text
stringlengths 1
10.9k
| meta
dict |
|---|---|
Effect of an acid mine drainage effluent on phytoplankton biomass and primary production at Britannia Beach, Howe Sound, British Columbia.
We investigated the effect of acid mine drainage (AMD) from an abandoned copper mine at Britannia Beach (Howe Sound, BC, Canada) on primary productivity and chlorophyll a levels in the receiving waters of Howe Sound before, during, and after freshet from the Squamish River. Elevated concentrations of copper (integrated average through the water column >0.050 mgl(-1)) in nearshore waters indicated that under some conditions a small gyre near the mouth of Britannia Creek may have retained the AMD from Britannia Creek and from a 30-m deep water outfall close to shore. Regression and correlation analyses indicated that copper negatively affected primary productivity during April (pre-freshet) and November (post-freshet). Negative effects of copper on primary productivity were not supported statistically for July (freshet), possibly because of additional effects such as turbidity from the Squamish River. Depth-integrated average and surface chlorophyll a were correlated to copper concentrations in April. During this short study we demonstrated that copper concentrations from the AMD discharge can negatively affect both primary productivity and the standing stock of primary producers in Howe Sound. | {
"pile_set_name": "PubMed Abstracts"
} |
The impact of baculovirus challenge on immunity: The effect of dose and time after infection.
Understanding how hosts respond to pathogen attack is crucial to disease management. The response of a host can be particularly important if hosts have to defend against multiple pathogens which could either benefit from or be suppressed by prior pathogen exposure. Insect defence against viruses is less well understood than responses to other entomopathogens and much of the information available relates to in vitro studies and model systems. Baculoviruses are natural pathogens of insects, particularly Lepidoptera, and have been well-studied in terms of their ecology, pest control potential and molecular biology. In order to examine how an insect reacts to baculovirus challenge, we measured components of the cellular and humoral immune response of the cabbage looper Trichoplusia ni to Trichoplusia ni SNPV, a narrow-host range nucleopolyhedrovirus (NPV), over four doses and three times after pathogen challenge (18, 42 and 90 h). We found that total haemocyte numbers peaked at 42 h post-exposure at all doses, and declined linearly with increasing dose after the 18 h time point. Two immune-related enzymes, phenoloxidase (PO) and FAD-glucose dehydrogenase (GLD), showed very different responses. PO levels were lowest at the 42 h time point and were not influenced by virus dose when each time point was examined separately. GLD levels declined over time but they interacted with virus dose in a non-linear manner, such that there was an increase in levels at intermediate virus doses after 18 h, no effect at 42 h, and then declined as infection progressed at 90 h post-infection. These data suggest that baculoviruses can rapidly infect haemocytes (or cause a reduction in their numbers) in a dose-dependent manner once the infection is systemic, likely reducing the ability of the host to counter subsequent infections. However, the data do not support a direct role for PO in defence against baculoviruses. Whether GLD plays a role in virus defence is still unclear. | {
"pile_set_name": "PubMed Abstracts"
} |
Implantation of green tea catechin α-tricalcium phosphate combination enhances bone repair in rat skull defects.
The purpose of the present study is to investigate effects of the combination of epigallocatechin-3-gallate (EGCG) and α-tricalcium phosphate (α-TCP) on bone regenerative capacity in a bilateral rat calvarial bone defect model. Bilateral 5-mm-diameter calvarial defects were created in adult male Wistar rats and filled with preparations of EGCG (0, 0.1, 0.2, 0.4 mg) combined with α-TCP particles. This was done by dissolving EGCG in 100% ethanol (50 μL/14 mg) and dropping under sterile condition. The control group was left unfilled (n = 8). The animals were sacrificed at 2 and 4 weeks. Radiological images were taken, and histological analysis was done. Six animals from control (0 mg EGCG + α-TCP) group and (0.2 mg EGCG+ α-TCP) group were labeled with fluorescent dyes and histomorphometrically analyzed (n = 6) at 2 and 4 weeks. Histomorphometric analysis revealed that the combination of EGCG and α-TCP at doses of 0.1 and 0.2 mg yielded significantly more new bone formation than untreated control group at 2 and 4 weeks (p > 0.05). Mineral apposition rate at 0.2-TCP group was enhanced compared with the one of the positive control α-TCP group at 4 weeks (p > 0.05). The combination of α-TCP particles and 0.2 mg EGCG stimulates maximum bone regeneration in rat calvarial defects, and this combination would be potentially effective as bone graft material. | {
"pile_set_name": "PubMed Abstracts"
} |
Determination of caffeine in pharmaceutical preparations by the linear absorbances method.
In this work a fast Linear Absorbance Method for the determination of caffeine in pharmaceutical preparations in the presence of paracetamol or acetylsalicylic acid is presented. The determination of acetylsalicylic acid or paracetamol is also possible by means of a tabulated parameter fB, which values are included in this paper. The method avoids the use of separation steps or multicalibration methods. The determination was carried out in commercial preparations with good results. | {
"pile_set_name": "PubMed Abstracts"
} |
Cholinergic nervous system and immediate hypersensitivity. II. An analysis of pupillary responses.
We studied the pupillary responses of various subjects to carbamylcholine chloride (CCC) in order to assess cholinergic responsiveness. Using the concentration of topical CCC required to induce greater than or equal to 1 mm miosis in the dark as the end point, we compared the responses of five groups of subjects: normal controls; patients with allergic asthma, allergic rhinitis, or intrinsic asthma; and a group who had reproducibly positive skin tests in the absence of symptoms. Subjects with allergic rhinitis or allergic asthma were significantly more sensitive than were normal controls. The patients with positive skin test and negative history were as sensitive as their symptomatic cohorts, suggesting that pupillary cholinergic hyperresponsiveness exists in atopic individuals regardless of symptoms. A small group with intrinsic asthma was examined and found to be even more sensitive than any of the atopic subjects. Thus abnormal hyperresponsiveness of the pupillary constrictor muscles to a topically instilled cholinomimetic has been found in all groups of atopic subjects plus nonallergic asthmatics. Analysis of pupillary responses may prove useful in assessment of autonomic responsiveness. | {
"pile_set_name": "PubMed Abstracts"
} |
[Adenine uptake in Neurospora crassa mycelium].
The uptake of 8-C14-adenine in N. crassa strain Lindegren (+) was studied. The ability of N. crassa cells to uptake adenine from the medium reaches maximum at the very beginning of the logarithmic stage of growth. Adenine enters the mycelium against the concentration gradient. The uptake of adenine is maximal at 25-30 degrees C, pH 4,6-4,8, and adenine concentration in the medium about 2-15X10(-6) M. The entry of adenine into the cells follows normal Michaelis-Menten kinetics, the apparent Km=0.83+/-0.02 micron. The uptake is inhibited at higher concentrations (10(-3)-10(-4) M) of adenine. 2,6-Diaminopurine, hypoxanthine, guanine, 8-azaadenine and 8-azaguanine inhibit the transport of adenine into the cell. Xanthine and cytosine do not affect the uptake of adenine. Adenine taken up into the cell is rapidly metabolized to AMP, ADP and ATP. | {
"pile_set_name": "PubMed Abstracts"
} |
Do short, frequent DNA sequence motifs mould the epigenome?
'Epigenome' refers to the panoply of chemical modifications borne by DNA and its associated proteins that locally affect genome function. Epigenomic patterns are thought to be determined by external constraints resulting from development, disease and the environment, but DNA sequence is also a potential influence. We propose that domains of relatively uniform DNA base composition may modulate the epigenome through cell type-specific proteins that recognize short, frequent sequence motifs. Differential recruitment of epigenomic modifiers may adjust gene expression in multigene blocks as an alternative to tuning the activity of each gene separately, thus simplifying gene expression programming. | {
"pile_set_name": "PubMed Abstracts"
} |
Cisplatin Cross-Linked Multifunctional Nanodrugplexes for Combination Therapy.
Combination therapy efficiently tackles cancer by hitting multiple action mechanisms. However, drugs administered, simultaneously or sequentially, may not reach the targeted sites with the desired dose and ratio. The outcomes of combination therapy could be improved with a polymeric nanoparticle, which can simultaneously transport an optimal combination of drugs. We have demonstrated a simple one-pot strategy to formulate nanomedicines based on platinum coordination and the noncovalent interactions of the drugs. A naturally occurring polymer, hyaluronan (HA), was chosen as the building scaffold to form a nanodrugplex with cisplatin and aromatic-cationic drugs. The platinum coordination between cisplatin and HA induces the formation of a nanocomplex. The aromatic-cationic drugs are tightly packed by an electrostatic interaction and π-π stacking. The nanodrugplex bears excellent flexibility in drug combination and size control. It is stable in storage and has favorable release kinetics and targeting capabilities toward CD44, a receptor for HA that is highly expressed on many types of cancer cells. | {
"pile_set_name": "PubMed Abstracts"
} |
Effect of Salmonella treatment on an implanted tumor (CT26) in a mouse model.
The use of bacteria has contributed to recent advances in targeted cancer therapy especially for its tumor-specific accumulation and proliferation. In this study, we investigated the molecular events following bacterial therapy using an attenuated Salmonella Typhimurium defective in ppGpp synthesis (ΔppGpp), by analyzing those proteins differentially expressed in tumor tissues from treated and untreated mice. CT26 murine colon cancer cells were implanted in BALB/c mice and allowed to form tumors. The tumor-bearing mice were treated with the attenuated Salmonella Typhimurium. Tumor tissues were analyzed by 2D-PAGE. Fourteen differentially expressed proteins were identified by mass spectrometry. The analysis revealed that cytoskeletal components, including vimentin, drebrin-like protein, and tropomyosin-alpha 3, were decreased while serum proteins related to heme or iron metabolism, including transferrin, hemopexin, and haptoglobin were increased. Subsequent studies revealed that the decrease in cytoskeletal components occurred at the transcriptional level and that the increase in heme and iron metabolism proteins occurred in liver. Most interestingly, the same pattern of increased expression of transferrin, hemopexin, and haptoglobin was observed following radiotherapy at the dosage of 14 Gy. | {
"pile_set_name": "PubMed Abstracts"
} |
Recent advances in electron imaging, image interpretation and applications: environmental scanning electron microscopy.
One of the latest developments in electron microscopy is the environmental scanning electron microscope (ESEM), which enables soft, moist and/or electrically insulating materials to be viewed without pre-treatment, unlike conventional scanning electron microscopy, in which specimens must be solid, dry and usually electrically conductive. Such an advance has significant implications for studies of the 'native' surfaces of specimens including rocks and minerals, polymers, biological tissues and cells, food and pharmaceutical products, precious artefacts and forensic material, for example. Previous types of electron microscopes made scientists think carefully about the physics of electron-beam interactions with specimens and, hence, the interpretation of images. We now face additional factors influencing the emission and detection of electron signals, unique to the imaging of specimens in the partial vacuum of an ESEM. Just as importantly, we must consider the thermodynamic and kinetic stability of specimens, as appropriate, and explore the possibilities for new applications, particularly those of a dynamic nature. This paper briefly describes some of the issues involved and reviews the current state of understanding. | {
"pile_set_name": "PubMed Abstracts"
} |
CpG Island Methylation in Sessile Serrated Adenomas Increases With Age, Indicating Lower Risk of Malignancy in Young Patients.
Among sessile serrated adenomas (SSAs) with identical histologic features, some never progress, whereas others become dysplastic and develop into invasive cancers. Development of the CpG island methylator phenotype is a feature of SSA progression; we examined the CIMP status of 448 SSAs and examined the association with patient clinical data. Overall, 190 SSAs were CpG island methylator phenotype-positive. CpG island methylator phenotype positivity was associated with older patient age (P < .001) and proximal polyp site (P < .001), but not with patient sex (P = .94) or polyp size (P = .34). These results might be used to improve SSA surveillance guidelines. | {
"pile_set_name": "PubMed Abstracts"
} |
Hoffa's Fat Pad Abnormality in the Development of Knee Osteoarthritis.
Over the past two decades, many hypotheses have been put forward to explain the cause of knee osteoarthritis. Scientific reports bring up the role of adipose tissue in the activation of the inflammatory mechanisms, which is a characteristic feature of osteoarthritis natural history. Adipose tissue produces and releases cytokines, interleukins, and growth factors by means of paracrine, endocrine, and autocrine mechanisms. Hoffa's fat pad (infrapatellar adipose tissue) plays a viable role in the initiation and progression of osteoarthritis due to its role in the activation and release of pro-inflammatory mediators. The degenerative joint disease is considered an inflammatory process. Therefore, in this article we overview the importance of Hoffa's fat pad in the development and progression of osteoarthritis. | {
"pile_set_name": "PubMed Abstracts"
} |
Self-pollen interference is absent in wild radish (Raphanus raphanistrum, Brassicaceae), a species with sporophytic self-incompatibility.
Explaining the diversity of mating systems and floral forms in flowering plants is a long-standing concern of evolutionary biologists. One topic of interest is the conditions under which self-pollination can interfere with seed set for flowering plants with a self-incompatibility system. We investigated the effect of self-pollen interference for wild radish, Raphanus raphanistrum, which has sporophytic self-incompatibility. We performed pollinations and determined seed set for plants grown in the greenhouse, using pollen mixtures representing either self- with outcross-pollen or outcross-pollen alone. Stigmas were collected for a subset of pollinated flowers to determine the number of pollen grains applied. Average seed set for the self/cross (5.13 seeds/pollination) and cross treatments (5.09 seeds/pollination) did not differ significantly. Stigmatic pollen loads averaged around 700 grains, an amount close to observed natural pollen loads on R. raphanistrum. We concluded that for R. raphanistrum in natural populations, self-pollen is unlikely to interfere with outcross-pollen success. This study is the first to investigate effects of self-pollen interference on seed set for a homomorphic species with sporophytic self-incompatibility where rejection occurs at the stigmatic surface. | {
"pile_set_name": "PubMed Abstracts"
} |
Plasma protein binding of frusemide in renal failure rabbits: investigation of endogenous protein binding inhibitors.
The reduction mechanism of frusemide-protein binding in the plasma of renal failure was investigated. The drug-albumin binding was inhibited by the low molecular-weight fraction obtained from acute renal failure rabbits, suggesting the presence of the inhibitors in the plasma. Further, this fraction was divided into six subfractions by Bio-Gel P-2. Fractions II and V2 showed significant inhibition of the protein binding of frusemide. Among uraemic toxins, four indole derivatives markedly inhibited the protein binding. Analysis by hplc confirmed that the concentration of indican was markedly increased in acute renal failure rabbit plasma. It is suggested that this compound could be one of the major inducers of the protein binding defect. | {
"pile_set_name": "PubMed Abstracts"
} |
GM-CSF therapy for delayed engraftment after autologous bone marrow transplantation.
Based on previous observations that granulocyte-macrophage colony-stimulating factor (GM-CSF) promotes granulocyte recovery following chemotherapy, we evaluated the effect of recombinant human GM-CSF on hematopoietic progenitors and clinical outcome in six patients with delayed engraftment (greater than 55 days) after high-dose therapy and autologous bone marrow transplantation (ABMT). Three patients responded to a 14-day course of GM-CSF (10 micrograms/kg body weight/day) with at least a sevenfold rise in circulating granulocytes and a corresponding increase in granulopoietic activity in the bone marrow. A fourth patient died of infection on the 8th day of GM-CSF therapy with no evidence of response, and the remaining two, one of whom received a lower dose of GM-CSF (5 micrograms/kg/day), did not respond. There was no change in platelet or red cell transfusion requirements in any patient during the treatment. In two of the three responders, the granulocyte counts returned to pretreatment levels by 4 and 7 weeks after stopping the drug, respectively. We observed a marked increase in marrow-derived as well as in circulating granulocyte-macrophage progenitors (granulocyte-macrophage colony-forming units, CFU-GM) by the end of the 14-day course of GM-CSF in the three responders. There was no change in the frequency of circulating or marrow-derived erythroid (erythroid burst-forming units, BFU-E) or multilineage (multilineage colony-forming units, CFU-GEMM) progenitors. The results indicate that GM-CSF therapy in patients with markedly delayed engraftment after ABMT may stimulate granulopoiesis, but the effect is transient in some patients. | {
"pile_set_name": "PubMed Abstracts"
} |
Carcinogen-induced mutagenesis in the simian virus 40 genome.
Here are reviewed the most interesting results which have been obtained with a mutational assay based on the use of Simian Virus 40 (SV40) as a biological probe. This mutational assay allowed us first to study the mutation potency of some chemical and physical DNA damaging agents such as acetoxy-acetylaminofluorene and UV-light and of apurinic sites created by heat treatment under acidic conditions, and second to study at the molecular level the modifications induced by these treatments. A correlation between the location of the DNA adducts and the location of the hot spots of mutagenesis has tentatively been researched. No direct link has been found. Our results suggest that mutation hot spots are correlated with local DNA conformations which could be modified by the DNA damaging agents. | {
"pile_set_name": "PubMed Abstracts"
} |
Team Reading (Peer Review) of Suspicious/Positive Slides for Continuous Quality Improvement in Cervical-Vaginal Cytology: A Comparison between Methods and Indicators.
In 2013, the Local Health Unit Roma 2 ex C screening laboratory introduced a new set of indicators for quality assurance. We compare 2 sets of indicators based on routine multiple readings (peer review) for their ability to identify problems in single-reader accuracy. All suspect slides were blindly reviewed by all the cytologists of the laboratory. The standard set of indicators includes interreader Cohen's kappa, positivity rate and atypical squamous cell of undetermined significance/squamous intraepithelial lesion (ASC-US/SIL) ratio. The new set included sensitivity for cervical intraepithelial neoplasia of grade 2 or worse (CIN2+), positive predictive value (PPV) and percentage of positive high-risk (HR)-HPV cases among ASC-US. In order to estimate sensitivity and PPV, we considered all women for whom there was a consensus of negative cytology, negative HR-HPV test, negative colposcopy or negative histology true negative. Kappa values ranged from 0.521 to 0.753, with narrow 95% confidence intervals (CIs). Positivity rate ranged from 73.9 to 85.7 and the ASC-US/SIL ratio from 0.61 to 0.81. Sensitivity for CIN2+ at the low-grade SIL threshold ranged from 85.8 to 94.2, PPV ranged from 14.8 to 19.4, and both had a broad 95% CI. Readers with low sensitivity did not show low kappa values. The percentage proportion of HR-HPV-positives (HR-HPV+) among ASC-US ranged from 39.9 to 43.8% with a narrow 95% CI. The proportion of HR-HPV+ among ASC-US cases is a powerful indicator to address in training. | {
"pile_set_name": "PubMed Abstracts"
} |
The health and productivity cost burden of the "top 10" physical and mental health conditions affecting six large U.S. employers in 1999.
A multi-employer database that links medical, prescription drug, absence, and short term disability data at the patient level was analyzed to uncover the most costly physical and mental health conditions affecting American businesses. A unique methodology was developed involving the creation of patient episodes of care that incorporated employee productivity measures of absence and disability. Data for 374,799 employees from six large employers were analyzed. Absence and disability losses constituted 29% of the total health and productivity related expenditures for physical health conditions, and 47% for all of the mental health conditions examined. The top-10 most costly physical health conditions were: angina pectoris; essential hypertension; diabetes mellitus; mechanical low back pain; acute myocardial infarction; chronic obstructive pulmonary disease; back disorders not specified as low back; trauma to spine and spinal cord; sinusitis; and diseases of the ear, nose and throat or mastoid process. The most costly mental health disorders were: bipolar disorder, chronic maintenance; depression; depressive episode in bipolar disease; neurotic, personality and non-psychotic disorders; alcoholism;, anxiety disorders; schizophrenia, acute phase; bipolar disorders, severe mania; nonspecific neurotic, personality and non-psychotic disorders; and psychoses. Implications for employers and health plans in examining the health and productivity consequences of common health conditions are discussed. | {
"pile_set_name": "PubMed Abstracts"
} |
Preliminary investigation of the clinical usefulness of super-high-resolution LCDs with 9 and 15 mega-sub-pixels: observation studies with phantoms.
Our purpose in this study was to evaluate the preliminary clinical efficacy of soft-copy reading of digital mammography, for a 15-mega-sub-pixel (MsP) and a 9-MsP super-high-resolution liquid-crystal display (SHR-LCD) by use of an independent sub-pixel driving technology. We performed three kinds of phantom observation studies by six radiological technologists. Detectability of a contrast-detail phantom and simulated small objects (SSOs) resembling microcalcifications (MCLs), and shape discrimination ability of SSOs with round and square shapes, were examined and compared with a 5-MP conventional LCD (5-MP LCD). In each study, four types of display magnification ratio were used. The detectability and the shape discrimination ability of the 15-MsP SHR-LCD were highest among the three LCDs of most of the display magnification ratios. The 9-MsP SHR-LCD indicated a higher or equal performance as compared with the 5-MP LCD in the SSO detection and shape studies. The results of our study demonstrated that the SHR-LCDs had good potential to detect MCLs and to evaluate the shape in high-resolution digital mammography. | {
"pile_set_name": "PubMed Abstracts"
} |
Psychological response of patients receiving two drug regimens for lung carcinoma.
Seventy-seven patients with small cell lung carcinoma were assigned randomly to two chemotherapy regimens to assess their psychological response to each regimen. One produced less depression and fatigue than the other, despite the absence of differences in tumor response. | {
"pile_set_name": "PubMed Abstracts"
} |
Cytokine-induced phosphorylation of pp100 in FDC-ER cells is at tyrosine residues.
Using FDC-P1 cells stably transfected with a murine erythropoietin receptor cDNA as a model, we recently have shown that erythropoietin (EPO), IL-3 and GM-CSF each induce the rapid phosphorylation of a common cytosolic target, i.e., a M(r) 100,000 phosphoprotein "pp100". Presently, we demonstrate that cytokine-induced phosphorylation of pp100 is primarily at tyrosine residues. This is shown by Western blotting with the anti-phosphotyrosine antibody PY20, and by the resistance of [32P]-pp100 to hydroxide-mediated hydrolysis of phosphates. These data, together with the recent observation by Linnekin et al. that pp100/p97 apparently associates directly with EPO receptors, suggest that pp100 may comprise an immediate common component in the signal transduction pathways of EPO, IL-3, GM-CSF and possibly other type I/II cytokine receptors. Additional analyses suggest that pp100 is distinct from a previously described M(r) 100,000 cytosolic target which is tyrosine phosphorylated in hematopoietic cells upon activation of T-cell receptors. | {
"pile_set_name": "PubMed Abstracts"
} |
[Immobilization of cytochrome P-450 from rabbit liver microsomes on albumin modified Sepharose 2B].
A highly purified cytochrome P-450 from rabbit liver microsomes has been immobilized on albumin modified omega-aminohexyl-Sepharose 2B, after glutaraldehyde treatment of the matrix. The effect of the degree of albumin modification of the matrix on the catalytic activity of immobolized cytochrome P-450 has been studied in cumene hydroperoxide dependent aniline hydroxylation. On this basis an optimal cytochrome P-450/albumin ratio has been found which allows a substantial decrease in the rate of cytochrome P-450 destruction by cumene hydroperoxide in the substrate absence. | {
"pile_set_name": "PubMed Abstracts"
} |
Chemical constituents and energy content of some latex bearing plants.
The latex bearing plants Plumeria alba, Calotropis procera, Euphorbia nerrifolia, Nerium indicum and Mimusops elengi were evaluated as potential renewable sources of energy and chemicals. Plant parts (leaf, stem, bark) and also whole plants were analyzed for elemental composition, oil, polyphenol, hydrocarbons, crude protein, alpha-cellulose, lignin and ash. The dry biomass yields were between 4.47 and 13.74 kg/plant. The carbon contents in whole plants varied from 38.5% to 44.9%, while hydrogen and nitrogen contents varied from 5.86% to 6.72% and 1.26% to 2.34%, respectively. The bark of the plants contained the highest amount of hydrocarbons (1.78-3.93%) and the leaves contained the lowest amounts (0.26-1.82%). The unsaponifiable materials and fatty acids in the oil fractions of whole plants ranged from 22.8% to 56.4% and 24.7% to 58.7%, respectively. The highest gross heat value was exhibited by C. procera (6145 cal/g) and the lowest by N. indicum (4405 cal/g). Hydrocarbon fractions were characterized by IR and (1)H-NMR and by thermogravimetric analyses. The activation energy (E(a)) in the third stage of decomposition was the greatest in the hydrocarbon fraction obtained from M. elengi (16.40 kJ mol(-1)) and the lowest for C. procera (3.96 kJ mol(-1)). The study indicated that the plant species might be suitable as alternative source of hydrocarbons and other phytochemicals. | {
"pile_set_name": "PubMed Abstracts"
} |
Magnetic zirconium hexacyanoferrate(II) nanoparticle as tracing tag for electrochemical DNA assay.
Novel multifunctional magnetic zirconium hexacyanoferrate nanoparticles (ZrHCF MNPs) were prepared, which consisted of magnetic beads (MBs) inner core and zirconium hexacyanoferrate(II) (ZrHCF) outer shell. As an artificial peroxidase, the ZrHCF MNPs exhibited remarkable electrocatalytic properties in the reduction of H2O2 at 0.2 V vs saturated calomel electrode (SCE). On the basis of the bonding interaction between Zr (IV) of the shell ZrHCF framework and phosphonate groups, the 5'-phosphorylated ssDNA probes with a consecutive stretch of guanines as a spacer could be incorporated in ZrHCF MNPs easily. Thus, DNA-grafted ZrHCF MNPs could be simply obtained by magnetic separation. The prepared nanoelectrocatalyst was further used as signal nanoprobe for the ultrasensitive electrochemical DNA assay. Under optimal conditions, the proposed biosensor presents high sensitivity for detecting target DNA with a linear range from 1.0 fM to 1.0 nM and a low detection limit of 0.43 fM. Moreover, it exhibits good performance with excellent selectivity, high stability, and acceptable fabrication reproducibility. | {
"pile_set_name": "PubMed Abstracts"
} |
Hepatitis C and neutropenia.
This review describes the pathogenesis and therapeutic implications of neutropenia in patients with hepatitis C. Mild-to-moderate neutropenia is increasingly recognized as the hepatitis C population has caused increased cirrhosis. Multiple mechanisms for the neutropenia have been postulated, with recent evidence pointing toward a combination of hypersplenism, autoimmunity, and direct viral infection of bone marrow cells. Advances in antiviral therapy are associated with worsened neutropenia and dose modification. Severe neutropenia is underreported and is generally not associated with increased rates of infection. Although neutropenia is common in hepatitis C patients it generally has a benign course and may not prohibit antiviral therapy. | {
"pile_set_name": "PubMed Abstracts"
} |
Acute hydrocephalus after subarachnoid hemorrhage.
Acute hydrocephalus as a consequence of subarachnoid hemorrhage is a relatively frequent problem. It is associated with more neurologic impairment and mortality than subarachnoid hemorrhage without hydrocephalus. A review of the literature was done to determine its frequency of presentation, the associated causes of morbidity and mortality, its clinical presentation, and treatment options. A search was done through the Med-Line system to obtain pertinent literature of the last 10 years. Articles before this date were obtained from references from the original search. Acute hydrocephalus is present in 20% of patients with subarachnoid hemorrhage. One third of them may be asymptomatic on admission; 50% of those who have clinical hydrocephalus recover spontaneously within the first 24 h. The presence of acute hydrocephalus after subarachnoid hemorrhage is associated with additional morbidity and higher mortality secondary to rebleeding, to cerebral infarction or to shunt infection. Once hydrocephalus develops, ventricular size is not related to the clinical status of the patient, nor to the associated complications. If a patient presents with subarachnoid hemorrhage accompanied by acute hydrocephalus and preserved level of consciousness, he/she should be carefully observed for the first 24 h. If deterioration of consciousness ensues and is not attributable to rebleeding or metabolic causes, ventriculostomy should be performed. If a patient presents with subarachnoid hemorrhage accompanied by acute hydrocephalus and depressed level of consciousness ventriculostomy should be immediately placed. After ventriculostomy, intracranial pressure should be maintained above 15 mm Hg to prevent rebleeding. Prophylactic antibiotics and long subcutaneous catheters should be used to avoid shunt infections. | {
"pile_set_name": "PubMed Abstracts"
} |
Factors Affecting Death of Yeast by Sulfur Dioxide 1.
The interrelated factors that influence the effectiveness of SO2 as a preservative against yeast were studied and the correct quantitative relationships of SO2 molecular species determined. Widely differing pK values for SO2 were found in the literature, compared with experimental data, and one set of values was selected. Undissociated H2SO3 is the only effective form of SO2 against yeast and can be calculated from measurement of free SO2 and pH, and the correct dissociation constants. Duration of contact, pH, concentration of SO2 and yeast, and binding of SO2 all influence the preservative action of SO2. Lower total SO2 concentrations can be used for food preservation by optimum control of these factors. | {
"pile_set_name": "PubMed Abstracts"
} |
Nameless desire: alexithymia and the anorexic patient.
In this article, the author attempts to provide a psychoanalytic understanding of the anorexic patient who is disconnected from her affective experience and is considered to be alexithymic. Through her restrictive food ritual, this type of patient may organize her internal states by repeatedly creating an illusion of what it is that she needs and desires. The author asserts that the task of the therapist working with the anorexic patient with alexithymia is to be aware of his own sensation-based reverie as lived within the intersubjective arena. This will enable the therapist to assist the patient in building an affective vocabulary to accurately identify, differentiate, and label the internal signals of her body. It is suggested that the subjective emotional experience of the patient will continue to be reorganized, expanded, and enriched as the therapist and patient mutually influence one another in this unique relational matrix. A clinical vignette is provided to illustrate intersubjective treatment interventions with a difficult-to-reach anorexic patient. | {
"pile_set_name": "PubMed Abstracts"
} |
Probucol therapy improves long-term (>10-year) survival after complete revascularization: a propensity analysis.
Probucol has anti-atherosclerotic properties and has been shown to reduce post-angioplasty coronary restenosis. However, the effect of probucol therapy on long-term (>10 years) outcome following coronary revascularization is less well established. Accordingly, we sought to determine if probucol therapy at the time of complete coronary revascularization reduces mortality in patients with coronary artery disease (CAD). We collected data from 1694 consecutive patients who underwent complete revascularization (PCI and/or bypass surgery). Mortality data were compared between patients administered probucol and those not administered probucol at the time of revascularization. A propensity score (PS) was calculated to evaluate the effects of variables related to decisions regarding probucol administration. The association of probucol use and mortality was assessed using 3 Cox regression models, namely, conventional adjustment, covariate adjustment using PS, and matching patients in the probucol and no-probucol groups using PS. In the pre-match patients, 231 patients were administered probucol (13.6%). During follow-up [10.2 (SD, 3.2) years], 352 patients died (including 113 patients who died of cardiac-related issues). Probucol use was associated with significant decrease in all-cause death (hazard ratio [HR], 0.65; P=0.036 [conventional adjustment model] and HR, 0.57; P=0.008 [PS adjusted model]). In post-match patients (N=450, 225 matched pair), the risk of all-cause mortality was significantly lower in the probucol group than in the no-probucol group (HR, 0.45; P=0.002). In CAD patients who had undergone complete revascularization, probucol therapy was associated with a significantly reduced risk of all-cause mortality. | {
"pile_set_name": "PubMed Abstracts"
} |
How useful are tests for rheumatoid factors, antiperinuclear factors, antikeratin antibody, and the HLA DR4 antigen for the diagnosis of rheumatoid arthritis?
To evaluate the usefulness for the diagnosis of rheumatoid arthritis of tests for rheumatoid factors, antiperinuclear factors, antikeratin antibodies, and the HLA DR4 antigen, we retrospectively reviewed the medical records of 138 patients consecutively admitted to our rheumatology department between January 1, 1988 and December 31, 1990 for evaluation of peripheral inflammatory joint manifestations. Each patient had a standard work-up including a physical examination, laboratory tests, and roentgenograms. In 1994, after a follow-up of three to six years, the final diagnosis was rheumatoid arthritis in 39 patients and another well-defined disorder in 63; no diagnosis was established in 36 patients, among whom nine were lost to follow-up. The decreasing order of diagnostic usefulness was antiperinuclear factors, HLA DR4, rheumatoid factors (latex test), and antikeratin antibody. The likelihood of rheumatoid arthritis was greatest in those patients with positivity of two of the three following markers: rheumatoid factors, antiperinuclear factors, and the HLA DR4 antigen. | {
"pile_set_name": "PubMed Abstracts"
} |
Issues in qualitative and quantitative risk analysis for developmental toxicology.
The qualitative and quantitative evaluation of risk in developmental toxicology has been discussed in several recent publications. A number of issues still are to be resolved in this area. The qualitative evaluation and interpretation of end points in developmental toxicology depends on an understanding of the biological events leading to the end points observed, the relationships among end points, and their relationship to dose and to maternal toxicity. The interpretation of these end points is also affected by the statistical power of the experiments used for detecting the various end points observed. The quantitative risk assessment attempts to estimate human risk for developmental toxicity as a function of dose. The current approach is to apply safety (uncertainty) factors to the no observed effect level (NOEL). An alternative presented and discussed here is to model the experimental data and apply a safety factor to an estimated risk level to achieve an "acceptable" level of risk. In cases where the dose-response curves upward, this approach provides a conservative estimate of risk. This procedure does not preclude the existence of a threshold dose. More research is needed to develop appropriate dose-response models that can provide better estimates for low-dose extrapolation of developmental effects. | {
"pile_set_name": "PubMed Abstracts"
} |
Risk factors for pediatric tuberculosis infection and disease after household exposure to adult index cases in Alaska.
To determine risk factors for pediatric tuberculosis infection and active tuberculosis. We examined medical records from multiple sources for all 282 children younger than 15 years in Alaska during the period 1987 to 1994 who were household contacts of an adult with culture-positive pulmonary tuberculosis. Infection developed in 25% of the children and progressed to active disease in 9.6%. Risk factors for pediatric infection included exposure to a parent who had active tuberculosis and exposure to any adult with active tuberculosis who had a cough, smear positivity, or a left upper lobe (LUL) chest lesion (odds ratios, 2.1 to 2.8). Among the 71 children in whom infection developed, Alaska Natives and younger children were more likely to progress to active tuberculosis, as were children exposed to a parent who had active tuberculosis and children exposed to any adult who had a LUL chest lesion (odds ratios, 1.5 to 12). Although all children with household exposure to adults with active tuberculosis have a high risk of contracting the infection and disease, specific risk factors can be identified and differ for infection and disease. Alaska Natives have an increased risk of progression to disease once infected. | {
"pile_set_name": "PubMed Abstracts"
} |
[A robust statistic AC₁ for assessing inter-observer agreement in reliability studies].
Understanding inter-observer variability in clinical diagnosis is crucial for reliability studies. As the statistical measurements of reliability, the kappa statistic and its extensions have been widely adopted in medical research, but it has been discussed that kappa is vulnerable to prevalence and presence of bias. As an alternative robust statistic, AC₁ has attracted recent statistical attentions. This article describes fundamental ideas and quantitative features of AC₁. The reliability of infrared thermoscanner as an application in detecting febrile patients of pandemic influenza is discussed by means of Monte Carlo simulation. AC₁ adjusts chance agreement more appropriately than kappa and is regarded as a more useful measurement for assessing inter-observer agreement, especially when prevalence is small. | {
"pile_set_name": "PubMed Abstracts"
} |
Clinical utility of a glucose reflectance meter for screening neonates for hypoglycemia.
The purpose of this study was to examine the clinical utility of a glucose reflectance meter to screen neonates for hypoglycemia. One hundred six infants admitted to the observation or level III nursery with a screening whole blood glucose concentration < or = 2.8 mmol/L (< or = 50 mg/dl) had a second sample drawn to compare glucose reflectance meter measurements with those of corrected laboratory-determined glucose concentrations. Error grid analysis was used to determine clinical utility of the reflectance meter in a clinical setting. No reading obtained with the glucose reflectance meter was > 2.2 mmol/L (40 mg/dl) in infants whose true whole blood glucose concentration was < or = 1.7 mmol/L (30 mg/dl). Only 0.9% (1/106) of glucose reflectance meter values were < or = 1.7 (< or = 30 mg/dl) when the simultaneous laboratory-determined whole-blood glucose concentration was > 2.2 mmol/L (40 mg/dl). Glucose concentrations obtained by the reflectance meter correlated (r = 0.77, p = 0.001) with laboratory-determined concentrations. The glucose reflectance meter provides a rapid and clinically useful method of screening for neonatal hypoglycemia. | {
"pile_set_name": "PubMed Abstracts"
} |
Distinction between pyogenic brain abscess and necrotic brain tumour using 3-tesla MR spectroscopy, diffusion and perfusion imaging.
The purpose of this study is to compare the effectiveness of relative cerebral blood volume, apparent diffusion coefficient and spectroscopic imaging in differentiating between cerebral abscesses and necrotic tumours. In the prospective study, a 3-tesla MR unit was used to perform proton MR spectroscopy, diffusion and perfusion imaging in 20 patients with cerebral abscesses and 26 patients who had solitary brain tumours (14 high-grade gliomas and 12 metastases). We found the mean apparent diffusion coefficient value at the central cavities of the cerebral abscesses to be significantly lower than in necrotic tumours. The mean relative cerebral blood volume values of the necrotic tumour wall were statistically significantly higher than the mean relative cerebral blood volume values of the cerebral abscess wall by the Student's t-test. The proton spectra obtained revealed amino acids only in the cerebral abscesses. Although the conventional MRI characteristics of cerebral abscesses and necrotic tumours may sometimes be similar, diffusion, perfusion-weighted and spectroscopic MRI enables distinction between the two. | {
"pile_set_name": "PubMed Abstracts"
} |
Dietary n-3 PUFAs affect the blood pressure rise and cardiac impairments in a hyperinsulinemia rat model in vivo.
The cardiovascular consequences of eicosapentaenoic acid (EPA)- and docosahexaenoic acid (DHA)-specific intake were evaluated in vivo in a hyperinsulinemia (HI) model induced by dietary fructose intake. Wistar rats were fed a diet containing (or not for control) either EPA or DHA. The rise in blood pressure (BP), heart rate, and ECG were continuously monitored using an intra-abdominal telemetry system. The myocardial phospholipid fatty acid profile was significantly affected by DHA intake but less by EPA intake. The data indicated a reduced rise in BP in both DHA and EPA HI groups compared with controls. This result was confirmed by tail-cuff measurement after 5 wk [133.3 +/- 1.67 and 142.5 +/- 1.12 mmHg in n-3 polyunsaturated fatty acid (PUFA) and control groups, respectively], whereas n-3 PUFA did not affect BP in non-HI rats (116.3 +/- 3.33 mmHg). The heart rate was lower in the HI DHA group than in the other two dietary HI groups. Moreover, DHA induced a significantly shorter QT interval. It is concluded that the cardioactive component of fish oils is DHA through a mechanism that may involve the cardiac adrenergic system. | {
"pile_set_name": "PubMed Abstracts"
} |
Predictors of Perioperative Acute Kidney Injury in Obese Patients Undergoing Laparoscopic Bariatric Surgery: a Single-Centre Retrospective Cohort Study.
Obesity has been associated with increased risk of perioperative acute kidney injury (AKI). We aim to establish the incidence of AKI among patients undergoing laparoscopic bariatric surgery and identify potential risk factors. Records of 1230 patients who underwent laparoscopic bariatric surgery in a tertiary centre from 1 December 2009 to 31 January 2014 were retrospectively studied. AKI diagnosis was made by comparing the baseline and post-operative serum creatinine to determine the presence of predefined significant change based on the Kidney Disease: Improving Global Outcomes (KDIGO) definition. Univariate analyses were performed to determine significant clinical factors, and multiple logistic regression analysis was subsequently done to determine independent predictors of AKI. Thirty-five (2.9 %) patients developed AKI during the first 72 h post-surgery. Multivariate logistic regression analysis revealed impaired renal function (OR 10.429, 95 % CI 3.560 to 30.552), use of angiotensin-converting enzyme inhibitors and angiotensin II receptor blockers (OR 3.038, 95 % CI 1.352 to 6.824), and body mass index (OR 1.048, 95 % CI 1.005 to 1.093) as independent predictors of perioperative acute kidney injury in the obese patients who underwent laparoscopic bariatric surgery. We found that the incidence of perioperative AKI among patients who underwent laparoscopic bariatric surgery is at 2.9 %. Impaired renal function, use of angiotensin-converting enzyme inhibitors and angiotensin II receptor blockers and raised body mass index were found to be independent predictors of AKI. Patients with these risk factors could be considered at risk for developing perioperative AKI, and extra perioperative vigilance should be undertaken. | {
"pile_set_name": "PubMed Abstracts"
} |
Assessing the relative incidence of mitochondrial DNA A3243G in migraine without aura with maternal inheritance.
To determine whether patients with migraine without aura with maternal "inheritance" are affected by a monosymptomatic form of the MELAS syndrome (mitochondrial encephalomyopathy, lactic acidosis, and strokelike episodes) or carry the most common mitochondrial DNA (mtDNA) mutation associated with MELAS, namely the A3243G transition in the transfer RNA (tRNA)Leu(UUR) gene. The association between migraine and abnormal mitochondrial function has been suggested on clinical, biochemical, and neuroradiological grounds. Migraine attacks with vomiting and cerebral infarctions, most often in the posterior cerebral regions, which are reminiscent of complicated migraine, are typical features of MELAS. The observation that migrainous patients have affected mothers more often than affected fathers suggests a possible role for maternally transmitted genetic factors. We studied 25 patients with migraine with aura whose mothers were also affected. A sensitive polymerase chain reaction restriction fragment length polymorphism analysis was used to detect mutated genomes. We failed to detect the MELAS mutation, but migraine may still be associated with point mutations of mtDNA other than A3243G or with as-yet-unidentified nuclear DNA factors related to mitochondrial function. | {
"pile_set_name": "PubMed Abstracts"
} |
[Assessment of bone quality--present and future].
Bone quality including "structural property" and "material property" , which is strongly affected by bone remodeling and has an influence on bone biomechanical property. Structural property means macroscopical geometry, bone size, trabecular microstructure, cortical thickness and cortical porosity. Material property means mineralization, crystal size, collagen and microdamage. Although most of them are analyzed in vitro, in the future, noninvasive assessment of bone quality may help to guide therapy of osteoporosis. | {
"pile_set_name": "PubMed Abstracts"
} |
The attachment of minicircles to kinetoplast DNA networks during replication.
Kinetoplast DNA (kDNA), the trypanosomatid mitochondrial DNA, is a network containing several thousand interlocked minicircles. During kDNA synthesis, minicircles dissociate from the network, and after replication their progeny reattach to the network periphery. Using electron microscopy autoradiography, we found that newly synthesized 3H-labeled minicircles, after short labeling periods, are concentrated in two peripheral zones on opposite sides of the network. These must be minicircle attachment sites, adjacent to the two diametrically opposed complexes of replication proteins observed previously. From the pattern of radiolabeling during longer pulses, we reached the unexpected conclusion that minicircle attachment around the entire network periphery may be due to a relative movement of the kinetoplast and the two complexes. The kinetoplast probably rotates between two fixed complexes. | {
"pile_set_name": "PubMed Abstracts"
} |
Quantum dots-hemin: Preparation and application in the absorption of heme iron.
The absorption mechanism of heme iron remains unclear due to the limit of labeling techniques. Quantum dots (QDs) are powerful fluorescent probes resistant to photobleaching, however, there is no data about the application of QDs in heme iron absorption. Herein, we prepared hemin-coated CdSe/ZnS (QDs-hemin), and studied their absorption in vitro and in vivo. Results showed that QDs-hemin had uniform particle sizes, physiological stability and high joint efficiency. Moreover, QDs-hemin could be successfully absorbed gradually into the duodenum with the time using synchrotron radiation micro X-ray fluorescence and confocal laser scanning microscopy. Furthermore, QDs-hemin were observed to degrade in lysosomes, and their absorption was blocked by Heme Carrier Protein 1 (HCP1) antibody and HCP1 siRNA. All the results demonstrate that QDs can be a good tracer for heme iron and that HCP1 pathway is critical and predominant over the endocytosis pathway in the absorption mechanism. | {
"pile_set_name": "PubMed Abstracts"
} |
Harnessing the natural diversity and in vitro evolution of Cas9 to expand the genome editing toolbox.
In the past few years, the Cas9 endonuclease from the type II CRISPR-Cas bacterial antiviral defense system has revolutionized the genome editing field. Guided by an RNA molecule, Cas9 can be reprogrammed to target almost any DNA sequence: the only limitation being the short nucleotide sequence in the vicinity of the target, termed the PAM, which is characteristic for each Cas9 protein. Streptococcus pyogenes Cas9 which recognizes the NGG PAM is currently most widely used for genome manipulation. However, Cas9 orthologues and engineered Cas9 variants offer expanded genome targeting capabilities, improved specificity and biochemical properties. | {
"pile_set_name": "PubMed Abstracts"
} |
p38 Kinase-dependent MAPKAPK-2 activation functions as 3-phosphoinositide-dependent kinase-2 for Akt in human neutrophils.
Akt activation requires phosphorylation of Thr(308) and Ser(473) by 3-phosphoinositide-dependent kinase-1 and 2 (PDK1 and PDK2), respectively. While PDK1 has been cloned and sequenced, PDK2 has yet to be identified. The present study shows that phosphatidylinositol 3-kinase-dependent p38 kinase activation regulates Akt phosphorylation and activity in human neutrophils. Inhibition of p38 kinase activity with SB203580 inhibited Akt Ser(473) phosphorylation following neutrophil stimulation with formyl-methionyl-leucyl-phenylalanine, FcgammaR cross-linking, or phosphatidylinositol 3,4,5-trisphosphate. Concentration inhibition studies showed that Ser(473) phosphorylation was inhibited by 0.3 microm SB203580, while inhibition of Thr(308) phosphorylation required 10 microm SB203580. Transient transfection of HEK293 cells with adenoviruses containing constitutively active MKK3 or MKK6 resulted in activation of both p38 kinase and Akt. Immunoprecipitation and glutathione S-transferase (GST) pull-down studies showed that Akt was associated with p38 kinase, MK2, and Hsp27 in neutrophils, and Hsp27 dissociated from the complex upon activation. Active recombinant MK2 phosphorylated recombinant Akt and Akt in anti-Akt, anti-MK2, anti-p38, and anti-Hsp27 immunoprecipitates, and this was inhibited by an MK2 inhibitory peptide. We conclude that Akt exists in a signaling complex containing p38 kinase, MK2, and Hsp27 and that p38-dependent MK2 activation functions as PDK2 in human neutrophils. | {
"pile_set_name": "PubMed Abstracts"
} |
Antibacterial protection of suture material by chlorhexidine-functionalized polyelectrolyte multilayer films.
The formation of bacterial biofilms on the surface of implanted materials is a critical factor that may lead to chronic microbial infection and tissue necrosis. In the present study we analysed the stability of polyelectrolyte multilayer (ML) films on suture materials and the antibacterial effect obtained with chlorhexidine (CHX)-functionalized films built on different types of suture materials such as silk, polyester and copolymer of glycolide and L: -lactide. The comparison of Escherichia coli culture on glass coverslips and glass coverslips with ML and CHX showed at 24 h an inhibition of the bacterial relative luminescence (40.68%, P < 0.5) and at 48 h (99.46%, P < 0.001). In another way, simple soaking of suture material overnight in CHX digluconate 20% without polyelectrolyte films did not at all protect sutures from bacterial colonization but CHX-functionalized polyelectrolyte films, made from poly-L: -glutamic acid and poly-L: -lysine, inhibited Escherichia coli proliferation. | {
"pile_set_name": "PubMed Abstracts"
} |
Self-Q-switched Er-Brillouin fiber source with extra-cavity generation of a Raman supercontinuum in a dispersion-shifted fiber.
Brillouin mirrors based on a single-mode optical fiber provide the simplest, completely passive, and most universal way to produce nanosecond pulses with extensive wavelength tunability. We propose an all-fiber solution, where a passively Q-switched Er-doped Briilouin fiber laser pumped by a low-power laser diode produces pulses with a peak/average power contrast of 500 W/25 mW and, in association with a conventional dispersion-shifted fiber employed as an extracavity nonlinear medium, causes the generation of a nanosecond supercontinuum extending from 900 to over 1800 nm. Expanding evolution of the spectrum kicked off by the multicascade Brillouin process is reported. | {
"pile_set_name": "PubMed Abstracts"
} |
Direct bonding with precoated brackets and self-etching primers.
To evaluate the shear bond strength and the adhesive remnant on the tooth after the debonding of APC Plus precoated brackets, when conditioning the enamel with phosphoric acid and Transbond Plus Self Etching Primer (TSEP), in comparison with uncoated brackets bonded with Transbond XT. The brackets were bonded to extracted premolars, which were divided into three groups: (1) Acid/Transbond XT, (2) Acid/ APC Plus and (3) TSEP/APC Plus. Shear bond strength was measured using a universal test machine. The crosshead speed was 1 mm/minute. The adhesive remnant on the tooth was quantified using an image analysis equipment. No significant differences were found in the bond strengths of the three groups evaluated (P> 0.05). The two groups in which APC Plus system was used left significantly less adhesive on the tooth than Transbond XT. TSEP/APC Plus left significantly less adhesive than Acid/APC Plus (P< 0.017). | {
"pile_set_name": "PubMed Abstracts"
} |
[Analysis of the meiotic recombination frequency in transgenic tomato hybrids expressing recA and NLS-recA-licBM3 genes].
To study and induce meiotic recombination in plants, we generated and analyzed transgenic tomato hybrids F1-RecA and F1-NLS-recA-LicBM3 expressing, respectively, the recA gene of Escherichia coli and the NLS-recA-licBM3 gene. It was found that the recA and NLS-recA-licBM3 genes are inherited through the maternal and paternal lineages, they have no selective influence on the pollen and are contained in tomato F1-RecA and F1-NLS-RecA-LicBM3 hybrids outside the second chromosome in the hemizygous state. The comparative analysis of the meiotic recombination frequency (rf) in the progenies of the transgenic and nontransgenic hybrids showed that only the expression of the recA gene of E. coli in cells of the F1-RecA plants produced a 1.2-1.5-fold increase in the frequency of recombination between some linked marker genes of the second chromosome of tomato. | {
"pile_set_name": "PubMed Abstracts"
} |
Cancer pain knowledge in Southern Italy: data from a postgraduate refresher course.
A survey of Italian physicians was conducted to assess knowledge, attitudes, and beliefs on cancer pain. Physicians attending a refresher course on cancer pain and symptom relief were given a questionnaire composed of 28 questions before starting the lectures. The physicians represented the different centers treating cancer pain, or were going to deal with cancer pain, and were from all the provinces of Sicily, a southern region of Italy. Insufficient knowledge and education of the physicians regarding the management of cancer pain was evidenced. Limited experience may be the principal reason. Most participants had difficulties in prescribing opioids (23%). Analgesics were frequently administered intramuscularly (46%), although the oral route was suggested by 86% of the physicians as the route of choice for opioids. Opioids were used in more than 75% of the patients by only 33% of the physicians. Opioid treatment was considered effective in more than 75% of the patients by only 63% of the physicians. An arbitrary maximum dose of opioids was reported by 35% of the respondents. Opioid spinal administration was mainly considered the most effective route, the first-choice route to start opioid therapy by 4% of the physicians, and the alternative route to the oral one in 29% of cases. Nausea and vomiting, and tolerance were considered the principal problem during opioid therapy. Antidepressants were the most common adjuvants associated with opioid therapy, and laxatives and antiemetics were frequently used to limit the side effects. Incident pain was rarely reported as a challenging pain syndrome. Examples of cancer pain syndromes were mainly reported correctly, although some definitions were disputable. Inadequate knowledge about cancer pain management limits appropriate treatment. Greater efforts should be made to improve medical education. | {
"pile_set_name": "PubMed Abstracts"
} |
Solution structure of the granular starch binding domain of Aspergillus niger glucoamylase bound to beta-cyclodextrin.
Carbohydrate-binding domains are usually small and physically separate from the catalytic domains of hydrolytic enzymes. Glucoamylase 1 (G1) from Aspergillus niger, an enzyme used widely in the food and brewing industries, contains a granular starch binding domain (SBD) which is separated from the catalytic domain by a semi-rigid linker. The aim of this study was to determine how the SBD binds to starch, and thereby more generally to throw light on the role of carbohydrate-binding domains in the hydrolysis of insoluble polysaccharides. The solution structure of the SBD of A. niger G1 bound to beta-cyclodextrin (betaCD), a cyclic starch analogue, shows that the well-defined beta-sheet structure seen in the free SBD is maintained in the SBD-betaCD complex. The main differences between the free and bound states of the SBD are observed in loop regions, in or near the two starch-binding sites. The two binding sites, each of which binds one molecule of betaCD, are structurally different. Binding site 1 is small and accessible, and its structure changes very little upon ligand binding. Site 2 is longer and undergoes a significant structural change on binding. Part of this site comprises a flexible loop, which appears to allow the SBD to bind to starch strands in a range of orientations. The two starch-binding sites of the SBD probably differ functionally as well as structurally; site 1 probably acts as the initial starch recognition site, whereas site 2 is involved in specific recognition of appropriate regions of starch. The two starch strands are bound at approximately 90 degrees to each other. This may be functionally important, as it may force starch strands apart thus increasing the hydrolyzable surface, or alternatively it may localize the enzyme to noncrystalline (more hydrolyzable) areas of starch. The region of the SBD where the linker to the catalytic domain is attached is flexible, allowing the catalytic site to access a large surface area of the starch granules. | {
"pile_set_name": "PubMed Abstracts"
} |
Carcinomatous meningitis associated with ovarian cancer complicated by SIADH.
We experienced a case of carcinomatous meningitis originating from stage IIIc ovarian cancer complicated by syndrome of inappropriate antidiuretic hormone secretion (SIADH). A 51-year-old woman had been treated with multiple chemotherapy regimens after an initial operation for ovarian cancer. During the last chemotherapy regimen, she suffered headache, mood changes and ataxia. After one week, she had a convulsive seizure and lost consciousness. Laboratory studies showed hyponatremia, low serum osmolality, elevated urinary sodium level and urine osmolality. Cranial-enhanced magnetic resonance imaging (MRI) revealed abnormal meningeal enhancement. A lumbar puncture examination revealed that numerous atypical cells were present. Carcinomatous meningitis complicated by SIADH was diagnosed and treatment for hyponatremia and whole brain radiotherapy were performed; however, she died two weeks after the radiation therapy. Clinicians should consider carcinomatous meningitis when there are findings of SIADH. | {
"pile_set_name": "PubMed Abstracts"
} |
Prosociality: the contribution of traits, values, and self-efficacy beliefs.
The present study examined how agreeableness, self-transcendence values, and empathic self-efficacy beliefs predict individuals' tendencies to engage in prosocial behavior (i.e., prosociality) across time. Participants were 340 young adults, 190 women and 150 men, age approximately 21 years at Time 1 and 25 years at Time 2. Measures of agreeableness, self-transcendence, empathic self-efficacy beliefs, and prosociality were collected at 2 time points. The findings corroborated the posited paths of relations, with agreeableness directly predicting self-transcendence and indirectly predicting empathic self-efficacy beliefs and prosociality. Self-transcendence mediated the relation between agreeableness and empathic self-efficacy beliefs. Empathic self-efficacy beliefs mediated the relation of agreeableness and self-transcendence to prosociality. Finally, earlier prosociality predicted agreeableness and empathic self-efficacy beliefs assessed at Time 2. The posited conceptual model accounted for a significant portion of variance in prosociality and provides guidance to interventions aimed at promoting prosociality. | {
"pile_set_name": "PubMed Abstracts"
} |
RING1 and YY1 binding protein suppresses breast cancer growth and metastasis.
Evidence suggests that RING1 and YY1 binding protein (RYBP) functions as a tumor suppressor. However, its role in breast cancer remains unclear. In the present study, the expression of RYBP was assessed in breast cancer patients and cell lines. Disease-free survival durations of breast cancer patients with high RYBP expression were determined based on the ATCG dataset. The effects of RYBP overexpression on cell growth, migration and invasive potency were also assessed. Nude mouse xenograft and lung metastasis models were also used to confirm the role of RYBP. The involvement of SRRM3 in RYBP-mediated breast cancer suppression was explored using SRRM3 siRNA. The potential relationship between RYBP, SRRM3, and REST-003 was examined by qPCR. The results showed that RYBP was downregulated in breast cancer patients and in several breast cancer cell lines. Breast cancer patients with high expression levels of RYBP displayed better disease-free survival. Overexpression of RYBP in MDA-MB-231 and SK-BR-3 cells significantly decreased cell proliferation, migration, and invasion ability, and increased the proportion of cells arrested in S-phase compared with the negative control cells. Additionally, upregulation of proliferation-related cell cycle proteins (cyclin A and cyclin B1) and E-cadherin, and downregulation of snail were observed in RYBP-overexpressing cells. Overexpression of RYBP reduced tumor volume and weight as well as metastatic foci in the lungs of nude mice. SRRM3 knockdown by siRNA, which is downregulated after RYBP overexpression, suppressed cell growth and metastasis in MDA-MB-231 and SK-BR-3 cells. Furthermore, qPCR analysis revealed that REST-003 ncRNA was downregulated in cells overexpressing RYBP and in SRRM3-inhibited cells. Moreover, cell invasion ability and growth were increased after SRRM3 upregulation in RYBP-overexpressing cells, but they were decreased following si-REST-003 transfection. In conclusion, overexpression of RYBP suppresses breast cancer growth and metastasis both in vitro and in vivo. SRRM3 and REST-003, which are downregulated in cells overexpressing RYBP, may be involved in RYBP-mediated breast cancer progression. | {
"pile_set_name": "PubMed Abstracts"
} |
Co-infection with Opisthorchis viverrini and Haplorchis taichui detected by human fecal examination in Chomtong district, Chiang Mai Province, Thailand.
Diseases caused by the liver fluke, Opisthorchis viverrini and the minute intestinal fluke, Haplorchis taichui, are clinically important, especially in the Northeast and North regions of Thailand. It is often difficult to distinguish between these trematode species using morphological methods due to the similarity of their eggs and larval stages both in mixed and co-infections. A sensitive, accurate, and specific detection method of these flukes is required for an effective epidemiological control program. This study aimed to determine the prevalence of O. viverrini and H. taichui infections in human feces by using formalin-ether sedimentation and high annealing temperature random amplified polymorphic DNA (HAT-RAPD) PCR methods. Fecal specimens of people living along the Mae Ping River, Chomtong district were examined seasonally for trematode eggs using a compound microscope. Positive cases were analyzed in HAT-RAPD, DNA profiles were compared with adult stages to determine the actual species infected, and specific DNA markers of each fluke were also screened. Our results showed that out of 316 specimens, 62 were positive for fluke eggs which were pre-identified as O. viverrini and H. taichui. In addition, co-infection among these two fluke species was observed from only two specimens. The prevalence of H. taichui infections peaked in the hot-dry (19.62%), gradually decreased in the rainy (18.18%), and cool-dry seasons (14.54%), respectively. O. viverrini was found only in the hot-dry season (6.54%). For molecular studies, 5 arbitrary primers (Operon Technologies, USA) were individually performed in HAT-RAPD-PCR for the generation of polymorphic DNA profiles. The DNA profiles in all 62 positives cases were the same as those of the adult stage which confirmed our identifications. This study demonstrates the mixed infection of O. viverrini and H. taichui and confirms the extended distribution of O. viverrini in Northern Thailand. | {
"pile_set_name": "PubMed Abstracts"
} |
Complete androgen blockade as primary treatment for advanced metastatic cancer of the prostate.
The results of a series of non-randomized studies suggest that complete androgen blockade, i.e. medical or surgical castration in association with an antiandrogen, is superior to castration alone as regard survival potential. This report presents 11 untreated patients (Stage T2-4, Nx, M1), who were treated with complete androgen blockade, orchiectomy and a pure antiandrogen (Flutamide 250 mg three times a day). The rate of subjective response was 100% and the median time to progression was 12 months. The objective response rate was 82% and the rates of partial remission at one and two years were 45% and 18%, respectively. The survival rates after one and two years were 91% and 53%, respectively, a result which is consistent with that of other studies on the survival of patients with metastatic cancer of the prostate treated with either diethylstilboestrol, orchiectomy or LH-releasing hormones. The results of this study do not support the hypothesis that androgen blockade improves the survival of patients with advanced metastatic cancer of the prostate. | {
"pile_set_name": "PubMed Abstracts"
} |
Prognostic significance of the cell cycle inhibitor p27Kip1 in chronic B-cell lymphocytic leukemia.
B-cell chronic lymphocytic leukemia (B-CLL) is characterized by the accumulation of resting lymphocytes. The identification of p27(kip1), a cyclin-dependent kinase inhibitor that contributes to cell cycle arrest and represents a link between extracellular signals and cell cycle, prompted us to study p27 protein in the lymphocytes from 88 patients with B-CLL and 32 patients with other chronic B-lymphoproliferative disorders. The expression of p27 protein was higher in B-CLL samples with variations among them. In B-CLL, p27 levels were independent of absolute number of circulating lymphocytes, but strongly correlated with both lymphocyte and total tumor mass (TTM) doubling time. High p27 expression was associated with a poorer overall prognosis. In vitro, there was an increased spontaneous survival of B-CLL cells expressing high p27 levels. Interleukin-4 (IL-4) upregulated p27 levels in B-CLL cells, while fludarabine decreased p27 levels. Thus, our results indicate that p27 may be a valuable kinetic marker in B-CLL by providing instantaneous estimation of the disease doubling time. In addition, these results suggest that there is a link between p27 expression and the ability of CLL cells to undergo apoptosis. | {
"pile_set_name": "PubMed Abstracts"
} |
The elderly traveller.
Improved living conditions and advances in medicine have extended life expectancy and quality of life, resulting in an increasing number of elderly travellers. Pathophysiological changes and treatments can reduce the efficacy of vaccines and facilitate drug interactions. Elderly travellers have various characteristics that should be considered when offering pre-trip counselling, which should include proper management of chronic diseases that are susceptible to worsening during the trip, as well as an appropriate study and follow-up after the trip. We performed a narrative review of the main problems of elderly travellers. | {
"pile_set_name": "PubMed Abstracts"
} |
Evaluation of endothelial cell function with anterior segment fluorophotometry in pseudophakic patients.
Determining fluorescein permeability of the endothelial cell layer provides information on the endothelial cell barrier. Following topical application of fluorescein, the time dependent change of its concentration in the corneal stroma and in the aqueous humor yields the transfer coefficient (Kc) of the corneal endothelium. Measurements with a fluorophotometer resulted in a Kc of 0.002 minute to 0.005 minute for normal eyes. Patients with corneal barrier dysfunction (cornea guttata, Fuch's dystrophy) showed an increased Kc of 0.006 minute to 0.013 minute. Up to five years postoperatively, none of the patients investigated after phacoemulsification and posterior chamber lens implantation showed a disturbance in the endothelial cell barrier function. | {
"pile_set_name": "PubMed Abstracts"
} |
Predictors of delay in presentation to the ED in patients with suspected acute coronary syndromes.
Delays in seeking medical attention for patients with acute coronary syndromes (ACS) preclude early application of life-saving treatment and diminish efficacy. Previous studies suggest 3-hour delays between onset of symptoms and ED arrival in patients with typical presentations of acute myocardial infarction (AMI). A prospective observational study was conducted in an urban ED measuring lag time (LT) among adults presenting within 48 hours of onset of symptoms suggestive of ACS. Univariate and multiple regression analyses were performed on 5 predictors: age, sex, symptoms at presentation, and 2 different outcomes (AMI and ACS). Three hundred seventy-four patients were enrolled. Mean age was 63 years with 38% 70 years or older. Seventy-three percent of all patients with suspected ACS presented with chest pain, 27% with atypical symptoms. Overall mean LT was 8.7 hours (standard deviation 11). In subgroup analysis, patients aged >/=70 years were more likely to have LTs >12 hours (29% vs. 19% P =.043) and patients without chest pain had longer mean LTs (11.6 vs. 7.6 hours, P =.01). Delay in ED presentation is group specific. Advanced age and patients with atypical symptoms are predictive of longer LTs. Contrary to previously published data, patients with symptoms suspicious for ACS can delay an average of 9 hours, which might alter current thinking in the prevention and care of these patients. | {
"pile_set_name": "PubMed Abstracts"
} |
Abul Abbas: an epitome of scholarship.
Immunology is a relatively new specialty. Ironically, the immune system impacts every physiological system in the body, but yet most textbooks of physiology do not include any functional aspects of the immune system. Indeed, with the exception of early descriptions of anaphylaxis and allergy, the majority of immune studies were focused on either the anatomy of lymph nodes and spleen, or of course on protection from microorganisms. The concept of autoimmunity is even newer and the first textbook on autoimmune disease was not published until 1963. For the past 50 years however, autoimmunity has virtually exploded from a field populated by a few, to recognition that autoimmune diseases can affect more than 10% of the population. There are many people that have contributed to this information explosion and the Journal of Autoimmunity devotes specific issues in recognition of the select few scientists that have contributed in a way that impacts not only their research peers, but also, and more importantly, the patients who suffer from autoimmune disease. Abul Abbas is one such individual. Abul is known not only for his outstanding research, but for his role in teaching and public service. His own scientific work is extraordinary and his impact is felt throughout the world. In this special issue a number of Abul's colleagues have specifically written papers to honor this unique individual. It is an extraordinary honor to be chosen for a special issue of a journal in recognition of one's career. | {
"pile_set_name": "PubMed Abstracts"
} |
Vesicular release statistics and unitary postsynaptic current at single GABAergic synapses.
The existence of vesicular docking sites in central synapses is supported by morphological and biochemical evidence, but their functional role remains elusive. To investigate this role we have studied single depressing GABAergic synapses where multivesicular release and postsynaptic receptor saturation have been documented. We used failure/success patterns to estimate the number of vesicular docking sites, which varied from one to six among synapses. Variations of docking site numbers account for differences in release probability, as well as in the amplitude and decay kinetics of unitary postsynaptic currents. Upon repetitive stimulation, decreasing docking site occupancy likewise accounts for changes both in presynaptic and postsynaptic parameters. Finally steady-state docking site occupancy during train stimulations can be modulated by applying subthreshold presynaptic conditioning potential steps. The results suggest that differences in docking site numbers determine intersynaptic variability and that docking site occupancy is a key parameter controlling single synapse signaling. | {
"pile_set_name": "PubMed Abstracts"
} |
Magnetic resonance imaging at microscopic resolution reveals subtle morphological changes in a mouse model of dopaminergic hyperfunction.
Structural abnormalities of the basal ganglia have been documented in several neuropsychiatric conditions associated with dysregulation of the dopamine system. However, the histological nature underlying these changes is largely unknown. Using magnetic resonance imaging at microscopic resolution (MRI, 9.4 T with 43 microm isotropic spatial resolution) and stereological techniques, we have investigated the effect of increased dopamine neurotransmission on brain morphology in mice with elevated extracellular dopamine, the dopamine transporter knockout (DAT-KO) mice. We first demonstrate the usefulness of MRI at microscopic resolution for the accurate identification and measurement of volumes of specific subregions, accounting for less than 0.03% (0.16 mm(3)) of the volume of a mouse brain. Furthermore, the MRI analysis reveals a significantly lower volume (-9%) of the anterior striatum of DAT-KO mice, while the volume of other dopamine-related structures such as the posterior striatum and the substantia nigra pars reticulata is unchanged in comparison to wild type littermates. Stereological analysis performed in the same brains reveals that one important structural factor accounting for this selective change in volume is a reduction of 18% in the absolute number of neuronal cell bodies. The feasibility of assessing accurately small morphological alterations in mouse models, where the molecular and histological pathologies can be easily compared in a controlled manner, provides a paradigm to examine the relevance of selective brain volumetric changes associated with a number of neuropathological conditions. | {
"pile_set_name": "PubMed Abstracts"
} |
Spectral optimization of iodine-enhanced CT: Quantifying the effect of tube voltage on image quality and radiation exposure determined at an anthropomorphic phantom.
To provide an experimental basis for spectral optimization of iodine-enhanced CT by a quantitative analysis of image quality and radiation dose characteristics consistently measured for a large variety of scan settings at an anthropomorphic phantom. CT imaging and thermoluminescent dosimetry were performed at an anthropomorphic whole-body phantom with iodine inserts for different tube voltages (U, 70-140kV) and current-time products (Q, 60-300mAs). For all U-Q combinations, the iodine contrast (C), the noise level (N) and, from these, the contrast-to-noise ratio (CNR) of reconstructed CT images were determined and parameterized as a function of U, Q or the measured absorbed dose (D). Finally, two characteristic curves were derived that give the relative increase of CNR at constant D and the relative decrease of D at constant CNR when lowering U. Lowering U affects the measured CNR only slightly but markedly reduces D. For example, reducing U from 120kV to 70kV increases the CNR at constant D by a factor of nearly 1.8 or, alternatively, reduces D at constant CNR by a factor of nearly 5. Spectral optimization by lowering U is an effective approach to attain the necessary CNR for a specific diagnostic task at hand while at the same time reducing radiation exposure as far as practically achievable. The characteristic curves derived in this study from extensive measurements at a reference 'person' can support CT users in an easy-to-use manner to select an appropriate voltage for various clinical scenarios. | {
"pile_set_name": "PubMed Abstracts"
} |
Interaction of chemical cues from fish tissues and organophosphorous pesticides on Ceriodaphnia dubia survival.
Cladocera are frequently used as test organisms for assessing chemical and effluent toxicity and have been shown to respond to stimuli and cues from potential predators. In this study, the interactive effects of visual and chemical cues of fish and two organophosphorous pesticides on survival of Ceriodaphnia dubia were examined. A significant chemical cue (homogenized Pimephales promelas) and malathion interaction was observed on C. dubia survival (P = 0.006). Chemical cue and 2.82 microg/L malathion resulted in a 76.0% reduction in survival compared to malathion alone (P < 0.01). Furthermore, potentiation of malathion toxicity varied based on the source of chemical cues (i.e., epithelial or whole body). It is unclear in this study whether these chemical cues elicited a predation-related stress in C. dubia. Future research should examine the mechanism of this interaction and determine what role, if any, stress responses by C. dubia might play in the interaction. | {
"pile_set_name": "PubMed Abstracts"
} |
[Quantitative assessment of the processes of insulin synthesis and secretion in B-endocrinocytes of pancreatic islets].
Immunofluorescent methods allowing the detection of different hormones in endocrine cells, are widely used in many works, however, their application is usually limited to the description of qualitative criteria, while the reactions of indirect immunofluorescence permit their quantitative assessment. The purpose of the present work was the definition of the criteria for the quantitative assessment of the activities of the processes of insulin synthesis and secretion in pancreatic B-endocrinocytes by examination of changes of their fluorescence using classical activation of these cells by glucose. The investigations performed indicate that the main parameters of activity of insulin synthesis and secretion in pancreatic B-endocrinocytes are the area occupied by immunoreactive material, its concentration and heterogeneity. As the secretory response of pancreatic B-endocrinocytes is of variable intensity, the classification of these cells into groups with different activity of the processes of insulin synthesis and secretion is proposed. This approach enables the quantitative assessment of the action of different insulotropic agents, opening promising prospects for their further investigation. | {
"pile_set_name": "PubMed Abstracts"
} |
Synthesis and characterisation of two monomeric crystalline thallium(I) beta-diketiminates.
Treatment of the appropriate sodium beta-diketiminate NaL or NaL' with an equivalent portion of TlCl in thf under mild conditions furnishes in good yield the first structurally characterised thallium beta-diketiminates: the monomeric, orange, crystalline Tl(I) complexes TlL and TlL' [L = {N(SiMe3)C(Ph)}2CH, L' = {N(C6H3Pr(i)(2)-2,6)C(H)}2CPh]. | {
"pile_set_name": "PubMed Abstracts"
} |
Spontaneous twisting of an implanted pacemaker electrode in three cases.
We present three cases of an unusual pacing lead aberration occurring at different times after implantation. In the first patient, the electrode was twisted close to the pacemaker, and dislodgment occurred on the 40th postoperative day. In the second case, there was only proximal twisting of the electrode. In the third case the electrode was twisted in two places: proximal to the pacemaker, and distal, within the right atrium. The complication was managed successfully by reimplanting the same electrode after stiffening the lead near the generator with a portion of the stylet. | {
"pile_set_name": "PubMed Abstracts"
} |
Evaluation of flow scintillation analysis for the determination of Sr-90 in bioassay samples.
An automated procedure for the determination of (90)Sr was adapted from existing methods of flow scintillation analysis (FSA) for use on aqueous samples with low levels of activity (<1000 dpm per sample). This technique employs high-performance extraction chromatography (HPEC) and an on-line liquid scintillation counter to provide automated separation and subsequent detection of (90)Sr. The total analysis time is 30 min per sample. Dilute urine samples, spiked with (90)Sr, were also processed by this method to test the application of this technique for bioassay monitoring. | {
"pile_set_name": "PubMed Abstracts"
} |
[Atypical hemolytic uremic syndrome. Report of two cases treated with Eculizumab].
Hemolytic uremic syndrome (HUS) is a type of thrombotic microangiopathy where organic damage predominates in the kidney. Atypical HUS (aHUS) is a rare disease that affects young adults and causes terminal chronic renal failure ending in dialysis, in most cases. It also recurs after kidney transplantation. aHUS is associated with genetic defects of the alternative complement pathway or its activation by other factors such as drugs, autoimmune diseases, infections, malignant hypertension and ischemia-reperfusion. We report two women aged 17 and 25 years old with catastrophic aHUS. In both cases, complement amplifying factors (drugs and infections) were added and acted on a genetic vulnerability to precipitate complement activation and produce aHUS. Both patients developed terminal renal failure and had to undergo hemodialysis. Fortunately, after a broad etiological study, it was possible to make the diagnosis of aHUS and start treatment with Eculizumab, a monoclonal antibody that changed the natural history of aHUS. It inhibits complement activity controlling microangiopathy and preventing the development of end-stage renal disease. It also improves the success rate in kidney transplantation. In the case of our patients, both discontinued dialysis after chronic treatment with Eculizumab. | {
"pile_set_name": "PubMed Abstracts"
} |
[Serum hormonal levels in diamond-extracting industry workers of Yakutia, with surface and underground type of work].
The authors studied influence of work type (surface or underground) on serum hormonal levels in male workers of "International" mine within diamond-extracting complex of Yakutia-Sakha Republic. The results obtained show compensation and adaptation changes of endocrine system in males engaged into underground work vs. those of surface work. | {
"pile_set_name": "PubMed Abstracts"
} |
A comparison of peritoneal fluid values in mares following bilateral laparoscopic ovariectomy using a vessel sealing and dividing device versus placement of two ligating loops.
The objective of this study was to determine the effect of bilateral laparoscopic ovariectomy on peritoneal fluid values in mares and compare how this effect was modified by the method of ovarian vessel hemostasis used. Ten mares undergoing standing bilateral laparoscopic ovariectomy were used in a randomized clinical study. During surgery, blood vessels within the mesovarium were either: (1) sealed and transected with a vessel sealing and dividing device (VSDD), or (2) ligated using two loops placed proximal to each ovary and then the mesovarium transected using laparoscopic scissors. The ovaries were removed through the ipsilateral body wall. Abdominocentesis was performed before surgery and 24 h and 72 h after surgery. Markers of peritoneal inflammation, as measured by total nucleated cell count, total protein (TP) and red blood cell count via abdominocentesis, were consistently increased for all groups compared to pre-operative values. The mean (range) of TP for the VSDD group was 4.14 (3.9-4.5) g/dL, and that for the ligating loop group was 3.18 (2.7-3.5) g/dL. Use of the VSDD resulted in significantly greater TP concentrations in the abdominal fluid at 24 h and 72 h post-operatively when compared to a ligating loop (P <0.001 and 0.04, respectively). | {
"pile_set_name": "PubMed Abstracts"
} |
Identification of noisy response latency.
In many physical systems there is a time delay before an applied input (stimulation) has an impact on the output (response), and the quantification of this delay is of paramount interest. If the response can only be observed on top of an indistinguishable background signal, the estimation can be highly unreliable, unless the background signal is accounted for in the analysis. In fact, if the background signal is ignored, however small it is compared to the response and however large the delay is, the estimate of the time delay will go to zero for any reasonable estimator when increasing the number of observations. Here we propose a unified concept of response latency identification in event data corrupted by a background signal. It is done in the context of information transfer within a neural system, more specifically on spike trains from single neurons. The estimators are compared on simulated data and the most suitable for specific situations are recommended. | {
"pile_set_name": "PubMed Abstracts"
} |
Budget impact of including ribociclib in combination with letrozole on US payer formulary: first-line treatment of post-menopausal women with HR+/HER2- advanced or metastatic breast cancer.
The combination of a cyclin-dependent kinase 4 and 6 (CDK 4/6) inhibitor with the aromatase inhibitor letrozole is a safe and effective alternative to letrozole monotherapy for first-line hormone receptor-positive (HR+)/human epidermal growth factor receptor 2-negative (HER2-) breast cancer. This study evaluates the budget impact of using the CDK 4/6 inhibitor ribociclib plus letrozole as a first-line treatment option for postmenopausal women with HR+/HER2- advanced breast cancer, from a United States (US) payer perspective. A cohort-based budget impact model was used to calculate the incremental cost of introducing ribociclib plus letrozole over three years for the target population. The analysis compared two scenarios: treatment options excluding or including ribociclib plus letrozole. Market shares were derived from market research and the assumption was the introduction of ribociclib plus letrozole would only displace existing CDK-based therapies. Treatment duration was based on the median time to treatment discontinuation or median progression-free survival for first-line treatment, and on clinical trial data for second- and third-line treatment. Acquisition costs were based on wholesale acquisition costs and considered co-payment. Costs for drug administration and monitoring, subsequent therapy, and relevant adverse events were included. Of 1 million insured members, 263 were eligible for CDK 4/6 inhibitor treatment. Cumulative total savings with ribociclib plus letrozole were $3.01M over three years, corresponding to a cumulative incremental cost saving of $318.11 per member treated per month. In the US, ribociclib plus letrozole represents a cost-saving first-line treatment option for postmenopausal women with HR+/HER2- advanced breast cancer. | {
"pile_set_name": "PubMed Abstracts"
} |
Comparison of the effects of Anemonia toxin II on sodium and gating currents in frog myelinated nerve.
Na+ and gating currents were measured in myelinated frog nerve fibres without and in the presence of 7 microM Anemonia toxin II in the extracellular solution. From the experiments, kinetic parameters of Na+ currents and of gating charge displacements during ('on' response) and after ('off' response) depolarizations were determined. The following parallel modifications of Na+ currents and charge displacements by Anemonia toxin II were observed: the toxin reduces the maximum Na+ permeability and the 'on' charge displacement; Na+ activation and 'on' charge displacement become faster; Na+ inactivation and the decline of the 'off' charge displacement with increasing pulse duration (charge immobilization) are prolonged; slow components of 'on' charge displacements are diminished. The observations support the notion that the fast 'on' charge displacement is connected with the process of Na+ activation, while Na+ inactivation is linked to charge immobilization. Our experiments suggest that slow 'on' charge displacements during longer depolarizations are correlated with the process of Na+ inactivation. | {
"pile_set_name": "PubMed Abstracts"
} |
Should pre-transfusion screening RBC panels contain Wr(a+) cells?
Sometimes commercial RBC sets for the screening of irregular antibodies contain Wr(a+) cells. The aim of this study was to define the usefulness of employing RBC sets for the screening of irregular antibodies containing Wr(a+) cells in pre-transfusion tests. Anti-Wr(a) is a relatively common naturally occurring antibody in candidates to blood transfusion, although the risk of receiving a non-compatible unit is low. We have studied both the incidence of Wr(a) antibodies and the effects of having a Wr(a+) cell in the screening test on routine work in an unselected population of 787 patients requiring RBC transfusion and in 151 new blood donors. Irregular antibodies were found in 64 sera, 58 of which were specific for Wr(a) , 46 (5·8%) and 12 (7·9%) in patients and donors, respectively. The positive tested sera contained specific IgM in 16 cases, IgM + IgG in 13 cases and IgG in 27 cases. Anti-Wr(a) can usually be detected during cross-match procedures; therefore, the presence of Wr(a+) cells in pre-transfusion screening of blood recipients is not justified and it causes an undue increase in cost and time to unit release. Moreover, because of the rare association between anti-Wr(a) and haemolytic transfusion reaction, the use of Wr(a+) RBC-containing sets is also questionable in the countries that do not perform pre-transfusion cross-match tests. | {
"pile_set_name": "PubMed Abstracts"
} |
Knowledge partitioning: context-dependent use of expertise.
Although exceptional performance is a defining attribute of expertise, experts sometimes exhibit striking errors and performance limitations. This article reports two experiments in which experts predicted the spread of bush fires, a domain characterized by complex but well-understood physical dynamics. Although accuracy was typically high, large errors were observed when two primary predictor variables were in opposition. In a second study, the experts' behavior--in contrast to that of novices--was additionally shown to depend on problem context. In one context, experts again committed errors, whereas in another, equally domain-relevant context, the correct predictions were made. Critically, when comparing performance across contexts, completely opposing predictions were made under identical physical conditions. We therefore suggest that expertise may comprise separate, and sometimes even mutually exclusive, components of knowledge. | {
"pile_set_name": "PubMed Abstracts"
} |
Prevalence, clinical characteristics, and seizure outcomes of epilepsy due to calcific clinical stage of neurocysticercosis: Study in a rural community in south India.
The objective of this research was to study the prevalence, clinical characteristics, and seizure remission rates of epilepsy due to calcific stage of neurocysticercosis (cNCC) in a rural community in south India. Comprehensive Rural Epilepsy Study South India (CRESSI) is a prospective longitudinal study of epilepsy care in a rural community in south India. As part of this study, prevalence of epilepsy was studied in a population of 74,086 in 22 villages. The prevalence study identified 451 people with epilepsy including 62 (13.7%) with epilepsy due to cNCC. Diagnosis of cNCC was based on computed tomography (CT) findings. The clinical characteristics and seizure outcomes were studied in this cohort of 62 patients. The data collected included demographics, seizure type, antiepileptic drugs (AEDs), seizure remission rates, and predictors of long-term seizure remissions. The crude prevalence of epilepsy due to cNCC in this rural community was 0.84 per 1000 (95% confidence interval [CI]: 0.65-1.07). This lesion accounted for 41% of the established etiology among 451 prevalence cases of epilepsy. Mean age at presentation was 28.87 ± 14.45 (range: 8-65 years) with equal gender distribution. The common location of the lesion was in the perirolandic region. Focal onset motor seizures were the common seizure type. Seizure remission (≥2 years) rate was 80.3%. The independent predictor of drug resistance was failure to respond to monotherapy (odds ratio: 63.9; 95% CI: 8.4-485.4; p < 0.0001). Focal impaired awareness behavioral arrest/automatisms with lesion located in the temporal lobe in all the three patients were drug-resistant. In this rural community in south India, epilepsy due to cNCC was the commonest acquired epilepsy in people aged ≥20 years. Long-term seizure remission rates were high, and failure to respond to monotherapy was the predictor of drug resistance. Drug-resistant epilepsy was extremely rare with this lesion. | {
"pile_set_name": "PubMed Abstracts"
} |
Ff gene 5 single-stranded DNA-binding protein assembles on nucleotides constrained by a DNA hairpin.
The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein. | {
"pile_set_name": "PubMed Abstracts"
} |
Reduced host cell reactivation of oxidatively damaged DNA in ageing human fibroblasts.
Many reports have linked oxidative damage to DNA and the associated avoidance and/or repair processes to carcinogenesis, ageing and neurodegeneration. Cancer incidence increases with age and there is evidence that oxidative stress plays a role in human ageing and neurodegeneration. Several reports have suggested that the accumulation of unrepaired DNA lesions plays a causal role in mammalian ageing. Since base excision repair (BER) is the main pathway for the repair of oxidative DNA lesions, the relationship of BER to human ageing and carcinogenesis is of considerable interest. The aim of the present study was to examine the relationship between donor age and increasing time of cells in tissue culture and the repair of oxidative DNA damage in primary human skin fibroblasts. Methylene blue (MB) acts as a photosensitizer and after excitation by visible light (VL) produces reactive oxygen species that result in oxidative damage to DNA. MB+VL produce predominantly 8-hydroxyguanine as well as other single base modifications in DNA that are repaired by BER. We used host cell reactivation (HCR) of a non-replicating recombinant human adenovirus, Ad5CMVlacZ, which expresses the β-galactosidase (β-gal) reporter gene, to measure BER of MB+VL-damaged DNA. HCR of β-gal activity for the MB+VL-treated reporter gene was examined in 10 fibroblast strains from normal donors of ages 2 to 82. The effect of cell passage number on HCR was also examined in human skin fibroblasts from 2 normal donors. We found a significant reduction in HCR with increasing cell passage number, indicating that BER decreases with increasing time of cells grown in tissue culture. We also found a significant correlation of donor age with HCR of the MB+VL-treated reporter gene for high passage number, but not for low passage number fibroblasts. The present study provides evidence that a decrease in BER of oxidatively damaged DNA may play a role in carcinogenesis, ageing and neurodegeneration. | {
"pile_set_name": "PubMed Abstracts"
} |
An appraisal of HIV antibody test counselling of injecting drug users.
One-hundred and nine injecting drug users entering a methadone detoxification programme underwent HIV antibody test counselling. Approximately 80% of men and women were concerned because of sharing injection equipment ('works') in the previous year, although other reasons for considering an HIV antibody test, such as sexual contact with drug users and concern for sexual partners, was also given. Two-thirds of both men and women decided to be tested. Reasons for declining or deferring an HIV antibody test included an inability to cope with a positive result, recent sharing of 'works', and intoxication with drugs or alcohol at the time of counselling. Of the 74 clients tested, two were HIV antibody positive. Only 55% of clients reattended for results. Testing drug users for evidence of HIV infection requires careful pre-test counselling and adequate support should be readily available when results are given. | {
"pile_set_name": "PubMed Abstracts"
} |
Insulin binding of human and porcine monocomponent insulin to monocytes in type 1 (insulin-dependent) diabetic patients and control subjects.
In the present study insulin binding properties of human semi-synthetic and porcine insulin were compared in Type 1 (insulin-dependent) diabetic patients treated from the onset of their disease either with human semi-synthetic insulin (n = 12) or porcine insulin (n = 12) and control subjects (n = 12). In all three groups, insulin binding to circulating monocytes revealed no difference between human semi-synthetic and porcine insulin (specific insulin binding at tracer concentration: 5.7 +/- 0.5% versus 5.4 +/- 0.5% in control subjects, 5.5 +/- 0.4% versus 5.4 +/- 0.4% in Type 1 diabetic patients on porcine insulin, 5.3 +/- 0.4% versus 5.6 +/- 0.4% in Type 1 diabetic patients on human insulin). Treatment with human or porcine insulin did not have any significant influence on receptor binding properties of the two diabetic groups investigated. Absolute receptor number and affinity of both diabetic groups were within the range of healthy control subjects irrespective of treatment with human or porcine insulin. | {
"pile_set_name": "PubMed Abstracts"
} |
In vitro culture of Glugea sp.
Recently the low host specificity of some microsporidians has been demonstrated and it has been indicated that many of these micro-organisms could be transmitted from invertebrates to mammals and adapt to changes in temperature. In this work, we demonstrate the first successful in vitro culture of a fish microsporidia of the genus Glugea on larval cells of the mosquito Aedes albopictus at 28 degrees C, and we show ultrastructural aspects of the different life cycle stages. It was impossible on salmon cells CHSE-214 at 21 degrees C. This study will be valuable for further work in biochemistry and immunology in addition to chemotherapy for microsporidiosis humans and animals. | {
"pile_set_name": "PubMed Abstracts"
} |
Is it True That the Normal Valence-Length Correlation Is Irrelevant for Metal-Metal Bonds?
The most intriguing feature of metal-metal bonds in inorganic compounds is an apparent lack of correlation between the bond order and the bond length. In this study, we combine a variety of literature data obtained by quantum chemistry and our results based on the empirical bond valence model (BVM), to confirm for the first time the existence of a normal exponential correlation between the effective bond order (EBO) and the length of the metal-metal bonds. The difference between the EBO and the formal bond order is attributed to steric conflict between the (TM)n cluster (TM=transition metal) and its environment. This conflict, affected mainly by structural type, should cause high lattice strains, but electron redistribution around TM atoms, evident from the BVM calculations, results in a full or partial strain relaxation. | {
"pile_set_name": "PubMed Abstracts"
} |
The clinical grading of Raynaud's phenomenon and vibration-induced white finger: relationship between finger blanching and difficulties in using the upper limb.
To investigate the association between functional difficulties in using the upper limb and extent and frequency of finger blanching, and the merits of these markers in grading the severity of Raynaud's phenomenon (RP) and vibration-induced white finger (VWF). A questionnaire was mailed to a randomly selected community sample of 22,194 working-aged adults. Information was collected on cold-induced finger blanching--including the extent and frequency of attacks in the past year, and on difficulty in using the upper limb in several everyday activities (e.g. doing up buttons, opening a tight screwtop jar, and pouring from a jug). Associations were examined by logistic regression with the resultant odds ratios converted into prevalence ratios (PRs) and 95% confidence intervals (95% CI). Among 12,907 respondents were 1,359 who reported finger blanching and provided details of its extent and frequency. Of these, 7.4% reported frequent attacks (50 or more over the year), and 12% reported extensive blanching (affecting nine or ten digits). After adjustment for potential confounders, subjects with finger blanching reported an excess of difficulties in using the limb. Thus, in men with blanching the PR for difficulty with buttons was 4.7 (95% CI 3.9-5.8), and that for pouring from a jug was 3.8 (3.0-4.9) in comparison with men who had never had blanching. Similar associations were found in women and in those men with exposure to hand-transmitted vibration. The risk of reporting difficulties increased markedly with frequency of blanching--up to four- or fivefold in those with 50 or more attacks in the past year compared with those who had none; but differences by extent were less marked, with PRs < or = 1.6 in those with nine to ten digits affected compared with one to two digits. RP and VWF are both associated with difficulties in using the upper limb in everyday tasks. Further investigation of potential reporting biases is warranted, but if the associations are causal, frequency of attacks influences impairment more than extent of disease. More account may need to be taken of frequency of blanching episodes in assessing and in compensating subjects with VWF. | {
"pile_set_name": "PubMed Abstracts"
} |
Treatment of herpes simplex and varicella zoster infections.
The introduction of antiviral agents such as acyclovir has had a remarkable impact on management of patients with viral infections. In this article the authors outline the management of herpes simplex and varicella zoster infections, giving specific guidelines for treatment with acyclovir. | {
"pile_set_name": "PubMed Abstracts"
} |
Development of computer-assisted simulation procedure to analyze receptor modulatory processes.
Experimentally induced changes in neurotransmitter receptors have been analyzed by means of a computer assisted simulation procedure over a wide range of free ligand concentrations. This approach allows to evaluate, for a given range of ligand concentrations, the relative influence of simultaneous variations in binding parameters (i.e. dissociation constant or Kd and in maximal number of binding sites or Bm) and to predict the net and final effect of the experimental condition on the receptor-mediated transmission line. The function representing the changes in bound values versus the respective free ligand concentrations, has been studied analytically on the basis of all the possible values that the percent changes in both Kd and Bm parameters induced by a given experimental condition can assume. A well characterized change in the pattern of bound radioligand could in this way be defined. This approach, developed to show in an immediate and clear way treatment-induce changes in receptor populations or to fit directly rough experimental data expressed as differences in bound values versus free ligand concentrations, seems to be an useful complement to the widely used saturation analysis of binding data. | {
"pile_set_name": "PubMed Abstracts"
} |
Birth weight and bone mass in young adults from Brazil.
Birth weight is positively associated with adult bone mass. However, it is not clear if its effect is already evident in early adulthood. To investigate the association between birth weight, adult body size, the interaction between them and bone mass in young adults. Bone densitometry by DXA was performed on 496 individuals (240 men) aged 23-24 years from the 1978/79 Ribeirão Preto (southern Brazil) birth cohort, who were born and still residing in the city in 2002. Birth weight and length as well as adult weight and height were directly measured and converted to z-scores. The influence of birth weight and length, and adult weight and height on bone area (BA), bone mineral content (BMC) and bone mineral density (BMD) at the lumbar spine, proximal femur and femoral neck were investigated through simple and multiple linear regression models. Adjustments were made for sex, skin color, gestational age, physical activity level, smoking status and dietary consumption of protein, calcium and alcohol. Interaction terms between birth weight and adult weight, and birth length and adult height were tested. Men in the highest tertile of birth weight distribution had greater BA and BMC at all three bone sites when compared with their counterparts in the lowest tertiles (p<0.008). For BMD, this trend was observed only in the lumbar spine. Adult weight and height were positively associated with BA and BMC at all three bone sites (p<0.05). For BMD, these associations were seen for adult weight, but for adult height an association was observed only in the lumbar spine. Birth weight retained positive associations with proximal femur BA and BMC after adjustments for current weight and height. No interaction was observed between variables measuring prenatal growth and adult body size. Birth weight and postnatal growth are independent determinants of adult bone mass in a sample of Brazilian adults. This effect is already evident in early adulthood. | {
"pile_set_name": "PubMed Abstracts"
} |
SS33410, an inhibitor for inflammation, blocks the intracellular transport of VSV G glycoprotein in BHK cells.
We have studied the effect of SS33410, an inhibitor for inflammation, on the intracellular transport and processing of the vesicular stomatitis virus (VSV) G glycoprotein as a model integral membrane protein. Delivery of G glycoprotein to the cell surface was blocked by 0.5 microgram/ml of SS33410 without any significant inhibition of protein synthesis. The G glycoprotein accumulated intracellularly electrophoresed a little faster than the control mature one excreted to the medium. The affinity for concanavalin A-agarose (Con-A) column suggested that most of the G glycoprotein oligosaccharides were of the high-mannose type. These results indicate that processing of N-glycosidic oligosaccharide is incomplete, suggesting that intracellular trafficking is arrested before reaching to the trans Golgi compartments in the presence of SS33410. | {
"pile_set_name": "PubMed Abstracts"
} |
Iron-catalyzed arylmagnesiation of aryl(alkyl)acetylenes in the presence of an N-heterocyclic carbene ligand.
Addition of arylmagnesium bromides to aryl(alkyl)acetylenes proceeded in the presence of an iron catalyst and a N-heterocyclic carbene ligand to give high yields of the corresponding alkenylmagnesium reagents, which were transformed into tetrasubstituted alkenes by subsequent treatment with electrophiles. [reaction: see text] | {
"pile_set_name": "PubMed Abstracts"
} |
Relevance and variability of the severity of incontinence, and increased daytime and night-time voiding frequency, associated with quality of life in men with lower urinary tract symptoms.
To estimate the distribution of the severity of urinary incontinence (UI) and daytime and night-time voiding in patients with lower urinary tract symptoms (LUTS) suggestive of benign prostatic hyperplasia (BPH); to estimate the proportion of 'subjectively relevant' symptoms within each severity category; to identify differences in quality of life (QoL) by degree of subjectively relevant daytime and night-time symptoms; and to identify differences in QoL in men with subjectively relevant UI or no UI. Data from a group of 480 men awaiting urological assessment for LUTS suggestive of BPH were collected by questionnaire shortly after referral from their general practitioner in 1997-2000. The International Continence Society--Benign Prostatic Hyperplasia Index, Sandvik's Incontinence Severity Index, and the World Health Organization Quality of Life Survey--Abbreviated Version (WHOQoL-bref) were used to assess symptoms and QoL. There was a large heterogeneity of self-reported symptom severity and related bother in the three symptoms of UI, increased daytime voiding frequency and night-time voiding in these referred patients. The WHOQoL-bref showed significant group differences of subjectively relevant symptoms. The perception of increased night and daytime frequency, as measured by symptom severity and bother, varied greatly. The severity of UI and its effect on men waiting for a urological assessment of LUTS suggestive of BPH also varied widely. In general, the symptoms and their impact were slight to moderate. The WHOQoL-bref could be used to differentiate among groups of subjectively relevant symptoms, and in so doing supported information generated by the bother question. | {
"pile_set_name": "PubMed Abstracts"
} |
Factors influencing hepaticojejunostomy leak following pancreaticoduodenal resection; importance of anastomotic leak test.
Pancreatic fistula is a common complication after pancreaticoduodenostomy. Prevention of a concomitant bile leak from hepaticojejunostomy is important because it could lead to more serious complications including intraperitoneal abscess, subsequent sepsis and massive hemorrhage by activating pancreatic fistula. This study was designed to determine perioperative risk factors of the hepaticojejunostomy leak for the purpose of decreasing this morbidity. Clinical records of 107 consecutive pancreaticoduodenal resections were reviewed. hepaticojejunostomy anastomoses were performed using absorbable sutures in an end-to-side, single-layer and interrupted fashion. A total of 8 presumed perioperative risk factors were analyzed. They included advanced age, low serum albumin, low serum total cholesterol, impaired glucose tolerance and placement of a biliary drainage catheter as preoperative factors, and dilated common hepatic duct and undone anastomotic leak test as intraoperative factors. In addition, transanastomotic stenting techniques including retrograde transhepatic bile drainage, T-tube and transjejunal drainage were compared with respect to hepaticojejunostomy leak rates. Hepaticojejunostomy leak was demonstrated in 9 patients (8%). Anastomotic leak testing only achieved statistical significance (p = 0.04). It is noteworthy that no hepaticojejunostomy leak developed among 28 patients who underwent this test through a retrograde transhepatic bile drainage catheter. In addition, the frequency of bile leaks (14/107) associated with the transanastomotic stenting techniques urged the necessity of appropriate intraperitoneal drain placement. Careful anastomotic procedures with a subsequent anastomotic leak test most effectively prevent hepaticojejunostomy leak after pancreaticoduodenal resection. | {
"pile_set_name": "PubMed Abstracts"
} |
Measurement of sympathetic nervous system activity in heart failure: the role of norepinephrine kinetics.
Recent demonstration that the level of sympathetic nervous drive to the failing heart in patients with severe heart failure is a major determinant of prognosis, and that mortality in heart failure is reduced by beta-adrenergic blockade, indicate the clinical relevance of heart failure neuroscience research. The cardiac sympathetic nerves are preferentially stimulated in severe heart failure, with the application of isotope dilution methods for measuring cardiac norepinephrine release to plasma indicating that in untreated patients cardiac norepinephrine spillover is increased as much as 50-fold, similar to levels of release seen in the healthy heart during near maximal exercise. This preferential activation of the cardiac sympathetic outflow contributes to arrhythmia development and to progressive deterioration of the myocardium, and has been linked to mortality in both mild and severe cardiac failure. Although the central nervous system mechanisms involved in the sympathetic nervous activation at present remain uncertain, increased intracardiac diastolic pressure seems to be one peripheral reflex stimulus, and increased forebrain norepinephrine turnover an important central mechanism.Additional neurophysiological abnormalities present in the failing human heart include release of the sympathetic cotransmitters, epinephrine and neuropeptide Y, at high levels more typical of their release during exercise in healthy subjects, and the possible presynaptic augmentation of norepinephrine release from the cardiac sympathetic nerves by the regionally released epinephrine. Following on the demonstrable benefit of beta-adrenergic blockade in heart failure, additional antiadrenergic measures (central suppression of sympathetic outflow with imidazoline binding agents such as clonidine, blocking of norepinephrine synthesis by dopamine-beta-hydroxylase inhibition, antagonism of neuropeptide Y) are now under active investigation. | {
"pile_set_name": "PubMed Abstracts"
} |
Experimental study of the so called left ventricular isovolumic relaxation phase.
Left ventricular filling begins in the ventricular isovolumic relaxation phase. According to the Torrent-Guasp myocardial band theory, this phase results from the contraction of the final portion of the myocardial band: the ascending segment of the apical loop. The objectives were to study the myocardial mechanisms influencing transmitral flow during early diastole and to determine whether the rapid ventricular filling phase involves contraction or relaxation. An experimental in vivo pig model was used. Regional contractility in three segments of the myocardial band was assessed using piezoelectric crystals and mitral flow was measured by echo-Doppler ultrasonography at baseline and after akinesia had been induced in the ascending segment by 2.5% formaldehyde infusion. Changes in intracavitary pressure in the left ventricle and left atrium and flow alterations in the aortic root were recorded. The start of the isovolumic relaxation phase was identified using the time at which the ejection of blood ceases, as indicated by aortic flow measurements. During the left ventricular isovolumetric relaxation phase, the ascending segment of the apical loop was undergoing contraction. The infusion of formaldehyde into this segment affected the extent to which the intraventricular pressure could decrease, prolonged the isovolumic relaxation phase and resulted in a lower minimum pressure. It also produced a significant decrease in transmitral flow velocity in early diastole and an increase at end-diastole. The rapid ventricular filling phase is characterized by contraction. | {
"pile_set_name": "PubMed Abstracts"
} |
Automated higher-throughput compound screening on ion channel targets based on the Xenopus laevis oocyte expression system.
As numerous diseases have been shown to be related to dysfunction of ion channels and neurotransmitter receptors and to affect regulatory pathways, ion channels have attracted increasing attention as a target class for drug discovery. The concomitant demand of the pharmaceutical industry for adequate electrophysiological methods to investigate drug effects on specific ion channels in secondary and safety screening has resulted in the development of electrophysiological instrumentation that allows automated monitoring of ion channel function with a higher throughput. Here we tested a fully automated screening system based on the Xenopus laevis oocyte expression system. We addressed the questions of data quality and reproducibility obtained by automated oocyte injection and two-electrode voltage-clamp (TEVC) recording using the Roboocyte (Multi Channel Systems GmbH, Reutlingen, Germany) technology compared to conventional oocyte recording. A gamma-aminobutyric acid (GABA)A-receptor subtype (alpha(1)beta(2)) was chosen as an example for a ligand-gated ion channel, and the slowly activating potassium current I(Ks) as a voltage-activated ion channel. Oocytes were injected with cDNA or cRNA via the Roboocyte injection stage. Ion channel currents were successfully recorded after 2-7 days in about 40% of the oocytes injected with GABA(A) receptor cDNA, and after 2-4 days in about 60% of the oocytes injected with KCNE1 cRNA. EC(50) values for the GABA(A) receptor and IC(50) values for blockers of I(Ks) were comparable to values obtained with conventional TEVC recording techniques. In conclusion, our results show that the Roboocyte is a valuable automated tool for oocyte injection and TEVC recording that can be used in drug screening and target validation to enhance the number of compounds and oocytes tested per day. | {
"pile_set_name": "PubMed Abstracts"
} |
Comparison of zero- and second-order derivative spectrophotometric and HPLC methods for the determination of gemcitabine in human plasma.
Zero- and second-order derivative spectrophotometric and high-performance liquid chromatography (HPLC) methods were developed and validated for the determination of gemcitabine in human plasma. Spectrophotometrically, gemcitabine was determined by means of zero-order derivative absorbance values (A) at 288 nm and from values from the second-order derivative absorbance values (2D) at 285 nm. Beer's Law was obeyed in the range 0.50-15.0 microg ml(-1). The proposed other method, normal-phase HPLC method for determination of gemcitabine in human plasma was described. Calibration curve was linear over the concentration range 0.20-15.0 microg ml(-1). Quantitation was achieved by diode array detection at 272 nm using 2'-deoxycytidine as internal standard. Results obtained by spectrophotometric and HPLC methods for determination of gemcitabine in human plasma described in this paper showed adequate accuracy, precision and repeatability. No interference was found in plasma at the selected derivative wavelength and chromatographic conditions. According to the statistical comparison, there is no significant difference between the three methods. This is suggested that the three methods are equally applicable. | {
"pile_set_name": "PubMed Abstracts"
} |
Ameliorating hypertension and insulin resistance in subjects at increased cardiovascular risk: effects of acetyl-L-carnitine therapy.
Insulin resistance, a key component of the metabolic syndrome, is a risk factor for diabetes mellitus and cardiovascular disease. Acetyl-L-carnitine infusion acutely ameliorated insulin sensitivity in type 2 diabetics with insulin resistance. In this sequential off-on-off pilot study, we prospectively evaluated the effects of 24-week oral acetyl-L-carnitine (1 g twice daily) therapy on the glucose disposal rate (GDR), assessed by hyperinsulinemic euglycemic clamps, and components of the metabolic syndrome in nondiabetic subjects at increased cardiovascular risk a priori segregated into 2 groups with GDR < or =7.9 (n=16) or >7.9 (n=16) mg/kg per minute, respectively. Baseline GDR and systolic blood pressure were negatively correlated (n=32; P=0.001; r=-0.545), and patients with GDR < or =7.9 mg/kg per minute had higher systolic/diastolic blood pressure than those with higher GDR. Acetyl-L-carnitine increased GDR from 4.89+/-1.47 to 6.72+/-3.12 mg/kg per minute (P=0.003, Bonferroni-adjusted) and improved glucose tolerance in patients with GDR < or =7.9 mg/kg per minute, whereas it had no effects in those with higher GDRs. Changes in GDR were significantly different between groups (P=0.017, ANCOVA). Systolic blood pressure decreased from 144.0+/-13.6 to 135.1+/-8.4 mm Hg and from 130.8+/-12.4 to 123.8+/-10.8 mm Hg in the lower and higher GDR groups, respectively (P<0.05 for both; P<0.001 overall) and progressively recovered toward baseline over 8 weeks posttreatment. Total and high molecular weight adiponectin levels followed specular trends. Diastolic blood pressure significantly decreased only in those with higher GDRs. Treatment was well tolerated in all of the patients. Acetyl-L-carnitine safely ameliorated arterial hypertension, insulin resistance, impaired glucose tolerance, and hypoadiponectinemia in subjects at increased cardiovascular risk. Whether these effects may translate into long-term cardioprotection is worth investigating. | {
"pile_set_name": "PubMed Abstracts"
} |
DCs and peripheral T cell tolerance.
Tolerance is a state in which the immune system as a whole fails to make an active response to antigen. Three mutually exclusive mechanisms appear to account for the fate of antigen-specific peripheral T cells within a tolerant animal: maintenance of naive status, deletion after responding to antigen, and long term survival after responding to antigen, a mechanism that should probably be considered part of the spectrum of memory responses. The types and functional status of the DCs that present antigen in each case remain controversial. This review will summarize the indirect evidence that underlies some of the hypotheses that account for peripheral T cell tolerance. | {
"pile_set_name": "PubMed Abstracts"
} |
Does operatory field isolation influence the performance of direct adhesive restorations?
To evaluate the influence of different adhesive strategies (etch-and-rinse and self-etching adhesives) and type of field isolation (absolute or relative) on the clinical performance of restorations of noncervical carious lesions (NCCLs). One hundred forty NCCLs were selected from 38 patients, according to previously established inclusion/exclusion criteria, and assigned to one of four groups (n = 35): etch-and-rinse/rubber-dam (ERR), etch-and-rinse/cotton roll (ERC), self-etching/rubber-dam (SER) and self-etching/cotton roll (SEC). The adhesive systems used were: Adper Single Bond 2 (3M ESPE) and Adper SE Plus (3M ESPE), with restorations made using a composite resin (Z350, 3M ESPE). Using the USPHS modified criteria, 140 restorations were evaluated by two calibrated examiners at 5 different times: immediately after placement, at 7 days, and 2, 6, and 12 months. In order to evaluate the presence of gingival recession after the use of the #212 rubber-dam clamp, the clinical crowns of the teeth from groups ERR and SER were measured at six different periods (baseline, immediately, and at 7 days, 2, 6, and 12 months). Data were subjected to McNemar's, chi-square, and Student's t-tests. Both adhesive strategies reduced tooth sensitivity beyond the second period of evaluation (7 days); tooth sensitivity disappeared after the third period of evaluation (2 months). There were no statistically significant differences between the adhesive techniques or isolation techniques, except for a Bravo score for marginal discoloration in group SEC at 6 months, which was significantly different from the other groups. The rubber-dam isolation technique was more uncomfortable for the patient and resulted in short-term gingival recession. No significant differences were found between the types of isolation or adhesive strategy in this clinical evaluation, with the exception of 2 restorations in group SEC that showed marginal discoloration, possibly due to inadequate enamel etching by the self-etching adhesive. Class V restorations perform equally well placed with or without rubber-dam. | {
"pile_set_name": "PubMed Abstracts"
} |
Neoplastic angioendotheliomatosis (NAE) of the CNS in a patient with AIDS subacute encephalitis, diffuse leukoencephalopathy and meningo-cerebral cryptococcosis.
A 12-year-old, hemophilic boy died with acquired immune deficiency syndrome (AIDS) after a clinical course characterized by progressive psycho-organic syndrome and opportunistic infections. Postmortem neuropathological examination revealed a cerebral form of neoplastic angioendotheliomatosis (NAE), leukoencephalopathy, giant cell encephalitis and meningo-cerebral cryptococcosis. The most unusual finding was the presence of proliferated neoplastic cells within lumina of some blood vessels throughout the central nervous system (CNS). These cells displayed cytologic features of malignancy and stained positively for common leukocyte antigen. Coronal sections showed diffuse cerebral and cerebellar leukoencephalopathy with most pronounced loss of myelin and axons in deep white matter, while the subcortical arcuate fibers and the corpus callosum were partially spared. In these areas numerous small foci of severe myelin loss were present. Microglial nodules and distinctive multinucleated giant cells (MGC) were numerous. Intracytoplasmic and intranuclear acidophilic inclusions were found in a few multinuclear and mononuclear cells. Close contact between mononuclear and multinuclear cells suggesting their fusion was also observed. As far as we know this is the first case of NAE encountered in AIDS, one of the rare primary cerebral forms and the youngest reported case of NAE up to now. This case could be considered as one proof more that NAE is a special form of malignant lymphoma. | {
"pile_set_name": "PubMed Abstracts"
} |
Accessibility, reliability, and usability of neurosurgical resources.
OBJECTIVE Closing the knowledge gap that exists between patients and health care providers is essential and is facilitated by easy access to patient education materials. Although such information has the potential to be an effective resource, it must be written in a user-friendly and understandable manner, especially when such material pertains to specialized and highly technical fields such as neurological surgery. The authors evaluated the accessibility, usability, and reliability of current educational resources provided by the American Association of Neurological Surgeons (AANS), Healthwise, and the National Institute for Neurological Disorders and Stroke (NINDS). METHODS Online neurosurgical patient education information provided by AANS, Healthwise, and NINDS was evaluated using the LIDA scale, a website quality assessment tool, by medical professionals and nonmedical professionals. A high achieving score is regarded as 90% or greater using the LIDA scale. RESULTS Accessibility scores were 76.7% (AANS), 83.3% (Healthwise), and 75.0% (NINDS). Average usability scores for the AANS, Healthwise, and NINDS were 73.3%, 82.6%, and 82.9%, respectively, when evaluated by medical professionals and 78.5%, 80.7%, and 75.9%, respectively, for nonmedical professionals, respectively. Average reliability scores were 58.5%, 53.3%, 72.6%, respectively, for medical professionals and 70.4%, 66.7%, and 78.5%, respectively, for nonmedical professionals when evaluating the AANS, Healthwise, and NINDS websites. CONCLUSIONS Although organizations like AANS, Healthwise, and NINDS should be commended for their ongoing commitment to provide health care-oriented materials, modification of this material is suggested to improve the patient education value. | {
"pile_set_name": "PubMed Abstracts"
} |
Removal and recovery of lead(II) from single and multimetal (Cd, Cu, Ni, Zn) solutions by crop milling waste (black gram husk).
The study reports removal of heavy metals when present singly or in binary and ternary systems by the milling agrowaste of Cicer arientinum (chickpea var. black gram) as the biosorbent. The biosorbent removed heavy metal ions efficiently from aqueous solutions with the selectivity order of Pb>Cd>Zn>Cu>Ni. The biosorption of metal ions by black gram husk (BGH) increased as the initial metal concentration increased. Biosorption equilibrium was established within 30 min, which was well described by the Langmuir and Freundlich adsorption isotherms. The maximum amount of heavy metals (qmax) adsorbed at equilibrium was 49.97, 39.99, 33.81, 25.73 and 19.56 mg/g BGH biomass for Pb, Cd, Zn, Cu and Ni, respectively. The biosorption capacities were found to be pH dependent and the maximum adsorption occurred at the solution pH 5. Efficiency of the biosorbent to remove Pb from binary and ternary solutions with Cd, Cu, Ni and Zn was the same level as it was when present singly. The presence of Pb in the binary and ternary solutions also did not significantly affect the sorption of other metals. Breakthrough curves for continuous removal of Pb from single, binary and ternary metal solutions are reported for inlet-effluent equilibrium. Complete desorption of Pb and other metals in single and multimetal solutions was achieved with 0.1 M HCl in both shake flask and fixed bed column studies. This is the first report of removal of the highly toxic Pb, Cd, and other heavy metals in binary and ternary systems based on the biosorption by an agrowaste. The potential of application for the treatment of solutions containing these heavy metals in multimetal solutions is indicated. | {
"pile_set_name": "PubMed Abstracts"
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.