 1943) is a British science fiction writer. He lives in Gijón, Spain.
Life
In 1959 Watson worked as an accounts clerk at Runciman's, a Newcastle shipping company. The experience was not particularly satisfying.
Watson graduated in English Literature from Balliol College, Oxford, in 1963; in 1965 he earned a research degree in English and French 19th-century literature.
Watson lectured English in Tanzania (1965–67) and Tokyo (1967–70), and taught Future Studies at the Birmingham Polytechnic from 1970 to 1976. After 1976 he devoted himself to his career as a professional writer.
His first novel, The Embedding, winner of the Prix Apollo in 1975, is unusual for being based on ideas from generative grammar; the title refers to the process of center embedding. A prolific writer, he has also written the novels Miracle Visitors, God's World, The Jonah Kit and The Flies of Memory and many collections of short stories. Watson is credited as author of the screen story for the motion picture A.I. Artificial Intelligence. In 1977, The Jonah Kit won the BSFA Award for Best Novel.
During 1980, Watson and Michael Bishop wrote the first transatlantic SF novel collaboration, Under Heaven's Bridge, using typewriters and postal services.
He has also written a series of novels relating to the Warhammer 40,000 line of games: Space Marine, and the Inquisition War trilogy of Inquisitor, Harlequin and Chaos Child (republished in 2002 by The Black Library, with Inquisitor retitled Draco). Other recent stories have been published in US magazine Weird Tales, the Canadian anthology Lust For Life, New Writings in the Fantastic, the Mammoth Book of Best New Erotica volume 7, and in a few more books. Some of these stories have been translated into non-English languages.
A collaboration with Italian surrealist writer Roberto Quaglia has produced a book, The Beloved of My Beloved, launched during April 2009 during Eastercon.
His major work of recent years is The Waters of Destiny co-written with Andy West.
Bibliography
Novels
The Jonah Kit. London: Gollancz, 1975.
Orgasmachine. Paris: Editions Champ Libre, 1976.
The Martian Inca. London: Gollancz, 1977.
Alien Embassy. London: Gollancz, 1977.
Miracle Visitors. London: Gollancz, 1978.
God's World. London, Gollancz, 1979.
The Gardens of Delight. London: Gollancz, 1980.
Deathhunter. London: Gollancz, 1981.
Under Heaven's Bridge, with Michael Bishop. London: Gollancz, 1982.
Chekov's Journey. London: Gollancz, 1983.
Converts. London: Granada, 1984 (paper).
The Books of the Black Current:
The Book of the River. London: Gollancz, 1984.
The Book of the Stars. London: Gollancz, 1984.
The Book of Being. London: Gollancz, 1985.
Yaleen, omnibus edition. Dallas, TX: BenBella Books, 2004
Queenmagic, Kingmagic. London: Gollancz, 1986.
The Power. London: Headline, 1987.
Whores of Babylon. London: Paladin, 1988 (paper).
Meat. London: Headline, 1988.
The Fire Worm. London: Gollancz, 1988.
The Flies of Memory. London: Gollancz, 1990.
The Books of Mana:
Lucky's Harvest. London: Gollancz, 1993.
The Fallen Moon. London: Gollancz, 1994.
Hard Questions. London: Gollancz, 1996.
Oracle. London: Gollancz, 1997.
Mockymen. Urbana, IL: Golden Gryphon Press, 2003.
Orgasmachine. Alconbury Weston: NewCon Press, 2010.
The Waters of Destiny (with Andy West)
Assassins. Palabaristas Press, 2012
Tongue of Knowledge. Palabaristas Press, 2012
Death Overflows. Palabaristas Press, 2012
Warhammer 40,000
The Inquisition War trilogy:
Inquisitor (vt 2002 Draco). Brighton: GW Books, 1990 (paper).
Harlequin. London: Boxtree, 1994.
Chaos Child. London: Boxtree, 1995.
Space Marine. London: Boxtree, 1993 (paper).
Short fiction
Collections
The Very Slow Time Machine. London: Gollancz, 1979.
Sunstroke and Other Stories. London: Gollancz, 1982.
Slow Birds and Other Stories. London: Gollancz, 1985.
The Book of Ian Watson. Willimantic: Mark V. Zeising, 1985.
Evil Water and Other Stories. London: Gollancz, 1987.
Salvage Rites and Other Stories. London: Gollancz, 1989.
Stalin's Teardrops. London: Gollancz, 1991.
The Coming of Vertumnus. London: Gollancz, 1994.
The Great Escape. Urbana, IL: Golden Gryphon Press, 2002.
The Butterflies of Memory. Harrogate: PS Publishing, 2006.
Saving for a Sunny Day. Alconbury Weston: NewCon Press, 2012.
Stories
Poetry
List of poems
References
Other sources
Contributors Bio for Helix: A Speculative Fiction Quarterly
External links
The Beloved of My Beloved, homepage of the 2009 book (Watson and Roberto Quaglia)
The Waters of Destiny, homepage of the 2012 trilogy (Watson and Andy West)
Category:1943 births
Category:Living people
Category:20th-century British novelists
Category:20th-century British male writers
Category:21st-century British novelists
Category:21st-century British male writers
Category:Alumni of Balliol College, Oxford
Category:Asimov's Science Fiction people
Category:British male novelists
Category:British science fiction writers
Category:Warhammer 40,000 writers | {
"pile_set_name": "Wikipedia (en)"
} |
Q:
Email Masking FreeFrom pro
I am using Freeform pro with a EE site that sells classified goods. I have a form where the customer can email another customer/member. But id like to mask the email with sender and receiver something like gumtree or craigslist. Can someone suggest a method for this if its possible.
Thank,
Mario
A:
You'd need to run some custom software that integrated with a local mail server to do this - beyond the scope of even an EE add-on I'd say, because your mail server would need to know how to map the incoming email aliases to your site members.
Maybe there's a third-party service that lets you create forwarding addresses programmatically via an API? That would be your best bet, if it exists - then you'd just need to store that anonymous email address as a custom member field for each member.
| {
"pile_set_name": "StackExchange"
} |
Our main objective is to characterize the immunological properties and molecular nature of inappropriate antigens detected on SJL/J reticulum cell sarcoma (RCS) and to define the role of these antigens in tumorogenesis. We plan to demonstrate the presence of inappropriate alloantigens on spontaneous, transplantable and cultured RCS cells by cell mediated and complement cytotoxicity, and by immunofluorescence. Furthermore, biochemical analysis of inappropriate antigens will be examined by immune precipitation of NP40 lysed 35S methionine labeled tumor cells with specific alloantisera and characterization of the molecules by SDS gel electrophoresis. The role of inappropriate antigens in host stimulation will be investigated by examining the in vivo response to inappropriate alloantigenic specificities in both cellular and antibody mediated assays. The mechanism by which the immune response promotes tumor escape from immune destruction will be investigated including the role of antigen-antibody complexes in specific anti-tumor-antigen-reactive cell opsonization, modulation of tumor associated antigens by circulating antibody, direct tumor mediated suppression of antigen-reactive cells and activation of suppressor cells. | {
"pile_set_name": "NIH ExPorter"
} |
Hind Motor
Hind Motor is a locality in Uttarpara Kotrung Municipality of Hooghly district in the Indian state of West Bengal. It is situated on the western bank of the Hooghly River. It is a part of the area covered by Kolkata Metropolitan Development Authority (KMDA).
The locality is prominent as it developed, and named, for a Hindustan Motors factory, shared with the neighbouring Uttarpara and Konnagar suburbs. The factory had been in the area since 1948, and was the sole manufacturing site of the famous Hindustan Ambassador. At its peak the town had its own schools, temples and hospitals.
Hind Motor is well connected by road and rail. Hind Motor railway station connects the town to Howrah Station via the Howrah-Bardhaman Main Line. A portion of the Grand Trunk Road passes through the locality.
References
Category:Cities and towns in Hooghly district
Category:Neighbourhoods in Kolkata
Category:Kolkata Metropolitan Area
Category:Company towns in India | {
"pile_set_name": "Wikipedia (en)"
} |
AV Haunts
AV Haunts
is creating adventure and exploration videos
0
patrons
$0
per month
Thanks for stopping by . We create videos of our wacky adventures. We search for historical locations. Sometimes we find ourselves that we are not alone. Join us and show us some support as we traverse across the land.
Thanks for stopping by . We create videos of our wacky adventures. We search for historical locations. Sometimes we find ourselves that we are not alone. Join us and show us some support as we traverse across the land. | {
"pile_set_name": "Pile-CC"
} |
The relationship between yogurt consumption, body weight, and metabolic profiles in youth with a familial predisposition to obesity.
This study examined the relationship between yogurt consumption, family history of obesity (FHO), and health determinants. Youth (n = 198; mean age: 20 ± 0.5 years) from the Québec Family Study were first classified based on their FHO, defined as the presence or absence of at least one obese (BMI ≥30 kg/m2) parent [with FHO (FHO+; n = 112) or without FHO (FHO-; n = 86)] and then on their yogurt consumption [yogurt consumers (YC+) n = 61 or non-consumers (YC-) n = 137]. A two-factor mixed ANOVA was performed to evaluate the association between FHO, YC, and their interaction with health determinant such as weight and body composition, metabolic and behavioral profiles. There was a main effect of FHO, but not YC, for weight and body composition, but no interaction between YC and FHO for these measures. However, a significant interaction between YC and FHO was observed for fasting insulin (P = 0.02), insulin area under the curve (AUC) (P = 0.02), and homeostatic model assessment of insulin resistance (HOMA-IR; P = 0.03) after adjustment for studied covariates. Specifically, lower fasting plasma insulin, insulin AUC, and HOMA-IR were observed in FHO+ and YC+ youth compared to YC- youth of the same group while no differences were found between the FHO- sub-groups. Consuming yogurt may protect against insulin resistance more specifically among youth at risk of obesity, and this relationship appears to be independent of body composition and lifestyle factors measured in this study. | {
"pile_set_name": "PubMed Abstracts"
} |
Q:
Error in Iterating through Pandas DataFrame with if statement
I have the following pandas DataFrame.
Id UserId Name Date Class TagBased
0 2 23 Autobiographer 2016-01-12T18:44:49.267 3 False
1 3 22 Autobiographer 2016-01-12T18:44:49.267 3 False
2 4 21 Autobiographer 2016-01-12T18:44:49.267 3 False
3 5 20 Autobiographer 2016-01-12T18:44:49.267 3 False
4 6 19 Autobiographer 2016-01-12T18:44:49.267 3 False
I want to iterate through "TagBased" column and put the User Ids in a list where TagBased=True.
I have used the following code but I am getting no output which is incorrect because there are 18 True values in TagBased.
user_tagBased = []
for i in range(len(df)):
if (df['TagBased'] is True):
user_TagBased.append(df['UserId'])
print(user_TagBased)
Output: []
A:
As others are suggesting, using Pandas conditional filtering is the best choice here without using loops! However, to still explain why your code did not work as expected:
You are appending df['UserId'] in a for-loop while df['UserId'] is a column. Same goes for df['TagBased'] check, which is also a column.
I assume you want to append the userId at the current row in the for-loop.
You can do that by iterating through the df rows:
user_tagBased = []
for index, row in df.iterrows():
if row['TagBased'] == 'True': # Because it is a string and not a boolean here
user_tagBased.append(row['UserId'])
| {
"pile_set_name": "StackExchange"
} |
Many businesses have dedicated telecommunication systems that enable computers, telephones, facsimile machines and the like to communicate with each other through a private network and with remote locations via a telecommunications service provider. In most buildings, the dedicated telecommunications system is hard wired using telecommunication cables that contain conductive wire. In such hard wired systems, dedicated wires are coupled to individual service ports throughout the building. Conventionally, the wires from the dedicated service ports extend through the walls of the building to a telecommunications closet or closets. The telecommunications lines from the interface hub of a main frame computer and the telecommunication lines from external telecommunication service providers may also terminate within a telecommunications closet.
A patching system is typically used to interconnect the various telecommunication lines within a telecommunications closet. In a telecommunications patching system, the telecommunication lines are terminated within a telecommunications closet in an organized manner. The organized terminations of the various lines are provided via the structure of the telecommunications closet. A mounting frame having one or more racks is typically located in a telecommunications closet. The telecommunications lines terminate on the racks, as is explained below.
Referring to FIG. 1, a typical prior art rack 10 is shown. The rack 10 retains a plurality of patch panels 12 that are mounted to the rack 10. On each of the patch panels 12 are located port assemblies 14. The illustrated port assemblies 14 each contain six telecommunication connector ports 16 (e.g., RJ-45 ports). Other types of patch panels are known, including patch panels with optical fiber ports (e.g., SC, ST, and FC ports) and copper wire ports.
Each telecommunication connector port 16 is hard wired to a respective one of the telecommunications lines. Accordingly, each telecommunications line terminates on a patch panel 12 in an organized manner. In small patch systems, all telecommunications lines may terminate on the patch panels of the same rack. In larger patch systems, multiple racks may be used. Interconnections between the various telecommunications lines are made using patch cords 20. Both ends of each patch cord 20 are terminated with connectors 22, such as, for example, an RJ-45 or RJ-11 telecommunications connector. One end of a patch cord 20 is connected to a connector port 16 of a first telecommunications line and the opposite end of the patch cord 20 is connected to a connector port 16 of a second telecommunications line. By selectively connecting the various lines with patch cords 20, any combination of telecommunications lines can be interconnected.
In many businesses, employees are assigned their own computer network access number exchange so that the employee can interface with a main frame computer or computer network. When an employee changes office locations, it may not be desirable to provide that employee with new exchange numbers. Rather, to preserve consistency in communications, it may be preferred that the exchanges of the telecommunication connection ports in the employee's old office be transferred to the telecommunications ports in the employee's new office. To accomplish this task, patch cords in a telecommunication closet are rearranged so that the employee's old exchanges are now received in his/her new office.
As employees move, change positions, and/or add and subtract lines, the patch cords in a typical telecommunications closet are rearranged quite often. The interconnections of the various patch cords in a telecommunications closet are often logged in either a paper or computer based log. However, technicians may neglect to update the log each and every time a change is made. Inevitably, the log may become less than 100% accurate and a technician may not have a way of reading where each of the patch cords begins and ends. Accordingly, when a technician needs to change a patch cord, it may be necessary for the technician to manually trace that patch cord between two connector ports. To perform a manual trace, the technician locates one end of a patch cord and then manually follows the patch cord until he/she finds the opposite end of that patch cord. Once the two ends of the patch cord are located, the patch cord can be positively identified.
It may take a significant amount of time for a technician to manually trace a particular patch cord, particularly within a collection of other patch cords. Furthermore, manual tracing may not be completely accurate and technicians may accidentally go from one patch cord to another during a manual trace. Such errors may result in misconnected telecommunication lines which must be later identified and corrected. Also, it may be difficult to identify the correct port to which a particular patch cord end should be connected or disconnected. Thus, ensuring that the proper connections are made can be very time-consuming, and the process is prone to errors in both the making of connections and in keeping records of the connections. Accordingly, a need exists for accurately and quickly tracing, detecting and identifying the ends of patch cords in a telecommunications closet. A need also exists for accurately and quickly knowing which patch panel ports are connected by patch cords. | {
"pile_set_name": "USPTO Backgrounds"
} |
reconciliation songs
My morning introspection had a catalyst. Barenaked Ladies’ new song ‘War On Drugs.’ The song verbalizes the exact changes I’m making in myself. Letting the tug-of-war relationships of my past go, ridding myself of the guilt and shame… saying goodbye to the demons haunting me, that kept me such company. Maybe it will be dull without all this drama, and maybe it will be odd to make myself happy, like I always thought I was supposed to feel, but never seemed to be. So one point for me.
I’m listening to Coldplay’s The Sceintist as I write this. Any song where a man is starting his sentence with “I’m sorry” is a good one. A song about reconciliation. Well done. I like men who show up in the middle of the night if you’re fighting on the phone, or the guy who when you sneak out of his apartment, chases you into the street, finds you in a cab and pleads for you to please come back inside… “there are things that need to be said.” I guess I love people who can realize they’re making mistakes before they make them. Romantics who know what to do if they ever are in a relationship.
Nobody said it was easy. It’s such a shame for us to part. Nobody said it was easy. No one ever said it would be this hard.
I love reconciliation. I just always thought it would be with a boy; I never thought I’d be reconciling with myself. | {
"pile_set_name": "Pile-CC"
} |
Lawyers Accused of Leaks in Tiger Woods and Elin Nordegren's Divorce
Elin's Lawyers Accused of Leaks in Tiger Divorce
5/14/2010 5:15 AM PDT BY TMZ STAFF
Things have already gotten nasty in the Tiger Woods divorce. TMZ has learned Tiger's lawyers have accused Elin Nordegren's legal team of leaking like a sieve to the media.
Elin's lawyer,Walter H. White, Jr., who practices in London, sent an email to his staff on April 19, 2010 -- an email obtained by TMZ. White warns his people, "Recently we have been accused by the other side of leaking information to the press. While we do not believe that anyone in the firm has been responsible for the leaks, we are aware that this is the second time that we have been so accused ... "
White urges his staff to "avoid conversations relating to firm activities in public ..."
After we called White on Wednesday and told him we had information he was repping Elin, he sent a staff email saying, "TMZ the web news service has discovered that we in London represent Elin Nordegren ... "
The email notes that Elin's sister, Josefin, works at the firm and then boasts, "To some extent it is a surprise and a tribute to the office and the firm that it has taken them so long to figure this out."
As we reported yesterday, White was already repping Elin in January -- a month and a half after Tiger's car crash.
HERE'S THE RUNDOWN Meredith Viera Defends the Killer of Cecil the Lion Jennifer Beals in a Hot-Dog-in-Car Controversy A 'Bachelorette' Star Gets Bashed in the Head with a Brick Zayn Malik is Goin' Solo Thanks to Simon Cowell | {
"pile_set_name": "Pile-CC"
} |
MANILA (Reuters) - Philippine security forces on Saturday killed a foreign national and his female companion who were suspected of being connected to a militant group supporting Islamic State, police officials said, two days after the group’s leader was also killed.
The foreigner, believed to be Pakistani and identified as Abu Naila, resisted arrest and attempted to throw a grenade while a police and military team was conducting a manhunt in Sarangani province, Chief Superintendent Cedrick Train, a police regional director, said.
They were conducting an operation against members of the militant Ansar Al-Khilafah Philippines (AKP), one of a handful of small groups that have pledged allegiance to Islamic State and blamed for years of unrest in the Philippine south.
On Thursday, police chief Ronald dela Rosa said security forces had effectively broken the backbone of AKP with the killing of its leader, Mohammad Jaafar Maguid, and the arrest of his three AKP colleagues.
He has warned of “retaliation” by other AKP members and said security forces were on full alert as Filipino Catholics are set to celebrate the feast of the Black Nazarene, with millions of devotees expected to join processions on Monday in several parts of the country, including Manila.
Authorities have linked Maguid’s group to several crimes ranging from arson and murder to bombings.
Regional police spokesman Romeo Galgo said they were still verifying the nationality of the foreigner killed on Saturday.
“Officers were forced to fire at the suspects when the grenade was lobbed at them,” Train said.
President Rodrigo Duterte has warned against Islamic State taking root in the southeast Asian country, saying it needed to avoid “contamination”. | {
"pile_set_name": "OpenWebText2"
} |
As an experienced solo artist and newly inducted full-time member of the legendary Pacific Northwest rock group Death Cab For Cutie, Dave Depper has had quite the share of experiences in his musical career. Between the release of his first solo record in the summer of 2017, Emotional Freedom Technique, and preparing for the release of a new Death Cab album and tour this coming fall, Depper has a lot going on.
After playing Travelers’ Rest in Montana this past Saturday with Death Cab, he was having so much fun that he decided to hitch a ride with his friends in The Decemberists instead of flying home a day earlier. Casual enough, right?
Fortunately, Dave was able to sit down and have a conversation with the Daily over the phone, and talk about his latest album, songwriting and working with a band like Death Cab For Cutie.
The Michigan Daily: So, your website describes you as the “go-to guy” in the Northwest music scene. Tell me about how you built yourself up as a musician to become this in demand player in the Northwest. How did you establish yourself as this prominent multi-instrumentalist as both a soloist and a collaborator?
Dave Depper: Well, it was not by design, it was sort of accidental. I moved to Portland in 2003, and I had a background of playing guitar and piano and bass, and it all sort of happened accidentally when I fell in with this group of people that were based around a record label called Hush Records, who actually were the first people to sign The Decemberists.
I joined a band called Norfolk and Western, and at the time their drummer Rachel Blumberg was also the drummer of the Decemberists, which is apropos because I was sleeping on their tour bus last night. the singer of Norfolk opened up this studio called Type Foundry, which is still here today. It was kind of a focal point for Portland music and recording. And for whatever reason, I sort of became his go to session guy.
I was just very open to wanting to collaborate with anyone, and I never said no to an opportunity. And it wasn’t some big ambitious plan to be “the guy” or anything, I just genuinely loved working with new people. It didn’t happen overnight.
TMD: And now you’ve got your own album out and you’re playing with Death Cab For Cutie. I’d say that’s a pretty good run.
DD: Thank you. Yeah, when people ask me like, how do you make it, I tell then to work hard at what you do, but also being the guy or gal that people want to ride in a van with for hours at a time is just as important in this industry.
TMD: So now that you’ve had these experiences working as a solo and touring musician, what sort of takeaways have you gotten from working in one area that have benefited the other?
DD: Ah, good question. I would say that working on an album like Emotional Freedom Technique sharpened my skill set all around, because I was really committed to playing everything on that record. I was a confident guitarist, but not a super confident singer, and okay keyboardist, but I also didn’t know too much in synthesizer, so I did my best to level up in all of those areas.
And then right when that album finished, we started on the Death Cab album, so I went into that album feeling a lot more confident musically. So if I wasn’t confident going in the studio writing with the band, at least I had this musical confidence, and the rest sort of caught up.
And the other way around, I feel like Death Cab really hasn't influenced me too much besides I’ve just been listening to them forever. I put out my album before I joined the band officially, and it was just this bedroom project that seemed to have no finish date. And then when I did join the band, I realized that I wouldn’t be putting it out as this moderately successful Portland session guy, I’d be putting it out as a member of Death Cab, which seemed like a bigger thing to me.
TMD: What’s it been like writing with Death Cab compared to your solo stuff?
DD: It’s been a pretty amazing opportunity. I’ve been playing with them for four years as a live guitarist, but then like a year and a half ago, I started getting demos from Ben in my inbox, and I was like, woah, these are new songs that have never been heard, this is very surreal.
Then I sort of had to find my place in writing, like, is it my place to say I don’t like the bridge on this song, or whatever. But we sat down and had some pretty frank talks about what was gonna be expected, and he [Gibbard] said, “look, we brought you into this band because we like your musicality and trust you… you don’t get to produce the record but your ideas will be taken in just like anyone else’s”.
It did take a minute to get used to, but at the end of the day, I got to play a big part in how the album sounds and I’m super grateful for that.
TMD: Yeah, and that’s coming out really soon isn’t it?
DD: Yeah, it’s coming out next Friday, it’s surreal.
TMD: And then after the release, you’ve got your upcoming tour for the album. What’s it been like preparing for the tour, especially compared to preparing for live sets of your solo music?
DD: Well, obviously Death Cab has a much larger infrastructure around it compared to Death Cab, my own things is just me and my friend doing our own things, putting things together and doing our own sound, while Death Cab has this big crew and guitar techs and stuff like that. So yeah, they’re pretty different.
I do find my own shows to be much more intimidating than Death Cab shows although there’s a fraction of the people there just cause… I don’t think I’m a natural front person, and I get very nervous about having all the crowd’s attention on me the whole show. So props to people like Ben that carry on two hour rocks shows with people staring at them the whole time. But yeah there’s just a lot of moving part to Death Cab.
But we’ve really delved into the tech side of things, there’s been a lot of sitting in dark studio rooms on sunny days dealing with computers and pedals and things, just getting it all ready to go. But I think it’s all gonna pay off. The tour this fall, I think, is going to pretty spectacular.
Emotional Freedom Technique is out now, and Death Cab for Cutie’s new album, Thank You For Today comes out on August 17. | {
"pile_set_name": "OpenWebText2"
} |
Blogger Russ Racop has obtained the dashboard camera footage of the Jan. 24, 2016, DWI arrest of Asa Hutchinson III, the son of Governor Hutchinson. The younger Hutchinson was convicted of DWI, careless and prohibited driving and refusal to submit to testing on Nov. 30, 2016, but the conviction was overturned last week by a Washington County judge. The original citation issued by the Arkansas State Police indicated that it was daylight when the younger Hutchinson crashed his truck into a guardrail on an exit ramp off Interstate 49 near Fayetteville around 2:55 a.m. A state trooper later voided that ticket and indicated it was dark, but Hutchinson’s attorney said Hutchinson never received the second citation and the statute of limitations had expired.
Hutchinson appears to be disoriented in the dash cam footage. He tells the officer he thinks he’s heading north when he was, in fact, traveling south. After he’s handcuffed, the state trooper asks Hutchinson, “Anything on you you’re not supposed to have?” After mumbling unintelligibly, Hutchinson tells the trooper he has a gun. Hutchinson is asked if he has a concealed carry license, and he responds that it has expired.
Bill Sadler, a spokesman for the Arkansas State Police, said Hutchinson was not charged with carrying a firearm, a class A misdemeanor, but his weapon was held by state police “until such time it could be released pursuant to applicable laws and criminal procedure.”
Asked why he wasn’t charged, Sadler said, “It would have been up to the discretion of the trooper.”
A Freedom of Information Act exemption enacted several years ago keeps the public from knowing anything about concealed carry holders in Arkansas. One of the state police’s listed reasons in its administrative rules for concealed carry for revoking a license is if a permit holder has been found guilty of an alcohol-related offense while carrying a handgun. | {
"pile_set_name": "OpenWebText2"
} |
Following the airport shooting, Steube doubled down on his view that license holders ought to bring guns into venues like airports, claiming that gun-free zones are more likely to be targeted by shooters. In fact, most major airports are not gun-free zones, as they have armed and unarmed security personnel. In addition, several studies show the vast majority of mass shootings do not occur in gun-free zones. In his book, "Rampage Nation," Louis Klarevas of the University of Massachusetts found that 93 of 111 mass shootings from 1966 to 2015 occurred in zones in which guns were not prohibited. | {
"pile_set_name": "OpenWebText2"
} |
Aorangi Forest Park
Aorangi Forest Park is a protected area in the Wellington Region of New Zealand administered by the Department of Conservation (DOC). It had been called the Haurangi Forest Park but DOC changed to reflect the Māori name of the range protected by the park.
There are six backcountry huts and a recreational hunting area in the park. There are deer, goats and pigs (in low numbers) in the park.
See also
Forest Parks of New Zealand
Protected areas of New Zealand
Conservation in New Zealand
Tramping in New Zealand
References
External links
Aorangi Forest Park at the Department of Conservation
Aorangi Forest Park at Google Maps
Category:Forest parks of New Zealand
Category:Protected areas of the Wellington Region
Category:Protected areas established in 1978 | {
"pile_set_name": "Wikipedia (en)"
} |
SO far the gender revolution has been a one-sided effort. Women have entered previously male precincts of economic and political life, and for the most part they have succeeded. They can lead companies, fly fighter jets, even run for president.
But along the way something crucial has been left out. We have not pushed hard enough to put men in traditionally female roles — that is where our priority should lie now. This is not just about gender equality. The stakes are even higher. The jobs that many men used to do are gone or going fast, and families need two engaged parents to share the task of raising children.
As painful as it may be, men need to adapt to what a modern economy and family life demand. There has been progress in recent years, but it hasn’t been equal to the depth and urgency of the transformation we’re undergoing. The old economy and the old model of masculinity are obsolete. Women have learned to become more like men. Now men need to learn to become more like women.
Will this transformation be good for men? In the long run, we think so. But in any case they don’t really have a choice. Recent changes in women’s status and in the economy aren’t going to be reversed. Men must either adapt or be left behind. | {
"pile_set_name": "OpenWebText2"
} |
Cloud Platform Suitable for Every Pocket: Jelastic Partners with MilesWeb Hosting in India
Keeping up our main strategy to provide customers with an affordable cloud hosting, today we are happy to announce a partnership between Jelastic and MilesWeb, web hosting company in India that is offering customized hosting solutions to small, medium and enterprise businesses since 2012.
What motivated MilesWeb to launch new service offering? Why not just proceed providing VPS hosting?
Affordable Cloud Hosting
The answer is clear - to meet the rising demand among Indian customers in the affordable cloud hosting platform that ensures you are paying only for the resource usage of your application.
People believe that affordable price in combination with high performance is a myth and keep overpaying up to 45% for their projects hosting. By joining the forces with Jelastic, MilesWeb Cloud will help their customers in India to save time and money with flexible Platform available from Mumbai data center.
MilesWeb’s spokesperson stated that: ‘The resources you need for your application might not be the same always, they might differ and in order to keep up with the resource needs and to ensure cost effectiveness, you need a platform that works according to your resource requirements. Our cloud platform completely works on the discretion of the users; the user can scale up or down whenever required without any manual intervention or downtime’.
No More Complexity
Breaking the next myth about complexity, MilesWeb powered by Jelastic enables customers to deploy Java, PHP, Ruby, Node.js and Python applications smoothly with no code changes. Another battle card in favor of cloud hosting - it is easy to scale projects and applications during load spikes with the help of Jelastic vertical and horizontal scaling. And yes, it is really easy to manage as the dashboard provides intuitive application topology wizard, deployment manager, access to log and config files, team collaboration functionality and integration with CI/CD tools.
Most Popular Apps Just in One Click
From now on, MilesWeb customers are able to install 100+ popular applications in one simple click right from the Marketplace in the dashboard. CMS`, e-commerce, developer tools, IoT and much more apps so demanded for running projects in the effective and highly productive way. All the applications available in Marketplace can be installed with no manual settings.
What Benefits from Milesweb Hosting?
MilesWeb empowers their customers with high uptime ensured by the state-of-art data center infrastructure in Mumbai (the financial capital of India), delivering top speed along with providing industry leading SLA.
One more advantage for MilesWeb Cloud hosting is round-the-clock technical support over phone, email, and chat. A good news for customers, that want to try cloud hosting service at MilesWeb for free - 30 days free trial is available with no credit card required as well as with a possibility to upgrade any time.
Inspired to try Jelastic Cloud at MilesWeb Hosting Provider? Register for free and unveil even more pros for your projects hosting. | {
"pile_set_name": "OpenWebText2"
} |
Background
==========
Diatoms are important primary producers in the ocean \[[@B1]\], contributing approximately 40% to global marine productivity. Although diatoms often dominate phytoplankton communities in nutrient-rich ecosystems, members of this diverse group are also adapted to survive and persist in nutrient-limited conditions. The development of large diatom blooms upon nutrient resupply demonstrates the metabolic plasticity inherent to their ability to recover rapidly from nutrient limitation.
Iron is an essential nutrient for all organisms and in particular for photoautotrophic organisms. It functions as a powerful electron carrier in iron-sulfur- and heme-containing proteins and as such is a required component of the photosynthetic apparatus. Solubility of iron in seawater is low and phytoplankton growth in marine habitats is often limited by iron availability. This is best illustrated in high-nitrate low-chlorophyll (HNLC) regions, remote oceanic areas that lack any form of regular iron supply and suffer from a persistent shortage of this micronutrient. Here, although other commonly limiting nutrients like nitrate or phosphate are present at high concentrations, primary productivity - and biomass as a whole - is low \[[@B2]\].
Numerous large-scale iron fertilization experiments have confirmed that iron is the limiting nutrient in HNLC regions \[[@B3]\]. Phytoplankton blooms induced by iron fertilization were dominated by diatoms and carbon export to the deep-sea floor could be observed in some cases. The strong response of diatoms to the input of iron in HNLC regions has been a motivation for exploring large-scale iron fertilization as a possible bioengineering strategy to sequester CO~2~into the ocean in HNLC regions, which are otherwise rich in macronutrients.
Genome projects on the model organisms *Thalassiosira pseudonana*\[[@B4]\] and *Phaeodactylum tricornutum*\[[@B5]\] have already generated a wealth of insights into the metabolic complexity of diatoms \[[@B6]\], a consequence of the secondary endosymbiosis event that gave rise to this group \[[@B7]\]. This secondary endosymbiosis brought together the benefits of a heterotrophic host and the \'red\'-type photosynthesis of red alga cells, which already have an elemental composition low in iron \[[@B8]\].
The impact of iron availability on phytoplankton growth has led to the evolution of strategies to counteract iron limitation. Well established parts of the low-iron response found in diverse phytoplankton species are the reduction of the chloroplast system, the corresponding development of a chlorotic phenotype, compensation mechanisms (replacement of iron-rich elements with iron-poor substitutes) and the activation of high-affinity iron-uptake systems \[[@B9]\]. The substitution of ferredoxin by flavodoxin \[[@B10]\], the use of plastocyanin instead of cytochrome c~6~\[[@B11]\] and a variant stoichiometry of photosynthetic complexes \[[@B12]\] are notable adaptive strategies to facilitate diatom growth in low-iron conditions.
Oceanic and neritic phytoplankton species can be distinguished from each other by their growth characteristics and their tolerance to nutrient limitation \[[@B13]\]. Unlike many other *Thalassiosira*species that are predominantly found in coastal waters, *Thalassiosiraoceanica*is adapted to oligotrophic conditions and is highly tolerant to iron limitation in particular. Therefore, we chose *T. oceanica*CCMP1005 as a model for a comprehensive analysis of its low-iron response in the context of genomic information.
Here, we explore the complex cellular response of *T. oceanica*to low-iron conditions with genomics, transcriptomics and proteomics approaches complemented by reverse transcription-quantitative PCR (RT-qPCR) analyses. We present a metabolic reconstruction of the iron limitation response based on the transcriptomics data from cells grown under iron-limited versus iron-replete conditions. A metabolic isotope labeling approach using ^14^N/^15^N was established for *T. oceanica*and showed the response to iron limitation at the protein expression level in a marine diatom for the first time. General characteristics of the \'diatom\' low-iron response and its ecological implications are discussed, as well as the constraints for species-specific adaptations to low-iron environments.
Results
=======
Characteristics of the *T. oceanica*genome
------------------------------------------
The genome of the centric diatom *T. oceanica*CCMP1005 (Figure [1](#F1){ref-type="fig"}) was *de novo*assembled from 725 Mb of Roche 454 sequence read information, generated using nuclear genomic DNA (gDNA) of an axenic clonal culture as substrate \[[@B14]\]. The current assembly version comprises 51,656 contigs of total size 92.15 Mb at N50 = 3,623 (that is, 50% of the genomic sequence information is present as contigs ≥3,623 bases). From a median 8.7-fold coverage of long contigs (≥10 kb) we estimated a true haploid nuclear genome size of 81.6 Mb, suggesting some redundancy in the current assembly. This estimate is in good agreement with the 159 Mb measured by van Dassow *et al*. \[[@B15]\] for the diploid G1 DNA content. The gene finder tool AUGUSTUS \[[@B16]\] predicts 37,921 protein gene models that cluster into a non-redundant set of 29,306 models including pseudogenes and short ORFs; 10,109 models have BLAST hits to the National Center for Biotechnology Information (NCBI) nr protein database at a conservative E-value cutoff of 1.0E-30 and thus are more indicative of the expected true protein-coding gene number (that is, expressed genes excluding pseudogenes and short ORFs). Best BLAST hits are listed in Additional file [1](#S1){ref-type="supplementary-material"}. In Table [1](#T1){ref-type="table"} we present an overview of the most abundant Clusters of Orthologous Groups (COG) domains in *T. oceanica*. The abundances of diverse groups of ATPases were overall very similar to those for other diatoms. A group of 19 chitinases is shared between the two centric *Thalassiosira*species.
{#F1}
######
Most abundant protein domains in diatom genomes
COG To Tp Pt Fc
-------------------------- ------------------------------------------------------------------------------------------------------------------------- ----- ----- ----- -----
ATPases
COG0515 SPS1, serine/threonine protein kinase 115 132 119 137
COG0464 SpoVK, ATPases of the AAA+ class 90 43 38 44
COG1132 MdlB, ABC-type multidrug transport system, ATPase and permease components 54 44 47 51
COG1222 RPT1, ATP-dependent 26S proteasome regulatory subunit 50 41 37 42
COG0465 HflB, ATP-dependent Zn proteases 49 37 35 39
COG1223 Predicted ATPase (AAA+ superfamily) 44 39 34 41
COG3899 Predicted ATPase 42 48 11 2
COG2274 SunT, ABC-type bacteriocin/lantibiotic exporters, contain an amino-terminal double-glycine peptidase domain 42 52 50 61
COG5265 ATM1, ABC-type transport system involved in Fe-S cluster assembly, permease and ATPase components 40 33 30 33
COG4618 ArpD, ABC-type protease/lipase transport system, ATPase and permease components 39 41 42 43
COG4987 CydC, ABC-type transport system involved in cytochrome bd biosynthesis, fused ATPase and permease components 31 50 46 56
COG4988 CydD, ABC-type transport system involved in cytochrome bd biosynthesis, ATPase and permease components 29 52 49 60
COG0488 Uup, ATPase components of ABC transporters with duplicated ATPase domains 29 50 46 53
COG1131 CcmA, ABC-type multidrug transport system, ATPase component 22 56 52 65
COG0661 AarF, predicted unusual protein kinase 21 21 22 26
COG0474 MgtA, cation transport ATPase 12 19 19 18
Basic cellular functions
COG0513 SrmB, superfamily II DNA and RNA helicases 46 48 44 54
COG0553 HepA, superfamily II DNA/RNA helicases, SNF2 family 35 27 24 36
COG5059 KIP1, kinesin-like protein 24 25 15 14
COG1643 HrpA, HrpA-like helicases 21 14 9 20
COG0443 DnaK, molecular chaperone 18 14 9 10
COG5021 HUL4, ubiquitin-protein ligase 15 7 8 8
COG5022 Myosin heavy chain 14 11 9 9
COG1249 Lpd, Pyruvate/2-oxoglutarate dehydrogenase complex, dihydro-lipoamide dehydrogenase (E3) component, and related enzymes 12 14 13 20
Chitinases
COG3325 ChiA, chitinase 19 19 1 0
Protein domains are listed based on Clusters of Orthologous Groups COG with an E-value threshold of 1.0E-10. To, *Thalassiosira oceanica*; Tp, *Thalassiosira pseudonana*; Pt, *Phaeodactylum tricornutum*; Fc. *Fragilariopsis cylindrus*.
The chloroplast genome has been published previously \[[@B17]\]. The mitochondrial genome encodes 31 protein genes and is represented by two contigs at a total of 35.3 kb (excluding the characteristic mitochondrial repeats). The current genome assembly, AUGUSTUS protein gene models, ESTs and proteomics peptides as well as updated versions thereof are publicly accessible with the *Thalassiosira oceanica*Genome Browser \[[@B18]\].
With an estimated haploid size of approximately 80 Mb, the genome of *T. oceanica*is significantly larger than those of *T. pseudonana*(approximately 34 Mb) or *P. tricornutum*(approximately 28 Mb), and rather comparable to that of *Fragilariopsis cylindrus*(approximately 80 Mb) \[[@B19]\]. The genome expansion has occurred by DNA recruitment from both internal and external DNA sources.
A best BLAST hit analysis indicated a putative vertical inheritance for greater than 95% of the 10,109 predicted genes (that is, any genes that have not been acquired by a horizontal transfer event), with most of the genes (88%) having a match in the genome of *T. pseudonana*, the most closely related species for which a sequenced genome is available (Figure [2](#F2){ref-type="fig"}). However, a significant fraction (10%) of the genes mapped to *P. tricornutum*instead. This could have resulted from frequent gene loss/replacement events in the genome of *T. pseudonana*, thereby reflecting the overall high capacity for horizontal gene transfer in diatoms \[[@B5]\]. Alternatively, the small genome size of *T. pseudonana*may have arisen from reductional trends in this species.
{#F2}
Further, the best BLAST screening revealed 530 genes whose best hits are assigned to taxa of diverse sources, indicating a putative lateral acquisition for these genes. The taxonomic distribution of the best BLAST hits at a conservative E-value cutoff of 1.0E-30 is presented in Figure [2](#F2){ref-type="fig"}. More refined phylogenetic analyses were obtained for 198 of these 530 genes (Additional file [2](#S2){ref-type="supplementary-material"}). Of the 198 cases we examined, 180 had sister groups that contained no stramenopiles. The sister groups for the remaining 18 cases contained a heterogenous mix of taxa, suggesting frequent transfer between taxa for the respective genes (Figure S1 in Additional file [3](#S3){ref-type="supplementary-material"}). Accordingly, a minimum of 1.8% of the 10,109 AUGUSTUS genes were confirmed to be from lateral gene transfer (LGT) based on the phylogenetic analyses. However, this may rise to 5% as more sequence information becomes available for the remaining \>300 genes for which the limited number of homologous sequences did not permit construction of phylogenetic trees. The group of genes for which phylogenetic trees are available indicated that genes from LGT could be assigned as prokaryotic (35%) and eukaryotic (59%) with approximately 10% of questionable taxonomic assignments. Among the eukaryotic taxa are several expected to be present in the ecological niche of *T. oceanica*, like the green algal genuses *Micromonas*and *Ostreococcus*.
Genomic expansion originating from internal DNA sources may happen from genomic duplication events or transposon activity. In *T. oceanica*we observe several paralogous gene pairs that could be the result of either mechanism (Figure S2 in Additional file [3](#S3){ref-type="supplementary-material"}). Notably, several iron-regulated genes have either been duplicated (for example, the *ISIP1*genes *ISIP1A*and *ISIP1B*and the flavodoxin genes *FLDA1*and *FLDA2*) or contain domain duplications (for example, *CREGx2*) as discussed below.
Physiology of the low-iron response: Fe(-) versus Fe(+)
-------------------------------------------------------
The variable to maximal fluorescence ratio F~v~/F~m~, an indicator of Fe-limitation in the laboratory \[[@B20]\], was used as a rapid measure of the physiological status in Fe-replete and Fe-limited cultures of *T. oceanica*harvested in late exponential growth phase. The growth rate of iron-limited cells in exponential phase was accordingly much smaller than for iron-replete cells (Table [2](#T2){ref-type="table"}), and cellular protein content was 50% lower.
######
Physiology of the *T. oceanica*low-iron response
Fe(+) Fe(-)
------------- ----------------------------------------- -------------
0.5 - 0.6 F~v~/F~m~ 0.2 - 0.3
0.73 ± 0.01 Growth rate (µ)(day^-1^) 0.28 ± 0.02
4 Chloroplasts/cell 2
409 ± 48 Chlorophyll a/cell (fg) 58 ± 27
122 ± 3 Cell surface area (µm^2^) 140 ± 5
100 ± 4 Cell volume (µm^3^) 80 ± 5
15.3 ± 0.9 Single chloroplast surface area (µm^2^) 12.0 ± 0.8
4.7 ± 0.3 Single chloroplast volume (µm^3^) 3.5 ± 0.2
Cellular dimensions and physiological parameters are compared between nutrient replete Fe(+) and iron-limited Fe(-) cells of exponentially growing *T. oceanica*cultures.
The cell volume of iron-limited *T. oceanica*was smaller than that of iron-replete cells (Table [2](#T2){ref-type="table"}), whereas the cells had a larger surface area to volume ratio at low-iron due to a smaller diameter (4.7 ± 0.1 versus 5.9 ± 0.1 µm) and a larger length (7.0 ± 0.4 versus 5.5 ± 0.2 µm). This imposed an elongated phenotype on the cells, but at the same time increased the surface/volume ratio by 43% (1.75 versus 1.22). The increase in surface/volume ratio is expected to favor the uptake of nutrients (that is, iron) into the cell \[[@B21]\]. The intracellular space of iron-limited cells exhibited increased vesiculation (Figure [3](#F3){ref-type="fig"}).
{#F3}
Under low-iron conditions *T. oceanica*cells show a severe decrease in chlorophyll content (Table [2](#T2){ref-type="table"}). This chlorosis response of iron-limited *T. oceanica*is further accompanied by a decrease in cellular chloroplast volume and in total cellular chloroplast surface area (Figure [3](#F3){ref-type="fig"}). Iron-limited cells have reduced the number of chloroplasts to two instead of four in the iron-replete counterpart, and these are also smaller in size. Total chloroplast dimensions for individual cells were distributed over a range spanning the two-fold increase in volume and surface, thereby reflecting chloroplast duplication during cellular growth.
Transcriptomics
---------------
For an in-depth analysis of the *T. oceanica*low-iron response, we focused on approximately 300 genes that were identified from a log-likelihood ratio test statistic \[[@B22]\] as significantly differentially regulated and that could be assigned a specific function (Figure [4a](#F4){ref-type="fig"}). Some additional genes for paralogous proteins were added. These were selected on the basis of their involvement in substitution between related proteins under iron-limited and replete conditions, or as members of a protein family exhibiting a differential response to low-iron conditions. In such cases, the response of a specific gene is better understood in the context of its respective group or family. The complement of organellar genes (encoded by the chloroplast and mitochondrial genome) was added as representative for the two well-defined and important pathways of photosynthetic and respiratory electron transport, or as proxy for organellar activity, respectively. A list of abbreviations for the genes discussed in this work can be found in Additional file [4](#S4){ref-type="supplementary-material"}. All sequences of the selected proteins are provided in Additional file [5](#S5){ref-type="supplementary-material"}, and the corresponding annotation is provided in Additional file [6](#S6){ref-type="supplementary-material"}.
{#F4}
To determine the major metabolic differences found in iron-limited compared to iron-replete growth conditions, all annotated gene products together with their respective expression data were mapped on a cellular scheme. The major cellular trends that could be deduced are summarized in Figure [4c](#F4){ref-type="fig"}. Identifier and detailed information on the discussed proteins (Additional file [7](#S7){ref-type="supplementary-material"}) are given in Additional file [8](#S8){ref-type="supplementary-material"}. In the following, proteins are referred to as exemplary (HSF1, p271) with HSF1 reflecting the gene name (or shortcut) and p271 being the identifier of its respective manually improved protein model (Additional file [5](#S5){ref-type="supplementary-material"}).
Under stress conditions, maintaining cellular integrity is crucial to survival. During iron limitation, the electron flow through the impaired photosynthetic machinery leads to enhanced production of reactive oxygen species that damage biomolecules located near the thylakoid membranes \[[@B23]\]. The need for protein repair and refolding induces an \'oxidative stress response\' that is presumably coordinated by up-regulated heat shock factors (HSF1, p271; HSF2, p256). While all other chloroplast-encoded transcripts were down-regulated in the course of the general chlorosis response, the chloroplast chaperones dnaK and clpC were up-regulated. Additionally, an LHCSR (light harvesting complex stress responsive subunit) ortholog (LI818, p170), belonging to the FCP (fucoxanthin-chlorophyll a/c-binding protein) family of light-harvesting proteins and implicated in efficient non-photochemical quenching \[[@B24],[@B25]\], showed an increased transcript level.
The development of a chlorotic phenotype and the corresponding retrenchment of the chloroplast system is the most pronounced cellular response to low iron. Accordingly, we find substantial changes in organellar transcript levels, which suggests that major functions related to the cellular energy metabolism are adopted by the mitochondrial system instead (\'metabolic shift\'). Chloroplast transcript levels decreased (2,026 Fe(-) versus 14,931 Fe(+) total chloroplast reads), while mitochondrial transcripts showed a two-fold increase (31,261 Fe(-) versus 18,136 Fe(+) total mitochondrial reads). Much of this effect can be attributed to the organellar rRNA operons, whose transcription is indicative of organellar translational activity (Figure S3 in Additional file [3](#S3){ref-type="supplementary-material"}). In parallel, diverse nuclear-encoded but chloroplast-targeted gene products were down-regulated. These included genes coding for enzymes involved in chlorophyll biosynthesis and the Calvin cycle, as well as components of the light reaction, such as photosystem (PS) subunits and several FCPs. Conversely, components of the mitochondrial respiratory chain, like cytochrome c oxidase, cytochrome b and several subunits of the NADH dehydrogenase, were up-regulated. This was also seen for a mitochondrial ATP/ADP-translocase (p242) involved in the transport of energy equivalents.
Cellular retrenchment (that is, the reduction of cellular biomass and activity) and decreased growth rates are general responses of nutrient-limited cells \[[@B13]\]. While chloroplast reduction was readily observable in iron limitation due to the visual predominance of these organelles in the cells, we also saw indications of a general cellular retrenchment in the transcriptional response. The expression level of the 18S rRNA gene (represented by 1,154 Fe(-) versus 2,691 Fe(+) reads) suggests a lower translation rate under iron limitation. Though such inferences must be taken with care, this would be in agreement with the decreased growth rate and lower biomass, as cellular rRNA correlates with cellular biomass. The strong up-regulation of mitochondrial isocitrate lyase (ICL, p419) and glutamine synthetase (GS, p302) suggests biomass recycling strategies to avoid losing fixed carbon and nitrogen during the metabolite conversions associated with enhanced respiration. The isocitrate lyase bridges the two decarboxylation steps of the mitochondrial citric acid cycle (carried out by isocitrate dehydrogenase and α-ketoglutarate dehydrogenase), thereby preserving carbon as glyoxylate. The glutamine synthetase reincorporates free ammonium, preserving nitrogen as glutamine. Under low-iron conditions, utilization of ammonium is energetically advantageous due to the high iron requirements of the nitrate assimilation pathway \[[@B26]\]. The concerted action of cellular retrenchment and biomass recycling allows for prolonged growth despite reduced carbon assimilation, thereby increasing the probability of cell survival.
Diverse genes, whose products are targeted to the secretory pathway, are up-regulated under iron limitation, suggesting extensive cell-surface remodeling as also observed for iron-limited *P. tricornutum*\[[@B20]\]. Many of these genes are assigned adhesive or degradative functions. An enhanced capacity for adhesion favors recruitment of organic matter to the cell. As organic matter can be a rich and complex source for various nutrients, including iron, its recruitment to the cellular surface represents a required first step in iron uptake. Besides providing a source of iron, the bound organic matter could also serve as a source for other nutrients like nitrogen or phosphorus in the context of facultative mixotrophy. Example genes assignable to such a hypothetical scenario and highly responsive to low iron are given in Figure [5](#F5){ref-type="fig"} and include *Adhesin 1*(p329), *CB*(Carbohydrate-binding 1, p230), *CHIT*(chitinase, p88), *M-Phosphoesterase*(p323), *M-Protease*(p279), *Redox 1*(p232). However, under the photoautotrophic experimental conditions, the cultures lacked any external organic carbon source except the essential vitamins.
{#F5}
A straightforward strategy to survive in low-iron conditions is to lower cellular iron requirements by replacing components that are rich in iron with iron-free substitutes that are functionally equivalent, like the substitution of the chloroplast electron carrier ferredoxin with flavodoxin \[[@B10]\]. The genome of *T. oceanica*encodes two cytochrome c~6~genes and one plastocyanin gene. While the cytochrome c~6~genes *CYTC6A*and *CYTC6B*are found to be weakly expressed, the plastocyanin gene *PETE*shows high expression under high-iron conditions with a characteristic decrease in low-iron conditions as seen from many constitutively expressed chloroplast genes in the course of the chlorosis response. This suggests a constitutive use of plastocyanin (PETE, p175) instead of cytochrome c~6~for photosynthetic electron transport and is consistent with prior findings \[[@B11],[@B12]\]. Constitutive expression of plastocyanin could certainly be regarded as a specific adaptation to low-iron regimes, although the retention of the cytochrome c~6~genes suggests that these may play a role under specific environmental conditions. Fructose-bisphosphate aldolase (FBA) genes are redundant in some diatoms and have recently been described in more detail for *P. tricornutum*\[[@B27]\]. The *T. oceanica*genome, too, was found to encode several FBA enzymes, with the cytosol, the chloroplast stroma and the chloroplast pyrenoid harboring two FBA enzymes each (FBA1, p380, and FBA3, p153, in the chloroplast pyrenoid; FBA2, p381, and FBA5, AUG_g19407, in the chloroplast stroma; FBA6, AUG_g24977, and FBA4, p154, in the cytosol). As is the case in *Phaeodactylum*, one of the *T. oceanica*FBAs from each compartment (FBA1, FBA2, FBA6) appears to act through metal catalysis (class II) while the second (FBA3, FBA5, FBA4) is predicted to use Schiff-base catalysis (class I) instead. While the metal cofactor of different class II FBAs was found to be Mn^2+^\[[@B28]\], Zn^2+^\[[@B29]\] or Cd^2+^\[[@B30]\] in *Escherichia coli*, the orthologous FBAs of *T. oceanica*apparently are differentially regulated through the availability of iron, suggesting the involved metal in these enzymes might be Fe^2+^, and implying a pairwise substitution by class I enzymes.
An essential part of iron-uptake systems are ferric reductases (FREs) and ferrous oxidases (MUCOX proteins) that act on the interconversion of the two ionic species Fe^3+^and Fe^2+^. In the iron-limited transcriptome we find an up-regulated putative ferric reductase (FRE1, p157) and an up-regulated multicopper oxidase (MUCOX2, p67) that shows characteristics of a ferrous oxidase. Their differential regulation with respect to iron availability makes them candidates for iron-specific reductase and oxidase involved in iron uptake (Figure [5](#F5){ref-type="fig"}). Iron uptake requires initial binding of iron and/or iron complexes. The involved receptors are presently unknown, though a number of genes, exclusively expressed under iron limitation, are targeted to the cell surface, making them candidates for iron-binding receptors. The low-iron-responsive gene *ISIP1*(Iron-starvation induced protein) was first identified in *P. tricornutum*, but has conserved orthologs in *T. oceanica*(*ISIP1A*, p159) and *F. cylindrus*. We provide further evidence for a role of the ISIP1 protein as a putative receptor below. Additional members in this group are ISIP2 (p160) and ISIP3 (p161), both represented by orthologs in *P. tricornutum*as well. Further, we list some proteins that contain duplicated domains known from *P. tricornutum*low-iron-responsive genes, like an eight-fold duplicated ISIP2-like subdomain (ISIP2x8, p84) or a duplicated CREG-like domain (CREGx2, p90). Duplication of iron-binding domains would directly enhance the capacity for iron binding and enable increased uptake kinetics \[[@B26]\].
Non-ribosomal peptide synthases (NRPSs) \[[@B31]\] are responsible for the production of peptide antibiotics or - in some cases - siderophores that are capable of binding iron \[[@B32]\]. In addition to a conserved fungal NRPS (NRPS1, p174) with orthologs in *T. pseudonana*and *P. tricornutum*, we find a putatively cytosolic NRPS of bacterial origin (NRPS2, p173) up-regulated in low-iron conditions. Co-regulated with this bacterial NRPS is a multidrug resistance-associated protein (MRP, p57) that might be involved in the export of the respective peptide products. The up-regulation of NRPSs likely indicates a defense mechanism in response to enhanced competition (either for iron or, under the premise of facultative mixotrophy, for organic matter).
We observe the induction of a reverse transcriptase (RT, p222) and a CRE-like recombinase (CRE, p321), potentially indicating an activation of mobile elements under iron limitation. These enzymes might also be involved in gene and/or domain duplication events through reverse transcription and genomic integration of cellular mRNA copies. Thereby, this molecular system may provide a link between environmental stresses and the structural dynamics of the diatom genome.
Proteomics
----------
The transcriptomic data of *T. oceanica*unveils extensive changes in cellular transcript levels in response to iron limitation. Although informative, transcript abundances do not necessarily reflect cellular protein levels \[[@B33]\]. We therefore supplemented the transcriptomic data with proteomic data to determine the protein complement in action under the defined iron-replete and iron-limited growth conditions. Figure [4b](#F4){ref-type="fig"} illustrates the dynamic range of differential abundances for all proteins detected by liquid chromatography-tandem mass spectrometry (LC-MS/MS) relative to equal amounts of total cellular protein for both conditions. The induction of flavodoxin is a hallmark of iron-deficiency responses in many diatoms and cyanobacteria (see above). In accordance with the transcriptome response, flavodoxin as well as ISIPs or class I FBAs could only be found under iron limitation. The extent of correlation between proteomics and transcriptomics data was assessed through plotting the relative abundance data from peptides (proteomics P) against the relative abundance data from their corresponding transcripts (transcriptomics T) (Figure S4 in Additional file [3](#S3){ref-type="supplementary-material"}). A stretched cluster along the y-axis indicates a high dynamic range of the transcriptomics data, while the proteomics data is more uniform for this group.
Both transcriptomics and proteomics data are biased towards highly abundant transcripts/proteins. Especially the proteomics data, despite its relatively high number of signals, could resolve only a subset of the protein complement. Accordingly, we interpret the complement of differentially regulated genes and proteins recovered from both approaches as complementary in the information that they provide, and we do not expect them to show a complete overlap. However, the overlap in the response for the specifically induced proteins ISIP1 and class I FBAs shows that the data from both approaches are, in general, in good agreement with each other.
In the proteomics data it is of specific interest to have a closer look at proteins of the photosynthetic machinery. Chloroplast ribosomal proteins provide an appropriate internal reference for the regulation of chloroplast proteins and indicate a down-regulation of the ribosomes at a ratio of 0.8 relative to the iron-replete proteome. Protein subunits of PS I were reduced about two-fold under low iron conditions (0.45), except PsaL, which was only found under iron limitation. In cyanobacteria, PsaL, generally important for trimer formation, facilitates the formation of IsiA (iron stress induced protein A) rings around PS I monomers under iron-deprivation \[[@B34]\]. We speculate that PsaL might be involved in the organization of PS I light-harvesting structures specifically formed under low-iron conditions and/or oligomerization of PS I in iron-limited *T. oceanica*. Subunits of the iron-containing cytochrome b~6~/f (cyt b~6~/f) complex, were down-regulated, with ratios of 0.2 and 0.32. In contrast, PS II subunits PsbB, PsbC, PsbE, PsbH and PsbV remained almost constant, with ratios at about 1.1. While the PS II core complex seems to be retained to some extent, the labile D1 protein is down-regulated at 0.7, probably reflecting a proportional decrease in functional PS II. The differential regulation of the two photosystems (0.45 for PS I versus 0.7 for PS II D1 protein) supports an adaptive significance for the remodeling of the photosynthetic architecture under iron limitation, in contrast to earlier findings \[[@B12]\].
While PS I and cyt b~6~/f complexes were down-regulated two- to threefold, it was still possible to detect the iron-rich mitochondrial complexes under iron limitation. Relative protein quantification was possible for subunits of complex III, complex IV and the ATPase with low-to-high iron ratios ranging from 0.95 for QOR2 (a NADPH-dependent quinone oxidoreductase) to 1.7 for the beta subunit of the mitochondrial cytochrome c oxidase (Figure [4b](#F4){ref-type="fig"}). This is in agreement with the transcriptomic data and supports the idea that mitochondrial electron transfer protein complexes are preserved under iron limitation relative to photosynthetic electron transfer protein complexes.
While the magnesium chelatase, involved in chlorophyll synthesis, is down-regulated at 0.35, the numerous FCP light-harvesting proteins showed very diverse responses to iron limitation (Figure S5 in Additional file [3](#S3){ref-type="supplementary-material"}). Some FCPs showed down-regulation under low-iron whereas others were up-regulated. In particular, LHCSR-like FCPs, involved in photoprotection, were highly abundant under iron limitation, corroborating the transcriptome analysis. Notably, the xanthophyll cycle enzyme violaxanthin de-epoxidase showed significant up-regulation at 3.1, suggesting a possible linkage to the group of FCPs, which accumulate under iron limitation.
Comparative genomics reveals extensive genomic plasticity in *T. oceanica*
--------------------------------------------------------------------------
We used the genome information of *T. oceanica*, *T. pseudonana*, *P. tricornutum*and *F. cylindrus*to investigate central issues of the diatom low-iron response in a comparative genomics approach.
### Taxonomic distribution of iron-regulated genes
We screened the four diatom genomes known to date (*T. oceanica*, *T. pseudonana*, *P. tricornutum*and *F. cylindrus*) for the highly conserved iron-regulated *ISIP1*, *ISIP3*, *PETF*, *FLDA*, *CYTC6*, *PETE*and class I and II *FBA*genes (Table [3](#T3){ref-type="table"}; Additional file [9](#S9){ref-type="supplementary-material"}). Phylogenetic trees for the important groups of flavodoxin \[[@B35]\] and FBA proteins are provided in Figures S6 and S7 in Additional file [3](#S3){ref-type="supplementary-material"}.
######
Presence and copy number of iron-regulated genes in the genomes of ecologically distinct diatoms
Gene Product Destination Mutual substitution at low-iron Putative role in iron uptake To Tp Pt Fc
------------------------ ----------------------------------------- ------------------------ ---------------------------------------------- ------------------------------ ---- ---- ---- ----
*PETF* Ferredoxin CP Ferredoxin → flavodoxin (short) 1 1 1 1
*FLDA*(s) Flavodoxin (short) CP Ferredoxin → flavodoxin (short) 2 0 1 1
*FLDA*(l) Flavodoxin (long) SP (ER?) None (distinct functional context) 1 1 1 1
*CYTC6*(type A) Cytochrome c6 CP Cytochrome c6 (type A) → plastocyanin 2 1 1 1
*CYTC6*(type B) Cytochrome c (?) SP (ER?) None (distinct functional context) 1 1 1 0
*PETE*/*PCY* Plastocyanin CP Cytochrome c6 (type A) → plastocyanin 1 0 0 1
Class II *FBA*(type A) Class II fructose-bisphosphate aldolase CP pyrenoid (Pt FBAC1) Class II FBA (type A) → class I FBA (type A) 1 1 1 1
Class II *FBA*(type B) Class II fructose-bisphosphate aldolase CP stroma (Pt FBAC2) Class II FBA (type B) → class I FBA (type B) 1 1 1 1
Class II *FBA*(type C) Class II fructose-bisphosphate aldolase Cytosolic (Pt FBA3) Class II FBA (type C) → class I FBA (type C) 1 1 1 1
Class I *FBA*(type A) Class I fructose-bisphosphate aldolase CP pyrenoid (Pt FBAC5) Class II FBA (type A) → class I FBA (type A) 1 0 1 1
Class I *FBA*(type B) Class I fructose-bisphosphate aldolase CP stroma Class II FBA (type B) → class I FBA (type B) 1 0 0 1
Class I *FBA*(type C) Class I fructose-bisphosphate aldolase Cytosolic (Pt FBA4) Class II FBA (type C) → class I FBA (type C) 1 1 1 1
*ISIP1* Iron starvation induced protein 1 Cell surface Receptor (?) 2 0 1 3
*ISIP3* Iron starvation induced protein 3 Cell surface Co-receptor (?) 1 1 1 2
The coastal diatom species *T. pseudonana*(Tp) lacks several genes that are found in the genomes of diatoms with high tolerance to low-iron conditions (*T. oceanica*(To), *P. tricornutum*(Pt), *F. cylindrus*(Fc)). Listed are also the respective counterparts whose products are subject to substitution under iron-limited conditions. The conserved paralogous genes of *FLDA*and *CYTC6*are predicted to contain a signal peptide and are assumed to act in a different functional context. CP chloroplast; ER endoplasmic reticulum; SP, secretory pathway.
The short flavodoxin isoform, plastocyanin and the class I FBAs are known or assumed to replace iron-containing counterparts under low-iron conditions. The two oceanic diatoms *T. oceanica*and *F. cylindrus*, which have some of the highest tolerance to low-iron conditions, both contain all five of the respective genes while *P. tricornutum*lacks two of them. The typical coastal species *T. pseudonana*lacks all except the gene for the cytosolic class I FBA, while at the same time having the highest requirement for iron in the group of diatoms for which genome information is currently available. Further, we find multiple copies of the *ISIP1*gene in *T. oceanica*and *F. cylindrus*, while this gene is absent in *T. pseudonana*. The presence or copy number of these genes in the tested diatom genomes suggests an adaptive significance with respect to the low-iron conditions found in oceanic waters.
### Domain duplications of iron-regulated cell-surface proteins
While differentially regulated genes for cell-surface proteins, identified from the low-iron response of *P. tricornutum*\[[@B20]\], like *ISIP1*, *ISIP2*, *FLDA*or *CREG*, represent single-copy genes encoding well-defined single-domain proteins, the situation in *T. oceanica*is different (Figure S2 in Additional file [3](#S3){ref-type="supplementary-material"}). Here, we find additional paralogous versions of several iron-regulated genes (*ISIP1*, *FLDA*), as well as diverse examples of domain duplications (*CREGx2*, *ISIP2x8*). In the case of iron-binding proteins the duplication of domains might provide benefits under iron limitation through a higher density of exposed domains, thereby increasing the affinity for iron at the cell surface \[[@B26]\].
With respect to the selective pressure encountered in the low-iron open ocean the duplication of complete genes may provide a possible mechanism for adaptation on the molecular level, in that it allows one of the two gene copies to vary, improve and optimize its iron-binding themes/motifs. This may potentially result in more efficient iron uptake. RT-qPCR allowed us to distinguish iron-regulated genes from their closely related paralogs (Figure S8 in Additional file [3](#S3){ref-type="supplementary-material"}).
### Iron uptake and the cell-surface protein ISIP1
Conservation between the predicted protein orthologs of ISIP1 in *T. oceanica*, *P. tricornutum*and *F. cylindrus*was high, and the orthologs exhibited identical secondary structure predictions (Figure [6](#F6){ref-type="fig"}). We found an amino-terminal signal peptide targeting the protein to the secretory pathway, while a carboxy-terminal transmembrane domain anchors the protein to a membrane. The major part of the protein is represented by a domain rich in β-strands that likely folds into a β-propeller-like structure. A clue to the structure and function of ISIP1 could be the low-density lipoprotein receptor LDLR, an important cell-surface receptor in humans \[[@B36]\]. Although its extracellular domains differ from the single β-propeller domain of ISIP1, the remainder of the protein is strikingly similar with regard to amino acid composition and secondary structure prediction. Hence, we may transfer the respective LDLR annotation to the ISIP1 protein model.
{#F6}
Accordingly, the ISIP1 protein would represent a cell-surface receptor, anchored to the plasma membrane by a carboxy-terminal transmembrane helix. A small carboxy-terminal tail without well-defined secondary structure contains a conserved endocytosis motif responsible for endocytotic cycling. An α-helical region amino-terminal from the transmembrane helix is predicted to be O-glycosylated and would thereby serve to expose the large β-propeller as a putative receptor domain to the extracellular space.
An alignment of the ISIP1 proteins from *T. oceanica*, *P. tricornutum*and *F. cylindrus*illustrates that the extracellular β-propeller domain contains a cysteine-rich center (Figure [6](#F6){ref-type="fig"}) whose pattern is reminiscent of cysteines found in Fe-S cluster proteins and might be involved in binding Fe. The cysteine-rich center is not found in the orthologous p130B of *Dunaliella salina*, which is thought to have undergone an evolutionary change in function and interacts with transferrin-like proteins \[[@B37]\].
### A conserved promoter motif associated with diverse iron-regulated genes
At the core of an organism\'s low-iron response are transcription factors (repressors or enhancers) and their respective binding sites (specific promoter motifs) that mediate the cellular response at the gene expression level. From pairwise promoter comparisons between the exclusively iron-regulated *ISIP1*, *FLDA*and *FBA3*genes of *T. oceanica*, *P. tricornutum*and *F. cylindrus*using dotlet \[[@B38]\] and MEME \[[@B39]\], we identified a conserved palindromic motif \'ACACGTGC\' located around position -200 from the translation start. Upon genome-wide screening, a total of 45 gene models contained the complete motif (perfect match) at a position of 150 to 250 bases before the translation start. Functional assignments for genes with positive matches were rarely possible (mostly hypothetical genes of unknown function and without significant regulation). However, the accumulation of low-iron responsive genes (*ISIP1*and three *FBA*genes) in this group is remarkable. In Figure S9 in Additional file [3](#S3){ref-type="supplementary-material"} we present only those genes whose orthologs in other species carry the motif in their promoters.
The complexity of the identified motif (A~2~T~1~C~3~G~2~) is high; its palindromic structure suggests binding of a homo- or heterodimeric protein factor. The remarkable conservation of this motif and its position (-200) relative to the translation start across three diatom species reinforces the suggestion that this motif plays a prominent role in iron-dependent gene regulation.
Discussion
==========
The cellular response to iron limitation
----------------------------------------
As the most prominent part of the complex low-iron response of *T. oceanica*we observe clear indications for an extensive cellular retrenchment, best seen in the reduced number and size of the chloroplasts. The proteomics and qPCR results indicate that not only is the iron-rich photosynthetic machinery affected, but that other cellular components also encounter a large-scale reduction, resulting in decreased growth rates. In addition, low-iron cells have a significantly lower protein biomass at roughly half that of iron-replete cells. We speculate that during the transformation from a high-iron/high-biomass cell to a low-iron/low-biomass cell the cellular biomass itself may serve as a supplementary energy source to compensate for the decrease in photosynthetic performance, that is, carbon fixation and generation of ATP. This is in line with the observation of increased cellular vesiculation in low-iron conditions (light microscopy) and increased lipid metabolism (transcriptomics and proteomics). It is also consistent with the relative increase of the mitochondrial respiratory machinery as deduced from the transcriptomics and proteomics data. As phototrophy, and thereby chloroplast energy metabolism, is largely impaired in low-iron conditions, mitochondrial respiration may provide a more constant and robust energy source that is retained, that is, excluded from the observed cellular retrenchment. Hence, we can describe the principal cellular changes observed at iron limitation as a metabolic shift with a gradual take-over of the energy metabolism by the mitochondrial system. Cellular maintenance under iron-limited conditions is further supported from biomass recycling through the action of isocitrate lyase and glutamine synthetase.
Moreover, changes in the photosynthetic machinery are likely a consequence of a coordinated remodeling process, indicating an intricate regulatory network that adjusts cellular energy demand in response to the availability of iron. The active remodeling as a response to low iron is an unexpected result since it was proposed earlier that photosynthesis of *T. oceanica*is constitutively adapted to a low-iron environment \[[@B12]\]. The observation of distinct cellular phenotypes in iron-limited versus iron-replete cultures may be due to the differing iron levels used in iron-replete control cultures, with approximately 60 nM applied by Strzepeck and Harrison \[[@B12]\] compared to the saturating 10 µM FeCl~2~used in this work, though not expected to ever occur under natural conditions. Nevertheless, our data demonstrate that *T. oceanica*possesses the potential to remodel its bioenergetic pathways in response to iron availability.
While the cultures in the present experimental setup were held under axenic photoautotrophic conditions, the situation in the natural context of the open ocean is very different. A major difference found between the artificially induced iron limitation of photoautotrophically growing cultures and the iron limitation encountered by diatoms in their natural habitats is the ubiquitous presence of particulate and dissolved organic matter in the latter, albeit dilute as in the case of the oligotrophic Sargasso Sea \[[@B40]\].
Some of the strongest up-regulated transcripts under low-iron conditions were found to be targeted to the secretory pathway, that is, with the cell surface or the vacuolar system as their destination. The functional annotation of the respective protein models reveals a complex suite of molecules capable of adhesion or degradative functions, suggesting a possible role in a mixotrophic context (Figure [5](#F5){ref-type="fig"}). Observations of diatom mixotrophy have been reported for five decades \[[@B41]\]. This characteristic has recently been explored for biotechnological application \[[@B42]\]. A principle metabolic competency for heterotrophic nutrition was demonstrated in transgenic *P. tricornutum*that were able to grow on sugar upon expression of a transgenic sugar transporter \[[@B43]\].
A hypothetical capability for mixotrophic nutrition and the conjoined ability to feed on dissolved and/or particulate organic matter would place diatoms in close proximity to the microbial loop responsible for recycling organic matter in the marine food web. Moreover, this would contribute to resolving the paradox of diatom survival in a low-iron world, as particulate and dissolved organic matter can be expected to be a relevant iron source. On the other hand, utilization of organic carbon/iron sources in low-iron conditions will immediately put the cell into competition with the bacterial community of diverse and specialized heterotrophs. In line with this scenario we find an up-regulation of both identified NRPS enzymes (Figure S8 in Additional file [3](#S3){ref-type="supplementary-material"}) that may mediate a bacterial defense response under iron-limited conditions.
Evolutionary roots and the impact of genome plasticity on adaptation to low iron
--------------------------------------------------------------------------------
Diatoms are the outcome of an endosymbiotic event that brought together two nutritional modes, each somewhat pre-adapted to low-iron conditions: phototrophy was contributed by the red-type plastids of the red algal endosymbiont, whose elemental composition shows a reduced iron requirement relative to the green-type plastids \[[@B8]\]; the host (related to ancient oomycetes) contributed an efficient heterotrophic machinery that might be retained to some extent in today\'s diatoms (compare \[[@B44]\]), thereby enabling exploitation of particulate and dissolved organic matter as a supplementary carbon and iron source. Survival under iron-limited conditions would have benefited from both the ancestral host\'s and symbiont\'s characteristics.
Additional adaptive strategies to the low-iron environment have probably also originated by means of horizontal gene transfer, with possibly as much as 5% of the conserved genes encoded in the *T. oceanica*genome being assigned to diverse taxonomic groups. This is consistent with the findings from the *Phaeodactylum*genome project \[[@B5]\] and appears to be a recurrent topic in diatom genomics. A prerequisite for integration of foreign DNA into a genome is its uptake, and an explanation for how lateral gene transfer might occur in heterotrophic cells has been proposed \[[@B45]\]. Accordingly, heterotrophic organisms would continuously take up and integrate new genes along with the organic matter they feed on, thereby creating some genetic redundancy that eventually leads to the permanent replacement of the genuine counterparts as long as no disadvantage is encountered. We take the proposed mechanism of lateral gene transfer, together with the extent of laterally acquired genes observed in *T. oceanica*, as additional evidence for mixotrophic potential in *T. oceanica*.
In low-iron conditions we observe the joint up-regulation of a reverse transcriptase and a CRE-like recombinase, thereby providing an appropriate mechanistic basis for genome rearrangements via transposon mobilization. Moreover, these are activated at a time where enhanced DNA input through increased uptake of organic matter might be expected under natural conditions. Stress-induced transposon activation has been reported for higher organisms as well - for example, \[[@B46]\].
The observed plasticity of diatom genomes clearly has ecological implications, as bacterial inventions such as genes that are beneficial in a competitive context might quickly find their way into diatom species and strains. We therefore state that the hypothesized close integration of diatoms within the microbial loop (due to mixotrophy) and their remarkable genomic plasticity (as seen from lateral gene transfer) are keys to diatoms\' ecological success: while mixotrophy opens up complex sources for carbon, energy and nutrients, the high capacity for lateral acquisition of genetic material facilitates adaptation in the context of the resulting competition with bacteria for organic matter, nutrients and iron.
Iron uptake, cellular iron requirements and adaptation of species to low iron
-----------------------------------------------------------------------------
For a better characterization of the complex cellular low-iron response it is necessary to distinguish the iron-specific aspects directed at counteracting the shortage of the limiting nutrient (substitution of iron proteins, induction of high-affinity iron uptake) from the rather general stress response directed at the situation of impaired growth and cellular starvation (cellular retrenchment, chlorosis, metabolic shift). With regard to the cellular iron economy we can define some constraints for beneficial adaptations to low-iron conditions \[[@B26]\].
Each evolutionary innovation that lowers the cellular iron requirements will favor survival under iron-limited conditions. Besides general biomass retrenchment - that is, the cellular adoption of a state with decreased biomass - the cell can actively lower its iron requirements through substitution of iron-containing proteins like ferredoxin or other metal enzymes that use iron as a cofactor. In addition to the well-known substitution pair ferredoxin/flavodoxin \[[@B10]\], we present evidence for the replacement of three metal-containing FBA enzymes by substitutes that use an amino acid-based Schiff-base catalysis instead. Differential regulation of diatom FBA genes was recently described for *P. tricornutum*and appears to be an evolutionarily conserved feature of several diatoms \[[@B27]\]. In *T. oceanica*we even find the apparently permanent functional replacement of an iron-rich counterpart as in the case of plastocyanin, though at the same time the genome harbors two genes encoding cytochrome c~6~whose function and regulation remain unknown. Cytochrome c~6~might be retained in the genome for replacing plastocyanin under specific circumstances like copper limitation, though this could not yet be observed \[[@B11]\]. Benefits may also arise from improved regulation of mutual substitution pairs - for example, as in the case of the transfer of the usually organellar ferredoxin gene *petF*to the nuclear compartment as found in *T. oceanica*\[[@B17]\].
Further, any improvement of the cellular iron-affinity and/or iron-uptake system will improve competitive fitness under low-iron conditions. The activation of a specific high-affinity uptake system as observed in yeast is expected to occur in diatoms as well. It has been found that reduction of Fe^3+^to Fe^2+^represents an essential step in uptake of organically complexed iron \[[@B47]\], suggesting that iron is extracted from its complexes prior to uptake. Accordingly, major players involved in iron uptake can be expected to be iron-complex-binding receptors, redox enzymes needed for extracting the iron from its complexes, possibly also specific iron-binding cell-surface molecules for short-term iron storage (like *D. salina*transferrins), ferric reductases and ferrous oxidases responsible for interconversion of the iron redox species +III and +II, and finally iron permeases for iron import. In this work on *T. oceanica*we were able to identify several candidate elements for the above groups. However, critical for iron-uptake kinetics is the overall iron-binding capacity of the cell surface, which directly depends on the sheer amount of iron-binding sites exposed to the cellular exterior \[[@B26]\]. A straightforward strategy to enhance the cellular capacity for iron binding is seen in the remarkable extent of domain duplications in iron-regulated cell-surface proteins. From the strong and exclusive expression in iron-limited conditions we speculate that ISIP1/ISIP3 are part of a specialized high-affinity iron-uptake system, with ISIP1 as the putative receptor (Figure [6](#F6){ref-type="fig"}). Carboxy-terminal endocytosis motifs as seen in ISIP1 (Figure [6](#F6){ref-type="fig"}) can also be found in other iron-regulated proteins (*T. oceanica*CREGx2, *P. tricornutum*ISIP2) and biochemical work is needed to confirm the location and proposed receptor function for these components. How far such features are species-specific adaptations or rather common to diatoms can only be clarified by a comparative genomic approach. Notably, screening for highly conserved iron-regulated genes in the genomes of *T. oceanica*, *T. pseudonana*, *P. tricornutum*and *F. cylindrus*revealed a correlation between the extent of a diatom\'s tolerance to low-iron and the presence of *ISIP1*and *PETE*, which directly impact cellular iron economy and uptake.
Conclusions
===========
From their evolutionary roots diatoms already appear to be pre-adapted to low-iron conditions through the endosymbiotic acquisition of a \'red\'-type photosynthetic machinery. While they have retained an implicit capacity for mixotrophy, the main contribution to cellular growth under conditions where iron or other nutrients limit the build-up of biomass, like in the iron-limited southern ocean or the oligotrophic Sargasso Sea, can be expected to stem from photosynthetic carbon assimilation.
The combined efforts in genomics, transcriptomics and proteomics reveal an unexpected metabolic flexibility in response to iron availability for *T. oceanica*CCMP1005. These responses include an extensive cellular retrenchment, the pronounced remodeling of bioenergetic pathways and an intrinsic shift to a mixotrophic life style. As a consequence of iron deprivation, the photosynthetic machinery undergoes remodeling into a photo-protected mode to cope with the overall decrease in photosynthetic electron transfer complexes. From the genomic and transcriptomic data we identify candidate components of a diatom high-affinity iron-uptake system, and we present a novel cellular strategy to enhance iron economy of phototrophic growth with the iron-regulated mutual substitution of three metal-containing FBA proteins.
The enormous genomic plasticity of *T. oceanica*, as seen from the large fraction of genes acquired through horizontal gene transfer, provides a platform for complex adaptations to the iron-limited ocean. The inferred dynamic exchange of genes between marine microbes suggests the genome of *T. oceanica*may not be an exceptional evolutionary invention, but rather that it may be seen as one possible outcome from a larger metagenomic gene pool. The future comprehensive characterization of this gene pool constitutes the ultimate challenge in appreciating the solutions that marine life found for defying the persistent shortage of iron in the open ocean.
Materials and methods
=====================
Strains, cultures and physiology
--------------------------------
The sequenced strain *T. oceanica*(Hustedt) Hasle et Heimdal CCMP1005 \[[@B48]\] was obtained from the Center for Culture of Marine Phytoplankton \[[@B49]\].
*T. oceanica*cells were grown in 8 l batch cultures using iron-free f/2 nutrients in artificial seawater medium (ASW) \[[@B50]\] at 100 µE, 25°C and a 14/10 h light/dark cycle. Iron-replete cultures (\'control\') were supplied in excess of other essential nutrients (10 µM FeCl~3~); no iron was added to the iron-limited cultures (\'stress\'), except for residual iron from the ASW salts, promoting iron-limited growth. Cells were harvested at late exponential growth phase by filtration on 5 µm polycarbonate filters of 47 mm diameter, resuspended into a small volume of media, followed by centrifugation at 4°C for 10 minutes at 11,000 rpm. Cell pellets were frozen in liquid N~2~and stored at -80°C.
For iron-limited cultures, iron-free techniques were applied as follows. Culture bottles were composed of plastic material, washed and incubated for some days with 1 N HCl and rinsed with ultrapure MilliQ water. All additional supply for iron-free work was washed with 1 N HCl and stored in closure bags until use. Iron-limited cultures were best achieved from a minimal inoculation volume of 10 to 20 µl or less than 10,000 cells.
Throughout this work we compare cells from late exponential growth phase, though we recommend to use iron-limited cells from late stationary phase when working on specifically low-iron responsive genes (for example, from compensation pairs or involved in iron uptake). For these, the expression level at the late stationary phase is found to be even higher than in the late exponential phase.
Total cellular protein was determined for iron-replete and iron-limited cells as follows. First, 85.5 million cells each were concentrated by centrifugation. The resulting pellets were frozen in liquid N~2~and stored at -80°C. For protein determination, pellets were re-dissolved and lysed in 200 to 300 µl SDS/CO~3~buffer with additional application of ultrasonication. Cell debris was precipitated by 4 minutes of centrifugation at room temperature and maximum rpm; 5 to 10 µl of the supernatant served as input for bicinchoninic acid (BCA) protein assay (Thermo Fisher Scientific, Waltham, MA, USA). SDS/CO~3~buffer was composed of 4% SDS, 68 mM Na~2~CO~3~and 0.4 mM phenylmethylsulfonyl fluoride (the latter was dissolved in EtOH to obtain a 100 mM stock solution).
The variable chlorophyll fluorescence F~v~/F~m~of *T. oceanica*cells was measured from fresh cultures with a PhytoPAM (PHYTO-PAM Phytoplankton Analyzer, Heinz Walz GMBH, Effeltrich, Germany) \[[@B51]\] upon 5 minutes of dark incubation.
Comparative genomics was done with genome data available at the Joint Genome Institute for *T. pseudonana*(Hustedt) Hasle & Heimdal CCMP1335 \[[@B4]\], *P. tricornutum*Bohlin CCAP1055/1 \[[@B5]\] and *F. cylindrus*(Grunow) Krieger CCMP1102 \[[@B19]\].
Microscopy and confocal microscopy
----------------------------------
*T. oceanica*was imaged *in vivo*using confocal laser scanning microscopy LSM 510 (Zeiss). Chlorophyll autofluorescence was excited at 488 nm (1% laser intensity), and emission recorded with a long pass (LP) 650 nm filter. Images were made using a Plan-Neofluar 40×1.3 oil objective (Zeiss). Z-section image series were captured with LSM 510 v3.2 software (Zeiss). Three-dimensional reconstructions of the chlorophyll fluorescence signal were made using the cell surface area-/cell volume-analyzing \'Surpass\' program module in Imaris 7.1.1 (Bitplane, Zürich, Switzerland). Images were segmented using consistent threshold values. Surface area grain size was set at 0.1 µm. In 20 cells from both iron-replete and iron-limited cultures, cell dimensions were calculated from transmission image measurements based on a cylinder model. Chloroplast dimensions were calculated from three-dimensional chlorophyll autofluorescence signal reconstructions.
Despite imaging in a narrow time window (12:00 ± 2 h), growth in the *T. oceanica*cultures was not synchronized. Thus, the observed values for the parameters with a growth-dependent variability are accordingly distributed over a characteristic growth range. The representative cellular and chloroplast dimensions provided in Table [2](#T2){ref-type="table"} were therefore determined from the statistical mean of 20 cells by calculating back to a cell at the beginning of its cell cycle. For this purpose we used a regular cylinder that expands through a gradual two-fold increase of its height as a model for the diatom cell. Around the statistical mean from all cells (of a variable parameter like cell volume) we created a range whose higher end differs from the lower end by a factor of 2, thereby representing a two-fold increase of that parameter during growth of the diatom cell. The lower end of that range is given in Table [2](#T2){ref-type="table"} as a representative value for a \'cellular unit\', that is, a freshly divided cell at the beginning of its cell cycle.
Nucleic acid extraction and sequencing
--------------------------------------
*T. oceanica*CCMP1005 was grown as axenic clonal culture from a single cell isolate obtained from serial dilutions of a stock culture to extinction. Nuclear gDNA for sequencing of the *T. oceanica*genome was extracted from nutrient-replete cells and separated from organellar gDNA in a CsCl gradient (Figure [1](#F1){ref-type="fig"}) using the alternative cetyltrimethlyammonium bromide protocol for algae \[[@B52]\].The quality of nucleic acids was assessed from NanoDrop UV absorption profiles and agarose gel electrophoresis. Second generation sequencing technology was applied to the gDNA as follows. After mechanical shearing by nebulization, followed by end-repair, specific sequencing adaptors were ligated. The genomic DNA fragments were shotgun sequenced using massive parallel pyrosequencing \[[@B53]\] on a Roche 454 GS-FLX instrument (Roche, Penzberg, Germany) according to the manufacturer\'s protocol.
Total RNA for transcriptome sequencing was extracted from frozen pellets of iron-replete and iron-limited *T. oceanica*cells from late exponential growth phase using the QIAGEN (Hilden, Germany) RNeasy kit. RNA quality was assessed from NanoDrop UV absorption profiles and agarose gel electrophoresis. For reverse transcription of total RNA the SMART cDNA synthesis kit from Clontech (Mountain View, CA, USA) was used with 1 µg input material and 15 rounds of amplification. The size distribution of the obtained cDNA libraries were controlled with agarose gel electrophoresis and then subjected to Roche 454 sequencing as described above for gDNA.
Transcriptomics
---------------
Global gene expression was assessed through Roche 454 massive parallel pyrosequencing of cDNA libraries prepared from total RNA extracted from iron-limited and iron-replete cultures. The 2× 95,000 sequence reads from both libraries were pooled, cleaned from adapter ends and processed in a combined assembly revealing 11,264 contigs (that is, transcript fragments) that map to approximately 6,500 distinct AUGUSTUS gene models (Additional file [10](#S10){ref-type="supplementary-material"}). The differential read contribution from the Fe(-) and Fe(+) libraries to each contig is taken as a measure for the differential transcription of the respective gene. For the purpose of statistically evaluating the gene expression level across our two cDNA libraries, we applied a log-likelihood ratio test statistic as described in Stekel *et al*. \[[@B22]\].
Differentially regulated genes were first screened with T-ACE \[[@B54]\], a transcriptome database browser that plots the assembled transcript fragments according to their differential regulation (Figure [4a](#F4){ref-type="fig"}) and provides information from BLAST analyses against the NCBI nr protein (NR) database and the Conserved Domain Database.
Models from selected genes were manually curated and annotated for protein function and location as described above (Additional file [6](#S6){ref-type="supplementary-material"}).
RT-qPCR
-------
RT-qPCR was done as in \[[@B17]\] and is described in the Supplementary Methods in Additional file [3](#S3){ref-type="supplementary-material"}. Primers are listed in Additional file [11](#S11){ref-type="supplementary-material"}. The differential regulation between high and low iron conditions with respect to 18S and RPB1 (threshold level) is shown in a ΔΔC~T~plot as calculated below:
$$\Delta\Delta\textsf{C}_{\textsf{T}} = \left\lbrack {\Delta\textsf{C}_{\textsf{T}}@\textsf{Fe(~+~)~-~}\Delta\textsf{C}_{\textsf{T}}@\textsf{Fe(~-~)}} \right\rbrack$$
where ΔC~T\ =~(C~T~gene 1 - C~T~gene 2) and represents the difference between the qPCR threshold cycle values (C~T~) of gene 1 (the gene of interest) and gene 2 ( the house-keeping gene, either the 18S rRNA or RPB1).
(Figure S8 in Additional file [3](#S3){ref-type="supplementary-material"}).
Proteomics
----------
The proteomes of iron-replete and iron-limited cells were analyzed in a mass spectrometry approach. Differentially labeled iron-sufficient and iron-deficient cells were mixed at equal protein concentration and fractionated by SDS-PAGE. Protein bands were excised, digested in-gel with trypsin and subjected to LC-MS/MS analyses. Identification and quantification of peptides and proteins was performed using Proteomatic data evaluation pipelines \[[@B55]\] as follows. To provide candidate peptides in the database search step using OMSSA \[[@B56]\], several sequence sources were used: (1) the AUGUSTUS gene models, (2) Genomic Peptide Finder peptides \[[@B57]\], (3) high quality chloroplast protein models, (4) a set of manually curated protein models. Resulting peptide/spectral matches were filtered with a hit distinctiveness filter, using a threshold of 2. Peptide/spectral matches were further filtered with a dynamically determined E-value threshold to achieve an estimated false discovery rate of 1% \[[@B58]\]. Finally, all peptide/spectral matches with a precursor mass deviation \>5 ppm were discarded.
A total of 1,695 peptides could be identified from two independent biological experiments and assigned to 767 protein groups. All identified peptides were subsequently quantified using qTrace \[[@B59]\], resulting in the quantification of 633 protein groups and an additional set of 88 quantified peptides, which were identified exclusively via Genomic Peptide Finder. For the determination of Fe(-)/Fe(+) protein ratios, all resulting combinations of peptide, SDS-PAGE band and charge state were grouped and all group ratios were combined into a total protein group ratio by calculating the median and interquartile range.
Data for differential protein expression as revealed from the mass spectrometry approach refers to equal amounts of total protein. For relating the observed regulation to a \'cellular unit\', the ratio of cellular protein biomass \[Fe(-)/Fe(+)\] as determined from a BCA (bicinchoninic acid) protein assay needs to be taken into account.
Bioinformatics
--------------
Bioinformatic analyses are described in the Supplementary Methods in Additional file [3](#S3){ref-type="supplementary-material"}.
Data access
-----------
The *T. oceanica*CCMP1005 whole genome shotgun assembly is registered as bioproject 36595, the *T. oceanica*CCMP1005 transcriptome shotgun assembly is registered as bioproject 73029. The genomic and transcriptomic Roche 454 GS FLX sequence reads from this study have been submitted to the NCBI Sequence Read Archive \[[@B60]\] under accession numbers SRA045826 and SRA045825, respectively. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession AGNL00000000. The version described in this paper is the first version, AGNL01000000. AUGUSTUS gene models deduced from the genome assembly have been assigned the gene loci accession numbers THAOC_00001 to THAOC_37921. The transcriptome assembly has been submitted to the NCBI Transcriptome Shotgun Assembly database \[[@B61]\] under accession numbers JP288099 to JP297710. The proteomics mass spectrometry mzML data associated with this manuscript may be downloaded from the Tranche repository \[[@B62]\] using the following hash: \'T9vKohxPxffmhOBsgb9kTlBKCrQIQYziH8hdonm9scou13EAFv57Uo+XYTj4d8XHbLRxR03+6WeDRSp2yhpp348wzWsAAAAAAABjUg==\'. The data from this study can be accessed in an integrated form with the *Thalassiosira oceanica*Genome Browser \[[@B18]\].
Abbreviations
=============
CCAP: Culture Collection of Algae and Protozoa; CCMP: Culture Collection of Marine Phytoplankton; EST: expressed sequence tag; FBA: fructose-bisphosphate aldolase; FCP: fucoxanthin-chlorophyll a/c-binding protein; Fe(-): iron deplete; Fe(+): iron replete; gDNA: genomic DNA; HNLC: high-nitrate low-chlorophyll; HSF: heat shock factor; ISIP: iron starvation induced protein; LC-MS/MS: liquid chromatography-tandem mass spectrometry; LDLR: low-density lipoprotein receptor; LGT: lateral gene transfer; LHCSR: light harvesting complex stress responsive subunit; NCBI: National Center for Biotechnology Information; NRPS: non-ribosomal peptide synthase; ORF: open reading frame; PCR: polymerase chain reaction; PS: photosystem; RT-qPCR: reverse transcription-quantitative PCR.
Competing interests
===================
The authors declare that they have no competing interests.
Authors\' contributions
=======================
ML prepared the *T. oceanica*RNA used for transcriptomics, was involved in genomics, transcriptomics and proteomics data analysis, performed manual gene modeling and annotation, contributed the comparative genomics section, prepared the figures, and drafted the manuscript. MS developed the bioinformatic tools for analysis of the proteomics data and prepared Figure [4b](#F4){ref-type="fig"}. ML and MS conducted the gene prediction on the *T. oceanica*genome assembly using AUGUSTUS. ASR cultured the algae, carried out the RT-qPCR work and commented on the manuscript. LK performed the assembly of the Roche 454 reads and a general blast and domain annotation. RA set up the web-server and Generic Model Organism Database, annotated gene models, and helped with genome and proteome analysis. MAG carried out the confocal microscopy and the three-dimensional rendering of chlorophyll autofluorescence signals. JW and SVB carried out the proteomics experiment and participated in the proteomics analysis. MBS prepared the gDNA libraries, performed the Roche 454 sequencing and generated the initial assemblies. UCK prepared the cDNA libraries for transcriptomics. RGB and RA contributed the phylogenetic analysis of LGT genes. PR coordinated the sequencing and contributed to manuscript writing. MH coordinated the proteomics and contributed to manuscript writing. JLR coordinated the study, isolated the *T. oceanica*gDNA and contributed to manuscript writing. All authors read and approved the final manuscript.
Supplementary Material
======================
###### Additional file 1
**Supplemental table - BLAST analysis of AUGUSTUS-predicted protein models versus the NCBI Non-redundant Protein (nr) database and the Conserved Domain Database**. The table lists the best BLAST hits from a BLASTP analysis of AUGUSTUS-predicted protein models against NCBI nr protein and Conserved Domain Database. The file is in .xls format (compressed to .zip).
######
Click here for file
###### Additional file 2
**Phylogenetic trees for *T. oceanica*LGT candidate genes**. The file comprises 254 unrooted, Newick-formatted trees containing candidate LGT genes as described in the main manuscript. Trees and corresponding support values were generated using FastTree. Novel *T. oceanica*genes are identified in the trees by a reference number followed by \'\_TO\'. Homologs from the \'nr\' database identified using BLAST are given in the form \'Genus_GI\', except for matches to unnamed genera, which are shown as RefSeq GI number followed by \'X\'. Visual inspection of trees was performed by importing this file into FigTree (Andrew Rambaut 2007) and assigning a root as described in the Supplementary Methods in Additional file 3. The file is in .tre format (compressed to .gz).
######
Click here for file
###### Additional file 3
**Supplementary Methods and Figures**. The file provides a description of the RT-qPCR as well as of the bioinformatics methods (genome assembly and analysis, setup of the *T. oceanica*genome browser and phylogenetic analyses). It further contains supplementary Figures S1 to S9. Figure S1: taxonomy of genes acquired by lateral gene transfer (2). An overview of the taxonomic assignments for LGT candidate genes as revealed from a refined phylogenetic analysis. Figure S2: duplications of genes and domains occurring in genes whose regulation is dependent on the cellular supply with iron. Figure S3: metabolic shift. The change in relative abundance of organellar RNA between *T. oceanica*cells subjected to high or low iron. Figure S4: correlation plot P versus T. The extent of correlation between proteomics (P) and transcriptomics (T) data. Figure S5: FCP proteomics. The variation in the response of different FCP light-harvesting proteins to iron limitation. Figure S6: phylogenetic tree of flavodoxin proteins. A neighbor-joining tree of diatom flavodoxin proteins. Figure S7: phylogenetic tree of FBA proteins. A neighbor-joining tree of diatom fructose bisphosphate aldolase proteins. Figure S8: qPCR ΔΔC~T~. The differential regulation of genes in response to low iron. Data represent the change in transcript level for iron-limited *T. oceanica*when compared to an iron-replete control. Figure S9: promoter motif. The conservation across diatom species of a motif found in the promoters of several iron-regulated genes. The file is in .pdf format.
######
Click here for file
###### Additional file 4
**Gene abbreviations list**. The file lists gene abbreviations and gene product descriptions for all genes mentioned in this paper. The file is in .xls format.
######
Click here for file
###### Additional file 5
**Supplemental sequences - curated protein models**. The file lists 436 manually curated protein sequences from nuclear genes (with custom identifiers x1 to x12 and p1 to p455) together with the 158 proteins encoded by the organellar genomes in FASTA format.
######
Click here for file
###### Additional file 6
**Supplemental table - manual transcriptome annotation**. The table lists annotation information for all protein sequences provided in Additional file 5. The file is in .xls format.
######
Click here for file
###### Additional file 7
**Supplemental sequences - selected protein models discussed in the manuscript**. The file lists sequences of proteins that we explicitly refer to in the discussion of the low-iron response. The sequences are provided in FASTA format.
######
Click here for file
###### Additional file 8
**Supplemental table - overview of low-iron responsive genes**. The table contains more detailed annotation information for all protein sequences provided in Additional file 7. Deviation of a custom curated model from its respective official \'t1\'-AUGUSTUS prediction is indicated as \'mod\'. The file is in .xls format.
######
Click here for file
###### Additional file 9
**Supplemental table - comparative genomics of selected genes with a putative adaptive relevance**. The table contains all official database identifiers for the gene products listed in Table [3](#T3){ref-type="table"}. The file is in .xls format.
######
Click here for file
###### Additional file 10
**Supplemental table - BLAST mapping of *T. oceanica*transcript fragments versus NCBI databases and other diatom genomes**. The table provides a comprehensive overview for all 11,264 transcript fragments with read statistics, best BLASTX hits to NCBI nr and Conserved Domain Database, and additional best TBLASTX hits to the genomes of *T. pseudonana*, *P. tricornutum*and *F. cylindrus*, notably including worldwide web link-outs to the respective orthologous genes of these species. The file is in .xls format (compressed to .zip).
######
Click here for file
###### Additional file 11
**Supplemental table - primers used for RT-qPCR**. The table lists the sequences of all primers used in the RT-qPCR experiments. The file is in .xls format.
######
Click here for file
Acknowledgements
================
We thank Prof. Stefan Rose-John (Institute of Biochemistry, Christian-Albrechts-University Kiel, Kiel, Germany) for advice in the isolation of nuclear genomic DNA from *T. oceanica*and access to his laboratory and equipment, and Prof. Stefan Schreiber (Institute of Clinical Molecular Biology, Christian-Albrechts-University Kiel, Kiel, Germany) for extensive help in building up sequencing resources in Kiel. Prof. Thomas Bosch (Institute of Zoology, Christian-Albrechts-University Kiel, Kiel, Germany) and Dr Georg Hemmrich-Stanisak (Institute of Clinical Molecular Biology, Christian-Albrechts-University Kiel, Kiel, Germany) provided help with the initial contig assembly. We thank Tania Klüver (Leibniz Institute of Marine Sciences at Kiel University IFM-GEOMAR, Kiel, Germany) for help with the laboratory experiments and culturing of the algae. Dr Dhwani Desai (Leibniz Institute of Marine Sciences at Kiel University IFM-GEOMAR, Kiel, Germany) helped with bioinformatics analyses and setup of the genome browser. The upper left light micrograph in Figure 1 showing *T. oceanica*in valve view is courtesy of CCMP. Sequence data from *F. cylindrus*were produced by the US Department of Energy Joint Genome Institute \[[@B63]\] in collaboration with the user community. This work was supported in part by a DFG grant to JLR (RO2138/6-1) and by funding from the DFG Cluster of Excellence \'Future Ocean\' (EXC 80) to JLR and PR. MH and JLR acknowledge funding from the BMBF \'BIOACID\' (03F0608N) program. RA received funding from EC FP7/2007-2011 under grant agreement number PITN-GA-2008-215157 and EC FP7 Grant \#205419 (ECOGENE).
| {
"pile_set_name": "PubMed Central"
} |
Anyone who has tried to tag a moving Cromwell B knows the true meaning of frustration! This highly mobile, quick reloading medium tank is one of the most effective in its class — especially in the hands of a tanker who can fire its 75 mm cannon accurately while on the move. All Cromwell B bundles come with a "zero-Skill" Crew with Brothers in Arms Perks and the vehicle has special exterior customization! | {
"pile_set_name": "OpenWebText2"
} |
Meeting Schedule
2017
All general membership Meetings are held on the first Wednesday of the month unless otherwise posted.
All meetings begin atT 7:30 PM
Directions to Holtsville Ecology CenterLong Island Expressway --- Go south at exit 63, 3 traffic lights (2 miles) turn right on Route 99, Woodside Avenue. Go to second road, Buckley Road and turn right, entrance to the park is on the right side.
Sunrise Highway --- Get off at Exit 52 (CR 19 Patchogue Holbrook Road). Go north and at the second light after Sunrise Hwy, turn right onto Buckley Road. The entrance is approximately 1.2 miles on your right.
Nichols Road --- Get off at Patchogue Holbrook Road. Head south and go to second light. Turn left on to Route 99 Woodside Ave. Turn left onto Buckley Road, the entrance is 1/10 mile. | {
"pile_set_name": "Pile-CC"
} |
Wireless bridging provides a simple method for connecting building sites without cabling or can be used as a backup to existing wired links. If you have hundreds of nodes or bandwidth-hungry applications and data transmitting between sites, bridging your networks will require more than 11 Mbps provided by the 802.11b standard. However, by using the following Cisco-tested design, you can easily and effectively aggregate and load balance the bandwidth of three 802.11b-compliant Cisco Aironet® bridges to support up to a 33-Mbps half-duplex connection between bridge locations.
The use of standard technology and protocols including virtual LANs (VLANs), VLAN trunks, equal-cost load balancing, and routing protocols makes this design easy to configure and troubleshoot. More importantly, it makes support from the Cisco Technical Assistance Center (TAC) possible.
Load balancing is a concept that allows a router to take advantage of multiple best paths (routes) to a given destination. When a router learns multiple routes to a specific network -- via static routes or through routing protocols -- it installs the route with the lowest administrative distance in the routing table. If the router receives and installs multiple paths with the same administrative distance and cost to a destination, load balancing will occur. In this design, the router will see each wireless bridge link as a separate, equal-cost link to the destination.
Note: The use of equal-cost load balancing and the routing protocols mentioned in this article are a Cisco-supported means of aggregating Cisco Aironet bridges for additional throughput between sites or as a redundant failover wireless bridge link.
If your design requires failover capabilities, the use of a routing protocol is required. A routing protocol is a mechanism to communicate paths between routers and can automate the removal of routes from the routing table, which is required for failover capabilities. Paths can be derived either statically or dynamically through the use of routing protocols such as Routing Information Protocol (RIP), Interior Gateway Routing Protocol (IGRP), Enhanced IGRP, and Open Shortest Path First (OSPF). The use of dynamic routes for load balancing over equal-cost wireless bridge routes is highly recommended because it is the only means available for automatic failover. In a static configuration, if one bridge fails, the Ethernet port of the other bridge will still be active and packets will be lost until the problem is resolved. Therefore, the use of floating static routes will not work for failover purposes.
With routing protocols there is a tradeoff between fast convergence and increased traffic needs. Large amounts of data traffic between sites can delay or prevent communication between routing protocol neighbors. This condition can cause one or more of the equal-cost routes to be removed temporarily from the routing table, resulting in inefficient use of the three bridge links.
The design presented here was tested and documented using Enhanced IGRP as the routing protocol. However, RIP, OSPF, and IGRP could also be used. The network environment, traffic load and routing protocol tuning requirements will be unique to your situation. Select and configure your routing protocol accordingly.
The active forwarding algorithm determines the path that a packet follows while inside a router. These are also referred to as switching algorithms or switching paths. High-end platforms have typically more powerful forwarding algorithms available than low-end platforms, but often they are not active by default. Some forwarding algorithms are implemented in hardware, some are implemented in software, and some are implemented in both, but the objective is always the same -- to send packets out as fast as possible.
Process switching is the most basic way of handling a packet. The packet is placed in the queue corresponding to the Layer 3 protocol while the scheduler schedules the corresponding process. The waiting time depends on the number of processes waiting to run and the number of packets waiting to be processed. The routing decision is then made based on the routing table and the Address Resolution Protocol (ARP) cache. After the routing decision has been made, the packet is forwarded to the corresponding outgoing interface.
Fast switching is an improvement over process switching. In fast switching, the arrival of a packet triggers an interrupt, which causes the CPU to postpone other tasks and handle the packet. The CPU immediately does a lookup in the fast cache table for the destination Layer 3 address. If it finds a hit, it rewrites the header and forwards the packet to the corresponding interface (or its queue). If not, the packet is queued in the corresponding Layer 3 queue for process switching.
The fast cache is a binary tree containing destination Layer 3 addresses with the corresponding Layer 2 address and outgoing interface. Because this is a destination-based cache, load sharing is done per destination only. If the routing table has two equal cost paths for a destination network, there is one entry in the fast cache for each host.
Both fast switching and Cisco Express Forwarding (CEF) switching were tested with the Cisco Aironet bridge design. It was determined that Enhanced IGRP dropped neighbor adjacencies under heavy loads less often using CEF as the switching path. The main drawbacks of fast switching include:
The first packet for a particular destination is always process switched to initialize the fast cache.
The fast cache can become very big. For example, if there are multiple equal-cost paths to the same destination network, the fast cache is populated by host entries instead of the network.
There's no direct relation between the fast cache and the ARP table. If an entry becomes invalid in the ARP cache, there is no way to invalidate it in the fast cache. To avoid this problem, 1/20th of the cache is randomly invalidated every minute. This invalidation/repopulation of the cache can become CPU intensive with very large networks.
CEF addresses these issues by using two tables: the forwarding information base table and the adjacency table. The adjacency table is indexed by the Layer 3 addresses and contains the corresponding Layer 2 data needed to forward a packet. It is populated when the router discovers adjacent nodes. The forwarding table is an mtree indexed by Layer 3 addresses. It is built based on the routing table and points to the adjacency table.
While another advantage of CEF is the ability to allow load balancing per destination or per packet, the use of per-packet load balancing is not recommended and was not tested in this design. Bridge pairs may have different amounts of latency, which could cause problems with per-packet load balancing.
Quality of Service (QoS) features can be used to increase the reliability of routing protocols. In situations with heavy traffic loads, congestion management or avoidance techniques can prioritize routing protocol traffic to ensure timely communication.
Setting the Fast Ethernet bridge ports and associated Layer 2 switch ports to 10-Mbps full duplex will increase reliability by causing congestion to be queued at the switch instead of the bridge, which has limited buffers.
For designs that require the emulation of full duplex links, it's possible to configure the administrative distance of the equal-cost links between sites to create two unidirectional links. With this design, the third bridge set could be used as a failover link or not be installed at all. Note that this specific design was not tested.
Traffic will flow from site 1 to site 2 across bridge pair 1 and from site 2 to site 1 across bridge pair 2. In the event that either bridge pair fails, bridge pair 3 will work as the failover link. See your specific routing protocol documentation for more information on how to configure the administrative distance.
EtherChannel® is another technology that can be used to aggregate bridges into a virtual single link. Using EtherChannel for this purpose is not recommended, however, as it is not a supported design by Cisco and the Cisco TAC. Furthermore, you will be unable to manage some bridges via TCP/IP due to the way EtherChannel works. The port aggregation protocol (PagP) is not a tunable protocol and failover support is limited.
As a general rule, as clients move farther away from the Access Point, signal strength increases and therefore the data rates decreases. If the client is closer to the AP, then the data rate is higher.
QoS is a technique that is used in order to prioritize certain packets over other packets. For example, a voice application heavily depends on QoS for uninterrupted communication. As of late WMM and 802.11e have emerged specifically for wireless application. Refer to Cisco Wireless LAN Controller Command Reference, Release 6.0 for more information.
In an environemnt where homogeneous clients are found to exist, data rates are higher than in a mixed environment. For example, the presence of 802.11b clients in a 802.11g environment, 802.11g has to implement a protection mechanism in order to co-exist with the 802.11b client, and therefore results in decreased data rates.
The following information is specifically related to the actual testing of the aggregation of three Cisco Aironet 350 Series bridges. The equipment used included six Cisco Aironet 350 bridges, two Cisco Catalyst® 3512 XL switches, and two Cisco 2621 routers. This design may also be used with two bridge pairs instead of three. The test design used Enhanced IGRP as the routing protocol with equal-cost load balancing, and CEF as the forwarding mechanism.
Most likely you will be using some hardware other than the specific models tested. Here are some guidelines when choosing the equipment to be used to aggregate bridges.
The routers used for testing had two Fast Ethernet (100-Mbps) ports and supported 802.1q trunking and CEF-based switching. It's possible to use a single 100-Mbps port to trunk all traffic to and from a switch. However, the use of a single Fast Ethernet port was not tested and could interject unknown issues or negatively impact performance. A router with four Fast Ethernet ports would not require the use of a VLAN trunking protocol. Other router considerations include:
If the routers don't support 802.1q trunking, check if they support ISL trunking, a Cisco proprietary trunking mechanism that can be used in place of 802.1q. Before you configure the routers, verify that your switch supports ISL trunking.
For Cisco 2600 and 3600 Series routers, IP Plus code is required for 802.1q trunk support (this would be a cost upgrade from IP code).
Depending on the hardware and its intended use, the base flash and DRAM may need to be increased. Take into consideration additional memory-intensive processes such as CEF tables, routing protocol requirements, or other processes running on the router that are not specifically related to the bridge aggregation configuration.
CPU utilization may be a consideration depending on the configuration and features used on the router.
The switches in the tested design require support for VLANs and 802.1q trunking. Using inline power-enabled switches such as the Cisco Catalyst 3524PWR when using Cisco Aironet 350 Series bridges is recommended, as this will make the setup less cumbersome. To collapse the switch and routing functionality into a single box, the Catalyst 3550 was tested and works quite well.
Using Cisco Aironet 340 Series bridges will work as well, but the configuration would be slightly different since the Cisco Aironet 340 uses 10-Mbps half duplex Ethernet ports and a different operating system.
Use VPN with the Cisco Aironet Base Station—A typical use of the Cisco Aironet® Base Station Ethernet (BSE) and Base Station Modem (BSM) is for accessing the Internet over cable or DSL connection using virtual private network (VPN) technology. This document shows how to set up the base station unit for use with VPN.
Support Cisco CatOS SNMP traps—Trap operations allow Simple Network Management Protocol (SNMP) agents to send asynchronous notifications that an event has occurred. Learn which traps are supported by the Catalyst® OS (CatOS) and how to configure them.
Get the lowdown on CISCO-BULK-FILE-MIB—Learn how to use the CISCO-BULK-FILE-MIB and transfer files created by this Management Information Base (MIB) using the CISCO-FTP-CLIENT-MIB. Starting with Cisco IOS® Software Release 12.0, Cisco has implemented a way to store a Simple Network Management Protocol (SNMP) object or table as a file on the device. This file can then be retrieved using the CISCO-FTP-CLIENT-MIB, allowing you to transfer large amounts of data using a reliable transport method.
Caching in on savings—Calculate cache savings using the tools and commands available on Cisco cache engines, content engines, and routers.
Set up shunning on a UNIX director—Cisco Intrusion Detection System (IDS) Director and Sensor can be used to manage a Cisco router for shunning. In this how-to, a Sensor is configured to detect attacks on the router "House" and communicate the information to the Director. | {
"pile_set_name": "Pile-CC"
} |
Testimonials
To really know what coaching can do for you, read what others have to say…
Elaine Simpson
Office Manager, Mother & Grandmother
Rogers, AR, USA
I’ve had the privilege to be “coached” by Dan Carson. Going into these sessions, I wasn’t sure what it was all about or even what we would talk about, but was surprised to find my sessions with Dan enlightening. I have a habit of just going through life without plans or goals, during several sessions I would have an “aha!” moment , realizing that there were things I could do to accomplish more in my life than I had even thought of before. As a result I have branched out of my comfort zone and learned several new things. I have learned to set goals in dealing with others and to pray for people more. I would definitely recommend Dan as a Life Coach.
Amanda Huffman
Human Resources Officer & Mother of 2
Austin, Texas, USA
Balance does not come to me naturally. I am the type of person who dives into things head first and get tunnel vision. Combined with the fact that I lead recruiting and HR in a start-up I lost the battle of finding balance quickly. I was in desperate need of reconnecting my mind, my body and spirit. I was stuck and wanted to function in life in a more peace filled and higher level manner. I knew I needed to work on organization, so all aspects of my life will would in synergy together and had no idea how to do it. And then I found Dan Carson.
Dan has a special talent in his line of work. He is compassionate, loving, spiritual (on a universal level), insightful and empowering. Dan has many tools, but I think the most amazing thing that he does is really listen and hear what you are fumbling and trying to say. He pinpointed the roots of my issues, and is helping me work through them. Dan has an uncanny ability to get to the heart of what is going on with you. He is intuitive and insightful and gave me a fresh perspective. Dan knows exactly what to say and stimulates dialogue, knowing when and how to push and when it is too much.
Dan’s enthusiasm and calm are contagious. Trust usually takes time for me to establish, but with Dan, he garnered it instantly. There is no judgment from Dan. He is grounded and intuitive and I found this to be so empowering. This is NOT coaching that requires you to do months of work to start seeing results. I quickly began to break through blocks. He has a great way of helping you re-energize and gain clarity and momentum quickly. He is a natural born motivator, but doesn’t browbeat or nag you to help you meet your goals, or even to define and set them. We have a very collaborative relationship. He guides you with empathy. Dan is very intuitive and is a subject matter expert… on life!
Dan has helped me implement changes in my life, both in work and personal and stayed with me to support me while making those changes really happen. We work together at me being my best and doing more than I thought I could do. He is never afraid to tell me the truth in the most supportive and gentle way even in emotionally charged situations. He handles everything with such finesse that it feels positive.
I am not saying that he does magic, like “poof” and your life gets better. Dan helps you understand how your mind and body is connected, and gives you tools so you can work on your stuff. He is a rare gem and I can’t recommend him enough!
Mark Haines
Pastor
Bay City, Michigan, USA
Have you ever worked on a project for a long time only to think if I had known that sooner I would have saved a lot of time? Dan Carson is the kind of coach who will help you discover those things sooner. I know because he has helped me. | {
"pile_set_name": "Pile-CC"
} |
Anti-Trump backlash drove voters to the polls, leading to historic gains for the Democrats. The Virginia state legislature will undergo a huge culture change, as a lot of old white dudes were replaced by the legislature's first out Lesbian, first two Latina women, first Asian-American woman, first Democratic Socialist, and the first openly transgender legislator to be elected in America. (This last legislator, Danica Roem, will likely garner most of the attention from this group, and for good reason: not every state legislator attends the American Music Awards with Demi Lovato, and GOP legislators are being forced to deal with gendered titles and pronouns, probably for the first time in their lives.)
After a number of close races, the election ended with the GOP holding onto a slim majority at 51-49. However, some races are still undecided.
Over in the 94th District, incumbent David Yancey has only a 10-vote (!) lead over Democratic challenger Shelly Simonds.
The 28th is the biggest mess. Republican Bob Thomas is ahead of Democrat Joshua Cole by 82 votes, but some voters in the district apparently got the wrong ballot. (Thanks to incredibly stupid election laws, voter precincts don't always overlap with House districts. See this VPAP overview if you want to understand how this works.)
The state Board of Elections has just certified the results of the last of these elections, so we can move on to the recount/challenge phase.
What's at stake here?
The outcomes of these three contested elections will determine which party controls one of the houses of Virginia's bicameral (two-house) legislature. The House of Delegates has 100 members, and it’s been skewed heavily towards the GOP in past years – in 2017, it was 66 to 34 for the Republicans.
Again, the GOP lead is now down to 51 to 49. And, if a single one of the three contested election results are reversed at any point, the house would be evenly divided. That’s happened at least once before in the chamber’s history, and both parties worked out a power-sharing arrangement, with co-Committee Chairs and shared speaker duties.
Over in the Senate, legislators get four-year terms, so their next election isn’t until 2019. But that house also has just a narrow Republican majority, 21-19.
So what can happen to change the GOP majority?
A bunch of things can change the House of Delegates math, actually. There are at least four ways that the Democrats could block the Republicans from controlling the chamber:
1. Recounts
Virginia state law allows losing candidates to request a recount, as long as they lost by less than 1% of the total votes cast. You don't need a lot of math to realize that all three of the contested races fall within that margin. Still, Hugo and Thomas probably have little to worry about here; it's unlikely that a recount will turn up enough miscounted or discounted votes to overcome their lead.
Yancey, on the other hand, is SUPER vulnerable. We last saw a recount for the 2013 Attorney General election; there election officials found ~750 more Democratic votes statewide. Based on that math, finding more than 10 new votes for Democrats in a single district is certainly possible. In fact, insiders say Democratic votes are more likely to be found in recounts. (This is probably due to demographics; Democrats are more likely to claim poor, young, and inexperienced voters.)
The 2013 recount took place over two days in mid-December, so we'll probably know the recount outcomes before the legislative session starts in January.
2. Contest in the house
Our endlessly inventive Virginia election laws also allow losing candidates to contest the election in the General Assembly. It’s not clear if this has ever happened before, so it's hard to know exactly how this would proceed. But the state code allows for such a challenge to be overseen by the House's Committee on Privileges and Elections. If the chamber remains Republican-controlled, it's unlikely the contest will go anywhere. But under a power-sharing arrangement, things could get more interesting.
3. Court challenges
Democrats will most likely look to the courts for the 28th district, where voters were assigned the wrong ballots. Still, only about 80 votes seem to be at question here. Surely not all of them voted Democratic, so it's unlikely the Democrats could generate enough votes from these folks even if they were allowed to submit new ballots.
The Democrats might instead try to get the original results thrown out and demand a special election. But they would have to find judges willing to interfere with election outcomes, which they are generally reluctant to do. The bottom line: these court challenges are less about the legal arguments made, and more about the politics of the situation. Will any Virginia judges be willing to wade into partisan politics and "overturn" an election? My guess is no, but we’ll see soon.
4. Political appointments
One final method that the Democrats could use: Governor-Elect Ralph Northam has a lot of jobs to fill in his administration. Some Republicans are worried he could try to change the legislature's math by offering plum spots to Republican Delegates or Senators. At the same time, the Governor has to be careful not to pull a legislator out of a weak Democratic district.
Northam's transition team may not end up affecting this year’s legislature much. (His predecessor, Terry MacAuliffe, only created one special election through appointment, and that wasn’t until August.) But remember that being a state legislator is only a part-time job; administration appointments can be lucrative, as well as allowing significant contributions to public service. Everyone will be eying the work of his transition team very closely.
Why do we care?
This is fascinating for political junkies for sure. But there are real policy consequences stemming from partisan control. For example, Republicans have blocked Medicaid expansion for years; so 400,000 Virginians who could have health insurance should care greatly about which party runs the legislature. Laws covering reproductive rights, gun regulations, and the environment all depend on whether or not they can get through committees.
So there’s a lot at stake. The next few weeks will determine what happens. Stay tuned. | {
"pile_set_name": "Pile-CC"
} |
Post navigation
We have our new work for October’s workshop! David Gaukroger is busy producing the music for his new children’s opera which we expect to become as popular as Romany Wood.
We are privileged to to have the first performance and are proud to know that the last Festival’s Romany Wood workshop – notably the children’s orchestra (a first in itself) – was the inspiration for this new work.
We will have lots of fun (and hard work) with Rebecca’s World which the three primary school orchestras will start work on immediately. The choir contingent will begin towards the end of term.
The Irfon Valley School Orchestra is under way and, unusually, rehearses in school time so it is not competing with lunchtime play. It is already booked for the Festival Holy Saturday concert.
David Gaukroger (composer of Romany Wood) is working on a new composition for children’s orchestra and choir after being inspired by the children’s orchestra brought together for 2014’s Romany Wood at Garth Village Hall.
Holy Saturday (4 April) will be inspired by the Chaos and Creation elements of Haydn’s Creation Oratorio and we will be joined by Irfon Valley School Orchestra.
The Festival is scheduled for 2-4 October (a week earlier than usual) and we will move the children’s workshop (with the new work by David Gaukroger) to Sunday and have the Mervyn Bourdillon Memorial Concert on Saturday Evening.
Gareth Cornelius (head teacher of Irfon Valley Primary School) has given the go ahead for a lunchtime school orchestra, starting after Christmas. Irfon Valley will join Llanelwedd and Builth Primaries in providing an ensemble for all the children learning orchestral instruments. See the projects page for more details.
The festival plans to bring these groups together in future events.
We thank South Powys Youth Music (SPYM) who, in recognition of our work in encouraging primary ensembles and similar projects, is providing financial support.
The performance of Haydn’s Seven Last Words Quartets at Beulah Chapel on Holy Saturday was accompanied by readings, poetry and songs on the theme of Remembering 1914. There was a small exhibition of memorabilia and a thematic image was projected for each word.
All the proceeds, amounting to £105.20 were donated to Help for Heroes.
We are pleased to announce that this celebrated men’s choir will join us in the Mervyn Bourdillon Memorial Concert on 12 October at Eglwys Oen Duw. The programme will include orchestral pieces from the Festival Ensemble and will be finalised as soon as possible. | {
"pile_set_name": "Pile-CC"
} |
PROJECT SUMMARY This UO1 application is a response to the NIMH Program Announcement intended to accelerate the development of a high priority therapeutic agent by establishing its dose-related pharmacodynamic effects on biomarkers designed to inform subse- quent clinical development. Dopamine D1 receptor (D1R) agonism is among the most highly prioritized adjunctive treatment mechanisms for schizophrenia. Currently, all D1R agonists are also D5R agonists. D1R/D5R agonists have pro-cognitive and antipsychotic-like effects in preclinical studies, reflecting their ability to stabilize prefrontal cortical network activity in the face of distractors, and to enhance the precision of spatial working memory (sWM) by enhancing inhibitory tuning of prefrontal cortical (PFC) functional connectivity (FC). Yet, dose-related benefits of D1R/D5R agonism in patients could not be demonstrated in prior pilot studies. This application proposes that the testing of D1R/D5R agonists requires both a more direct translational/computational neuroscience framework (i.e., the most appropriate biomarkers) and a precision medicine strategy (i.e., the appropriate subpopulation of patients). To accelerate the selection of an optimal dose, we propose a multi- center study that densely maps the dose-related effects of the D1R/D5R partial agonist, PF-06412562 immediate release (IR), on three informative translational functional neuroimaging (fMRI) biomarkers as primary outcome measures: i) sWM-related activation; ii) task-based FC; and iii) resting-state FC in early course schizophrenia patients. Primary Aim 1 will apply a mul- tivariate analytic strategy to these three outcome measures (sWM-related activation, task-based FC and resting-state FC) to test if PF-06412562 produces a dose-related effect. This multivariate translational neural marker is designed and powered to inform a clear Go/No-Go decision with regards to proceeding to a full-scale clinical trial. A Go decision will be indicated if there is a significant dose-related drug effect on the neural signal measured via the multivariate combination of task-evoked activation and FC during the sWM task and FC during rest. Conversely, a No-Go decision will be reached if there is an absence of a dose-related effect on the multivariate index. Secondary Aim 2 will quantify dose-related drug effects on sWM precision based on behavioral data collected during fMRI. Exploratory Aim 3 will model the biophysical properties of PF- 06412562 in a cortical circuit model capable of sWM simulations, which will simulate hypothesized molecular mechanisms governing pro-cognitive PF-06412562 effects on sWM. In turn, we will will test if the dose-related pattern of PF-06412562 effects on resting FC in patients maps onto D1R and D5R receptor transcriptomic profiles in humans derived from from Allen Human Brain Atlas. Finally, Exploratory Aim 4 will study potential clinical predictors and moderators of PF-06412562 ef- fects on neuroimaging biomarkers. Collectively, this translational biomarker study informs the highest priority experimental treatment mechanism identified by the NIMH MATRICS Initiative using a precision medicine strategy that targets a specific subpopulation of early course schizophrenia patients who may pro-cognitively respond to D1R/D5R agonism. | {
"pile_set_name": "NIH ExPorter"
} |
--- a/pppd/sha1.c
+++ b/pppd/sha1.c
@@ -18,7 +18,7 @@
#include <string.h>
#include <netinet/in.h> /* htonl() */
-#include <net/ppp_defs.h>
+#include "pppd.h"
#include "sha1.h"
static void
| {
"pile_set_name": "Github"
} |
Southampton V Yeovil at St. Mary's Stadium : LIVE
Southampton midfielder James Ward-Prowse has backed Saints to reach the fifth round of the FA Cup - regardless of which side Mauricio Pochettino sends out to face Yeovil.
The Southampton boss fielded a strong side in the 4-3 third-round win over Burnley but, with a Barclays Premier League game against Arsenal on Tuesday evening, there may be a chance for some of Pochettino's fringe players to show their worth in their fourth-round tie.
The Burnley victory is the only game Ward-Prowse has started since the turn of the year but the 19-year-old is likely to start at home to Sky Bet Championship strugglers Yeovil as he targets a place in the last 16.
"Playing Yeovil is a winnable game and after this we will be looking at the tasty end of the competition, so we will be looking to win this for sure," he said.
"The mentality of the club and the manager is that we want to win every game, whether it is Yeovil in the cup, or Manchester United.
"The Arsenal game comes into consideration but we have just come off a busy Christmas period and we showed we could deal with that really well - the depth of the squad and the quality we have got, I don't think any team that is put out will be weakened."
With Ward-Prowse one of a number of players looking to force their way into Pochettino's Premier League side, the England Under-21 international knows a good performance against the Glovers is the best way to get noticed.
He continued: "Within English football we know the love of the FA Cup and I'm sure a lot of the players will be wanting to go out and make a statement to get through to the next round.
"I love playing in the FA Cup and it is a good chance to show everyone what you can do - it is always a competition that has been close to my heart."
Saints' assistant manager Jesus Perez has said the club will approach the game as if it were a league fixture and that Yeovil will not be underestimated.
"We are fully aware of them [Yeovil]," he said. "We did the same scouting on them as we do for a Premier League game.
"We know they won their last game and they are near the bottom of the table, but in the FA Cup the pressure is off and the players are a little bit different, so we have to face the game with full respect and full focus from the first minute to try to win it.
"Our target before the game is to talk more about us than our opponent in this situation and the players are aware that if we don't play with full focus then you will face problems during the game.
"You have to try to play in the same style as normal, keep the ball, play attacking and nice football so that you can forget about anything else.
"When the players have to think too much they lose focus, so it's important that we look forward and play well to win the game and get into the next round."
Dejan Lovren and Gaston Ramirez are both missing after suffering similar ankle ligament injuries while the game will come too soon for midfielder Victor Wanyama.
Striker Dani Osvaldo will also be missing after he was banned by the club for two weeks following a training-ground altercation with a team-mate.
Yeovil will be able to field loan signing Ishmael Miller. The powerful striker arrived from Nottingham Forest on Thursday until the end of the season and has been given the green light to feature by his parent club.
There will be a change at left-back for the away day after Zoumana Bakayogo returned to Leicester having damaged his cruciate ligament on his debut at Birmingham. With Liam Davis sidelined due to a broken toe, Jamie McAllister or Luke Ayling look set to step in.
Ed Upson is clear of his ankle problem and came through an appearance in a friendly against Plymouth unscathed and he is pushing for a start but Matteo Lanzoni is cup tied. | {
"pile_set_name": "Pile-CC"
} |
Q:
How do I get the pcap lib on Ubuntu?
I have a programming assignment where I need to use the pcap lib.
#define _BSD_SOURCE
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include <pcap.h> // <-- missing include
#include <netinet/ip.h>
#include <netinet/tcp.h>
void logpacket( unsigned char* payload, struct ip* ipheader, struct tcphdr* tcpheader )
{
//...
}
int main(int argc, char* argv[] )
{
//...
}
How can I get the library files I need to compile this program?
A:
For Ubuntu 12.04, 12.10, 13.10, 14.04 and onward open the terminal and type:
sudo apt-get install libpcap0.8-dev
| {
"pile_set_name": "StackExchange"
} |
A well-designed Domain Specific Language (DSL) can help you be more productive as a developer, thus making you, your team and your clients happier. In this post, I’ll guide you through the design and creation of a simple DSL to create EPUB files. We’ll start with a regular API and refactoring until we get to a DSL solution.
A short into to DSLs
At it’s very core, DSL is a fancy term for a very simple language designed to solve something in particular. It’s domain-specific because it works in a very particular use-case, the most common ones being configuration files and APIs. If you are a Ruby developer then you have most likely used a DSL already. RSpec is one of the most popular:
describe "Something" do subject { SomeClass.new } it { is_expected.not_to be_nil } it "passes" do subject.greet eq "Hello!" end end 1 2 3 4 5 6 7 8 9 10 describe "Something" do subject { SomeClass . new } it { is_expected . not_to be_nil } it "passes" do subject . greet eq "Hello!" end end
That code is in a language designed to helps us write tests in a more natural way following the BDD testing methodology.
The result is code that is more understandable to you as a human — programmer or otherwise. Even if you’ve never used Ruby before, or don’t know about RSpec, you get an idea of what it is, it describes the functionality of Something.
The biggest drawback of DSLs is that you need to learn a new language every time — it’s easier to always use the same interface for all libraries. The advantage, though, is that the API is much more friendly and easier to use in the long-run. It’s an investment, the easiest the library, the lesser bugs consumers have, and everyone loves having less bugs. 🙂
So let’s get starting building a DSL. I’ll guide you through the design and creation of a simple DSL to create EPUB files. Starting with a regular API, we’ll refactor until we get to a DSL solution.
The design
EPUB is a format for digital books used by iOS and macOS. It’s basically a bunch of HTML files zipped together, following certain naming rules and ceremony. Without getting too deep into the file format specification, let’s just assume for now that all EPUBs must have a title, a description and at least one chapter. Initially, one could think of an API design as follows:
generator = EPUBGenerator.new(title: "My Awesome Book", description: "An awesome book, really.") generator.chapter = Chapter.new(title: "Chapter 1", contents: "Once upon a time...") book_path = generator.generate puts "The book was created, it now lives in #{book_path}" 1 2 3 4 5 generator = EPUBGenerator . new ( title : "My Awesome Book" , description : "An awesome book, really." ) generator . chapter = Chapter . new ( title : "Chapter 1" , contents : "Once upon a time..." ) book_path = generator . generate puts "The book was created, it now lives in #{book_path}"
That looks good, right? If the problem is that simple, then we are done. But what if the generator needs more than just a title and a description. Let’s say we now also need an author and a URL. We could just add more arguments:
generator = EPUBGenerator.new(title: "My Awesome Book", description: "An awesome book, really.", author: "Federico Ramirez", url: "http://blog.beezwax.net") 1 2 generator = EPUBGenerator . new ( title : "My Awesome Book" , description : "An awesome book, really." , author : "Federico Ramirez" , url : "http://blog.beezwax.net" )
You might say “Meh it’s not that bad”. And you would be right! But we are taking an unnecessary risk, four arguments for a method is a red flag — it can get out of hand quite easily.
There are many ways to solve that issue, the most common of which is to “extract it into an object”. Let’s create a Book model. We just add the arguments as attributes, make sure the data is always consistent and just inject that object into our generator. Now our code is not only more solid and easier to maintain, but we have the added benefit of testability.
Now we are done… well, not really. Consider now that our EPUB generation library is a Ruby gem. We’ll force all our users to know all the class names: EPUBGenerator , Chapter and Book .
If the library is this small, it’s not really a big deal. If we know we’ll need to expose the user to more classes, then we might want to consider a better solution. This is where a DSL comes handy.
A DSL gives us yet another layer of abstraction. In this example, with a single class name, the user can easily use the library to create a new EPUB:
generator = EPUBGenerator do |g| g.title "My Awesome Book" g.description "An awesome book, really." g.author "Federico Ramirez" g.url "http://blog.beezwax.net" end 1 2 3 4 5 6 7 generator = EPUBGenerator do | g | g . title "My Awesome Book" g . description "An awesome book, really." g . author "Federico Ramirez" g . url "http://blog.beezwax.net" end
The way that looks is arbitraty, that’s just a common format for DSLs. With domain-specific languages it’s easier to start with “how it looks” and then move into the implementation, as the other way around might be harder if you have never made a DSLs before.
Now that’s a good enough solution. The code is simple and easy to read. We are still missing a few things though. What would a chapter definition look like? Easy!
generator = EPUBGenerator do |g| g.title "My Awesome Book" # ... g.chapter do |c| c.title "Chapter 1" c.contents "Lorem ipsum dolor sit amet..." end end 1 2 3 4 5 6 7 8 9 10 generator = EPUBGenerator do | g | g . title "My Awesome Book" # ... g . chapter do | c | c . title "Chapter 1" c . contents "Lorem ipsum dolor sit amet..." end end
You start to notice a pattern here, if chapters needed some dependency, we just pass a new block:
generator = EPUBGenerator do |g| g.title "My Awesome Book" # ... g.chapter do |c| c.title "Chapter 1" #... c.footnote do |f| f.contents "Hello! I'm a footnote." end end end 1 2 3 4 5 6 7 8 9 10 11 12 13 14 generator = EPUBGenerator do | g | g . title "My Awesome Book" # ... g . chapter do | c | c . title "Chapter 1" #... c . footnote do | f | f . contents "Hello! I'm a footnote." end end end
Good! We now have our general design, let’s make it happen!
The implementation
Ruby’s yield is what makes it so easy to write DSLs. You can think of it as a function which gets called with whatever arguments we give it.
class EPUBGenerator def self.generate book = Book.new yield book generator = Generator.new(book) generator.generate end end 1 2 3 4 5 6 7 8 9 class EPUBGenerator def self . generate book = Book . new yield book generator = Generator . new ( book ) generator . generate end end
In the code above, pass book , an instance of Book to a block of code. We don’t know what the code-block will do with it, that responsibility is up to the caller. The generate method call looks like this:
generator = EPUBGenerator.generate do |book| puts "I have a book! #{book}" end 1 2 3 4 generator = EPUBGenerator . generate do | book | puts "I have a book! #{book}" end
We’ve abstracted away the Book class name dependency! We’ve also reduced the ceremony for creating books, it’s much simpler now. Let’s repeat this process of yieding code blocks for the Book model:
class Book attr_reader :chapters def initialize @chapters = [] end # getter/setter def title(text = nil) return @title if text.nil? @title = text end def chapter chapter = Chapter.new yield chapter chapter.id(chapters.count + 1) chapters << chapter end end 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 class Book attr_reader : chapters def initialize @ chapters = [ ] end # getter/setter def title ( text = nil ) return @ title if text . nil ? @ title = text end def chapter chapter = Chapter . new yield chapter chapter . id ( chapters . count + 1 ) chapters < < chapter end end
Nice! Our generator now looks like this:
generator = EPUBGenerator.generate do |b| b.title "My Awesome Book" b.chapter do |c| # ... do something with chapter object end end 1 2 3 4 5 6 7 8 generator = EPUBGenerator . generate do | b | b . title "My Awesome Book" b . chapter do | c | # ... do something with chapter object end end
We are still lacking functionality, but the important thing is to realize that every time we write b.<something> in the generator, we are actually calling a method on a book instance.
That’s it! The hard part is done! From now on, it’s quite straightforward to implement the missing functionality. For the sake of completeness, let’s make another model, the Chapter :
class Chapter attr_reader :title def initalize @title = "Not defined" end def title(text = nil) return @title if text.nil? @title = text end end 1 2 3 4 5 6 7 8 9 10 11 12 class Chapter attr_reader : title def initalize @ title = "Not defined" end def title ( text = nil ) return @ title if text . nil ? @ title = text end end
The generator can now add titles to chapters:
generator = EPUBGenerator.generate do |b| b.title "My Awesome Book" b.chapter do |c| c.title "Chapter 1" end end 1 2 3 4 5 6 7 8 generator = EPUBGenerator . generate do | b | b . title "My Awesome Book" b . chapter do | c | c . title "Chapter 1" end end
Wrapping up
We’ve built our own DSL. And it wasn’t even hard! If you are curious and want the full source code, you can see a fully working gem on GitHub. The complete DSL looks like this:
path = Epubber.generate do |b| b.title 'My First EPUB book' b.author 'Ramirez, Federico' b.description 'This is an example EPUB' b.url 'http://my-url.com' b.cover do |c| c.file File.new('my-image.jpg') end b.introduction do |i| i.content '<p>This is an introduction.</p>' end b.chapter do |c| c.title 'Chapter 1' c.content '<p>This is some content!</p>' end b.chapter do |c| c.title 'Chapter 2' c.content '<p>Some more content this is.</p>' end end 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 path = Epubber . generate do | b | b . title 'My First EPUB book' b . author 'Ramirez, Federico' b . description 'This is an example EPUB' b . url 'http://my-url.com' b . cover do | c | c . file File . new ( 'my-image.jpg' ) end b . introduction do | i | i . content '<p>This is an introduction.</p>' end b . chapter do | c | c . title 'Chapter 1' c . content '<p>This is some content!</p>' end b . chapter do | c | c . title 'Chapter 2' c . content '<p>Some more content this is.</p>' end end
BONUS TIP
Yielding blocks is used everywhere in Ruby. It is particularly useful for making sure resources are beeing handled properly, the most common example is file manipulation. In order to write to a file we have to open it for writing, write stuff, and then close it.
file = open_file('my_file.txt', 'w') file.write("Something") file.close 1 2 3 4 file = open_file ( 'my_file.txt' , 'w' ) file . write ( "Something" ) file . close
If we forget to close the file, we won’t get any errors, but it might lead to unexpected behavior. That’s not good, we want all our users to always close the file after they write to it. We can easily solve this with yield : | {
"pile_set_name": "OpenWebText2"
} |
Q:
I18n - locale file - use ruby - use translation()
In a I18n locale file (eg el.yml):
can I use translation method in order to use an already defined translation?
can I use ruby code inside?
For example, in the locale yml file, in several places I want to use the word "Invalid". So one approach is to translate the word "Invalid" each time
Another approach is to translate it once, at the top, and then in each translation inside the locale yml which contains this word I could use something like t(:invalid)..
eg:
el:
# global translations - in order to be used later in the file
locked: 'kleidomeno'
invalid: 'mi egiro'
password: 'kodikos'
devise:
failure:
invalid: "#{Invalid} %{authentication_keys} or #{password}."
locked: "Your account is #{locked}."
last_attempt: "You have one more attempt before your account is #{locked}."
not_found_in_database: "#{invalid} %{authentication_keys} ή #{password}."
A:
can I use translation method in order to use an already defined translation?
Yes, that's what I18n translation comes for, e.g.
t 'something'
can I use ruby code inside?
No, it's a .yml file, which does not accept Ruby or any other programming languages.
Another approach is to translate it once
To translate once, you can write a new Rake task to generate the target yml for you.
Or maybe, wrap the official translation function with a new method, which can recognize your custom string syntax:
# custom translate
def ct(msg)
msg.gsub(/#\{\s*([^\}]+)\s*\}/) {|_| t $1}
end
Call it like:
ct 'Your account is #{locked}.'
I think you'd better remove these failure strings out of your yml file if so.
| {
"pile_set_name": "StackExchange"
} |
Tüzer See
Tüzer See is a lake in the Mecklenburgische Seenplatte district in Mecklenburg-Vorpommern, Germany. At an elevation of 51.5 m, its surface area is ca. 0.25 km².
Category:Lakes of Mecklenburg-Vorpommern | {
"pile_set_name": "Wikipedia (en)"
} |
EVANSVILLE, Ind. -- A Mount Vernon, Indiana, man with a history of sexual violence has been arrested after his alleged victim escaped and reported him to Evansville police.
Roy Clifford Bebout, 46, was booked into the Vanderburgh County Jail at 3:57 a.m. Saturday morning, where he remains on no bond. He faces felony charges of battery with a deadly weapon, battery by strangulation, criminal confinement while armed with a deadly weapon and kidnapping while armed with a deadly weapon.
Bebout is on the Posey County sex offender registry, classified as a violent sexual predator. He was out on probation from Marion County, where he was sentenced to 45 years for kidnapping and rape charges in 1998, according to Vanderburgh County circuit court records from 2014.
According to a probable cause affadavit, a juvenile female approached a METS bus driver Friday afternoon near the 200 block of North Main Street in the vacant parking lot of the former IGA grocery store building.
The bus driver's report to police said the girl was screaming, "He's trying to kill me."
When officers arrived, the girl was handcuffed behind her back. She told police she had been walking to work when a man in a red Dodge dually pickup truck jumped out and threatened her with a handgun.
The affadavit states that a struggle ensued between Bebout and the victim. The girl told officers she was choked and handcuffed by the man. He also tried to gag her by placing a yellow ball in her mouth, she told police.
During the struggle, the victim told police, she was able to reach pepper spray she carries and sprayed it on her alleged attacker. She then escaped and ran away to the parking lot, where the METS bus was parked, she said.
The bus driver stated he saw the man get into the red Dodge and drive away.
Officers searching the ground found a cell phone which they soon determined belonged to Bebout. A contact listed as "mom" in the phone was called and was found to be Bebout's mother. She confirmed the phone belonged to her son, that he drove a red Dodge truck and that he lived with her.
During an interview with detectives, the female victim identified Bebout in a photo lineup of six men, saying she was 90 percent sure the man in the photo was her attacker.
Police found Bebout in Princeton, Indiana late Friday night.
More:Evansville welcomes four new firefighters
More:This Southern Indiana legend is terrifying. But is it true? | Webb | {
"pile_set_name": "OpenWebText2"
} |
Interleukin (IL)-6 and IL-10 induce decorin mRNA in endothelial cells, but interaction with fibrillar collagen is essential for its translation.
Decorin, a small multifunctional proteoglycan, is expressed by sprouting endothelial cells (ECs) during inflammation-induced angiogenesis in vivo and by human ECs co-cultured with fibroblasts in a collagen lattice. To investigate how decorin is induced, human EA.hy 926 ECs and/or human umbilical vein ECs were treated with interleukin (IL)-10 and IL-6. Both treatments induced decorin mRNA in human ECs. IL-6 and IL-10 led to a dose-dependent mRNA increase with a maximum at 10 and 50 ng/ml, respectively. The combination of both interleukins together had a stronger effect than one alone. Immunostaining demonstrated that both interleukins caused decorin synthesis in ECs and the formation of capillary-like structures in a collagen lattice. However, immunoprecipitations of interleukin-treated ECs cultured on plastic were negative. Only interleukin-stimulated ECs grown on a collagen type I matrix or growth factor-reduced Matrigel were able to synthesize the proteoglycan. Acid-soluble collagen type I did not support decorin protein synthesis. The addition of antibodies to alpha(1) or alpha(2) integrins or the alpha(2) integrin inhibitor rhodocetin led to an inhibition of synthesis. These data show that IL-10 and IL-6 induce decorin mRNA transcription, but additional signals from the extracellular matrix are necessary for its translation. | {
"pile_set_name": "PubMed Abstracts"
} |
July 7th 1339
The re-possession of Perth
The lade used to surrond three sides of Perth
After the death of Robert the Bruce in 1329, Scotland entered another period of uncertainty. Edward
Balliol, with the support of Edward 3rd of England, invaded the country and after winning the battle of
Dupplin occupied Perth and was crowned at Scone. His triumph was short lived, Perth was reoccupied
by the Scots and Balliol was forced back over the border.
The following year he was back again with a large body of English barons and their followers. The
country was re-occupied and Balliol swore fealty to Edward as his Lord Paramount. As time went by
it became more and more obvious that it was only the presence of the English soldiers that enabled
Balliol to remain in control. Slowly the Scots regained the strong points within the kingdom and by
1339 they commenced the task of repossessing Perth. By this time it was under the command of Sir
Thomas Ughtred and the city was strongly fortified. Surrounded on three sides by the Town Lade, it was
very difficult to scale the defences and with the fourth side fronting the Tay the garrison was enabled
to receive supplies from the English ships on the river.
The siege continued for over two months without any great success until five French ships-of-war
sailed into the Tay estuary and were able to blockade the river. At the same time, under the direction
of the Earl of Ross, a new passage was dug to divert the waters of the Lade before they reached Perth.
The defenders were dismayed to find the water level in the moat dropping alarmingly, so much so that
the Scots could fill up the channel with brushwood.
July 7th was fixed as the day for the final assault but before the horns could sound for action an
eclipse of the sun started. There was consternation both within and without the town of Perth. An
eclipse was thought to portend some great disaster though to whom was not altogether clear. It was
decided to postpone the assault for another day, but Sir Thomas Ughtred had by this time already
decided that further resistance was useless. He capitulated to the Scottish forces and was permitted to
march out from the city with all the honours of war. He and his men were then conveyed back to
England in the English ships lying in the Tay. In accordance with the old system the fortifications of
Perth were once more razed to the ground.
This was now almost the end of the English occupation; the castles of Stirling and Edinburgh were soon
captured and in 1341 David and his Queen returned to Scotland from their exile in France. | {
"pile_set_name": "Pile-CC"
} |
Strategies to control alkoxy radical-initiated relay cyclizations for the synthesis of oxygenated tetrahydrofuran motifs.
Radical relay cyclizations initiated by alkoxy radicals are a powerful tool for the rapid construction of substituted tetrahydrofurans. The scope of these relay cyclizations has been dramatically increased with the development of two strategies that utilize an oxygen atom in the substrate to accelerate the desired hydrogen atom transfer (HAT) over competing pathways. This has enabled a chemoselective 1,6-HAT over a competing 1,5-HAT. Furthermore, this allows for a chemoselective 1,5-HAT over competing direct cyclizations and β-fragmentations. Oxygen atom incorporation leads to a general increase in cyclization diastereoselectivity over carbon analogues. This chemoselective relay cyclization strategy was utilized in the improved synthesis of the tetrahydrofuran fragment in (−)-amphidinolide K. | {
"pile_set_name": "PubMed Abstracts"
} |
Q:
mysql CREATE TRIGGER after insert on Update column with count
it gives error. I don't understand why.
CREATE TRIGGER `estatecat_piece` AFTER INSERT ON `estate`
FOR EACH ROW
BEGIN
UPDATE estate_category set piece = (Select count(*) from estate where estate.estatecat_id=new.estatecat_id);
ERROR 1064 (42000): You have an error in your SQL syntax; check the
manual that corresponds to your MySQL server version for the right
syntax to use near '' at line 1
-EDIT-
agian error...
mysql> DELIMITER ; CREATE TRIGGER `estatecat_piece` AFTER INSERT ON `estate` FOR EACH ROW BEGIN UPDATE estate_category set piece = (Select count(*) from estate where estate.estatecat_id=new.estatecat_id); END; DELIMITER ;
mysql>
mysql> show triggers;
Empty set (0,00 sec)
_ LAST ATTEMPT'S ERROR _
mysql> DELIMETER $$ -> CREATE TRIGGER estatecat_piece
-> AFTER INSERT ON estate FOR EACH ROW
-> BEGIN
-> UPDATE estate_category set piece = (Select count(*) from estate where estate.estatecat_id=new.estatecat_id) where estatecat_id=new.estatecat_id;
ERROR 1064 (42000): You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'DELIMETER $$
CREATE TRIGGER estatecat_piece
AFTER INSERT ON estate FOR EACH ROW ' at line 1
A:
The immediate issue with your first statement is that it has BEGIN without a corresponding END. In this case, END should be at the very end of the CREATE TRIGGER statement.
Once you add the END keyword, the statement becomes technically correct, but you will have trouble executing it in MySQL. The reason is that semicolons, while being standard statement delimiters in SQL, are also treated by MySQL in a special way. MySQL splits the input text at semicolons and sends each part of the text to the server separately. The server thus receives incomplete, syntactically incorrect pieces and returns an error. See here for more details:
Defining Stored Programs
So, to prevent MySQL from doing that, you need to instruct it to use a different symbol as a delimiter – that is what the DELIMITER command is for. Consequently, your second attempt should be something like this:
DELIMITER $$
CREATE TRIGGER `estatecat_piece`
AFTER INSERT ON `estate`
FOR EACH ROW
BEGIN
UPDATE estate_category set piece = (Select count(*) from estate where estate.estatecat_id=new.estatecat_id);
END$$
DELIMITER ;
The first DELIMITER command tells MySQL to parse the input text until $$ is encountered from that point on. Your CREATE TRIGGER should, therefore, end with the $$ symbol so that MySQL can consume it in its entirety and send the whole statement to the server. Finally, the second DELIMITER command restores the standard delimiter for MySQL to resume normal processing of your commands.
There is also a simpler solution, but it works only in cases similar to yours. The trigger body in your case consists of a single statement. That allows you to omit the keywords BEGIN and END from your statement and, as a result, avoid using the DELIMITER command at all:
CREATE TRIGGER `estatecat_piece`
AFTER INSERT ON `estate`
FOR EACH ROW
UPDATE estate_category set piece = (Select count(*) from estate where estate.estatecat_id=new.estatecat_id);
The above trigger will work exactly the same.
On a different note, your UPDATE statement may have a flaw: as currently written, it will update the piece column in every row with the same row count – that of the category matching the inserted row. If the table has multiple rows, each for a different category, you probably need to introduce a filter on new.estatecat_id to your UPDATE statement, similar to the filter in the subquery, in order to update only the corresponding piece value:
UPDATE
estate_category
SET
piece = (
SELECT
COUNT(*)
FROM
estate
WHERE
estate.estatecat_id=new.estatecat_id
)
WHERE
... /* specify the necessary column name */ = new.estatecat_id
;
| {
"pile_set_name": "StackExchange"
} |
Agriculture Secretary Sonny Perdue took steps Monday to roll back healthy school lunch standards promoted by former first lady Michelle Obama Michelle LeVaughn Robinson ObamaBiden courts veterans amid fallout from Trump military controversies The Hill's Campaign Report: Trump's rally risk | Biden ramps up legal team | Biden hits Trump over climate policy Jill Biden's boots latest fashion choice to encourage 'vote' MORE in one of his first regulatory acts.
In an interim final rule, aimed at giving schools more flexibility, Perdue and his department are postponing further sodium reductions for at least three years and allowing schools to serve non-whole grain rich products occasionally as well as 1 percent flavored milk.
The rule allows states to exempt schools in the 2017-2018 school year from having to replace all their grains with whole-grain rich products if they are having a hard time meeting the standard.
USDA said it will take “all necessary regulatory actions to implement a long-term solution.”
“This announcement is the result of years of feedback from students, schools, and food service experts about the challenges they are facing in meeting the final regulations for school meals,” Perdue said in a statement.
“If kids aren't eating the food, and it’s ending up in the trash, they aren't getting any nutrition – thus undermining the intent of the program.”
Sodium levels in school lunches now must average less than 1,230 milligrams in elementary schools; 1,360 mg in middle schools; and 1,420 mg in high school.
ADVERTISEMENT
Before Perdue’s rule, schools were expected to reduce sodium even further to average less than 935 milligrams in elementary schools, 1035 milligrams in middle school lunches and 1,080 in high school lunches by the week by July 1, 2017.
Further reductions were set to take effect by July 1, 2022.
Perdue made the announcement Monday with Sen. Pat Roberts Charles (Pat) Patrick RobertsThe Hill's Morning Report - Sponsored by National Industries for the Blind - Trump seeks to flip 'Rage' narrative; Dems block COVID-19 bill GOP senators say coronavirus deal dead until after election Trump says he'll sign USPS funding if Democrats make concessions MORE (R-Kan.), who has long been working to ease the standards.
“We worked really hard the last two years to provide flexibility, but after unanimously passing a bipartisan bill out of Committee, our effort stalled,” he said in a statement.
“The policies that Secretary Perdue has declared here today will provide the flexibility to ensure that schools are able to serve nutritious meals that children will actually eat. Because that is really what these programs are about: serving meals to hungry children so that they can learn and grow.”
The School Nutrition Association, which represents nutrition directors at schools across the country, was quick to praise Perdue. The group has been lobbying Congress for more flexibility in what the have called “overly prescriptive regulations.”
SNA claims less kids are buying lunch because they no longer like the food and schools are being forced to spend more money on lunches that largely end up in trash.
The former standards required all grains, including croutons and the breading on chicken patties, to be whole grain rich.
“School Nutrition Association is appreciative of Secretary Perdue's support of school meal programs in providing flexibility to prepare and serve healthy meals that are appealing to students,” the group’s CEO Patricia Montague said in a statement.
“School nutrition professionals are committed to the students they serve and will continue working with USDA and the Secretary to strengthen and protect school meal programs.”
Health groups, meanwhile, claim the standards are working and that 99 percent of schools are in compliance.
“Improving children’s health should be a top priority for the USDA, and serving more nutritious foods in schools is a clear-cut way to accomplish this goal,” the American Heart Association CEO Nancy Brown said in a statement Friday ahead of USDA’s action. | {
"pile_set_name": "OpenWebText2"
} |
Dose reduction of hyoscine-N-butylbromide for double-contrast barium meal examinations--a prospective randomized study.
A search of the literature suggests that the conventional 20 mg dose of intravenous hyoscine-N-butylbromide (HBB) for smooth muscle relaxation in double-contrast barium meal (DCBM) studies is largely empirical. This study analysed the merits of three different doses (5 mg, 10 mg, 20 mg) in the performance of routine DCBMs. One hundred and twenty DCBM examinations were prospectively and randomly allocated to receive one of three doses. Three parameters were measured for each examination: gastroduodenal distension, delay in gastric emptying and gastric antrum overlapping with barium-filled duodenal loops. Almost half the examinations using 5 mg produced undesirable duodenal-gastric overlay. Unacceptable early flooding of the duodenal bulb with barium was seen mostly with doses of 5 mg and 10 mg. Overall, the best results were obtained with 20 mg. The continued use of 20 mg HBB in routine DCBMs is recommended. | {
"pile_set_name": "PubMed Abstracts"
} |
Candace Knoebel ~ Ten Reasons to Stay ~ Teaser Reveal
We are just 4 weeks away from the release of TEN REASONS TO STAY by Candace Knoebel–check out the first teaser below and add TEN REASONS TO STAY to your TBR today!
About TEN REASONS TO STAY
Available August 30th, 2018
One day a week—Thursdays—my husband and I could do whatever or whomever we pleased.
Protection was non-negotiable.
And no matter what, we had to be home by midnight.
Jack was the one who wanted an open marriage, but we were supposed to keep things simple. No strings. No commitments. It seemed so easy…until it wasn’t.
Devilishly handsome Cole Blackwater was only supposed to be a fling, but everything about him made me feel alive. Wanted. Seen. When I realized he was my husband’s boss, I should have broken things off right then…but I didn’t.
One day a week, I could pretend that I was his and he was mine…until Cole wanted more.
But how could I decide between the man I’d promised to love, honor, and cherish, and the man who tempted me to break every single vow I’d made?
TEN REASONS TO STAY releases August 30th–add it to your TBR today!
TEN REASONS TO STAY on Goodreads
About CANDACE KNOEBEL
Candace Knoebel is a hopeless romantic with an affinity for whiskey and good music. Her love of words began when she met the boy who lived in the cupboard under the stairs. She’s a self-proclaimed Lost Girl. Words are her mirror.
With two completed series, her work ranges from paranormal to contemporary, all centered heavily around romance. Currently she lives in Florida with her husband and two children, and has just completed her thirteenth novel, The Taste of Her Words. | {
"pile_set_name": "Pile-CC"
} |
** 16-bit/44.1Khz **
disc 01 [Set I]
01 applause
02 Box Of Rain
03 Dire Wolf
04 Peggy-O
05 Cruel White Water
06 Ship Of Fools
07 Candyman
08 Silvio
09 New Speedway Boogie
disc 02 [Set II]
01 applause/banter
02 Brown-Eyed Women
03 Deal
04 Talking Money Tree
05 Friend Of The Devil
06 Jack Straw
07 Stella Blue
08 Tiger Rose
09 Brokedown Palace
10 Reuben And Cherise
11 Scarlet Begonias
12 encore break
13 E1:Ripple
14 E2:Boys In The Barroom
AKG CK91 (ORTF) > Gotham 13001 GAC-2pair on AKG MK90/3 connectors > MixPre-D AES Out >
PMD661 S/PDIF In via passive impedance conversion cable. Mics at 5 ft height located in the sweet spot,
dead center - 2nd row of orchestra floor. Tracked to fit on 2 CD's as indicated and discs join smoothly.
**An Evening with Robert Hunter**
Robert Hunter - vocals, guitar, harmonica
Thanks to Robert Hunter for all the great lyrics and for allowing taping and sharing. There's a fitting nod to Bob Weir when Robert Hunter forgets the words to a verse during Jack Straw, a song he wrote with Bob Weir and Robert extends a heartfelt thanks to Jerry Garcia.
plus-circle Add Review
comment Reviews
Reviewer: Twist&Trout - favorite favorite favorite favorite favorite - October 20, 2013
Subject: Great recording Gal, this one is my favorite! I have listened to all the recordings from Rob Hunter's brief 2013 Fall Tour and this recording is easily my favorite. It's the one I keep coming back to, Roberts performance is exemplary and the recording sounds like you are right there with him.
Congratulations Lady, well done and thank you so much for sharing. Hopefully we'll get more from Robert Hunter in the Spring, this ones a keeper regardless! Twist&Trout -- October 20, 2013Great recording Gal, this one is my favorite!
Reviewer: WabiSabi - favorite favorite favorite favorite favorite - October 4, 2013
Subject: A Great Pull ! & Thanks for Sharing A beautiful, bright and clear recording that compliments Hunter's voice. Thank you so much for the record of this time in RH's history and this wonderful performance which sums a good deal of his best known and loved work.
You gave us the opportunity to hear this show which was not within our reach to attend.
Very grateful ! - October 4, 2013A Great Pull ! & Thanks for Sharing
Reviewer: Shad-O-Vision - favorite favorite favorite favorite favorite - October 1, 2013
Subject: Thanks! Only listened to a few seconds but the recording sounds clear and Robert's voice is soooo good during Box. Great night, even if he seemed kinda miffed at those hootin' during Stella Blue. Say what you want about his guitar playing, but I dig the way he sings. And let's not forget that without him, there is no GD, or at least not the GD we know.
Thanks for putting this one up just a day after the show too!!!
EDIT: GREAT SOUND. Thank you so much! But I have to stick to the "miffed" explanation during Stella Blue. And yeah I know he said he had some tech issues, but he pauses for a moment after each Hoot during the tender parts ... then continues to play. The youtube video suggests those Hollers maybe didn't "miff" him, but they caught him off-guard, or something. Use your own word. - October 1, 2013Thanks!
Reviewer: EZ Sleeper - favorite favorite favorite favorite favorite - October 1, 2013
Subject: Guitar problems Terrific show -- made me run right out and get tickets for Friday's Keswick show.
Hunter was not acting miffed a the crowd during Stella Blue. He was having real problems with his guitar sound and what he was hearing in the monitor. He had asked for "more guitar" several times earlier then finally said something like, "The guitar in the monitor sounds like shit." It was corrected, finally, and sounded great the rest of the way.
Rated five stars for Hunter's effort, ignoring the techincal issues. - October 1, 2013Guitar problems
Reviewer: SaintSteveg - favorite favorite favorite favorite favorite - September 30, 2013
Subject: Timeless Genius This is incredible. I think one should be cautious about throwing around the word "genius," but what else can we call Robert Hunter. This word wizard is a direct connection to a brilliant flowering of our culture darn near 50 years ago, and in this recording he sounds absolutely fresh and immediately now as he brings back the wonder of exploring the byways of the world and the heart and the mind. If there are artists like this these days I don't know them (other than people like Bob Dylan and Neil Young). And here he is in Allentown, PA two nights ago?
I was tempted to mark this 4 stars because I'm a little tired of audience tape sound with hooting louder than the music. But how could I? It sounds like you are there, witnessing a miracle of musical history and creativity. - September 30, 2013Timeless Genius | {
"pile_set_name": "OpenWebText2"
} |
Alto-Shaam Golf Outing Raises $100K for Lymphoma
The sixth annual Jerry Maahs Memorial Golf Outing held on Aug. 9 at Ironwood Golf Course in Sussex raised more than $100,000 for the Leukemia & Lymphoma Society’s Wisconsin chapter, making the event its largest independent fundraiser in the state.
Alto-Shaam founder Jerry Maahs passed away from lymphoma in 2006. The Jerry Maahs Memorial Golf Outing was founded in 2009 to honor Jerry’s memory and to support finding a cure for this cancer.
“Our goal is to support research that will one day save many lives,” says Steve Maahs, chief operating officer and president of Alto-Shaam. “My family is overwhelmed by the supportshown by our employees and extended business community. Not only will my father’s industry legacy continue, but his memory will continue to live on as we support the discovery of a lymphoma cure.”
Finding a cure for lymphoma remains a growing concern. Nearly 71,000 new non-Hodgkin lymphoma cases are expected to be diagnosed in the United States in 2014, according to the National Cancer Institute at the National Institutes of Health. The NCI estimates almost 19,000 people in the U.S. will pass away from the disease this year.
Because of the generous donations from sponsors and the Alto-Shaam family, Jerry’s name will continue to support a research grant to help find a cure for aggressive non-Hodgkin lymphoma. The Jerry Maahs Memorial Golf Outing has raised nearly $225,000 since its inception in September 2009.
The golf outing continues to grow each year. The first event included 56 golfers and six volunteers working to raise $7,680. This year, 187 golfers and 31 volunteers helped raise $100,000. Golfers came from throughout the U.S., including Arizona, New England, Florida, California, Washington, New York, and Georgia.
“We look forward to seeing an end to non-Hodgkin lymphoma,” Steve says. “Every person who helped with the golf outing—whether sponsoring the outing, donating prizes, volunteering at holes, or swinging the club—should be proud of their contribution toward that goal.”
The research portfolio includes seven cutting-edge investigations underway at prestigious research institutions and a strategic alliance with a biotechnology company.
“We would like to congratulate and thank Steve Maahs, the golf committee and Alto –Shaam, Inc. family on their amazing event and generous donation,” says Mike Havlicek, Wisconsin chapter executive director. “Alto-Shaam has once again proven to be not only an industry leader, but a valued community leader. LLS is grateful to have their support and partnership. The company’s efforts and generosity bring help and hope to patients and their families.”
News and information presented in this release has not been corroborated by FSR, Food News Media, or Journalistic, Inc. | {
"pile_set_name": "Pile-CC"
} |
It was basically an aside — an odd and interesting nugget in an interview with Barbra Streisand that otherwise dealt with heavy topics like sexism and politics.
Indeed, most of the 2,800-word article about Streisand in Variety is devoted to detailing the actress's decades-long efforts to break up Hollywood's boys' club, as the 90th Academy Awards ceremony approaches with the #MeToo movement as the backdrop.
But it was that one nugget — a brief comment about her dogs — that drew the most attention Tuesday night.
In her interview with Variety, Streisand revealed that two of her three Coton de Tulear dogs were clones. Specifically, the magazine reported that the dogs ? Miss Violet and Miss Scarlett — had been cloned from cells taken from the mouth and stomach of Streisand's late dog Samantha, who was 14 when she died last year.
Miss Violet and Miss Scarlett "have different personalities," Streisand told Variety. "I'm waiting for them to get older so I can see if they have her brown eyes and her seriousness."
Streisand's third dog, Miss Fanny, is a distant cousin of Samantha's, the magazine said. (Miss Fanny's mother, the story noted, had been named Funny Girl.)
If the possibility of cloning your dog intrigues you, there is good news: You do not have to be an incredibly famous and highly acclaimed actor, director, producer and writer to have it done.
You do, however, need at least $50,000. But first, a little context.
We can clone dogs? Since when?
Even if you are not a close follower of clones, you may recall Dolly the Sheep, who was born in 1996. Since then, researchers have cloned about two dozen other mammal species, including cattle, deer, horses, rabbits, cats, rats ? and yes, dogs.
South Korean researchers announced that they had cloned a dog for the first time in 2005, after almost three years of work and more than 1,000 eggs. With help from a yellow Labrador retriever who served as the surrogate mother, a cloned male Afghan hound named Snuppy was born. (Snuppy, of course, stood for "Seoul National University puppy.")
By 2008, a California company had partnered with a South Korean laboratory and made plans to auction off chances to clone five dogs. Later that year, the New York Times reported that the first three puppies from the group had been born in South Korea.
Two 2015 reports — from Business Insider and NPR — detail the work of Sooam Biotech, a lab in South Korea, and said the lab, on its own, had cloned more than 600 dogs.
How much does it cost?
Both articles say Sooam Biotech charged about $100,000 to attempt the process. ViaGen Pets, a company based in Texas, says it charges $50,000 for the cloning or $1,600 to merely preserve your pet's genes.
Reports and information on ViaGen's website suggest that the cloning process ? specifically a dog's pregnancy ? usually takes about 60 days.
It was not clear which company Streisand used to create her clones. A publicist for Streisand did not immediately respond to an email or phone message on Tuesday night.
But will the cloned dog actually be similar?
That depends.
Sooam told Business Insider that it can clone any dog, regardless of age, size or breed. NPR, though, reported that cloned animals aren't exact replicas of original dogs.
Researchers at the South Korean lab told the station that the dogs it had cloned have been healthy ? and had almost always looked and acted like the dogs they were cloned from.
"Cats and dogs delivered by cloning have the same genes as their donor pets and will be the closest match possible to the donor," ViaGen said on its website. "This is best described as identical twins born at a later date."
"The environment does interact with genetics to impact many traits such as personality and behavior," the company continued.
Is it safe?
That also depends — mostly on how you define "safe."
In essence, the process involves getting a genetic sample from your dog, sending the sample to the lab, and letting the scientists put the sample through a process that fuses it with an egg. Eventually, the egg develops into an embryo; and that embryo is then transferred to the surrogate, who surgeons hope will give birth.
At the Korean lab, the process requires operating on the egg donor and the surrogate mother ? two dogs rented from a lab-animal provider. And, at least in the case of Sooam Biotech, it's not clear what happens after those dogs are no longer needed.
The company also told the media outlets that the cloning process works only about 33 to 40 percent of the time, which means there is strong potential for miscarriages.
Far from the medical labs, Streisand told Variety that she loves sharing her Malibu home with Miss Violet and Miss Scarlett. At least from that vantage point, the process seemed to work out just fine. Because, really, whatever your genes, who wouldn't want to live in a place with an ocean view? | {
"pile_set_name": "OpenWebText2"
} |
Q:
Vertical scroll Scintilla Textbox during Text Changed event
Setting a Scintilla.Net textbox with a string and scrolling to last line doesn't work.
This Q & A How make autoscroll in Scintilla? has the answer but it wont work at the same time as setting the text.
Bare bones repro:
private void button1_Click(object sender, EventArgs e)
{
string s = RandomString(400);
scintilla1.Text = s + " " + s + " " + s + " " + s + " " + s;
scintilla1.Scrolling.ScrollBy(0, 10000); //<-doesn't work (but does work eg in a Button2_click)
}
private static Random random = new Random((int)DateTime.Now.Ticks);
private string RandomString(int size)
{
StringBuilder builder = new StringBuilder();
char ch;
for (int i = 0; i < size; i++)
{
ch = Convert.ToChar(Convert.ToInt32(Math.Floor(26 * random.NextDouble() + 65)));
builder.Append(ch);
}
return builder.ToString();
}
Does anyone know how to scroll vertically down to end line after setting the text?
A:
Well you can try to put Refresh() after adding the text;
scintilla1.Text = s + " " + s + " " + s + " " + s + " " + s;
scintilla1.Refresh();
for this case i found out that you will need to Refresh() twice depend on the length of the string you put on the textbox.
| {
"pile_set_name": "StackExchange"
} |
The goal of this proposal is to use morphological and biochemical approaches to analyze insulin receptor regulation. Ultrastructural studies on insulin-sensitive cells have shown significant cell-specific heterogeneity in the organization, distribution and mobility of insulin receptors. These morphological observations correlate with cell-specific differences found in biochemical binding studies on the same cells. Recent evidence suggests that cell-to-cell variability may exist in the processes involved in insulin receptor internalization and recycling. The specific aims of this proposal are: (1) to qualitatively and quantitatively determine and compare insulin receptor organization and distribution on different cell types. Relationships, if any, will be established between occupied insulin receptor and specific cell surface structures and components. (2) to analyze the post-occupancy mobility of insulin receptors on cells that demonstrate occupancy-induced changes in receptor organization or distribution. Various chemical reagents will be used in attempts to block receptor microaggregation in order to determine the mechanisms involved and relationships to insulin action. (3) to determine the routes and subcellular structures involved in the internalization, degradation or processing, and recycling of insulin and insulin receptors. In addition to using monomeric ferritin-insulin for morphological studies, immunocytochemistry using both anti-insulin receptor antibody and biotinyl-labeled insulin binding to insulin receptors followed by antibody or avidin conjugated colloidal gold particles and/or peroxidase will be used to demonstrate the insulin receptors in intact as well as permeabilized cells. This laboratory is in a unique position to accomplish this proposal because of our proven capability to perform both quantitative morphological and correlative biochemical studies. These studies will contribute to our understanding of insulin action and of possible sites for post-binding defects in insulin resistant states. | {
"pile_set_name": "NIH ExPorter"
} |
Q:
How to load a partial view in a new window?
I have an MVC partial view. I try to load it using window.open by calling the controller name and the action name. I got from the action the related partial view back but there are no links to stylesheets and scripts because this is a new window. How can I fix this issue please?
This is the javascript code I´m using:
function OpenNewWindowForDetail(model) {
$.ajax({
url: '@Url.Action("ActionName", "ControllerName")',
dataType: 'html',
data: {
userid: model.UserId
},
type: 'POST',
success: function (data) {
var win = window.open('about:blank');
with (win.document) {
open();
write(data);
close();
}
}
});
}
All links to stylesheet files and javascript files are in the layout.cshtml by the way.
Thank you in advance
A:
You should modify your action to regular view with layout, instead of partial view. There is no reason to use partial view in this situation.
There is also no reason to use AJAX. Simple anchor with target='_blank' would be enough. userId can be passed by GET parameter.
| {
"pile_set_name": "StackExchange"
} |
Tony Christian starts upp Joneskogs 738 camaro
First start upp in Bradenton FL 2009 12 04.
Peter Rosenqvist is starting his Pro Mod Camaro
Peter Rosenqvist in Sweden are starting his Pro Mod Camaro for the first time after
he bought it from Adam Flamholc.
Rickard Asp is helping him from team Top Mod Viper.
Filmed with Canon 5D Mark II with EF 17-40 lens. | {
"pile_set_name": "Pile-CC"
} |
Q:
Pod spec lint fail validation: no known class method for selector
I'm trying to create a pod, my framework is building fine and I have no problem using it projects, but when I am trying to convert it into a pod and run pod spec lint to validate it it fails, and gives me the following error:
- ERROR | [iOS] xcodebuild: SimpleCameraFramework/SimpleCameraFramework/AVCaptureSession+Safe.m:28:67: error: no known class method for selector 'safeCastFromObject:'
In this file I have no compiler error, I have exposed the category in the umbrella header, so I really don't see where the problem is... Any idea?
A:
I found out the problem, for some reason the pod doesn't work with the precompiled header, if I remove it and import the .h file directly in AVCaptureSession+Safe, it works...
| {
"pile_set_name": "StackExchange"
} |
Centuria announces major new unlisted property investment
Investors given opportunity to invest in iconic commercial asset on Sydney’s North Shore
Sydney, 20 May 2016
Centuria Property Funds Limited (Centuria) today announced that contracts have been exchanged on the Zenith, an institutional grade office asset located at 821 Pacific Highway, Chatswood. A new Centuria unlisted property fund, the Centuria Zenith Fund, will co-invest with global investment firm, BlackRock to acquire the property. The purchase price is $279.1 million. The purchase remains subject to FIRB approval, with settlement expected to occur in late July.
Commenting on the Fund, CEO – Unlisted Property Funds, Jason Huljich, said he was confident the Fund would provide attractive returns to investors due to the strong fundamentals of the location and the property itself.
“Sydney’s North Shore office market is already performing strongly, and we expect that it will continue to experience falling vacancies and strong rental growth over the next few years. The withdrawal of commercial office space in the CBD and North Shore due to residential conversion and the construction of the Metro will drive above trend rental growth and mean excellent total returns for our investor clients.
“Chatswood is a dynamic office, retail and residential area and is the North Shore’s major rail and bus hub. The new Sydney Metro rail infrastructure will further improve connectivity,” he said.
The Zenith is a landmark office asset with a diversified tenant mix. Approximately 40% of its rental income is underpinned by government tenants, and it is currently 94% occupied. It has around 44,000sqm of net lettable area with 800 car spaces and occupies a large 8,000 sqm site.
Mr Huljich said that he was pleased to be able to offer such an iconic asset to the market via an unlisted fund.
“In the current low interest rate environment, there’s no question that investors are becoming increasingly yield-driven. Distribution yields from the Zenith Fund are forecast to be 7.6% in the 2017 financial year, growing to 7.7% in the 2018 financial year. These are very attractive rates for such a high quality asset,” Mr Huljich said.
In conclusion, Mr Huljich said that the choice of The Zenith is in line with Centuria’s investment strategy, which has been primarily focused on Sydney over the past 5 years.
“We are asset-driven in our investment strategy, which means we will consider all properties, even those in weaker markets, if we can see the potential for strong returns over time. But it’s fair to say that our pick at the moment is Sydney. “Our partner, BlackRock, clearly shares our confidence when it comes to The Zenith, and we anticipate that we will experience the same strong investor demand for this fund as we have done for our previous unlisted investment funds,” Mr Huljich said. | {
"pile_set_name": "Pile-CC"
} |
ZTE launches first Android Go phone in the US – Here’s everything you want to know
ZTE has launched the first ever Android Go phone in the US, ushering in a new wave of cheap, yet well-optimized smartphones in the country. The “ZTE Tempo GO” will cost only $80 and will showcase the newest version of Android in action for the first time in the US.
Although Android Go was made available through other companies too such as Nokia, they never really targeted the US in particular. This is why ZTE’s launch is so significant. Not everyone in the US, or any part of the world for that matter, wants a high-specced phone which can do lots of things. Some people just want a phone for basic communication purposes alongside internet facilities.
Furthermore, not everyone can afford an expensive phone. Smartphones have come a long way in just a few years, however, so have the prices. In order to cater to the “budget market”, Google came up with Android Go.
What is Android Go?
Source: Androidcentral
Android Go is a lightweight version of Android optimized for low-end devices. This version of Android is made to drive the cost of Android phones significantly in order to cater to the people with lower budgets. It’s not that different to the original Android, in fact, both are built on the same foundations.
Android Go, however, is a better optimized, more stable version of the two and it’s more suitable for underpowered devices. As mentioned, the two versions of Android are very similar, as this one also runs on the latest Android OS, Android 8.1 Oreo. The Go version of the OS has several data management features allowing users to closely monitor data usage.
All Android Go devices come with Google Play Protect which uses machine learning to check for malicious apps on your phone. It also constantly scans your phone for viruses, even for apps that aren’t downloaded through the PlayStore in order to make sure the phone doesn’t get infected with a virus.
It has its own set of apps
Since Android Go is meant to run on underpowered phones (phones with less than 1 GB RAM), obviously the regular Android apps won’t perform so great on it. Therefore, it comes with its own set of optimized apps. Many of the apps are lightweight versions of the existing apps in the regular version of the Android.
For example, Google Go lets you search the web just like the regular Google app but the install size for the Go version is only a fraction of the original. Another example is the Google Assistant Go. The Assistant app is a newer Go app that was recently released for the PlayStore. Unlike the Google Go app, there are some things that the assistant app can’t do compared to the original assistant. Some of the things the Go version isn’t able to do include setting reminders and control smart home gadgets, however, it does allow you to set alarms, send texts, open apps, ask questions, and much more.
Most of the apps have more or less the same functionality as the non-go versions of the apps. The Gboard has all the features the regular stock Android keyboard would offer. Youtube Go lets people watch youtube videos and even download them for offline viewing just like the regular Youtube app. Moreover, users can share videos with each other without the need for a data connection. The lightweight apps alongside the built-in apps ensure for minimal or no bloatware, allowing users to get more available internal storage for their devices. The PlayStore on Go phones will also recommend apps that will work best with your device.
Source: Androidcentral
ZTE Tempo Go specs
The ZTE Tempo Go makes use of the Android Go firmware, which in fact, is more up to date than many flagship Android phones out there. As you’d expect from an Android Go device, the specifications aren’t that spectacular. The phone has a 1.1 GHz quad-core Qualcomm Snapdragon 210 and has 1 GB of RAM and only 8 GB of storage. It also has a 5-inch screen with 854×480 FWVGA resolution.
Since Android Go phones are meant to be budget friendly, the specs don’t come as a surprise. This is particularly reflected upon with the phone’s camera as it features a low-end 5 MP rear camera and only 2 MP at the front. However, the phone’s price makes up for it as it’s ridiculously low. The phone costs only $80 and it provides users with basic necessities and more.
The ZTE Go phone is significant because it’s the only Go phone available in the US. Whether or not the phone is a success in the country depends on how many people look for a basic phone in the US. The phone would be more successful in countries like India or Pakistan where budgets are low. Google is aiming to make phones available for as low as $30 which would make it much easier for people to buy basic Android phones.
What’s next?
Google has shown through Android Go phones that it’s definitely possible to make semi-decent Android phones below $100. Moreover, the optimization the Go phones have is astounding. The ZTE Tempo Go has the same apps as a regular Android phone would have, but with half the size. The Go versions of these apps also perform better.
If you’re a user of the regular Android phone, you can still try out the Go apps by downloading them from the PlayStore. As for what’s next with the release of Android Go phones, the possibilities are endless. The main aspect of Android go is the superior level of optimization. Therefore, if the same level of optimization could be applied to regular Android devices, then high-specced devices could become much better than they already are.
If a greater level of optimization is achieved, then there won’t be a need to increase power in phones, which would drive down the costs of phones significantly. The only thing left to improve upon each upgrade would perhaps only be the camera. If its possible to make lightweight, highly optimized versions of apps for underpowered devices, then its also possible for higher-end devices to get highly optimized apps of their own.
We’ve already seen this level of optimization in Apple devices. Whether Android is able to do it depends on many factors, such as the large variety of devices with different specifications. However, the Android Go is a step in the right direction, the future looks bright for Android users.
Your email address will not be published. Required fields are marked *
Comment
Name *
Email *
Website
Notify me of follow-up comments by email.
Notify me of new posts by email.
Advertisement
FactsChronicle.com, a High-Tech news website providing fresh and factual information about modern devices, gadgets, games, apps, latest inventions and innovations and much more. Stay with us and Know the Future! | {
"pile_set_name": "Pile-CC"
} |
/*
* Licensed to the Apache Software Foundation (ASF) under one or more
* contributor license agreements. See the NOTICE file distributed with
* this work for additional information regarding copyright ownership.
* The ASF licenses this file to You under the Apache License, Version 2.0
* (the "License"); you may not use this file except in compliance with
* the License. You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
package org.apache.stanbol.entityhub.web.writer;
import java.util.ArrayList;
import java.util.Collection;
import java.util.Collections;
import java.util.HashMap;
import java.util.HashSet;
import java.util.LinkedHashSet;
import java.util.List;
import java.util.Map;
import java.util.Map.Entry;
import java.util.Set;
import java.util.concurrent.locks.ReadWriteLock;
import java.util.concurrent.locks.ReentrantReadWriteLock;
import javax.ws.rs.core.MediaType;
import org.apache.stanbol.entityhub.servicesapi.model.Representation;
import org.apache.stanbol.entityhub.web.ModelWriter;
import org.osgi.framework.BundleContext;
import org.osgi.framework.ServiceReference;
import org.osgi.util.tracker.ServiceTracker;
import org.slf4j.Logger;
import org.slf4j.LoggerFactory;
public class ModelWriterTracker extends ServiceTracker {
private final Logger log = LoggerFactory.getLogger(getClass());
/**
* Holds the config
*/
private final Map<String, Map<MediaType,List<ServiceReference>>> writers = new HashMap<String,Map<MediaType,List<ServiceReference>>>();
/**
* Caches requests for MediaTypes and types
*/
private final Map<CacheKey, Collection<ServiceReference>> cache = new HashMap<CacheKey,Collection<ServiceReference>>();
/**
* lock for {@link #writers} and {@link #cache}
*/
private final ReadWriteLock lock = new ReentrantReadWriteLock();
@Override
public Object addingService(ServiceReference reference) {
Object service = super.addingService(reference);
Set<MediaType> mediaTypes = parseMediaTypes(((ModelWriter)service).supportedMediaTypes());
Class<? extends Representation> nativeType = ((ModelWriter)service).getNativeType();
if(!mediaTypes.isEmpty()){
lock.writeLock().lock();
try {
for(MediaType mediaType : mediaTypes){
addModelWriter(nativeType, mediaType, reference);
}
} finally {
lock.writeLock().unlock();
}
return service;
} else { //else no MediaTypes registered
return null; //ignore this service
}
}
@Override
public void removedService(ServiceReference reference, Object service) {
if(service != null){
Set<MediaType> mediaTypes = parseMediaTypes(((ModelWriter)service).supportedMediaTypes());
Class<? extends Representation> nativeType = ((ModelWriter)service).getNativeType();
if(!mediaTypes.isEmpty()){
lock.writeLock().lock();
try {
for(MediaType mediaType : mediaTypes){
removeModelWriter(nativeType, mediaType, reference);
}
} finally {
lock.writeLock().unlock();
}
}
}
super.removedService(reference, service);
}
@Override
public final void modifiedService(ServiceReference reference, Object service) {
super.modifiedService(reference, service);
if(service != null){
Set<MediaType> mediaTypes = parseMediaTypes(((ModelWriter)service).supportedMediaTypes());
Class<? extends Representation> nativeType = ((ModelWriter)service).getNativeType();
if(!mediaTypes.isEmpty()){
lock.writeLock().lock();
try {
for(MediaType mediaType : mediaTypes){
updateModelWriter(nativeType, mediaType, reference);
}
} finally {
lock.writeLock().unlock();
}
}
}
}
/**
* @param reference
* @param key
*/
private void addModelWriter(Class<? extends Representation> nativeType,
MediaType mediaType, ServiceReference reference) {
//we want to have all ModelWriters under the null key
log.debug(" > add ModelWriter format: {}, bundle: {}, nativeType: {}",
new Object[]{mediaType, reference.getBundle(),
nativeType != null ? nativeType.getName() : "none"});
Map<MediaType,List<ServiceReference>> typeWriters = writers.get(null);
addTypeWriter(typeWriters, mediaType, reference);
if(nativeType != null){ //register also as native type writers
typeWriters = writers.get(nativeType.getName());
if(typeWriters == null){
typeWriters = new HashMap<MediaType,List<ServiceReference>>();
writers.put(nativeType.getName(), typeWriters);
}
addTypeWriter(typeWriters, mediaType, reference);
}
cache.clear(); //clear the cache after a change
}
/**
* @param typeWriters
* @param mediaType
* @param reference
*/
private void addTypeWriter(Map<MediaType,List<ServiceReference>> typeWriters,
MediaType mediaType,
ServiceReference reference) {
List<ServiceReference> l;
l = typeWriters.get(mediaType);
if(l == null){
l = new ArrayList<ServiceReference>();
typeWriters.put(mediaType, l);
}
l.add(reference);
Collections.sort(l); //service ranking based sorting
}
/**
* @param key
* @param reference
*/
private void removeModelWriter(Class<? extends Representation> nativeType,
MediaType mediaType, ServiceReference reference) {
log.debug(" > remove ModelWriter format: {}, service: {}, nativeType: {}",
new Object[]{mediaType, reference,
nativeType != null ? nativeType.getClass().getName() : "none"});
Map<MediaType,List<ServiceReference>> typeWriters = writers.get(null);
removeTypeWriter(typeWriters, mediaType, reference);
if(nativeType != null){
typeWriters = writers.get(nativeType.getName());
if(typeWriters != null){
removeTypeWriter(typeWriters, mediaType, reference);
if(typeWriters.isEmpty()){
writers.remove(nativeType.getName());
}
}
}
cache.clear(); //clear the cache after a change
}
/**
* @param typeWriters
* @param mediaType
* @param reference
*/
private void removeTypeWriter(Map<MediaType,List<ServiceReference>> typeWriters,
MediaType mediaType,
ServiceReference reference) {
List<ServiceReference> l = typeWriters.get(mediaType);
if(l != null && l.remove(reference) && l.isEmpty()){
writers.remove(mediaType); //remove empty mediaTypes
}
}
/**
* @param key
* @param reference
*/
private void updateModelWriter(Class<? extends Representation> nativeType,
MediaType mediaType, ServiceReference reference) {
log.debug(" > update ModelWriter format: {}, service: {}, nativeType: {}",
new Object[]{mediaType, reference,
nativeType != null ? nativeType.getClass().getName() : "none"});
Map<MediaType,List<ServiceReference>> typeWriters = writers.get(null);
updateTypeWriter(typeWriters, mediaType, reference);
if(nativeType != null){
typeWriters = writers.get(nativeType.getName());
if(typeWriters != null){
updateTypeWriter(typeWriters, mediaType, reference);
}
}
cache.clear(); //clear the cache after a change
}
/**
* @param typeWriters
* @param mediaType
* @param reference
*/
private void updateTypeWriter(Map<MediaType,List<ServiceReference>> typeWriters,
MediaType mediaType,
ServiceReference reference) {
List<ServiceReference> l = typeWriters.get(mediaType);
if(l != null && l.contains(reference)){
Collections.sort(l); //maybe service.ranking has changed
}
}
public ModelWriterTracker(BundleContext context) {
super(context, ModelWriter.class.getName(), null);
//add the union key value mapping
writers.put(null, new HashMap<MediaType,List<ServiceReference>>());
}
/**
* @param mts
* @return
*/
private Set<MediaType> parseMediaTypes(Collection<MediaType> mts) {
if(mts == null || mts.isEmpty()){
return Collections.emptySet();
}
Set<MediaType> mediaTypes = new HashSet<MediaType>(mts.size());
for(MediaType mt : mts){
if(mt != null){
//strip all parameters
MediaType mediaType = mt.getParameters().isEmpty() ? mt :
new MediaType(mt.getType(),mt.getSubtype());
mediaTypes.add(mediaType);
}
}
return mediaTypes;
}
/**
* Getter for a sorted list of References to {@link ModelWriter} that can
* serialise Representations to the parsed {@link MediaType}. If a
* nativeType of the Representation is given {@link ModelWriter} for that
* specific type will be preferred.
* @param mediaType The {@link MediaType}. Wildcards are supported
* @param nativeType optionally the native type of the {@link Representation}
* @return A sorted collection of references to compatible {@link ModelWriter}.
* Use {@link #getService()} to receive the actual service. However note that
* such calls may return <code>null</code> if the service was deactivated in
* the meantime.
*/
public Collection<ServiceReference> getModelWriters(MediaType mediaType, Class<? extends Representation> nativeType){
Collection<ServiceReference> refs;
String nativeTypeName = nativeType == null ? null : nativeType.getName();
CacheKey key = new CacheKey(mediaType, nativeTypeName);
lock.readLock().lock();
try {
refs = cache.get(key);
} finally {
lock.readLock().unlock();
}
if(refs == null){ //not found in cache
refs = new ArrayList<ServiceReference>();
Map<MediaType, List<ServiceReference>> typeWriters = writers.get(
nativeTypeName);
if(typeWriters != null){ //there are some native writers for this type
refs.addAll(getTypeWriters(typeWriters, mediaType));
}
if(nativeType != null){ //if we have a native type
//also add writers for the generic type to the end
refs.addAll(getTypeWriters(writers.get(null), mediaType));
}
refs = Collections.unmodifiableCollection(refs);
lock.writeLock().lock();
try {
cache.put(key, refs);
} finally {
lock.writeLock().unlock();
}
}
return refs;
}
private Collection<ServiceReference> getTypeWriters(
Map<MediaType,List<ServiceReference>> typeWriters, MediaType mediaType) {
//use a linked has set to keep order but filter duplicates
Collection<ServiceReference> refs = new LinkedHashSet<ServiceReference>();
boolean wildcard = mediaType.isWildcardSubtype() || mediaType.isWildcardType();
lock.readLock().lock();
try {
if(!wildcard){
//add writer that explicitly mention this type first
List<ServiceReference> l = typeWriters.get(mediaType);
if(l != null){
refs.addAll(l);
}
}
List<ServiceReference> wildcardMatches = null;
int count = 0;
for(Entry<MediaType,List<ServiceReference>> entry : typeWriters.entrySet()){
MediaType mt = entry.getKey();
if(mt.isCompatible(mediaType) &&
//ignore exact matches already treated above
(wildcard || !mt.equals(mediaType))){
if(count == 0){
wildcardMatches = entry.getValue();
} else {
if(count == 1){
wildcardMatches = new ArrayList<ServiceReference>(wildcardMatches);
}
wildcardMatches.addAll(entry.getValue());
}
}
}
if(count > 1){ //sort matches for different media types
Collections.sort(wildcardMatches);
}
//add wildcard matches to the linked has set
if(count > 0){
refs.addAll(wildcardMatches);
}
} finally {
lock.readLock().unlock();
}
return refs;
}
@Override
public ModelWriter getService() {
return (ModelWriter)super.getService();
}
@Override
public ModelWriter getService(ServiceReference reference) {
return (ModelWriter)super.getService(reference);
}
/**
* Used as key for {@link ModelWriterTracker#cache}
*/
private static class CacheKey {
final String nativeType;
final MediaType mediaType;
CacheKey(MediaType mediaType, String nativeType){
this.nativeType = nativeType;
this.mediaType = mediaType;
}
@Override
public int hashCode() {
final int prime = 31;
int result = 1;
result = prime * result + mediaType.hashCode();
result = prime * result + ((nativeType == null) ? 0 : nativeType.hashCode());
return result;
}
@Override
public boolean equals(Object obj) {
if (this == obj) return true;
if (obj == null) return false;
if (getClass() != obj.getClass()) return false;
CacheKey other = (CacheKey) obj;
if (!mediaType.equals(other.mediaType)) return false;
if (nativeType == null) {
if (other.nativeType != null) return false;
} else if (!nativeType.equals(other.nativeType)) return false;
return true;
}
}
}
| {
"pile_set_name": "Github"
} |
Tamer Shaaban's video, a snapshot of the Egypt protests on Jan. 25, has accumulated nearly 2 million views on YouTube.
via Huffington Post:
Despite the attempt by the Egyptian government to shut down the Internet throughout the country, a a harrowing video montage of home video from the chaotic streets of Cairo. has surfaced on YouTube
The protests began on Tuesday, January 25, when thousands of people blocked the streets to sound off about unemployment, government corruption, and the autocratic rule of President Hosni Mubarak, who has been in office for thirty years.
The protests were inspired, in part, by the recent uprising in Tunisia, which began because of widespread anger over corruption and unemployment and ended with the ousting of president and strongman Zine El Abidine Ben Ali.
The video was created by Tamer Shaaban, described on YouTube as "another Egyptian who's had enough." | {
"pile_set_name": "OpenWebText2"
} |
1. Field of the Invention
The present invention is related to a multi-specification read/write signal transmission module for silicon disks, and especially to a signal transmission module for silicon disks (flash memory cards/small memory cards) of various specifications in the markets, it is provided with a structure with a common space for reading and writing on silicon disks of various specifications to thereby satisfy the requirement of customers.
2. Description of the Prior Art
The silicon disks developed in the recent years are light, thin and small, they have the superior features of high storage capacity, vibration durability, repeated memorizing for many times etc., and are widely applied in the field of IA (Information Appliance) and many portable digital products. For example, merely all the popular products including personal digital assistants (PDA), digital cameras (DSC), digital walkmans (MP3 Players) etc. in the markets use the silicon disks as storage media.
By virtue that IA is a newly rising field, its products are novel and multivariable; thereby, the criteria of the silicon disks form a large market that makes struggles for development as well as competitions among international big manufacturers. There is no uniform standard or specification presently in the art of silicon disks in the whole world. Products that are mutually related include at least PC ATA cards, CF cards (CompactFlash cards), SM cards (Smart Media cards), MMC cards (MultiMedia cards), MS cards (Memory Stick cards) and SD cards (Secure Digital cards) etc.; and not only are multifactorial, but also have their respective predominance in the markets.
The multiple specifications of the silicon disks induce market strategies as to manufacturers. For example, if customers find that their neighboring people do not use MS cards or are uneasy to purchase MS cards, he may think about whether he will purchase and use a digital camera for MS cards. On the contrary, a customer who have purchased a digital camera for MS cards may not purchase a PDA of some other brand, rather, he may still want to purchase a PDA still of the kind using MS cards, unless he wants to use another kind of specification of silicon disk.
For the large group of customers, however, lacking of uniform standards and specifications for silicon disks is not a good thing. This is because that silicon disks are unable to achieve effective applicability on various portable digital products, computer systems and peripheral equipments of computers, and this makes inconvenience of use of consumers. The computers are quite restrained in selection of using digital products.
Therefore, it is an extremely important direction of consideration to make efforts to provide a module compatible with all known specifications for silicon disks and capable of integrating all the electronic transmission modes of these silicon disks, in order that the module can be built in or externally connected to computers and other digital products to thereby increase the convenience for consumers in using silicon disks of different specifications.
The Prior Art
During study and development of the present invention, the inventor had designed a primary structure for reading and writing on silicon disks for the purpose of achieving the above stated objects. The structure of the module in practicing is shown in FIG. 1: Wherein, a xe2x80x9cUxe2x80x9d shaped base 1 is provided on the upper and the lower sides thereof respectively with an electric circuit board 2, the xe2x80x9cUxe2x80x9d shaped base 1 is formed in the center thereof a receiving space 3. A plurality of guide recesses 4 are provided on the lateral arms at the two lateral sides of the receiving space 3. Each of the guide recesses 4 has the sizes of length and width thereof in coincidence with a kind of silicon disk 5; thereby, several kinds of silicon disks 5 can be inserted in the receiving space 3. And the upper and the lower electric circuit boards 2 are provided on the surfaces thereof confronting the receiving space 3 with a plurality of protruding contact pin sets 6, each pin set 6 is positioned in corresponding to that of the signal pin set 7 of a silicon disk 5. When the silicon disk 5 is inserted into the receiving space 3, the pin sets 6 of the upper and the lower electric circuit boards 2 can be connected with the signal pin set 7 of a silicon disk 5 for reading the data in the silicon disk 5.
The primary structure designed by the inventor of the present invention can surely achieve the object of reading on several kinds of silicon disks; however, it cannot suit all kinds of silicon disks. This is mainly because that the contact pin sets 6 provided on the upper and the lower electric circuit boards 2 and protruding into the receiving space 3 is vertically contact with the silicon disk 5; but the signal pin sets of some silicon disks 5 are provided on the front end face of the silicon disks 5 (such as PC ATA cards or CF cards as shown in FIG. 5 depicting a silicon disk Axe2x80x2), thereby, the contact pin sets 6 provided on the upper and the lower electric circuit boards 2 can not contact or connect with such a silicon disk 5, they do not suit all kinds of silicon disks.
To solve the above stated problems and to render a read/write signal transmission module for silicon disks to suit all kinds of silicon disks, the inventor of the present invention reconsider the above stated primary structure concentrating on designing of the different specifications, and developed the multi-specification read/write signal transmission module for silicon disks of the present invention after nonstop study and tests, with the module, all known silicon disks with different specifications can be inserted and read/written.
In particular, the present invention is provided on the center of a xe2x80x9cUxe2x80x9d shaped base with a partitioning plate, an upper and a lower lid, so that the base is formed therein a first and a second receiving chamber. The base is provided respectively on the lateral arms at the lateral sides of the first and the second receiving chambers with a plurality of guide recesses, thereby, different kinds of silicon disks with different specifications can be inserted therein. The first receiving chamber is provided therein at least with a vertically contacting pin set, and the second receiving chamber is provided therein at least with a horizontally contacting pin set, in order that when silicon disks with different specifications are individually inserted into the first or the second receiving chamber, they can contact respectively with the vertically contacting pin set or the horizontally contacting pin set. In this way, the module of the present invention can suit all the silicon disks with different specifications in the markets.
The primary object of the present invention is that, by the fact that the above stated vertically and the horizontally contacting pin sets are allocated at different orientations, when a silicon disk is inserted into the module, it can be connected with one of the vertically and the horizontally contacting pin sets to proceed to transmit signals for and read/write on the silicon disk. Thereby, the module of the present invention can meet module of the present invention can of multiple silicon disks.
Another object of the present invention is that, after the base is divided into the upper first and the lower second receiving chambers by means of the partitioning plate, the first and the second receiving chambers can respectively receive a silicon disk of its own specification. This makes customers convenient in use.
The present invention will be apparent in its structural characteristics after reading the detailed description of the preferred embodiment thereof in reference to the accompanying drawings. | {
"pile_set_name": "USPTO Backgrounds"
} |
Q:
How to use two conditions in "where" clause in XQuery
I'm trying to extract only those <book> data that has a certain type of <xref> type and matching a list of specific xrefs using a Xquery (I'm new to this).
Here is the input data:
<book id="6636551">
<master_information>
<book_xref>
<xref type="Fiction" type_id="1">72771KAM3</xref>
<xref type="Non_Fiction" type_id="2">US72771KAM36</xref>
</book_xref>
</master_information>
</book>
<book id="119818569">
<master_information>
<book_xref>
<xref type="Fiction" type_id="1">070185UL5</xref>
<xref type="Non_Fiction" type_id="2">US070185UL50</xref>
</book_xref>
</master_information>
</book>
<book id="119818568">
<master_information>
<book_xref>
<xref type="Fiction" type_id="1">070185UK7</xref>
<xref type="Non_Fiction" type_id="2">US070185UK77</xref>
</book_xref>
</master_information>
</book>
<book id="119818567">
<master_information>
<book_xref>
<xref type="Fiction" type_id="1">070185UJ0</xref>
<xref type="Non_Fiction" type_id="2">US070185UJ05</xref>
</book_xref>
</master_information>
</book>
<book id="38085123">
<master_information>
<book_xref>
<xref type="Fiction" type_id="1">389646AV2</xref>
<xref type="Non_Fiction" type_id="2">US389646AV26</xref>
</book_xref>
</master_information>
</book>
XQuery that I'm using:
for $x in //book
where $x//xref/@type='Fiction'
and
$x//xref=('070185UL5','070185UJ0')
return $x
The above Xquery only fetches the first book information matching the "070185UL5". I would expect it to fetch both. What is wrong? I appreciate your response.
A:
In the query
for $x in //book
where $x//xref/@type='Fiction'
and
$x//xref=('070185UL5','070185UJ0')
return $x
do you intend to say
(1) "there must be at least one xref whose @type is 'Fiction' and at least one xref whose value is '070185UL5' or'070185UJ0'"
or do you intend to say
(2) "there must be at least one xref whose @type is 'Fiction' and whose value is '070185UL5' or'070185UJ0'"
Currently you are saying (1). If you want to say (2) then the query should be
for $x in //book
where $x//xref[@type='Fiction' and .=('070185UL5','070185UJ0')]
return $x
which you can simplify to the XPath expression
//book[.//xref[@type='Fiction' and .=('070185UL5','070185UJ0')]]
With the data you have supplied the two queries give the same result, but with different data they could give different results.
| {
"pile_set_name": "StackExchange"
} |
Court of Appeals
of the State of Georgia
ATLANTA, February 15, 2017
The Court of Appeals hereby passes the following order
A17D0257. JEAN B. ST. FELIX v. BAYVIEW LOAN SERVICING, LLC.
Upon consideration of the Application for Discretionary Appeal, it is ordered that it be
hereby DENIED.
LC NUMBERS:
2016CV00496
Court of Appeals of the State of Georgia
Clerk's Office, Atlanta, February 15, 2017.
I certify that the above is a true extract from the minutes
of the Court of Appeals of Georgia.
Witness my signature and the seal of said court hereto
affixed the day and year last above written.
, Clerk.
| {
"pile_set_name": "FreeLaw"
} |
Knox Cameron
Knox Cameron (born September 17, 1983 in Kingston) is a Jamaican-born American soccer player who most recently played for AFC Ann Arbor in the National Premier Soccer League.
Career
College and Amateur
Cameron grew up in New York City, attended Cardinal Spellman High School in The Bronx, and played college soccer at the University of Michigan, where he is second in the school's all-time record for goals (28) and points (72), and was named Big Ten Player of the Year his junior year.
Playing in the indoor and rec league's while in Michigan, Cameron excelled in the bare-foot method of playing soccer, and once scored 14 goals in an indoor soccer game while playing with no shoes on.
During his college years Cameron also played in the USL Premier Development League for the Brooklyn Knights and the Michigan Bucks.
Knox also played for Pasco Soccer Club from Wayne, NJ during his high school years. He helped the team win countless tournaments and was one of a handful of players from the club to move on to play professional soccer.
Professional
Cameron suffered a serious knee injury while playing for the Michigan Bucks, and subsequently missed much of his senior year at Michigan. As a result of this, and doubts over his signability, Cameron slipped to the fourth round of the 2005 MLS SuperDraft, where he was drafted by Columbus Crew. He went on to play 30 games and score 4 goals for the team over the next two years, but following the 2006 season, he was waived by the team. During his time with the Crew he played a friendly against English side Everton and thanked them on the scoreboard for coming to Columbus so he could beat them.
Following his release by Crew, Cameron played for amateur team Canton Celtic, which plays in Michigan's MUSL Men's Open 1st Division. Celtic won the Michigan section of the USASA National Amateur Cup Championship, and represented the state at the 2008 USASA Regional tournament in Bowling Green, Kentucky.
Cameron returned to play for the Michigan Bucks in the USL Premier Development League in 2009, and then signed with Detroit City FC in 2012. He made his DCFC debut against the Erie Admirals on May 26, 2012, scoring the first goal in a 3-0 victory. He continued to play for DCFC in 2013, and scored two goals in their opener and another in the home opener. Cameron scored again in DCFC's 2-0 over Zanseville AFC, giving him 4 goals on the season.
Post-Professional
Cameron now is a co-owner and player for AFC Ann Arbor in Ann Arbor, Michigan. Cameron also helps with a youth soccer club called Saline FC.
International
Cameron elected to represent the United States internationally, and played for various youth national teams, being brought to UAE in 2003 for FIFA World Youth Championship.
References
External links
Columbus Crew player profile
Michigan bio
Category:1983 births
Category:Living people
Category:AFC Ann Arbor players
Category:African-American soccer players
Category:American soccer players
Category:Association football forwards
Category:Brooklyn Knights players
Category:Columbus Crew SC draft picks
Category:Columbus Crew SC players
Category:Jamaican emigrants to the United States
Category:Major League Soccer players
Category:Flint City Bucks players
Category:Michigan Wolverines men's soccer players
Category:National Premier Soccer League players
Category:Soccer players from New York (state)
Category:Sportspeople from the Bronx
Category:Sportspeople from Kingston, Jamaica
Category:United States men's under-20 international soccer players
Category:USL League Two players
Category:Cardinal Spellman High School (New York City) alumni | {
"pile_set_name": "Wikipedia (en)"
} |
Subsets and Splits