text
stringlengths 44
776k
| meta
dict |
|---|---|
Neuron – Electron, ES6, React, PouchDB, Sass, Webpack - JamesTheHacker
https://github.com/JamesTheHacker/Neuron
======
dexwiz
This is little more than a few common npm packages in a package.json and super
basic folder structure. There isn't even a sample app in this. Why was this
posted? This is nothing more than some buzzwords glued together with no
example.
~~~
JamesTheHacker
This project is not intended to be a sample application. As it stands it's a
simple starter kit to avoid having to repeat the same configurations for every
application. I created it purely for personal use, and decided to share it.
Over time I will be adding more features. Today PouchDB and CouchDB remote
replication has been added comply with offline first development practices.
Along with a few other tweaks. Next I'll be adding common React components
that I use often in my own commercial projects.
It's every growing, and an attempt to get contributors to jump on board to
create something that will be beneficial and helpful to all.
Rome wasn't built in a day.
------
felixrieseberg
This is similar to electron-compile, built by my fellow desktop app coders
over at Slack.
[https://github.com/electron/electron-
compile](https://github.com/electron/electron-compile)
------
biocomputation
On the one hand, all these web tech products are interesting. On the other
hand, I've recently discovered that writing desktop apps with web tech is just
about as awful as doing it in C++, albeit awful in different ways.
~~~
Everlag
Personally, the appeal of electron is that most of my knowledge for writing
web apps is immediately portable to desktop apps as well. Using the same
tooling, language, and with more control over the environment, you can build
good enough applications.
Are there gray areas where everything is an awful hellscape of trying to mix
node apis and a browser? Oh yes. Is the experience not the absolute best?
Yeah. However, I feel the trade is worth it to defer sinking time into native
desktop applications.
~~~
biocomputation
Yeah, so with no extra work, I can run on Linux and Mac...
>> awful hellscape
In my opinion, there are just a few not so insignificant problems with web
tech, not the least of which is that the incredibly serious flaws and
limitations of the text-as-data-structures programming model in web tech seems
to be a like a perpetual motion machine for technical debt.
I cannot be the only one who is deeply unsettled by the notion that the web
tech world is populated by thousands of libraries designed to help paper over
incredibly serious problems/limitations with the basic programming model. Even
stuff like Angular just exists to help paper over problems that had already
been solved in the 1980s.
But yeah, maybe it's cool for doing stuff that's good enough. I can definitely
see that!
------
davej
I have to give a shout-out to this Electron + React + Redux boilerplate:
[https://github.com/chentsulin/electron-react-
boilerplate](https://github.com/chentsulin/electron-react-boilerplate)
I've been using it for about 8 months and it's very well maintained. Neuron
looks like a nice lightweight alternative though.
------
crimsonalucard
Is there any electron style solution that works for both desktop and mobile?
~~~
giosch
Apache Cordova [https://cordova.apache.org](https://cordova.apache.org)
------
SilverSpandex
Very cool. I have been getting into Electron for the past couple of months and
I'm starting to find it better than working with C# and WPF for smaller apps.
I have never thought about using React. Will play with this today thanks :)
| {
"pile_set_name": "HackerNews"
} |
Book imagines what animals might look like if humans went extinct (2018) - Tomte
======
jolmg
[https://duckduckgo.com/?q=Book+imagines+what+animals+might+l...](https://duckduckgo.com/?q=Book+imagines+what+animals+might+look+like+if+humans+went+extinct&t=ffab&ia=web)
------
_Schizotypy
Is this supposed to link somewhere?
| {
"pile_set_name": "HackerNews"
} |
HashiCorp Consul 1.2: Service Mesh - onnimonni
https://www.hashicorp.com/blog/consul-1-2-service-mesh
======
syllogism
If you're using Consul for web services, I really recommend the Traefik web
server: [https://traefik.io](https://traefik.io)
Traefik replaces Nginx: it's the reverse proxy that maps the incoming requests
to your various services, which are advertising on some arbitrary localhost
port.
The amazing thing is that Traefik integrates with Consul: you only need to
point it to your Consul endpoint, and it can automatically publish your
services! You can also do other dynamic configuration of Traefik, e.g. by
publishing a service via a REST API, via Kubernetes, etc.
I've struggled for years to get Nginx configured correctly, and it's been
frustrating to have no alternative. In Nginx, dynamic binding is a premium
feature. In the free version, you have to rewrite the config and restart the
service. That's not fun if you expect services to come and go as part of your
natural life-cycle.
Traefik's still pretty young. Notably, the docs are shit. But the application
is well-designed, and it compiles as a single self-contained binary (as it's
written in Go).
~~~
hellcow
Traefik isn't worth the trouble. We used it in production over the course of 2
years, and it was consistently our only source of downtime due to rediculous
bugs: not closing file descriptors, breaking changes, and silent failures with
no log output, panic or exit even with debug logs enabled.
As you mentioned, the docs are terrible. What makes that worse are the
undocumented breaking changes between each release. They don't even pretend to
follow semver, so v1.5 broke v1.4, and v1.6 broke v1.5. Each update you pray
that it doesn't take your whole setup down. If anything goes wrong, since
nothing is documented and there's often no logs explaining what went wrong,
you might be down for an extended period while you make 100 best-guess changes
to the config that worked in staging, but for whatever reason isn't working in
production. May the odds be ever in your favor.
Last I checked, Traefik was 988,000 (!!!) lines of code. That's 20x the size
of my very complex web application. I replaced it with 500 lines of go
providing all the essential features for me. Higher reliability, way fewer
bugs, no breaking changes.
~~~
emilevauge
Traefik creator here. Wow, that's harsh!
You may encountered issues while using Traefik so giving your opinion is
totally fine, but I don't think that's fair to overreact.
Many users (and I mean big companies) have been using Traefik in production
for years without issue. I'm not saying there is not bug, which software can
claim this, I'm just saying that many users have a good opinion on Traefik
stability.
We follow semver, there shouldn't be any breaking change between 2 minor
versions. But, yes, it can happen, sometimes, we may have forgot to check a
specific use case. But hey, again, let's be fair, we don't want it. We are
just human. And no, this does not happen at every minor version and this is
pretty uncommon...
Finally, on Traefik size. You are including Traefik dependencies, in vendor/,
which is a bit weird. In go, the convention is to push the dependencies in
your repository to get reproducible builds, so that's not a good way to count.
If you exclude vendor/:
golocc --no-vendor ./...
Lines of Code: 58532 (2987 CLOC, 55545 NCLOC)
Which is rather tiny.
So all in all, I regret you had such a bad experience with Traefik, but I just
wanted to express the fact that many users are using it without any issue :) I
would be happy to discuss further on this.
~~~
shaklee3
Thanks for clearing all that up.
------
mochtar
If you want to try the new Connect feature from Consul yourself, we've put up
an interactive tutorial on our Instruqt learning platform, together with the
nice folks at HashiCorp:
[https://play.instruqt.com/hashicorp/tracks/connect](https://play.instruqt.com/hashicorp/tracks/connect)
~~~
thepumpkin1979
this instruqt thingy is pretty cool, it's actually addictive. I started with
the Connect course and I'm not going for Istio:
> Please wait while we setup a Kubernetes cluster with Istio preinstalled. In
> the meantime, browse through these notes to learn more about the sample
> application.
damn
~~~
mochtar
Thanks!
We also like apps and services that start faster better ;-)
~~~
thepumpkin1979
Oh what I meant to say is, it's a real kubernetes cluster, it's a good thing.
------
chuhnk
I've been using Consul as part of micro
([https://github.com/micro/micro](https://github.com/micro/micro)) for 3 years
now. It's a great mechanism for service discovery. This additional feature is
going to be seamlessly integrated. They've done a fantastic job of pushing
forward Consul as a whole.
------
esseti
If I use Kubernetes, this service is superfluous, right? Instead, it's useful
if you use Docker containers in other fashion since services should
communicate with each other.
~~~
paultyng
I think the answer is yes and no depending on your needs. I don't have a lot
of experience with the Kubernetes NetworkPolicy which does support selector
based allow/block of communication between pods, but I believe it does not
encrypt the traffic itself (although you could always do so on top of the
network layer). It also is constrained to only controlling communications
within Kubernetes and requires an actual controller to implement the
networking. Consul Connect does use a sidecar proxy for intra cluster
communication, but in addition to just the authorization it also does a mutual
TLS and can allow that secure communication to endpoints outside the cluster.
It now occupies a space very similar to Istio:
[https://www.consul.io/intro/vs/istio.html](https://www.consul.io/intro/vs/istio.html)
Disclaimer: I work for HC but not on Consul
------
Already__Taken
sidebar: I'm quite fond of hcl[0] I hope it worms its way through more systems
as a config format option
[0]: [https://github.com/hashicorp/hcl](https://github.com/hashicorp/hcl)
~~~
alecthomas
Agreed, it's a great format. I wish it would kill YAML.
~~~
vesak
I wish Hashicorp will seriously maim many of the other devops solutions. Their
stuff has grew on me slowly, but I'm appreciating the hell out of their
focused tools. Smells like Unix spirit.
------
jrs95
Damn, this is nice. If this had been around a few months ago I don't think I'd
be using Kubernetes right now.
------
kamura
Could someone care to elaborate what are the main differences between Consul
and Istio? What would be the primary reasons to choose one service mesh over
the other?
~~~
cube2222
Consul is not a service mesh. At its core it's a distributed key-value store
which is commonly used for service discovery, configuration management and
healthchecks.
~~~
lifty
Consul just became a service mesh. It’s in the release notes.
| {
"pile_set_name": "HackerNews"
} |
An Inside Look at a Flat Organization That Serves Millions - jodooshi
http://firstround.com/article/An-Inside-Look-at-a-Flat-Organization-That-Serves-Millions
======
mkramlich
When employee count is small enough you can make just about anything work.
That's the key ingrediant here, not any particular management paradigm.
For example, right now, I run an organization of precisely 1 employee and 1
leader type, both residing in the same body, and you'd be surprised at the
exotic, hyper-efficient, dare I say sometimes quasi-communist-libertarian-
artistic-entrepeneurial-self-empowered management techniques I/we use. :-)
~~~
jodooshi
>People have a strong instinct not to disappoint a system that gives them so
much ownership. A flat structure surfaces and amplifies this instinct.
That's human nature.
------
fian
Flat works well for small groups and for growing/sustainable businesses. When
a downturn occurs and staff count needs to be reduced, how is that handled in
the transparent, everyone-can-look-into-everything organisation described in
the article? Sometimes, some information needs to be keep confidential and
restricted to a smaller group.
| {
"pile_set_name": "HackerNews"
} |
Has the internet run out of ideas? - Sigma0
http://www.guardian.co.uk/technology/2012/apr/29/internet-innovation-failure-patent-control
======
computerslol
No; we have run out of the type of companies that can both encourage
innovation AND provide the resources (money and time) to get good ideas
transformed into great products to put on the market.
Modern software is built in two week sprints and emotionally abandoned as soon
as it barely works.
| {
"pile_set_name": "HackerNews"
} |
A blockchain is a specific set of choices suitable for a narrow set of use-cases - BerislavLopac
https://threadreaderapp.com/thread/987266940887535616.html
======
kmc059000
I was recently at an "Emerging Technology" conference for emerging
technologies that was targeted at non-technical entrepreneurs and innovators.
90% of the conference was focused on blockchain, while the remaining was
focused on AI. During the entire conference, blockchain was being touted as a
silver bullet for many problems, and many of the people at the conference ate
it up.
The best anecdote to summarize the conference was a speech by IBM where they
covered a project which they did with major retailer to track a supply chain.
The speaker mentioned some impressive results which caused a noticeable people
around me to literally say "wow". However, they did not once mention
specifically how blockchain was the cause of these results or give reasons why
blockchain was superior. From what I could tell as an engineer, the entire
application could have been built without blockchain.
I was surprised at how blockchain was being touted as the next technological
revolution (and very light on the details) and was concerned at how quickly
the other attendees accepted blockchain as it was being sold. I left the
conference thinking that it would only be a matter of time before blockchain
would be touted as a silver bullet in the larger community due to conferences
like these (although I am sure they've been happening for a while, and this
was my first exposure). It will not be long before a large number of software
projects will be based on blockchain needlessly, and/or the engineers will be
arguing with management why using blockchain is a mistake.
~~~
havkom
We now live in the information age. Blockchains and AI will transform everyday
life as well as specific sectors such as health care and trade.
Imagine walking in to a Starbucks café, order a cup of coffee, digitally
signing a payment transaction on your mobile or laptop and then wait for it to
be confirmed by the Blockchain while enjoying the hot cup of coffee you have
ordered.
What is more, think about AI, you will not need to talk to the staff to place
an order for your coffee. The staff can relax and watch you make gestures to a
camera. They will be able to read on a screen if you’d like it white or black.
I think the article is too negative and does not see the big picture of
transformation that is going on (as exemplified above).
~~~
Scarblac
> Imagine walking in to a Starbucks café, order a cup of coffee, digitally
> signing a payment transaction on your mobile or laptop and then wait for it
> to be confirmed by the Blockchain while enjoying the hot cup of coffee you
> have ordered.
You could do the the exact same thing now with credit cards, except the
waiting. And then you could get your money back if the coffee sucked, and you
wouldn't lose all your money if someone happened to steal your private key .
~~~
hopfog
Pretty sure it was sarcasm.
~~~
wool_gather
It's important to keep Poe's law in mind when you're posting plain-text
parody; you don't have tone of voice and body language to help convey your
real intent.
------
KirinDave
What exactly is the specific use case where Proof of Work blockchain are
appropriate?
Consensus in that design is:
1\. Perhaps the single most expensive consensus algorithm ever designed.
2\. Deliberately one of the slowest.
3\. Does not actually provide trustless consensus once 1/3 of the miner nodes
decide to collude.
Other than "our data is a merkle tree but you have to trust us to submit
transactions to it", and "a currency system with a failed promise to deliver
either scale or trustless consensus" what, is the proper application?
~~~
ozmbie
If you can invent a reliable alternative to proof-of-work distributed
consensus there is a multi-billion dollar opportunity there. It’s inefficient,
but before bitcoin came along there was no way to even do it. An inefficient
way is better than no way at all.
Some other cryptocurrencies are trying alternatives. But none have been as
“battle hardened” as bitcoin.
Follow the core developers and you’ll see their focus is on creating an open
distributed platform. It’s up to us to figure out what to use it for.
~~~
curun1r
> An inefficient way is better than no way at all
Really, why?
IMHO, there's a pretty compelling argument to be made that Bitcoin and the
other cryptocurrencies have had a significantly net-negative impact on the
world, from facilitating scams and other illegal activity to now having to
worry that sites we visit will monetize by stealing CPU cycles to the
significant impact on climate change, these technologies have caused a lot
more harm than benefit. And all the while, they haven't even figured out how
to build a ledger that can scale to day-to-day transactions. My bet is that
the whole thing ends up being a tax on people who've forgotten their 17th
century Dutch history.
~~~
knocte
> from facilitating scams and other illegal activity
The same was said over and over on the nascent days of the internet, about how
it facilitated anonymity so easily and how it would be used by criminals.
> by stealing CPU cycles
Difficulty in bitcoin mining is raising all the time (because of the
competition among miners). This is why nobody mines nowadays with CPUs or GPUs
but with ASICs. The fact that some sites are trying to achieve some decent
mining hashrate by pulling the amount of visitors of a website is a naive move
that will soon be off-set by even more raising levels of difficulty. Soon this
will not be profitable at all, even if your website was the 1st in Google's
page rank.
> to the significant impact on climate change
I like that skeptics raise this point, because:
1) The cryptocurrency mining industry is the fastest one to chase energy-
efficient solutions. As soon as a device consumes less electricity, it's
adopted widely because of the huge incentives to do so (e.g. CPU->GPU->ASIC).
2) Compare the electricity spent by the entire banking industry with the
electricity spent by the entire crypto-mining industry. Now guess what's more
efficient.
~~~
KirinDave
> The same was said over and over on the nascent days of the internet, about
> how it facilitated anonymity so easily and how it would be used by
> criminals.
There's 2 things I want to say about this comment:
1\. Those accusations _were not wrong._ In the same sense that we have pretty
clear evidence that a lot of the value injected into bitcoin and stored there
is via money laundering.
2\. _Unlike_ proof of work currency blockchains, the internet clearly
delivered and had no direct theoretical challenges to its very existence that
people subsequently and fervently denied.
Proof of work is a bad idea. It's been discredited. It doesn't do what people
thought it did. And it's MUCH too expensive to keep doing.
~~~
siwatanejo
Proof of Work is the only way for people to transact in which they don't have
counterpary-risk problems before transacting.
Before PoW was invented, there was no way of doing this.
Now, thanks to layer2 technologies, PoW will start becoming much more (orders
of magnitude more) energy efficient.
How is that a bad idea? Make something possible, and later make it
sustainable. So long as there's demand for that something, then it's a good
idea.
~~~
skybrian
There are two sides to a trade, and typically Bitcoin only handles one of
them. Buy some food with Bitcoin and it still might taste bad or make you ill.
Even for purely financial transactions, any kind of loan or investment still
has counter-party risk.
So even if a crypocurrency worked perfectly, it doesn't solve very much.
~~~
siwatanejo
> There are two sides to a trade, and typically Bitcoin only handles one of
> them. Buy some food with Bitcoin and it still might taste bad or make you
> ill.
You have this same problem with any form of money. The problem I raised is
counterparty-risk when holding your assets (before transacting).
> Even for purely financial transactions, any kind of loan or investment still
> has counter-party risk.
Yeah, that's why maybe loans should have higher interest (right now, the low
interest is artificial, because the bank is really making more money from the
fact that it's working as a fractional reserve, not from the interest it
gathers from loaning you money).
> So even if a crypocurrency worked perfectly, it doesn't solve very much.
It solves just one thing. Granted, it's not a silver bullet. But there are
never silver bullets. Every single invention that humanity achieves, just
improves the world a little tiny bit. Cryptocurrency does this as well.
~~~
wpietri
It does not solve anything. It's true that cash and bitcoin both avoid a
narrow slice of counterparty risk. But that's not a whole problem, just part
of one. As a currency, Bitcoin is an abject failure. Even big proponents admit
that: [http://avc.com/2017/08/store-of-value-vs-payment-
system/](http://avc.com/2017/08/store-of-value-vs-payment-system/)
Bitcoin made no practical dent in existing legal financial transactions
because it's not better for the great majority of use cases.
------
olouv
While the definition is exact, it’s a pretty narrow one. I understand that
people are tired with all the hype and naturally want to counter it somehow.
But don’t let it blind you, blockchain technologies will deeply change our
societies. It’s a trust machine: it creates trust where there is none. Trust
being one of the pillar of our civilization, the scope of its applications is
wider than you would expect.
Edit: thanks for the downvotes... if your confirmation bias can’t handle a
contrarian, respectful point of view, i’d seriously question your rationality
as a member of this scientific-related community.
~~~
zakk
In most situations trust between two parties can be obtained by means of a
third party they both trust.
That’s how the banking system has worked for centuries.
The use case for a blockchain is narrower: it can be used to establish trust
between two parties in absence of a trustable third party.
~~~
olouv
Exact, and we have seen how well this third-party trust system worked during
the last financial crisis just a decade ago.
~~~
paulgb
Which system failure from that crisis does blockchain technology fix?
~~~
olouv
Sudden cascading lack of trust?
~~~
paulgb
Blockchains can reduce counterparty risk in a transaction, but there's no
technical solution to the fact that trust is required between, for example, a
lender and a borrower. The idea that you can just sprinkle some blockchain
dust and avoid financial crises is naive.
~~~
someguydave
>but there's no technical solution to the fact that trust is required between,
for example, a lender and a borrower.
No, it does not. However, if someone lends bitcoin to a borrower, it does not
involve third parties, and therefore cannot "run" like a fractional reserve
bank.
~~~
Scarblac
Of course it can.
Someone (A) can loan Bitcoin to another person (Bank), with the terms that if
he asks he can have it back at any time, and he'll also receive a small
percentage of interest each year.
Bank can then lend 90% of the money to a third person (C), betting that A will
not ask to get all his money back at the same time. To decrease this risk, he
does this with lots of people so he is covered in case only a few ask all of
it back (but still is in trouble if too many of them do at the same time).
A still has money (his assets are very liquid as he can ask for them back at
any time, very liquid assets are what we call money), C has money, the sum is
more than the initial amount, so money was created through fractional reserver
banking.
That's all fractional reserve banking is, and nothing about Blockchain
prevents it.
~~~
someguydave
>That's all fractional reserve banking is, and nothing about Blockchain
prevents it.
Implicit in my comment was the idea that it would be a bad idea to start a
fractional reserve bank which used a currency of account that wasn't available
in infinite supply from a nearby government.
Also, I merely stated a way in which Bitcoin could be used as a sound bank,
not that all possible banks which use Bitcoin are sound.
------
Moodles
It's interesting how blockchain became so incredibly hyped though isn't it?
Something to do with money (bitcoin) and some new technology perhaps?
I wanted to find out what was going on, so I literally applied for a bunch of
blockchain jobs just so I can talk to these people on the phone to see what
they're all about. I end up asking really basic questions like: "So why are
you using a blockchain instead of a normal database?" or "What problem are you
actually trying to solve?" It is actually embarrassing; I feel like I'm being
abrasive on the phone by asking such truly basic questions, yet they always
seem so startled by these kinds of questions and assume I'm somehow incredibly
intelligent and perceptive to ask these basic questions.
Generally what happens is as follows. Some business MBA type people watch a
TED talk or read in the FT that blockchain is the next big thing, so they go
out and look to hire "blockchain evangelists". Evangelists is the word they
often use, and that sounds about right because it is just like a religion
sometimes. Then I only end up talking to the business people about these
projects, because that's all the people they have. I won't name them, but I've
had conversations with huge firms or startups that both equally talk utter
nonsense. One large firm told me that they're working on "permissionless and
permissioned blockchains for everything from auditing to wine". While for a
small startup I once asked: "why are you using a blockchain for this instead
of just having a database?". The answer I got was "well... our customers
aren't really technical people...". I told them perhaps they should look at
something like Google's certificate transparency rather than blockchains, and
they echoed back to me "Oh we are definitely looking at certificate transfer!"
(Transfer, not transparency.) It's astonishing.
To summarize, huge firms tend to have people who just want to get paid so they
always say yes to whatever the clueless MBA person asks, while startups tend
to mostly know it's bullshit but go along anyway because there is a lot of $$$
involved, particularly with ICOs.
~~~
thinkingemote
I really like the idea of phoning up the recruiters to find out more about a
technology!
We have a Blockchain meetup group in my city, however its mainly about
cryptocurrency investments than any actual blockchain technological
innovation.
~~~
Moodles
To be honest I'm more onboard with cryptocurrency, even though obviously there
are way, way too many of them (Kanyre-West coin anyone?) becuase at least
blockchain actually solves a very specific problem for bitcoin: decentralized
peer-to-peer currency. It's when you get blockchains for sexual consent and
tracking your bananas in Laos that really annoys me (both real proejcts btw)
------
onetwotree
As part of my job, I often have to convince business folks that they don't
need to buy a fucking private blockchain (from IBM of course, because they're
old enough to think that no one ever got fired for buying IBM). This is very
close to the arguments I make, and adds some excellent, articulate points!
~~~
time0ut
This is happening at both of my companies now. I'm almost to the point of
telling them to buy it just so they can tell their golf buddies they're using
blockchain too.
~~~
onetwotree
Pro-tip: do an "experiment" with blockchain (built in house to keep it cheap)
so they can tell their golf buddies they're looking into it. Make sure it's
compared to a sane solution, because then they can feel superior for having
"insider knowledge" that it's pointless.
------
leifg
These are all very excellent points. I would go even further: “The only viable
application of blockchain is cryptocurrencies” (and cryprocurrencies have a
whole different set of problems).
By arguing that there is only a “narrow set of use cases” you open the door
for the counter argument “yes, but MY blockchain startup is not bullshit”.
I isually use the argument “show me the increase of profit margin specifically
by using blockchain technology”.
I so far have not gotten a satisfying answer.
~~~
snarf21
I think there are also use cases that revolve around using a blockchain as a
public database and API for the transfer and security of data.
Obviously, you could do this without using blockchain _IF_ you could get the
top 20 players in vertical X to agree on what that looks like. However, using
"blockchain" as an excuse to get the project funded and get buy-in from those
same top 20 players so they can talk about blockchain at the next board
meeting is an enabler of practical problem solving. Sometimes you have to take
the path of least resistance.
------
woah
This guy makes a lot of good points, but at heart, this is a false appeal from
authority. Every distributed system makes a set of tradeoffs. If you were to
design a distributed system with the same tradeoffs as a blockchain (single
global state, and very low trust of node operators), you would end up with
something that has similar performance characteristics as a blockchain.
Arguing that these tradeoffs are not good is perfectly valid. For instance,
this guy feels that you should be willing to trust your bank with your money,
and Microsoft with your code execution, in return for better performance.
Valid opinion.
The problem is when he comes in with this hand wavy stuff about how him and
his very smart friends think this and that and they are distributed systems
engineers so you should listen to them. It’s not a technical question, it’s a
basic question of where you want to place your trust, and a distributed
systems engineers opinion is just as valid as that of UI designer, a teacher,
or a janitor.
~~~
ajkjk
I don't think that was the point of the article at all.
The point is that distributed systems engineers know already about these sets
of tradeoffs, and many of the alternatives to them, and with that wider
perspective see few, if any, reasons to recommend blockchain.
Meanwhile many the people going around hyping up blockchain know very little
about the tradeoffs and alternatives, and are definitely _not_ recommending
blockchain because it's the right set of choices in each of the tradeoffs.
Like - picking randomly - KodakCoin[1], he would argue (and I would agree),
definitely did not choose to use blockchain because was the database that made
the most sense for their needs. Indeed, it's probably a terrible choice
compared to the alternatives.
(Except, perhaps, for optimizing for"hype factor" as seems to have worked
considering their stock price, in which case the best thing to do might
actually be to lie and _say_ you're using blockchain, and then... not.)
[1]
[https://en.wikipedia.org/wiki/KodakCoin](https://en.wikipedia.org/wiki/KodakCoin)
~~~
woah
> _The point is that distributed systems engineers know already about these
> sets of tradeoffs, and many of the alternatives to them, and with that wider
> perspective see few, if any, reasons to recommend blockchain._
It's not really a technical question. People who like blockchains like them
_because_ of that set of tradeoffs. Beyond obvious scams and stupid corporate
hype (by most of the same people who misused "cloud", btw), people understand
the tradeoffs.
I don't think that distributed systems experience qualifies you to do any more
than understand the tradeoffs, and these specific tradeoffs are understood
well by a very large number of people already.
------
_bxg1
_Thank you._ This is what I've been telling people forever. Blockchain
technology is revolutionary for a very specific and narrow set of use cases,
and outside of that it ranges from a crappy solution to completely irrelevant.
------
misrab
I think people are severely underestimating the value of a single source of
digital signing and chronology, as well as the network effects of
interoperability. Time will tell ;)
also to the point of specific design decisions, there are plenty of models
that will evolve including arbitrary protocols on the Filecoin Merkle forest,
so I'm not worried about that
also find that distributed systems experts tend to fail to see things through
the lens of cryptoeconomics, which was nakamoto's fundamental innovation. it's
about provable behavioural security
~~~
mrharrison
I agree. Imagine a frontend developer connecting to the internet and with a
couple tools like truffle and his crypto wallet, that dev will immediately
have access to so much information and logic through smart contracts via one
interface, that it blows my mind. It's still young but it's going to be
ubiquitous and pervasive. At least I'm 90% sure it will be ;)
~~~
dmitriid
I'm a frontend developer. So let's assume I've connected to the internet with
"a couple of tools". Which information and logic (???) are now available to me
that were previously inaccessible?
------
DennisP
There's room for more choices than that. E.g. you can do transactions off-
chain and keep some relevant state yourself, with an exit plan to the public
chain in case of cheating. Examples include state channels and Ethereum's
Plasma.
------
zilchers
I've found my life is a lot happier and I'm a lot less frustrated if I replace
"blockchain" with "distributed database" in my mind any time these types of
discussions come up. Technically they're different, but what is actually
potentially revolutionary about everything happening right now isn't the hash
chain, it's the idea of moving apps to distributed databases, self contained
databases and away from the database tech of old. This could apply to consumer
apps, enterprise apps, pretty much anything. When I think about it that way,
I'm much more ok with the broad overuse of the term blockchain.
------
aje403
On the bright side, we can stop calling it a scam and start calling it a
religion soon
------
tbtok
There's only one use case for blockchains: creating ecosystems. Solving a
customer's problem is typically not something you do on your own, you need to
collaborate in ecosystems. Having one company dictating what rules and
technologies are in effect in the ecosystem is risky (e.g. ecosystems created
by Amazon or Facebook). A blockchain democratises the collaboration, at the
cost of efficiency. So at its core it's a governance technology, and a trade-
off between efficiency and security of your ecosystem.
Blockchains are just a technology. The point is to look at use cases that are
now viable because of the ecosystems we create.
------
Scarblac
I was recently asked to give a short presentation on "what is blockchain" at a
session with government agencies who wanted to formulate a position on whether
they should do anything with blockchains.
And my conclusion was almost exactly the same as this post: blockchain is part
of a set of specific technologies you need to solve the very specific problem
that Bitcoin solves. Another thing without which Bitcoin wouldn't work is the
PoW stuff. If your requirements are different, then many of those other
technologies are still relevant but blockchain is not. And if you are not a
digital coin, your requirements _are_ different.
------
pknerd
This happens with most of the technologies. Remember the days when AJAX was
introduced? every other site was being ajaxified. Tech companies were
promoting it as if something very unique arrived in this world. Later it was
found that Microsoft was using it in outlook for long time, it's just they
failed to coin the term for it. Same seems with blockchain and as usual IBM is
at it's best to cash this hype for enterprises who are already customer of
their products one way or other, specially Middle east countries.
------
decentralised
The blockchain enables a set of use-cases around trust, value exchange and
cryptoeconomics. With these building blocks, there are a number of companies
working on amazing projects that are truly revolutionary.
[https://vitalik.ca/general/2018/04/20/radical_markets.html](https://vitalik.ca/general/2018/04/20/radical_markets.html)
------
jernejzen
Here's my case. I have problems trusting any centralised cloud service out
there that is significant for my privacy. I have problems with Pocket, because
it knows what I read.
If data would be stored on the decentralized nodes and accessible over the
smart contracts, my zen would be way closer.
~~~
kevinwang
But wouldn't that change your data being readable by Pocket to your data being
readable by everyone?
I fail to see how that's better. And if encryption is the solution, there
could be encrypted centralized or decentralized apps.
~~~
crispyporkbites
Readable by everyone != decentralised / blockchain
Blockchain code literally runs in an open source, open memory environment.
Which means you can guarantee the execution of code without interference.
~~~
roywiggins
But that non-interference comes from exposing all the information it operates
on to the public. Otherwise, you wouldn't be able to maintain a consensus.
(if you encrypt your data, then nobody else can see it, but you can't do
anything with it on the chain and you might as well store it in S3 or
wherever)
~~~
zodiac
Technically, fully homomorphic encryption exists (and may someday be
practical)
~~~
kevinwang
But still, you could have a centralized service that involves client-side
(potentially homomorphic) encryption and stores (and in the case of
homomorphic encryption, does operations with) the data on their servers. So
that shouldn't give a privacy benefit from blockchain over centralized
servers.
~~~
zodiac
You would get a privacy benefit in the sense that the computation provider
would not learn anything about the data you gave them. However you are right
that centralized computation providers are equally constrained (ie don't learn
anything) as blockchains in this regard.
------
xmly
I am a distributed system engineer. I worked for aws... I agree with that
bitcoin blockchain is only specific for electronic payment system. But its
design concept is quite interesting, could make quite huge impact.
------
XR0CSWV3h3kZWg
The shortest I have been able to explain it as:
If you want an append only log with arbitrary (including malicious) actors
then use a blockchain. Otherwise you may want to avoid the huge costs
associated.
------
fgoldberg
Only some projects have utility in the blockchain Actually, some of the are
Augur or Cryptocup.io
------
johnx123-up
_As original link is not available, posting the content from Google Cache for
future reference_
Thread by @clemensv: "I've talked to a lot of distributed systems engineers
(who build cloud-scale stuff) from across the industry about blockchain. While
most pl […]"
I've talked to a lot of distributed systems engineers (who build cloud-scale
stuff) from across the industry about blockchain. While most platform folks I
talked to are perfectly happy to help with frameworks that help selling
product or services, ...
... and some even rode the crypto wave to make some hay, I have a hard time
finding people in the distributed systems platform community who believe that
blockchain is even remotely as significant as the hype wants to make us
believe.
Engineers at the center of the industry understand the qualities of append-
only logs, understand signatures and non-repudiation, and understand consensus
protocols. They understand that those are a few building blocks from a large
toolbox and that there are choices for each.
A "blockchain" is a specific composition of specific choices for these
building blocks that's suitable for a fairly narrow set of use-cases. The
blockchain-specific consensus models are tailored to (a) all-around lack of
trust and (b) convergence to a singular global log.
Convergence to a singular global log with many candidate writers and many
replicas makes it hard to reach consensus and for that consensus to be
propagated; PoW or PoW+PoS (cleverly) solve that by being intentionally slow.
The PoW lottery is probabilistically set up so that a singular mining winner
can emerge and its winning block can be propagated throughout the network
before another miner finds a competing solution (there can be many valid
ones). The enabler for that is a time window.
The tradeoff the "nobody is trusted" blockchain model makes, is that it
literally trades trust for time. It's slow by design. Giving consensus forming
ample time is foundational. (I'll be happy to hear arguments that prove the
contrary).
Once parties trust eachother to faithfully collaborate, the existing consensus
models that we all use to build hyper-scale cloud systems become applicable
and those can resolve even complex and contested consensus problems in a few
milliseconds, largely gated by network latency.
Even if there's no all-around trust, there's often a neutral party that can
supervise a transaction of two parties that don't trust eachother, but who
each trust that party. "Sidechains" and "Private permissioned blockchains" are
playing that trick.
However, once there's a trusted neutral party, that trusted neutral party can
already establish non-repudiation by forcing authentication/authorization
along with a content signature and only ever allowing appends. With any
regular old database that the neutral party maintains.
The world's economy today is built on the very principle that accounting
records are both safe from deletion and immutable in digital accounting
systems. There's a clear sense of order. They are written to audit logs for
non-repudiation proof.
The cryptographic chaining of records is a good idea to strengthen the
immutability of the ledger as a whole, but it's not really superior to holding
a ongoing full copy of the ledger in safe escrow. A signature chain can be
done on any existing database.
The single global log requirement and therefore the global consensus problem
completely falls apart in all cases where the problem is partitionable (FWIW
"sidechains" are partitions). Turns out, that's true for most problems,
otherwise nothing would ever scale.
Once you can use partitions, the consensus scope shrinks to the scope of the
partition. When you transfer money from your bank account, the intial scope is
just your bank, with the initial transaction to a clearing account. (FWIW, a
"sidechain" is a clearing account). Easy.
For those familiar with (shall I say "classic"?) distributed systems
architecture, it's amusing to see things like "sidechains" with local trust
relationships emerge, because they are nothing but a reaffirmation of the
partitioning principles foundational for a functional economy
Yes. The combination of decentralized operation, variable trust, and non-
repudiation is very attractive. The world already works like that. There are
easily 15,000+ banks globally and countless more businesses that maintain
various ledgers. That's hardly "centralized".
"Centralization" is not when 15000 organizations are federated such that you
can transfer funds between them. Yes, you need a banking license and audit in
the local jurisdiction to be a bank. Because, as we see, some people are happy
to separate other people from their funds.
The specific combination of well-understood architectural building blocks that
make up "blockchain" is very well applicable, but nearly exclusively
applicable to all-around trustless global ledger accounting problem (e.g.
"coins").
Any other set of requirements is likely better addressed using a different
combination of elements from the broad toolset that exists across the
distributed systems platform landscape today. /fin
PS: I'm not an ideolog on this matter. If you're convinced that you need a
blockchain, I'll surely help with the communication path if asked. I have the
finest shovels.
Clemens Vasters 🇪🇺 (@clemensv)
------
cocktailpeanuts
First, I can't stand these people who qualify their logic based on "My crypto
friends say ...", "All my start friends are saying ... ", "All my friends who
are building distributed systems say ...", instead of 100% being responsible
for their own words. I see them as lazy cowards who takes other people's words
and transforms them into attention (a.k.a. retweets, viral posts, media
mentions, ad revenue, etc.)
Second, some thoughts on this specific argument. This whole thread is based on
an assumption that "skilled distributed systems engineer" is an authority when
it comes to Bitcoin or blockchain.
Except they aren't.
I would even go further to say that the very developers who are working on
Bitcoin protocol itself cannot be trusted as an "authority". They may be very
good at cryptography and coding, but it is very difficult for one individual
who has made a career out of a single expertise suddenly become an "expert" in
all things combined (economics, coding, cryptography, game theory). Especially
the economics part, if you're coming from a programmer background. A lot of
programmers seem to THINK they understand how Bitcoin works after reading an
economics 101 book, but the thing is, even the economists are never 100%
certain about their theories. There's a good reason why there are multiple
parties of thoughts in economics.
I once read a blog post from a guy who's very well respected in the Bitcoin
community who wrote a post about "crypto keynesians" and "crypto austrians",
and it was so obvious that he had no idea what he's talking about because he
got it completely opposite. The post only made sense if you interpret what an
"austrian economist" and "keynesian economist" is on an extremely superficial
and shallow level, perhaps reading a couple of blog posts or investopedia
articles on that topic.
I think people really need to be humble when they talk about this topic
because I'm pretty sure it's really hard for one person with narrow expertise
--unless she/he is very motivated to learn everything--to understand
Bitcoin/blockchain as a whole. This is especially true for those who just have
one expertise and never really delved into the rest because they think it's a
bullshit technology even before learning about what actually powers it.
And I have yet to see a single person who's dived really far into learning
everything Bitcoin is made up of and come away thinking this whole trustless
ledger thing is a fad and a bullshit. Some may get disillusioned that the
current existing solutions don't satisfy what they were promised, but even
these people still they understand that this doesn't mean the whole idea of a
trustless ledger is a sham. They would only think there's got to be a better
solution.
~~~
lapinot
Note that blockchain and economy (or more precisely _finance_ ) are two very
different things. Do not mix up blockchains and cryptocurrencies. The first is
a distributed system creating a centralized log, the second is a class of
(very classic, mostly unregulated) financial assets (which could be
constructed on top of very different architectures). I'm pretty sure this guy
doesn't even care about the financial asset thing, he is criticizing the
blockchain from a computer-science pow.
~~~
Scarblac
> Do not mix up blockchains and cryptocurrencies. The first is a distributed
> system creating a centralized log
It's a _very specific_ distributed system creating a centralized log, namely
one that absolutely rules out using any mechanism of trust. Only
cryptocurrencies need that. It does so at huge cost in terms of security and
efficiency.
------
snissn
> I have a hard time finding people in the distributed systems platform
> community who believe that blockchain is even remotely as significant as the
> hype wants to make us believe.
Right here! Take eBay or Amazon for example, the entirety of their business
can be run as decentralized smart contract software. The blockchain is a
distributed ledger whereby storing information is incentivized. It's
unbelievably significant. The scale problems will be figured out and reliable
and auditable databases will be the defacto choice.
~~~
KirinDave
We already have reliable databases. Blockchains purport to offer _trustless_
consensus. If that were true, it'd be a big deal. It's not clear that they do.
But why would eBay want a trustless consensus? Their entire business model is
around being that trusted arbiter and broker.
Even off in darkweb land, companies exist to service and broker transactions
that then fall back to the blockchain to reconcile payment. So presumably if
you were correct we'd see that model emerging.
I've looked, but the inside of Tor is a big place. Maybe you've seen an
example I haven't?
~~~
snissn
> We already have reliable databases.
not in the way that a blockchain maintains the final state and a clean audit
log of every transaction.
~~~
KirinDave
Git does this, doesn't it?
(Not that people here appreciate my contention that GitHub is a "white label
blockchain company")
~~~
snissn
Yeah that's true, and Github is really popular, I use it every day.
~~~
KirinDave
Well then: Git is a blockchain with proof of ownership for commits and it
doesn't need multiple miners or anything and you use it every day with what I
guess is acceptable risk.
~~~
Scarblac
Because it uses trust. I trust that only I can access my local Git
repositories, and that Github's authorization does its job.
Which is absolutely great, but nothing new and not what people mean when they
hype about "blockchain".
~~~
KirinDave
I find most folks don't mean anything they think they mean when they hype
about blockchain, so I like to try and inject reality.
------
ThomPete
The Blockchain is TCP/IP with History.
That's how you think about it and once you do that a huge amount of things
open up. Some of those might not make sense to the current cohort of
developers, proponents, and critics but the next coming generations will grow
up with this normalized and will find plenty of ways to use it.
The most underappreciated part of the blockchain is its ability to create a
secondhand market (not secondary) for digital assets. This means that digital
assets will be able to increase in value if ex-owned by the right person
(think an ebook who was owned by Obama. If you think this is far out I urge
you to look at the art industry to understand how things with no inherent
value gets traded for often insane amounts.
Collectors Cards (Crypto Kiddies) this is only the beginning and when I look
at the kind of things my son care about it's fairly obvious that digital
memorabilia is going to be a huge industry.
Digital Identity this is going to be the defacto standard in a few decades,
decentralized is the future.
So hate it or love it. The blockchain is here to stay and there is nothing
wrong with us not having found any real traction for it yet outside the
speculation space, it will come because the fundamental properties are sound
and useful.
It's worth spending many more billions on this to get it to to become the 2nd
layer on top of TCP ip on the internet. That's my take on it.
Edit: I'm genuinely curious. Why the downvotes? Did I say something wrong?
~~~
ifdefdebug
> I'm genuinely curious. Why the downvotes? Did I say something wrong?
"The Blockchain is TCP/IP with History" \- this is just sound bytes, noise
without any substance, technically wrong, and could have triggered most of
your readers to stop reading right there and press the downvote button.
~~~
ThomPete
The title of the Post starter isn't technically right either so that's hardly
a reason to downvote as that's not really the purpose of the articles.
Understanding bitcoin isn't about understanding the technology any more than
understanding economics is about how you technically print money.
Analogies are very important and the analogy I use isn't that wrong and not
without substance, in fact, I provide that.
I am not the only one who think of it like that
[https://www.wired.com/2015/01/how-bitcoins-blockchain-
could-...](https://www.wired.com/2015/01/how-bitcoins-blockchain-could-power-
an-alternate-internet/)
It wasn't the creator of TCP/IP that created Google, Facebook or any of the
other big companies out there and it most likely won't be that either with
Bitcoin.
~~~
ifdefdebug
You asked a question, I provided an answer. There is no point for me to
discuss this any further.
| {
"pile_set_name": "HackerNews"
} |
Migrations and Future Proofing - w01fe
https://github.com/Prismatic/eng-practices/blob/master/swe/Migrations_and_future_proofing.md
======
spoondan
This is a really good write-up.
In consulting and mentoring on this topic, I've found a lot of engineers push
back against how "dirty" it is to have multiple copies of the data around in
different formats. It feels wrong to not have a single, authoritative data
format at any given instant. If the idea is to change the column type, why not
just `ALTER TABLE ... ALTER COLUMN` instead of `ALTER TABLE ... ADD`?
But if you think about it, excepting trivial cases, once you're migrating
data, there are parallel realities at least for the duration of the migration
and deployment. It's not a question of whether you create divergence by
versioning/staging (in some fashion) your data. It's a question of whether you
manage the divergence and convergence of the parallel realities that already
exist as part of a migration. If you don't, you either incur downtime or risk
data corruption.
One big win here is that, by being disciplined about your code and data
changes, you can cleanly separate _deployment_ from _release_. You can deploy
a feature but have it disabled or only enabled for a subset of users.
Releasing a feature means enabling its feature flag, not orchestrating a set
of migrations, replications, and deployments.
------
nostrademons
When I was at Google this was the single worst problem we had in engineering,
at least in terms of engineer-hours consumed. We came up with a bunch of
solutions, a few of which (like protobufs) are open-sourced and many of which
are just in the heads of the engineers who did them, but there's unfortunately
no general solution to the problem. Sometimes I dream about a programming
language that has thought through all these issues and includes "evolvability"
as a first-class design constraint, but oftentimes these problems show up in
multi-process situations where you may be using multiple programming
languages.
------
tcopeland
When you introduce a new API endpoint or format
for data at rest, think hard
Yup. I've added columns where I've used a datetime where a date would have
sufficed and then regretted it later once tons of data was already in the
table. Or added a varchar(255) and only later realized that that wasn't big
enough. Sometimes the wrongness of a type only becomes clear down the road.
If you're designing an experimental server-side
feature, see if you can store the data off to the
side (e.g., in a different location, rather than
together with currently critical data) so you can
just delete it if the experiment fails rather than
being saddled with this data forever without a
huge migration project.
Yup, sometimes an extra join or lazy-load is well worth the isolation.
~~~
DenisM
Why is it hard to drop an extra column from a database, or to change its type?
ALTER TABLE...
~~~
taeric
It a) takes time, and b) means current code can not possibly work. Worse, it
c) means canceling a rollout is now a complicated process, due to b.
------
shykes
When we introduced pluggable storage drivers in Docker 0.7, we wanted all
existing data to work as usual (full compatibility of data at rest), but we
also wanted to migrate the layout of the legacy storage system (based on AUFS)
so that it would be "just another driver" instead of a perpetual special case.
At the same time, we didn't have the luxury of a full-stop mandatory
migration, because if anything went wrong, the upgrade would fail and the user
would be stuck in a hairy half-migrated situation. Keep in mind we are not
talking about a relational database, but directories used to mount the root
filesystems of live containers. That means that some of those directories may
be mounted and therefore unmovable. So we had to accomodate partial migration
failure, and the possibility of a partially migrated install.
So we shipped a migration routine which ran at startup _every time_ and gave
up (gracefully and atomically) at the slightest sign of trouble. Over time, we
reasoned, each install would converge towards full migration, and the huge
majority of containers would be migrated within seconds of the upgrade. The
rest would be much easier to deal with if anybody had any trouble.
Of course we had the luxury of a data structure which allowed this.
------
jamessantiago
At least for the server size, entity framework partially solves this with code
first migrations. Using the code first model you can define your data types in
code then have entity framework generate the appropriate sql code. If you
change your data structure down the road you can autogenerate a migration that
changes the database from one version to another. If you deploy a version that
is a few migrations ahead then it will execute the proper migrations one after
the other.
For the client side it's usually a good idea to specify a versioning
relationship between server and client. AWS, for example, you request the API
version you want to use:
[http://docs.aws.amazon.com/AmazonSimpleDB/latest/DeveloperGu...](http://docs.aws.amazon.com/AmazonSimpleDB/latest/DeveloperGuide/APIUsage.html)
------
tieTYT
How does Erlang deal with these problems? It often touts minimal downtime and
the ability to run updates to your code while it's running.
I _think_ that means you can have Process V1 and Process V2 running on the
same server simultaneously. If they read from the same database, won't you run
into issues?
~~~
jamii
When you update an erlang module, the vm stores the old and new versions of
the code. Calls like foo() call the current running version. Calls like
module:foo() call the latest version of that module. So typically you would
have all the control flow for a given process in one module and it would use
the module call to control when the upgrade happens. At that point it gets to
pause and migrate it's data.
The process isolation and code swap mechanisms do give you some help, but when
it comes to messages sent between processes you are back in the same boat with
API versioning or carefully ordered upgrades.
There is no real magic involved. It takes careful thought and tons of testing
to make live upgrades work. Most of the projects I worked on preferred to just
eat the few seconds downtime instead rather than risk getting the server into
some weird in-between state.
------
w01fe
Author here, would love feedback on this, and also happy to answer any
questions.
~~~
ivanceras
I saved the document for later use, but it got me thinking how ORMs like
hibernate is dealing with the migration and future proofing issues. I wrote
code libraries for a small company, in which part of the libraries design is
to allow data transformation/representation of Data Models to work on the new
database schema/changes while representing the data structure as if it were
from previous versions. So I ended up writing generators to create a mapping
of the DAO and the Models exposed to the API's in such a way that when the
database changes while you still have to support the previous version of the
API, I will only have to edit/tweak the mappers of the previous version of the
API.
The library has been opensourced here in this link
[https://github.com/ivanceras/orm](https://github.com/ivanceras/orm)
| {
"pile_set_name": "HackerNews"
} |
A Primer on Web Caching - renownedmedia
http://thomashunter.name/blog/a-primer-on-web-caching/
======
latch
Weird stuff in here...
Makes it sounds like Redis is "closer to the metal" with a lower-level API
than Memcached. Also how can you be "more persistent"...you're either
persisten or not, unless you are being cynical and saying Redis' persistence
is hit or mess?
The idea that caching results from SQL queries to disk won't, in general,
provide gains is silly. Aggregates, complex joins, high offsets, queries that
don't hit indexes and so on can all benefit _greatly_ from having the final
results cached. It isn't the network overhead that you are trying to avoid,
it's the data transformation.
There are other oddities in there.
Out of curiosity, does PHP code really still use interpolation rather than
parameters for queries?
[select...where] company_id = " . $this->db->escape($company_id) . "";
~~~
renownedmedia
memcached is not persistent, redis is, therefore, redis is more persistent
than memcached.
The framework the example app is built in provides a (poor) database library,
and that is the method for building SQL queries (I've since moved on to PDO's
parameterized queries).
~~~
latch
Ok, maybe I was being pedantic about the persistence thing, but just to be
clear, I read that in the way that you might say Julia Roberts is more female
than me.
Anyways, we'd need to find an english teacher to see if you can say it or not.
| {
"pile_set_name": "HackerNews"
} |
Inequality and Skin in the Game - danielam
https://medium.com/incerto/inequality-and-skin-in-the-game-d8f00bc0cb46#.bz1692rjs
======
dkarapetyan
> Blindness to ergodicity which we will define a few paragraphs down, is
> indeed in my opinion the best marker separating a genuine scholar who
> understands something about the world, from an academic hack who partakes of
> a ritualistic paper writing.
Self aggrandizing much?
~~~
qubex
I have difficulty appraising NNT: I find his writings erudite and his
reasoning sound, but he blows his own horn to a totally unparalleled degree. I
followed him on Twitter for a long while but eventually got banned for having
made an unappreciated statement. I wish he were easier to approach and
interact with, and didn't put so much effort into being actively hostile
towards people who broadly agree with him and appreciate what he has to say.
| {
"pile_set_name": "HackerNews"
} |
Say Hello to X64 Assembly Part 3 - valarauca1
http://0xax.blogspot.com/2014/09/say-hello-to-x64-assembly-part-3.html
======
userbinator
I think something isn't quite right with int_to_str/print; in int_to_str, each
converted char is pushed onto the stack as _8_ bytes, and while the total
length is calculated correctly in print, the result is that 7 null bytes get
written out with each char as well. What you see will depend on how your
terminal interprets them, but they will definitely be there if the output is
redirected into a file.
There's also an extra "add rdx, 0x0" in int_to_str, a puzzling multiplication
by _1_ in print, and a confusion between the standard input (0) and output (1)
fds.
------
pjmlp
Thankfully the article uses Intel syntax.
I had to port a code generation module from Intel syntax to AT&T. What a pain!
Gas is so limited compared with what PC macro assemblers are capable of.
~~~
MegaDeKay
I wrote a blog post a while back showing how Intel syntax can be used in gas,
along with a number of examples.
[http://madscientistlabs.blogspot.ca/2013/07/gas-
problems.htm...](http://madscientistlabs.blogspot.ca/2013/07/gas-
problems.html)
~~~
pjmlp
If you check a sibling thread you'll see I also had some issues with Gas macro
capabilities.
Has Gas understanding of Intel syntax meanwhile improved? It had a few bugs
when I did this.
~~~
MegaDeKay
I ported the five examples from an IBM Developerworks article on x86 assembler
[0] and they all worked fine, but didn't fool around much beyond that.
[0] [http://www.ibm.com/developerworks/library/l-gas-
nasm/](http://www.ibm.com/developerworks/library/l-gas-nasm/)
------
Havoc
I'm a little confused - why is ASM still an issue these days? Sure I can
understand some in-line ASM for hardcore speed-critical code but beyond
that...why bother? Even interpreted langs seem fast enough these days, so
compiled should def be fast enough and resorting to ASM should imo be
unnecessary.
NB the above is a personal view & I'm not a programmer by profession...so if I
missed something - no offence intended.
~~~
userbinator
As someone who reverse-engineers and has seen a _lot_ of compiler-generated
code as a result, I'm even more convinced than before that the whole
"compilers are better at generating code" mantra is a myth. The only thing
they're good at in practice is generating lots of code quickly; there are
instances when the output of a compiler manages to impress me (Intel's is
particularly good at that), but they're still quite isolated instances and the
rest of the code continues to have this "compiler-generated" look to it, i.e.
much could be improved.
It is certainly not hard to beat a compiler on speed or size (often both), and
I believe that the only ones who can't are the ones who learnt Asm the stupid
way that compilers generate code and not how the machine really works. E.g.
it's commonly taught that x86 has 6 general-purpose registers (reserving
eBP/eSP), but in reality eBP-based stack frames and the use of the stack is
nothing more than a compiler-generated artificial construct. Even eSP can be
used for something else if you _really_ need one more register[1]!
Compilers follow the rules of their source language and impose strict, often
unnecessary conventions on their output. Asm follows the rules of the machine,
which are far richer and more expressive than the abstracted simplicity of any
HLL. That being said, they have improved significantly over the years - the
days when compilers would push/pop every register on entry/exit to a function
regardless of whether it was used (or its caller needed the value preserved),
or when the start of every function could be identified by a distinctive 55 89
E5 (push bp; mov bp, sp) in the binary are fortunately mostly history.
[1]
[http://www.virtualdub.org/blog/pivot/entry.php?id=85](http://www.virtualdub.org/blog/pivot/entry.php?id=85)
~~~
pjmlp
In what regards modern processors I doubt very few humans are able to keep on
their head, what each model and micro-code firmware release is doing to their
micro-ops.
~~~
dllthomas
But sometimes you are faced with squeezing all the performance you can out of
a specific processor.
~~~
pjmlp
And then comes a firmware update to the microcode...
~~~
dllthomas
And then you apply it in testing, note the regression, and either don't apply
it in production or apply it as you push out an update.
~~~
pjmlp
Do you control all the processors your customers use?
~~~
dllthomas
If the software will be running on the machines of "customers" and you do not
"control all the processors" they use, then you're not in the "sometimes" I
was discussing above.
~~~
pjmlp
That was what I was trying to say, somehow badly I guess.
~~~
dllthomas
Yeah, I certainly didn't want to give the impression it was a _common_
situation, just that it totally does happen.
------
schappim
I think I just found the perfect use for the Intel Edison (a tiny Atom (x86) +
BLE + Wi-Fi module by Intel):
[https://www.sparkfun.com/products/13024](https://www.sparkfun.com/products/13024)
~~~
Narishma
Edison is 32-bit x86.
------
anjanb
is there something equivalent for nasm on the OS X ?
~~~
DigitalJack
yes, as someone commented already you can use homebrew. I think xcode might
include nasm too, but I'm not sure if that is still true.
There are some hello-world examples for 32bit and 64bit with nasm on osx here:
[https://gist.github.com/desertmonad/36da2e83569bc8b120e0](https://gist.github.com/desertmonad/36da2e83569bc8b120e0)
| {
"pile_set_name": "HackerNews"
} |
What one engineer learned when he stopped taking photos and started drawing - taneem
http://www.fastcompany.com/3036378/my-creative-life/slowgrams-what-one-silicon-valley-engineer-learned-when-he-stopped-taking-p
======
zeruch
This is quite cool. I actually have worked from the opposite in that I've
started taking more photos as reference for future drawings and paintings,
which in some ways has reinvigorated my tendency towards inspiration from
mundane objects and events.
| {
"pile_set_name": "HackerNews"
} |
The future of Raphters, a web framework for C. - DanWaterworth
https://github.com/DanielWaterworth/Raphters/wiki/Architecture
======
JoachimSchipper
Personally, I'd want to have a --disable-v8 option. If I'm writing a web
application in C, I must have had tight speed/memory/code size requirements; a
JSON-based v8-backed template language doesn't seem to fit very well. (Yes, v8
is pretty fast, but if it's fast/small enough for what I'm doing, I wouldn't
be using C.)
~~~
DanWaterworth
You will be able to disable v8.
~~~
vmind
Have you considered LuaJIT instead of v8? Given you are using v8 as a target
VM for compiling another language to javascript, and lua is quite similar,
although if other javascript libraries are used that could be a major factor.
(This is assuming you are writing Chrysalis/Stencil)
~~~
swah
Bump! Lua is small and sweet. Zed Shaw picked it for his framework, not _that_
unlike Raphters in some ways: <http://tir.mongrel2.org/home>
~~~
throwa_way
Specifically, the lua _jit_ implementation is known for being ridiculously
fast.
<http://luajit.org/performance.html>
<http://lua-users.org/lists/lua-l/2009-06/msg00071.html>
~~~
silentbicycle
Normal Lua's performance is also quite decent (especially compared to its
peers: Python, Ruby, and Perl), and has a very clear path for moving hotspots
out to C. LuaJIT's performance is just a bonus. :)
------
JoachimSchipper
Previously: <http://news.ycombinator.com/item?id=2407334>. The author seems to
have taken a good look at some of the suggestions given there - or am I just
imagining that?
~~~
DanWaterworth
Yes, I've certainly studied the suggestions made in those comments. This
design document represents a sharp change in design.
| {
"pile_set_name": "HackerNews"
} |
What's the hardest part in the job searching process in the tech industry? - aginovski
======
duxup
Making meaningful contact with someone on the other end who is TRYING.
Most contacts I have with recruiters of all types involve indications they
haven't read my resume (or anything about me) and effectively are a sort of
"cold call" situation where they know nothing about me compared to the job.
I feel like there is a whole recruiting business of creating busywork for
themselves.
I'm inundated with folks contacting me on various services (most are turned
off as I'm working), and most every contact was a waste of time for me the
last time I was in contact with anyone.
For a given job the real technical decision maker probabbly could give me a
thumbs up or down in a matter of seconds as far as the first filter goes, but
instead you dance around with various other people first for what could be
hours for no good reason.
~~~
rboyd
best story I've read about these gatekeepers
[https://www.reddit.com/r/cscareerquestions/comments/ayep7t/a...](https://www.reddit.com/r/cscareerquestions/comments/ayep7t/a_hr_rep_asked_me_if_i_had_any_experience_with/)
------
samfisher83
Going through the interviews. You have to waste a day + study time doing it.
If you have 4 interviews in a week that is 4 days you have to burn.
------
logari
The hardest part is actually having your resume read by a human decision maker
who is not HR,agent, jobsite, middleman, etc.
To do so, your resume must look flawless. And impressive. Both content and
form. For form, try Latex.
Then find the decision maker and send email directly. The job sites are
useless.
------
JSeymourATL
Hands-off Managers and Department Heads -- who are largely uninvolved in the
hiring process.
Especially true for large companies, they've abdicated this responsibility to
mindless, soulless HR flunkies.
~~~
duxup
"Well you've got all the technical skills we listed but I don't see this
random file format we added on so ..."
~~~
peteradio
You don't know jason?
~~~
duxup
One of those things you don't think to mention, but should.
How much alphabet soup makes sense to list?
------
world32
Nothing, its always been easy for me to get jobs as a developer, I don't
understand people that find it difficult. If you have at least one years full-
time experience and are competent on the job then most companies I've known
will be desperate to hire you as there is such a huge shortage of good
developers.
Sorry if thats conceited.
~~~
wolco
That's what I thought until I tried to go remote.
There isn't a huge shortage. If there was they would take on people with
proven skill in related languages and train. There is a shortage with
developers with 3-5 years experiencd having the exact stack the company is
looking for.
~~~
world32
Interesting point. I have stuck with the same stack for about 6 years so maybe
this is why I find it easy to get jobs?
As for remote work, the majority of the jobs I've had have been either fully
remote or partial - like between 1-3 days a week in the office, the rest from
home. Never found any difference when applying to remote jobs myself.
------
gcheong
Trying to find the motivation to prepare for the arbitrary algorithm
interviews when you believe on principle that this is just the wrong way to
hire.
------
christopher8827
When recruiters barely take a look at you because you didn't go to Stanford or
some elite uni.
Job interviews with too many interview rounds.
~~~
neuroticfish
>When recruiters barely take a look at you because you didn't go to Stanford
or some elite uni.
Is this only a problem on the West Coast or applying at FAANG-like companies
or something? Neither myself nor anybody I know has ever had such an issue in
the South, Midwest, Northeast, or on the East Coast.
~~~
christopher8827
Really? I went to uni in Australia but I get passed on by HR because they are
looking for someone with ‘US experience’.
| {
"pile_set_name": "HackerNews"
} |
Orwell’s Last Neighborhood - anarbadalov
https://theamericanscholar.org/orwells-last-neighborhood/
======
ptah
Jura is certainly interesting [https://www.scotsman.com/arts-and-
culture/music/why-did-the-...](https://www.scotsman.com/arts-and-
culture/music/why-did-the-klf-burn-1-million-in-cash-on-scots-island-of-
jura-1-4275820)
------
situational87
Of all the sci fi I have ever read I continue to be amazed at how perfectly
Orwell could see the future. Forget this island, someone needs to research the
question as to whether or not he was a legitimate time traveler.
| {
"pile_set_name": "HackerNews"
} |
Ask HN: What are the roadmaps to becoming a kernel dev or Security analyst? - sigkrieger
======
n_t
I can speak only for kernel development part of question. Assuming your
question is about Linux kernel -
1\. You must have good systems understanding, and I assume you already know
basic computer organization/architecture. Read Robert Love's Linux Kernel
Development to begin with.
2\. Start dabbling with small device drivers. Use Linux Driver Development, or
other such books.
3\. Pick a small subsystem within Linux (say, a specific driver, or
filesystem, or PCI, etc) and start reading it's mailing list like a religion.
Initially, it wont make sense but keep pushing - whatever you don't
understand, read about it, find it's code, ask questions (usually on IRC,
avoid mailing list for asking introductory questions).
There are many resources these days about kernel in general and not
necessarily Linux kernel. You can read/use those. Best way, as with any other
field, is to get involved - either by getting into a kernel dev team or taking
up a small project.
Be aware that unlike other domains, in kernel development, significant time is
spent in learning/understanding underlying system (hardware, system
architecture, etc) and amount of code written in comparison to learning, is
very less. Also, a decade ago, kernel team was considered as elite team in
company. These days they are just sustenance team in most companies (exception
may be Intel, AMD, 1 or 2 teams in Google/FB/Apple and few other companies).
Also, I feel being kernel domain reduces your scope in corporate world (it's a
separate topic). However, kernel devs are still quite paid well due to
shortage of expertise in this domain.
For Security analyst, just like kernel dev, one needs to understand system
very well. Having good grasp of system, underlying architecture in hardware or
in memory, does help significantly but I dont think kernel development
background is necessary.
~~~
hacknat
Also, very few people are _only_ kernel devs. Usually you can be an advanced
systems programmer and ease your way into creating kernel features or fixing
bugs as you need. The market for people who can do that is large and
desperate.
------
anitil
Without more information about you it's hard to really say. As an example -
what are you interested in? Do you like hardware?
I got in to kernel development by basically being the only person willing to
do it when it was needed. But I'd already done a heap of kernel work as side
projects, and was already working as an embedded developer.
I know some people get in to security by breaking systems, but I don't know
enough to say any more.
------
jonahbenton
Those have very different skill domains, workdays, future trajectories.
------
badrabbit
Are you sure you know what a Security Analyst does? Few things in IT are as
different as those two roles.
For one you need minimal communication and interpersonal skills as a ker el
dev,it's the opposite as a Security Analyst.
Security Analysts do different things based on the company. This can include
SOC work,vulnerability management,incident response and threat hunting. It all
depends on the size and scope of the security departments.
Let me give you two analysts at different companies for an example:
Bob spends 40% of his time responding to SIEM events which include IDS
alerts,firewall alerts,AV and endpoint ATP solution detections as well as
suspect windows or linux system events. He knows some malware and network
traffic analysis to do his job but most importantly he understands the various
paid and free tools needed to do his event analysis work. 30% of his time is
spent on reviewing suspect phishing emails and reported security issues. The
rest of his time is down time or he processes and documents indicators of
compromise for known current threats. He does little to no coding. The
security department is well resourced and matured so he does not need to
manage vulns, do incident response or other pesky tasks.
Enter Analyst 2,Alice. Alice also handles some SIEM events but maybe 20% of
her time. The company is either too small or has too much of an immature
security department to have 24/7 monitoring,they either outsource SIEM
monitoring to a MSP and only look at confirmed true positives or they just
don't see enough SIEM events to care for 24/7 human eyes. Alice attends a lot
of meetings with security vendors and internal teams. She works on various
projects but also handles threat intelligence,vulnerability scans and incident
response which all takes up 70% of her time. Phishing emails,threat intel and
hunting are all done on left over time. Alice might do coding but only as a
last resort.
These are just very vague examples but even if you work for a security
vendor,the work in some shape or form involves these types of tasks. Now, A
dedicated malware analyst for a security company can reverse engineer malware
all he wants and do write ups. A security engineer might do sysadmin-ish work
and integration coding. A pentester or red teamer might do presentations and
occasionally pentest but these are not typically described as a "Security
Analyst" roles,they are more or less infosec roles one gets after getting
their feet wet elsewhere in infosec(Like with alice and bob).
To answer your question: there are generally two paths you can take. The
traditional path, where your passion for infosec and a well rounded IT
experience is valued above all else or the latest trend which is to recruit
people with a formal infosec degree. Either way works at least for now. If you
have any kind of a technology degree you're fine,else one never hurts.
A few years of working in IT ops is generally recommended before an infosec
role.This isn't because you can't learn stuff in a lab but having context
around events and knowing how IT is operated is very important for analyzing a
security event or when responding to an incident.
I went on longer than I should have but I figured someone else might read this
and find it helpful.
Helpful links:
Att&Ck framework:
[https://attack.mitre.org/wiki/Main_Page](https://attack.mitre.org/wiki/Main_Page)
NIST pubs (there are a few more out there if you care to duckduckgo):
[https://www.nist.gov/publications/computer-security-
incident...](https://www.nist.gov/publications/computer-security-incident-
handling-guide)
[https://csrc.nist.gov/publications/detail/sp/800-40/version-...](https://csrc.nist.gov/publications/detail/sp/800-40/version-20/archive/2005-11-16)
Traffic analysis excercises:
[http://malware-traffic-analysis.net/training-exercises.html](http://malware-
traffic-analysis.net/training-exercises.html)
A good awesome list that does a good job of what I'd say a security anaylst
needs to know;
[https://github.com/0x4D31/awesome-threat-
detection/blob/mast...](https://github.com/0x4D31/awesome-threat-
detection/blob/master/README.md)
Others here can probably answer the kernel dev part better than myself.
Although,the Linux kernel newbies(janitors) site and mailing list might be a
good place to start asking. I liked the linux device drivers book as
well([http://www.makelinux.net/ldd3/](http://www.makelinux.net/ldd3/))
Last word - evaluate your life goals carefully and rationally. Happiness isn't
everything. It's nice to pursue what makes you happy and passionate now but
finances,responsibilities and other life factors should be considered. I am
not saying this as a discouragement but as a practical advice. The person who
loves tearing apart malware or writing a kernel patch on his free time might
some day start thinking family time and time spent taking care of one's self
is more desirable and this might conflict with career goals and make hiring
managers think "Oh,he doesn't have a malware analysis lab at home and I don't
see him posting malware write-ups done on free time. He/She doesn't have
passion for the work." \-- tangentially, maybe this is why you don't see as
many women in infosec as other IT sectors? Might get me downvotes but like it
or not, women who choose to have a family have a harder time "Breathing,eating
and drinking security" (or as I say, maintain an unhealthy work-life balance
that benefits employers)
Hope I helped.
------
egberts1
Linux Device Driver, by O’Reilly
| {
"pile_set_name": "HackerNews"
} |
Job applicants over 40 filtered out by employers - fraqed
https://www.uu.se/en/media/news/article/?id=9014&typ=artikel
======
zebraflask
I just turned 40. There is an unfortunate grain of truth, especially among
start ups, but it would be a mistake to think the situation that dire.
I am constantly pestered by recruiters and companies to interview. I think one
of the things that helps is that I trimmed my resume to omit material older
than 5 years, removed unnecessary dates, and I make a point of drawing
attention to studying for new industry certifications. It probably doesn't
hurt that I stay physically fit, either. As cruel as it may be, if you're out
of shape and look "frumpy" or "run down," that will count against you far, far
worse than your age.
The key is to make the age factor irrelevant by not drawing unnecessary
attention to it or by projecting a stereotypical "middle aged" image. We can
argue all day about whether that's fair or not (it's not), but you have to do
what you have to do.
~~~
arvinsim
> It probably doesn't hurt that I stay physically fit, either. As cruel as it
> may be, if you're out of shape and look "frumpy" or "run down," that will
> count against you far, far worse than your age.
I am still in my early 30's but this really resonated me. All my life I have
been conditioned to think that character, experience and expertise is what
matters.
But the reality is that people will form impressions of you by they first 5
seconds they meet you.
~~~
Kluny
Once they get to know you and your work, looking frumpy or whatever becomes a
much smaller factor in their opinion of you. But the first impression is often
what determines whether they will get to know you or not.
------
sandoze
I might have 'lucked out', I'm 41. I under performed in my 20s (it was the 90s
after all and the bubble burst just as I was gaining momentum in the market)
and received my college degree at 30. I assume most people who see my resume
consider me 8 - 10 years younger than I really am. Doesn't hurt that I hit the
gym and haven't gone gray yet. I went the mobile route (iOS) and haven't had a
pay cut in 8 years (currently 200k+ living in the mid-west). Not without its
ups and downs, I tend to not get hired at start ups, maybe those 20 somethings
smell something is up, but fortune 100s are quick to give me an offer letter.
With age comes maturity. It's allowed me to get along better with my co-
workers (so many upper 20s, lower 30s tend to be a bit... hot headed) and I'm
not afraid to negotiate. The older I've gotten, the more comfortable in my
skin and in my skill set I've become.
If there's ageism I've yet to experience it and I've worked with people well
in their 50s doing mobile. It comes down to who you're working for, what your
skill set is, timing and, in my opinion, health. You've got to stay healthy
and look healthy! Also, I tend to prune my resume, no one wants to see your
experience 8+ years ago.
Or maybe it's all luck, ask me in five years what I think when Objc/Swift goes
the way of PHP, I might be singing a different tune.
~~~
zerr
> currently 200k+ living in the mid-west
Is this an employee salary or contracting/consulting income?
~~~
tooltalk
I'm not sandoze, but the figure seems reasonable for folks with 20 years of
experience. Most of my buddies make about that much (plus 25% to 50% bonus) in
NYC. I make slightly less than that.
~~~
pc86
NYC is slightly more expensive than the mid-west.
I can say that I live in an area closer to the rural mid-west than NYC, and we
consistently see 1-year contract rates for iOS developers in the low $200's,
up to $280-300k if you have 8+ years of relevant domain experience (again
1-year contracts). If sandoze is consulting $200k is 100% reasonable. If
they're a full-time employee, $200k is pretty high but definitely possible
with their experience.
------
notadoc
Harsh and an obvious problem for those over 40 and industry in general, but is
this simply the natural result of companies optimizing for maximum
productivity at the lowest possible cost to them?
Many 40+ year olds have families or other life obligations outside of work,
and thus they may not be as willing to put in absurd hours that a young
employee could be squeezed for. The older employee also might be more likely
to take weekends off, and want to use vacation time.
Additionally, someone over 40 is supposed to be in or near their peak earning
years, which lasts ten to twenty more years (or did historically anyway) so
their expenditure is going to be significantly more than someone with a few
years of experience.
I realize it's one of the lamest analogies possible, but for many companies,
employees are quite literally a cog in a larger machine, and so they want the
cheapest possible cog at a reasonable quality level that works the longest
before breaking down (quitting, getting fired, burning out, etc).
To fight this, I'd bet those over 40 would have to aim to get into important
management and executive positions, which are less likely to be swapped out
for less experienced, less demanding, and cheaper labor.
~~~
nhebb
> Many 40+ year olds have families or other life obligations outside of work
Why is this a (seemingly) common belief? It seems backwards to me. I had a lot
more obligations outside of work in my 20's and 30's when my kids were young
than after 40. I'm in my early 50's, and I have more free time now than ever.
~~~
arthur_sav
I'm in my mid 20s and i don't know any friends my age with kids.
It's just not very common to want a family before 30.
~~~
scott_karana
Not sure why people downvoted you... "mean age of first time mother" is
climbing and is nearly at 30 years old in most of the developed world now.
[http://time.com/4181151/first-time-moms-average-
age/](http://time.com/4181151/first-time-moms-average-age/)
[http://www.statcan.gc.ca/pub/11-630-x/11-630-x2014002-eng.ht...](http://www.statcan.gc.ca/pub/11-630-x/11-630-x2014002-eng.htm)
[http://www.huffingtonpost.co.uk/2016/03/09/pregnancy-
around-...](http://www.huffingtonpost.co.uk/2016/03/09/pregnancy-around-the-
world-age-of-new-mums_n_9416064.html)
------
pleasecalllater
That's hilarious. In medicine, a 30-year-old MD is too young to make some more
complicated operations alone. In IT a 30-year-old programmer is just too old
to be hired.
The funniest interview I had was with some blonde girl in her twenties, who
read through my CV and said: "Oh, you see. We cannot send your application to
our client. You see, here I have hundred of applications from people at your
age, who are managers in their thirties, and you are not. There is most
probably something wrong with you." And it was a position for a programmer,
not a manager.
And it was when I was in my early thirties, not forties.
Currently, I'm almost 40, and I seek only for remote work (family issues). I
have been paid for programming for the last 14 years. I had different jobs
like sysadmin, dba, programmer; using over 10 different languages.
And despite all that searching for work is really hard. Usually, it stops at
the recruiter who is only interested in an answer to "how much do you want to
get?". After that, there is no counter offer, no negotiation, nothing.
Sometimes there is an answer like "you want too much, but don't negotiate at
this recruitment step".
When I get to the technical part of the interview, I usually get some Yeti-
Level programs to write. Yeti-Level, because you are not going to write
anything like that in those time restrictions in that jobs. A good example is
implementing a program which gets input from a file, in the input, there are
domino tiles, and a function needs to match them and find the longest chain...
all must be super optimized from the beginning. And you have 5-10 minutes to
do everything, including reading the task description, examples and writing
tests.
The funny fact is that this company is searching for candidates for months.
The sad fact is that due to such strange recruitment process, good old
experienced programmers will starve.
I really think that I did very bad choice with my career. There are so many
other jobs where people are not removed because of age, and experience is
really appreciated. In IT you just need to accept that companies want young
inexperienced kids, who want to get little figures, but a game room is a must.
~~~
jbreckmckye
> I really think that I did very bad choice with my career.
Sadly, I have come to a similar conclusion: tech is a great way to earn money
early (because the wages rise quickly), but the ceiling hits early and is
quite hard to break through. Use those early years to save up money, then
switch to something else.
~~~
mcv
My early years I was terribly paid. It's only recently (since I became
freelancer, in fact) that I'm making decent money.
~~~
c12
I worked with a freelancer once when he was brought in to help pick up the
slack due to two people going on paternity leave, guy was being paid more per
day than the two guys were getting in a week.
Contract work has interested me since then, but it looks like a real hard slog
to get good income.
~~~
mcv
My first year I made € 8000 (though that was mostly due to trying to make my
own product). I recommend building a buffer before you take the leap, though
once I'd had my first big project, it's been fairly smooth sailing.
------
ThomPete
I am 43 I know this is true. Even for people in their thirties.
This is why I decided to start my own company again after 4 1/2 years at
Square which was probably the last time I ever would be working for someone
else.
This way age becomes an asset rather than a liability.
~~~
tcbawo
I've often wondered whether this industry is similar to Hollywood with its
ageism. Once you get in, there are often many roles available. But at some
point, you need to start creating roles for yourself (if you can).
------
badsock
I don't understand why everyone bought the idea that we don't need unions
anymore.
This is exactly the sort of thing they make better.
~~~
kjksf
Citation required.
A union won't make a company hire you. Whatever power union has, it comes
after signing on the dotted line, so that particular problem would not be
solved by a union.
Unlike police or muni drivers or Detroit auto works, programmers are among the
most frequent job changers.
Other than Hollywood unions (where main benefit, as far as I can tell, is
ensuring that you don't get taken advantage of too much at the low end thanks
to minimum wages etc.) is there any example of a union for a profession where
you change your employer every 2-3 years?
~~~
dec0dedab0de
_is there any example of a union for a profession where you change your
employer every 2-3 years?_
I know a few construction workers who essentially work for the union. A
contractor will get a job, and they'll contact the different unions and say
they need people to get it done.
~~~
fludlight
The unions in construction also provide continuous training for their members,
and good training to boot. I've had real estate developers in NYC tell me they
won't do foundation work with non-union labor because it's so important to get
it right the first time.
~~~
Johnny555
Though the drawback is that union workers tend only to want to work with union
workers. So you can't go with the union workers to do your foundation, and use
a non-union contractor to do other work.
An employer I used to work for found this out the hard way when word got out
that they had hired a non-union carpenter to do some custom cabinetry on an
office build out (he was an expert craftsman who was not cheap, so it wasn't
done for cost savings).
Suddenly it got very hard to find workers to finish the electrical and
plumbing work.
~~~
gaius
_Though the drawback is that union workers tend only to want to work with
union worker_
That is the whole point... a worker's only leverage is to withhold labour. As
an individual that is insignificant but en masse...
------
SOLAR_FIELDS
Since it is not legal for employers to require you to give your age as part of
an application, doesn't this simply encourage candidates to lie about their
age? One way that age is given away on resumes is to look at work history or
date of college graduation. In lieu of the current situation, is it not
advisable to simply not give the date of graduation and only provide the
previous 5-10 years of work experience on resume?
It isn't a perfect approach, but it makes it more difficult to discriminate
since by the time you have a face-to-face interview with the employer you are
already well along in the interview process.
~~~
brooklyn_ashey
It is difficult to hide your age. LinkedIn makes it impossible. If you want to
be competitive, you need to share your accomplishments. If they are actual
accomplishments, they are Gooogleable in a simple search anyhow. Hiding your
age by leaving off dates says, "Hey! I'm old enough to hide my grad dates!"
(which means you are now over 30) This culture is not helping itself. We all
need to find the bravery to stand up against this at every age, because, I
hate to break it, every person under 30 on this forum will be over 40 before
they know it. I sure hope it finds them at the very tippy top of their career
game. Our economy doesn't look great right now. Best of luck finding that
chair before the hip-hop stops.
~~~
zeckalpha
I am under 30 and do not list my graduation date.
~~~
brooklyn_ashey
you may want to start listing it and take advantage of the ageism in your
favor while you can. :) I had a 28 year old friend who was getting botox a few
years ago. I could not believe it; they looked so young to me. They told me I
didn't understand how bad it had gotten in NYC. I thought they were nuts. Now
I see why they were freaking out. This climate is so unhealthy. If we thought
we had real problems with body image and eating disorders--- I fear the level
and scope of mental illness this kind of youth-loss anxiety tech bro culture
will deliver unto us as time passes and we do nothing. This plus body image
plus some of the social issues that come these plus drugs plus work only
social circles seems like a recipe for a kind of health crisis epidemic
that---- we totally see this coming and are doing nothing about it. In fact,
we are still convincing many of our own on this very forum that its even a
problem even as Chinese workers are facing overworking themselves to death as
a health crisis.
~~~
zeckalpha
Thanks for the advice, and it may hold true in some markets but in my market
I've been seeing ageism affect the young, too.
------
justboxing
> In the study, the researchers sent more than 6,000 fictitious job
> applications to employers who had posted job ads for administrators, chefs,
> cleaners, restaurant assistants, retail sales assistants, business sales
> agents and truck drivers to then compile the employers’ responses, such as
> invitations to job interviews.
Not trying to be in denial, but all these jobs appear to be blue collar jobs
(assuming "administrators" is office admins and not Sys Admins / Network
Admins :) .
Any data on whether this happens in our Tech / I.T. Industry, where every
other month, you read a story on severe shortage of skilled tech workers
everywhere?
~~~
tooltalk
I have to concur with you. I've been hearing about this death at 40 thing for
decades and I think it's a bit blown up, especially in IT field. There were a
lot of folks warning about this even during the dot com bubble when there was
very severe IT labor shortage.
In my 20 year IT career -- and I've worked mostly in tech/finance in the NYC
area -- the only downturns I noticed were during the most extreme financial
crisis, such as the dot com bubble (2001 -- I was at an internet startup) and
the housing crash (2008 - I was at Merrill). Most of my buddies in my age
group are doing quite well. Even those non-technical folks who used to
complain about the age discrimination two decades when they were in their
20's, are now employed in semi-technical jobs.
Now, I'm pretty sure that the age discrimination is real in other industries,
but it's still quite difficult to find qualified, experienced candidates in
IT, regardless of age.
~~~
user5994461
The finance industry is much nicer than the web industry, when it comes to
aging.
------
nether
"You know what they do with engineers when they turn 40? They take them out
back, and shoot them." \- Primer
~~~
ronilan
This reminds me of the off topic question I always had about YC - "if it is an
incubator for fungus - is it valuable?"
~~~
cyphar
"And there was value in the thing, clearly, that they were certain of. But
what is the application? In a matter of hours, they had given it into
everything from mass transit to satellite launching, imagining devices the
size of jumbo jets. Everything would be cheaper. It was practical, and they
knew it. But above all that, beyond the positives, they knew that the easiest
way to be exploited is to sell something they did not yet understand."
I've always been quite impressed by the writing in Primer. The dialogue is a
massive departure from the clean world of Hollywood but it makes it feel far
more frantic but also real.
------
tomohawk
In government contracting, the jobs can be hit or miss. There's some really
good ones and some stinkers. They usually pay based on experience. Jobs
requiring 20+ years are of course more rare than ones requiring just a degree
and no experience. A buddy of mine who's 60 decided he'd take an entry level
Java job for a few years after being in a challenging senior architect role.
The pay is less, but he loves it.
Part of the challenge of getting a new job after 40 is deciding whether it
really matters whether you're making the same or more $$ in the next job or
not. Many people are unwilling to take a pay cut when they have 20 years of
experience, even though the job only requires 5.
------
Keyframe
Time for some heavy stick and penalties, laws exist:
[https://en.wikipedia.org/wiki/Employment_discrimination#Lega...](https://en.wikipedia.org/wiki/Employment_discrimination#Legal_protection)
Challenge is to prove it.
~~~
fludlight
An employment lawyer chimed in on this in another thread. Apparently
discrimination laws are generally only enforceable at the end of employment,
but discrimination is much more prevalent at the beginning. It's much harder
to prove that some didn't get hired for a prohibited reason than it is to
prove they got fired for one.
------
krapp
Welp. Guess it's freelancing and minimum wage shift-work until I die, then.
~~~
itg
Sometimes I really do wish I went into an industry where experience matters,
such as law or medicine.
~~~
collyw
Someone needs to clean up the crap left by all these 20 somethings.
We have 3 developers all nearly or over 40 cleaning up the mess done by
someone who appears to have been in his early 20's. The system works, but it
could have been done with a fraction of the complexity.
------
awacs
I left my former industry at 40 (now just over 3 years ago), bootcamp'd and
got into dev and it was the best thing I ever did. I've been gainfully
employed since the move and love my current job. I can't say it wasn't a lot
of work, and yes I feel the competition of the young folks, but it is what it
is.
~~~
daxfohl
Congratulations, and welcome!
------
ErikVandeWater
How did they actually test this? Without details, there is no new information.
As well, do we know that there are no confounding variables in these findings?
As a hypothetical employer I might think these roles are lesser roles, so if
you are older I would wonder why you had not been able to secure a greater
economic situation.
Second, as consumer facing roles, attractiveness is a benefit, with those over
40 having less of it. It is not discrimination on the basis of age, but
attractiveness that would be the cause.
~~~
SOLAR_FIELDS
This is a tough one, because it's rooted in reason. The employer asks
themselves "This guy is applying for an entry-level or junior role at a very
senior age, why are they doing so? I must be on guard for potential problems
because if this guy is still applying for these kinds of roles at this age
there must be something wrong with him/her".
The worst part about this is that it's somewhat rooted in truth in a lot of
cases - but it shouldn't be a preclusion to an interview at least. I try to
view things as objectively as possible and give objective examinations to
avoid this kind of bias.
With consumer-facing roles, I think that is an acceptable bias to have. After
all, the courts have ruled that Hooters can discriminate on basis of gender
for their consumer facing roles (not back end such as chefs though). For joe
schmoe engineer that only writes code and rarely/never talks to the end user
though there is no excuse.
~~~
Broken_Hippo
I don't agree that most consumer-facing roles should be able to discriminate
in such a way. Does it matter if your wal-mart cashier is older or younger in
the same manner that it does at Hooters - or any other establishment that is
based on looking at people?
I'd argue not. Hooters - and modeling agencies, nudie bars, and so on -
actually have a business based on how their employees look. Stores, offices,
and so on? The truth is that it doesn't matter. Unlike Hooters, they wouldn't
lose a large base of their customers.
------
daxfohl
I didn't have too much trouble last year at 41. Took a couple months to get
any traction at all, but then suddenly got a few interviews and eventually
some offers all in quick succession. Maybe I was lucky though. After reading
this story I'm definitely more inclined to stick with the position I have
rather than to try to go out on my own again.
Another talking point: the trend of waiting until late 30's to have kids
greatly compounds this problem.
~~~
tootie
I've been actively searching the last few months and my resume is getting
rejected on sight despite many years of experience doing exactly what the
requirement states. I honestly don't know if it's agism, their expectation
that I'll demand more salary or It's just written poorly.
~~~
ams6110
When you're past entry level, you need to be getting jobs through your network
not by cold-calling or submitting resumes in response to ads.
I've changed jobs three times since I was 40, but in all cases I knew people
at my new employer who could sell me internally.
I don't think it's so much age as it is that employers don't want to take as
much risk on an unknown person for more senior level positions.
~~~
tootie
It's how I got my last job. I haven't actually been hired off my resume in 10
years. Almost all of my network today do the crap I'm trying to get away from.
~~~
daxfohl
OP here. FWIW I got my leads entirely off of spamming my resume around. For
the prior 15 years I'd done freelancing for local companies and had a few-year
stint in a small company, so didn't have a network. I was in small-town
Michigan so once freelancing dried up I knew moving was going to be a
requirement. Thus I was able to spam the whole country. That probably helped
my cause a bit.
I noticed you mentioned LinkedIn in another thread. FWIW I don't have an
account and it didn't appear to hurt me.
------
Banthum
>A questionnaire study directed at a selection of employers shows that there
are three characteristics that the employers consider to be important and are
worried that employees over the age of 40 have begun to lose: the ability to
learn new things, being adaptable and flexible and being driven and taking
initiative.
Open question - is there any research on to what degree these three worries
are true?
~~~
kem
Not really an expert in this particular area, but the research I'm aware of
kind of suggests if anything the opposite is true, depending on what you mean
by "the ability to learn new things."
There's some cognitive decline, but it tends to start after 25 or so, and it's
mostly associated with slowed speed per se rather than learning ability.
There's also some controversy in that the declines might be associated with
serious health conditions, that are associated with age, rather than age per
se.
The other things you mention either stay the same or increase with age, which
strikes people as kind of counter-intuitive, which speaks to stereotypes
people have.
------
xiaoma
For founders who are fundraising, it's even more extreme.
Job applications generally don't and possibly can't ask about age, but it's a
required field on applications for YC or other incubators.
~~~
ddebernardy
That's extremely curious, if it's indeed the case, because older founders tend
to succeed more often than their younger peers.
~~~
xiaoma
For a investor who funds many businesses, EV matters much more than hit rate.
TBH, for an early investor, a success rate of over 20% is possibly a sign of
being too risk-adverse.
------
noncoml
So, age discrimination is not tech specific, but unlike other industries, tech
workers change jobs much more often and that creates the illusion that the
problem is more tech industry related.
------
prawn
With general increases in the age to receive a pension (increasing six months
every two years in Australia), but challenges in finding employment, what
bridging options are there? What's the landscape going to look like for 50
year olds if re-skilling after a lay-off doesn't always help?
------
alanfranzoni
There's ONE thing that really amazes me. A lot of people around the world -
not just in Europe or in US - keep speaking about talent crunch, STEM
shortage, etc, as an emergency... so, if this research is not flawed, the real
issue is that such talent is just ignored at 40?
~~~
gedy
They only say that to loosen immigration for cheap, visa-dependent developers.
~~~
brooklyn_ashey
Thank you for saying that. The Elephant was just sitting on everyone's face.
------
justin_vanw
It's very hard (if not impossible) to avoid being biased when reading resumes.
Personally I would strongly prefer that resume's I review were anonymized and
all hints that might bias me were removed before any decisionmaker see's them
or they are filtered. This could help more women and minorities get a foothold
at that step in the process (I mean generally, not with me specifically).
However, while relatively simple censoring of resumes would remove some bias
from review, such as race (can often be hinted at by the name or university
attended), gender, etc, and it would prevent googling of the person's name,
age is extremely hard to hide. You can see a person's job history, which is
generally will tell you their age within +-5 years. One partial solution might
be to only list job history for the previous 10 years and remove the year a
degree was earned, but relative seniority at the beginning of that 10 year
work history will still be a very effective proxy for determining age.
So, unfortunately I think we can't hide age in an effective way without
removing critical information from a resume (removing everything else we can
that can be removed _should be removed or hidden_ ), but I think it's
interesting to speculate on why older workers will be filtered out. I suspect
it is a belief (or intuition aka unconscious belief) that someone applying for
junior or entry level positions when they are > 40yo is correlated with
'something being wrong', since if there is nothing wrong you would have
expected them to have reached a point in their career that they no longer have
to blindly submit resumes for these kinds of positions.
I wonder what would happen in a study like this if the resume's representing
older hypothetical candidates included some kind of cover letter explaining
the situation. For example, saying that they started out working at a bank for
15 years but they found a passion for cooking and that is why they only have 5
years of experience as a chef. My guess would be that not only would this undo
the bias against them, but you would find a strong bias towards them (just a
guess).
------
myro
My father, 60 y.o. engineere, in a few months retiree, asked me how to find a
reliable freelance basic lvl jobs. The thing is, the country just passed a
couple of recession periods, and the retirement program, the country is going
to greet him with is around usd100/mo. What obviously is not enough to cover
expenses. To find a local job at such age and at that economical situation us
just not worth time and effort. And there are literally millions of such as
him. I personally will probably not receive any pension at all (currently
32yo.).
------
gexla
> In the study, the researchers sent more than 6,000 fictitious job
> applications to employers
Might this be a clue?
Any job application which is in the reaches of an automated process must be a
joke endpoint. How many other automated applications do they get selling
employee skills, sex, penis enlargement pills, fast loans, malware and other
trash.
Disclosing information should be the first "BS" smell for a job. I'm often
well into getting work done before the person I'm working with figures out how
old I am, where I live or other personal details. Granted, that's freelancing.
I live in the Philippines where the age requirements are actually advertised.
And these ages seem pulled out of a hat. And I get the sense that people
running the show at all levels couldn't tell their asses from a hole in the
ground. It's a pleasant surprise to find someone who seems competent at
convincing you that there's some purpose for them taking up a spot at that
spot or role they are taking up in a serious time commitment out of their
life.
Clearly the hiring process is just as broken as everything else. Why expect
that hiring is going to be significantly more awesome than the rest of the
system?
Don't interact with machines. Get to know real people. Show people what you
can do. Preferably find people who tell you they could use your help rather
than you telling them that you need a job. ;)
------
empressplay
Have a side project in an en vogue "cutting edge" framework or language, and
they will care much less about how old you are.
------
geodel
I am unable to reconcile these facts that life expectancy keeps rising and
jobs opportunities keeps falling. Government across the world in low/mid or
sometimes even high income countries are already running huge budget deficits.
So they are not going cheap/free amenities to jobless masses when even people
with jobs are finding things expensive.
------
chiefalchemist
Is there (age) discrimination? Of course.
That said, there are qualifications and there's "fit." The more experience you
have, the stronger the signal on what you might (or might not) enjoy.
For example, if you're 40+ and most your resume says startup, do you really
expect a blue chip international to be interested in you? Do you really want
them to be? Sure, maybe YOU really need a job. But history probably shows
you'll leave as soon as you can land another startup opportunity.
Again, not doubt there's bias in the hiring process. But bias can have a
purpose. And sometimes you have to live with the depth and breadth of your CV.
------
EternalData
This is why employment-based purposefulness of life is so dangerous -- I think
it is nothing short of a tragedy that the way society is set up validates an
utter hopelessness if you are not employed, this despite the fact that there
may be structural factors arrayed against you. I've seen it almost chew up my
father and I want to resolve that it'll never happen to me, but I know so long
as structurally employment remains the default badge of worthiness in a
capitalist society -- that it will come to pass for me as well.
------
ruleabidinguser
Whats the logic here? Are applicants >40 generally worse performers?
~~~
hackits
No one has mentioned that sometimes older people don't fit into the culture of
the business.
~~~
ThomPete
So funny to be called older people when you are 43 and party with the best of
them. Anyway.
This is why I decided to start my own company again after 4 1/2 years at
Square.
This way age becomes an asset rather than a liability.
~~~
flukus
How do you recover? I'm only 33 and while I can still party with the best of
them it takes it out of me. No more $1 drinks until midnight on Thursdays and
being back at work at 8am.
~~~
ThomPete
I don't recover I just don't do it as often as I used to :) I have two kids
how wake me up between 5-6 am.
------
SQL2219
If only there were some kind of physically demanding test for employment, I
would then punish all those youngsters by going to the front of the line.
------
baybal2
The market conjuncture is not skewed only one way. Right now, people whose
career went under 10 years ago, are competing with people in their 20ies. IT
industry has a disproportional portion of people in "senior" level positions.
Companies want to hire professionals in their prime, and look at anybody else
as a second grade cadre.
------
woogiewonka
31 here. Couldn't find work for 6 mo despite being well qualified for
positions I applied for. My guess: too many applicants for the same position.
Ended up going the freelancer route, couldn't be happier now. Sorry, I know
this doesn't relate to age (I don't think) but just wanted to say that.
~~~
77pt77
How do you put your freelance work on your resume?
Do you list projects, companies, time spans?
If you apply to a "regular" job, how are those references checked?
~~~
erichurkman
Good, long-term clients are worth their weight in gold. Both in terms of
regular income, but also references: references for new clients or new
employers.
------
Entangled
I am in my fifties with over 30 years programming experience and proficient in
20 languages yet one employer rejected my application because I didn't meet
their requirements and they found a better fit.
I work fifteen hours a day, can't stop learning and trying new technologies to
keep myself on top of the wave.
~~~
tcbawo
I have been in the business a while myself. It's a lot of work to stay current
(and well-rounded). But, I've had relatively long stints in my career with one
big industry change. I'm not sure that years of experience necessarily
translates from one company to the next, although a proven track record of
adaptability and flexibility is helpful. I've come to rely on networking for
job opportunities. Having someone willing to vouch for a candidate made a
difference when I was on the hiring side.
------
Aron
I'm more concerned personally with the fact that at nearly 40, I think I can
actually notice getting dumber. :-/
------
Animats
"Logan's Run". It's here.
~~~
banku_brougham
Good movie, good ending.
------
lquist
I don't speak the language, so I'm unable to read the underlying report, but I
hope this quote is out of context in the article: "There should be no doubt
that the employers discriminate on the basis of age," when the study itself
shows discrimination for very specific roles: administrators, chefs, cleaners,
restaurant assistants, retail sales assistants, business sales agents and
truck drivers.
------
TheBobinator
A few observations.
First off, companies like Cisco, Microsoft and Oracle, and even Google, are
running entirely off of the centralized education system in the US. These are
companies that got their software into curriculum and taught everyone their
way of doing things, then engaged in shoving their software and a lot of labor
into large organizations making a gargantuan mess that was glossed over with
lots of "free overtime". Compare Cisco CLI to Juniper, or Microsoft to Debian,
or MS SQL to Oracle; who's going in who's direction.
Why?
If you made the investment in understanding exclusively those companies
products you went along the technological imperialism trip and now that you're
on the other side, and you never spend time understanding the theory or
building critical thinking skills, you're washed up. 20 years working on a
massive oracle mainframe or with purely Cisco R&S becomes a liability, the
reason being, you never tried to find a better way to do things or try to
eliminate your job and replace it with something better.
There's an honesty in Meritocracy; The market has always valued the
independent thinking, hard-working, incredibly knowledgeable IT staff with a
tremendous depth of understanding of infrastructure, programming, politics,
and equipment over what 95% of the IT market has become. 95% of the people
I've worked with expect the solution to be in some arcane google search result
or in a book; they don't expect to go on the journey of finding the answer.
What they never develop is real creativity, a real understanding of the
systems they work with, or a real understanding of the architecture, why
things are done, or the process of how to build on themselves; to set a path
for themselves and others that that eventually brings about a finished
product.
The entire IT industry is maturing and getting older and as they do, older
staff that haven't done this is viewed as a liability. I'll agree, there's all
kinds of ways to try to hire gullible people who don't know their own self-
worth. Fact is though, those kinds of companies are on a long-term death
spiral of their own making. Every time a large corp outsources, I go look at
the 10-k and I see a major cash flow problem of managements making. "The old
cranky sysadmin way" is beginning to take at more and more companies and that
will trickle into academia as time goes on as management begins to understand
what technological imperialism means and what the results are; generally, a
total mess.
It's a very controversial thing to say these things because it makes a lot of
people who aren't that good, or who invested their time in the wrong things
feel like they are doomed. Fact is, there's no set career path in IT like
there is in other fields like Attorneys and Lawyers, Stock Brokers, Research
scientists and Academia.
The trick I've discovered is to put in no more than 40hrs a week at work, and
if overtime is needed, come home and practice, do architecture work, learn
algorithms, make good notes, read programming and architecture and project
management books. 40hrs a week is for work, 10-20hrs a week is for self-
betterment. Then you come into work, and find ways to eliminate your job. A
new approach that saves butt loads of time. Get your assignments done early,
then either come up with a new project to work on, move on, or study. Within a
few years of doing this, you will be a top-tier programmer\architect\systems
admin, whatever you want to do.
And while I do feel for people who feel they've fallen behind due to having a
family, the fact is from my perspective, the real issues with society are
things like 21% of GDP being spent on a scummy healthcare industry, or high
incomes of the top 1%, or lack of wage parity tariffs on imports from China.
The baby boomers have really messed things up for us. The fact you can't go
from a high paying IT job to a factory job or retail management position and
still have enough money to put your family in a decent home with 3 hots and a
cot and to put your kids through school and college is a failure of society in
general, not the IT industry. Those issues need fixed and frankly, contribute
a heck of a lot to our messed up society.
~~~
havetocharge
Good observations; some good points made here. We can expect things to become
even more competitive in the future. If one does not feel that their years of
experience are an asset in solving problems for others, then they should
perhaps look back and adjust.
It is convenient to place blame for personal issues on some anonymous
discriminatory entity (which may as well be real and not imaginary), but there
must be things one can do to better themselves, especially in such high
demand, unstoppable industry that we're in.
It is best to focus on finding ways to stay afloat (or even control your
drift) than wail and sink.
------
drawkbox
At any age, just ship products that are quality and marketable. Have good
routines and get things done. Stay well informed and educated. Your only
useless when you decide you are useless, everything else is just noise.
Averages and means are not necessarily definitive of what individual
experience will be.
Technology and mobile/web/games are _still_ young industries, in all new
industries they start/skew younger. Radio for instance was young at inception
but is now older in terms of age, it takes a couple decades for people to
decide it is worth pursuing or starting in.
Being a web developer has only been around for 20 years and being a mobile
developer only a decade truly (smartphone era). People are going to skew
younger here and more coders are 40-50 and younger. As time goes on this will
change and skew older. Incidentally because it is a young industry, there is a
large divide of people that grew up with the internet and ones before, same on
mobile. I think that hangs over the age thing. Older people used to be bad at
tech but most people in their 40s even grew up with it or used it very young.
Many of my older coder friends started with commodore 64s, Apple IIs and had
to find answers before Google, they are now mobile/game/app/web developers.
Many of them are more knowledgeable than younger coders today may ever be
because they were in the time when everything was being built and the layers
were easier to see. There is tons of cruft for a young coder to navigate and
once you get out of college (22-24) or masters (27-30) and work for 5-10 years
and get your head around this skill, they call you too old, it is a bit cruel
but goes back to the young industry bit.
On the brightside, our industry is also unique, we can break out on our own
and still compete enough to provide a living. In other industries and lines of
work, the costs to startup are immense and risky, bootstrapping is easier in
technology. Either in freelance or software as a service or starting
something, there is always an option if you keep
coding/building/shipping/solutions. Programming is a meta skill like business
and marketing that allows you to literally go into almost any industry.
Most people in tech around their late 30s or 40s want to start their own thing
and that is a benefit. Young developers may be too uncomfortable doing that
because of their confidence and experience. Even lawyers and doctors, if they
don't start their own practice, put up with the same push around that everyone
else does as they age and get experience. What you need to do is find your own
vehicle around this time so you can navigate the waters with a little more
command.
Just ship and build things, don't get caught up in the averages. There is a
lack of coders still that can deliver from start to live, in fact this
situation appears to be getting worse. Provide that and you will always be
marketable.
Side note: if you are over 40, I'd suggest paying for your own individual
independent insurance. I feel health insurance is another pressure on older
engineers in startups at least. I have seen at least two guys get run out
based on health conditions and age. Once health insurance is separated from
the job, ageism is less intense at these types of places.
------
subru
I will be 40 next year. Humans are expendable; we have to make our own worth.
If we don't do that, we end up like I am right now: a year from 40, homeless,
broke, in a lot of debt, out of work, failed startup, facing a felony on false
accusation.
Life is challenging for me now, and this article directly applies to me. Oh,
and there's that thing about being a white male and suicide. Now imagine being
a kind of intimidating looking type in a very non white anti trump area.
Tribalism is real. Had I stuck with my tribe early on I'd be more secure. My
demise is probable at this time.
I am solid in my desire to self terminate yet lack the ability to overcome
fear of death. I stay alive but it's closer than ever. It's almost a humane
thing to let me go. I wouldn't wish my brain on anyone.
Good luck all.
~~~
alexashka
[Deleted] - upon re-reading the parent, I feel I've misjudged the volatility
of the situation. Sorry.
~~~
edoceo
These are the wrong ideas to express to one who indicates an interest in self-
termination.
I wish I could double down vote you.
| {
"pile_set_name": "HackerNews"
} |
Ask HN: What does a good Google AdWords campaign cost? - cdvonstinkpot
Hi,<p>I'm busy developing a startup capital estimate in preparation for talks with an investor, and am at the part where I detail my marketing plan.<p>I don't know how to get a handle on what I can expect to spend on Google AdWords.<p>Could readers share their experience with what they ended up having to do to get an effective reach out of it? Maybe share resources on estimating potential spend if you're aware of such things?<p>Thanks.
======
joshdance
I have not done any major Adwords campaigns, but you need to detail what you
actually want. What is "good"? Do you want to be #1 for major keywords? It
will cost you a lot. Do you want to drive a few hundred new users to your site
everyday? Maybe cheaper.
It might be a good idea to setup an Adwords campaign for a personal project as
experience is the best teacher.
~~~
cdvonstinkpot
Good idea- thanks.
| {
"pile_set_name": "HackerNews"
} |
Why Python Runs Slow, Part 1: Data Structures - Sauliusl
http://lukauskas.co.uk/articles/2014/02/13/why-your-python-runs-slow-part-1-data-structures/
======
jnbiche
If you're using Python for performance-critical applications, simple use of
the integrated ctypes module (uses libffi in background) can make a world of
difference. There's a modest performance overhead, but basically you're
getting near C performance with proper use of ctypes.
Coincidentally, one of the usual examples given in the ctypes howto is a Point
structure, just like in this post. It's simple:
from ctypes import *
class Point(Structure):
_fields_ = [("x", c_int), ("y", c_int)]
Then you can use the Point class the same way you'd use a regular Python
class:
p = Point(3, 4)
p.x == 3
p.y == 4
Really, taking a half-day to learn how to use ctypes effectively can make a
world of difference to your performance-critical Python code, when you need to
stop and think about data structures. Actually, if you already know C, it's
less than a half-day to learn... just an hour or so to read the basic
documentation:
[http://docs.python.org/2/library/ctypes.html](http://docs.python.org/2/library/ctypes.html)
If you plan to write an entire application using ctypes, it'd be worth looking
at Cython, which is another incredible project. But for just one or two data
structures in a program, ctypes is perfect.
And best of all, ctypes is included in any regular Python distribution -- no
need to install Cython or any additional software. Just run your Pythons
script like you normally do.
EDIT: I was just demonstrating how to get an easy-speed up using ctypes, which
is included in the Python standard library. To be clear, you would usually use
this type of data structure in ctypes along with a function from a C shared
library.
Furthermore, if you're serious about optimizations, and you can permit
additional dependencies, you should absolutely look at cython and/or numpy,
both of which are much faster than ctypes, although they do bring along
additional complexity. Other commenters are also pointing out cffi, which I've
never used but also bears consideration.
~~~
Sauliusl
This would be one of the approaches to use if you wanted to squeeze the last
pieces of performance out of this class. I would recommend using Cython for
this though.
The problem with both of these approaches is that, well, use this too often,
however, and you suddenly realise you are not really coding in Python anymore.
Also, correct me if I'm wrong, overuse of tricks like these is one of the key
reasons why we cannot have nice things like PyPy for all modules.
~~~
jnbiche
I actually agree with everything you write here. If I could re-write the post
to include these points, I would.
I do think PyPy is very near to having full ctypes support, if they don't
already.
------
erbdex
"My experience in working on Graphite has reaffirmed a belief of mine that
scalability has very little to do with low-level performance but instead is a
product of overall design. I have run into many bottlenecks along the way but
each time I look for improvements in design rather than speed-ups in
performance. I have been asked many times why I wrote Graphite in Python
rather than Java or C++, and my response is always that I have yet to come
across a true need for the performance that another language could offer. In
[Knu74], Donald Knuth famously said that premature optimization is the root of
all evil. As long as we assume that our code will continue to evolve in non-
trivial ways then all optimization6 is in some sense premature.
For example, when I first wrote whisper I was convinced that it would have to
be rewritten in C for speed and that my Python implementation would only serve
as a prototype. If I weren't under a time-crunch I very well may have skipped
the Python implementation entirely. It turns out however that I/O is a
bottleneck so much earlier than CPU that the lesser efficiency of Python
hardly matters at all in practice."
\-- Chris Davis, ex Google, Graphite creator
~~~
jnbiche
This is the key. Very often, the app is IO bound, and moving to C will make
little difference.
This is one reason why I'm very excited about Python's new AsyncIO module in
Python 3 only. It's asyncore done right, and is a great way to write network
applications. I look forward to seeing what is built on top.
~~~
a8da6b0c91d
> Very often, the app is IO bound
I hear this all the time but it really doesn't square up with my personal
experiences. I've had to re-implement dynamic language stuff in C++ many times
to get acceptable performance. No real design changes, just straight ports to
C++. The entire value proposition of Golang is that the scripting language
dynamic type systems are too slow, and it seems like loads of folks agree.
~~~
pjmlp
That is why they never used Dylan, Lisp, SELF or any other dynamic language
with native compilers.
~~~
a8da6b0c91d
Those dynamic languages are only performant when you add a bunch of type
information. You wind up writing a simulacrum of C and it still under-
performs.
~~~
lispm
The idea is that there is some useful speed for much of the application by
using native compilers. Higher speed might be needed only in parts of the
program. Then a type inferencer, etc. comes to use. If that's still not enough
one calls C or assembler routines - but, say, 95% of the application can be
written in Lisp.
------
munificent
What I find interesting here is that Python (and most other dynamically-typed
languages) treat instances of classes as arbitrary bags of properties, with
the negative performance implications of that, _even though that feature is
rarely used_.
I'd love to have the time to examine codebases and get real data, but my
strong hunch is that in Python and Ruby, most of the time every instance of a
class has the exact same set of fields and methods. These languages pay a
large performance penalty for _all_ field accesses, to enable a rare use case.
JavaScript VMs (and maybe Ruby >=1.9?) don't pay the perf cost because they do
very advanced optimizations ("hidden classes" in V8 et. al.) to handle this.
But then they pay the cost of the complexity of implementing that
optimization.
I'm working on a little dynamically-typed scripting language[1] and one design
decision I made was to make the set of fields in an object statically-
determinable. Like Ruby, it uses a distinct syntax for fields, so we can tell
just by parsing the full set a class uses.
My implementation is less than 5k lines of not-very-advanced C code, and it
runs the DeltaBlue[2] benchmark about _three times faster_ than CPython.
People think you need static _types_ for efficiency, but I've found you can
get quite far just having static _shape_. You can still be fully dynamically-
dispatched and dynamically type your variables, but locking down the fields
and methods of an object simplifies a lot of things. You lose some
metaprogramming flexibility, but I'm interesting in seeing how much of a
trade-off that really is in practice.
[1] [https://github.com/munificent/wren](https://github.com/munificent/wren)
[2]
[https://github.com/munificent/wren/blob/master/benchmark/del...](https://github.com/munificent/wren/blob/master/benchmark/delta_blue.wren)
~~~
gopalv
Python actually comes static shapes for objects with __slots__
class vertex(object):
__slots__ = ["x", "y", "z"]
I use __slots__ in most code after the first refactor for a very important
reason - I'm a _hyper-caffeinated_ code monkey.
I wasted an entire day because I set self.peices in one place and self.pieces
in another & couldn't figure out the bug, until I used the "grep method".
~~~
munificent
Right, but the problem here is you have to opt _in_ to that. The most terse,
simple way to express something is also the slowest.
Most classes have static shapes, so for the few types that are more dynamic, I
think it makes sense for users to have to opt _out_.
------
alephnil
It is of cause possible to write a faster Python, as PyPy proves, but some of
the design choices in Python does make it hard to optimize. This is not
inherently a problem with dynamic languages as the development of Julia
proves. In Julia it is easy to write programs that is in the same ballpark as
C efficiency wise, while still feeling very dynamic and having a REPL. Pythons
problem is that both the interpreter and the language is quite old, and
existed before modern JIT technology was developed, so that was not considered
when designing the language and the interpreter.
That said, Python emphasis on fast development as opposed to fast running code
is very often the right tradeoff, and is why it is so popular.
~~~
jl6
What language features would you have or not have if you designed a language
with knowledge of "modern JIT technology"?
~~~
andreasvc
If I would guess, I would say that you want to design the language in such a
way that things such as types are typically easy to guess for the JIT
compiler.
------
jzwinck
There's no silver bullet, but NumPy comes pretty close sometimes. Here's an
example where I achieved a 300x speedup with regular old CPython:
[http://stackoverflow.com/questions/17529342/need-help-
vector...](http://stackoverflow.com/questions/17529342/need-help-vectorizing-
code-or-optimizing/17626907#17626907)
The trick is often to somehow get Python to hand the "real work" off to
something implemented in C, Fortran, C++, etc. That's pretty easy for a lot of
numerical and scientific applications thanks to NumPy, SciPy, Pandas, PIL, and
more. Lots of libraries are exposed to Python, and you can expose more either
by compiling bindings (see Boost.Python) or using ctypes. If you do this well,
nobody will notice the speed difference, yet your code will still look like
Python.
And sometimes your performance problem is not Python's fault at all, such as
this lovely performance bug:
[https://github.com/paramiko/paramiko/issues/175](https://github.com/paramiko/paramiko/issues/175)
\- a 5-10x speedup can be had simply by tweaking one parameter that is no
fault of CPython or the GIL or anything else (in fact, Go had basically the
same bug).
What I'm getting at here is that performance is not just one thing, and the
GIL is a real and worthy spectre but hardly matters for most applications
where Python is relevant. Your Python is slow for the same reason that your
Bash and your C and your Javascript and your VBA are slow: you haven't
profiled enough, you haven't thought long and hard with empirical results in
front of you about where your program is spending its time, your program is
improperly factored and doing work in the wrong order, or perhaps you should
just throw some hardware at it!
------
crntaylor
The part that really surprised me was this:
We only had 23 years of Python interpreter development,
how would things look like when Python is 42, like C?
C, which I always think of as an ancient venerable systems language, is less
than twice as old as Python, which I think of as a hot new kid on the block.
In thirty years, when my career will probably be drawing to a close, Python
will be 53 years old and C will be 72 years old. Barely any difference at all.
~~~
coldtea
> _We only had 23 years of Python interpreter development, how would things
> look like when Python is 42, like C?_
Well, mostly like it is today. Maybe a little better, maybe a little slower.
Python hasn't progressed much. Compare it to the last 10 years and it's mostly
a flatline, if not a slight decline with some 3.x versions.
Whereas C was from the onset one of the fastest or THE fastest language on any
machine.
Getting fast is not usually due to some incremental effort. You either go for
it or not. If you start from a slow language, incremental changes without a
big redesign of the compiler/interpreter never get you that far.
Javascript got fast in 3 years -- not by incrementally changing the Javascript
interpreters they had before, but by each of the major players (Apple, Google,
Mozilla) writing a new JIT interpreter from scratch. In 2007 it was dog slow,
and then in 2008 all three major JS interpreters got fast.
Sure, they have been enhanced since, but the core part was changing to JIT,
adding heuristics all around, etc. Not incrementally improving some function
here and some operation there.
~~~
gizmo686
>Whereas C was from the onset one of the fastest or THE fastest language on
any machine.
You can't write performance critical code in C. C is great for high level
code, but if performance is important there is no alternative to assembly.
~~~
coldtea
> _You can 't write performance critical code in C. C is great for high level
> code, but if performance is important there is no alternative to assembly._
That statement makes no sense.
Of course you can write performance critical code in C. People write all kinds
of performance critical code in C. Heck, kernels are written in C. What's more
"performance critical" than a kernel? Ray traycers are written in C. Real time
systems are written in C. Servers are written in C. Databases are written in
C. Socket libraries. Multimedia mangling apps like Premiere are written in C
(or C++). Scientific number crunching libraries for huge datasets are written
in C (and/or Fortran).
The kind of "performance critical code" you have to write in assembly is a
negligible part of overall performance critical code. And the speed benefit is
not even that impressive.
~~~
spc476
That's true _now_ (and perhaps has been true for easily the past fifteen
years). But up til the early-to-mid-90s, it was relatively easy for a decent
assembly language programmer to beat a C compiler. In fact, it wasn't until
the early mid-90s that general purpose CPUs broke 100MHz.
Just be very thankful you don't have to deal with C compilers under MS-DOS
what with the tiny, small, medium, compact, large and huge memory models (I
think that's all of them).
~~~
ygra
Even now performance-critical code is assembly. Just take a look at your
libc's memcpy implementation, for example. Most likely there's a default C
implementation that is reasonably fast and a bunch of assembly versions for
individual architectures.
~~~
coldtea
> _Even now performance-critical code is assembly._
The problem I have with this statement is that it implies other code, like the
kernel, a ray-tracer, video editor, number crunching etc, stuff usually done
in C/C++, are not "performance critical".
Let's call what you describe "extremely performance critical" if you wish.
With that said, MOST performance critical code is written in C/C++.
Code that's not that much performance critical is written in whatever.
------
joshmaker
Who would use a dictionary for a point? If it's a 2D grid, you are only going
to have two axes and by convention x-axis is always first, and y-axis is
always second. Perfect use case for a tuple.
point = (0, 0)
~~~
w0utert
It's just an example. There are many cases where you need more than what you
can safely stuff into a tuple, which means the choice becomes 'naked
dictionaries vs. classes', it's a tradeoff I've had to make many times writing
python code.
Of course there are many cases where using tuples is the best way to represent
some data item, (x, y) point data is an obvious example. But when your data
structures become more complex, need to be mutable, need to have operations
defined on them, have relations to other objects, etc, tuples are a bad
choice. You don't want to end up with code that uses tuples of varying
lengths, composed of elements of varying types, consumed and produced by
functions that are hard-coded to rely on the exact length, ordering and
element type of their their tuple inputs. Named tuples are one step in the
direction of dictionaries, but they are still nowhere as flexible as mutable
dictionaries or proper classes.
~~~
RyanZAG
If you can't use a tuple, it's not like you could have really used a C-struct
either. So the point is valid - the code should be using tuples and not
dictionaries or classes.
~~~
w0utert
Again, I assume the article only served as an example of how in Python you
usually end up using dictionaries or classes, which have fundamentally
different performance characteristics compared to C-structs. Yes, you could
use tuples instead, in some cases, and get performance characteristics
comparable to C structs. Often this is not an option though, and you would
still have to use classes or dictionaries. There are many scenarios you could
conveniently implement in C using structs, that would end up as an ungodly
mess in Python if you would implement them using nothing but tuples.
Just as a thought exercise, try to come up with a way to represent and
manipulate an hierarchical, mutable C-structure with 20 fields, using nothing
but tuples in Python.
~~~
falcolas
Like... named tuples? That's the nice thing about python, you're not
restricted to using one data type. If you have a data structure that doesn't
change, and speed matters, you can use something better suited to the task at
hand.
Of course, you're not restricted to using one datatype in C either, but the
constant comparison this article makes between structs and dictionaries is
misleading. Comparing hash map implementations with dictionaries would be much
more apt.
~~~
sitkack
named tuples are classes, but they use __slots__ so they are sealed to
extension thus using less memory. Take a look at the `namedtuple` source, it
is a fun little bit of metaprogramming.
[http://dev.svetlyak.ru/using-slots-for-optimisation-in-
pytho...](http://dev.svetlyak.ru/using-slots-for-optimisation-in-python-en/)
[http://hg.python.org/releasing/2.7.6/file/ba31940588b6/Lib/c...](http://hg.python.org/releasing/2.7.6/file/ba31940588b6/Lib/collections.py#l228)
I am _wrong_. namedtuple does NOT using slots. weird, wonder why?
Because it directly subclasses `tuple`
point = namedtuple("Point","x y z",verbose=True)
[http://blip.tv/pycon-us-
videos-2009-2010-2011/pycon-2011-fun...](http://blip.tv/pycon-us-
videos-2009-2010-2011/pycon-2011-fun-with-python-s-newer-tools-4901215)
------
kashif
The pythonic way of creating a Point like data structure is not
point = {'x': 0, 'y': 0}
but instead, this
Point = namedtuple('Point', ['x', 'y'], verbose=True)
The resulting class, I believe to be more performant than using a dictionary -
but I haven't actually measured this.
~~~
mjschultz
I'm probably doing it wrong but I measured exactly this yesterday and the dict
version was faster:
$ python -m timeit --setup "from collections import namedtuple; Point = namedtuple('Point', ['x', 'y']); p = Point(x=0, y=0)" "p.x + p.y"
1000000 loops, best of 3: 0.284 usec per loop
vs.
$ python -m timeit --setup "p = {'x': 0, 'y': 0}" "p['x'] + p['y']"
10000000 loops, best of 3: 0.0737 usec per loop
Maybe the use isn't right because I agree with your belief that namedtuple is
suppose to be more performant.
~~~
pdonis
You should be creating a dict vs. a namedtuple instance once, then accessing
it many, many times. What you're doing is creating a lot of dict vs.
namedtuple instances, then accessing each one only once. That's mostly testing
the instance creation time, not the field access time.
~~~
mjschultz
That code should only create the dict/namedtuple instance once, then access it
many, many times.
The creation occurs in the --setup portion. The field accesses occur in the
actual looping portion of the timeit code.
~~~
pdonis
Ah, ok, I see, for some reason my browser wasn't showing the namedtuple code
snippet right. Now I need to go look at the namedtuple code to see why
accessing the fields by name is slower than accessing them by index.
------
unwind
The article was kind of interesting, it's always good to talk about why things
are slow, since that might help highlight what you can do about it (short of
switching away from Python, that is).
I was abit annoyed about the benchmarks part; there was no C-based benchmark
for comparison, it was not clear how many points were being processed which
made the exact time kind of pointless. Also, C and C++ _are not the same_
which the author seems to think.
~~~
craigching
> C and C++ are not the same which the author seems to think.
The part where he lost me was when he said this referring to C:
> Here we tell the interpreter that each point would have exactly two fields,
> x and y.
Maybe I misread that, but I don't think I did, he was referring to the C
struct when he said that. It's one of those glaring mistakes that is hard for
me to look past when someone says something like this.
~~~
Sauliusl
Not sure why I put an "interpreter" there when C is compiled, of course, I
fixed this now.
Again, this does not change the fact that structs and dictionaries are very
different data structures.
~~~
GregBuchholz
[http://stackoverflow.com/questions/584714/is-there-an-
interp...](http://stackoverflow.com/questions/584714/is-there-an-interpreter-
for-c)
------
jaimebuelta
The sentence "Python run slow" is a little misleading. While is true that does
more stuff than other languages (C, for example) for similar operations, it is
also true that in the majority of cases, the relevant time consuming parts of
execution are in other areas, like waiting for I/O, etc.
In most of the cases, a program done in Python (or Ruby, or JavaScript) is not
slower than a program done in C or even assembly. Sure, for some cases, it may
be necessary to take care of rough cases, but I think that just saying "Python
is slow" is not very fortunate...
~~~
stefantalpalaru
> the relevant time consuming parts of execution are in other areas, like
> waiting for I/O, etc.
It's safe to assume that people complaining about a language's performance
deal with CPU bound cases.
> In most of the cases, a program done in Python (or Ruby, or JavaScript) is
> not slower than a program done in C or even assembly.
This is false:
[http://benchmarksgame.alioth.debian.org/u64q/benchmark.php?t...](http://benchmarksgame.alioth.debian.org/u64q/benchmark.php?test=all&lang=python3&lang2=gcc&data=u64q)
~~~
acdha
> It's safe to assume that people complaining about a language's performance
> deal with CPU bound cases.
That's a very unlikely assumption – many people will complain about the
language before even profiling their code. I've seen people do things like
complain about Python's performance before, say, realizing that they were
making thousands of database queries or allocating a complex object inside an
inner loop. Because they've heard “The GIL makes Python slow” it's incredibly
common for even fairly experienced programmers to simply assume that they
can't make their program faster without rewriting it in C and they never
actually confirm that assumption.
>> In most of the cases, a program done in Python (or Ruby, or JavaScript) is
not slower than a program done in C or even assembly. > This is false:
[http://benchmarksgame.alioth.debian.org/u64q/benchmark.php?t...](http://benchmarksgame.alioth.debian.org/u64q/benchmark.php?t..).
That's a micro-benchmark collection. It's interesting for low-level
performance but it doesn't tell you much about the kind of programs most
programmers write. For example, I serve a lot of images derivatives over HTTP
– it's certain that are many operations which could be significantly faster if
they were written in C (i.e. reading HTTP headers in place rather than
decoding them into string instances) but in practice none of that matters
because almost all of the total runtime is already spent in a C library.
~~~
igouy
> That's a micro-benchmark collection. <
No, it's a meagre dozen "toy programs". (See Hennessy and Patterson "Computer
Architecture").
> ... many operations which could be significantly faster if they were written
> in C ... none of that matters because almost all of the total runtime is
> already spent in a C library. <
See Sawzall quote -- [http://benchmarksgame.alioth.debian.org/dont-jump-to-
conclus...](http://benchmarksgame.alioth.debian.org/dont-jump-to-
conclusions.php#jump)
~~~
acdha
> See Sawzall quote -- [http://benchmarksgame.alioth.debian.org/dont-jump-to-
> conclus...](http://benchmarksgame.alioth.debian.org/dont-jump-to-conclus..).
Agreed – my point was simply that over a couple decades I've only seen a
handful of cases where a performance issue which was due to the language
rather than the algorithm or simple data volume. Such problems exist but not
for the majority of working programmers.
~~~
igouy
Incidentally -- [http://books.google.com/books?id=gQ-
fSqbLfFoC&lpg=PP1&dq=Com...](http://books.google.com/books?id=gQ-
fSqbLfFoC&lpg=PP1&dq=Computer%20Architecture&pg=PA37#v=onepage&q=toy%20benchmark&f=false)
------
arocks
Rather than using a better data structure from the start (class vis-a-vis
dictionaries), why not move to a better Python implementation (PyPy vis-a-vis
CPython)? When I need a data structure, I look for one that is a natural fit
to the problem. Perhaps everything is implemented as a hash table in a certain
language (not taking names here :)) but would I replace every data structure
with a hash table for efficiency? That would be Premature Optimisation.
I would recommend to code in idiomatic Python as much as possible (in this
case, use a tuple for Point). Primarily because it is easy for other fellow
programmers and your future self to understand. Performance optimisations are
best done by the compiler for a reason, it is usually a one-way path that
affects readability.
~~~
GFK_of_xmaspast
I can't use pypy yet, I need scipy/numpy.
------
analog31
For my casual use, Python has been fast enough that I can be pretty carefree
about how I program. But I had one shocking experience when I ported a program
with a fair amount of math over to a Raspberry Pi, and it practically ground
to a halt. That was a disappointment. It won't drive me away from Python, but
it means I've got some learning to do on how to better optimize Python code.
~~~
fidotron
Python and performance can be summed up as "just think about what it has to do
to add two ints together". The I/O requirements of that vastly exceed the CPU
requirements.
Basically any tight loop, heavy use of hash tables (so that's Python, Ruby
etc.) or floating point (since this is a sore spot for ARM) is going to create
an explosion in time used. C/C++/C#/Java can, by being careful about the types
being used, be much faster.
~~~
a8da6b0c91d
I don't understand what I/O has to do with that. The issue is all the extra
branching and copying with every op code. Python is going to be 20X to 100X
slower than C++ at pretty much anything. It's an inevitability of the type
system.
------
tgb
This should be bringing up the classic array-of-structures versus structure-
of-arrays debate instead of what was mentioned. If only NumPy were standard
Python and so we could have an easy, standard answer that is usually fast
enough.
~~~
pekk
what is stopping you from using NumPy?
~~~
tgb
I do use it - it's just that it can't quite be given as the 'standard' answer
for cases like this. I just wish it could become the definitive rather than
the de facto standard.
------
rtpg
I'm surprised that Python's interpreter tech isn't advanced enough to try and
JIT some of this away. Python could probably learn a lot from various JS
interpreter advances.
~~~
jaimebuelta
The PyPy project is doing that [http://pypy.org/](http://pypy.org/) (is
mentioned on the article)
~~~
dagw
There is also Numba, which is a JIT python to LLVM compiler that supports
optional type annotations. Unlike pypy, it is designed to seamlessly integrate
with CPython.
------
zurn
On a related note, the field of compilers seems to have ignored data
optimization almost completely at the expense of code optimization.
Applying a few basic tricks lets a human typically save 50-75% off an object's
storage requirements and a compiler could combine this with profile feedback
data about access patterns & making it more cache friendly.
This would be a good fit for JIT where the compiler could do deopt when the
assumptions are violated, and this would let you make more aggressive
optimizations.
------
tasty_freeze
This article is making a misleading comparison. Yes, dynamically typed
languages have overheads that statically typed languages don't. But the better
question to ask is why Python implementations are factors slower than leading
javascript implementations, which have the same theoretical overheads that
Python does.
The V8 is is now about a factor of 4 or 5 off of the speed of C for general
purpose code, while CPython is 30x to 100x.
~~~
pekk
if Google would invest the same engineering effort in Python
------
hessenwolf
Runs 'slowly'. Led by the population of the North American continent, the
adverb is dying gradual.
------
rplnt
Yet another case of someone (the blog engine?) being too smart and replacing "
with “ and ” in code.
------
mumrah
If you don't want to mess with ctypes, this sounds like a straightforward use
case for namedtuple.
------
minimax
std::hash_set<std::string, int> point;
point[“x”] = x
point[“y”] = y
This is a very interesting implementation of a set...
------
yeukhon
if you ever watch Robert's talk
[http://www.youtube.com/watch?v=ULdDuwf48kM](http://www.youtube.com/watch?v=ULdDuwf48kM)
you will find that different version of Python can have different run time for
the same code.
------
martinp
Wouldn't a regular tuple be the most pythonic (and possibly most efficient)
way to represent a point?
I think that's what most image libraries do (at least Pillow).
~~~
chmike
It was just an example to illustrate the problem. Pythons don't have legs. So
they can't run, not even slowly.
It would have been more instructive if the author showed the alternate
solutions classified by measured speed.
------
wcummings
Wouldn't a tuple be more appropriate than a class?
~~~
anaphor
Then you have stuff like point[0] and point[1] littered throughout your code,
or you write getter functions and then you have function calls as an overhead
which is roughly as expensive as the class. An instance of namedtuple is
actually the Correct (tm) solution.
~~~
Redoubts
>An instance of namedtuple is actually the Correct (tm) solution.
Do you have an implementation to support that? Because a comment from TFA
shows that's actually the worst idea in cpython.
[http://lukauskas.co.uk/articles/2014/02/13/why-your-
python-r...](http://lukauskas.co.uk/articles/2014/02/13/why-your-python-runs-
slow-part-1-data-structures/#comment-1242618646)
~~~
anaphor
Sorry, which comment are you referring to? All I see is a footnote saying "One
would be right to argue that collections.namedtuple() is even closer to C
struct than this. Let’s not overcomplicate things, however. The point I’m
trying to make is valid regardless" which doesn't really say it's a bad idea,
just that he didn't decide to talk about it in that article.
| {
"pile_set_name": "HackerNews"
} |
Ask HN: Recommend a contract to sell a website? - dustyreagan
Does anyone have a good recommendation of a sample contract for the sale of a website? Perhaps one you've used yourself?
======
minalecs
might want to look on docstoc
| {
"pile_set_name": "HackerNews"
} |
Webhooks Level Up - Zikes
https://github.com/blog/1778-webhooks-level-up
======
skywhopper
Here's an example of the kinds of features Github's staff is working on that
takes a significant amount of time and coordination, and it's why we don't see
100 new "who of your friends also starred this repo?" features each week.
~~~
fudged71
"who of your friends also starred this repo?"
I hope you know that feature came out this week...
~~~
skywhopper
Yep. I was indirectly responding to a complaint from that thread in which the
commenter wondered why Github wasn't announcing new UI features every day
since the friend-starring feature was just "an afternoon's worth of work".
------
sync
How are people integrating their own webhooks into their apps? e.g. What is
the backend for github or stripe's webhooks?
I'm surprised there's not a SaaS that handles the distribution, security,
retries, and introspection for you...
~~~
tdumitrescu
What kinds of consumers, you mean? I've found them most useful for integration
with new hosted services that haven't yet made it onto the external services
list provided out-of-the-box by Github. For instance, when you want to try out
(or develop) some new project tracker or hosted CI solution.
I'm a little surprised they still don't offer any auth configuration for
webhooks the way they do for most external services, so you're stuck with
basic auth on the post-receive URL.
~~~
delroth
There's some HMAC-SHA1 available but it's hidden in their REST API. I really
don't understand why the option is not available via their web interface,
especially since it is already supported in their backend.
------
akerl_
I'm stoked to see the webhooks get an overhaul. I was just about to use them
for a project, and this'll be a great help.
I wish they'd do similarly for the services. Currently, editing multiple
services across repos is a bit of a pain, due to the length of the list and
how it jumps you to the top on any interactions. (Originally, I thought this
announcement meant they'd revamped that as well)
Out of curiosity, is there a generally-accepted best practice for rate-
limiting / authenticating webhook pushes? I'm planning to run a daemon that
listens for them, and while the effect of somebody finding the URL and
hammering it isn't likely to be catastrophic, I'd still like to rate limit it
if I can. Alternately, are GitHub's webhook-sending IPs static enough to put
in an IP set and add to my firewall?
~~~
atmos
You can always get an updated list from
[http://developer.github.com/v3/meta/](http://developer.github.com/v3/meta/)
but they're pretty static right now.
------
joeshaw
I wrote a tool to integrate GitHub pull requests with Jenkins builds called
Leeroy: [https://github.com/litl/leeroy](https://github.com/litl/leeroy)
This new feature will make things so much easier to set up and debug, I'm
thrilled. Before, you could not create a pull request hook without using the
API, and this caused a lot of people confusion. We set up the hook
automatically in Leeroy, but this will allow people to set it up manually if
they want, and debug when it doesn't work.
~~~
hack_edu
Just to share an awesome GitHub feature that I learned about when doing a
similar integration as you; your repository also tracks all Pull Request
related commits. Really helpful when you're trying to build these sorts of
tools in the future. If you set refspec to the following then you'll get
automated builds for any commit activity related to all Pulls. Its saved me
tons of time writing middleware to handle these things.
+refs/pull/*:refs/remotes/origin/pr/*
The major Jenkins plugins have their respective build-on-new-commits, so you
can automate these builds and just treat these like feature branches.'
------
jds375
The direct configuration will be pretty neat to try out. For those unfamiliar
with webhooks:
[http://developer.github.com/webhooks/](http://developer.github.com/webhooks/)
------
jnwng
digging through some of the events we can hook on to here:
[http://developer.github.com/webhooks/#events](http://developer.github.com/webhooks/#events),
i noticed the `gollum` event, which is triggered whenever a wiki page gets
updated. i'm curious why its named that?
~~~
chrisguitarguy
[https://github.com/gollum/gollum](https://github.com/gollum/gollum)
Named after the software that powers the wiki.
~~~
jnwng
ah, got it. thanks!
------
jackcarter
Can I use this to automatically push to (e.g.) Heroku upon pushing to Github?
~~~
michaelmior
You could, but you'd have to have some intermediate service to handle that
process. One great choice is Travis CI[1] which is really a continuous
integration service, but would let you do what you want. You can also just
attach multiple URLs to a single git remote so you push to both GitHub and
Heroku all the time.
However, I think running a test suite before deploying is a much safer option
as it stops you from accidentally deploying something you haven't properly
tested.
[1] [http://docs.travis-ci.com/user/deployment/heroku/](http://docs.travis-
ci.com/user/deployment/heroku/)
~~~
atmos
We have a preview API in place for these types of deployment tasks. Lots of
folks, travis/etc, seem to have piggy backed on top of successful builds too.
[http://developer.github.com/v3/repos/deployments/](http://developer.github.com/v3/repos/deployments/)
~~~
jon-wood
Seeing that in the list of events to listen to was probably the thing I was
most excited to see, I'm looking forward to seeing where that API goes!
| {
"pile_set_name": "HackerNews"
} |
Ask YC: Examples of freemium companies that did not work? - iseff
After the recent discussion on the freemium "business model", I'm doing some research (for a future blog post as well as just personal interest) into what makes companies successful or not using freemium.<p>The funny thing: though it's very easy to find companies that use freemium successfully, it's much more difficult to find companies that failed.<p>Does anyone have examples of companies that failed trying to use freemium and either died completely or switched to another (more or less successful) model?
======
iseff
P.S. One of the ones that I do have on my list of companies that failed is The
New York Times and its TimesSelect program.
| {
"pile_set_name": "HackerNews"
} |
Chinese Hackers Bypass 2FA - Husafan
https://gizmodo.com/chinese-hackers-bypass-2fa-in-attacks-spanning-10-count-1840613473/
======
crmrc114
Bad title. RSA tokens are named but almost no technical details are given in
the article.
| {
"pile_set_name": "HackerNews"
} |
Recession Already Grips Corners of U.S., Menacing Trump’s 2020 Bid - edwardfrank
https://www.bloomberg.com/news/features/2019-09-09/a-manufacturing-recession-could-cost-trump-a-second-term
======
gumby
"job" measurement isn't an adequate metric as some jobs are high earners and
some jobs pay so little that you need more than one just to keep your head
above water. So people may be happier or unhappier than suggested by this
metric.
In other words I don't think the article really addresses its own thesis.
~~~
Mikeb85
Yup. Also doesn't measure the fact that some people have multiple jobs, when
wages go up they often ditch one. Not to mention things like labour
participation rate, underemployment, etc...
------
c3534l
Economists have correctly predicted 5 out of the last 3 recessions.
------
joezydeco
My contacts in various parts of the manufacturing sector tell me they're
already pulling back but keeping it quiet. Nobody wants to be the first to
proclaim gloom and doom.
~~~
ahartmetz
Similar situation over here in Germany. New orders have dropped greatly in
some branches of the industry that I know about.
------
_bxg1
I want nothing more than for Trump to get unseated, but it amazes me how
people pin the entirety of the economy's ebbs and flows on whoever was most
recently president.
Edit: the sitting president of course has influence on the big picture, but
there are many other factors at play, some of which are inevitable
~~~
blitmap
Anecdote: I have seen my shares of stock dip by up to 5% because of his
tweets.
~~~
toomuchtodo
[https://www.vox.com/policy-and-
politics/2019/9/9/20857451/tr...](https://www.vox.com/policy-and-
politics/2019/9/9/20857451/trump-stock-market-tweet-volfefe-jpmorgan-twitter)
------
Mikeb85
The infographic shows 4 of Trump's swing states with job gains vs. 3 with job
losses. My US geography isn't perfect, but it looks like losses vs. gains
across states are pretty equal.
I read the whole article, they don't do a great job backing up their thesis,
instead using anecdotes.
> His advisers argue that the blame for any slowdown rests with a Federal
> Reserve that last year hiked interest rates too quickly and a strong dollar
> that makes U.S. exports less competitive.
They're not wrong. Interest rate hikes reduce the amount of debt companies (or
farmers) can take on to pay for equipment and rates that are too high are a
drag on the economy. Low rates encourage growth.
~~~
wahern
> They're not wrong.
They're not right, either. What's far more important for farmers and loan
officers is a market for selling the product.
Normally it's sort of silly to point a finger at the president for larger
market trends, but if ever culpability for market trends could be laid at a
president's feet, it'd be for something exactly like a poorly executed trade
war. On the other hand, the market has been on a nearly 10 year run. Some sort
of slowdown was inevitable.
The real story is that the tax cuts did squat to help the economy, and instead
resulted in extraordinary deficits, precisely as predicated by everybody whose
professional credibility was on the line.
~~~
credit_guy
> The real story is that the tax cuts did squat to help the economy, and
> instead resulted in extraordinary deficits, precisely as predicated by
> everybody whose professional credibility was on the line.
This is a very partisan opinion. Objectively assessing how much the tax cuts
helped or didn't help the economy is impossible, but seeing what professionals
predicted and then observed is not. For example the Congress has the Joint
Committee on Taxation [1], whose job is to estimate the impact of various tax
cuts (among other things). Their assessment was an impact on GDP of about 0.8%
on average for the first decade [2]. Despite this, they also predicted a one
trillion reduction in revenues overall (for the first decade). Separately, the
Congressional Budget Office (which in this case has overlapping duties with
the JCT), predicted a reduction in revenues of about 1.4 trillion for one
decade [3] and an average impact on real GDP of 0.7% over the same period [4].
>and instead resulted in extraordinary deficits
The tax cuts did increased the deficits, but the main reason for the deficit
increase is the military spending. To be more precise, the deficit increased
by $194 BN between 2016 and 2018 ([5],[6]), and the military spending has
increased by $123 BN over the same period, [7].
[1]
[https://en.wikipedia.org/wiki/United_States_Congress_Joint_C...](https://en.wikipedia.org/wiki/United_States_Congress_Joint_Committee_on_Taxation)
[2]
[https://www.jct.gov/publications.html?func=startdown&id=5045](https://www.jct.gov/publications.html?func=startdown&id=5045)
[3]
[https://www.cbo.gov/publication/53312](https://www.cbo.gov/publication/53312)
[4]
[https://www.cbo.gov/publication/53787](https://www.cbo.gov/publication/53787)
[5]
[https://en.wikipedia.org/wiki/2016_United_States_federal_bud...](https://en.wikipedia.org/wiki/2016_United_States_federal_budget)
[6]
[https://en.wikipedia.org/wiki/2016_United_States_federal_bud...](https://en.wikipedia.org/wiki/2016_United_States_federal_budget)
[7] [https://www.thebalance.com/u-s-military-budget-components-
ch...](https://www.thebalance.com/u-s-military-budget-components-challenges-
growth-3306320)
------
sjg007
Trump has basically nuked the farmers... so watch them all vote him out.
~~~
gootdude
The farmers actually have doubled down on Trump and believe conspiracies that
the USDA is just out to get him. [1]
Never thought I’d actually witness the emperor has no clothes.
[1] [https://www.cnbc.com/2019/09/10/reuters-america-many-u-s-
far...](https://www.cnbc.com/2019/09/10/reuters-america-many-u-s-farmers-fume-
at-washington-not-trump-over-biofuel-trade-policies.html)
~~~
sjg007
He is down 10% in farm support and that number will continue to drop as the
new reality continues to set in over the next year.
| {
"pile_set_name": "HackerNews"
} |
Cuban youth build secret computer network despite Wi-Fi ban - markmassie
http://hosted.ap.org/dynamic/stories/C/CB_CUBA_SECRET_NETWORK?SITE=AP&SECTION=HOME&TEMPLATE=DEFAULT
======
chris_overseas
I stayed in a casa particular in Baracoa, Cuba, a couple of years ago. The
owner had an illegal Internet connection that was beamed down via a Pringles
can style setup from a tourist hotel on top of a nearby hill (apparently fancy
tourist hotels there often have unrestricted Internet). He would lose his
connection for a day or two each month when the setup had to be removed and
hidden from the local inspector. I can't remember exactly how much he said he
was paying but it was a lot even by Western standards, something like
US$200/month, and the performance was pretty awful.
~~~
mikeash
Interesting story. Do you happen to know what he did with his internet access?
Look at pictures of cats and argue with strangers like the rest of us?
~~~
chris_overseas
Heh... he was one of the many doctors in Cuba and had been fortunate enough to
travel to a couple of countries to work, so he'd had a bit of a taste of the
outside world. As far as I could tell he mostly used the Internet to keep
informed on what was really going on in the world, without the censorship or
propaganda that affected the local news sources. Based on some of the things
he said I suspected he was very active politically though I didn't feel it was
wise or fair to question him about that, as much as I wanted to.
------
NovaS1X
I love reading these kinds of stories so much. To me, this is the essence of a
hacker and the spirit of people who are simply passionate about technology and
the belief of freedom of information.
It feels cyberpunk and innovative. I can just feel the character of this
network and the interesting people who've built it. These are the technology
types that I love talking with, these are the passionate ones who are
passionate even when it's not convenient.
It takes an honest and faithful heart to do these things, and I find that
beautiful.
~~~
irremediable
What a lovely tribute. I hesitate to bother you, but would you mind sharing
some other examples of such "technology types" that you know about?
~~~
nsxwolf
FYI: I downvoted you because your reply seemed to be a weirdly hostile
response to an innocent comment.
~~~
TrevorJ
Huh, I read it as pretty much the opposite.
------
hyperbovine
Almost seven years ago, I opened up my MacBook in downtown Havana and was
shocked to find dozens of wi-fi networks appearing up. This makes so much more
sense now.
------
brianbreslin
the chinese could have been selling the cubans Wuawei gear for YEARS. That
stuff is comparable to US stuff from cisco or whomever. So the argument that
US restrictions inhibited their net access is pure propaganda. Is there a
fiber link to cuba from anywhere else in the Caribbean ? I know the NAP of
Americas link in Miami goes around cuba.
so assuming the US eases restrictions, how fast could a true blanketing of the
country or at least Havana occur with modern grade Wifi gear? Can solar be
used to supplement the poor electrical infrastructure?
~~~
leke
I think it's a case of the leaders restricting the web to its citizens. They
have it, but you need to be special to get it.
------
c0decracker
This reminds me of neighborhood networks of late 90s in post-Soviet era
countries like Belarus and Ukraine that were created for somewhat different
reasons but for pretty much exactly the same purpose. One time we used ancient
ARCNet over the regular TV coax cable with whopping 2.5mbit throughput on a
good day.
------
secfirstmd
Wonder are they using any of the open source tools for mesh networking like
Commotion Wireless
------
blueskin_
Why does Cuba still have oppressive policies such as banning internet access
if they want the US to stop enforcing sanctions on them? Seems the change
should be both ways to me. Such a shame that each seems to want the other to
act first, when if we put them both in a room and told them they'd have to
come to an agreement before they could be let out, the embargo and oppressive
policies would both be over in hours.
~~~
nykwana
>Why does Cuba still have oppressive policies
Oppressive policies like hosting America's 21st century concentration camps at
Gitmo?
~~~
blueskin_
Also true, although Obama shares the blame for having promised to close it
down and not doing so.
------
hectorxp
Some insights:
My guess is this network is something the government have under control, and
they are just experimenting to see how people behave in a connected
environment.
I worked as freelancer in Cuba for over 10 years, so having internet was top
priority for me. I started while studying in the univ, stealing professor's
accounts who had internet access, some friends were separated from the
university when got caught, fortunately I made it through. After graduated the
real "illegal activities" began, met a friend of a friend who was selling
"legal" internet dialup connections (56bkit/s) 120 hours a month for $160
(yes! dollars), "legal" meaning: foreigners students in cuba are allowed to
have internet from their rentals, so someone inside the telecommunication
company (only one in cuba ETECSA) created one of these accounts for you.
Eventually this guy was caught too, and my hunt for connectivity started once
again. A bug on an government controlled intranet allowed you to navigate
(only HTTP no HTTPS) if you happened to know a magic query string, hmmm need
outside help, talked to a friend outside cuba who had a hosting to put a
tunnel/proxy on port 80, this didn't last long either, next option, a guy in a
government company was selling internet (illegal dialup, but only at 33kb/s
for technical reasons), this was "technically" 24h, but you shouldn't used on
working hours for obvious reasons, $250/month, for the first time I was able
to download something greater than 50MB without resume. Oh!! HTTP 1.1 what a
relief!! websites serving files without resume don't know the pain they cause
to us. Well, all sorts of these stories happened until I found the "GUY", this
guy had internet via satellite, he paid the subscription to HugeNET through a
third party. He built a wifi network with APs and some handmade antennas, but
to join to his network you needed to have an potent AP at least 50 ft from the
ground and be located nearby one of his APs. After managing the infrastructure
I finally had a decent internet connection, at a minimal cost $150. At some
point HugeNET cancelled all the connections in cuba, and happiness ended. The
bright side of the lack of internet in cuba is that you really need to focus
and learn the hard way, there's no way you can see a youtube video, skype,
play games, or load endless facebook pages; every time you have an error, the
answer is not two google/stackoverflow clicks away. You need to learn about
everything, from communication protocols, to how the browser's cache works, to
repair your own computer. No technical support, no skype, no G3/4 on your
phone, nothing, just 56kbit/s max 5~6h a day, and a hard drive full of pirated
books.
There are a lot of people freelancing in cuba, so if at some point you had
outsourced some work and your provider disappear for a couple of days, don't
be so hard at them, they might be fighting harder than you think to deliver.
------
yuhong
I wonder if the recent changes in exporting from Cuba will change things.
------
justizin
This is so completely out of Cory Doctorow's "Little Brother". Brilliant book,
highly suggest reading.
Goes to show how accurate his estimation of what censored youth will do was.
~~~
zhemao
Except for the fact that it has the tacit approval of the authorities and is
monitored by volunteers for pornography or political discussions. The Xnet
system in "Little Brother" was feasible because it was working on top of a
well-established existing infrastructure. A system like Snet could not operate
in defiance of the authorities because it could easily be dismantled by taking
down the key links and arresting the operators.
~~~
justizin
They're definitely different, I forget _all_ the technical details of Xnet,
having last read the book a couple years ago, I was mostly talking about the
show of human ingenuity.
Xnet was certainly "informally monitored", though.
~~~
justizin
Wow, pretty shitty that I was downvoted for this comment, when I personally
upvoted the one before it.
#discourse
------
grobinson
Researchers at MIT built an 802.11 mesh network some years back. All it would
take would be one or two gateway nodes in the middle of the mesh and you would
have Internet at a tolerable speed. It would also save having to lay cables
over your neighbours.
[http://www.cs.cmu.edu/~srini/15-744/papers/roofnet-
mobicom05...](http://www.cs.cmu.edu/~srini/15-744/papers/roofnet-
mobicom05.pdf)
------
dharma1
what's the best hardware to go for an el cheapo mesh network with decent range
these days? tp-link with openwrt? ubiquiti?
~~~
hultner
Well I have no experience actually setting up this but some high power
routers/access points with high gain antennas would probably be preferable (at
least if both sides use comparable hardware). I don't know how well the
software stands up from software such as Amped Wireless equipment but they'd
probably be a good from an hardware standpoint. But it might be cheaper jam
wifi-cards in the already available computers and running local software.
I once needed internet access from an server with no physical network access,
however I had an friend living across the hall (quite thick concrete and brick
walls but hardwood doors). That time I were rather successful running two
cheapo PCI wifi-cards with external antennas I had laying around. Used lagg
interfaces (link aggregation in failover mode) in FreeBSD and got a workable
remote terminal session over mosh. It wasn't optimal but it certainly worked.
------
pekk
And what if it turned out that the State Dept. was helping to bankroll this?
It would be consistent with things the US has been caught doing in Cuba just
in the last few years.
Would this change our opinion of it?
~~~
jrochkind1
I am fairly confident the State Dept is helping to bankroll it one way or
another.
It still sounds like super neat tech. I wish we had more technical details.
Presumably it's mesh networking of some kind?
------
teen
I wonder if we can access it from outside Cuba? It would be cool to poke
around.
~~~
zhemao
The article says it is not allowed to connect to the larger internet, so you
can't access it from outside Cuba.
~~~
technomancy
It also says they're using it to play WoW, so I wouldn't trust the technical
details.
~~~
fragmede
Good thing it's impossible to run a private server for WoW since Blizzard sued
everyone out of existence, and there's no way to find so-called 'illegal'
software on the internet.
~~~
technomancy
Huh, I keep forgetting how old WoW is... I just assumed they'd have the
ability to block third-party servers.
I love the irony of Cubans asserting their software freedom against a US
corporation.
------
funkdobiest
This is really cool, my home wifi network is called SNet.
------
Nicholas_C
Fantastic read.
I wonder how hard it is to acquire a computer in Cuba.
~~~
quickvi
Extremely easy in the black market if you have the money. This is the cuban
eBay: [http://www.revolico.com](http://www.revolico.com). It is sometimes
cheaper than in USA in absolute prices, but of course, this is a lot of money
for most normal people.
------
beamform3e8cow
not legal advice; no endorsement of any 'illegal activities' JUST TECHNICAL.
the problem is running an ethernet cable over the roof of a bystander.
a.) spray open wifi all over could be a 'security risk' b.) WIFI beamforming
or point to point and a directed beam. using also a potatato chip pringles can
is a possible solution.
c,) for those engineers, for engineers are disappearing from the USA; why
bother studying technical subjects?
lightning and electrical wires on top of the roof?
d.) it does not seem to BE SECRET SECRET
e.) air gaps may be ok. every two hours fast bicycle ride and the solid state
drive. Obviously only transfer diffs via rsync or whatever protocol.
beamforming with central nodes?
| {
"pile_set_name": "HackerNews"
} |
‘Zuck Buck’ Grilled in the House: Facebook CEO Defends Libra in Hearing - hinchlt
https://sociable.co/technology/zuck-buck-grilled-in-the-house-facebook-ceo-defends-libra-in-hearing/
======
egusa
“Facebook is about putting power in people’s hands… Giving people control of
their money is important, too. A simple, secure and stable way to transfer
money is empowering. Over the long term, this means that more people transact
on our platforms — that’ll be good for our business.”
| {
"pile_set_name": "HackerNews"
} |
Lightworks - necenzurat
http://www.lightworksbeta.com/
======
ibotty
what's the news here? that's only advertisement, isn't it?
| {
"pile_set_name": "HackerNews"
} |
The Australian National Broadband Network board have submitted resignations - xelfer
http://www.smh.com.au/business/entire-nbn-board-resigns-20130922-2u835.html
======
contingencies
Sad, really sad.
Despite being an Australian, I rarely follow the news there, so if someone
closer to the action could confirm and clarify here: the notion was put
forward to build fiber to the home across the country (extremely costly), it
was passed by a government courageously (for supporting any long term benefit
at immediate expense is tantamount to severing a near-term political limb),
the government changed, and the new one is likely appointing the current
chairman of what used to be the state-owned telecommunications provider (sold
off by the incoming government in a prior reign) to 'fix' it.
Does it not appear then, on a macro scale, as if the government gave up its
golden goose and wound up redistributing wealth to many private hands whilst
reducing its actual capacity to get anything done or maintain a semblence of
competitiveness with more successful but similar ventures elsewhere? (China,
France and New Zealand come to mind)
After spending much time living in China, I can only conclude that two party
democracies are essentially incompetent structures for long term
infrastructure.
Perhaps my homeland could fix its NBN project with a pause to enforce
transparency, issue public reports and a referendum. Of course, the government
wouldn't do that ... the've just stolen the goose.
~~~
anthonyb
Yeah, it's the same story across the board really - not even many private
hands, just a small handful of them.
Public infrastructure was never particularly invested in, even under Labour,
but now that the Liberals are back in (I'm in Victoria, so double Liberal for
me) it's "jobs for the boys", more roads, more private health insurance, etc,
etc.
~~~
jacques_chester
"Jobs for the boys" is a universal in Australian politics. Scan the resumé of
anyone appointed to any board, committee, commission, agency etc etc and you
will usually find clear connections to one of the majors.
~~~
vacri
I'm not sure why you needed to specify 'Australian' there.
~~~
jacques_chester
Touché. One of my favourite scenes in _Yes, Minister_ is when Sir Humphrey is
having lunch with Sir Desmond, a banker he needs a favour from. He offers
about a dozen random appointments in the scene -- Potato Board, Wine Marketing
Committee etc. It's great.
~~~
vacri
I've just finish rewatching those series. I'd forgotten how much fun they
were, and surprised at how little had gone out of date.
~~~
jacques_chester
"In Sydney you think it is a comedy. In Canberra we see it as a documentary".
------
redact207
What's the point of a FTTN network? You haven't removed the bottleneck which
is the copper wire infrastructure. This was one thing that could have made
Australia competitive in the years to come, but instead the people who make
the decisions know nothing about it let alone able to spell NBN.
IMO it's not all doom and gloom. By putting in the FTTN "backbone", it leaves
the door open to rewire it to FTTH down the line when the government realises
that commerce is being stiffed because of a slow network.
~~~
cam_l
The big issue will be in the sort of contracts they sign with Telstra to rent
and maintain the copper infrastructure - which by the figures I have seen
published so far may make it _more_ expensive than the FTTH (though no one
really knows at this point).
Given that the point of the FTTN as opposed to FTTH is to essentially maintain
the status quo for the media (and give established businesses, city areas and
the wealthy a competitive advantage - at 2-5G a pop for a connection).. the
likelihood is that the libs will try to lock in these contracts as much as
possible.
It disappoints me that the article seems to suggest that the board quit due to
a lack of faith _from_ the incoming minister, rather than as a gesture which
shows a disturbing lack of faith _in_ the incoming minister.
~~~
jacques_chester
Does this conspiracy theory that Turnbull is doing Murdoch's bidding have any
... you know ... _evidence_?
The cui bono is just stupidly thin. Murdoch makes bugger all on his Australian
operations. If he divested the lot Wall Street would cheer, holler and stamp
its feet.
Edit: "quo vadis" indeed. What's the Latin for malapropism?
~~~
cam_l
I never mentioned murdoch. I think FTTN benefits all established media. I was
also was having a go at smh reporting, so whatever..
But since you ask, I would say the reason why people think there was a
conspiracy is the rabid anti-NBN propaganda by murdoch during the election.
A better explanation perhaps.. [http://theconversation.com/news-corp-
australia-vs-the-nbn-is...](http://theconversation.com/news-corp-australia-vs-
the-nbn-is-it-really-all-about-foxtel-16768)
~~~
jacques_chester
Sorry, I was reading my own pet peeve about conspiracy theories into your
remarks. I've seen all the arguments given before, but honestly, Foxtel just
doesn't make very much money for Newscorp.
And given the huge bargaining power Foxtel has to alter content agreements,
switching to an NBN-based streaming model just isn't the contractual minefield
that it is in the USA (where there are far more cable providers).
I think that most papers came out against Rudd because they were ... against
Rudd.
------
DigitalSea
This whole fiasco reminds me of a hilarious satire article I read recently on
an Australian satire site called The Shovel:
[http://theshovel.com.au/2013/08/26/malcolm-turnbull-
launches...](http://theshovel.com.au/2013/08/26/malcolm-turnbull-launches-new-
logo-for-coalitions-broadband-plan/)
Sadly, we all know this sub-par alternative will be a disaster that will go in
the history books. In 40 years I'll tell my grandchildren, "I remember a time
when you would have to wait 10 minutes to load a video on the Internet" and
they'll laugh and call me crazy. But the sad fact of the matter is, the LNP
party have outdated views on not only Internet access but gay marriage, the
economy and way things work in the real world.
It's going to be a bumpy 3 years, but LNP won't get another term after all of
the crap they've pulled. If I were on the board I'd rather get out before the
impending ship of failure sinks (and trust me, it will).
~~~
zarify
Never underestimate the power of the opposition to snatch defeat from the jaws
of victory.
We could be having Labor leadership scuffles for the next three years.
~~~
GrumpySimon
I agree. Compare what happened in New Zealand when John Key and the National
party ousted the long-term Labor government.
Despite some major missteps from Key/National, Labor's spent the last term and
a half fighting amongst themselves about who will lead it. There just wasn't
the talent or the public respect for the interim leaders that could compete
with Key.
My money's on a few Liberal terms in government, I'm afraid. The scary thing
is, the second time they get voted in, they'll treat it was a strengthened
mandate to do what they want.
------
anthonyb
Disgraceful, IMO. The last Liberal government over here entrenched Telstra as
a monopoly by selling it off in its entirety. They were kicked out of the
process last time, due to not taking it seriously, now that their cronies are
back in power, they're off the hook.
[http://abbotsinternet.com.au/](http://abbotsinternet.com.au/) gives a good
idea of just how bad the offerings over here are. And that doesn't show half
of it. My internet drops on a regular basis, and if you call out a technician
you will typically get slugged with a callout fee of $100 or so regardless.
From... Telstra, because they run all of the phone lines, even though I want
to get as far away from them as possible.
~~~
shaunpud
FTFY [http://abbottsinternet.com.au/](http://abbottsinternet.com.au/)
------
ajtaylor
One thing that always puzzled me about the NBN rollout was why they chose to
do the least populated areas first? It seems that it would have helped to
allay the cost concerns if they had brought it to more populated areas where
the customer uptake would have been greater. By doing places like remote
Tasmania (among other small customer base areas), they pretty much guaranteed
disappointing numbers up front.
~~~
vacri
Brunswick in Melbourne is a pretty solid medium-density suburb, and the area
within it that got the NBN is the most dense of the lot - and was one of the
first rollouts. It's also one of the politically safest seats in the country,
held by a no-name MP, Kelvin Thompson. Maybe he has a lot of behind-the-scenes
power? I've certainly never seen his name outside of local papers. Or maybe
someone high up in the NBN planning committee lives there? I never could
figure out 'why there?', and simply assumed that the rollout areas were
political.
The NBN rollout area missed my house by about two streets...
~~~
contingencies
_The NBN rollout area missed my house by about two streets..._
Aha! So maybe _FTTN_ (Fiber To The Neighbour) or _FTTO_ (Fiber To The Others)
would be more accurate topology summaries?
------
enneff
> Former Telstra boss Ziggy Switkowski is waiting in the wings to be appointed
> executive chairman.
That's all that needs to be said, isn't it?
~~~
Volpe
Isn't most of NBN Corp made up of ex-telstra... Where else would they get
communications engineers?
| {
"pile_set_name": "HackerNews"
} |
Headless Chrome support in Cloud Functions and App Engine - idoco
https://cloud.google.com/blog/products/gcp/introducing-headless-chrome-support-in-cloud-functions-and-app-engine
======
rmdashrfroot
I wrote a collection of Dockerfiles for images running Python 2.7 or Python
3.6 + Selenium with either Chrome or Firefox and using Xvfb for the X display
(necessary for running Selenium headlessly).
[https://github.com/seanpianka/docker-python-xvfb-selenium-
ch...](https://github.com/seanpianka/docker-python-xvfb-selenium-chrome-
firefox)
Using this, in conjunction with AWS Step Functions, Lambda, and ECS, it became
merely cents a month to run a headless scraper task in the cloud.
~~~
lars_francke
Can you elaborate a bit? Sounds interesting. I had never heard of AWS Step
Functions before.
What does your workflow look like?
~~~
tjbiddle
Not OP, but to elaborate on AWS Step Functionss:
In short - this gives you the ability to pass the output of one lambda
function to the input of another lambda function.
An example of one that I've written to regularly create a new copy of our
Production RDS database in Ireland as a Staging RDS database in Oregon.
1\. Cloudwatch Event starts Step Function on the 15th
2\. Copy last Production snapshot from Ireland to Oregon
3\. Restore this snapshot as a new RDS instance (It will fail until the
snapshot is available and retry with exponential backoff - this is a step
function feature)
4\. In parallel:
- Add tags to the instance (Once it's available)
- Delete the snapshot copy (When finished restoring)
- Modify the new instance with security groups and subnets
- In parallel:
- Run a SQL query to anonymize all of PII columns for GDPR compliance as data has now left the EU.
- Call out to the Cloudflare API to update our DNS entry with the new RDS endpoint.
- Delete the old Staging database instance
~~~
ocdnix
Do you run into problems with Lambda's 5-minute maximum execution time for
those kinds of operations? I'd like to do something similar to this for both
RDS and DynamoDB, but the execution time will often surpass 5 minutes, meaning
I'd have to run a Step Functions worker on EC2 or ECS. That opens up a whole
bunch of complexity with managing the worker code and its deployment, which
I'd rather avoid if possible.
~~~
tjbiddle
With the current implementation; no problems hitting the limit. As mentioned
in my below comment, our query for anonymization would be the heaviest - but
it's designed to be quick as we don't care about unique values for most data.
If we did though - Fargate is a great solution for it, but you wouldn't be
able to feed data back into the next step without some additional complexity -
Maybe have the next step pull an SQS queue, or an S3 file, or look for a
database entry, etc. as it's next bit of data that it needs - and just fail
until it finds it, and once the Fargate (Or whatever) has done it's job and
placed it in your method of choice, then it could continue.
------
mostlystatic
I tried to use Headless Chrome on Cloud Functions for a project I'm working
on, but even on the fastest instances loading pages was sometimes really slow
(pages timing out after waiting for 60s).
It seems sometimes JS execution was taking a long time, so I guess that was
preventing requests from being made. In a single CPU cloud function you have
network requests, JavaScript execution, rendering, and the Node process
controlling the browser all competing for resources.
That being said, it was super simple to get started!
~~~
python999
Do simple hello-world HTML pages render ok? I found that rendering was slow-
ish but totally acceptable for reasonably heavy HTML pages, so long as we
weren't flooding page re-renders (eg by using React without any optimisation
of render calls)
~~~
mostlystatic
Yes those were fine.
------
iamjustlooking
Among other things with puppeteer we do screenshot generation using GKE on
Google Cloud @ [https://screenshots.cloud/](https://screenshots.cloud/)
scaling up and down running instances depending on demand. We keep browser
instances running constantly as the startup time is significant. I will be
interested to see what the startup time is for puppeteer on this, will
definitely be giving it a try.
~~~
exikyut
Nice reference immediately above "used by us" :)
One completely unrelated thing. On Chrome 68.0.3440.84, I noticed the large
icons (particularly the Kubernetes one) looked "weird", with jagged edges that
didn't make any sense. Some poking with the devtools revealed that 'backface-
visibility: hidden' seems to be disabling antialiasing.
Suggest opening the following in new tabs so you can flip back and forth
between them:
\- As is right now:
[https://i.imgur.com/nYzsukI.jpg](https://i.imgur.com/nYzsukI.jpg)
\- Nicer-looking:
[https://i.imgur.com/GNlvx7Z.jpg](https://i.imgur.com/GNlvx7Z.jpg)
I noticed disabling this has an effect on the animation at the top (the edges
of the moving webpage slides don't have constantly-moving jaggies).
There may well be a valid reason you have this enabled, perhaps for added
performance. Or perhaps React added it in for you? :P
~~~
iamjustlooking
Thanks for spending time to let me know because I don't think I would have
noticed it otherwise! I can't see it on retina but I can on my non retina
display. We'll have to make the CSS rule more specific. As to why it's there I
believe Firefox 57 or around that version had an issue with the sliding
animation on the top of the page causing images to tear or not render at all
when they scrolled in. This bug must have been solved recently because
disabling backface-visibility on the image doesn't cause the same tearing.
~~~
exikyut
I was very curious what was causing the non-antialiasing, it was fun.
And you can repro :) cool. Makes a lot of sense you can't see it on retina.
Interesting FF bug you hit. CSS3 GPU-accelerated animations are incredibly
complex... heh, adding the rule fixed Firefox ~57, but now Chrome 68 is
glitching out _because_ the rule is there. I wonder if Google realizes yet.
_Ponders complexity of creating minimal testcase, versus waiting for someone
else to notice :P_
------
bergie
Nice to see this concept get into the big cloud platforms. We built something
similar couple of years ago, primarily to get a sandbox for some compute jobs
we were running on Heroku:
[https://github.com/flowhub/jsjob](https://github.com/flowhub/jsjob)
------
k__
Does this mean that HC is preinstalled in the runtime?
Becauee as far as I know you can already run HC with other FaaS solutions, but
having this out of the box would be really nice.
~~~
tnolet
Running Headless Chrome / Chromium is a bit of a hassle on AWS Lambda and
other FAAS providers. Chrome requires some specific bindings/binaries to work.
I think the Chrome guys and girls convinced their Cloud coworkers to provides
these in the underlying Linux machines that run the Cloud Functions.
~~~
mylesborins
exactly this. The base operating system comes with the system libraries
necessary to support headless chrome out of the box.
(disclaimer: I work for Google Cloud)
~~~
giancarlostoro
What's to really stop other providers from doing the same thing though? :)
~~~
manigandham
Nothing. It's about developer convenience, not technical possibility.
------
mrskitch
If Google cloud ain’t your jam then checkout browserless
([https://browserless.io/](https://browserless.io/)). It can be considerably
cheaper under certain situations, and we’ve been up and running for almost a
year. Happy to answer questions if anyone has any.
EDIT: We’ve got stuff on GH:
[https://github.com/joelgriffith/browserless](https://github.com/joelgriffith/browserless),
and startup is under 100ms most of the time. Fonts and other things “just
work” as well, plus there’s a slew of REST APIs for common stuff as well.
Selenium webdriver support landing soon!
~~~
jotto
...and if browserless ain't your jam, checkout
[https://www.prerender.cloud/](https://www.prerender.cloud/)
cheap, because we optimized for just 3 things:
pre-rendering, screenshots, or PDFs for $0.000365 per API request
curl https://service.prerender.cloud/screenshot/https://google.com/ > out.jpg
curl https://service.prerender.cloud/pdf/https://google.com/ > out.pdf
curl https://service.prerender.cloud/https://google.com/ > out.html
~~~
Operyl
Pricing is in tiers, not per request as you seem to imply?
~~~
jotto
Correct, only the final tier is variable rate; apologies for the confusion.
Under 20,000 monthly requests = $9 flat rate ($0.00045)
Under 100,000 monthly requests = $40 flat rate ($0.0004)
>= 100,000 monthly requests = variable rate @ $0.00036/req
~~~
Operyl
Yeah, that's completely different than what you were trying to imply. Still a
cool service, though.
------
schappim
I wish Google would support Ruby!
If you do too checkout the petition over at [https://www.serverless-
ruby.org](https://www.serverless-ruby.org)
~~~
mrskitch
Something somewhat related: I think more Cloud providers need to start doing
Docker-functions. It’s always going to be a waiting game for runtimes and
upgrades. Docker is portable and can run just about anything, so why not
support that?
[https://zeit.co/blog/serverless-docker](https://zeit.co/blog/serverless-
docker) is an example of what I mean
~~~
hugelgupf
See the "Serverless Containers" section on [https://www.google.com/amp/s/gweb-
cloudblog-publish.appspot....](https://www.google.com/amp/s/gweb-cloudblog-
publish.appspot.com/products/gcp/cloud-functions-serverless-platform-is-
generally-available/amp/)
It's still in alpha, so Google is not advertising it wide. It was announced
about a week before Zeit's Serverless docker at GCP Next.
Disclaimer: I work at Google and I've had some involvement in the tech behind
this.
~~~
exikyut
That's an interesting domain: '[http://gweb-cloudblog-
publish.appspot.com/'](http://gweb-cloudblog-publish.appspot.com/')
(it just redirects to cloud.google.com)
------
antoncohen
I think it would be pretty cool to use Cloud Functions as a Selenium Grid,
sort of like Zalenium
([https://github.com/zalando/zalenium](https://github.com/zalando/zalenium))
does with Kubernetes. If you could parallelize end-to-end tests enough, you
could get massive burstable capacity to run parallel tests.
------
wslh
Not perfect but HtmlUnit anyone? I used it for scraping in the past with mixed
experiences.
~~~
ksahin
HtmlUnit API is really cool. It's fine for most use cases. But obviously the
Javascript support is not perfect. [Shameless plug] I wrote a book about web
scraping where I talk about HtmlUnit & headless chrome with Java:
[https://www.javawebscrapinghandbook.com](https://www.javawebscrapinghandbook.com)
------
tnolet
I've been screwing around with running Headless Chrome & Puppeteer on
Lambda/Serverless/FAAS solutions. It's all a bit of a mixed bag. You CAN run
Headless Chrome on AWS Lambda, but the cost involved is pretty crazy as you
need ~1500Mb in RAM to comfortably run any code with Chrome.
Google Cloud of course has "inside knowledge" and I would love to switch to
them for my SaaS [https://checklyhq.com](https://checklyhq.com), were it not
that Google Cloud Functions is just offered in four (!) regions...
~~~
mrskitch
Great to see you here Tim, love that chrome extension! We should chat a bit
more sometime. I’d love to back checkly’s infrastructure.
------
pwaai
that's it...im moving to GCP
sorry but Rekognition rekt it for any type of computer vision on AWS.
Great infrastructure...after all I do have an AWS Solution Architect Associate
certification....which means jack shit
Great move by GCP, I'm also very pleased with Firebase and it's integration
with cloud functions....
BUT my biggest reservation still in 2018 when it comes to serverless is the
cold start up time...
I built a token based API on AWS Lambda and registering, signing up took
forever when the app was not at peak. that was 2014 tho.
~~~
aviv
We use GCP heavily. It's really great.
Latency between Google Cloud Functions and other GCP products improved
significantly in the past week, as did start up and execution time.
However we only use GCFs for background tasks and not for any web API/micro
services, etc. Still too much latency for that use case.
------
guiomie
Ok, I was just looking into this 1 week ago and was gonna spin up a VM to do
headless. Now I get to keep my firebase project in cloud functions only. Much
cleaner architecture.
------
defied
My company provides a similar service, with both Chrome and FireFox headless
support for Automated Testing/Screenshots:
[https://testingbot.com/support/getting-
started/headless.html](https://testingbot.com/support/getting-
started/headless.html)
We run each test in a new VM, running on our own private cloud (dedicated
servers).
Note: we use the Selenium protocol for this, not yet Puppeteer.
------
patd
I'm currently using a headless Chrome for my latest project www.blockedby.com
(still in alpha stage, looking for feedback)
I've been looking at a non-local solution. I'm using Python and this article
hints that Puppeteer is not the only way to invoke this. But I don't see any
documentation on the DevTools protocol.
Anyone knows if it's supported ? Or any providers that do ?
~~~
transreal
You should just need to get a handle on the host and port to use Devtools
protocol to talk to the launcher headless chrome instance. If you use node.js
to start it, you can get the port like this:
[https://github.com/GoogleChrome/puppeteer/blob/master/docs/a...](https://github.com/GoogleChrome/puppeteer/blob/master/docs/api.md#browserwsendpoint)
Then you can use PyChromeDevtools to connect to that host/port:
[https://github.com/marty90/PyChromeDevTools/blob/master/READ...](https://github.com/marty90/PyChromeDevTools/blob/master/README.md)
------
kwerk
I’ve tested HC on GCF and GAE standard with the IO launch. Sadly they’re 3-10x
slower than App Engine Flex (same vm size on App Engine Flex vs Standard).
Even a screenshot of google.com takes 6+ seconds on GCF / GAE Standard vs 2
seconds for Flex. I hope they fix this as spinning to zero is important for me
but the latency is too high right now.
------
nojvek
I don’t know what this means for browserless.io but I hope he still retains a
strong niche and has a desirable product.
------
eknkc
Tried HC just yesterday on cloud functions. For some reason, it runs extremely
slow. Did some comparisons to AWS lambda with similar memory / cpu sizes and
basic “load page and screenshot” jobs would take 2x - 3x more time on google
cloud functions.
I’ll dig deeper soon but this is a bad start.
~~~
leesalminen
Is it still within say 5 seconds?
Do you get the impression there’s some config tuning to do or something you
can’t control?
------
dakom
Can someone please explain what the advantage of running a snapshot service
via GCF would be vs. AppEngine Standard (w/ node)?
~~~
wereHamster
Lower costs. With AppEngine you pay for a whole instance, regardless of how
much utilisation it gets. With cloud functions you only pay for the time the
function is being executed. If your code isn't being executed often, GCF are
much cheaper.
~~~
dakom
Oh I see... AppEngine is also "pay for what you use" but it seems it's rounded
to 15 mins rather than CloudFunctions which is 100ms. Thanks!
------
isuckatcoding
I wonder how feature/pricing compete with Browserless?
~~~
mrskitch
Our small instance ($30/month) is roughly similar to their $44.38 instance on
App Engine. If you were to run a full 10 concurrent sessions constantly, which
a small browserless instance can max-out at, this would cost roughly $427 a
month in Functions. So depends on your use-case
~~~
fefb
For reference, how did you get $427? Thanks in advance
~~~
mrskitch
Running 10 concurrent Google Functions at 1GB/1CPU. Assumes 30 days in a month
~~~
fefb
I am getting a different price from GCP calculator. Almost $2000. In your
example, 10functions por Second, so each function is taking 1000ms to finish.
2592000s in a month * 10invocation = 25920000 invocations month, running with
a 1GB function and 500kb of network bandwidth (out).
[https://cloud.google.com/products/calculator/#id=555e1af7-c8...](https://cloud.google.com/products/calculator/#id=555e1af7-c858-4573-9d8a-a7d87475c236)
~~~
mrskitch
Ah, I wasn’t calculating their other fees like invocations and networking
costs. Crazy it’s almost an order-of-magnitude
------
techsin101
How Google is behaving recently... I can feel it becoming Oracle. I want to
stay 10 miles far from it. Learned my lesson with Google maps.
------
benatkin
I'm not buying it, Google Cloud just moved to node 8 earlier this year as the
post says, but now it's node 10. It's just not good tech, it's unnecessary
lock-in. Docker on anything is better, this is similar:
[https://zeit.co/blog/serverless-docker](https://zeit.co/blog/serverless-
docker)
~~~
chrisabrams
It’s wonderful tech that has saved us thousands a month. The lock in is very
little as it’s running a JS function. We’ve written our functions so that the
export to the GC function merely passes in arguments to another function that
is required. We could move to AWS, Zeit, or anywhere else with little
friction.
~~~
benatkin
Please do, then, it's better for everyone in the node ecosystem if people
aren't running node 4.x in 2018.
~~~
antonvs
Would you be happier if people switched to some other language for their cloud
functions? Node is not that important.
------
jancurn
It's nice to see serverless platforms adding support for headless Chrome. But
there's still one problem with AWS Lambda / Cloud Functions / Zeit Now - the
run time is limited to a few minutes. If you want to run any longer job, e.g.
a web crawler, you need to either spin up the instances yourself or use
platform like Apify, which allows running arbitrary-long jobs, provides pre-
built Docker images for headless Chrome or XVFB, and provides SDK to simplify
state persistence, access to proxies etc.
For example, a simple actor to convert HTML to PDF looks like this:
[https://www.apify.com/jancurn/url-to-pdf](https://www.apify.com/jancurn/url-
to-pdf)
More info:
[https://www.apify.com/docs/actor](https://www.apify.com/docs/actor)
[https://www.apify.com/docs/sdk/apify-runtime-
js/latest](https://www.apify.com/docs/sdk/apify-runtime-js/latest)
[https://www.apify.com/library?type=acts](https://www.apify.com/library?type=acts)
Disclaimer: I'm a co-founder of Apify
| {
"pile_set_name": "HackerNews"
} |
A gentle introduction to return-oriented programming - iamwil
http://blog.zynamics.com/2010/03/12/a-gentle-introduction-to-return-oriented-programming/
======
iamwil
Looked it up because of <http://news.ycombinator.com/item?id=1217310> and
hadn't heard of it before.
As a side note, Morris worm mentioned in the diagram tickled me.
| {
"pile_set_name": "HackerNews"
} |
Ask HN: Interested in a site for listing startup ideas you want done? - haliax
I know there are a lot of experiences out there that frustrate people, and that they'd like to see done better (think cloud storage pre Dropbox), but unless you <i>have</i> one of those problems, it's pretty tricky to know that it exists, and even then, it's tricky to know that there's a sizeable market for it. But if people could post their frustrations online, it would be pretty easy for would-be entrepreneurs to find good markets, and the rest of us would get better products...seems like a win-win to me. Thoughts?
======
SABmore
Yes. I had a similar thought last year, registering
ideaserving/ideaservingsize.com, but obviously never did anything with it. My
thought was to have folks post their ideas, and each day you'd see/get a list
of 3-4 new ideas. If you liked one of the ideas you could then connect with
the submitter. All the best.
------
breathesalt
Be lean. Create a stack exchange proposal at
<http://area51.stackexchange.com/>, make a new HN post linking to it, and
we'll see where this goes. But anyone interested should try making the
proposal, since it seems the OP has already lost interest.
------
brittohalloran
YEAH. I always thought this would be a good idea. A place to post good ideas
that I don't want to or have the time or means to do. An "idea exchange". I
half think that something like this already exists, but I've never seen it.
------
ohnivak
Infinitly scalable real-time website analytics and server monitoring.
<http://vanillamonitor.com>
------
bmelton
Not saying it should deter you, but there are a LOT of sites that already do
this. The first that I know of was either "shouldexist.org"[1] or "The
Halfbakery"[2], but there are more. [1] - <http://shouldexist.org/>
[2] = <http://halfbakery.com>
<http://Thinkcycle.org>
<http://ideaexplore.net/>
<http://www.whynot.net/>
<http://www.globalideasbank.org/site/home/>
<http://www.ideas4all.com/>
<http://www.springwise.com/ideas/>
Most of them are in various states of sucking, but Springwise looks pretty
nice, and I like the half-bakery if only for nostalgia.
------
yashchandra
i like this one:
<http://www.ideaswatch.com>
| {
"pile_set_name": "HackerNews"
} |
Necunos is selling FOSS phone today - drctee
From their web store
======
snazz
Interesting. Having heard so much about the Purism phone, I’m surprised that
this slipped under my radar. The price does seem a bit much, though, for what
it is.
------
pkphilip
Its ridiculous. It is not even a dumb phone let alone a smart phone. There is
no SIM, no cellular modem, no Wifi, no net connectivity of any kind.
------
Down_n_Out
Is this a normal price for an engineering unit, no cellular modem or SIM-card
capabilities? I get they need to get some funds together but on the other hand
they need to attract engineers to develop on these phones no? Genuinely
curious.
------
tony-allan
[https://necunos.com/shop/#!/Necunos-
NC_1/p/127507133/categor...](https://necunos.com/shop/#!/Necunos-
NC_1/p/127507133/category=0)
------
tadzik_
Welp, it's hardly a phone if you can't call from it. A mobile device, perhaps.
| {
"pile_set_name": "HackerNews"
} |
Unsigned apps on High Sierra can programmatically dump and exfil keychain - EwanToo
https://twitter.com/patrickwardle/status/912254053849079808
======
0x0
So.. is this specific to macOS 10.13? Or is 10.12.6 also vulnerable?
~~~
gondo
"other versions of macOS are vulnerable too" the author confirmed it on
twitter
[https://twitter.com/patrickwardle/status/912392633909047296](https://twitter.com/patrickwardle/status/912392633909047296)
------
teilo
Patrick Wardle (the source of this video) is on a roll today:
[https://www.synack.com/2017/09/08/high-sierras-secure-
kernel...](https://www.synack.com/2017/09/08/high-sierras-secure-kernel-
extension-loading-is-broken/)
~~~
teilo
This makes me wonder if the vector for this exploit is a kernel extension that
subverts the keychain service. Except that the kernel loading exploit appears
to require root privileges.
------
zimpenfish
Is there actually any external verification that this can be done?
~~~
Twisell
On the screencast it appear that the dialog box have been reworked to be less
constraining than in Sierra where you needed to go to Preferences>Gatekeeper
to allow execution of unsigned app.
I haven't tested the beta so this struck me, can someone confirm?
~~~
eridius
Right-clicking an app and selecting "Open" has always given you the ability to
bypass Gatekeeper. It's been that way since Gatekeeper was introduced.
------
Osmium
This is scary if accurate.
For people unfamiliar with Keychain, the problem as I understand it is _not_
that unsigned apps can do this per se (though I don't think this is a good
idea), it's that they can do this without user intervention.
The normal flow for Keychain is that when an app wants access to a keychain
item that was not created by that app, it has to ask for user permission to
allow once or always allow access. It sounds like this isn't happening in this
case.
(Aside: it used to be possible to trivially access all website passwords in
Safari too (which I dutifully reported as a bug, because it was a terrible
design choice), but Apple thankfully changed this to require authentication in
new versions of Safari.)
------
raimue
From a security perspective, I would assume that signed binaries should not
have additional restrictions that are also not in place for unsigned binaries.
Would this exploit also work with a signed app as well, but avoiding the user
confirmation?
~~~
teilo
There is no difference between a signed and unsigned app once it has been
allowed to launch the first time. The permission model is the same for both.
Normally you would have expected to see a system dialog asking if you would
like to grant an app permission to access the keychain once or permanently.
EDIT: As another commenter pointed out, an app is also only granted access to
one key at a time, each requiring an independent confirmation (with password).
There is no way (normally) to grant cart-blanche access to the entire
keychain.
~~~
anyfoo
False. Signed apps can have entitlements, unsigned apps cannot. Some
entitlements grant access to keychain items.
~~~
teilo
Completely wrong. Entitlements are for sandboxed apps, and grant a sandboxed
application access to other parts of the system. Unsigned apps are by
definition, not sandboxed, and have no such restrictions. They are granted
access, not by a sandbox entitlement, but by the Keychain API.
~~~
mikeash
There are both sandbox and non-sandbox entitlements. iCloud storage and push
notifications are examples of the latter.
~~~
teilo
Granted. In any case it is not relevant in the context of this discussion.
Access to the local keychain does not require an entitlement. Even the
"keychain-access-groups" entitlement only applies to the iCloud keychain.
------
Cthulhu_
"Unsigned" apps, I'd recommend a headline update to provide a bit of nuance.
How safe are unsigned apps anyway? I can imagine it's "all bets are off" level
software.
~~~
mikeash
Keychain is supposed to require user authorization before returning any data.
Unless you're running as root, it's certainly not "all bets are off." Even if
you are, the keychain is supposed to use crypto which would prevent reading it
without the user's consent.
~~~
eeeeeeeeeeeee
It's debatable.
Once the user has installed unauthorized software, the attacker can simply sit
and wait for the user to expose more goodies (logins, bank data, 1password
access, etc). In many ways, it is game over. If the attacker can leverage that
to get your admin password, prompts are not going to save you.
------
Jdam
Proves me once again that the best password vault is sitting on my shoulders.
~~~
alien_at_work
How does that work? With Keychain I literally have a different password on
every single site I visit. If someone hacks Facebook they'll have... my
Facebook password (and whatever sites use OAuth and won't let me opt out of
it). Does your brain consistently handle that level of password
diversification, because that's the best defense against password theft.
~~~
Waterluvian
For many years now I've used an algorithm for password generation that I keep
in my head. It's pretty simple, I have a memorized string (like a traditional
password), and a memorized set of rules. For example, I might have a rule
where I take my password, replace the first character with the first character
of the product (a for Amazon), and replace the last letter with the type of
product I'm using (s for shopping).
I have a significantly more complex algorithm than that, but you get the idea.
Every password I have is different, but they're all trivial to remember. This
isn't super hardcore security, but it helps me have like 40 passwords that are
all different.
~~~
snowwolf
So your password has a root password and probably 2-4 pseudo random characters
appended/prepended/replaced? That means once it has been leaked in 1 breach,
your 'true' algorithmic password is only 2-4 characters long. Which should
take a few minutes to crack on other sites. And the more breaches you are
included in, the easier it would be to work out your algorithm, reducing the
number of attempts further.
But they aren't going to target me specifically? They won't. They just find
everyone whose password across multiple breaches is similar (Levenshtein
distance or something) and brute force the differences.
~~~
Santosh83
> But they aren't going to target me specifically? They won't. They just find
> everyone whose password across multiple breaches is similar (Levenshtein
> distance or something) and brute force the differences.
Is this possible when the leaked passwords are all only salted hashes?
~~~
snowwolf
You mean like LinkedIn (SHA1 hashes without salt), Adobe (Poor Crypto),
Dropbox (half of them SHA1), etc., etc.
[1]
[https://haveibeenpwned.com/PwnedWebsites#LinkedIn](https://haveibeenpwned.com/PwnedWebsites#LinkedIn)
[2]
[https://haveibeenpwned.com/PwnedWebsites#Adobe](https://haveibeenpwned.com/PwnedWebsites#Adobe)
[3]
[https://haveibeenpwned.com/PwnedWebsites#Dropbox](https://haveibeenpwned.com/PwnedWebsites#Dropbox)
------
altitudinous
Isn't this how keychain works?
This is clearly not remotely executable, it needs to be run on the device that
is signed in.
Say you visit facebook.com, your password is in the keychain, so the keychain
must be decrypted to return the plaintext password so it can be passed in the
password field to facebook.com
This is how keychain works isn't it??
You can view your entire password list in Safari Preferences - it does the
same thing.
So this is nothing? Someone has written a command line version of this same
tool.
Am I missing something, this seems to be normal functionality of the OS for a
signed in user.
~~~
teilo
No. Application access to the keychain is restricted via an API with a
(supposedly) robust security model behind it, for precisely this reason.
Applications must explicitly be granted access to the keychain. There should
have been a prompt requesting keychain access.
~~~
mikeash
Furthermore, it's supposed to ask about each item the app wants to access. You
can see this in Keychain Access. Pick a password, inspect it, click the Show
Password box, and a prompt will appear asking you to authorize it before it'll
show you anything. That's part of the Keychain API, not something special to
Keychain Access.
~~~
lloeki
Also visible with the built-in CLI tool security(1):
$ security find-internet-password -s www.facebook.com -g
~~~
thoughtsimple
Didn't work for me on today's release of macOS High Sierra.
~~~
teilo
Works for me on HS.
| {
"pile_set_name": "HackerNews"
} |
15-Inch MacBook Pro with Touch Bar Has Non-Removable SSD - noarchy
http://www.macrumors.com/2016/11/15/macbook-pro-touch-bar-non-removable-ssd/
======
static_noise
>90% of Apple customers wouldn't replace their SSD anyways and why should
they? In a cloud connected world local storage doesn't matter like it used to.
If you don't like it, don't buy it.
------
zygimantasdev
At least it is fast. [1]
1345MB/s sequential write
2000MB/s sequential read
And 13 inch model's SSD is replaceable [2]
[1] - [http://wccftech.com/macbook-pro-2016-fastest-stock-
ssd/](http://wccftech.com/macbook-pro-2016-fastest-stock-ssd/)
[2] - [http://wccftech.com/macbook-pro-13-inch-ssd-fast-
replaceable...](http://wccftech.com/macbook-pro-13-inch-ssd-fast-replaceable/)
------
brazzledazzle
That's unfortunate.
| {
"pile_set_name": "HackerNews"
} |
Why Draw Something Is A Hit - hamey
http://www.bonobolabs.com/the-7-sneaky-reasons-why-draw-something-is-a-hit/
======
msluyter
I've enjoyed the game, but it seems to have a short shelf life. I started
playing with about half a dozen co-workers last week, and now almost all of
them have quit playing. This may in part be due to a.) not enough words (I'm
seeing a lot of repeats), b.) time required to play -- drawing an elaborate
picture (or watching it be drawn) takes considerable time (on an iPhone), and
I often find myself shying away from the game for that reason.
Finally, I'd add that the game has a few annoyances. For example, the popup
requesting you to rate the game in the app store can't be ignored. You must
either rate the game, or postpone doing so. I also lost all of my purchased
colors after an update. Clearly they're having growing pains, but my
enthusiasm is waning.
~~~
afterburner
"or watching it be drawn"
I believe there's a skip button? Never tried pushing it, though.
~~~
roc
You send drawing 1 to player B. They watch it being drawn and guess. They send
you drawing 2. When you open your app you see drawing 1 happen again and
player B making their guess. You can skip that. Then you're shown drawing 2
and can make your guess.
You can "pass" during drawing 2, but that ends the game (streak) between you
and player 2.
And though the streak doesn't really matter, it means that, no, you can't
really 'skip' watching the other player's drawing stroke-by-stroke. You can
only choose to stop playing.
~~~
rictic
I think they hit the right compromise here. As you said you can give up and
pass on the word. If you get the word early then it shows you the final
drawing then moves on to the next turn.
Not allowing someone to skip to the final drawing when they do want to play
but can't guess the answer yet is a feature, not a bug. It allows new
strategies, like drawing a series of states to show a change. It also gives
you a sense of the other person, it's a big part of the fun sense of
communication that you get with the game.
A skip button, if added, would be widely used and make the game worse.
------
carlsednaoui
For those having a hard time getting to the article.
<copy>
1\. Watching friends screw up is fun
This is genius. Draw Something combines the benefits of asynchronous gameplay
(easier to play with friends instead of strangers because they don’t have to
be online) with the benefits of synchronous gameplay: watching the action in
quasi-realtime. Watching your friends painfully draw a crude Tom Hanks stroke-
by-stroke is just good ol’ fashioned fun. Even better, this acts as an
indirect communication channel for users to write messages and clear the
screen before starting the actual drawing.
2\. There isn’t a freaking back button
When you tap on a game to have a turn, there is literally no way back. You are
forced to complete the turn before you can view your other games. Given most
players have a lot of games on the go, they are keen to get back to the home
screen and see who is ready to play. If you play Words With Friends, how many
times have you tapped on a game, not thought of a move then tapped back to try
another game? Draw Something forces you through the turn which keeps the whole
machine ticking over faster.
3\. Play for seconds or hours
The amount of time you want to dedicate to playing is completely variable. If
you are waiting in a queue you can spend 10 seconds drawing a quick move on a
single game. If you really want to knuckle down, you can slave over every
pixel for 20 games and spend hours playing it. This is vital for a mobile
casual game to fit into all sorts of time-killing / entertainment situations.
4\. Natural encouragement to start new games
You just finish 5 moves and are waiting on everyone to have their turn…what do
you do? Start another game of course! Why wouldn’t you when you can see all
those other fun Facebook friends are ready to play?
5\. Cooperative playing where scoring actually doesn’t matter
Most game developers spend a huge amount of time trying to tune scoring
systems and get the balance right. In Draw Something it’s all kinda a bit
vague…and that’s a good thing. If you are really into scores, you can dive
into it. Most regular players just have fun guessing drawings from their
friends (and maybe getting a decent streak). You are essentially working
together, which can be a lot less intimidating for people who are worried
about not being good at games.
6\. Virtual ice breaker with Facebook crushes
Seriously, don’t tell me you didn’t start a sneaky game with that guy/gal you
don’t really know but thought “why not”. Given the tight Facebook integration,
it makes it socially acceptable to start a game with someone on the outer edge
of your social circle. Because there isn’t a chat option, it forces you to
communicate purely through drawing which can be far less awkward.
7\. Words are taken from pop culture
Rather than just ripping a bunch of words straight from the dictionary…you end
up drawing things like Lady Gaga or Dubstep. Far more stimulating!
</copy>
~~~
hamey
Thanks for posting, back up now ;-)
------
nextstep
Being able to see your friend's brush strokes as they draw is very cool. It is
fun to watch people draw because it is interesting insight into how people
think. Also, clues can be given through "actions" this way, e.g. the word
"wind" can be clued through the action of the artist, and this information
would be lost if users could only see the finished product.
Additionally, the reverse is interesting and fun as well: it is kind of fun to
see your friends guess the word in realtime. This way, you get to see what
clue in the drawing finally made it click for your partner.
------
obiefernandez
Not having a back button is a big deal. You sit there and think "well, I
better just whip out a drawing so I can get back to my list of games" -- the
only alternative is to exit back to the homescreen and wait some undetermined
time (perhaps for the app to be moved out of memory?)
But the point is that forcing you to play the next turn in the round instead
of picking another game acts to perpetuate engagement very effectively.
~~~
wbrendel
You can force quit the app, and it will relaunch to your list of games.
~~~
toadkick
Heh, which I find myself doing frequently. Every time I get to the point where
there are no "easy" choices for words to draw, I find myself force-quitting
the app, relaunching, and playing a round with someone different, and then
coming back to the round I skipped (incidentally, you get offered new word
choices in this case). Hard to say whether having a "back" button would end up
discouraging people from continuing the game or not without some A/B testing,
and I have a hunch that not having a back button probably keeps people in the
game a little longer, but I still wish there was a back button. I'd like to be
able to return to the same point in the round instead of having to completely
restart the round again.
EDIT: something else occurs to me too. When you are presented with a list of
words to draw, you have the option to "bomb" the list and get new words. As I
mentioned, if you force quit the app at this point, and come back to that
round, you will be offered different words, for free (definitely an exploit if
you are patient enough to go through the process of force-quitting and
restarting). I guess putting a back button on this screen would pretty much
obviate the need for the "bomb" button, and would directly impact their bottom
line since people wouldn't have as many opportunities to use their bombs. I
have a suspicion that _that's_ the reason there is no back button...the fact
that it doesn't give players a chance to back out and keeps them a little more
engaged it probably just a happy side effect.
~~~
freehunter
I was frustrated by the new word choices popping up after quitting, actually.
I had a pretty awesome drawing, the app crashed, and the new choices were
pretty lame.
Minor quibble, I know, but it does seem odd that you get new choices just by
quitting when they really want you to pay for them.
~~~
toadkick
Yeah, I was wondering how they would have let something like this slip
through. I figure either a) they weren't aware of the exploit (unlikely, but
possible...Draw Something, while fun, is not a very polished game), or b) they
know of the exploit, but fixing it is a non-trivial. I suspect b) because the
game does not appear to store any state between the time you start guessing
the other player's drawing, and the time you complete you drawing (so it just
starts over if the round is interrupted, as if nothing ever happened). So, in
order to remember the list of words that was previously presented to you, the
game would have to 1) maintain state that indicates which "phase" of each
round you are in for a given game, and 2) maintain the original list of words
presented to you after you get to the "choose a word to draw" phase. I suspect
they just decided that fixing the exploit isn't worth it, because a lot of iOS
users don't even know that they can force quit the app, and a lot of the ones
who do probably still wouldn't be bothered to actually do it. Also, having to
go through the process of watching/skipping the other player draw his picture
again can be tedious.
------
saurik
I would love to see a comparison to Depict, which was really popular a year or
two ago, and now seems much less well known than this "Draw Something" that
people started talking about.
(edit: Ugh, and Draw Something apparently has a "choose a username" feature,
rather than using your name from Game Center or allowing multiple people to
have the same username, so of course someone chose my username, because they
knew it would cause a lot of people to try to play games with them.)
------
minouye
This Quora answer by Nabeel Hyatt goes into more depth on the actual game
mechanics involved:
[http://www.quora.com/Draw-Something/What-did-Draw-
Something-...](http://www.quora.com/Draw-Something/What-did-Draw-Something-do-
differently-from-other-Pictionary-apps-that-made-it-so-viral)
------
hamey
WordPress issues sorry folks, working on a fix now will be back up shortly!
------
hamey
Site back up after a hefty Linode upgrade, thanks for your patience y'all.
------
jeffool
I'm curious, but it kills the Android Browser on my Droid X. Words appear on
the right frame, but before I can see them, or anything, the screen goes black
and I'm back at the home page.
------
apricot13
Its unplayable on my iphone 4 (up to date) I really dont see why its so
popular? its SO slow. Personally I prefer depict!
~~~
MattBearman
How odd, it runs really well on my old 3Gs. And yes, I'm completely addicted
to it :)
~~~
apricot13
its annoying because when I finally managed to draw something (see what i did
there!) it was really fun!
------
darylteo
Getting a database error, Hamey.
Daryl - bonobo +1
~~~
hamey
Fixed! Thanks Daryl - hope you're well!
~~~
calydon
Still can't connect...
| {
"pile_set_name": "HackerNews"
} |
Chat messages in bytes? - chintan39
Has anyone tried benchmarking various chat application and measure the bandwidth usage?<p>I am building a chat app with smallest footprint. It would be great to know how much data other apps uses.
======
yrezgui
Did you have a look to Protocol Buffers, Apache Thrift or Cap’n Proto for
efficient network exchanges ?
~~~
chintan39
Haven't looked in details. I just want to find out if existing chat
application are efficient
| {
"pile_set_name": "HackerNews"
} |
ECMAScript 2016+ in Firefox - robin_reala
https://blog.mozilla.org/javascript/2017/02/22/ecmascript-2016plus-in-firefox/
======
shadowmint
Realistically, when are we going to see the modules situation resolved?
ES2017?
ES2018?
I know, I know, just use a transpiler and emit a bundle... but really?
It's been a draft since 2015, and no browsers have _any_ support for it yet,
despite full support for the rest of the standard?
Are modules really that controversial?
I'm kind of disappointed, honestly, that despite all the progress in the
ecosystem, this long standing issue still remains mysteriously unsolved, by
anyone.
If you're using a transpiler anyway, who really cares if you have native
support for the language features?
~~~
JoshGlazebrook
Forget about browsers, have you read the clusterfuck that Node.js is aiming
for with ES6 Modules?
[https://medium.com/the-node-js-collection/an-update-on-
es6-m...](https://medium.com/the-node-js-collection/an-update-on-es6-modules-
in-node-js-42c958b890c#.afjuek8br)
~~~
mstade
It really is a shame isn't it? I'm not sure why the unambiguous syntax
proposal was shot down – there were good reasons I'm sure – but I thought it
was a pretty solid idea.
------
nailer
I can see that strict mode inside a function using default parameters should
throw according to the spec ( [https://tc39.github.io/ecma262/#sec-function-
definitions-sta...](https://tc39.github.io/ecma262/#sec-function-definitions-
static-semantics-early-errors)) but does anyone know why? Is strict mode
something we should now be avoiding?
~~~
swhipple
See here [1], under "Why make this change?".
[1] [https://www.nczonline.net/blog/2016/10/the-
ecmascript-2016-c...](https://www.nczonline.net/blog/2016/10/the-
ecmascript-2016-change-you-probably-dont-know/)
~~~
nailer
Ah that makes sense - by the time the parser sees a 'use strict' it's too late
to apply strict mode to the default arguments. Thanks!
------
cdnsteve
Async Functions Status: Available from Firefox 52 (now Beta, will ship in
March 2017).
------
M4v3R
Good to see such quick progress in this area in major browsers. It's worth
noting that WebKit also has 100% support for ES 2016+. So now only Edge is
lagging in this regard.
[0] [http://kangax.github.io/compat-
table/es2016plus/#webkit](http://kangax.github.io/compat-
table/es2016plus/#webkit)
~~~
pjmlp
It doesn't help when one needs to target enterprise markets or devices that
only have their factory provided browser.
~~~
paol
That's what Babel[0] is for. Realistically you can't rely on native ES2016 for
any target audience yet, but with Babel you can blissfully live in the future,
today :)
Also, thrown in core-js[1] while you're at it.
[0] [https://babeljs.io/](https://babeljs.io/)
[1] [https://github.com/zloirock/core-js](https://github.com/zloirock/core-js)
~~~
pjmlp
Babel is only part of the history, then there is HTML and CSS support levels.
Some of our projects are with customers that still rely on XP with IE 8,
require using the "Internet Browser" for pre-Android 4.4 or Windows Safari (!)
or IoT devices without updatable browsers.
~~~
myared
Your customers are lucky to have you. I imagine they will rely on XP and IE8
as long as you are around.
~~~
pjmlp
Not me personally, my employer is quite big, and any consulting company will
happily sell such services.
------
rocky1138
Do any of these changes make the language objectively better? All I see are
nice-to-haves that aren't really required.
~~~
mrspeaker
I've always had a soft-spot for JavaScript, and have written a tonne of it
over the years - all these "nice-to-haves" are really nice to have. I find it
a lot more fun to write and, more importantly, easier to read six months later
(assuming people don't try to be overly tricky with it: I'm looking at you,
nested-destructed function parameters!)
------
hatsunearu
I like how they added (what is essentially) left pad. Hah!
------
scanr
I'm unreasonably happy about Async Iterators being on the roadmap. Makes it
much easier to write imperative asynchronous streaming code.
------
andrzejsz
I wonder does ECMAScript 2017 has optional name ES8?
~~~
mstade
Not really, but there's certainly an off-by-one joke in there somewhere.
Since ES2015 the official nomenclature is ES<year>, to convey that a new
version of the standard is cut yearly. While this may result in somewhat
underwhelming releases, like ES2016, at least it's much easier to reason about
and target than previously. Case in point, it took ten years or so to get from
ES3 to ES5, and another five-six years I believe to get to ES2015.
These were substantial releases to be sure, but for a long time the
uncertainty about when a spec draft was considered done was anything but fun,
and I for one applaud the new nomenclature and process for being much, much
easier to reason about and target.
~~~
jakub_g
We must stop using names like ES8 etc. _right now_ , otherwise there'll be a
lot of confusion in 4024 about which version of ES your customers' IE
supports.
~~~
u02sgb
Surely we'll get there in 2020 or 2021, is that ES10, ES11 or ES20, ES21?
Edit: and yes I know you were joking :)
------
SimeVidas
Async iteration is already at Stage 3? Nice.
| {
"pile_set_name": "HackerNews"
} |
Airports are normalizing facial recognition in the U.S. - pslattery
https://onezero.medium.com/airports-are-normalizing-facial-recognition-in-the-united-states-dd4c9659945d
======
pluma
There are a few different sides you could take from this article. 1) this
could improve flight experiences and help find individuals who are on the run
or could cause a threat but 2) like the article discusses, it is invasive and
there are no rules with regards to storing and selling bio-metrics in 99% of
the states.
| {
"pile_set_name": "HackerNews"
} |
Show HN: Understanding the Monty Hall paradox through code - deeg
https://github.com/DeegC/monty_hall_paradox
======
drewm1980
If you phrase it adversarially it makes more sense... 2/3 of the time you
select a goat and force Monty to reveal the other goat. For those 2/3, you're
guaranteed to get a car by switching. The remaining third you get a goat.
If you take the "stay" strategy... 1/3 you hit the car and keep it. 2/3 you
hit a goat and keep it.
In summary... "switch" is 2/3 car, "stay" is 2/3 goat.
In these times you should choose "stay" and hope to get a goat so you can turn
grass into food. Cars are overrated.
------
andischo
The easiest explanation I've ever heard and which immediately made me
understand it was the following:
Instead of 3 doors, imagine there are 100. 99 of which have a goat and only
one of which has a price behind it. Now blindly choose a door and the host
opens 98 of the other doors which have a goat behind it. Would you switch your
door now, given the choice?
It's easy to see that your probability of choosing a "wrong" door when you had
100 doors to choose from was much higher than choosing the right door when you
only have two doors to choose from.
This method of thinking, i.e. increasing or decreasing the problem space by
some orders of magintude has helped me a lot in thinking about problems and
their solutions in general.
~~~
millstone
I'm the host, and I also happen to be blind. I chose 98 doors and none of them
have the car - terrible luck on my part! But probably this lends some credence
to your initial guess?
~~~
andischo
That is also a very interesting way to think about it, if I understood you
correctly. Seeing the host as another player, any "bad luck" he has, should
translate into myself having a higher chance of success if used correctly.
~~~
hanoz
With the host as another blind player, his opening of 98 goat doors only
increases the probability you were right from 0.01 to 0.5, so still makes no
difference for you to change. But of course the original version of the
problem is predicated on the host knowing where the car is and only revealing
goats.
------
aszs
One thing that intrigued me about this puzzle is wondering what mental model
for probability would make solving it intuitive? The one that works for me was
thinking about it in terms of information:
Because Monty can never choose the door you first picked he can't give you any
new information about that door. So when he reveals which of the remaining
doors has a goat, he is only giving us new information about those remaining
doors. That information reduces the odds on the remaining doors and that is
why you should always switch.
~~~
kortex
If you switch "you" get to "open" two doors in fact, not one. It's just that
Monty picks which one for you. And since your choice is random, you might as
well let an RNG do it for you.
If you consider it two independent rounds instead of stay/switch,
Stay: you get to roll 1d3, "1" wins
Switch: you get to roll 1d3, "1" loses, "2" or "3" wins
------
lordnacho
The main thing that seems to cause the paradox is a lack of specificity around
the door opening mechanism. If you make it clear that Monty only opens a door
that will definitely be empty, I find that most commentators will agree that
Marilyn is correct, you should switch.
~~~
niel
The original question that vos Savant responded to contains the phrase "...and
the host, who knows what's behind the doors, opens another door, say No. 3,
which has a goat..." \- I don't know how they could be any more specific.
If the host opens the door with the car, the game would be over anyway. It is
clearly implied that the host always opens a door with a goat.
~~~
tromp
> I don't know how they could be any more specific.
"the host opens another door that he knows has a goat behind it, say No. 3,"
Using the knowledge of where the car is to avoid showing it, is more specific
than just having the knowledge, and possibly still opening at random.
~~~
niel
Whether the host opens a door with a goat or a car determines whether the game
can still be played at all. How that door is selected does not factor into
whether the contestant should switch or not in any way.
I think the source of the paradox lies somewhere in the biases (the Endowment
effect or Status Quo bias) as discussed in the Wikipedia article about the
problem - not with how the question was stated and especially not with the
part about how the host selects a door.
~~~
CJefferson
Ah, you are wrong (and this is often confusing to people).
If you model this game where the host chooses randomly, and might open the car
door (when that hapoens the player instantly loses) , then there is no point
switching.
I think the fact this does matter is the source of many people's confusion.
~~~
Sandman
_then there is no point switching_
Why not? Your chances of choosing the correct door were 1 in 3 from the start.
That doesn't change with the fact that the host opens the doors at random.
~~~
deeg
Sorry for the late reply, but if you look at the original article on GitHub I
explore that scenario in the code. The answer is that if Monty randomly opens
a door then the contestant automatically loses 1/3 of the time before given a
chance to switch.
------
dpflan
Monty Hall himself wrote to the Harvard C.S. Professor Lawrence Denenberg
questioning the counter-intuitive logic:
> [https://stats.stackexchange.com/questions/373/the-monty-
> hall...](https://stats.stackexchange.com/questions/373/the-monty-hall-
> problem-where-does-our-intuition-fail-us/23674#23674)
____
The topic of the counter-intuitive nature of probability reminds of Newton's
letter to Pepys - "In 1693, Isaac Newton answered a query from Samuel Pepys
about a problem involving dice. Newton’s analysis is discussed and attention
is drawn to an error he made."
Here is the classic Newton-Pepys Problem
[http://www.datagenetics.com/blog/february12014/](http://www.datagenetics.com/blog/february12014/)
Here is the Newton-Pepys problem explained by Professor Joe Blitzstein in the
Harvard class Stats110:
[https://www.youtube.com/watch?v=P7NE4WF8j-Q&feature=youtu.be...](https://www.youtube.com/watch?v=P7NE4WF8j-Q&feature=youtu.be..).
Here is further discussion about the logical error Newton made in his
solution:
[http://arxiv.org/pdf/math/0701089.pdf](http://arxiv.org/pdf/math/0701089.pdf)
------
harimau777
It seems to me that a lot of what trips people up is that they don't realize
that the host specifically opens a door which they know does not to contain a
car (as opposed to selecting the door to open randomly).
Therefore, it seems to me that many people fall for it not so much because
they misunderstand the probability but because the rules of the game are
designed to be misleading.
------
paultopia
For a more prosaic use of code to help people understand, I once wrote a quick
simulation to help get it into the intuitions of my students: [https://paul-
gowder.com/montyhall/](https://paul-gowder.com/montyhall/)
------
anotheryou
I finally understood it!
I always wondered why it's not 50/50 if I enter the room late. How can a past
event that now seems irrelevant change the odds.
Basically you watch Monte jump around and see which doors he avoids because
they have prices. Now you can't make that observation about your own door
because he'd never touch it anyways and he jumps just once but sometimes
skipping a door if his random hits the price. The fact that it's just 3 doors
so just one is left makes it even more quirky, but doesn't change much.
So you know the other door is a door monty pontentialy avoided not to reveal
the price.You don't have that information about your door.
~~~
greypowerOz
edit oops i should have refreshed before duplicating this thought !!!!
funny how different people grasp things.. this code example didn't really
click with me, but someone else explained it by imagining 100 doors, not 3.
After you choose one door, 98 of the remaining 99 doors (all with goats behind
them..) are opened.... leaving 1.
stay or switch? :)
~~~
anotheryou
yea the code didn't click with me either, just "focus on what monte does"
helped me along. Your train of thought clearer, great :)
------
bmn__
Much more complete discussion of the problem, with strategy variants and code:
[http://loup-vaillant.fr/tutorials/monty-hall](http://loup-
vaillant.fr/tutorials/monty-hall)
Author is also a HNer: [https://news.ycombinator.com/user?id=loup-
vaillant](https://news.ycombinator.com/user?id=loup-vaillant)
------
gugagore
For this and other probability "paradoxes" explained through code, check out
this great notebook:
[https://nbviewer.jupyter.org/github/norvig/pytudes/blob/mast...](https://nbviewer.jupyter.org/github/norvig/pytudes/blob/master/ipynb/ProbabilityParadox.ipynb)
~~~
Stratoscope
That is great, thanks!
This note in particular could be a lesson for many things in life:
> When I believe the answer is 1/3, and I hear someone say the answer is 1/2,
> my response is not _" You're wrong!"_, rather it is _" How interesting! You
> must have a different interpretation of the problem; I should try to
> discover what your interpretation is, and why your answer is correct for
> your interpretation."_ The first step is to be more precise in _my_ wording
> of the experiment...
------
oceanghost
Why do explanations of this problem never mention conditional probability, on
which the explanation is based?
There are dozens of videos explaining conditional probability on youtube, but
basically, the taking away of a door gives us additional information about the
state of the system. It is counter-intuitive, but it's not a mystery.
This principle is used everywhere to optimize real-world problems.
------
textread
There's a Kevin Spacey movie scene on this:
[https://www.youtube.com/watch?v=cXqDIFUB7YU](https://www.youtube.com/watch?v=cXqDIFUB7YU)
------
davidmurdoch
Michael Stevens of Vsauce does a fantastic job explaining why this works:
[https://youtu.be/TVq2ivVpZgQ](https://youtu.be/TVq2ivVpZgQ)
------
thecopy
for me it clicked when i realized he will only open the bad door which you
have not chosen. Even if you chose the bad door he will never open that one to
show you. He’ll always open the other
------
ngcc_hk
The simplest solution is you Always switch as it meant 2/3 instead of 1/3
winning chance. the door opening earlier or (clearer and easier to understand)
later is just to help you to check your 2/3 pool.
------
29athrowaway
Github supports the IPython notebook format.
I much rather prefer that for literate programming.
| {
"pile_set_name": "HackerNews"
} |
Ask HN: What apps are on your phone, and why? - Jaruzel
Hi all, just a piece of curiosity...<p>There are millions of phone apps out there. If you wanted to highlight one (or a few) apps on your phone that have made your day to day life better which would they be, and why?
======
ceezuns
Spotify... Probably the most game changing app for me, until like 3 years ago
I usually would download music on my phone whenever I had free time, and that
would take so long to get it onto my phone. Now I can just click the app and
listen.
Edit: Also, Instagram, not for its social media aspect such as stories or
posting pictures, but its direct messaging feature, since all my friends are
on Instagram I no longer need to collect phone numbers or go onto various
messaging services. Usually I can just message them on there, even if I have
to sacrifice a little bit of privacy it's fine since none of my conversations
are usually sensitive.
| {
"pile_set_name": "HackerNews"
} |
Ask HN: Where can I learn about Linear Programming - unwantedLetters
I recently feel like I've been stagnating, writing code that requires no thought (sort of like writing longer versions of FizzBuzz). I want to do something a bit more challenging, and feel like Linear Programming will be a great thing to learn.<p>If anyone can tell me about some Linear programming resources, I'll be very happy. Also, if you have any suggestions as to other topics that I can look into, those are welcome as well.<p>Thanks.
======
gaius
The book _Quantitative Methods for Business Decisions_ By Curwin & Slater
would be a good start.
| {
"pile_set_name": "HackerNews"
} |
How to thrive as a solo non-technical founder - limedaring
http://weddinglovely.com/blog/how-to-survive-as-a-solo-designer-founder/
======
patio11
In addition to making all the necessary steps to deal without a technical
cofounder (problem: can't iterate without code, solution: crash course in
Python programming then), Tracy also really, really works angles that many
technical founders wouldn't consider. I did a wee bit of work with her at 500
Startups -- my favorite example of several is that she produced an actual,
honest to God, on-dead-tree _photo book_ of her paying customers' wares. It
was _extraordinarily compelling_ , both as a product (I have recent experience
with wedding product photo books, mostly produced on 1000x the budget of
that), as a sales channel for her company, and clearly the hackiest use of
paper I've ever seen in a software company.
~~~
limedaring
Oh goodness, thanks Patrick — that really means a lot.
Funny, we just announced the 2nd version of the Lookbook a couple days ago,
and it's going to be a whole new challenge, since we're working with over 3x
the number of vendors and in multiple wedding verticals rather than just
invitations. I'll have to send you the new one once it's released in a month.
:)
~~~
melissamiranda
The look book was awesome, it brought all the invitations on the site to life.
You could curl up on a couch and flip through beautiful stationery at your own
leisure. It made it a pleasure rather than a chore by simple getting it off
the computer. Tracy, where were you when I got married? I was impressed that
Tracy had to learn pdf scripting to pull it off, she learns just about
anything, and fast.
~~~
limedaring
Mmmm alas, I didn't learn PDF scripting (eugh, one of the reasons why I
dropped my original startup idea) — it was all painfully done by hand in
InDesign. That said, we're looking at scripting for this time around!
~~~
thinkmaya
very cool Tracy! I think it takes a certain kind of skill to marry our
strengths with customer needs and build something that wins. Great job on the
lookbook!
------
scottkrager
What I really enjoyed about this post is the ending...
You learn all the hard work Tracy puts in on her own. And in the end she EARNS
a technical co-founder. She doesn't stop working on her product while waiting
for the mythical tech co-founder to join her. Bravo and congrats.
~~~
limedaring
Ha yeah — I wrote an article about finding a cofounder the traditional way a
year ago ([http://www.limedaring.com/technical-co-founder-wanted-for-
di...](http://www.limedaring.com/technical-co-founder-wanted-for-disrupting-
the-wedding-industry/)) — well, that didn't work out. This article really is
my followup to that article, that I should have just jumped forward then and
started working rather than doing a few months of searching for the "right
cofounder"!
Thank you!
------
prgibbons
I would consider having design skills as a technical skill. Try doing a tech
startup with a liberal arts degree (or three) ;)
Good article!
~~~
limedaring
Maybe true, but both design and liberal arts degrees are missing the true
technical skills that a tech startup really requires: back-end development,
experience with servers, databases, etc. That's been the toughest part — it's
all well and good to ideate, but implementation is where things really matter.
I waffled on the title, but decided that if YC considers myself non-technical,
then it fits. :P
Thanks for the compliment! It's really fun being the tech person because at
least I'm learning something new every day.
------
Pimp4life
This is all good stuff. I'm pretty active in Co-Founder recruiting. When I
apply to incubators, I still list out the portfolios of all the people that
I've talked to, so that they are aware of who I'd like to get aboard. The main
problem is not having any money to hire them. I've had a few that are willing
to do sweat equity, but they have their hands tied with other commitments
(work, school) and projects. When I go to meetups and hackathons, the first
thing people ask me when I say that I need a Co-Founder is "Do you have any
money?". Granted, I wouldn't want to work with the type of folks that say
anyway, but seed capital will help me pluck talent away from cubicles or have
a 3rd-party get a MVP made. I need a developer and a designer. I want to split
the equity 3-ways evenly among us.
You also have to raise the bar of what you're looking for by learning to code
yourself. Codecademy is great, because everyone on a startup needs to be
technical to some extent, at least early on. You need to be able to
collaborate shoulder to shoulder.
------
hkarthik
This is a great story.
As a visionary who clearly doesn't mind getting her hands dirty and has design
skills you seem like every tech co-founder's dream! I'm honestly surprised you
had difficulty finding a tech co-founder before launching.
I'm dabbling with the idea of becoming a tech cofounder for someone, so I'd
like to know what were the criteria that you looked for in a tech cofounder
and how did you finally find one?
~~~
limedaring
"As a visionary who clearly doesn't mind getting her hands dirty and has
design skills you seem like every tech co-founder's dream! I'm honestly
surprised you had difficulty finding a tech co-founder before launching."
The difficulty wasn't in finding a tech cofounder — I had one back in the day,
went through a whole "interview" process with people from my original post
that got on HN. The problem was knowing someone long enough to feel
comfortable with them and finding the right person for the industry,
especially since I'm working in the weddings industry which is generally
uninspiring for a lot of devs. So it ended up with me working solo for over a
year, and the right person approached me, which worked way better.
"I'm dabbling with the idea of becoming a tech cofounder for someone, so I'd
like to know what were the criteria that you looked for in a tech cofounder
and how did you finally find one?"
Personality and fit with you and the company is number #1. Fit within the
current needs of the company was #2. Right skillset wasn't considered (hell,
if I can pick it up, someone who specializes in software development certainly
can.) But definitely finding someone who you can work with is the most
important, because if things go badly, you can work together on a new idea if
you jive well together.
~~~
amirhhz
What would you say about trying to identify a potential co-founder's
underlying motivation (money, experience, small team/flexibility, fame,
actually caring about the market, etc.) for joining a start-up?
I'm actually asking from the perspective of a technical person who finds it
hard to trust/gel with potential non-tech founders, but I thought perhaps you
had some thoughts :)
------
ErikEliason
Thanks for sharing Tracy. Your story is encouraging and reminds me of Abraham
Lincoln's story: <http://pinterest.com/pin/224687468879142473/>.
I think it would help the entire startup ecosystem if more founders shared
their challenges, failures, and triumphs.
------
citricsquid
The article doesn't answer the headline, unless "become one" is the answer?
~~~
limedaring
Anyone can be a solo founder, but I'm hoping the article answers some of the
qualities and tips you'd need in order to be successful, or at least put
yourself on the path to success. So, if you can't find a cofounder, what
things to remember and to get yourself motivated by in order to continue
endlessly without another person working on the company with you.
------
sausagefeet
I wonder how often the advice in these How I Succeeded posts are actually
related to their success. Hard to filter out these things when you're the one
experiencing them.
~~~
shazow
Everyone defines success differently. Most generally, success is the absence
of failure. Bonus points if you're making progress.
I'd take these posts more as inspiration to persist. Take toll in your
achievements and realize that your business is alive up until the moment you
allow yourself to give up.
------
jeffrese
Congratulations Terry and thanks for sharing your story. What kind of
ownership split did you do with your post product, post revenue, post funding
co-founder?
------
iamdann
Great success story. Great links too (although, the 30x500 link is broken).
Thanks!
~~~
limedaring
Whoops — missing the http. Fixed, thanks!
------
nickler
'cockroach' !! I love it. Stealing that one.
~~~
limedaring
Yeah, I think Paul regrets saying it because I've been using it as my personal
nickname now. :P
~~~
grokaholic
First time I heard "cockroach" used to describe start up founders is in this
article by Paul Graham.
<http://paulgraham.com/guidetoinvestors.html>
"Apparently the most likely animals to be left alive after a nuclear war are
cockroaches, because they're so hard to kill. That's what you want to be as a
startup, initially. Instead of a beautiful but fragile flower that needs to
have its stem in a plastic tube to support itself, better to be small, ugly,
and indestructible."
By the way, you go girl! Best of luck. I admire and applaud your persistence.
Keep going. I believe you can do it.
------
pydanny
Great job Tracy! Keep it up!
------
apz
Good job tracy!
------
allanscu
Great job!
------
ChrisNorstrom
No wonder. She's a woman. (READ THE WHOLE POST before you downvote)
I keep seeing this over and over again in my life. Nearly all the women I
know, from family to friends, are self driven, independent (even with a family
they have a strong sense of self), stable, educated or self-educated, and self
disciplined. Earning degrees, starting businesses, or properly investing the
family funds. The men I know.... well... we're the worst kind of failures. Not
the good Silicon Valley "I failed but I learned" kind of failure. The bad kind
of failure where you keep doing the same thing over and over expecting
different results. Out of all the men in my the family, my mother is the only
one that played her cards right. Financially, career wise, everything. Same
with my aunt. Same with my other aunt. Same with my childhood female friends.
WTF.
I think I've developed such a bias favoring women that I specifically want a
female co-founder. At least I know there's a much less chance of testosterone
induced ego trips, driving the company into the ground from unnecessary overly
risky decisions. I've noticed that these women's decision making is VERY
different from the men's.
From what I've seen. Women change their success strategy much more often,
whereas the men keep the same one despite years of failure. Women adjust to
change much quicker than the men I know. When women mess up, they say to your
face "I'm sorry, it's my fault". In fact they blame themselves a lot more when
things go wrong, whereas the men place blame on others and don't apologize at
all. Men don't see it as "I screwing up", they see it as "things didn't go my
way". Women gather information first, then make a decision. The Men skip the
information gathering step. They rush in and just call the shots. It's quicker
but more risky and eventually leads to a lot of failures. When business
doesn't work, women blame themselves and try to change themselves (get a
degree, educate, find new partner, find what they did wrong) but when business
doesn't work for men, they try to change the business itself, refusing to
admit that it might just be their fault. And lastly, the men I know seem to
think they are correct by default and tread ahead into the darkness, whereas
the women think they are incorrect by default and carefully tread through
decisions.
I think I'm sexist. But I can't help it. You call it sexism and generalizing
but I call it 'pattern recognition'. Literally all the women in my extended
family and friends have good jobs and the guys (me included) have nothing or
terrible jobs. I feel as if I'm destined for a life of failure. I know I
shouldn't feel that way but I can't help it. It feels inescapable. The more I
think about it, the more it makes sense and becomes evident. Sorry if I
dragged any men into the same depressive pit that I'm stuck in.
~~~
ericd
There are lots of guys doing huge things very successfully. Bezos just located
an Apollo rocket _on the bottom of the Atlantic Ocean_. James Cameron has gone
from being one of the most successful film directors to being one of the most
successful deep divers of all time. These are bold things that were
successful. Being a risk taker causes a higher variance in ones endeavors,
which implies some spectacular failures, but that also implies occasional
spectacular successes.
Don't count yourself out just because of your gender. Tracy is awesome because
she's Tracy, not because she's a woman. Actually, just don't count yourself
out period, that's silly. You can always improve at things.
~~~
ChrisNorstrom
I should have emphasized more on the fact that this is what I'm seeing with
the men and women that -> I <\- know and have met. Those successful men you
mentioned obviously have behaviors that I (or anyone in my family) don't have.
It's just that in my life I'm seeing more of those behaviors in women than in
men. Leading me to feel this way. I shouldn't, I know. It's illogical and I
deserve the downvotes for such a loaded, wide, generalizing, polarizing
statement, but I can't help but feel this way.
~~~
ericd
Ah ok, gotcha. I personally know a bunch of very successful guys and gals
both, so maybe you just need to meet a wider variety of people. I've mostly
lived in urban areas (Boston, NYC, Silicon Valley), though, so that probably
skews my own sample pretty badly.
| {
"pile_set_name": "HackerNews"
} |
The first photo on the Internet - denzil_correa
http://musiclub.web.cern.ch/MusiClub/bands/cernettes/firstband.html
======
geldedus
you mean "on the Web"
~~~
denzil_correa
Errr... yeah you are right.
| {
"pile_set_name": "HackerNews"
} |
Ask HN: More background on these Brave browser findings? - humanetech
Interesting thread on the fediverse about Brave browser, but lacking more background and sources. This toot [0] and this msg:<p>"first, they sold exceptions to privacy tracking to Facebook and Twitter, now it comes out they've got a header override that allows them to set header exceptions on demand."<p>[0] https://glitch.social/@tessaracht/101572578668968885
======
Dahoon
More here:
[https://news.ycombinator.com/item?id=19129086](https://news.ycombinator.com/item?id=19129086)
| {
"pile_set_name": "HackerNews"
} |
Ask HN: If you have had a FTTN broadband rollout, how is it? - samuellevy
Brief background. I live in Australia, where, as many people may know, we were getting a Fibre To The Premises broadband rollout, organised by the government.<p>As many people are likely also aware, we in Australia had a change of government last weekend, with the incoming government dedicated to Fibre To The Node, instead (citing a faster rollout, and lower costs).<p>I run www.weneedthenbn.com (I'll put a clicky below), which is one of the many sites which have appeared in the last week, attempting to rescue the FTTP broadband network plan.<p>What I'm asking for is this: Have you had FTTN <i>or</i> FTTP/FTTH broadband? What can you tell us (from a user experience perspective) about stability, access, speeds, cost, etc. I would like to build up some user stories, either to use as "this is why we need FTTP", or to show me that I should stop worrying, and learn to love the node.
======
hkarthik
I live in the US, and I have had both FTTP (via Verizon FIOS) and FTTN (via
AT&T U-verse).
FTTP was by far, the best internet service I ever experienced. The latency was
super low, download times were always fast, uploads were synchronous, and the
service had amazing uptime in the 3 years I had it.
FTTN was by contrast, a miserable experience. The hardware was finicky, the
latency was terrible (thanks to a DSL Interleave), the downloads were
inconsistent, upload speeds were laughable, and the hardware was total crap
and couldn't stay up at all.
Unfortunately, Verizon has halted new development of it's FIOS product even
though it was awesome, due to cost. AT&T has pushed forward with it's crappy
U-verse solution and has eclipsed FIOS installs in my local area.
My takeaway from this is that fiber optic cable is far and away one of the
most stable and solid technologies since the invention of the copper wire. But
unfortunately it comes at such a steep price, that it gets sidelined when it
comes up against the "Last Mile" problem of getting a connection from the node
to the residence.
I would love to see an opt-in option for FTTP where you pay the difference to
the service provider to have the fiber optic cable run into the residence.
Even if they charged me at cost ($2-3K USD last I checked), I think many would
pay for it due to the better experience. Over time, this cost would fall and
everyone would opt in.
------
cbhl
My understanding is that a lot of people had bad experience with FTTP/FTTH
when it was first rolled out in the US, because the telco would cut the copper
cables that lead to the house. This meant that once you switched to FTTP/FTTH,
you had no way to switch back to ADSL (or that it was prohibitively expensive
to do so).
In my neighbourhood in Canada, FTTN is quite common, and speeds of
25Mbps/10Mbps and 50Mbps/10Mbps are commercially available using VDSL to cover
the last mile between the node and the home (and this is well below the
theoretical capabilities of VDSL, since the telco is also using VDSL to
deliver the TV component of a triple-play package ). While a new modem is
still required, since the last mile is still copper, it means that switching
from ADSL to FTTN+VDSL and back is easy (alleviating concerns that a FTTH
provider might suddenly jack up prices knowing that you can't switch back to
ADSL).
I believe the local telco has started rolling out FTTH to select areas, but:
\- it's available in far fewer neighbourhoods than FTTN
\- the monthly fee is much more expensive (think $150 CAD/month, compared to
$40/month for FTTN)
\- there's an expensive installation fee for FTTH
\- the bandwidth cap on FTTH doesn't increase proportionally with bandwidth
compared to FTTN or ADSL; the caps are so low that you're basically on usage-
based billing for all usage above the base monthly fee
------
bob_george33
I haven't experienced FTTH yet, but reports from people who do have it seem
really good.
I have however worked supporting both FTTP and FTTH on a private network. In
my experience, FTTH was so much simpler to diagnose. If there was an issue you
would check the exchange, and their house. The Fiber converters we had where
tiny compared to the ones NBNCo offers too.
The FTTN users where a lot harder to deal with. All the network equipment is
still fairly young (under 10 years iirc), but we would still get cables from
the pits that needed to be rerun. Our nodes supported 4 houses at most. Though
most of them only had 1 or 2 users attached to them.
------
jameswyse
I lived in West End, Brisbane for a while and due to the closing of the local
ADSL exchange (to build a new childrens' hospital) Telstra upgraded the whole
area to FTTP.
Getting it set up was a nightmare but this was entirely the fault of our ISP
(DoDo are the worst.) After it was installed I had 3 months of perfect
internet access until moving out of the area! Shame I could only order 30mbit
at the time.
------
samuellevy
[http://www.weneedthenbn.com](http://www.weneedthenbn.com)
| {
"pile_set_name": "HackerNews"
} |
Animate NBA shot events with Paper.js - yukiegosapporo
http://opiateforthemass.es/articles/animate-nba-shot-events/
======
FroshKiller
This is very, very cool! After looking at this, I was interested in how this
data is acquired and used and found this podcast episode that touches on it:
[http://radar.oreilly.com/2014/11/the-science-of-moving-
dots-...](http://radar.oreilly.com/2014/11/the-science-of-moving-dots-the-
oreilly-data-show-podcast.html)
| {
"pile_set_name": "HackerNews"
} |
Show HN: Over 120 places to promote your software - mypresences
https://www.mypresences.com/services/#Software%20Company_
======
v4violetta
I think the location part is not so relevant these days. Also, I would love
there to be sub-categories because a "software business" can mean many things.
Just my 2 cents.
~~~
mypresences
Hi .. you are right the location is not really relevant for a software company
but we support many different business types where location is relevant and
different services exist for different parts of the world .. such as
restaurants, salons etc.
We do add other categories as we support new services that require further
classification ... but it really comes down to are there any services that are
only relevant to a specific subset of software companies and if there are some
we will add the subcategories.
------
MildlySerious
I'd love the links to be actual links. No middle clicking is just so
inconvenient these days.
~~~
mypresences
Hi ... thanks .. sorry if you had some problems navigating. Can you elaborate
on the problem? Would love to know if there is something we are missing.
There are direct links to each service on each card. More detail is initial
hidden and requires a click to expand as the screen would have too much
information if we expanded everything initially.
Thanks.
------
mypresences
Would love any feedback and information on other services we should include.
| {
"pile_set_name": "HackerNews"
} |
How long does it take to make a context switch? (2010) - majke
http://blog.tsunanet.net/2010/11/how-long-does-it-take-to-make-context.html
======
luckydude
Pretty sure that he's just rediscovering what I did in lmbench back in the
early 1990's. All written up and open source (and got best paper in the 1995
Usenix):
[http://mcvoy.com/lm/bitmover/lmbench/lmbench-
usenix.pdf](http://mcvoy.com/lm/bitmover/lmbench/lmbench-usenix.pdf)
Edit: which now that I think about it, was over 20 years ago. Reminds me of
something a friend (Ron Minnich) said long ago: people rediscover stuff in
computer science over and over, nobody wants to read old papers. Or something
like that. He said it better, I think it was something like "want to look
smart? Just take any 5 year old paper and redo whatever it did, our attention
span seems to be very short."
~~~
chillydawg
One reason people are reluctant to trust old sources (regardless of how well
received they were at the time) is that software, operating systems and
hardware all move at lightning pace. I've not read your paper, but I'm willing
to bet enough has changed to warrant a new writeup talking about modern
systems.
~~~
LoSboccacc
> operating systems and hardware all move at lightning pace
not really, last big leap was the ability to unlock gpu for stream processing,
and that's it.
it's quite faster today as ten or one year ago, but at it's core it's still a
von neumann machine and not much has been discovered ever since, mostly we're
repackaging under a new name things that have been discovered in the 70s',
like the thick vs thin client debate, which played more or less the same over
and over again as the bottleneck switched from bandwidth to latency to client
performances, the last iteration of which was ember and angular
precompilation.
~~~
noir_lord
Some of the stuff goes back even further than that.
The thread on the Intel Optane stuff the other day had an interesting
conversation about how you would program for such systems and someone said we
already did, mainframes 50 years ago.
It's nice to see old ideas in a fresh context.
------
JoeAltmaier
On the order of a millisecond. Which seems to me, way too slow in this day and
age. The context switch has been a hard wad that chokes algorithms in
unexpected ways, that are hard to diagnose.
This can be fixed with a different approach to CPU design? Most threads block
on a semaphore-thingy or a timer or wait for io completion. If the CPU made
those an opcode instead of a wad of kernel code, the switch could be reduced
to a clock cycle (ns?)
How could this work? Maybe a global semaphore register where you Wait on a
mask. Each bit could be mapped to one of those wait-condition. Another opcode
would Set the bit.
To scale, the CPU would have to have not 2 or 4 hyperthreads but maybe 1000.
So every thread in the system could be 'hot-staged' in a Wait, ready to
execute, or executing.
There would still be cache and tlb issues, but they would be at the same level
as any library call. They wouldn't include yards of kernel code messing with
stacks and register loads and so on.
~~~
luckydude
Hey, same Joe from Sun? If so, howdy.
On my i7-5930K I'm seeing 7-10 usecs, quite a bit better than a millisecond.
Linus cares about this stuff, I'd be very surprised if he didn't measure it
regularly.
~~~
JoeAltmaier
Probably thinking of my brother, Rich?
usecs are a thousand times better than a ms of course. And a ns is a thousand
times better than that!
------
bogomipz
The author states:
>"In practice context switching is expensive because it screws up the CPU
caches (L1, L2, L3 if you have one, and the TLB – don't forget the TLB!)."
How does a context switch "screw up" the L1 through L3 caches? Yes when there
is context switch the TLB gets flushed and the kernel then needs to "walk" the
page tables which is expensive and yes I can see the L1 needing to flush some
lines but is that really screwing up the L1, L2 and L3 caches, the later two
being fairly large these days?
~~~
Someone
A context switch changes the virtual-to-physical mapping. So, _if_ a cache
uses virtual addresses for determining whether data is in the cache a context
switch has to flush the cache.
It looks like (1) x86 is virtually indexed and physically tagged (i.e. you
need a virtual address to find the cache line data might be in, and the
physical address to check whether that line actually holds the data. See
[https://en.wikipedia.org/wiki/CPU_cache#Address_translation](https://en.wikipedia.org/wiki/CPU_cache#Address_translation)
for details))
(1) [http://www.realworldtech.com/sandy-
bridge/7/](http://www.realworldtech.com/sandy-bridge/7/) but that may have
changed, they might use different strategies for the various cache levels, or
they may by now use some other tricks. Address translation is very hairy in
multi-core systems.
~~~
bogomipz
>" So, _if_ a cache uses virtual addresses for determining whether data ..."
I was curious about your "if" caveat. I believe nearly all modern CPUs uses
the virtual address as it doesn't know about the physical addresses no?
~~~
pm215
The CPU does know the physical address, because the MMU is part of the CPU; so
you can have a physically indexed cache if you want. The problem is just that
you can't do the cache lookup in parallel with the MMU physical-to-virtual
lookup, so it's slower than if you used a virtually-indexed cache.
~~~
bogomipz
Sure, I didn't articulate my comment very well. I meant to say that the L1-3
caches operate on virtual addresses because they don't know the physical
address but the MMU does since all memory access must transit through the MMU.
------
mashmac2
Context switch in this article = within a computer and processor, not about
psychology
~~~
chrisseaton
Well this is a computer technology new aggregator isn't it? Not a psychology
one.
~~~
OJFord
To be fair, we do frequently talk about 'context switching' in a metaphorical
sense of flitting between programming and conversations/meetings, or among
different projects.
If anything, I think I agree with GP that it's more unusual to see the term
used in the 'real' (not metaphorical) sense on the front page.
------
bogomipz
The author also seems to be loose with specifying "context switches" where
there is a difference between a context switch between two threads which
shares everything except a stack and a context switch between two processes
that have separate address spaces. Did anyone else find that odd?
~~~
mfukar
Context: Linux.
~~~
nkurz
Could you expand your response? I presume you are saying that since in Linux
processes and threads are "the same" there is no need to distinguish whether
the process being switched in shares the same address space. Does this mean
that there is a missed optimization on Linux to preserve some virtually-
addressed caches and tables when switching to thread/process that shares the
same address space? Or that the terminology is correct, but that Linux already
makes the possible optimization?
~~~
mfukar
> I presume you are saying that since in Linux processes and threads are "the
> same" there is no need to distinguish whether the process being switched in
> shares the same address space.
That's right. Threads share everything but their stack.
> Does this mean that there is a missed optimization on Linux to preserve some
> virtually-addressed caches and tables when switching to thread/process that
> shares the same address space?
I'm not entirely sure I understand your question. What scenario do you have in
mind?
------
otabdeveloper1
> Applications that create too many threads that are constantly fighting for
> CPU time (such as Apache's HTTPd or many Java applications) can waste
> considerable amounts of CPU cycles just to switch back and forth between
> different threads.
Completely wrong. Context switches happen at a set interval in the kernel.
Creating more threads won't make context switches happen more frequently, each
thread will just get a proportionally smaller share of CPU time.
Conceptually, the CPU scheduler can be thought of as a LIFO queue. An
interrupt fires at a fixed interval of time and switches to the first ready
thread (or process) on the queue.
What's more important is the fact that this queue is exactly equivalent to how
'asynchronous' operations are implemented in the kernel.
The only difference between creating threads and using async primitives is the
thread prioritization algorithm. With threads you're using whatever scheduling
heuristics are baked into the kernel, while with async you can roll your own.
(And pay the penalty of doing this in usermode.)
~~~
chrisseaton
Does the CPU interrupt threads running happily on cores even when there are no
other threads which want to run or which have affinity that would allow them
to run on that core?
But creating more threads will cause each to run slower as their caches are
ruined by each context switch aren't they?
~~~
otabdeveloper
> Does the CPU interrupt threads running happily on cores even when there are
> no other threads which want to run or which have affinity that would allow
> them to run on that core?
Yes. Even if you are careful to ever run only one process (so: no monitoring,
no logging, no VM's, no 'middleware', etc.) and limit the number of threads to
strictly equal the number of processors, you still have background kernel
threads that force your process to context switch.
~~~
gpderetta
Tough you can instruct the kernel not to run anything (not even interrupt
handlers) on specific cores, except for manually pinned processes.
~~~
monocasa
At a minimum you still need timer and TLB IPI shootdown interrupts hitting
every core, just to have a working SMP system.
~~~
gpderetta
the cpu does need to handle IPI of course but not sure about timers.
| {
"pile_set_name": "HackerNews"
} |
How to launch and defend against a DDoS attack [pdf] - jgrahamc
http://www.secure.edu.pl/pdf/2013/D1_1530_A_Graham-Cumming.pdf
======
MichaelGG
SIP is a particularly terrible protocol using UDP. A single SIP packet can
generate significant processing, generally with IP address as the only sort of
authentication. Most VoIP providers will fall over pretty quickly. The "best"
implementation I've heard of is a simple L3 whitelist of known-OK IPs, but
that still has the effect of killing your network to many customers. On top of
that, RTP comes in dynamically on different IPs, so you need to propagate L7
info in real-time to your L3 filters. And of course, if an attacker knows who
your customer is, they can just spoof their IPs.
------
SteveLivesInSLO
Set your DNS records TTL to something relatively small like an hour.
If you are hit with a DDOS and want to direct traffic through a DDOS
mitigation service you will often need to point your domain at their servers.
If your DNS TTL is 48 hours then you will be up a creek for quite a while.
~~~
bigdubs
What are the downsides of a small TTL? Why wouldn't a low TTL be default?
~~~
madsushi
If your TTL is very low, you end up creating/handling a lot more DNS traffic,
because your records are flushed from the cache more often and have to be re-
retrieved. Also, many public DNS servers (e.g. your ISP's, or Google's) set a
minimum TTL on all records (overwriting any lower value) to minimize DNS
traffic/requests. Setting your TTL to an hour is fairly standard, but some DNS
hosts (especially old ones) will leave the defaults set to something like 48
hours for no real reason.
~~~
imbriaco
Very few resolvers break DNS TTLs in that way anymore. Google certainly honors
TTLs down to at least 30 seconds. I'm not aware of any major ISPs that get
this wrong anymore either.
This hasn't been a significant problem in years. When I execute a DNS change
on a record with a 30 second TTL, I expect to see 95+% of the traffic move
within a couple of minutes. The things that tend to get it wrong these days
are applications that don't honor the TTL instead of resolvers, but browsers
generally get it right.
~~~
tokenizerrr
madsushi is talking about servers, not resolvers.
------
dmourati
I watched Artur Bergman's talk at Surgecon:
[http://www.youtube.com/watch?feature=player_embedded&v=LQ_6o...](http://www.youtube.com/watch?feature=player_embedded&v=LQ_6oS3UqsM#t=761)
He covers DDoS in detail. Warning, possibly NSFW for many f-bombs.
------
joshguthrie
Martian packets are a funny thing: The packet is ALWAYS coming from somewhere,
so why don't internet providers just flat out refuse to send packets exiting
their networks if the given IP doesn't match what they get?
Okay, routers are supposed to get a packet and just route it to the next point
by blindly following the instructions ("0.0.0.1 wants to UDP 124.40.28.9 on
port 80"), but whatever the route taken, once my route leaves my home router,
my first stop will ALWAYS be my provider's routers, the very company that
gives me an IP.
So why can't these companies check on their client-to-outside-world routers
that the request is coming from my IP and not something otherworldly?
~~~
elorant
And what happens if you use a VPN?
~~~
AsymetricCom
VPN is on another layer, the packets should still have valid IPs. 'V' stands
for virtual (not Vendetta), there is no actual private network existing on top
of the internet.
------
yeukhon
I am quite surprised by "Dreamhost" listed in the spoofed IP list?
What is the reason Dreamhost servers are comprised? Are those the old server
accounts?
I am also amazed by the durability of our infrastructure able to sustain this
huge flow everyday. But good work, CF.
~~~
jeanjq
It's a list of spoofed addresses. That means they are pretending to be
Dreamhost, not that Dreamhost is compromised.
------
richbradshaw
I have a number of websites hosted on a dedicated server running Linux. Is
there any specific things that I should do on my server to mitigate/prevent
any impact from a DDoS against one of the site I host?
~~~
oceanplexian
Make sure your upstream or colo provider comes with DDoS mitigation.
Nothing within your power can protect you from a multi-gigabit DDoS attack
except bandwidth or a black hole route.
If you're getting smaller attacks you can try Fail2ban, some Nginx rules, or
an edge cache.
------
al1x
Under "Hide Your Origin", how does one ensure that "IP only accepts packets
from the [DDoS] service"?
~~~
avtar
Determine the range of addresses used by the service and then you could use
hardware and/or software (iptables, pf, etc.) packet filtering to only allow
packets from those hosts.
------
poobrains
Are there any "best practice" settings for specific OS/firewalls? I use
FreeBSD and pf.
------
alimoeeny
What are the Martian ip addresses?
~~~
joshguthrie
[http://en.wikipedia.org/wiki/Martian_packet](http://en.wikipedia.org/wiki/Martian_packet)
TL;DR: "Today, all CloudFlare routers were being DDoS'ed by 127.0.0.1.
CloudFlare is now investigating its employees."
| {
"pile_set_name": "HackerNews"
} |
India authorises sale of electric vehicles without batteries - baybal2
https://www.electricmotorengineering.com/india-sale-of-electric-vehicles-without-batteries/
======
taneq
From [https://www.indiatoday.in/auto/latest-auto-
news/story/morth-...](https://www.indiatoday.in/auto/latest-auto-
news/story/morth-allows-the-sale-of-electric-vehicles-without-batteries-
everything-you-need-to-know-1710727-2020-08-13)
> The amendment will allow OEMs to sell batteries separately or with
> subscription models, and will also encourage private players to join in as
> well, boosting the grass-roots of the electric ecosystem.
So it's about allowing competition in battery providers and allowing battery
leasing. This is a good move because not only does it open up the industry and
hopefully drive overall prices down, but it decouples the prices of vehicle
and "fuel", making it easier to compare directly with petrol-powered vehicles.
Also, by incentivizing vehicle designs with removable (and thus swappable)
batteries, it makes taxis and other high demand use cases more practical
without needing widespread fast charging infrastructure.
~~~
deepGem
Better place, An Israeli startup tried electric cars with battery swapping and
failed miserably.
So, decoupling battery from the car and allowing better competition in the
battery space might fly. Car makers need not be bothered by the battery tech
and can just focus on making good electric motors, since most of the car parts
are from other vendors anyways.
However, the decoupling might not be all that rosy as Musk has demonstrated
that safety is best achieved with total vertical integration. Even Tesla tried
battery swapping but gave up.
This might work really well in 2 wheelers though. The existing bike
manufacturers won't have to retool their factories by much to replace the
engine with a motor and the batteries can be probably swapped in and out of
the under seat space or something like that.
~~~
CarbyAu
I am inclined to agree with you.
Removable batteries for cars has a LOT of bulk and weight to deal with. More a
"service interval" like action rather than a daily event. Still handy to have
but not nearly so much incentive in the market.
But for motorbikes and scooters, maybe it could work. Especially small city
scooter(125cc equivalent) work.
Mind you, I am picturing a dystopian future whereby all the UberEats-like
delivery scooter people keep getting their batteries stolen...
edit: streamline
~~~
deepGem
Theft is a major issue and all anti-theft measures will result in increased
cost. One possible option is for the battery manufacturers to make the stolen
batteries useless by short circuiting them or something like that. So there is
total deterrence against theft.
~~~
AdmiralGinge
I wonder how much it'd cost for them to license a tiny part of the low-
frequency radio spectrum? The one for BBC Radio 4 covers most of the country
with a single transmitter for example, using this old-school technology you
could report your battery's serial number as stolen (with the appropriate
authentication) and the company would broadcast a signal to short it out. This
would be much harder to defeat than an internet-based solution I think.
~~~
rowanG077
It's trivial to defeat with a faraday cage.
~~~
AdmiralGinge
Not if you want it to actually fit in the socket of a car or bike.
------
aetherspawn
This is actually a really great direction.
Imagine - a software and hardware standard developed for batteries that allows
generic installation/communication between the vehicle and the battery pack.
And the realization that EV's may be multi-decade investments (and need to be
high quality to last) if the batteries are replaced each decade. Electric
motors don't wear down with kms like petrol motors do - how often have you
seen luxury cars wrecked where the interiors lasted a lot longer than the
driveline (pretty often i.e. BMW Audi)?
Why shouldn't people be able to buy high quality interiors and put new
batteries in them.
------
atburrow
Why was there a regulation in place preventing this in the first place? I
don’t get it.
~~~
LeifCarrotson
How does it pass safety regulations without an integral part of the vehicle?
How do they publish performance data if it can't move on itself?
Not that those are insurmountable obstacles, but a law that says "You can't
claim your vehicle does 200 miles on a charge if it doesn't include a battery"
or "You can't claim your vehicle is safe in a frontal crash because the
battery absorbs some of the energy except you're not including the battery"
don't seem unreasonable.
~~~
gruez
Can't you just design/test it with OEM batteries, but allow the end user to
buy it without the OEM batteries?
~~~
umeshunni
That's pretty much what this law allows now
------
Abishek_Muthian
This is nice, if the battery spec is standardised and 3rd party battery makers
can directly supply to the end users; not just to the OEMs. Barriers to entry
for power delivery systems should be brought down as well incl. Smart Power
Grids so that startups can enter the space in order to improve power delivery
to the end users, at the end of the day economics of owning an EV in India
should be favourable for the consumer to invest in it.
------
pkphilip
India currently has a law forcing the scrapping of all petrol and diesel
vehicles after 15 years of manufacture.
[https://www.financialexpress.com/auto/car-news/cars-older-
th...](https://www.financialexpress.com/auto/car-news/cars-older-
than-10-years-to-be-scrapped-govts-new-scrappage-policy-how-it-will-affect-
you/1294836/)
This is unnecessary as it will force perfectly usable vehicles to be scrapped
and it would come at a huge cost to the environment.
Ideally it would have been good to allow this change for internal combustion
engines as well so as to allow ICE cars to swap out their engines for more
fuel efficient engines.
~~~
captn3m0
15 year old cars in India are tinboxes, with very little margin for safety. No
airbags for eg. Maybe once we actually start manufacturing cars that are safe,
we can turn this off after a decade.
~~~
pkphilip
You can still buy new cars off the lot right now without airbags or any safety
features. And of course, trucks and commercial vehicles rarely come with these
safety features in any case.
Also, this scrapping law applies even for vehicles with all safety features..
including from companies such as Mercedes, BMW, VW etc.
I would think that it makes perfect sense to scrap vehicles - no matter how
young/old, if it seriously fails an inspection or if the pollution levels from
the vehicle is too bad - and there are existing "fitness" tests for this, and
so why scrap vehicles which are well maintained?
~~~
knolax
I feel like in practice people will just find ways to skirt around the law.
Who's gonna scrap a perfectly good BMW.
~~~
pkphilip
The new law that is being put into motion requires that all petrol and diesel
vehicles be scrapped in 15 years no matter their condition. So if you have BMW
in mint condition and serviced regularly - but it is 15 years old? well, tough
luck, it won't be allowed to ply on the roads.
[https://timesofindia.indiatimes.com/auto/miscellaneous/govt-...](https://timesofindia.indiatimes.com/auto/miscellaneous/govt-
proposes-scrapping-of-vehicles-older-than-15-years/articleshow/70401198.cms)
------
Gabrielfair
Can someone help me understand how this will help the adoption when they still
have to buy the expensive batteries
~~~
mattnewton
It will allow companies to compete above their scale if they don’t own huge
battery operations, and probably force standard battery interfaces / easy
customer install. That could make swapping batteries practical depending on
the design.
~~~
thewhitetulip
Considering that the ruling party is BJP (equivalent to US Republicans), this
move will directly help Ambani & Adani.
There won't be any tight competition or open interface, it'll be a monopoly by
the two business groups who support him the most.
~~~
ra7
> Considering that the ruling party is BJP (equivalent to US Republicans)
There are many things wrong with the BJP, but they are not really equivalent
to the Republican Party. This is a lazy comparison at best, disingenuous at
worst. Their economic, environmental policies and even social issues are
completely different than the Republicans.
~~~
addicted
Yeah. The Modi government/BJP is equivalent to right wing authoritarian
governments around the world. Tories in the UK, Netanyahu’s government in
Israel, etc.
The Republican Party is on its own little island far far away from any other
normal political party in the world. For example, the Republican Party is the
only major democratic political party in the entire world that denies the
existence of anthropogenic climate change. There are major right wing
political parties worldwide that may claim the costs of doing anything exceeds
the benefits or that we need to wait for better solutions, etc but no major
party denies the basic scientific fact of it happening the way the Republicans
do.
There is also other stuff like the prevalence of young earth creationism, the
overt religiosity, the lack of any economic principles (e.g. just see their
rhetoric on deficits when there is a Democrat in charge vs what they do when
they are in charge) etc that sets them apart from major right wing political
parties worldwide.
~~~
thewhitetulip
> lack of any economic principles (e.g. just see their rhetoric on deficits
> when there is a Democrat in charge vs what they do when they are in charge)
> etc that sets them apart from major right wing political parties worldwide.
You literally described six mismanaged years of BJP in India
They did EVERYTHING which they opposed during Congress's time
They opposed FDI when in opposition And now they approved FDI in everything
including defence manufacturing
There even was a site called modilies.com containing all such listing of
things he opposed as CM which he is doing as PM
------
dn3500
I got a chuckle out of the photo they used to illustrate the story.
------
CarbyAu
If they can do this for one highly complex, many moving parts, integrated
product.... do it for phones.
And standardise recycling while you're at it.
------
alexose
We need an open source, modular, convenient swappable battery + BMS design.
Something that end users can pick up and drop in their vehicle of choice.
Something like the Gogoro battery, but with flexibility for larger vehicles.
------
known
Sounds rational since existing car owners prefer to covert to EVs
[https://www.bharatmobi.com/faqs/](https://www.bharatmobi.com/faqs/)
------
hathym
Off topic, but why not a battery standard for all cars that will make charging
almost instant by switching them just like we do with toys?
~~~
speedgoose
Swapping a battery is simply a lot more complex than charging it.
Renault tried it with the Fluence in Israel, it stopped. The Zoé has been
designed to have easy battery swaps but it's not used.
Tesla did some demos in the past but they didn't explore more.
However Nio still believes in this solution, with proprietary batteries, so if
they are very successful in China some others may try again.
~~~
newyankee
Actually in Indian market the primary target audience i believe is 2 and 3
wheelers, which have smaller batteries and shorter ranges. China has already
converted most of such fleet to electric. Due to lack of capability in
producing batteries locally in India as well as geopolitical issues hampering
China imports and dependency, this is one policy designed to make adoption
cheaper.
Indian ICE manufacturers never had the vision to create an EV industry at
home, they are very reactive in nature. Only Tata, Mahindra have some
capability and most of the 2 wheeler manufacturers were importing almost all
the important components from China.
------
867-5309
"excluding" may have been more appropriate than "without"
------
afrojack123
Now I can drive my Tesla around with a hydrogen fuel and fuel cells.
~~~
speedgoose
Why would you do that though?
~~~
newen
Why not?
~~~
speedgoose
Hydrogen is expensive and not convenient for cars.
~~~
afrojack123
Batteries are ~$3/KWH. The natural gas that hydrogen comes from is only
$.50/KWH.
~~~
speedgoose
What about the hydrogen charging station?
~~~
afrojack123
Modify existing gas stations to supply hydrogen instead.
~~~
speedgoose
I was thinking about the cost of hydrogen fueling stations compared to
electric fast chargers.
------
xenospn
How long before we have cars exploding because someone, somewhere, tried
cutting corners and jerry-rigged a DIY battery in their car to save some
money?
| {
"pile_set_name": "HackerNews"
} |
College is a waste of time - dalejstephens
http://www.cnn.com/2011/OPINION/06/03/stephens.college/index.html?hpt=op_t1
======
zppx
This was posted yesterday: <http://news.ycombinator.com/item?id=2617379>
| {
"pile_set_name": "HackerNews"
} |
Turn a snorkeling mask into a respiratory mask for assisted ventilation [video] - ggurgone
https://www.youtube.com/watch?v=w4Csqdxkrfw
======
Tepix
Can a snorkeling mask also be used as a PAPR?
Here's a DIY project by Shen Ye:
[https://twitter.com/shen/status/1240478370619629568](https://twitter.com/shen/status/1240478370619629568)
~~~
granjef3
[https://www.youtube.com/watch?v=lmNIEDDCqSk](https://www.youtube.com/watch?v=lmNIEDDCqSk)
------
hnarn
Are people really assuming that professional, medical ventilator equipment
does nothing more than uncontrollably push air into your lungs? Spreading
potentially dangerous medical "hacks" should be illegal, "well-meaning"
hackers may cause people to harm or even kill themselves by accident. Please
let these strategies take the proper route via medical professionals.
~~~
nico_h
According to the story the designs & 3D printing guys were contacted by a
doctor with the idea about how to re-purpose the mask
------
caiobegotti
Full article in English with the video embedded and where they say they have
supposedly patented it even though it's a branded snorkeling mask from
Decathlon: [https://www.isinnova.it/easy-
covid19-eng/](https://www.isinnova.it/easy-covid19-eng/)
~~~
kbaker
True but the patent is in good faith:
> We clarify that the patent will remain free to use, because it is in our
> intention that all hospitals in need could use it if necessary.
> We clarify that our initiative is totally non-profit, we will not obtain any
> royalties on the idea of the link, nor on the sales of Decathlon masks.
~~~
phyzome
They can't just say "hey, we're publishing this, and this is now prior art" so
no one can patent it in the future?
(Is this a difference between the US and EU patent systems?)
~~~
GloriousKoji
Not anymore. US used to be first to invent but switched to first to file a
some years ago.
~~~
tzs
That doesn’t make a difference in this case. It just affects which filer gets
priority if more than one party files claiming the same invention.
The winning filer’s claim still has to meet the other requirements for a
patent, including novelty and non-obviuousness.
------
coderintherye
Has anyone looked into using CPAP machines for ventilation for covid-19 cases?
They are lower pressure and only one pressure, but seems like would still be
quite useful if one didn't have a full ventilator?
I don't know how many CPAP machines there are in the US but I know three
people who each have one.
~~~
satya71
The trouble as I understand is that CPAP aerosolizes the virus and spreads it
everywhere.
~~~
jacobush
Still useful if you can put people in a balcony for instance, old school
sanatorium style. And what is usually called "CPAP" is actually not constant
airpressure anymore but adapts continuously with software.
~~~
bradknowles
That would technically be an “Auto-PAP”. I have a CPAP and my doctor has
specifically said that I should stick with this technology for as long as I
can, because it will be better and more effective for me in the long run. He
said that an Auto-PAP or a Bi-PAP would be the next step, if we get to needing
pressure levels that a CPAP can’t deliver.
------
jariel
What's interesting about the 'mask' concept is that it changes the nature of
intubation and invasive tubes.
Can a medical practitioner comment on the nature of the opportunity here?
Would a 'mask' be more practical for unconscious patients?
~~~
stuckindoors
This essentially provides CPAP therapy. CPAP can be helpful but it is not a
direct replacement for ventilation/intubation.
Initial info from the intensivists (ICU docs) from Kirkland Washington suggest
that time should not be wasted with CPAP or BiPAP. These measures only
postpone the inevitable in patients with COVID-19.
Also a good percent of medical personnel were becoming infected from the
Italian data with SARS-CoV2 (10-15%). Measures like BiPAP or CPAP do can
exposure others in the room, especially with the rapid progression of this
disease and the likely need to intubate the patients and ventilate them.
That being said this is a great accomplishment and the variety of sizes these
masks come in would be helpful especially in the pediatric population. I now
have to fire up my 3D printer.
------
pedrocr
What filter would be needed to make this into an N95 replacement instead?
Seems like the full face mask would make this even more effective as it also
protects the eyes.
------
mirekrusin
..now we just need sodastream refills with o2 and adapter?
| {
"pile_set_name": "HackerNews"
} |
Mark Zuckerberg on SNL (video) - moses1400
http://www.mediaite.com/tv/the-real-mark-zuckerberg-confronts-a-surprised-jesse-eisenberg-on-snl/
======
sayemm
I really applaud Zuckerberg for positively embracing all the attention that's
been shouldered on him, really. I think stuff like this SNL skit or him taking
his core team at Facebook to watch "The Social Network" together at a movie
theatre just shows tremendous inner strength and maturity on his part. It's
great to see him be able to laugh it off and joke about it.
He's come a long way in his public speaking skills too, he was pretty natural
and comedic during his talk at Startup School. I think he's only going to get
better from this point on too.
~~~
locusm
I seriously doubt this was of his own doing, more an indication his PR team is
working hard on rebuilding his public image
~~~
rokhayakebe
I seriously doubt Mark is the type to appear on a TV show because the Facebook
PR team convinced him to.
------
rickdangerous1
I'm glad that was awkward. If he got 1600 on his SATs, started a 50bn company,
and was a gifted comedic actor...I'd be pissed off. And a little sad for
myself.
------
bvi
I liked how he totally loved his own joke about having invented poking ("I
invented poking! :-D"), and after a second of silence from the audience,
realized that he should be in character, and went back to trying to look
serious.
~~~
jrockway
To be fair, it was a pretty good line. One thing I like about comedians like
Jerry Seinfeld and Larry David is that they both realize when they've said
something hilarious and can't help but giggle a bit. It works for Zuckerburg
too, although I guess the audience didn't care that much.
------
iamclovin
Not to sound like a fanboy (thought that might be a lost cause), this reminds
me of how good a showman Steve Jobs is - as seen in the 1999 Macworld Expo
with Noah Wyle (in very similar circumstances - Wyle had played Jobs in
'Pirates of Silicon Valley').
<http://www.youtube.com/watch?v=TIClAanU7Os>
------
rabidsnail
Direct link:
[http://videos.mediaite.com/embed/player/container/1666/1232/...](http://videos.mediaite.com/embed/player/container/1666/1232/?layout=&playlist_cid=&media_type=video&content=SPS1PQ1MLH1R0DSM&read_more=1&widget_type_cid=svp&referrer=)
More direct link (for Chrome users, for which their player seems broken):
[http://videos.cache.magnify.net/XHGXHV243M6QF0PD-
mark_483_33...](http://videos.cache.magnify.net/XHGXHV243M6QF0PD-
mark_483_336_384x256.mp4)
~~~
NZ_Matt
youtube: <http://www.youtube.com/watch?v=yKuaO6P8ZAg>
~~~
karlzt
[http://www.iviewtube.com/videos/177177/jesse-eisenberg-
snl-m...](http://www.iviewtube.com/videos/177177/jesse-eisenberg-snl-
monologue-with-mark-zuckerberg)
------
kulpreet
I think the awkwardness might have been part of the joke.
~~~
zaidf
Bingo.
For all those complaining about his lack of performance here, you're kinda
missing the point..
It's not Zuckerberg if he's not awkward.
------
rudiger
That's a lot of 'bergs.
------
redthrowaway
So what happened to Zuckerberg receiving a bunch of PR lessons and not being
so awkward? I get that this isn't his thing, but... ow.
I actually think Zuck should just hire Eisenberg to be him anytime he has to
appear in public. And get Sorkin to write his speeches. He'd be far more
entertaining that way, and he would get to stay at Facebook doing what he does
best.
~~~
gruseom
_I actually think Zuck should just hire Eisenberg to be him anytime he has to
appear in public. And get Sorkin to write his speeches._
Goodness gracious, I couldn't disagree more. I thought Eisenberg played MZ
like an angry cartoon character. And Sorkin's incessant zingers were classic
bad "good" writing calling attention to itself, the writer trying to wedge
himself in as one of the stars of the movie (which worked, judging by the
attention he got for it).
~~~
redthrowaway
Would you say that Juno had bad writing, or anything by the Coen brothers or
Joss Whedon? All of those feature the kinds of conspicuously zippy one-liners
that you seem to feel constitute bad writing.
~~~
gruseom
Good question. I didn't see Juno. I loathed what I saw of Joss Whedon, so
you're probably right there. But IMO the Coens are far greater artists than
that. I don't have any unified theory of why, but I'll point out one thing.
_Lebowski_ has lots of zippy writing (different than Sorkin's, but I'll
concede the point) but _True Grit_ , to take the obvious recent example, does
not. Neither did _No Country_. In other words the Coens have the discipline to
subordinate their cleverness to the needs of the genre and the story. In fact
this is one of their distinguishing features. Sorkin by contrast seems to have
this adolescent need to prove how smart he is in every context, and is quite
willing to turn his characters into caricatures in order to do it. It's a form
of incontinence.
~~~
redthrowaway
"Lebowski has lots of zippy writing...but True Grit...does not."
Did we watch the same movie? True Grit had some of the wittiest, zippiest
dialogue I've seen in a long time. The writing was _incredibly_ conspicuous,
in a good way.
I disagree with your notion that conspicuous writing makes for a bad movie,
just as I would argue that conspicuous editing, or score, or cinematography,
or acting can lead to an excellent movie.
------
mattlong
Wow, that guy is painfully awkward....I got uncomfortable just watching it.
~~~
endlessvoid94
He's definitely come a long way, though. I remember watching him on stage at
F8 and being uncomfortable with how terrible of a speaker he was.
Fast forward, and he's definitely learned at least the rudiments of being the
center of attention and speaking without sounding like he has zero social
skills.
------
mmaunder
As much as I hate the idea of The Social Network, that was actually really
f'ing funny. Good one Zuck!
If you haven't seen it, check out Jesse Eisenberg in Holy Rollers - IMHO his
best movie.
------
blackysky
gotta love is PR team ...at least he is a better public speaker ...
------
bound008
the zuck is having trouble being a fanboy on here. i think thats where the
real comedic value stems from for those of us in the valley who have met him,
or at least heard him speak.
------
tmsh
Not all who seem awkward are lost.
------
shimi
Zuckerberg came out at Eisenberg's home turf, I can't see this happening the
other way around
| {
"pile_set_name": "HackerNews"
} |
Ask YC: Do you know of any web 2.0 sites where most users are computer illiterate? - amichail
And do these computer illiterates contribute much content to the site?<p>This is interesting because the ad revenue from such a site could be much greater than average as computer illiterates are more likely to click on ads (not even knowing they are ads).
======
TheTarquin
MySpace. I can't count the number of people have asked me some version of
"Dude, you're good at computers? Can you help me make a bitchin' MySpace
page?"
Admittedly, as the saying goes, the plural of "anecdote" is not "data", but it
seems to me that MySpace is a wealth of user-created content primarily created
by the computer illiterate (incomputerate?).
------
bmaier
At its loosest description, email is a social network and a ton of otherwise
computer illiterate people use it daily.
------
aykall
Well, I'm saying this but I'm not based on any data, it is just my opinion.
You will find tons of computer illiterates on Facebook and MySpace. When I say
tons I really mean it. Those users, based on my observations, really have a
higher ad-click rate but social networks at the same time have a low click
rate. When surfing those sites people are usually just "wasting" some time and
they know what they are looking for: they wanna know more about life of
others...
------
allanscu
Any picture-only type website doesn't require much from the user. So I Picasa
and Flickr and YouTube (and web 1.0's hotornot.com) fall within this category.
It doesn't take much to look at a picture/video and click. Or if they want to
submit their own content, it isn't hard to browse, upload and submit.
------
izak30
In my experience, when people are becoming computer literate, they get exposed
to: Webmail, Search, Wikipedia, Chat Rooms, Online Poker, MySpace, Facebook,
In no particular order.
I think that the mobile web would be a place to make a killing on ads once
it's mainstream, no computer required.
------
bayareaguy
I think you may need to define computer literacy a little more, but I suspect
most users of YouTube and various online gaming forums may qualify.
| {
"pile_set_name": "HackerNews"
} |
Might be as good as Old Spice Marketing...pleaseshutup.com - keltecp11
http://www.pleaseshutup.com/hidden-videos/#/video/amishcountry
======
byoung2
Aren't these the same skits from Trigger Happy TV?
<http://www.youtube.com/watch?v=PHqdz-g8tQk>
| {
"pile_set_name": "HackerNews"
} |
Scientists in Germany, Peru and Taiwan to Lose Access to Elsevier Journals - rvern
http://www.nature.com/news/scientists-in-germany-peru-and-taiwan-to-lose-access-to-elsevier-journals-1.21223
======
biehl
How about "Scientists in Germany, Peru and Taiwan to Rightfully Dump Elsevier
Journals" ?
Or maybe "Librarians in Germany, Peru and Taiwan to Rightfully Dump Elsevier
Journals" ?
------
kaffee
Title is inaccurate. The scientists in question can simply go to sci-hub and
input the DOI to access the Elsevier articles.
We need more heroes like Alexandra Elbakyan.
~~~
yladiz
This isn't a solution because, while yes, it does allow them to access
some/all of the specific journals and articles the academics would need to
use, but the schools/country aren't going to advocate for this since they want
the contract with Elsevier in general even if they don't like the terms.
~~~
rvern
It isn't a solution in theory, but it's a great solution in practice.
You're right that the schools won't advocate so-called piracy, but they don't
seem to care too much about dropping the subscriptions either.
------
jmnicholson
I think science is at an interesting point. We've just had our Napster moment
with Sci-hub. We'll soon have our Youtube moments with Authorea
([https://www.youtube.com/watch?v=Qa1ObxI_dqU](https://www.youtube.com/watch?v=Qa1ObxI_dqU))
and the rise of preprints in new disciplines, In short, I see self-publishing
and dissemination increasing in the coming years.
Maybe we'll have our Justin Bieber of research quite soon!
~~~
trendia
Authorea looks cool, but you should probably disclose in the comment that you
are associated with it. You might even get more attention to it that way, too.
------
maverick_iceman
In subjects like physics journals are already an anachronism as everything is
published and referred via arXiv anyway.
------
sctb
Previous related discussion:
[https://news.ycombinator.com/item?id=13187315](https://news.ycombinator.com/item?id=13187315)
------
a3n
Why not change "publish or perish" to "edit, review or publish or perish?"
Gather a union of universities, or a guild or whatnot, and publish through
guild venues.
------
jrochkind1
How long til Elsevier sues scihub? What scihub does isn't possibly legal, is
it?
~~~
schoen
About negative 19 months (Elsevier filed a lawsuit against Sci-Hub on June 3,
2015).
[http://www.stephenmclaughlin.net/2016/03/18/elsevier-v-
sci-h...](http://www.stephenmclaughlin.net/2016/03/18/elsevier-v-sci-hub-on-
the-docket/)
| {
"pile_set_name": "HackerNews"
} |
Don't return null; use a tail call - ranit8
http://joelneely.wordpress.com/2010/04/17/dont-return-null-use-a-tail-call/
======
ufo
The important thing here is not that passing onOK and onError callbacks is a
good idea. The real issue is that NULL pointers are the most dangerous thing
invented in the 20th century and should be avoided like the plague.
From an [expression problem](<http://c2.com/cgi/wiki?ExpressionProblem>) point
of view using a discriminated union (in the same spirit as returning null but
safer, since you can you peek at the value after doing a null check) would
probably be just fine anyway. You still get to avoid the danger of NULL
pointers but you still get a real value to work with (unlike the callback case
that allways immediately splits it) so you can store it, pass it around, etc.
By the way, astute readers might have recognized all that callback passing as
just the [visitor pattern](<https://en.wikipedia.org/wiki/Visitor_pattern>) in
disguise.
~~~
VMG
> _The real issue is that NULL pointers are the most dangerous thing invented
> in the 20th century_
Not sure if serious
~~~
ufo
I am somewhat serious about this. Tony Hoare even called them his "Billion
Dollar mistake" in a talk he gave a while ago
([http://www.infoq.com/presentations/Null-References-The-
Billi...](http://www.infoq.com/presentations/Null-References-The-Billion-
Dollar-Mistake-Tony-Hoare))
~~~
barrybe
That talk gets quoted pretty often, but it's a bit silly for Hoare to take all
the blame/credit. Null references were discovered, not invented. They are so
easy (from the point of view of someone implementing a non-functional
language) that they were inevitable.
------
leppie
Funny article. He mentions 'tail call elimination' once, and then never
mentions 'tail call' again.
Also a 'tail call' and 'tail call elimination' are 2 completely different
things. The former being an implementation detail (to provide proper tail
recursion for languages that require it, ie Scheme), the latter an
optimization technique (to remove (expensive) tail calls!).
~~~
jonmrodriguez
Nonetheless, the term "tail call" should apply to what he is talking about.
If "tail call recursion" means recursing as the last thing you do before
returning, then he is saying to send a message as the last thing you do.
AKA send a message as a tail call instead of returning the value of that
message.
------
dhx
Remember to keep track of the call stack in your head as you write code. The
trap to avoid is to invert control and then fail to invert (return) back to
the main program flow.
In the example referenced, the following call stack could be created:
0. authenticateUser
1. login
2. authSucceeded
If authSucceeded continues to call other functions as if it were the new main
flow of control you could end up with a very deep call stack (it's not
uncommon to see software with a call stack 40 calls deep). This is why I would
have preferred "authSucceeded" to be renamed as "registerUserSession" or
something else that screams "this function will do a well defined bit of work
and _return quickly_" rather than "this is a loosely defined event callback
that may do anything".
~~~
chalst
In the context of the OA's first sentence ("Why should an object-oriented
programmer care about tail-call elimination?"), I think the author is thinking
more of Scala and Ruby than Java, and there's no expectation that the tail
call will return at all.
------
lubutu
Using this approach you would often also need to maintain state about what was
requested, using closures or similar to avoid race conditions. Alternatively,
Haskell offers the _Maybe_ type, where _Nothing_ means "not found" and _Just
x_ means "found _x_ ". Using a callback seems more prone to disaster than just
encoding the possibility of null into the type system.
~~~
troygoode
C# offers this via Nullable<T>:
Nullable<int> someNumber = foo.TryAndGetSomeNumber();
if(someNumber && someNumber.HasValue)
doSomething( someNumber.Value );
~~~
dkersten
_if(someNumber && someNumber.HasValue)_
You still have to remember to do this check. Will the compiler complain if you
use _someNumber.Value_ without checking that its valid first? If not, then its
not really the same thing.
The point of Haskell's Maybe is that the compiler will make sure that you take
both cases (that there is a value and that there isn't a value) into account
(because to extract the value you must pattern match and pattern matches must
be exhaustive, otherwise you get a compile error).
~~~
chc
Eh, that's putting it a little too strongly. Haskell is a nice language, but
it still doesn't protect you from all your mistakes. The easiest way to
extract the value in Haskell is fromJust, which simply errors if no value was
returned. I do agree that Haskell makes it more natural, though.
------
gurraman
Common idiom in Erlang. Using message passing (untested code):
do_something(N) ->
Pid = self(),
spawn(fun() -> find_x(Pid, N) end),
receive
{found, Item} -> ...;
not_found -> ...
end.
find_x(Pid, N) -> find_x (Pid, N, [1, 3, 5]).
find_x(Pid, _N, []) -> Pid ! not_found;
find_x(Pid, N, [N|_T]) -> Pid ! {found, N};
find_x(Pid, N, [_H|T]) -> find_x(Pid, N, T).
You can also handle timeouts and stuff.
~~~
mononcqc
Unless you specifically need a timer, I wouldn't use that and would simply
return {ok, N} or {error, not_found}; that would avoid useless copying and
message passing. Something like:
find_x(N) -> find_x (N, [1, 3, 5]).
find_x(N, []) -> {error, not_found};
find_x(N, [N|_T]) -> {ok, N};
find_x(N, [_H|T]) -> find_x(N, T).
If what you want is to get out of deep recursion and the above doesn't work
especially well, that's what 'throw/1' is for:
Res = try find_x(N) of
Val -> {ok, Val}
catch
throw:not_found -> {error, not_found}
end.
This will allow to avoid the stack, special cases for returning values and
give you the code result you need.
The spawning of a process for a simple use case like this is only worth it if
you need a timer to give a maximum execution time for a given request.
Otherwise, it's not very useful, clear or efficient. I'd mark it as
'concurrency for the sake of it'.
------
mmariani
IoC is a very useful concept for any OO language. For instance, ObjC uses it a
lot through protocols. More info on that subject can be found here:
<http://martinfowler.com/bliki/InversionOfControl.html>
The above link has some very interesting links about OO design and SmallTalk
right at the end.
------
strictfp
I don't think that this article focuses on the right problem at all. The real
problem in my eyes is that the semantics of 'null' is not agreed upon. It can
mean anything, including but not limited to:
* Wrong username
* Wrong password
* Login procedure aborted due to external factor
* Programming error
This causes a headache, since the client might forget to check for the magic
value 'null' and the symptom might therefore accidentally be deferred to any
later time.
Instead of using a callback method, why not just return an instance of some
more sophisticated class, i.e something like this:
public AuthenticationResult authenticateUser(User user) {
...
}
with a possible usage:
AuthenticationResult authResult = authenticateUser(user);
if (authResult.failed()) {
notifyUser(authResult.getFailureReason());
}
If the client then tries to use a failed AuthenticationResult as a successful
one, or use a successful AuthenticationResult as a failed one, the programmer
is free to throw any informative exception. Example:
class AuthenticationResult {
...
public FailureReason getFailureReason() {
if (!failed) {
throw new IllegalStateException("you cannot fetch a failure reason from a sucessful AuthenticationResult!");
}
}
public AuthToken getAuthToken() {
if (failed) {
throw new IllegalStateException("you cannot fetch a auth token from a failed AuthenticationResult!");
}
}
}
If one instead would use 'null' as a magic value for 'auth failed', the
dreaded NPE would show up instead!
~~~
politician
I'm not bashing your idea, but throwing an authentication exception covers
this almost entirely.
See, the calling code probably can't correctly proceed unless authentication
was successful, and there's no chance that the caller can simply forget to
handle an exception -- at the very least, it'll hit a top-level exception
handler and/or crash the program.
~~~
strictfp
That is another viable strategy if you don't want to handle the login failure
in any graceful way.
~~~
politician
Exceptions are not a crash-or-nothing proposition. The idea is that the caller
should handle them at the earliest point in the call-stack that can do
something reasonable about the problem.
Also, let me clarify that I don't believe that exceptions should be used as
the only way to return values from a method in languages that support them.
They are simply a tool with certain properties (among them, the ability to be
more difficult to ignore, the topic at hand).
~~~
strictfp
I generally find that one should avoid using exceptions for flow control. They
have their usages, but they should in my opinion only be used when they really
shine - when you have multiple levels of callers between the detection of the
error and the handling. This was not the case in the simple example, and so I
chose a return value instead of an exception.
------
wlievens
Common idiom in javascript/jquery too, where the callback is called after the
asynchronous execution. That's the advantage of this technique of course:
synchronous or asynchronous implementations are interchangeable.
------
batterseapower
AKA double-barrelled continuation passing style
~~~
wickedchicken
Which is annoying as all hell to write directly. I know it's a cliche to bitch
about how 'ugh, language X doesn't have feature Y' but many callback-
spaghettisms of Node would go away with call/cc.
~~~
dustingetz
if anyone's curious, i wrote a presentation about how call/cc can fix
callback-hell per parent.
slides: lets make a blocking API not block. wait, what? (a practical
introduction to continuations)
[<https://docs.google.com/present/view?id=dv9r8sv_82cn7dngcq>]
------
antihero
" In his post, the caller passes itself as an argument (using a suitable
interface type, of course), and the callee responds by invoking either a
“found” or “not found” method on the caller."
Isn't this pretty much what you do in Twisted already?
~~~
andrewcooke
the difference is that twisted uses trampolining - there's a top level
scheduler that manages everything. if twisted worked exactly as described in
this article then you'd run out of stack space (python doesn't eliminate tail
calls) (also, of course, the trampoline allows other work to happen while
processes yield, which is what makes twisted useful).
from another pov: this article describes how the designers of twisted want you
to think (ie continuation passing style), but the actual implementation is
slightly different.
[http://en.wikipedia.org/wiki/Trampoline_(computing)#High_Lev...](http://en.wikipedia.org/wiki/Trampoline_\(computing\)#High_Level_Programming)
<http://en.wikipedia.org/wiki/Continuation-passing_style>
------
dustingetz
OP argues that callbacks are less complex than type-checked null because it
eliminates checking success at the call site. Branching on success at the call
site is similar complexity as implementing onSuccess and onError. I don't
think its the check itself that matters, its remembering the check, and both a
success/failure interface and type-checked null meet this goal.
As to which is better, type-checked null is referentially transparent, which
is a nice objective measurement of complexity, and referentially transparent
functions are generally more reusable than those that aren't. It also keeps my
mental model of the stack tidy, tail-call optimization or no.
QED, right? have I missed anything?
~~~
kinofcain
I agree that it doesn't make things easier but makes it easier to remember.
One thing that the callback style enables is that you can have more than just
success and failure and/or you can provide more information about _why_ it
failed.
I don't particularly like this callback style though. I do like the multi
return value style in languages like Go* where, by convention, an error is
returned as the last parameter. You still have to check whether the error
itself was nil, but at least you get a reason why; It is also part of the
method signature, meaning you can ignore it, but you have to explicitly ignore
it.
While that doesn't make it referentially transparent, it does force the
programmer to acknowledge the possibility of error, even if they don't deal
with it. It also keeps the flow more sequential and often times easier to read
than the callback style.
*C#, Ruby and others also have some form of multiple-return values, but it's rare to see them used in this way.
~~~
dustingetz
the whole point of type-checked null is that the type system (compiler)
_forces_ you to acknowledge potential error states. it doesn't care if you
deal with it; you can ignore the error states, or not, but its not possible to
forget.
------
noblethrasher
Or return an iterator (e.g. IEnumerable<T> in C#).
| {
"pile_set_name": "HackerNews"
} |
How to sell your side-project/startup? - anmolparashar
Hey guys,<p>A lot of times makers/founders want to sell their business, but don't really know how to do it without later regretting it. Sometimes it's because they sell it to the wrong person (someone who's just looking to resell it in a few months) and sometimes it's because they feel like they didn't sell it for a good enough price (mostly happens when they accept the first offer as soon as they hear it). There are a few marketplaces to help facilitate this process for the founders, but honestly most of them care only about making a sale, mostly because they get a cut.<p>I started Soochi [1] to solve this exact problem: Help founders sell their projects/startups without having them regret it later. At the risk of not stretching this post to a blog post's length, I'll just link this Medium post [2] I wrote introducing Soochi, and explaining how I see things working with Soochi.<p>I am really hoping Soochi succeeds at solving the issues makers/founder currently face with the current options, and would love to hear any feedback, or answer any questions that you may have about the site.<p>[1] https://soochi.co
[2] https://medium.com/p/soochi-d32221e4a180
======
mtmail
This is soochi advertising disguised as question. Can you add the company name
to the title like in previous submissions? (e.g.
[https://news.ycombinator.com/item?id=15621579](https://news.ycombinator.com/item?id=15621579))
~~~
anmolparashar
The post you linked to was a Show HN post. This is a discussion posts for
people to share similar stories, or give feedback on Soochi.
I could have easily deleted the previous post, and do a Show HN again, but I
didn't because that'd be spamming. Please understand that HN is a community
where people can discuss anything related to tech. This post doesn't violate
any HN rules
~~~
gus_massa
It's ok to submit your own stuff here, but if you ask questions where (one of)
the answer is your product, many people will feel that it's a disguised ad.
Also:
> _I could have easily deleted the previous post, and do a Show HN again, but
> I didn 't because that'd be spamming._
From the FAQ:
[https://news.ycombinator.com/newsfaq.html](https://news.ycombinator.com/newsfaq.html)
> _Please don 't delete and repost the same story, though. Accounts that do
> that eventually lose submission privileges._
| {
"pile_set_name": "HackerNews"
} |
The Government Thinks This Couple Isn't Smart Enough to Be Parents - greedo
http://reason.com/blog/2017/07/20/oregon-has-decided-this-couple-isnt-smar
======
legostormtroopr
The source article from "The Oregonian" paints a much bleaker assessment of
the parents abilities.
"According to child welfare records provided by the couple, Ziegler "has been
sleeping with the baby on the floor and almost rolled over on him. There were
also reports that Eric is easily frustrated and often forgets to feed his
dog.""
Its sad, but the question we need to ask is, does the government have an
obligation to provide the best opportunity for the child? If so, given that
the mothers mother is dead and her father is quite old, and that both parent
suffer difficulties, maybe this is the least worst option for the child and
the parents.
[http://www.oregonlive.com/pacific-northwest-
news/index.ssf/2...](http://www.oregonlive.com/pacific-northwest-
news/index.ssf/2017/07/parents_with_intellectual_disa.html)
~~~
krapp
>Its sad, but the question we need to ask is, does the government have an
obligation to provide the best opportunity for the child?
I don't think so. The government has the obligation to preserve the _general_
welfare and public order - providing opportunities for any particular child is
entirely the obligation of their parents and community.
Unless there's an actual law being broken - and as far as I know, being
mentally incapacitated is no crime, and according to the article, there were
no signs of abuse - then the government shouldn't get involved.
------
xxSparkleSxx
That's fucking awful. Would love to see the state step in and take children
from families where parents are working more than 40 hours a week.
Seems like leaving your child to their own devices is much more irresponsible
than parents with low-IQ. After all, dumb parents being present are better
than no parents.
~~~
dragonwriter
> Would love to see the state step in and take children from families where
> parents are working more than 40 hours a week.
I'd rather the state step in and align the economic incentives so people don't
feel the need to do that as much (though 40hrs—presumably per week—is a pretty
low maximum threshold.) The state isn't much good at substituting for parents.
> Seems like leaving your child to their own devices is much more
> irresponsible than parents with low-IQ.
Probably, at least for very young children or somewhat older children for
extended periods. But working doesn't inherently imply leaving your child to
their own devices while you do that, even if both parents are working at the
same time.
------
ateesdalejr
This is wrong morally and politically.
~~~
sldoliadis
I usually find Reason pretty, well, reasonable.
But I think this article is potentially misleading, if unintentionally.
I do these sorts of evaluations professionally routinely, in exactly these
sorts of cases.
The state (at least my state) doesn't take children away because of low
cognitive ability. They take them away because there's some danger to the
children, and low cognitive ability is found to be a contributing factor
that's unlikely to go away.
72 and 66 are not just below average, as the article portrays. It's about 2sd
below average.
I've seen exactly these sorts of cases, and they're extremely, extremely sad
because the parents love their children and truly want the best for them. But
when you see the consequences of not intervening, it's often even more sad.
This may be a case where the state screwed up. That happens, and it seems from
the Oregonian story that there's disagreement among social workers about their
parenting abilities, so it's possible it's in a very grey area.
Lost in the Reason story and buried in the Oregonian story, though, is that
the state has a duty to protect the children's privacy usually. It states that
they removed the recent child from the parents' care in the hospital without
them even being able to take the child home.
In my experience, that often happens when something serious happens to the
child in the hospital (for example, hospital staff witness something very
threatening or concerning to them). If there was some doubt, given the
previous history of involvement, child protection would be more likely to lean
toward acting out of caution.
Critically, though, neither child protection nor the hospital would say a peep
about this to the press, to protect the child's privacy. So what it would look
like from the outside is that the state just came in and took the child away,
and isn't providing any explanation for what triggered the removal.
It's also possible this case isn't really over. Children get taken away for
long periods of time and then are returned, as long as there aren't permanent
decisions in the court system.
I've seen a lot of these types of scenarios, and the reporting on this seems
potentially misleading, even if well intended. Although the impression the
press is giving could be accurate, I'd want to see a lot more information
before I'd pass judgment.
| {
"pile_set_name": "HackerNews"
} |
Duke University research fraud settlement: $112M payment to U.S. government - danso
https://www.dukechronicle.com/article/2019/03/duke-university-settlement-research-fraud-president-price-announces-research-fraud-settlement-with-substantial-payment-to-u-s-government
======
Jerry2
Retraction Watch has an interesting list of papers from Erin Potts-Kant, the
Duke researcher that falsified data, that have been retracted so far [0].
There's still some other papers that haven't been retracted yet so her count
of retracted papers will go up over time (it's at 8 full and 1 partial
retraction).
According to The Retraction Watch Leaderboard [1], researcher with most
retractions so far is Yoshitaka Fujii with 183 total retractions.
[0] [https://retractionwatch.com/?s=erin+potts-
kant](https://retractionwatch.com/?s=erin+potts-kant)
[1] [https://retractionwatch.com/the-retraction-watch-
leaderboard...](https://retractionwatch.com/the-retraction-watch-leaderboard/)
~~~
yread
That's terrible people keep citing retracted papers, there is one with 977
citations after retraction
[https://retractionwatch.com/the-retraction-watch-
leaderboard...](https://retractionwatch.com/the-retraction-watch-
leaderboard/top-10-most-highly-cited-retracted-papers/)
Someone should make plugins for endnote and mendeley so that people can easily
check it. Any hacker here wants to help science?
~~~
foobarbecue
Hunh, that's a great idea! I might do it for zotero if I can find the time.
Edit: ugh, people have talked about this but reactionwatch has no api. I'm
guessing their motivations are misaligned.
[https://twitter.com/bmwiernik/status/1044278851541635072?s=2...](https://twitter.com/bmwiernik/status/1044278851541635072?s=20)
~~~
acct1771
Unless they sell access to it reasonably.
------
sahin-boydas
If duke can do this level of fraud, more universities will follow. Lets see
which university will be next.
~~~
ddavis
Labeling one person (or even one department) as "Duke" is very disingenuous.
It was one researcher who committed fraud. The negligent researchers, as
mentioned in the article, are guilty of wrongdoing, but not fraud.
~~~
HillRat
Specifically, a lab tech, not a professor or researcher, who was embezzling
from the university while falsifying lab data. So the school’s guilty of not
aggressively dealing with the faked data and the research it buttressed —
definite wrongdoing! — but it wasn’t engaged in an ongoing conspiracy to use
faked data to apply for federal grants. The penalty seems excessive,
especially given that federal fines for schools engaged in covering up rape
and sexual misconduct (Cleary violations) have never exceeded $2.5mm (and
generally are in the tens or hundreds of thousands of dollars range).
~~~
kevinventullo
I'm confused, the article does describe Potts-Kant as a researcher, not a lab
tech (rather, the whistleblower was a lab tech). Also, it sounds like this was
not a penalty, but a settlement, which to me suggests it is simply
proportional to the value of the grants given to Duke as a result of the
fraudulent research.
~~~
AmazingAtalanta
Medscape published an article a few days ago (below) about this. I was under
the impression that there was proof that Duke management knew about the fact
that Potts-Kant falsified data. There was also evidence that she did not
actually buy supplies necessary to even run the experiments:
>>According to court records, colleagues had questions about whether Potts-
Kant had even purchased methacoline, a drug she said she used in experiments.
Meanwhile, Duke was trying to control the message. A colleague told Thomas at
the time that Duke's research integrity office did not want the case to
"snowball," and that it wanted to write any retraction notices.
That would suggest there was no way she could have had the data. Even after
they knew the data was bad (or probably bad), it was used by others as well
was Potts-Kant to secure additional funding. I think the court couldn't
definitively say when Duke became aware of the fraud, but I think they had
enough reason to be concerned about the integrity of the data that they should
have acted more strongly and been more forthright.
[https://www.medscape.com/viewarticle/910922?nlid=129046_3902...](https://www.medscape.com/viewarticle/910922?nlid=129046_3902&src=wnl_newsexcl_190326_MSCPEDIT&uac=291999MV&impID=1918389&faf=1)
------
dbcooper
Lot of focus on the technician, but the lab's P.I. must've been fully
involved.
~~~
ams6110
Maybe not. The PI (principal investigator) is mostly directorial/managerial on
most grants. Almost certainly the PI was not the person who was in the lab
running the experiments and collecting the data.
~~~
Rafuino
Isn't it a PI's job to know what's going on in his/her lab?
~~~
ams6110
Yes of course, ultimately it's his or her responsibility. I was responding to
the "fully involved" allegation.
| {
"pile_set_name": "HackerNews"
} |
San Francisco Subway Muzzles Cell Service During Protest - hornokplease
http://news.cnet.com/8301-27080_3-20091822-245/s.f-subway-muzzles-cell-service-during-protest/
======
nettdata
Am I the only one who doesn't see a problem with this?
They provided a cel phone repeater as an amenity/courtesy to their passengers.
It's not part of their charter to provide cel service.
Their goal is to keep their passengers moving efficiently. By no longer
providing that cel service, they disrupted the wannabe disrupters.
Their freedom of assembly wasn't interfered with, they just didn't help it.
If the protesters relied on cel phone coverage to perform their demonstration,
then their strategy failed, and they'll have to come up with another way.
They increased the presence of police in the area, so the "how will I call for
an ambulance" concern is a bit melodramatic; there were emergency personal
already on scene, with non-cel communication capabilities.
Personally, I feel the right to assemble/demonstrate has been extended too far
into the area of "I demand the right to fuck up everyone else's day", and
applaud BART for doing something about it.
~~~
samstave
Freedom of speech implies the freedom to communicate. Given the era of
technology has made it such that the communications infrastructure is
fundamental to our speech and communication, it could be construed that
removing this is violating our constitutional rights.
~~~
nettdata
Does it MEAN that, or simply imply it?
I don't think it means that there is a requirement to provide the most
convenient method available. Cel phone service isn't even classified as an
essential service. Never mind internet access.
They didn't stop communication, they made it less convenient. The protesters
had to stay within range of a normal cel tower, rather that use the
locally/BART provided repeaters. "Can you hear me now?" "No."
What's next? BART has to provide the paper and photocopying to the protesters
for their pamphlets so they can communicate their issues?
~~~
samstave
Well, as IANAL - I used the word implies as I am not 100% positive...
However, I would propose this is one example where the populous needs to start
exerting their opinion on how these things should be interpreted. We are far
to reticent to express our view and too complacent in accepting the position
of the government in matters where it is critical that we remind the
government that this is a REPRESENTATIVE democracy and as such, our views must
be properly represented.
I am reminded of when I had a dispute with my home owners association about a
ridiculous rule whereby I was precluded from putting up anything other than
white curtains in my townhome.
The rule stated that the externally facing view of any curtains must be white.
Which is what I had.
The complaint came that due to me having gold colored curtains on the interior
side of my windows, at night, when the lights were on - they could tell these
were not white.
They attempted to fine me. We battled for months. I went to several HOA
meetings and was confronted with an opinion that "these are the rules, we do
them to uphold the property values of the community" -- I emphatically
reminded the HOA that not only was this argument ridiculous that WE were
infact the HOA and thus WE should change the rules to not be so "fucking
retarded".
I ended up winning - but the lesson was that bureaucratic authority applied
unnecessarily begets mediocre minds reaching for abuseable power.
~~~
nettdata
I could just as easily say that those same mediocre minds are looking for
rights where none exist.
And I won't comment on the mindset it takes to move into a place that is
controlled by an HOA in the first place. ;)
Complaining about morons on an HOA is like moving next to an airport and
complaining about the aircraft that always seem to be around.
~~~
samstave
Sure, you can claim that assuming you have had prior experience with an HOA or
other groups... My problem was that I had no idea this level of ridiculousness
existed. So it is not like I entered into that thinking "this time it will be
different" :)
Also, Iam trying to point out in my other comments that I am not lokoing for
rights where they do not exist, per se, but that I think we as a whole need to
be open to the possibility that the framework and definition of said rights
need to evolve with the changes in our society, and the expression and level
of our civilization.
It appears to me that anyone denouncing those who question the current state
refuse to stray from the centuries old definitions.
------
tlb
It is not OK for the government to cut off citizen communications in times of
civil unrest or any other time. BART, which has its own police force, must be
held to constitutional standards. While they can prohibit assembly within
their stations, disabling communications infrastructure violates people's
basic rights.
~~~
blantonl
in this case, legally it is a tricky issue and BART is probably and
unfortunately in the clear on this.
BART cut _power_ to the wireless sites in these/tunnels tations - they didn't
ask the wireless providers to terminate their services. I suspect that since
the wireless sites lease space and consume power from BART operated
facilities, BART is well within their rights to terminate power and other
services based on existing contractual agreements.
However, that doesn't make what BART did "right." It is downright disgusting
and I hope that the wireless providers mount up and put some serious pressure
on BART in response. Certainly the providers are paying serious money to BART
to lease space to provide service to riders, and the optics of the loss of
that will hurt BART far more than it will hurt the wireless providers. At the
end of the day, loss of wireless lease would really be a punch in the gut to
BART, not to mention the public safety issues.
~~~
sehugg
I don't know that the technical details factor into this -- BART admitted that
their intent was to prevent speech and to interfere with communications,
therefore it's possible they ran afoul of the First Amendment and/or the FCC.
I don't know that we'll find the answer unless someone takes it to trial.
~~~
blantonl
I'm not condoning what BART did, I think it was wrong.
But, if you decided to use HN to organize a response to an issue and HN
deleted your posts, that doesn't make HN's actions a First Amendment issue.
The First Amendment does not apply for private institutions that you choose to
participate on.
~~~
joeguilmette
HN has a TOS and is a private institution. Further, HN is not part of our
public telecom infrastructure - ie if I'm being stabbed during the protest
they were trying to thwart, I wouldn't use HN to call an ambulance.
BART shutting down cell service is irresponsible, deplorable and something
we're going to see more and more as the first world descends into the kind of
place we all see it becoming.
~~~
GHFigs
_...as the first world descends into the kind of place we all see it
becoming._
Which is what?
------
tshtf
Are they really concerned about public safety?
What if, while the cell sites were powered down, a crazed lunatic with a knife
started stabbing people on a BART platform or train? How could anyone call for
help?
This is lunacy.
~~~
skroth
From the article: "In addition, numerous BART police officers and other BART
personnel were present during the planned protest, and train intercoms and
white courtesy telephones remained available for customers seeking assistance
or reporting suspicious activity."
So, to answer your question, BART police would have detained him, or someone
would have used one of those phones to call for help.
Regarding your first question, what are you implying was their motive for
doing this, if not for safety?
~~~
dsl
They address the safety of people on the platform, but what about people that
didn't have a few dozen cops nearby?
I have ill family members, and need to be able to be on a plane in a few hours
notice. Avoiding some bad PR photos justifies missing that important inbound
phone call?
~~~
yummies
Simply put, the primary purpose of bart is to run a train service and maximize
availability of that service. Cell service is a non essential (and until a few
years ago, nonexistant) enhancement of that service.
The theory here is that if they allowed cell service to continue then
protesters would have disrupted train service. So then the more pressing issue
becomes getting people to the airport, not cellphone availability.
So yes, you missed your important call, but that's better than others missing
their important flight.
~~~
dunham
Your important call would have been cut off as soon as you left the station
anyway.
~~~
scelerat
BART has continuous cell service even in tunnels.
~~~
dunham
Cell service usually drops between 16th and civic center (I frequently see
people get cut off). And 3G service on Verizon seems to drop off for at least
50% of the way between 24th and montgomery (personal experience, iPhone4).
------
stevenp
As a frequent public transit rider in SF, and the developer of a popular Muni
iPhone app, let me say: If you told anyone in SF thought that there was
intentionally functioning cell service in the subway tunnels, they would
LAUGH.
My application is supposed to tell you when the train is coming, and it
doesn't work once you walk down to the platform due to complete lack of cell
service.
I chuckle at the ludicrous idea of "disrupting" something that doesn't
actually work to begin with. If it worked, perhaps my app would be more
useful.
------
lucasjake
Really just seems like they're adding fuel to the fire. Its kind of a
boneheaded move, as people will just organize the old fashioned way the next
time around.
Just silly.
~~~
molecule
When it does succeed while BART is doing this, affected riders will be w/o
rail AND cell service.
And many of them will be angry @ BART for disabling their ability to contact
friends / family during delay, look up status and alternate routes on the web,
etc.
wide ripple to heavy-handed tactics.
~~~
yummies
You can simply walk upstairs where there's normal cellphone reception, and
you're good to go.
Now if you're stuck on a train in a tunnel because protesters are causing the
system to shut down, that's a different situation, but still not decidedly
evil or foolish for BART to turn off its cell service. In BART's defense, they
did tell everyone earlier in the day to make alternate plans and prepare for
delays.
------
mc32
Was it the underground cell repeaters? Or the cell towers on BART property
--for which they lease out the land to telecom providers?
If it's the underground repeaters, that's their business. If it was the towers
on Bart property but property of telecoms, then that's problematic -as it
interrupts service to non-Bart users.
~~~
dunham
I believe just the underground repeaters - probably just in San Francisco
proper. I had one bar on the east end of the embarcadero station (Verizon),
probably from outside, but I couldn't successfully send a text or call. After
getting on the train, I figured out they'd shut down the cell service on the
platforms/tunnel (no signal until I got above ground at 24th). This was around
4:30pm.
I'm guessing the AT&T customers just figured it was service as usual in SF. :)
~~~
SeoxyS
Yeah, on AT&T I pretty much give up on using my phone once the train starts
moving, even though we're supposed to have service from Civic Center all the
way to the Oakland end of the transbay tube.
------
tinio
Additional details on the matter are reported here:
[http://www.baycitizen.org/bart-police-shooting/story/bart-
ce...](http://www.baycitizen.org/bart-police-shooting/story/bart-cell-phone-
service-legal/)
with BART saying they were within their legal right to shut down the cell
service. However, the Electronic Frontier Foundation had this to say:
“It’s outrageous that the authorities would resort to the same tactics of the
repressive Mubarak regime,” said Kevin Bankston, a lawyer for the Electronic
Frontier Foundation. “The fact that it was motivated by a desire to stifle
free speech raises serious First Amendment problems.”
------
sp332
Isn't it against FCC regs to intentionally cause cell phones to stop working?
I remember some prisons wanted to buy cell jammers to prevent inmates from
using smuggled phones, but it's illegal.
~~~
m0nastic
"Jamming" wireless transmissions does indeed run afoul of FCC regulation; but
that's not what they did here.
They disabled the power to the base stations which were deployed in specific
locations (locations which are not public property). I assume they argue that
they are not under any obligation to provide access to these base stations. I
also assume that the base stations in question are either owned by them, or
provided by the telcos.
Technically, one of the wireless providers could probably raise a stink that
this action made their service look bad, but I seriously doubt they are going
to take a stand in this regard.
~~~
count
It's actually potentially more interesting than that. AM/FM radio stations on
licensed frequencies are _required_ to be transmitting. Dead air has to be
reported and justified to the FCC, or they can face fines. I wonder if that
sort of thing applies to CDMA/GSM radio towers and repeaters.
~~~
m0nastic
I'm trying to ascertain that, but so far lost in a maze of twisty little links
on the wireless.fcc.gov site, all alike.
I'd actually be surprised if that was the case though.
------
SeoxyS
BART exists to transport people safely and efficiently. I think they do a
fantastic job of it. They manage to make BART travel reliable, fast and
_safe_. The presence of a strong and armed police force is necessary and
fundamentally a good thing. If disrupting cell service protects riders, then
it is the right course of action.
Or would you all prefer BART to protect people's right to tweet at the cost of
lives and injuries?
BART rides trough some extremely violent neighborhoods, and carries all kinds
of people, rich and poor. The fact that it works as smoothly as it does is a
miracle already. Compare it with some of the trashier public transport options
out there. Even some MUNI lines have some really creepy things going on on
them.
------
realou
The ability to organize protestations live via cell phones is becoming more
popular all around the world.
In response, cell comms are disrupted, of course, by the powers in place.
It is easy to see what the response to _that_ will be... Anonymus showed it
brillantly recently at Defcon. Eventually, we will have human-carried
miniaturized cell tower repeaters amongst the protesters, insuring local cell
coverage.
We live in interesting times...
------
jrockway
This is why cell phones need the ability to create a transparent mesh network.
------
pstephens
The issue isn't access, it's injustice. Don't let the topic change to some
bland consumer access issue -- Why does BART mandate its officers carry lethal
force?
------
Anti-Ratfish
>Meanwhile, they also released a digital flyer with the words "muBARTek,"
"Mystery of Lulz,"<
Article misquotes. It said "ministry of lulz".
------
tibbon
I'm laughing at the fact that BART thinks they can effectively control people
with this. This will only make things worse.
------
lowglow
I'm speechless. This is insane and I fear it will only get worse.
------
ck2
Apparently the USA is once again taking notes from China and the middle-east.
------
bherms
Wouldn't this effectively be violating freedom of assembly?
~~~
raganwald
Most of the “freedoms” people speak of are really freedoms from government
interference. For example, “freedom of speech” doesn’t apply to a symphony
hall that requires its patrons to be silent during performances, but it may
restrict a government’s ability to enact anti-hate crime legislation.
In this case the more interesting issue is that a private entity disrupted
telecommunications on its property without notice or warning. In addition to
making it difficult for protesters to coördinate their actions, it also made
it difficult for people to make unrelated calls, to report crimes, call 911,
and so forth.
It might be legal, but I admit I find the idea very unsettling.
~~~
pavel_lishin
Is BART a private entity, or are they state funded/run?
I've never been clear on this in most places I've been; I don't know if New
York's MTA is part of the city, or if it's a private corporation entrusted
with a public utility - and if it is, what are the ramifications?
~~~
tibbon
Most subway systems are actually privately owned/operated, yet state funded
entities. Or at least that's my understanding of many of them. The MTA and
MBTA are this way I believe.
------
kanamekun
News.com still exists?
It's amazing to me how my primary read for years and years has been totally
and utterly eaten alive by tech blogs.
------
michaelfeathers
I think that when cell-jammers first became available, the FCC said that they
were illegal regardless of whether private citizens used them or
municipalities. The FCC is the regulatory body that has the last word on radio
technology, and since it is a federal agency the whole area is under federal
authority; it isn't an area states and cities can enter into.
~~~
skroth
This has nothing to do with cell-jammers. BART normally offers cell phone
service underground as signal usually can't travel there. They just flipped
the switch.
| {
"pile_set_name": "HackerNews"
} |
Vbcc is a highly optimizing portable and retargetable ISO C compiler - doener
http://sun.hasenbraten.de/vbcc/
======
hyc_symas
Amazing that folks are still developing for the Atari ST, I miss those days on
mine.
Surprised they haven't done an ARM backend yet. I wonder if this is a suitable
base for a no-undefined-behavior compiler.
| {
"pile_set_name": "HackerNews"
} |
Uberzet : The First File-Sharing Network built on Dropbox - uberzet
http://uberzet.com/?src=hn
======
mukyu
I seem to recall there being an HN post about people doing this same concept
and they just ended up with their accounts being unable to share files.
~~~
uberzet
Hm - not sure I recall that. I went through a fairly intense app verification
process with Dropbox though - so I'm sure that won't happen.
~~~
mukyu
Dropship is what I was thinking of. Here is one of the hn posts about it:
<http://news.ycombinator.com/item?id=2482712>
------
anigbrowl
I like the basic concept, but I am not going to give you access to my _entire_
Dropbox; why not a subfolder therein?
~~~
uberzet
In-fact you're only giving access to the Public folder. The idea being that if
you're willing to share it publicly ... well you're willing share it publicly
: )
In any case, it's obvious that I haven't communicated that clearly enough.
Thank you for the feedback : )
------
arkitaip
Unless this has a file search/discovery feature I don't see point.
~~~
uberzet
Thanks for the feedback. Obviously I am not communicating what uberzet is
clearly enough.
You can do a keyword search. Also you can view popular files on uberzet.
Finally you can ask uberzet to show you a random file.
| {
"pile_set_name": "HackerNews"
} |
Garry Kasparov arrested outside Moscow court - instakill
http://www.bbc.co.uk/news/world-africa-19300149
======
ck2
That was almost civil.
USA will give them a lesson in abusive police power at the end of the month at
RNC convention and then again at the DNC next month.
| {
"pile_set_name": "HackerNews"
} |
Jacoby Jones was the Super Bowl MVP on Twitter. Not Joe Flacco - martinroldan
We all know Joe Flacco is the official MVP of Super Bowl 47, as stated by CBS and the NFL. But the popular vote on Twitter says otherwise. Joe Flacco was more mentioned as MVP material at the beginning of the game, and during the fourth quarter, but if we look at the numbers for the whole game, Jacoby Jones was the favorite.<p>Was Joe Flacco the MVP winner because people were asked to cast their vote on nfl.com or by texting only during the fourth quarter?<p>http://blog.ejenio.com/social-media-monitoring/when-should-we-let-people-vote-for-super-bowl-mvp/
======
cooperadymas
Jacoby Jones had two very electric, exciting plays. Flacco was consistent and
steady throughout most of the game. I wouldn't have batted an eye if they had
named Jones, or Anquan Boldin the MVP.
Quite simply, it's tough bordering on impossible for a position player to
match the output of a good quarterback. Even if you propose that Jones
receives 100% credit for the kick return touchdown (he doesn't, the blockers
deserve a fair amount), and 75% credit for the receiving TD, he didn't do much
else in the game. Flacco threw two other TDs and completed 67% of his passes.
Like usual he was cool and not very "exciting." His only really memorable pass
was when he was flushed out to the right and seemingly threw it away, but
hooked up with a terrific Anquan Boldin down the sideline.
Flacco was less exciting but more consistent and just did more.
I can't say for sure why he was named MVP, but he certainly deserved it.
------
ScottWhigham
_Was Joe Flacco the MVP winner because people were asked to cast their vote on
nfl.com or by texting only during the fourth quarter?_
Good question. I don't think Twitter is the correct measuring medium but it's
a worthwhile question. The answer is, of course, "It makes no sense to open
voting any earlier than the fourth quarter". What if the voting was open in
the 2nd quarter, for example, and Jacoby Jones earned 16,800 mentions. But
then... the 49ers come back and win the game at the end thanks to Colin
Cantspellhisname's comeback throws. But Colin only gets 16,799 votes due to
the lateness of his surge...
| {
"pile_set_name": "HackerNews"
} |
Splitting water molecules for a renewable energy future - bookofjoe
https://phys.org/news/2020-09-molecules-renewable-energy-future.html
======
bookofjoe
>Phase segregation reversibility in mixed-metal hydroxide water oxidation
catalysts
[https://www.nature.com/articles/s41929-020-0496-z](https://www.nature.com/articles/s41929-020-0496-z)
| {
"pile_set_name": "HackerNews"
} |
Smallest Hard Disk to Date Writes Information Atom by Atom - scriptdude
http://www.sciencenewsline.com/news/2016071815570027.html
======
CarolineW
Several submissions of this item:
[https://news.ycombinator.com/item?id=12116686](https://news.ycombinator.com/item?id=12116686)
(nature.com)
[https://news.ycombinator.com/item?id=12116615](https://news.ycombinator.com/item?id=12116615)
(gizmodo.com)
[https://news.ycombinator.com/item?id=12116127](https://news.ycombinator.com/item?id=12116127)
(wsj.com)
Which will win the race for votes?
------
niftich
But does it support atomic writes?
| {
"pile_set_name": "HackerNews"
} |
Asbestos – A Matter of Time (1959 film by the US Bureau of Mines) - YeGoblynQueenne
https://www.youtube.com/watch?v=PVQVfIB4MIc
======
mimixco
I love these old educational films. First, the music is absolutely hilarious.
Everything had to be accompanied by a Disney-style orchestral soundtrack. Of
course, there's no mention of the fact that asbestos literally _kills people._
Everything in these movies is built around the belief that governments and
technology are making the whole world better for everyone. As a child of the
60's, I grew up with these ideas. In adulthood I learned, along with the rest
of the world, that technology and government won't save us and, in fact, are
often a great source of harm.
------
mimixco
The title (and final quote of the film) is unintentionally prescient: "For
asbestos, it's still a matter of time." Indeed. Asbestos currently causes a
quarter of a million deaths every year.
| {
"pile_set_name": "HackerNews"
} |
Launch HN: Hackernoon 2.0 - jayzalowitz
http://hackernoon.com
======
octosphere
Might need to fix the default banner slot at the very top. I'm seeing:
{{ad.banner.text}}
| {
"pile_set_name": "HackerNews"
} |
The Software shall be used for Good, not Evil - bootload
http://wonko.com/post/jsmin-isnt-welcome-on-google-code
======
simonw
The problem here is simple: there is no legal definition of good and evil,
which means that the final decision on whether or not you can use the software
belongs to Douglas Crockford, the maintainer. If one person can arbitrarily
decide whether or not you can use a piece of software, it's not Open Source.
~~~
philwelch
I'm not sure that's how the license would be enforced, in practice. There's no
automatic right for any party to dictate the meaning of undefined or unclear
terms.
~~~
rmc
Yes, perhaps it's up to a judge to decide what "good"/"evil" means, however
that still means there's 1 person who gets to decide whether or not you can
use the software, ergo, not open source.
------
bootload
_"... When I put the reference implementation onto the website, I needed to
put a software license on it. I looked up all the licenses that are available,
and there were a lot of them. I decided the one I liked the best was the MIT
license, which was a notice that you would put on your source, and it would
say: "you're allowed to use this for any purpose you want, just leave the
notice in the source, and don't sue me." I love that license, it's really
good. ... So I added one more line to my license, which was: "The Software
shall be used for Good, not Evil." ..."_
I was using JSMin (py) today ~
<http://www.crockford.com/javascript/jsmin.html> wondering why there was no
installer and poking around I found this article. Seems the addition of
additional line in the MIT license gives lawyers headaches.
~~~
davidw
Not just lawyers - anyone sensible. It's not open source any more - you can't
restrict what open source is used for - and extremely vague.
DIY licenses are a bad idea. In this day and age you should probably pick
between MIT, Apache, LGPL and GPL, and maybe something like the Affero GPL for
open source, in order of how much they limit people using your code.
~~~
bootload
doesn't stop the code being used in google android though ~
[http://google.com/codesearch?q=%22The%20Software%20shall%20b...](http://google.com/codesearch?q=%22The%20Software%20shall%20be%20used%20for%20Good%2C%20not%20Evil.%22)
in _"git://android.git.kernel.org/platform/external/webkit.git› V8Binding› v8›
tools› jsmin.py"_ for example using this license ~
[http://google.com/codesearch/p?hl=en#N6Qhr5kJSgQ/V8Binding/v...](http://google.com/codesearch/p?hl=en#N6Qhr5kJSgQ/V8Binding/v8/LICENSE)
~~~
davidw
Maybe they just figured it's unenforceable BS and went ahead anyway.
------
shin_lao
I'd love to send Douglas a copy of Beyond Good and Evil.
[http://www.amazon.com/Beyond-Good-Evil-Friedrich-
Nietzsche/d...](http://www.amazon.com/Beyond-Good-Evil-Friedrich-
Nietzsche/dp/1453640207/ref=sr_1_3?ie=UTF8&s=books&qid=1278572208&sr=8-3)
~~~
igravious
This software may only be used for purposes that are beyond good and evil.
Nietzsche: spiritual progenitor of the free software movement.
------
joe_bleau
Oh, I've seen something like this with a book ([http://www.amazon.com/Front-
Panel-Designing-Software-Interfa...](http://www.amazon.com/Front-Panel-
Designing-Software-Interfaces/dp/0879305282)) before: "It is the authors
preference that his book not be used by the military or the munitions
industry."
~~~
hugh3
At least that is specific. I've also used several pieces of (European)
software which forbid themselves from being used for the creation of nuclear
weapons.
~~~
ptomato
iTunes EULA has a clause stating that you're not allowed to use it for
“development, design, manufacture or production of missiles, or nuclear,
chemical or biological weapons.”
------
yock
The last thing free software needs is yet another dogmatic argument. Being
cute in your licensing damages the perception of free software because you're
essentially broadcasting the fact that you don't care how the rest of the
world works.
~~~
JoeAltmaier
Hm. So the existing licenses are the Holy Scripture, and we should all bow
down to them? Write any software you like, but it has to have the Blessing
from Stallman?
This is rediculous.
~~~
yock
No, not at all. Licenses change all the time, both for the better and for the
worse. It isn't change that I'm challenging, but rather this particular
change.
I challenge anyone to defend the language that is the subject of this news
item, using clear, concise, and unambiguous language defending the terms
"good" and "evil" without offering your own definition. It cannot be done
because it requires a value judgment on the part of the reader, and not all
readers will share the same value judgment.
Simply put, "good" and "evil" mean different things to different people.
Therefore, they cannot be used as terms in a legal agreement without clear
definitions as to their meaning. Google has chosen, rightfully so, to simply
prohibit the language rather than debate their meaning.
~~~
JoeAltmaier
As mentioned elsewhere in this topic, so have all the other terms in the
license have slippery meanings.
In fact Good and Evil are extremes of behavior. The words are intended to
indicate obvious things. As the Justice said "you know it when you see it".
~~~
yock
The other terms in the license have the benefit of long-standing, generally
accepted legal definitions. I don't think you're going to find definitions for
"good" or "evil" in Black's.
------
ptomato
I'm not sure complete humorlessness is actually necessary to be an advocate of
Free Software(or whatever the trendy term is these days), but there certainly
seems to be a high degree of correlation.
------
guelo
I don't see how the license is not free. The loophole is it does not state
who's definition of evil applies. Therefore you can state that your software
is not evil and be done with it. If Mr Crockford decides to sue you you will
have a very easy defense.
~~~
dantheman
yeah, this same loophole can be used to determine who's definition of: "use,
copy, modify, merge, publish, distribute, sublicense" etc
...
in other words, if we allow people to arbitrarily decide what a word means in
a license then the license means nothing..
~~~
hugh3
The difference being that judges are entirely happy to make precedent-setting
rulings on what "use, copy, modify" et cetera mean. I don't think any judge
would be willing to rule on whether a particular use of the software counts as
"evil".
Even if they're presented with a case where someone is using the software in
an _unambiguously_ evil way (like, I dunno, kidnapping small children to use
as sex slaves) then they probably still won't rule on that, because that
creates a precedent that a judge _can_ rule on whether something is good or
evil, creating difficult situations for future judges.
------
po
The problem is that evil doesn't care about your license.
~~~
JoeAltmaier
No, that's the solution from a legal standpoint. The license is not longer
vague.
------
aneth
A policy against vague restrictions in an open-source license seems sensible
to me. I appreciate Crockford's humor, and also that he freely offers
exceptions to the clause, since in end, it's silliness.
| {
"pile_set_name": "HackerNews"
} |
Why we[The helios project] insist on Linux on the desktop - sagarun
http://linuxlock.blogspot.com/2011/01/why-we-insist-on-linux-on-desktop.html
======
zdw
I feel that linux has reached parity with other OS's in all ways but these:
1 - Continuity of applications. For example, in updating Ubuntu on a laptop I
use for compiling embedded kernels, I lost the swanky power management window
that could tell me things about battery charge/discharge rates. No idea where
it went. Then the next version changed the interface again. Adding and
removing apps between versions causes problems, if only from jarring users
from how things used to work. This is the main reason that I don't support
Linux on the desktop as much as I could - I can't more than a few versions of
"how the GUI works for program X" when X seems to be replaced frequently.
2 - Hardware compatibility at the edges. The core works great - the problem is
with weird/proprietary things (binary drivers, etc...). I don't have a
solution for this, other than proper hardware choices at purchase, which is
harder than you think.
3 - Microsoft specific formats. I'm talking .doc/.xls/etc. These are the
biggest reason people "can't" switch - they have too much rolled up in these
old crappy formats that don't convert perfectly to OO.org. 90% of those
problems are formatting/fonts/printing/interchange related. The BIGGEST win
Microsoft ever had was getting their XML formats (.docx/.xlsx/etc.) approved -
had the standards bodies and governments rejected them, everyone, on all
platforms (Windows included), would be in a much better place now.
------
cnkt
yes, windows has a lot of virus. ok, we get it. we get it for over ten years.
every year i hear "this year linux will be on every desktop". But it never
happened. Just be more realistic please.
data source:
[http://en.wikipedia.org/wiki/Usage_share_of_operating_system...](http://en.wikipedia.org/wiki/Usage_share_of_operating_systems)
~~~
derleth
The point he's making is that Windows is being kept alive, in large part, by
closed-source fanatics.
| {
"pile_set_name": "HackerNews"
} |
Visual COBOL 2.0 for Visual STudio 2012 RC - thibaut_barrere
http://www.microfocus.com/plus/visual-cobol-beta/_visual-cobol-beta.aspx
======
thibaut_barrere
While plenty of people here are using Ruby, Python etc, I found interesting to
report that completely different tools exist, too!
| {
"pile_set_name": "HackerNews"
} |
Why do we hate wasps and love bees? - siberianbear
https://www.bbc.com/news/science-environment-45566304
======
nutcracker46
We love bees because they go out and pollinate flowers, and work hard. Their
motto is, "Don't fuck with people."
Wasps, on the other hand, are hateful, badass, sting you 50 times insects that
don't care much for flowers. Their motto is, "Don't fuck with me."
------
Arcadcomp
Bees bring honey, wasps don't, pretty easy. Though I'll give credit where its
due for wasps. Most people don't like spiders, but they don't realize their
importance too.
| {
"pile_set_name": "HackerNews"
} |
Popcorn-app - ilhackernews
http://github.com/Yify/popcorn-app/releases/tag/v0.2.7-beta
======
jeswin
Popcorn Time (or the next leeching app) isn't good for torrents and sharing in
general. If everybody switched to this type of software, there won't be enough
seeds. Or maybe seeders will predominantly be those with some commercial
interests (malware, ads?); and torrents will no longer be truly peer to peer.
Add: The old FAQ is gone, but quote from [http://www.ibtimes.com/popcorn-time-
movie-streaming-netflix-...](http://www.ibtimes.com/popcorn-time-movie-
streaming-netflix-pirated-content-explained-tech-novice-1560827) : "According
to Popcorn Time’s FAQ, you do indeed seed (upload) parts of the movie while
you watch. Popcorn Time does state that ‘your movies will stay buried in a
secret folder somewhere in your drive until you restart your computer. Then it
will be gone for good.’"
~~~
sergiotapia
This is incorrect. By design, torrent participants both download AND upload at
the same time. If you don't believe me, check your network activity using the
tool that comes with your OS. You'll see significant upload transfer. :)
~~~
mburns
I think you're missing his point.
The success of bittorrent as a swarming protocol is that each client tries to
download the least available snippet of the file it wants. This increases the
chances that other clients will be able to find 100% of the pieces of a file
as they go through the download process.
With popcorn and other streaming-torrent hybrids, the clients requests are
biased towards the snippets of file that the user is about to watch. This
makes the beginning of the movie widely available (as all clients start there
to begin a stream) but increases the chance that bits of the middle or end of
the movie aren't available when a given client needs them.
~~~
notimetorelax
This may be true, but on my network it takes less than 5 minutes to download a
2GB file and 20 minutes to have 200% upload. I usually stop uploading after
that. Now if I were to use Popcorn Movie I'd be uploading for much longer
period.
~~~
spoiler
In most countries, your average Internet consumer can't achieve the speeds you
described, though. Also, the download-to-upload rate is significantly higher.
For example, my peak download speed is 5Mbits while the upload speed peaks at
0.6Mbits. That's on one of the more expensive packages, too.
------
Daiz
The sad thing about Popcorn Time is the way it shows how little people
actually care about AV quality. One of the biggest reasons why I personally
resort to illegal options (especially with video material) is because of the
higher quality they offer compared to legal alternatives, but this aspect is
not present in Popcorn Time _at all_ since it sources all the video and audio
from YIFY.
YIFY is basically a bunch of morons producing nothing but total garbage who
would be better off encoding things in SD with the low bitrates they use.
Sadly, since their fork is likely going to be considered the "main" one for
Popcorn Time, decent AV quality will probably never be a thing with it. (I
found a couple issues on various GitHub forks about this subject and ran into
this image[1] which demonstrates the problem quite well.)
EDIT: Well, I guess there's some hope for the future[2]. Not holding my
breath, though.
[1]
[https://f.cloud.github.com/assets/1736009/2426834/15aa358e-a...](https://f.cloud.github.com/assets/1736009/2426834/15aa358e-abcd-11e3-894a-07cb33069ec7.jpg)
[2] [https://github.com/Yify/popcorn-
app/issues/51](https://github.com/Yify/popcorn-app/issues/51)
~~~
mistercow
>who would be better off encoding things in SD with the low bitrates they use
DCT quantization always beats down-scaling at the same bit rate.
~~~
Daiz
Look at the image I linked and say that again.
And it's not like this is particularly hard to test on your own. If you encode
the same video at low enough bitrate X in 480p/720p/1080p, the higher
resolution versions can have more definition at times but the 480p version
will generally end up having the highest overall quality and is usually the
most consistent in its quality as well. I've done this kind of comparing a
couple times myself and the results are exactly that.
~~~
mistercow
Comparing still frames from VBR video streams is spurious on multiple levels.
------
sillysaurus3
Wait, why are people so quick to download and install these binaries? This is
an excellent opportunity to piggyback a virus onto a ton of people's
computers, and the "Yify" github profile seems to have no other prior history:
[https://github.com/Yify](https://github.com/Yify)
EDIT: Nevermind, it's headed by jduncanator who seems to have done a lot of
public work. They also contributed to the original popcorn time.
~~~
balls187
I don't if it's the same dude|lady|group, but Yify is well known in the
torrent scene.
~~~
mistercow
It looks like it is actually affiliated, given that the group's email is
[email protected]
------
forrestthewoods
It's obvious that $8/month for unlimited access to all TV and/or movie content
ever created ever just isn't an economic reality. So, how much would you pay
on-top of your $8/month Netflix subscription (assuming you have it in your
country) for access to new releases? Would you pay another $8 a month? Maybe
$12 so it's a round $20 total?
Would you pay $5 to rent a new movie if it could then easily be streaming
through Netflix on one of eleventy kazillion devices? What would you be
willing to pay?
~~~
egeozcan
I'm living in Germany. Here, for non-dubbed, easily accessible (on-demand
access on every device) and rich (all popular shows, movies and then some)
content, I'd gladly pay 100€/month. I hate having to use VPNs to make it look
like I'm in the US to receive crappy service.
------
cliveowen
I don't see the usefulness in this. On my Mac it runs very slowly and once you
start playing it takes an eternity to jump forward or rewind a little bit. If
you just download the movie with torrent in 20 minutes you can jump around
instantly and use the _much_ lighter Videolan Player.
I can see the convenience in searching movies though.
~~~
jaydz
Its quite useful for people who cannot download an HD file in 20 minutes.
~~~
marcosdumay
Those people will have an even worse experience with streaming than the GP.
I don't get what's all the buzz about streaming. Copy the damn file, watch it,
and erase (it's a new concept, let's call it "cache"). Not even Youtube works
anymore because everything must be online.
~~~
riffraff
> I don't get what's all the buzz about streaming.
There is a noticeable difference between starting to watch a movie in 10
seconds and waiting >15 mins to download completely.
Suppose a movie takes an average 25 minutes to download. I can start watching
it in my lunch break if I am streaming it. If I have to download it completely
first, I may not have finished downloading it by the end of it.
Streaming is a _much_ better experience, even if it has a bunch of downsides.
------
dphnx
Can’t help being a pedant but the plural of synopsis is synopses. “Synopsis’s”
refers to something belonging to a synopsis, e.g. “the synopsis’s true
meaning”.
------
Relys
With the Vuze torrent client right click on the file, select "Set Priority"
and select "Numeric...".
Next, right click on the file, select "Media Server" and select "Copy Stream
URL to Clipboard".
Now open VLC Media Player, select "Media", select "Open Network Stream", paste
in the URL and click "Play".
The cool thing about Vuze is that you can use a SOCKS5 proxy and/or restrict
traffic to a virtual NIC if you have a VPN. This way even if you turn your VPN
off (to play games etc.) you won't be exposed to the swarm.
If you use XBMC you can install the XBMCTorrent add-on which has an interface
similar to Popcorn Time.
[http://forum.xbmc.org/showthread.php?tid=174736](http://forum.xbmc.org/showthread.php?tid=174736)
XBMC is cool because you can use the Android app Yatse to control XBMC. If you
have two boxes running XBMC (i.e. in your living room and bedroom) you can use
Yatse to resume playback on the other box with the push of a button!
Unfortunately, XBMCTorrent and Popcorn Time don't support SOCKS5 proxies or
restricting traffic on specific NICs. Therefore you'll want to set up an
internet kill switch on your box as a fail safe.
------
DigitalSea
It makes me incredibly happy as an Australian with no access to a Netflix type
service (because none exists here) that isn't cable television that costs over
$100 per month via Foxtel to be able to stream movies.
Yes, I do feel bad for using apps like this, but I have no other legal and
affordable choice. I have Fetch TV which offers movies and additional content
bundled with my Internet connection, you get 30 free movies per month (usually
older movies) and have to pay for newer ones which can quickly add up if you
pay for a few of them.
Popcorn highlights a real problem in the entertainment industry and as someone
who's looked into starting a Netflix like service in Australia, the licencing
and costs associated with licences and obtaining decent content are way too
expensive to even consider starting something up.
Until the situation improves for us Australians and our New Zealand neighbours
amongst other countries, people will continue to use apps like this. Learn
from Spotify industry heavyweights and open up your content for streaming
globally via paid services like Netflix.
~~~
randorando
You should consider subscribing to Netflix and using a service like Hola
Unblocker to access it in Australia. This approach is still illegal but
arguably better than torrenting.
~~~
biafra
Is it really illegal or just violating the TOS? Can you be dragged to court
for it or only have the service terminated?
~~~
icebraining
IANAL, but I would say that if you're violating the TOS, you don't have a
proper license to the content (since that's contingent upon following the
terms), and so you're committing copyright infringement.
On the other hand,
_" In relation to the use of VPNs by Australians to access services such as
Hulu and Netflix, on the limited information provided there does not appear to
be an infringement of copyright law in Australia," a spokesman for Attorney-
General Robert McClelland said. "Whether the Australian users have committed
an offence by deceiving these providers about their identity, or eligibility
to receive their services, would depend on state or territory criminal law."_
[http://www.theaustralian.com.au/technology/media-streams-
spa...](http://www.theaustralian.com.au/technology/media-streams-spark-piracy-
row-over-copyright/story-e6frgakx-1226078817583)
------
sergiotapia
Nice! I want this to continue to grow in popularity and mindshare. It's about
time the movie industry stopped being so greedy and selling things using
RIDICULOUS drm rules.
Why can I pay $8 for netflix and watch in on my phone, pc, mac, ps3 and ipad -
but any newish movie I need to use iTunes and locked there?
~~~
sailfast
You can pay $8 for Netflix because they pay movie studios the prices they ask
for the content. You can't watch those same new movies on Netflix because the
market value of that content is higher. The DRM allows companies to exploit
the price difference between "early adopter" customers and those that will get
it later on Netflix.
Same price strategy occurred with hard and softcover books and their release
schedules.
Studios should be allowed to charge more for their content when it's new -
they'll keep doing this until it's proven the streaming model works out to
more money over time. Popcorn Time only hurts that argument as it stands, but
could be an interesting Netflix competitor in the pay for play space (peer to
peer would save on infrastructure costs)
~~~
wpietri
I agree with the pricing differential stuff, but I'm suspicious about the DRM
claim. Is there any evidence that DRM allows companies to exploit the price
difference? I always thought it was studios' better marketing and
distribution. E.g., people buy real copies of The Incredibles not because DRM
keeps it out of the hands of criminals, but because criminals can't sell
movies on Amazon or at Walmart.
------
donpdonp
Is there any content in the popcorn catalog that is known to be license-
friendly with popcorn's distribution mechanism?
I want to see the mechanism of popcorn work without violating copyright. I'd
like to see a category for 'Creative Commons' or 'Public Domain'.
~~~
winningio
LOL, just watch a YouTube video of it.
------
cristianpascu
8 years ago I bought a small DVD player for my son from US. I can't use it for
any of the DVDs I bought from here, in Romania. But the AVIs will play just
fine.
------
rdl
It's weird that the absolute best video experience right now seems to involve
Plex plus either piracy or purchasing huge numbers of Blu-Ray and ripping them
yourself; it's pretty much your own Netflix, seeded with first-run content, no
spying, etc. But you need a seedbox, membership on private torrent sites
(which requires either starting from semi-open sites and moving up, or getting
direct invites from knowledgeable friends), some effort paid to keep ratio in
line, etc.
That's a pretty substantial investment; for $100/mo or more, it's hard to
believe the "legit" industry hasn't come out with something like "Netflix that
doesn't suck".
~~~
w-ll
As a long-long time XBMC user, this has been my main movie/tv setup for years.
Things have changed, I do spend $7 bucks a month on a seedbox, private
trackers are the way to go, and yea ratio is pretty key. So way less than
$100/mo or even $15/mo on Netflix. And for ratio isn't too hard to maintain if
you are always getting the latest content (new movies/episodes) and let them
seed for a day or until next weeks show airs your ratio will be top notch.
~~~
kenrikm
What seed box provider + private torrent sites do you use? I used to be a big
fan of demonoid or waffles. But have been out of it for so long that I no
longer have an "ins".
~~~
pikachu_is_cool
[http://What.CD](http://What.CD) for music
[http://BroadcasThe.Net](http://BroadcasThe.Net) for TV
[http://PassThePopcorn.me](http://PassThePopcorn.me) for movies
[http://WhatBox.ca](http://WhatBox.ca) for seedbox
My in was What.CD (open interviews). If you want quick access to the other
ones then you should get a seedbox on WhatBox. Upload 25GB with your seedbox,
and then upload 5 torrents. Now you will be a Power User and have access to
the invite forum which has unlimited invites for pretty much every other
private tracker (including BTN and PTP).
~~~
rdl
I thought the rule with private trackers was to try not to name them in
public?
~~~
pikachu_is_cool
Really? I guess I won't do that anymore. Sorry about that.
------
thefreeman
Question to anyone who uses this or torrents directly to their PC (rather then
via Seedbox). Has anyone heard of anyone that has received notice from their
ISP yet for the "6 strikes" changes that went into play?
As soon as I heard about those I transitioned completely to a seedbox setup.
It is actually great for media because I can stream directly from my seedbox
to my chromecast, but for some things like software / games it would be more
convenient to just torrent it directly.
I am basically curious if maintaining an up to date IP block list via
peerblock and using only private trackers is enough to keep you off the radar?
~~~
j2kun
I think ISPs gave that up...
------
daturkel
No need for the sensationalist title (currently "Popcorn Time is back with a
vengeance"). "Popcorn Time build 0.2.7" would suit it fine.
~~~
mcantelon
The original Popcorn Time team announced they were stopping the project and
their feed of torrents stopped working. So having someone else continue the
project fits the headline.
~~~
daturkel
I understand the context, but "back with a vengeance" doesn't exactly fit the
rule of "Don't abuse the text field in the submission form to add commentary
to links. The text field is for starting discussions. If you're submitting a
link, put it in the url field. If you want to add initial commentary on the
link, write a blog post about it and submit that instead."
[http://ycombinator.com/newsguidelines.html](http://ycombinator.com/newsguidelines.html)
~~~
Dylan16807
I suppose "Popcorn time is back" would be an ideal title, but "with a
vengeance" doesn't really mean anything so there's no harm done.
------
grannyg00se
"To allow any computer user to watch movies easily streaming from torrents,
without any particular knowledge."
The screen shot shows a bunch of very old looking movies, and categories like
film-noir and biography. Is there really a vast resource of torrents for all
potential movies with enough seeds to stream them for real-time viewing?
~~~
vnchr
Those old movies are purposely used in the screenshot because they're public
domain examples. The actual library is as modern as up to date as the pirate
bay would be :-P
~~~
tommoor
I bet it took some effort to put that fake screenshot together :)
------
fnsa
The app is terrific. Can't wait for a revision that includes all the popular
tv shows.
~~~
sirdogealot
Unfortunately I doubt the sparse uploading of most older TV shows means it
will be a long time before we see a full-blown netflix competitor.
Moderately popular TV shows that aired last year are fairly difficult to find
a complete season of via torrent for example.
------
kzahel
I can't see this going bad! [/s]
------
miah_
Interesting, Yify picked it up. If you don't know, Yify is a movie release
group.
[https://torrentfreak.com/yify-torrents-announces-
retirement-...](https://torrentfreak.com/yify-torrents-announces-retirement-
of-yify-but-show-goes-on-140124/)
------
pd0wm
It would be great if they could build a version for music streaming. Something
like spotify...
~~~
jjsz
There's: [https://github.com/mopidy/mopidy](https://github.com/mopidy/mopidy)
...
------
quackerhacker
I wonder if it's the _real_ Yify who did the dev on the popcorn app revival?
------
manishrc
Inspired by Popcorn-time, Hacked together a cli tool: Morrent - Command-line
Search and Stream Movie Torrent.
[https://www.npmjs.org/package/morrent](https://www.npmjs.org/package/morrent)
Uses yts.re API and peerflix.
------
wyager
I played around with the original a bit, and I couldn't find this anywhere;
does Popcorn Time support/allow me to require encrypting my torrent traffic?
------
daGrevis
I wonder what's GitHub opinion on this. What would they do if the government
would ask them to remove all code including forks from their site?
------
cantbecool
fantastic standalone app. I created something similar, a simple movie torrent
search engine: [http://www.moviemagnet.net](http://www.moviemagnet.net) I hope
people are not discouraged by Popcorn's exit, since torrent based applications
should force the issue, old media companies to change their archaic
distribution models.
~~~
higherpurpose
Are you the same owner behind the "original" movies.io, or did you just clone
it?
~~~
cantbecool
They stopped serving torrents, so I decided to pick up where they left off.
------
h1karu
xbmc + xbmctorrent plugin is way better than either popcorn app.
------
plg
so someone tell me the real risk of me getting sued (or even threatened) by a
movie company, by my ISP, by my police department, and then I will use it.
maybe
~~~
sergiotapia
Honeypot trackers log your IP and big media send ISP notices in batch. So you
may or may not get a 1st strike warning in the future.
Better to just using a private tracker with semi-lax rules, such as
ILoveTorrents.
~~~
neotek
How is a private tracker going to help if anyone can register an account
there?
------
jitl
The links to downloads 404 for me.
------
rishid97
The power of open source.
------
jhprks
People breaking the law should be prosecuted to the fullest extent of the law.
Digital rights management protects the artists and the publishers from having
their rights violated by the criminals who watch movies using Popcorn Time.
Furthermore, the creators of Popcorn Time are subject to being accessories to
the crime.
~~~
andybak
> should be prosecuted to the fullest extent of the law
So - you feel the penalties set down in law are always just and appropriate?
And maximum sentences/fines are the ideal that should be aimed for?
What are you trying to say exactly?
~~~
jhprks
"So - you feel the penalties set down in law are always just and appropriate?"
I believe not all penalties set down in law are always just and appropriate,
probably even some authorities may see it this way too, but just imagine that
you were to ask that question if you were set in front of a judge to justify
your piracy acts, do you really think that'll get you out of trouble?
~~~
cdash
I think instead I will ask myself whether I give a shit how a judge rules on
enforcing laws I think are insane.
------
piratebroadcast
Whats the elevator pitch on what this is and what it does?
| {
"pile_set_name": "HackerNews"
} |
Matt Taibi: The Scam Wall Street Learned From the Mafia - martythemaniak
http://www.rollingstone.com/politics/news/the-scam-wall-street-learned-from-the-mafia-20120620
======
johnny22
I think i can thank Matt Taibi for both making me easily recognize and
completely turning me off of hyperbole.
Thanks Matt.. now i actually kinda feel like an adult now.
~~~
rprospero
I know how you feel. I always enjoy his stories. I just feel that I'd enjoy
them more if someone else wrote that.
~~~
steauengeglase
It is the Rolling Stone National Affairs Desk, essentially Taibi fills the
Gonzo void. Someone has to do it to sell those cologne scented pages.
| {
"pile_set_name": "HackerNews"
} |
Show HN: Basilica – word2vec for anything - hiphipjorge
https://www.basilica.ai/
======
mlucy
Hey all,
I did a lot of the ML work for this. Let me know if you have any questions.
The title might be a little ambitious since we only have two embeddings right
now, but it really is our goal to have embeddings for _everything_. You can
see some of our upcoming embeddings at [https://www.basilica.ai/available-
embeddings/](https://www.basilica.ai/available-embeddings/).
We basically want to do for these other datatypes what word2vec did for NLP.
We want to turn getting good results with images, audio, etc. from a hard
research problem into something you can do on your laptop with scikit.
~~~
xapata
What's different between an "embedding" and a projection, which I believe is
the more standard term for this kind of transformation?
~~~
mlucy
"Embedding" is the term I've heard used for this most often. It's definitely
the term that seems to dominate in the literature. (Just to pick a random
paper off my reading list:
[https://arxiv.org/abs/1709.03856](https://arxiv.org/abs/1709.03856) .)
In my mind "embedding" carries the connotation that you're moving into a
smaller space that's easier to work with, and where things which are similar
in some way are near each other.
~~~
xapata
The TensorFlow docs agree with you. This field has such jargon proliferation,
it's hard to keep up.
[https://developers.google.com/machine-learning/crash-
course/...](https://developers.google.com/machine-learning/crash-
course/embeddings/video-lecture)
~~~
mlucy
Yeah, I agree. The number of new nouns per year is kind of ridiculous.
------
e_ameisen
Interesting idea, but seems to very much fall within the category of something
you would often want to build in-house. I always imagined the right level of
abstraction was closer to spacy's, a framework that lets you easily embed all
the things.
If you are interested in how to build and use embeddings for search and
classification yourself, I wrote a completely open source tutorial here:
[https://blog.insightdatascience.com/the-unreasonable-
effecti...](https://blog.insightdatascience.com/the-unreasonable-
effectiveness-of-deep-learning-representations-4ce83fc663cf)
------
projectramo
What is the use case for this? (And this is a general point for AI cloud APIs)
Specifically, I am trying to think of an example where the user cares about a
vector representation of something, but doesn't care about how that vector
representation was obtained.
I can think of why it would be useful: the ML examples given, or perhaps a
compression application.
However, in each of these cases, it would seem that the user has the skill to
spin up their own, and a lot of motivation to do so and understand it.
~~~
mlucy
Apologies for the long answer, but this touches on a lot of interesting
points:
1\. Transfer learning / data volume. If you have a small image dataset,
embedding it using an embedding trained on a much larger image dataset is
really really helpful. In our tutorial
([https://www.basilica.ai/tutorials/how-to-train-an-image-
mode...](https://www.basilica.ai/tutorials/how-to-train-an-image-model/)), we
get good results with only 2-3k animal pictures, which is only possible
because of the transfer learning aspect of embeddings.
You could do transfer learning yourself, if you have the time and expertise.
And for a domain like images, it's really easy to find big public datasets.
But long-term we're hoping to have embeddings for a lot of areas where there
_aren 't_ good public datasets, and pool data from all our customers to
produce a better embedding than any of them could alone.
2\. Ease of Use. You can take a Basilica image embedding, feed it into a
linear regression running on your laptop CPU, and get really good results. To
get equally good results on your own, you'd need to run tensorflow on GPUs.
This is harder than it sounds for a lot of people.
3\. Exploration. Because of the other two points, if you have a thought like
"huh, I wonder if including these images would improve our pricing model", you
can whip up some code and train a model in a few minutes to check. Maybe if
it's a big model you go grab lunch while it trains.
If you're doing everything from scratch in tensorflow, it can take days to try
the same thing. This activation energy reduces the amount of experimentation
people do. It's bad for the same reasons having a multi-day compile/test loop
would be bad.
~~~
projectramo
Hi mlucy,
I agree with what you're saying here. I just wonder how it would work in
practice.
So imagine I have this monster text or image, and I want to know if it looks
like another text or image.
I send each to Basilica, it gives me back two vectors and I compare the
vectors.
I use the cosine of the vectors as a similarity score, and lets say it comes
out to be 0.6.
However, I think this is too low, and I want to tweak my algorithm.
At this point, doesn't the question of how the vector was generated come to
the front. Did you get rid of common words, how did you treat stems, and so
on? Or did what biases did you introduce into training?
Furthermore, these questions come up right away, and they seem fundamental to
whatever the main practice is.
In other words, can I even experiment or start without knowing how the
word2vec works?
~~~
mlucy
You're definitely right that you sometimes need to know the exact details of
how an embedding is produced, especially if you're doing cutting-edge work.
That's one of the things we really need to improve documentation-wise. I'd
like to have a page for each embedding that talks about how it's generated,
what to watch out for while working with it, etc. etc.
I'm going to narrow in on the question of how to go about tweaking a model
that uses an embedding, since I think it's a really interesting topic.
To use your first example, let's say you're doing the image similarity task.
You probably wouldn't be computing the cosine distance on the embeddings
directly. You'd probably normalize and then do PCA to reduce the number of
dimensions to 200 or so.
If you weren't getting good results, you'd have a few options. You could
fiddle with the normalization and PCA steps, which can have a big effect. You
could also include other handcrafted features alongside the embedding. But
let's say you have a fundamental problem, like your similarity score is paying
too much attention to the background of your images rather than the
foreground.
There are two major approaches to solving that sort of problem with
embeddings: preprocessing or postprocessing. You could preprocess the images
before embedding them to de-emphasize the backgrounds (e.g. by cropping more
tightly to what you care about). You could also postprocess the embeddings.
For example, you could label which of your images have similar backgrounds,
and instead of naive PCA you could extract components that maximally explain
variance while having minimal predictive power for background.
~~~
rpedela
I definitely agree you should add more documentation to how the word vector
model(s) is generated. Also you may want to have a set of models that the user
can choose from. For example, Wikipedia is good for a general language use
case. But something more technical, such as finance, SEC filings are a better
data source.
------
ASpring
How do you plan to counter the harmful societal biases that embeddings embody?
See Bolukbasi
([https://arxiv.org/pdf/1607.06520.pdf](https://arxiv.org/pdf/1607.06520.pdf))
and Caliskan
([http://science.sciencemag.org/content/356/6334/183](http://science.sciencemag.org/content/356/6334/183))
While these examples are solely language based, it is easy to imagine the
transfer to other domains.
~~~
hiphipjorge
Hi. Jorge from Basilica here.
We don't have any concrete plans to tackle this right now but it is something
we're definitely mindful of. Thanks for the links! We'll be sure to go through
them.
------
gugagore
Aren't these embeddings task-specific? For example a word2vec embedding is
found by letting the embedder participate in a task to predict a word given
words around it, on a particular corpus of text.
The embedding of sentences are trained on translation tasks. A embedding that
works both for images and sentences is found by training for a picture
captioning task.
The point I'm asking about is that there may be many ways to embed a "data
type", depending on what you might want to use the embedding for. Someone
brought up board game states. You could imagine embedding images of board
games directly. That embedding would only contain information about the game
state if it was trained for the appropriate task.
~~~
mlucy
You can definitely improve performance by choosing an embedding closely
related to your task. In the future we're hoping to have more embeddings for
specialized tasks.
Kind of surprisingly, though, if you get your embedding by training a deep
neural network to do a fairly general task -- like denoising autoencoding, or
classification with many classes -- it ends up being useful for a wide variety
of other tasks. (You get the embedding out of the neural network by taking the
activations of an intermediate layer.)
In some sense you'd expect this, since you'd hope that the intermediate layers
of the neural network are learning general features -- if they were learning
totally nongeneral features, it would be overfitting -- but I found it
surprising when I first learned about it.
------
piccolbo
You quote a target of 200ms per embedding, not sure if it's one type of
embedding in particular. I am using Infersent (a sentence embedding from FAIR
[https://github.com/facebookresearch/InferSent](https://github.com/facebookresearch/InferSent))
for filtering and they quote a number of 1000/sentences per second on generic
GPU. That's 200 times faster than your number, but it is a local API so I am
comparing apples to oranges. Yet it's hard to imagine you are spending 1ms
embedding and 199 on API overhead. I am sure I have missed a 0 here or there,
but I don't see where, other than theirs is a batch number (batch size 128)
and maybe yours is a single embedding number. Can you please clarify? Thanks
~~~
piccolbo
So I am going to answer it myself. On batched data, it's a lot faster than
200ms per embedding and I'd say on a par with Infersent. On the other hand, I
couldn't get statistical performance in the same ballpark as Infersent and I
had to backtrack. This was training a logistic regression on the embeddings to
filter some text streams according to my preferences. If I had, I would have
preferred Basilica as Infersent is py2 only, hard to install and distribute
and a battery killer on my laptop. Its vectors are also 4x bigger. I
experienced some server errors and the team at Basilica was very responsive
and fixed it, very pleased with the interaction. It would be important IMHO to
publish some benchmark results for these embeddings, as it's usually done in
the universal embedding literature, or serve published embeddings with known
performance when licensing terms are favorable.
~~~
piccolbo
Another update, on their v2 sentence embedding basilica is ahead of Infersent
for my task. Well done basilica!
------
jdoliner
How much does this depend on the data type? I.e. do you need people to
specify: this is an image, this is a resume, this is an English resume, etc.
Could you ever get to a point where you can just feed it general data, not
knowing more than that it's 1s and 0s?
~~~
mlucy
That's a really interesting idea.
I can't really think of a barrier to this. Detecting the file format is
straightforward, and generic image/text/etc. embeddings work surprisingly
well. (In fact, you can actually get some generalization gains by training
subword text embeddings on corpora in multiple languages.)
If we wanted to able to use specific embeddings (e.g. photos vs. line art,
English vs. German), we could probably do it by running the data through a
generic embedding, and then seeing which cluster of training data it's closest
to and running it through that specific embedding.
It would be really important in this case to make sure that all the specific
embeddings are embedding into the same space, in case people have a mixed
dataset, but that's very doable.
------
pkaye
Slightly different topic but what are some approaches to categorize webpages.
Like I have 1000s of web links I want to organize with tags. Is there software
technique to group them by related topics?
~~~
yorwba
The task is known as document clustering
[https://en.wikipedia.org/wiki/Document_clustering](https://en.wikipedia.org/wiki/Document_clustering)
or topic modeling
[https://en.wikipedia.org/wiki/Topic_model](https://en.wikipedia.org/wiki/Topic_model)
Generally, you'll want to extract features (e.g. word counts) and then apply a
clustering algorithm to group related documents together. The precise details
are the subject of thousands of papers, each one doing things slightly
differently.
------
Lerc
Is this actually 'for anything'? I see references to sentences and images. If
I, for example, wanted to compare audio samples, how would it work?
~~~
mlucy
"Word2vec for anything" is where we want to get to. Right now we only support
images and text, but you can see the other data types on our roadmap at
[https://www.basilica.ai/available-
embeddings/](https://www.basilica.ai/available-embeddings/) .
------
kolleykibber
Hi Lucy. Looks great. Do you have any production use cases you can tell us
about? Are you a YC company?
~~~
mlucy
Thanks!
No production use cases yet. This is the first usable release, and it's the
bare minimum we felt we could build before showing it to people.
> Are you a YC company?
We have a YC interview on Friday, so hopefully in a few days I'll be able to
say yes.
------
msla
So the actual code is closed-source?
~~~
hiphipjorge
Hi, Jorge from basilica here.
Yes. We intend to run this as a cloud service API for now.
------
captn3m0
Do you think board game states might be a good target later?
~~~
mlucy
Sort of depends on how late "later" is.
In the very-long term, I want us to literally have embeddings for everything
people want to embed, which will probably include the states of popular
boardgames.
I'm not sure how we'll get there. Maybe we'll have community embeddings, or an
embedding marketplace, or we'll abstract away the process of creating an
embedding so well that we can create simple embeddings just by pointing our
code at a dataset. But I'd like to get there eventually.
In the less-very-long term, we're still focusing on embeddings that are either
very general and useful across a lot of domains (e.g. images, text), or
embeddings that have clear and immediate business value (e.g. resumes), since
running GPUs is expensive.
------
asdfghjl
How are you embedding images?
~~~
mlucy
We're feeding them through a deep neural network and using the activations of
an intermediate layer as an embedding.
You can read more about this technique in
[https://arxiv.org/abs/1403.6382](https://arxiv.org/abs/1403.6382) if you're
interested.
------
aaaaaaaaaab
>Job Candidate Clustering
>Basilica lets you easily cluster job candidates by the text of their resumes.
A number of additional features for this category are on our roadmap,
including a source code embedding that will let you cluster candidates by what
kind of code they write.
Wonderful! We were in dire need for yet another black-box criteria based on
which employers can reject candidates.
“We’re sorry to inform you that we choose not to go on with your application.
You see, for this position we’re looking for someone with a different
_embedding_.”
~~~
panarky
word2vec:
king
- man
+ woman
--------
= queen
Basilica:
resumes of candidates
- resumes of employees you fired
+ resumes of employees you promoted
---------------------------------------
= resumes of candidates you should hire
~~~
kvb
word2vec[0]:
computer programmer
- man
+ woman
---------------------
= homemaker
Basilica?
[0] -
[https://arxiv.org/pdf/1607.06520.pdf](https://arxiv.org/pdf/1607.06520.pdf)
~~~
ben_w
One thing I’ve been tempted to research but never had time for myself: can one
use that aspect of wording embeddings to automatically detect and quantify
prejudice?
For example, if you trained only on the corpus of circia 1950 newspapers,
would «“man” - “homosexual” ~= “pervert”» or something similar? I remember
from my teenage years (as late as the 90s!) that some UK politicians spoke as
if they thought like that.
I also wonder what biases it could reveal in me which I am currently unaware
of… and how hard it may be to accept the error exists or to improve myself
once I do. There’s no way I’m flawless, after all.
~~~
teraflop
> For example, if you trained only on the corpus of circia 1950 newspapers,
> would «“man” - “homosexual” ~= “pervert”» or something similar?
If it did, what conclusion would you be able to draw?
As far as I know, there's no theoretical justification for thinking that word
vectors are guaranteed to capture meaningful semantic content. Empirically,
sometimes they do; other times, the relationships are noise or garbage.
I am wholeheartedly in favor of trying to examine one's own biases, but you
shouldn't trust an ad-hoc algorithm to be the arbiter of what those biases
are.
~~~
pasabagi
I think there's a further problem that there's never been a shortage of
evidence, about things like this. The point is, prejudice and discrimination
are not evidence-based in the first place. People who support existing unjust
structures are generally strongly motivated to turn a blind eye. Even people
who don't support them are - it's simply far easier and more socially
advantageous to stop worrying and love the bomb.
------
mathena
Am I really missing something here or this thing is a complete nonsense with
no actual use cases what's so ever in practice?
There are a number of off-the-shelf models that would give you image/sentence
embedding easily. Anyone with sufficient understanding of embedding/word2vec
would have no trouble train an embedding that is catered to the specific
application, with much better quality.
For NLP applications, the corpus quality dictates the quality of embedding if
you use simple W2V. Word2Vec trained on Google News corpus is not gonna be
useful for chatbot, for instance. Different models also give different quality
of embedding. As an example, if you use Google BERT (bi-directional LSTM) then
you would get world-class performance in many NLP applications.
The embedding is so model/application specific that I don't see how could a
generic embedding would be useful in serious applications. Training a model
these days is so easy to do. Calling TensorFlow API is probably easier then
calling Basilica API 99% of the case.
I'd be curious if the embedding is "aligned", in the sense that an embedding
of the word "cat" is close to the embedding of a picture of cat. I think that
would be interesting and useful. I don't see how Basilica solve that problem
by taking the top layers off ResNet though.
I appreciate the developer API etc, but as an ML practitioner this feels like
a troll.
~~~
vladf
> Calling TensorFlow API is probably easier then calling Basilica API 99% of
> the case.
Maybe, but training/curating data appropriate for your application isn't. It's
not in that state right now but I think this service could save you some time
if they had a domain-relevant embedding ready to roll for your application and
it performed decently well -- that would save you a lot of time gathering
training data and help you focus on the "business logic" ML needs that accept
the embeddings as input.
That said, they'd need to be more performant than, say, GloVe 2B, which I can
get for free off of torchtext, meaning they have to do the domain-specific
heavy-lifting.
| {
"pile_set_name": "HackerNews"
} |
How to Build a GCC Cross-Compiler for the Raspberry Pi - bezzi
http://blog.felipe.rs/2015/01/20/how-to-build-a-gcc-cross-compiler-for-the-raspberrypi/
======
dima55
Heh? Debian cross toolchains work fine:
[https://packages.debian.org/sid/gcc-4.9-arm-linux-
gnueabi](https://packages.debian.org/sid/gcc-4.9-arm-linux-gnueabi) for armel
and [https://packages.debian.org/sid/gcc-4.9-arm-linux-
gnueabihf](https://packages.debian.org/sid/gcc-4.9-arm-linux-gnueabihf) for
armhf
~~~
fit2rule
Cool if you're running Debian.
~~~
dima55
Well, not having to build your own cross-compilers is a HUGE reason to run
Debian. Other distros probably have packages too in any case.
~~~
fit2rule
OSX.
~~~
dima55
Right. Get something better.
------
hannibalhorn
I'd recommend just using a project like buildroot - it's really easy to begin
with, and afterwards every odd device you eventually decide you need to cross
compile for (old router with a MIPS CPU, etc.) becomes just as easy.
------
sliken
I have one of the new Pi's with 1GB ram. With a fast 64GB microsd card ($21 on
black friday). I've been pretty impressed with fast it compiles with make -j4.
~~~
stinos
Yes especially the difference with the very first A model is night and day :]
------
fit2rule
Great, this brings me one step closer to a dream: setting up distcc on every
computer in the house so I can build rPi software in seconds, not hours..
------
oso2k
Couldn't tell from the guide, is this armv6 (A/A+, B/B+, Compute) or armv7
(B2)?
------
jwatte
I went one step further and built a Canadian that was built on x64, ran on
raspberry pi, and targeted teensy cortex m4!
[https://github.com/jwatte/teensy-canadian](https://github.com/jwatte/teensy-
canadian)
------
poseid
thanks for sharing! understanding how to cross-compile is increasingly
important for upcoming (cheap) embedded hardware. maybe related a blog post on
compiling a sketch for Arduino: [http://thinkingonthinking.com/an-arduino-
sketch-from-scratch...](http://thinkingonthinking.com/an-arduino-sketch-from-
scratch/)
------
karmicthreat
You might consider building Linaro instead, especially if you are going to use
a RPI 2.
| {
"pile_set_name": "HackerNews"
} |
Parse makes large many-to-many relations more efficient - bjornick
http://blog.parse.com/2012/05/17/new-many-to-many/
======
DavidAbrams
There seem to be regular posts about this for-pay service...
~~~
markerdmann
The service is great and I'm interested in hearing about the new features,
which is why I personally vote up the posts.
New AWS features often hit the front page as well, so I'm not too worried that
there is a Parse conspiracy at play. :-)
~~~
tl
Are the new AWS features posted from accounts that are 2 hours old?
blog.parse.com has an rss feed for those who are interested; I'm personally
tired of the spam.
~~~
onetwothreefour
Me too.
~~~
darkf
Thirded. This should not be on HN.
| {
"pile_set_name": "HackerNews"
} |
How do you tackle fear? - hekocelsius
How do you drown your fears?
======
jammygit
I think you need to do things that build your self efficacy. If you start with
small wins, larger things will not be as intimidating.
~~~
hekocelsius
Thanks
------
cloudking
(F)alse (E)vidence (A)ppearing (R)eal
~~~
hekocelsius
Most of the time,it's as real as day.
~~~
cloudking
If that's what you believe, I'd argue the opposite. Most of the time people
fear things that haven't happened yet. Give us an example of your fear?
| {
"pile_set_name": "HackerNews"
} |
The Sounds of Sorting Algorithms - detaro
http://www.caseyrule.com/projects/sounds-of-sorting/
======
detaro
Not my work, after seeing one of those animations of sorting algorithms I
wondered about turning it into audio instead. And of course someone else had
already done it in a very comprehensive way.
Try the recommendations at the bottom:
> _I would personally recommend Quicksort on the "Dark" pitch set, or, if
> you've got some time, Stooge sort on the "Shifting" pitch set._
| {
"pile_set_name": "HackerNews"
} |
Ask HN: Why do Hackers always (it seems) go after Sony? - desouzt
Hey guys,<p>I read another article today http://www.bbc.co.uk/news/technology-30373686 where the Playstation network has been hacked. What is with all the hacks to Sony? Are they perceived to be easy to hack or are they a company that are for whatever reason hated?
======
debacle
Hackers are always going after everyone. A lot of the vulnerability detection
is automated, so really if you are vulnerable it's only a matter of time
before you are exploited, and if you are a juicy target that timeframe is
probably hours, not days.
Sony just seems to have more high-profile cases than others. Media companies
tend to have a pretty devil-may-care relationship with security, and Sony has
also done a few things in the past to earn people's ire.
------
fiberloptic
If you read the news, others have been hacked too like Home Depot, Target,
etc.
Perhaps it is you focusing on Sony that is the issue, since others are getting
hacked as well?
~~~
desouzt
I do read the news, and I am aware of the hacks on other companies.
Specifically I meaning this -
[http://attrition.org/security/rant/sony_aka_sownage.html](http://attrition.org/security/rant/sony_aka_sownage.html)
and the table at the bottom. Over 30-40 high profile attacks on a regular
basis (every couple of months). And more recently hacks on the PS network,
Sony pictures, customer details etc that were so high profile.
------
junto
Ok, here are just two items of recent history:
[http://en.wikipedia.org/wiki/Sony_BMG_copy_protection_rootki...](http://en.wikipedia.org/wiki/Sony_BMG_copy_protection_rootkit_scandal)
and
[https://www.schneier.com/blog/archives/2005/11/sonys_drm_roo...](https://www.schneier.com/blog/archives/2005/11/sonys_drm_rootk.html)
In the days after the rootkits were exposed, Thomas Hesse, president of
Sony's global digital business, was quoted on NPR as saying, "Users don't
know what a rootkit is, so why should they care about it?"
[http://en.wikipedia.org/wiki/PlayStation_Network_outage#Crit...](http://en.wikipedia.org/wiki/PlayStation_Network_outage#Criticism_of_Sony)
Credit card data was encrypted, but Sony admitted that other user information
was not encrypted at the time of the intrusion.[44][58] The Daily Telegraph
reported that "If the provider stores passwords unencrypted, then it's very
easy for somebody else – not just an external attacker, but members of staff
or contractors working on Sony's site – to get access and discover those passwords,
potentially using them for nefarious means."[59] On May 2, Sony clarified the
"unencrypted" status of users' passwords, stating that:[60]
While the passwords that were stored were not “encrypted,” they were transformed
using a cryptographic hash function. There is a difference between these two types
of security measures which is why we said the passwords had not been encrypted.
But I want to be very clear that the passwords were not stored in our database in
cleartext form.
Bottom line is that Sony haven't helped themselves in the last few years.
Whilst they build pretty good hardware, building software systems (especially
to support things like the Playstation) isn't their forté. Worse is that when
they do screw up, they are arrogant and disrespectful to their customers.
Their arrogance has irked a generation of hackers and script kiddies, who see
Sony as a carte blanche target. The recent hack shows both their arrogance and
negligent attitude to the security of their customer and private company data.
Investors should be punishing Sony and calling for the heads of the board.
| {
"pile_set_name": "HackerNews"
} |
How The Economic Machine Works by Ray Dalio - zbravo
http://www.youtube.com/watch?v=PHe0bXAIuk0
======
caprock
Dalio has also written papers on this and related topics [0]. Originally,
there were three separate papers, but it looks like they've been combined in
to a new draft. The three main sections:
* How the Economic Machine Works
* Debt Cycles: Leveragings & Deleveragings
* Productivity: Why Countries Succeed & Fail Over the Long Term
[0] [http://www.bwater.com/home/research--press/how-the-
economic-...](http://www.bwater.com/home/research--press/how-the-economic-
machine-works.aspx)
| {
"pile_set_name": "HackerNews"
} |
Frustrated Musk Shakes Up Autopilot Team [Unlocked for HN] - ballmers_peak
https://www.theinformation.com/articles/frustrated-musk-shakes-up-autopilot-team?pu=hacker39uvpw&utm_source=hackernews&utm_medium=unlock&utm_content=autopilot-shake-up
======
ballmers_peak
Hi, this is Jay from The Information. We're big fans of HN and we're trying
out an experiment to unlock our paywalled articles specifically for HN users
to read. Hope you enjoy!
~~~
joncrane
Wow, this is great! If only you could unlock the org charts for HN users, that
would be great! $400 a year (no monthly option) for the org charts is a tough
sell!
| {
"pile_set_name": "HackerNews"
} |
The New 10-Year Vesting Schedule - genieyclo
https://zachholman.com/posts/the-new-10-year-vesting-schedule?sr_share=facebook
======
a3n
> This is a top VC and luminary advocating for the position that people who
> end up wanting to make some money on the stock that they’ve worked hard to
> vest are disloyal.
Loyal or disloyal to what? It's a job, and there's a compensation package.
| {
"pile_set_name": "HackerNews"
} |
Ender’s Game is Already a Reality for the U.S. Military - robabbott
http://spectrum.ieee.org/computing/software/enders-game-is-already-a-reality-for-the-us-military/?utm_source=techalert&utm_medium=email&utm_campaign=110713
======
hosh
Is it just me, or does this article (and the people it talks about) get
fixated on the technology?
"I almost think it’s passé at this point ... Ender’s Game is happening. It’s
already done."
The technology is not what I remembered Ender's Game for.
~~~
GeneralMayhem
Unfortunately, it's all the movie is memorable for.
------
alexeisadeski3
\-----SPOILER ALERT-----
Children are being tricked into unknowingly fighting wars for the US military?
Really?
~~~
mey
[https://en.wikipedia.org/wiki/Toys_(film)](https://en.wikipedia.org/wiki/Toys_\(film\))
~~~
stcredzero
A Buzz Lightyear RTS would sell. If it was done well, it would even continue
to sell.
~~~
lazugod
Toys is a different film from Toy Story.
~~~
stcredzero
Whoops. I'm not so sure a Robin Williams based RTS would sell. (Though he's
been in enough movies, you could probably have 3 entire factions based on his
characters.)
------
laxatives
The title makes it sound amazing in a bunch of different and misleading ways,
but all the demos look like cheap toys and video games.
~~~
stcredzero
JWARS was an amazing simulation system that the US defense department had in
the 1990s. They could simulate entire theaters of war down to individual
soldiers at 10000x speed.
The problem with good, accurate simulations in the defense department, is that
higher-ups who do not like the results that come out of them will have them
killed politically. This is what happened to JWARS. (This is also what
happened to the war game where a 3rd rate power sank a US aircraft carrier.
[http://wakeupfromyourslumber.com/node/3793](http://wakeupfromyourslumber.com/node/3793)
)
~~~
theorique
The troublesome thing is when unpredictable things happen far outside the
boundaries of the expected battlespace.
Who would have guessed that a small band of Islamic fundamentalists would
\- overstay their (legal) visas
\- do some flight training
\- hijack commercial aircraft to use as giant suicide bombs
In hindsight, it looks logical, but on Sept 10, 2001, who was thinking of
this?
~~~
scotty79
Tom Claney. In 1994.
[http://en.wikipedia.org/wiki/Debt_of_Honor](http://en.wikipedia.org/wiki/Debt_of_Honor)
~~~
theorique
Good point, and you're absolutely right.
I'm guessing, however, this was not part of mainstream military doctrine or
scenario planning.
------
altero
Cheap movie promotion?
------
D9u
raise the heavy rifle in my hands... an exact replica of an M16
An M16 is far from being a "heavy rifle." What other bits of this "reality"
are unrealistic?
~~~
xauronx
I think the author was trying to convey that it was an actual rifle in his/her
hands, and not a plastic toy/digital.
~~~
D9u
My bad for conflating the meaning of reality in reference to the use of VR
with the reality of my own experience.
~~~
chc
I _think_ the point is more that "heavy" is relative. It feels heavy in his
hands, not that it's heavy compared to a bunch of stuff that he doesn't know
about.
| {
"pile_set_name": "HackerNews"
} |
Vim GIFs - shawndumas
http://vimgifs.com/
======
kartD
Great idea, vim is intuitive ( -ish?) once you understand what each character
means ( y for yank being a simple example ). If anyone is looking to learn vim
or any IDE really, check this place out.
[https://www.shortcutfoo.com/app/dojos/vim](https://www.shortcutfoo.com/app/dojos/vim)
~~~
wodenokoto
It seems to me there is a lot of VIM vocabulary that is very different from
what is common on the desktop today. I don't know what yank means. I don't
think I have a desktop app that has a yank function.
The current front page example is using 'z' to "redraw the cursor". I know
what all those words means, but put together they are complete jibberish.
Looking at the gif, it appears that redraw is VIM-speak for scrolling.
Also "z doesn't do anything on it's own. But it pairs with a number of other
things. It is used for redrawing the screen, saving and quitting, as well as
manipulating folds." doesn't sound intuitive _at all_.
~~~
jzymbaluk
It's intuitive once you already know what it means and have sunk dozens of
hours into memorizing what the shortcuts do /s
~~~
cpdean
Actually it takes more like 2 months for the Stockholm Syndrome of vim to sink
in and then you don't want to use anything else ever again.
~~~
Spivak
And that's not a bad thing. I don't think it's right to call Vim intuitive
unless you're used to reading a book to understand 35% of the features of an
editor.
But Vim isn't about being intuitive, it's about being efficient. Once it
'clicks' you will be able to express incredibly complex text manipulations in
only a few keystrokes. And with configuration you'll build the most powerful
but comfortable environment that you'll miss anywhere else.
~~~
TeMPOraL
In other words, Vim is a professional tool, not a toy for causal user. It
offsets steeper learning curve for much more powerful and efficient way of
editing text. It's a _feature_.
~~~
Asooka
That said, it would benefit A LOT from having a more discoverable interface.
See what kakoune is doing in that space:
[http://kakoune.org/](http://kakoune.org/)
~~~
moosingin3space
When it comes to discoverability, I really like what Spacemacs is doing with
its continuous suggestions UI.
------
sdegutis
Speaking of vim, just a reminder that @antirez made a terminal based text
editor in pure C with no dependencies, not even ncurses, in under 1000 lines
of code, complete with search feature, and customizable syntax highlighting
for variable number of languages.
[https://github.com/antirez/kilo](https://github.com/antirez/kilo)
Lots of people have forked it and are actively making it their very own
editor. Sure, none of them may ever take off and become a new emacs or vim
competitor. Or maybe they will. Let's not discount innovation.
Plus it's amazing to me that to make a full fledged terminal editor, almost
all you really need is the ability to read from stdin and write to stdout.
Only a tiny little bit of glue C code is needed (for handling signals like
SIGWINCH, or for setting or unsetting raw mode in the terminal), but almost
the entire rest of it can be written in, say, Lua.
~~~
kartD
+1, to complete the editor love, people should also give the
[https://github.com/google/xi-editor](https://github.com/google/xi-editor) a
look.
"The xi editor project is an attempt to build a high quality text editor,
using modern software engineering techniques. It is initially built for Mac OS
X, using Cocoa for the user interface, but other targets are planned."
------
i336_
There's a truckload of feedback already so I'll keep it short.
Two things:
1\. A "TV mode" that cycles between examples with a pause in between so I can
sit going "oooh, okay!" for a few minutes
2\. A random mode, with a link that's accessible without scrolling the page
down
Bonus: Maybe using cookies/localStorage, remember what's already been seen,
and avoid showing it again too quickly.
------
ue_
The performance could be increased (i.e less choppy) and filesizes could be
decreased (i.e taking up less transfer of data for the same quality) by
filming webm or similar rather than gif.
The only disadvantage visible is Internet Explorer users who don't have the
plugin installed, in which case you could provide a gif fallback.
~~~
cridenour
But then they would need a new domain.
~~~
iBzOtaku
Not really. gfycat does both gifs and webm.
------
vegabook
This is actually very good! My initial reaction was to roll my eyes at another
Vim tutorial, but this suits my (low) attention span by giving me exactly what
each letter does in a spoonfeed (read animated) way. Brilliant taxonomy (a-z)
and brilliant bite-size aborption medium that doesn't require me to trawl
through a tutorial. Bookmarked.
------
captn3m0
This is a very creative (and definitely not bandwidth-happy) way of teaching
vim. Bookmarked.
------
hosh
This is a great idea!
At least until I started to seriously use it to level up my vi skills. Some of
the links (say, for `a` or `g`) goes to the wrong places -- to the entry for
`b`. When I stepped back and looked at how to navigate it, I realized the
structure is disordered so I have no idea how to get to the info I'd like to
see.
~~~
mrmrs
Well I started designing the site a few hours ago so - it would make sense it
has bugs and is out of sorts at the moment. Better information architecture is
coming down the pipe for sure.
~~~
hosh
Awesome, looking forward to it.
------
foota
One of my coworkers once shared the use of set relativenumber, which causes
line numbers to be relative to your current position in the file. Great for
movements.
------
MrQuincle
+1 Minor point. Somehow I first checked f, it gives me the description for b.
~~~
chestervonwinch
I think "b" might be a default? "a" also gives "b":
[http://vimgifs.com/07-18-2016/a/](http://vimgifs.com/07-18-2016/a/)
------
atsaloli
Very nice. I've added VimGIFs.com to my list of resources for learning Vim
([http://www.verticalsysadmin.com/vi.htm](http://www.verticalsysadmin.com/vi.htm))
------
zuck9
I've never understood, what does Vim or Emacs have to offer that people use it
over Atom or Sublime Text?
I think I can edit and navigate through text as fast as Vim users, using the
native OS text editing hotkeys.
~~~
skylerberg
> I think I can edit and navigate through text as fast as Vim users, using the
> native OS text editing hotkeys.
This is where I think you are wrong. An experienced vim user has so many
faster ways to edit text than someone limited to what the OS provides. Here
are some examples:
yt( - Copy characters up to the nearest (
ci{ - Replace text enclosed by curly braces
:g/\\(['"]\\).*\1/d - Use regex to delete every line containing a string
literal
A vim master has thousands of permutations of commands at their disposal the
specify exactly how they want to manipulate text in 5 or less keystrokes. But
navigation is just one great feature. Vim users can travel backwards in time
(:earlier 10m), can have multiple clipboards with different content at the
same time, easily record macros on the fly.
~~~
aninhumer
>faster ways to edit text than someone limited to what the OS provides
But other editors aren't limited to what the OS provides, they build on those
basics to provide most of the same features, but in a way that's intuitive to
modern users.
For example in Sublime:
>ci{ - Replace text enclosed by curly braces
Ctrl-Shift-M selects text inside brackets. Subsequent presses work outwards
through layers of brackets.
>:g/\\(['"]\\).* \1/d - Use regex to delete every line containing a string
literal
Ctrl-F Alt-R (['"]).* \1 Alt-Enter Ctrl-L Delete
>yt( - Copy characters up to the nearest (
Not available out of the box, but there are plugins for it. Although, in my
experience of using vim, the mental effort of working out what character I
needed for t/f tended to be far more disruptive than just using arrow
keys/mouse.
Honestly that was my experience of vim in general. Whenever I had to do
anything slightly non-trivial, it took a lot of mental effort to work out the
exact command I needed. Whereas Sublime's multiple selections are more
intuitive and flexible in unusual situations.
To use your regex example above, depending on the context, I'd probably just
use Ctrl-D to step through instances of " checking whether each one is a
string (which it probably is), skipping any that aren't, and then Ctrl-L
Delete. (And repeat for ') If it's a short file, this is probably about as
fast, it flows from muscle memory, and it means I'm actually checking through
the changes I'm about to make. (And if it was a massive file, I'd use the
regex. My point is just that Sublime offers a more ad-hoc way to do bulk edits
where you're not exactly sure what you need to match on.)
~~~
emanuelev
> Although, in my experience of using vim, the mental effort of working out
> what character I needed for t/f tended to be far more disruptive than just
> using arrow keys/mouse.
I think you maybe didn't give it enough time. What really happens after a
while is that you don't have to do _any_ mental effort to do very complex
things fast and efficiently. My experience is that after three months I had
some sort of clicking in my head and everything made sense.
Said that, I wouldn't mind Ctrl-D on vim though, that's one of those sublime's
features that I really like (and non consecutive multi line editing).
~~~
aninhumer
I gave it several years as my primary editor, and I did learn a lot of things.
Then I switched to Sublime and became about as proficient in a matter of
weeks. I could have put more effort into learning vim, but I didn't have to in
Sublime.
------
stockkid
feedback: 'b' section:
[http://vimgifs.com/07-18-2016/b/](http://vimgifs.com/07-18-2016/b/) has
instructions about some other keys. Similarly
[http://vimgifs.com/07-19-2016/g/](http://vimgifs.com/07-19-2016/g/) has
instructions about 'b'.
------
devin
I've used Vim, and I don't get it. I have no idea why this is useful. Is this
about generating gifs? Why is the alphabet shown with dates?
~~~
pssdbt
This is useful because it shows how to do many things in vim in easily
consumable gifs. The letters are shown with dates because that's when the
author posted each one. Probably not for everybody, I think it's kind of neat
though!
~~~
devin
Thanks for the explanation. Apparently not understanding this immediately
counts as downvote-worthy. I was not trying to be snarky, it simply did not
make sense to me. A better explanation on the page seems like it wouldn't be
asking too much?
------
Philipp__
Vim may be daunting at first, but after you use it for some time, things just
sink into your brain and fingers.
As some of you mentioned here, it is a professional tool, not easy to learn,
requires patience and dedication, but I think in a long term, you will save
much more time by doing so and mastering it, rather than sticking to some gui
editors where you select with mouse.
------
hbz
Does anybody know what program was used to generate the gifs?
~~~
mrmrs
Licecap and visualize
~~~
hbz
Thanks!
------
roansh
Does anyone know a similar site for Emacs users?
------
mrmrs
Hi everyone.
Crazy to see this thing on the front page of hacker news.
First off - I JUST started putting the site together and didn't expect any
attention yet. So apologies for the bugs and mismatched content. Pull requests
welcome at github.com/mrmrs/vimgifs :)
I created vimgifs because I have found gifs to be an effective way to help
people learn vim commands. And I really like helping people become more
efficient at building out their ideas.
The long term vision is to have a comprehensive set of examples that can be
searched in a myriad of ways i.e related commands, all motion commands,all
commands available in insert mode, .etc. If it's in :help I want a gif of it!
I don't have an opinion on whether or not vim is 'intuitive' but I will say it
is much easier to learn than people make it out to be. I'd say it is
infinitely less complex than whatever language you are trying to write in.
It took me less than a week to become more proficient in vim than in textmate
- and I knew most of the command and shortcuts in textmate.
To people who say they don't have time to learn vim, a counter: If you are
pressed for time so much that you are debating whether or not you have time to
learn something... it sounds like vim is definitely for you!
Vim isn't just about key strokes, commands, shortcuts, and the like. The more
I learn about vim's capabilities the more I fundamentally think differently
about editing and manipulating text. It has branching history, native ability
to step through compile errors for ANY language, and navigation methods that
truly changed how I think about exploring/navigating a code system. It's also
ubiquitous which is pretty rad. I can't remember the last time I touched a
computer that didn't have my favorite editor already installed.
I would encourage people not to denounce something they have never possessed.
If you are not proficient in vim - it is difficult to denounce how intuitive
it is. It's tough to denounce its ways and how much time they might save you.
I have become quite proficient in atom, sublime, textmate, and a few other
editors. Even with 'vim mode' enabled these editors do not come close to the
power that lies within vim.
But rest assured you can write amazing software with any text editor. I've met
a lot of people who are excellent at writing code that never use vim and don't
like it much.
In short - I hope this project makes it more fun and less intimidating to
learn vim. I was lucky to have some amazing teachers when I got going and
would love to pay their efforts forward a little bit.
Thanks for flying vim.
------
naviehuynh
finally a comprehensive list of vim shortcuts
~~~
mrmrs
not comprehensive yet, but we will get there!
------
jegutman
Wow, this is really cool.
| {
"pile_set_name": "HackerNews"
} |
BetterExplained - mshafrir
http://betterexplained.com/
======
samstokes
"I want to share hard-won “a ha!” moments in clear and simple language."
I looked at a couple of articles and they seem to achieve this pretty well.
[http://betterexplained.com/articles/understanding-quakes-
fas...](http://betterexplained.com/articles/understanding-quakes-fast-inverse-
square-root/) is a great explanation (previously discussed:
<http://news.ycombinator.com/item?id=419166>) - it omits some detail to better
convey the key ideas.
This one's going in my RSS reader.
------
kebaman
I like it, too. First time I got an easy explanation for the Monte Hall
problem. Bookmarked.
------
kalid
Hi all, this is Kalid from BetterExplained -- thanks for the submission!
Hacker News has been a favorite source of article discussions for me :).
I'm hoping to crank up the posting frequency, topic suggestions are more than
welcome.
------
snorkel
Bookmarked. Keep writing.
------
rhymes
Where's the story?
| {
"pile_set_name": "HackerNews"
} |
Earth just experienced its hottest-ever October - reddotX
https://www.cbsnews.com/news/earth-just-experienced-its-hottest-october-ever/
======
adamiscool8
Headline: Earth just experienced its hottest-ever October
Report:
>0.69°C warmer than the average October from 1981-2010, making it by a narrow
margin the warmest October in this data record;
>an insignificant 0.01°C warmer than October 2015, the second warmest October;
>0.09°C warmer than October 2017, the third warmest October.
I don't want to be a "climate change denier" or whatever, but what if 1980 was
hotter? It sound like things are largely in line with the last 5 years. The
report is (probably) good data collection, but this kind of reporting by CBS
doesn't seem useful -- other than to mislead.
~~~
n9
I do not think that it is dialogically interesting to critique the reporting
when the subject matter is clearly what is in scope here. As with any new
reporting if you have interest in a broader context or more details after
consuming a story you should, you know, check it out. I'm fuzzy on what your
expectation would be... a comprehensive telling of an enormously large scale
of data in a mainstream press story? The story is that it was the hottest-ever
October. The reason for the telling is that October 2019 just came to a close.
But, to do as you ought to have done rather than type and copy and paste this
story in the comments, I googled: global temperature data for last 100 years.
The first response is from NOAA which has reasonably accurate temp data since
1880. [https://www.ncdc.noaa.gov/cag/global/time-
series/globe/land_...](https://www.ncdc.noaa.gov/cag/global/time-
series/globe/land_ocean/all/10/1900-2019)
October 2019 data is not yet added, but it does already indicate that
September 2019 was the hottest on record, and that the top of a sorted list of
hottest months ever recorded features very few months not in the 21st century.
It's interesting. Poke around.
Also, friend, .69 degrees C more in the global temperature average is not, not
at all, a narrow margin. Variations exist in these global averages for sure,
and they are often naturally occurring and they can be bigger than that but
.69 is not small. Check it out.
------
woodandsteel
Standard conservative responses:
\--The globe is not getting warmer
\--We don't know if the globe is getting warmer or not
\--We do know the globe is getting warmer, but we don't know why
\--We do know the globe is getting warmer, but it has a different cause than
human activities
\--We do know the globe is getting warmer, and it is in part due to human
activities, but any action to counter this would be more harmful than letting
it get warmer.
\--We do know the globe is getting warmer and action needs to be taken, but it
should all be voluntary actions by private enterprises, and no new
governmental regulations.
And let us not forget: increased atmospheric co2 is beneficial because it
increases agricultural production.
Have I missed any?
------
dagdesheren
Still freezing my balls off here at 20c
| {
"pile_set_name": "HackerNews"
} |
Slick CSS3 overlay system (js) - rgbrgb
http://blog.learnboost.com/blog/a-css3-overlay-system/
======
WiseWeasel
I loaded the site in FF4b8, and was wondering why the demo was so
unimpressive, and then decided to try it in Safari, where I saw how it was
supposed to work. Seems nice and easy to implement, but unless it can work on
other browsers without having me do two completely different implementations,
I doubt I'd use this instead of drawing my own overlays and positioning my
modal windows the old-fashioned way.
Edit - I guess the '-webkit' tags everywhere should have clued me in... They
mention that it should work for Firefox, but I'm not feeling like putting in
the work to see if that's true. It would be nice if FF support could be added
to the demo code.
The animated version is pretty sweet, but again, I'm not sure how FF does with
those CSS transitions and transforms. I've been using jquery animations which
seem to have a fairly wide browser support, though they rely on javascript
rather than these slick CSS implementations. It's just not clear how much I'd
be shooting myself in the foot with regards to browser compatibility trying to
go this route instead of tried-and-true javascript.
~~~
Rauchg
Firefox fixes were merged in the repo, never really had the time to update the
Demo.
------
neovive
Very clean implementation. Any recommendations on the best implementation for
modal form windows at the current time (until we CSS3 is better supported)?
~~~
jonah
If you're using jQuery then, <http://jqueryui.com/demos/dialog/>
------
51Cards
FF3.6 here... not centered, won't close. Cool in Safari as mentioned but far
too exclusive to consider using anytime soon. Things we get to look forward to
though.
------
btipling
Very nice, would like to see a decent reference source for transformations.
| {
"pile_set_name": "HackerNews"
} |
If you’ve got it, flaw-nt it: flawed medieval manuscripts - diodorus
http://blogs.bl.uk/digitisedmanuscripts/2018/03/if-youve-got-it-flaw-nt-it.html
======
thisacctforreal
At first glance of the title I thought it was a clever name for a Windows
vulnerability.
But I definitely like this more :)
~~~
jwilk
Can you explain what "flaw-nt" is supposed to mean?
~~~
grzm
It's a pun on "flaunt".
~~~
lainga
and "Flaw in NT".
| {
"pile_set_name": "HackerNews"
} |
Show HN: Scoopinion, The Weirdly Accurate Newsletter - villesundberg
https://www.scoopinion.com
======
seltzered_
so...this thing tracks my browsing habits?
| {
"pile_set_name": "HackerNews"
} |
CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC - e0m
http://www.wolframalpha.com/input/?i=CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC
======
e0m
This is a repost of:
[https://news.ycombinator.com/item?id=6769202](https://news.ycombinator.com/item?id=6769202)
because the title got changed to something fairly useless. This more directly
illustrates what's hidden here :)
| {
"pile_set_name": "HackerNews"
} |
The State Of Railway e-Ticketing In India - mindprince
http://mindprince.blogspot.com/2011/10/state-of-railway-e-ticketing-in-india.html
======
todsul
I just spent 6 months in India, which included a 12,000km circumnavigation of
the country by rail. A team of 20 of us, half rail enthusiasts, half
travellers and entrepreneurs, spent 2 weeks on Indian trains venturing to the
country's most Western, Northern, Eastern and Southern points (in that order).
We travelled a little in unreserved and Sleeper class, but mostly 3AC and 2AC.
It was by far my favourite travel experience ever (after travelling
extensively across 6 continents).
The Indian rail and ticketing systems are chaos personified. As a traveller
post-India, I love the adventure of just trying to buy a ticket from a
station. (Quick tip: stand wide, shoulders broad, with ticket form in hand
blocking access to the hole in the ticketing window so others can't push
through.) But, thinking back as an Indian-rail newbie, my goodness!
As an entrepreneur on a trip like this (full of industry experts), I couldn't
help but see business opportunities. When I say experts, I mean guys that can
recite the Indian rail timetable (approx. the size of the Yellow Pages)
without missing a beat. They're also the guys that dominate the popular India
rail forum called IndiaMike.com. The depth of their knowledge was staggering.
When someone like me meets people like them, we can't help but plot and
conspire.
From a business perspective, the problem with building an Indian Rail startup
was getting access to the rail information. We had grand plans and certainly
the expertise, but then came the stories of bureaucracy. Forget publicly
accessible APIs, the IRCTC would apparently only give access through bribes. A
couple of people I spoke with talked of requests for US$40k. (Dinner and
expensive champagne is one thing, but $40k is on another planet.)
So why compete with Cleartrip, et al? Well, they're just not intuitive or
efficient. They're actually a pain in the ass. We envisaged something like
Hipmunk for Indian train travel. But rather than being satisfied with just
better design, we saw an opportunity to bring Indian rail travel to the
average foreign traveller. Of course, the last thing the Indian rail system
needs is more passengers, but it felt such a shame that most people would
never experience India the way we did.
In the end there were just too many hurdles. For starters, you can't book
foreign tourist allocated seats over the internet (despite bribes and access
to APIs). You can't even book them at most stations. Then there are issues
with IndRail passes and availability. You can book tickets 90 days out, but
the volume of ticket sales in India is mind-blowing. If someone wants to
travel cross-country next month, sometimes they'll buy 5 different days and
just cancel the 4 extra as they get closer to the day. The cancellation fee is
so low that it makes sense. So in a country with 1.1 billion people, imagine
people booking multiple tickets to provide flexibility. This is why there's
such an insane last minute frenzy.
I still think there's an opportunity here, but the data needs to be made
accessible. In my opinion, this kind of openness requires structural and
cultural change in government. I hate to say it, but don't hold your breath.
All of that said, I highly recommend travel by Indian rail to anyone. We were
a mixed group of Brits, Americans, Canadians, Australians, etc and were
treated more warmly than anywhere on the planet. Of course there were a couple
of "incidents" (e.g. breast groping), but hanging out the door a speeding
Indian locomotive in the middle of nowhere is something everyone should
experience.
If you're a foreigner wanting to book Indian train tickets with minimum fuss,
I've written a detailed guide here: <http://globetrooper.com/notes/plan-book-
train-trip-india/>
------
statictype
No rant on the Indian Railway system is complete without mentioning the
disaster that is the 'Thatkal' quota booking at 8 in the morning.
Years ago when I was one of the few people among friends and family that had
good internet and a credit card, I used to book a lot of tickets for others.
Out of frustration, I wrote a simple python script that automated the process
of booking tickets at 8 in the morning.
It would log you in, fill in the passenger details, payment mode etc.. and
boot you into a browser for the final bank transaction screen. It was fast
because it wouldn't actually wait to download the html screens before
submitting the data. It would scrape the main page's date and sync itself with
it to submit the booking exactly at 8am. I was able to finish a booking in
less than 30sec.
After spending a few days prodding their system to make this hack work, I
learned just what a mess their backend was.
They have a form variable called 'clickCount' which they increment and pass
around on every page. This is how they 'detect' that you clicked a link twice
and helpfully log you out.
Their validation and actual processing of passenger genders is case-
insensitive - they accept either 'M' or 'm'. However the final ticket printout
you get will show all passengers as female unless the gender you sent in was
in upper case (curiously though the actual official print out pasted on the
train when travelling contains correct genders - I have no idea why).
I presume many people had similar scripts to what I had and so eventually in
an attempt to circumvent it, they introduced captchas. Turns out the captchas
didn't actually work.
I know this because my script continued to work for a long time and only a few
months after they introduced captchas (when I visited the website the normal
way to make a booking) did I even know they introduced it. I can only presume
that if you didn't actually submit the 'captcha' form variable then they
didn't bother to validate it. So the irony was that the people booking tickets
the normal way suffered while the rest of us working around the system were
rewarded.
Finally they realized this at some point and threw in the towel and just
banned quick booking altogether from 8-9 because they couldn't figure out any
other way to actually solve this problem. So yeah, I'm probably part of the
reason that happened (though by no means the only one who did this type of
hackery,I'm sure).
~~~
whoahey
I believe the captcha was introduced because travel agents were using VB based
software to automatically book tickets at 8 am using IRCTC.
For the life of me I don't get why IRCTC doesn't use some good load balancing
and improve performance of their mainframe.
~~~
rottenapple87
For one, they are not IT majors in webspace, they are a travel firm. For a
company like Indian railways, they have more important things to do like the
safety of trains and ensure better travel experience than just concentrate on
making the online user experience better.
~~~
Indyan
FYI the website is not developed and maintained by Indian Railways. It's
outsourced to an IT services provider. As far as I recall, TCS, which is an IT
Major, currently has the contract. All the Indian Railways needs to do is have
a couple of competent people, who can supervise the project to ensure quality.
~~~
adisesha
I don't know if TCS still have contract but this company is
<http://www.broadvision.com/en/customers_aeroxchange.php> part of it. When I
tried to get PNR status, I once got this error,
javax.servlet.jsp.JspException: No bean found for attribute key historyDetails
and rest of the stack trace. From stacktrace, they are using struts and
broadvision's some customized servlet container, most likely tomcat.
------
harichinnan
The whole point of having such a weird system is to make it "difficult" for
you to book a ticket. Think about the "common man" standing in a queue for 4-8
hrs trying to book that ticket when you could ideally book using your coolest
newest gadget in seconds. Now that would cause a riot at the railway station
booth. In Indian you never have enough resources available for the 1.3 billion
people. So everything is rationed, including the online train tickets. It's
like the IIT's or IIM's conducting the world's toughest entrance examinations
only to select a statistically insignificant 1% of the applicants. Great
Indian politics demands badly run government services. Private services are
still banned in a number of areas including private universities, public
transportation, power, Aeronautics ....
~~~
mayanksinghal
Actually much of the sectors that you have mentioned have been deregulated:
1\. Private Universities: No. But there are tons of private institutes under
universities.
2\. Public Transport: Trains no. Buses - in most parts of the country (eg.
Madhya Pradesh)
3\. Power: Tata Power, Reliance etc. Coal mining is the part that has not been
privatized, AFAIR.
4\. Aeronautics: No, but airtravel yes. Secondly, the aeronautics industry and
research in India is still at a very nascent stage - so I am not sure if it
really hurts the economy/society.
~~~
seunosewa
Privatization is not deregulation.
------
eli
_Every day from 23:30 to 0:30 the server is down for maintenance. Seriously,
every day? Their server needs maintenance every fucking day? Which technology
are they using?_
A mainframe that does batch processing at night.
~~~
wulfric
They use OpenVMS on Alpha it seems. Look at this:
[http://h71000.www7.hp.com/openvms/brochures/indiarr/indiarr....](http://h71000.www7.hp.com/openvms/brochures/indiarr/indiarr.pdf)
I don't think HP is winning any customers here.
------
Indyan
The IRCTC website was frequently cited as an example of "what not to do"
during the training phase in my company.
Cleartrip on the other hand is a shining example of stuff done right. It's one
of the friendliest websites I have ever used. Don't have an account? No
problem. You can still go ahead and book a ticket, Cleartrip will drop a
gentle reminder to set your password to create an account, _after_ you have
booked your ticket. Forgot your password? Again, no problem. Cleartrip will
allow you to go ahead with the booking, and send the link to reset your
password to your email.
~~~
mayanksinghal
Wait, ClearTrip is actually pretty pathetic in terms of the UI. Try MakeMyTrip
- it is _way_ better.
~~~
Indyan
This might be just a personal preference, but I find Cleartrip's UI to be far
superior to any of its competitors. Btw, I just remembered another good
example of Cleartrip "getting it". I was trying to book a hotel. And due to
messed up internet connection it didn't go through. I think I attempted to
book the same hotel twice or thrice. This was after midnight. The very next
morning I get a call from Cleartrip enquiring if I was facing any issues with
their website, and offering to do the booking over the phone.
------
sidjha
I like how @dcurtis approached a similar problem with his open letter
containing a redesign of the horrific aa.com website:
<http://www.dustincurtis.com/dear_american_airlines.html>
I'm not sure how effective such an approach would be considering it's much
harder to get Indian organizations (especially a Government one, oh boy) to
respond to feedback of the people, but it's definitely worth a try.
As some of us know, Anna Hazare and his stellar campaign against corrupt
politicians in India is an inspiration to get Governments to act.
~~~
potatolicious
It didn't even work that well on this side of the ocean - if I recall
correctly when this redesign first hit the web HN ripped dcurtis a new one.
Without addressing the Indian trains issue at all, there's a common mistake
designers make that particularly annoys me - which is that "clean looking" is
often conflated with "usable". As much as we hate to accept it, there is a
_lot_ of data out there that indicate many _extremely_ busy looking, messy
looking websites out there work very, very well.
------
yaacovtp
I survived backpacking in India using <http://www.cleartrip.com/trains> for
all train reservations.
~~~
blntechie
Seconded. There are multiple third party apps/sites which provides almost all
these functionalities. But my only gripe is that there is no public api im
aware of. You need to put in a request for aceess to train schedules/routes
and other details and i assume you need to pay for that. Or the only option
left is scrapping their site which is against TOS and illegal.
------
dsrikanth
Oh boy that reminds me of all my similar experience with IRCTC. If I need to
book a ticket for a busy weekend, I get my friends at various other locations
to try and book the same. We all stay on conference call and when one person
books it, others stop trying. Usually tickets open for booking at 8:00 am and
the server is literally dead for the next 1 hour.
------
random99
Well, let's just hope that they don't do it like they did in Finland. Good
luck! 1\. [http://www.helsinkitimes.fi/htimes/domestic-
news/general/167...](http://www.helsinkitimes.fi/htimes/domestic-
news/general/16782-part-of-finnish-railways-ticketing-system-tested-in-india-
paper-.html) 2\. <http://www.trainorders.com/discussion/read.php?17,2578324>
------
jrockway
Clearly the solution is to offshore the job to the US.
------
hsshah
The reason is; people who can influence a change (bureaucrats, politicians,
businessmen etc) use intermediaries (agents) to get things done. They never
experience the pain of the "common" people. All government services are like
this.
------
rajeshsundaram
It is so funny, that I've been unlucky with 90% of my cleartrip train ticket
bookings. No I did not mean, failure to book. But it is that, I end up
cancelling those tickets! LOL.
IMO, IRCTC UI with its "just-ok"user experience, has almost all the options
readily available. Whereas, Cleartrip does not. Cleartrip tries to keep things
simple here, but I guess it does not work good for certain areas like
Cancelling the ticket, or filing for TDR etc. Often it takes extra clicks to
refine my train searches.
------
swapsmagic
It's the same experience most of the indian railway travelers have faced
(including me) and so i have put my 2 cent by creating this website which
helps travelers to track their ticket status on mobile/email. site:
<http://www.railpnrstatus.com>
I think as a HN reader you should also think in those line and give ur 2 cents
by improving the system.
------
nakkali_kuere
This is the state of the English language edition, forget about the it in
local language with translator's laziness there actually no word of the local
language used instead the English is just transliterated in the local script.
It might be possible to learn English the same day and read it rather than
trying to read in the local language.
~~~
sateesh
Not sure why you are downvoted here. This is a valid point and it is true that
much of the web content/computer generated content that is available in local
language is obtained using transliteration. Also much worse is that many of
the English words are written in local language as is, where as the actual
need is to translate that word to local language and use it.
------
mmahemoff
I think Transport For London used to be more protective of its data, but
ironically budget cuts meant govt departments like TFL realised they can get
much better leverage by opening up to third-party apps. The creative power of
constraints.
------
chrisbennet
I believe it is interesting and relevant but I'd be more sympathetic to the
author if he hadn't disabled the ability to go back to HN after I read it.
WTF?
------
foobarkid
Why cant they hire ONE decent programmer who can come up with a good design !!
~~~
rottenapple87
Son, It aint easy to scale up a system like that. "ONE" programmer within a
small timescale can never achieve something as scalable as that all by
"himself". I have been using IRCTC since its inception and I see it the user
experience is constantly evolving. Let the product evolve.
~~~
foobarkid
Well.. True that ONE programmer cant scale. But we are not talking here just
about scaling. The way the current site works, I doubt if any one with a
decent programming experience is working on it. The current site is clearly
not user friendly. Takes huge efforts to book a simple ticket and if you
havent experienced being logged out constantly now and then, just cos you did
some thing wrong, I refuse to believe anyone sane is working on the other side
of the website !
------
fungi
sounds like you could hack around much of that with a firefox / chrome
extension.
------
pitdesi
The more interesting and useful thing about this rant is that companies have
come in and done something about this problem and started making money doing
so. Historically you could avoid the lines at Indian railways by using offline
travel agents who charged their commission. A few venture-backed* companies
have brought that model into the 21st century - IRCTC sucks, so they put a
pretty interface on it that doesn't suck and charge 10-20 rupees (25-50 US
cents!) extra per booking:
<http://www.cleartrip.com/trains>, <http://www.makemytrip.com/railways>,
<http://www.yatra.com/trains.html>
Solve a problem like the Indian Government (IRCTC is a government undertaking)
like this and you'll have lots of takers for 10-20 rupees. They offer a better
user interface, saved payment details, a consolidated place for air & rail
bookings and better customer support.
*Cleartrip is funded by Kleiner Perkins, Ram Sriram, and Concur. MakeMyTrip by several top asian funds, and Yatra by Norwest Venture Partners and Intel Capital
~~~
jezclaremurugan
But the dumb government has stopped them from providing full fledged service.
These other sites cannot book "tatkal tickets" from 8:00 - 9:00 AM, after
which there would be no useful tickets anyway. The least Indian Railways can
do is to fully deregulate. So, right now IRCTC is monopoly and that explains
why it is like it is.
~~~
tmbsundar
8-9 Tatkal booking is not allowed in irctc also.
~~~
abhishekdelta
Its not allowed only for Agents, as there have been past incidents when mass
booking is done by agents and normal customers don't get any tickets.
------
geekin
Frankly, I am shocked to see why this story is trending on HN. A college
student ranting about the biggest railways booking system ? really ?
~~~
almost
Why the hate? Its an interesting read. Thinking about and discussing awful
systems like this can help in figuribg out how to better make non-awful
systems.
And why exactly is it relavant that he is a college student?
~~~
geekin
Awful system ? yes, but a massively scaled. think about the scale of the
system. One single backend is serving kiosks at thousands of railway stations,
lakhs of booking counters and several agent terminals. True that there are
downtimes and slowness - but consider this system as a classic usecase and
study of how massive a system can be. The student who wrote this rant just
talks about the downsides and how bad the whole system is. I would appreciate
a few ideas on how he in his great might would do to fix this massive system.
Are there any constructive ideas in this article ? do we learn from this
article ? It is very easy to rant about everything...if you don't like my
views and downvote my comment, you are free to do so.
~~~
almost
Awful is still awful :) And from that description it is a truly awful system.
And saying "if your so great why don't you fix it yourself" is a really stupid
response to criticism. Why be so defensive about a bad system, YOU didn't
write it, right?
~~~
geekin
Well, its beneath me to respond to an ignorant and snide remark. I think the
level of language on HN has gone down a lot
~~~
almost
Oh come on, your originally comment was a nasty little dig at someone for
writing up their experiences and a suggestion that they don't count because
they're "just a college student". You made that comment from a new account so
you either are new here (in which case, what's with the complaining about the
discussion going down hill?) or you where not prepared to stand behind your
comment so used a throw-away account.
I have no idea why you consider the Indian internet rail booking system a
subject above criticism, it just seems bizarre.
------
rottenapple87
This post imho is attracting way too much attention than it actually deserves.
Well IRCTC is the least of the worries about Indian Railways. Well, the
technology they seem to be using is not the best around, but considering their
financial and time limitations, they are trying to put out the best they can.
Best service certainly comes at a greater cost(yes, monetarily) which the govt
is in no luxury to afford and IMHO, they certainly are trying to put out the
best they can. (Just look at the figures the internet majors spend on scaling
up and you'd understand.)
Convenience charges : You sir have to realize that because of IRCTC you need
not waste fuel, stand in huge queues etc. and thus you have to appreciate that
part and pay up the nominal amount. I think they should charge the convenience
charges at least for the next few years, may be because the employees still
have to be paid and can not be asked to quit their jobs even if you do not go
to the reservation counter.
I do accept that Indian Railways being a govt. organization as expected is
corrupt and is not efficient etc, but well its not all that bad.
~~~
foobarkid
This post is attracting way too much attention just for the simple reason that
so many people are pissed off at the service. I refuse to believe that lack of
money is the cause for all this. For all that we know, more than half of funds
are being eaten by politicians.
~~~
miraze
why are blaming "Politicians" for bad UI ...
| {
"pile_set_name": "HackerNews"
} |
Open Source Game Clones - madc
http://osgameclones.com/
======
daeken
Not quite ready to submit this to the list yet, but I've been working on a
Quake 3 engine clone from scratch in C# with Bridge.NET, targeting the browser
and WebGL. It's been a super fun project so far -- a few days of part-time
work and I have levels rendering nearly perfectly and I'm making progress on
character model rendering. Repo is at
[https://github.com/daeken/WebArena](https://github.com/daeken/WebArena) and
you can see a live version at
[http://demoseen.com/bridge/](http://demoseen.com/bridge/)
Still a ton to do, but I'm really digging it.
Edit to add: WASD + Space/Shift + arrows to control the camera.
~~~
westoncb
Awesome! I wrote an MD3 loader/renderer/animator years ago[0] and had a lot of
fun with it—always wanted to try loading the levels as well, though I've yet
to try it. Any comment on how difficult that was in comparison to dealing with
characters? I imagine you are pulling the data from WAD files (err.. does
quake 3 still use those?), and static geometry is in a 3D BSP tree?
[0]
[http://symbolflux.com/statichtml/oldprojects/md3library.html](http://symbolflux.com/statichtml/oldprojects/md3library.html)
(No source or anything available atm—just a screenshot and description, though
I could up it up if anyone were interested.)
~~~
daeken
The actual level loading itself is stupid easy -- I had the geometry loading
and rendering in something like two hours. The tough part is converting their
"shader" model over to something that modern GPUs can understand. That took
about a day and a half and still isn't entirely complete -- I'm missing
environment mapping and vertex deformation.
MD3 has been pretty straightforward on the whole, but I didn't design my mesh
abstraction super well out the gate, so I've mainly been redesigning that and
trying to make it futureproof. I think I have it to about the minimum repeated
code possible at this point, but I'm sure I'll reach some other snag down the
road and have to refactor again!
~~~
westoncb
Interesting—yes, I was wondering about their shader model. I glanced through
your source and saw what looked to me like some of the conversion. In any
case, the shaders you have running so far (I assume they generate the
animations on various objects in the scene) look very nice :) Good luck with
the project!
------
AdmiralAsshat
It would actually be really cool if games officially adopted this kind of
engine-based model that we see in some of the examples, where the "engine"
would be FOSS (meaning it can be ported, modded, improved, etc.), and the
"game" that is sold is the compiled binary blob graphics, assets, scripts,
etc.
In short, I guess it would basically be like selling RPG Maker games or DOOM
wad's, but without the engine itself being proprietary.
~~~
pvg
Isn't UE reasonably close to that already for most practical, if not
ideological purposes?
~~~
AdmiralAsshat
But that only works if Unity open sources the engine. A _ubiquitous_ engine is
not the same as an open engine. The fact that we now have jDoom, Doomsday, and
other enhancements to the engine that let us play Doom, Doom2, Hexen, Heretic,
etc. only work because id software released the source code. Otherwise, it
would be like any other proprietary engine, and we'd have to reverse-engineer
it if we want to be able to play those games again.
I'm sure you could argue that Unity is currently more cross-platform than
engines were 10-20 years ago and already works on
Mac/Win/Linux/Android/whatever, but we can't guarantee it will be around in 20
years.
~~~
mintplant
UE is Unreal Engine, not Unity. Presumably Unreal Engine 4, which gives full
source access to anyone who agrees to their EULA and takes patches through
GitHub.
------
kiddico
You missed the best clone of them all :P
[https://github.com/raxod502/TerrariaClone](https://github.com/raxod502/TerrariaClone)
~~~
salqadri
Just submit a PR to
[https://github.com/piranha/osgameclones/](https://github.com/piranha/osgameclones/)
~~~
katastic
It's not a real game. It's a project online to show all the bad code the guy
wrote when he was a young coder.
~~~
salqadri
Lol oh ok
~~~
kiddico
Sorry, I wasn't trying to cause confusion!
------
throwaway2016a
This is an awesome list.
I know there are many programmers that spend long hours recreating games they
like in open source. But are there artists doing the same? It would be great
if many of these projects that require a copy of the original game for the
assets could get contributions from artists willing to make open source skins
/ texture packs as well.
~~~
cr0sh
Yes: [https://opengameart.org/](https://opengameart.org/)
~~~
throwaway2016a
Thanks for the link. This looks really cool.
------
hutzlibu
Those projects are good, but I think it is a bit sad, that the open source
movement allmost only manages to produce clones of games and not a new one.
Well, let's see, if I can change that one day ... lot's of ideas, but not the
time, nor money at the moment. Common problem, I suppose ;)
~~~
krapp
To be fair, creating a new game that's _good_ takes a lot more talent across a
lot more domains of expertise than your average FOSS hacker might appreciate.
The code is just one part of it - you've got art, music, level design, story
possibly, it can be as complicated as making a movie.
Cloning an existing game is easier.
~~~
lloeki
If people want to try their hand at it, I recommend them to try to participate
in game jam warm-ups, such as MiniLD[0] for Ludum Dare. Getting your feet wet
gives quite some hint at the scope of things you have to handle.
[0]: [http://ludumdare.com/compo/minild/](http://ludumdare.com/compo/minild/)
------
salqadri
This is an amazing list; thanks a lot for sharing! Here is a link to the
underlying github repo where people can contribute to that list:
[https://github.com/piranha/osgameclones/](https://github.com/piranha/osgameclones/)
------
thriftwy
There's this best game ever, Master of Magic, which countless people tried to
rewrite over but nobody ever got anywhere. Even in this list.
Of these, Star Control (Ur-Quan Masters) is also one of the best games with
tear-dropping story which I also recommend highly. The open-source port is of
excellent quality.
------
soared
This is a good example of when a site with a lot of images would actually be
helpful - I could use some thumbnails! ('go submit a pr then')
------
microcolonel
I didn't know that Allegiance was switched to an MIT license from Shared
Source, that's awesome! I've not been running Windows natively on a computer
for some years now, and I kinda miss playing Free Allegiance with easily 200
players in a single game, so hopefully under the new license it's more likely
to be ported off of Direct3D, and then perhaps off of Windows dependence. I'm
probably not going to be the one to do it though, so maybe it'll never happen.
------
indescions_2017
Great list!
If we were to start an archival project to preserve some of these classics for
posterity, it seems there are a couple of techniques. Internet Archive's
strategy of collecting (public domain?) ROMs and exposing via JSMAME. Use an
open clone as reference and then port again to WebGL. Or for games ported to
SDL perhaps re-compile via Emscripten to Javascript.
HTML5 and browsers are becoming performant enough. Is there some other
portable emulator that might be a better target?
~~~
conradev
libretro is pretty cool:
[https://www.libretro.com/index.php/mission/](https://www.libretro.com/index.php/mission/)
------
fritzy
I should submit [https://spacewar.pro](https://spacewar.pro) as a clone of DOS
SPACEWAR
------
erikb
Really nice, but out of date it seems. A lot of the links don't work and
sometimes good alternatives aren't mentioned.
------
dimman
There’s one engine missing in that list, and it’s pretty advanced:
[http://fte.triptohell.info](http://fte.triptohell.info)
Supports a lot of the Quake based games (started out as a QW engine but is
much more today).
Had Vulkan support way earlier than vkQuake came to be. Spike, the basically
single developer behind it is really talented.
------
itomato
I'd like to see an open, multiplatform clone of Subspace.
We've had a reverse-engineered server for some time:
[https://bitbucket.org/grelminar/asss](https://bitbucket.org/grelminar/asss)
------
kzrdude
RTTR for a Settlers II remake is really good (but requires original graphics
files).
------
vog
If you didn't play it, and are into puzzle games, I strongly recommend you to
try the Pushover reimplementation. I loved that one back in the DOS times, and
the free clone contains may additional levels.
------
rodolphoarruda
How do I know which of these could be played in Ubuntu?
------
VikingCoder
I'd love it if someone made a Visual Studio Solution that correctly built as
many of these as possible.
------
axonic
I stumbled upon this when searching for examples of successful open source
games. Great list, thanks for this.
------
emodendroket
It's always seemed funny to me that there aren't a million Fantavision clones.
------
dmm
You include several clones built on Unity. These are not open source.
~~~
derefr
Is a game "not open source" if all the business-logic code and game assets are
open-source, but it relies on a closed-source engine (that it doesn't ship
with)?
Doesn't seem much different to me to e.g. writing an open-source game that
uses DirectX. DirectX is not, itself, open-source, but it's not really "part
of" the game. The game just uses its API; and could equivalently use anything
else with the same API (like the DirectX implementation in Wine.)
~~~
throwaway2016a
A purist would say that an open source game should use OpenGL. But I generally
agree. Unity is free to download so there is no monetary barrier to compiling
these games. So it's not free from a GNU sense of the word but it is free
money wise and the gameplay parts are open source.
~~~
derefr
That's not even so much what I meant. The "game" isn't the engine; and so the
"game" _is_ open source. You're free to modify and redistribute everything
that constitutes the game. To _play_ the game, you need the game engine,
similar to how running a program requires a machine (real or virtual) with a
compatible ISA. But there's nothing forcing you to use a closed-source
implementation of the game engine. If an open-source implementation of the
engine doesn't exist, you're always free to write one.
Nobody ever says that a program being written for closed-source _hardware_
necessarily implies that the program can't be open source. Because, of course,
you can just write your own open VM for that same hardware. Saying that e.g.
Gameboy Advance home-brew is all closed source, because the reference
implementation of the hardware is closed source, is nonsensical. People are
free to write, modify, and run GBA home-brew. Doing the last one just requires
an emulator for most people, which is an everyday tool for programmers (given
that many languages target _abstract machines_ like the JVM or Erlang's BEAM,
where the resulting bytecode ISA is _only_ reified as an emulator.)
~~~
rekado
> If an open-source implementation of the engine doesn't exist, you're always
> free to write one.
This is a very strange interpretation.
When a piece of software that is released under a free license has a crucial
non-free dependency, it is effectively non-free. As the software only works
with the non-free dependency, but that dependency cannot be conveyed along
with the free part, the whole thing cannot legally be distributed and thus is
non-free.
~~~
derefr
The reason I take that view, is that the ability to _use_ the software isn't
actually a part of what makes software open source! As long as people have all
the code, and can modify it, and can redistribute their modifications, the
code is open-source... whether or not you can run it.
Consider: there are also hardware platforms that have effectively ceased to
exist over the years. If you wrote a program for one of these platforms, and
it was open-source, would you now consider the program closed-source,
because—given that the platform hardware doesn't exist any more—you can't run
the software any more?
No. Why not? Because open source is about the source, not about the binary.
The source is a product in its own right, and valuable in its own right,
whether or not it can be compiled into a working program.
~~~
khedoros1
> Why not? Because open source is about the source, not about the binary.
If you have the platform and the source, but you can't run the program, then I
wouldn't consider it "open source". At least not in the usual sense of FOSS.
It's not just about the source; it's about the freedom to study and modify the
source, produce improved versions of the original binary, and distribute that
binary and the source that created it.
The division between game and platform is lower in the stack than the engine.
> The source is a product in its own right, and valuable in its own right,
> whether or not it can be compiled into a working program.
I agree with that statement, but it's a different argument than you were
making before.
~~~
hacking_again
And you won't get far with source modifications if you can't run the program.
| {
"pile_set_name": "HackerNews"
} |
Ask HN: Have you noticed this peculiarity on vending machines? - glaberficken
[advance apologies for the trivial nature of this post. Hope it finds a fit on your Saturday =]<p>A vending machine at my workplace has a 10 item row with water bottles (all same brand and label) numbered in the range [51-60].<p>As is customary in current vending machines you select the item by entering a double digit number on a keypad.<p>When I'm buying water I always select item number 55 (because I find it more convenient to just press the same button twice without looking than typing any of the other options that have 2 different digits).<p>Surprise, surprise, item 55 is always the first one to sell out on that row. Which means most people also do the same convenience trick as me.<p>Have you noticed any similar "hidden" patterns like this one?
======
superflit
In Brazil vote is not a right but "mandatory" -> Quotes mean..double speaking.
If you don't vote you have to pay fees, cannot work on the public sector or
get a passport.
So it is very common for the candidates with number 12345 being elected[1].
Or the ones with 123,111 [2] [3]
Even Business companies try to make "easier" for you to remember their number.
[1] -
[https://pt.wikipedia.org/wiki/Elei%C3%A7%C3%B5es_distritais_...](https://pt.wikipedia.org/wiki/Elei%C3%A7%C3%B5es_distritais_no_Distrito_Federal_em_2018)
[2] -
[https://pt.wikipedia.org/wiki/Elei%C3%A7%C3%B5es_distritais_...](https://pt.wikipedia.org/wiki/Elei%C3%A7%C3%B5es_distritais_no_Distrito_Federal_em_2014)
[3] -
[https://pt.wikipedia.org/wiki/Elei%C3%A7%C3%B5es_estaduais_n...](https://pt.wikipedia.org/wiki/Elei%C3%A7%C3%B5es_estaduais_no_Rio_Grande_do_Sul_em_2014)
~~~
maerF0x0
I'm surprised the candidates are not randomised on the ballots?
~~~
facorreia
There are many parties; each party has a double-digit number; candidate
numbers start with their party number. You can even just enter the 2 digits to
vote on the party's candidate list instead of on individual candidates.
------
throwlaplace
this pattern is mostly coincidental i think but you might be interested in
benford's law
[https://en.wikipedia.org/wiki/Benford%27s_law](https://en.wikipedia.org/wiki/Benford%27s_law)
which is an observation about scale invariant quantities
[https://en.wikipedia.org/wiki/Benford%27s_law#Scale_invarian...](https://en.wikipedia.org/wiki/Benford%27s_law#Scale_invariance)
------
tanseydavid
Reminds me a little bit of the chapter "Candy Machine Interfaces" from Steve
Maguire's book "Writing Solid Code"
------
pouta
My University has the water bottles at the same number range and the first one
to be sold out is always 55.
I usually pick 51, no idea why.
------
maxrf
[https://en.wikipedia.org/wiki/Nudge_theory](https://en.wikipedia.org/wiki/Nudge_theory)
------
jasonhansel
Reminds me of: [https://www.xkcd.com/1103/](https://www.xkcd.com/1103/)
| {
"pile_set_name": "HackerNews"
} |
A writer leaves Microsoft Word - gw666
http://stevenpoole.net/blog/goodbye-cruel-word/
======
latch
I know this is in a different league..but I wrote Foundations of Programming
in Word, and then The Little MongoDB Book in Markdown + Textile (in Textmate).
Writing in Markdown was a much more liberating experience as it was much
quicker and let me focus more on the content rather than the document.
I've always really liked Word, it's a great product, but for 99% of people it
just does way too much and is thus way too expensive. Office is worse...gmail
is better than outlook, anything is better than powerpoint or access.
My last two jobs have shown me that Excel is really what you need to kill if
you want to break the Office stronghold.
~~~
dereg
You're right about Excel. It is the corporate behemoth that may never be
slayed.
I'm thinking of getting a Mac, but can the Mac version of Excel do keyboard
shortcuts like on Windows? (E.g. "alt, o, h, r" to rename a sheet, or "alt, i,
w" to insert a sheet). From my experience, it doesn't. Losing shortcuts would
put a heavy drag on my productivity.
~~~
2arrs2ells
Excel is 99% of the reason I run virtualized windows.
~~~
pstephens
Excel's basic math errors are 99% of the reason I do my stats with python.
~~~
Volpe
Care to elaborate?
~~~
tedunangst
[http://blogs.office.com/b/microsoft-
excel/archive/2007/09/25...](http://blogs.office.com/b/microsoft-
excel/archive/2007/09/25/calculation-issue-update.aspx)
~~~
SoftwareMaven
That's not a math error, that's a display error. I'm no fan of Office, but
that would not be a reason to fear Excel's ability to calculate correctly.
~~~
nitrogen
During the whole OOXML debacle, there were many examples discovered of
ambiguous or flat-out wrong behavior in various versions of Excel over the
years, the kind of wrong behavior that could easily have altered the outcome
of financial transactions that were managed using spreadsheets. You can
probably find some if you hunt for them on Groklaw. I seem to remember one
related to a date basis parameter, so that might be a good first keyword set
to try.
~~~
chokma
Rob Weir has pointed out a lot of OOXML-problems over the years:
<http://www.robweir.com/blog/2007/07/formula-for-failure.html>
[http://www.robweir.com/blog/2008/05/fractured-yearfrac-
and-d...](http://www.robweir.com/blog/2008/05/fractured-yearfrac-and-
discounted-disc.html)
------
cstross
TL;DR -- another book-writer discovers the thing of beauty that is Scrivener.
I've written one book 100% in it, and used it to refactor three others (when
their multiple plot threads were threatening to get out of hand). It's not
that it does anything magical at the _word processing_ level, but it makes the
structure of a book-length work transparent.
(If you don't write books for a living, the best metaphor I can give you is
this: imagine you've been writing code for years using just a text editor. (If
your editor is Emacs, congratulations: that's the MS Word of text editors --
kitchen sink included, but not everything ideally placed unless you do a lot
of customization.) Then someone shows you an IDE. That's Scrivener: it's
basically an IDE for books.)
~~~
irahul
> If your editor is Emacs, congratulations: that's the MS Word of text editors
> -- kitchen sink included, but not everything ideally placed unless you do a
> lot of customization.) Then someone shows you an IDE.
That analogy doesn't stand at all. Most of the people whose _editor of choice_
is Emacs(mine is Vim) have known about IDEs all along, have used them at some
point of time, or may be still use it for languages which are too verbose to
do without IDE code generation. They chose not to use it, or use it sparcely.
There is no _someone showing you an IDE_.
~~~
singular
The beauty of emacs/vim is that they are a. highly optimised to enable quick
editing of _any_ text document, not just a specific subset of languages, and
b. highly customisable - the customisation isn't an annoying overhead, rather
it lets you define exactly how you want the environment to be whereas an ide
tends to be harder to customise to that degree.
Horses for courses.
As an aside - I think the analogy fails purely in terms of quality, word is a
horrible mess and a nightmare to work with, emacs is a (sometimes clunky)
thing of beauty.
------
jseliger
Ah: I wish I could leave Word for good. But my family's business does grant
writing for nonprofit and public agencies (see <http://blog.seliger.com> if
you're curious), which means we routinely have to exchange documents with
other people. In that world, Word still rules, especially for complexly
formatted documents.
~~~
yariang
How so? You can open Word docs in LibreOffice and save them as well...
~~~
russellallen
Every day I open, edit and share legal contracts and other Word documents.
They're usually up to about 120 pages long, with reasonably simply formatting.
They usually have marked up changes from about 2 to a dozen people.
Every six months or so I check out OpenOffice/LibreOffice to see whether the
documents I'm being sent survive the open/edit/save cycle.
Every time so far I end up with a document with widely differing formatting
from the original.
So at least for me, LibreOffice isn't suitable for my usage patterns.
I imagine other people are the same.
~~~
jseliger
This.
In addition, many funders require that submitted proposals be .doc files.
Sure, one could play roulette with other programs, but when thousands to
millions of dollars are on the line, it's easier to simply use Word.
~~~
billybob
Is there any good reason for this requirement, or is it just inertia?
If I'm submitting something read-only, PDF seems like the obvious choice. If
you're going to edit it, maybe .doc is the solution, but really, Google Docs
would make collaboration easier.
What does a Word file have that other solutions don't, other than mindshare?
------
jrico
Word is still a great Word processor. It actually has a full screen mode that
eliminates all the distractions just as the programs used by the author.
Word's biggest problem is that all its power increases its complexity and
there really isn't a good user manual or resource to train people. I find that
most people that switch to something like GoogleDocs don't use the advanced
features of Word and probably would have been just as happy using WordPad.
~~~
slowpoke
What would be 'advanced features' of Word that are neither completely
unnecessary nor could be replaced by (more or less) simple LaTeX macros?
I'm actually curious - I've heard a lot of people raving about the 'power of
MS Word', yet no one was really able to name any meaningful features that
would justify calling it 'powerful'.
~~~
tincholio
I use LaTeX for most of my writing, and I'm not a big fan of Word. That being
said, I think the advantage probably is that it significantly lowers the
barrier of entry to those advanced features. Hence, you'll get 'secretaries'
doing fancy stuff, who might not be otherwise inclined to learn LaTeX (and
let's admit it, writing TeX macros is not particularly nice).
~~~
slowpoke
I have to admit I haven't learned LaTeX myself yet, but I've been using LyX
for a while now, which basically spits out compilable TeX. Processors like LyX
(are there even any processors like it?) take care of exactly that barrier of
entry.
I agree fully that advanced features in LaTeX are most likely more difficult
to learn, but if the argument in the first place is the 'power' of the
features, then LaTeX will win out regardless. It's like comparing vim/emacs to
nano (in terms of 'power').
------
onedognight
Emacs users intrigued by the idea of an always centered cursor might like to
try this mode out. <http://www.emacswiki.org/emacs/centered-cursor-mode.el>
~~~
kleiba
On a similar note, I'm always a bit amused whenever WriteRoom gets lots of
praise, because it's actually not so much different from good old Emacs
running in a terminal (no X). Back to the future!
~~~
shabble
I've not used WriteRoom, so I don't know just how configurable it is, but I
often find myself in Emacs getting distracted from my original task by
accidentally discovering new features, or deciding to automate something in
elisp.
_"The art of spending 3 hours to complete a 1 hour job in 5 minutes"_
And this is after using it for nearly a decade already :)
~~~
tincholio
Don't worry... it'll pay off in only three times using it :)
------
mathattack
Two interesting thoughts here, that are general to application development.
1 - The reason Windows lost it's way was a lack of simplicity. This is a broad
comment about software in general. It is tough to be everything for everyone.
And most software starts this way.
2 - There was a great line hidden in the footnotes. This speaks to the
importance of collaboration amongst great programmers.
"As Scrivener’s creator relates, he emailed Jesse Grosjean, Writeroom’s
author, wondering how he did the block-cursor thing; very generously, Grosjean
just gave him the code, and even recommends Scrivener on his own website."
Very good read!
------
icebraining
For a person working alone, the question of the format is largely irrelevant -
Word support saving in plain text too. The problems exists when we need to
interact with open people, and most of us can't tell them "What the fuck".
~~~
tomjen3
Most people wouldn't know what a .doc file is if their lives depended on it.
So take advantage of it and send them a .rtf file -- nobody has to know and
you get excellent compatibility.
~~~
roel_v
But only for very simple documents - no cross references, working image
formatting/layouting, watermarking, shabby table support, footnotes, embedded
styles, ...
------
sixothree
>WriteRoom has a “typewriter-scrolling mode”, so that the line you are typing
is always centered in the screen, not forever threatening to drop off the
bottom...
That's the one thing I hate most about every modern editor: When I page down,
my cursor appears at the bottom of a page I can't even see. What the hell is
that?
------
mrcharles
I used Scrivener to write my 2010 Nanowrimo entry. It's a great piece of
software, and I can't recommend it enough.
~~~
jseliger
I'm not sure it will be useful to most people, for reasons tangentially
related to this post: [http://jseliger.com/2010/11/12/scrivener-or-devonthink-
pro-w...](http://jseliger.com/2010/11/12/scrivener-or-devonthink-pro-with-a-
side-of-james-joyces-ulysses) on Scrivener and Joyce.
The main reason I say is because I think a lot of people, based on the amateur
writing I've seen, don't need a fancier way of arranging words so much as they
need to focus on 1) the quality of their sentences and 2) how one event drives
another in their plots. I worry especially regarding point 2) that Scrivener
lets people work in parallel when they should be working in serial, with one
event driving another organically. Too much amateur writing I see is, for lack
of a better term, plotless: meandering around feelings, or random encounters,
or designed to show how _deep_ the author is—instead of telling a story.
Scrivener will help with some things, as I've written elsewhere, but I'm not
sure it's really enough for the vast majority of what writers and would-be
writers are working on.
~~~
officemonkey
In other words:
If you want to be a good writer, concentrate on your craft instead of your
tools.
~~~
InclinedPlane
This is a silly dichotomy. A craftsman's skill lies in using his tools, so
tool choice is important. it's important for a chef to have a high quality
knife that they feel comfortable using, but a high quality knife will no more
make a person a good chef than a good text editor, build and language tools,
etc. will make someone a good programmer. But good programmers, like good
chefs or good writers, will nevertheless spend a goodly amount of money and
effort ensuring they have the highest quality tools they feel they need.
~~~
visural
I think the more important tools in this case though are language, grammar,
and punctuation.
~~~
jseliger
Agreed. In the case of computer tools, I think the difference between someone
productive using Word and someone using Scrivener is going to be pretty small
in most instances. For the novel I'm working on now, multiple people are
speaking (like Tom Perrotta's Election or Anita Shreve's Testimony), for which
Scrivener is pretty useful. But for anything else I've written, I don't think
Scrivener would've been a huge advantage. I'm not even sure it would've been a
small advantage.
Still, if you're curious about this sort of thing, I wrote in more depth about
it here: [http://jseliger.com/2011/08/11/how-to-be-a-faster-writer-
don...](http://jseliger.com/2011/08/11/how-to-be-a-faster-writer-dont) .
------
siphr
I can honestly recommend Scrivener for both technical and non-technical
writing. I use that application regularly and have nothing but respect for the
developer. From an engineering point of view, it is a great example that
demonstrates the developer's understanding of the problem domain. Little
things that make all the difference.
------
gallerytungsten
re: "Many people agree that revision 5.1a, specifically, was the best version
of Word that Microsoft has ever shipped."
Fortunately, my Ancient Powerbook still runs version 5.1. Eminently usable,
and far less annoying than the Office 2008 version. Among other travesties,
the current version will often refuse to select a single word, obstinately
selecting another word, next to the word you want to select (and delete) and
thus deprecating one's deletion experience to repeated tapping of the Delete
key.
As a side benefit, the Powerbook won't load almost all web sites, thus
removing one obvious procrastination temptation.
~~~
epochwolf
alt + delete doesn't work?
~~~
gallerytungsten
Ahhh! I wasn't aware of that shortcut, thanks. But the selection snafu
remains. Blast you, Office 2008!
(Note: that's option + delete for Mac.)
------
fiddly_bits
The author really sets his screen to yellow text on a black background? Makes
my eyes tired just thinking about it. Anywayz... on a Mac you can flip the
colors of your monitor by holding down ctrl-option-command and pressing 8, if
you like that sort of thing.
~~~
_frog
Or even better, use something like Flux[1] to subdue the tones of that glaring
white screen just enough to reduce eye strain.
[1]: <http://stereopsis.com/flux/>
~~~
airlabam
Oh wow, thanks for this one. Immediately noticed a reduction in eyestrain. If
you're found the GUI buggy (as I did), try the command line interface (xflux).
The CLI app works fine for me.
~~~
mitchty
I need to try out the linux version of flux, but the mac version is seriously
awesome.
Has helped fix me off of getting off the computer at night with the
color/gamma changes.
~~~
rtg
F.lux is indispensable on Mac and PC (when I still had a PC.) Absolutely
required if you code at all during evening/nighttime.
Unfortunately I couldn't get it to work* on my Ubuntu box and found another
app, Redshift, that seems to jive better with Linux:
<http://jonls.dk/redshift/>
\-----
* Ran without errors, but didn't tint my screen. I chalked it up to oddities of video card drivers on Linux.
------
mark_l_watson
Nice article - I downloaded a trial copy of Scrivener to try tomorrow.
A couple of years ago, Apress wanted Word files and I discovered Pages: really
pretty good, good Word compatibility, and fun enough to use.
That said, I really prefer Latex for writing because I spend a very small
amount of time thinking about formatting compared to writing.
------
adamokane
Funny timing for this - a few hours ago, I decided I needed more of a minimal
word processor (although I'm not going as far to delete Word.) I stumbled
across WriteMonkey (<http://writemonkey.com/>) and so far, I love it.
Note: this only runs on Windows
~~~
_frog
I found parts of WM like the giant context menu with icons for every entry,
ability to enable typewriter noises and other little features detracted from
the overall experience but it's still a solid app.
Since switching to OS X I've used Byword but recently tried out iA Writer and
am considering a purchase.
~~~
bahman2000
iA Writer is great! <http://www.informationarchitects.jp/en/ia-writer-for-
mac/>
------
PeterMcCanney
...and another starts to use it <http://www.warrenellis.com/?p=13077>
------
inflatablenerd
I do everything besides screenplays in plain text. Compatibility wins here.
Between Google Docs, Word 2010, Word for Mac, Pages and Open Office, it seems
even basic documents get mangled. RTF is only reasonably better.
------
flocial
MS Word's greatest sin is mixing up content and layout into a strange binary
format. Whether it was a devious scheme to lock in users or bad design is
anyone's guess but it sure crashed a lot when uou mixed tables and diagrams.
Formatting was a nightmare too and sometimes the changes were irreversible. I
wish I saw the light and went with plaintext/markdown earlier.
~~~
shriphani
About the binary file format :
<http://www.joelonsoftware.com/items/2008/02/19.html>
I'll let you set your own opinions.
------
agavin
Scrivener blows the pants off of monolithic WPs like Word for large structured
writing (books or longer articles). I have a pretty detailed analysis on my
blog as to why:
<http://all-things-andy-gavin.com/2011/02/25/scrivener/>
------
jbuzbee
I too had been using MS Word for years to write the various articles and
reviews that I do. But for my last article
([http://www.smallcloudbuilder.com/apps/articles/410-crossing-...](http://www.smallcloudbuilder.com/apps/articles/410-crossing-
the-chasm-converting-an-iphone-app-to-android)) I switched over to Google
Docs. For my use, it worked fine. The feature I missed most was the live word
count that like the author, I had come to depend on when writing articles of a
designated length. Google, are you listening? :-)
~~~
redCashion
You can extend the functionality of google apps using apps script. I thought
it was already in use and there were libraries of extensions, but I don't see
any. But I'm guessing they will be coming soon..
------
snoozer
Number one deterrent to me using Word: no support for emacs navigation
keystrokes, which are near-universal on the Mac. I don't use actual emacs, but
I've come to rely heavily on those keystrokes.
~~~
ordinary
I have never tried this, but apparently you can set key binds in Word. See:
[http://emacsblog.org/2007/02/18/emacs-key-bindings-in-ms-
wor...](http://emacsblog.org/2007/02/18/emacs-key-bindings-in-ms-word/)
------
starwed
Apparently Steve Brust writes using emacs.
[http://dreamcafe.com/words/2009/04/11/help-us-dr-internet-
em...](http://dreamcafe.com/words/2009/04/11/help-us-dr-internet-emacs-
edition/)
~~~
yariang
I was going to suggest this. Religious themes and issues of learning curve
aside, I find emacs is the perfect text-editor for my needs. (Emphasis on _my_
needs).
I have disabled the scrollbar, menubar, and toolbar. Full screen it and you
have black and white. Nothing else. Combine that with some really great text
manipulation features/shorcuts and you have an awesome text editor for
anything you want.
And it can even do spell-checking and all that other fancy stuff.
As for the whole "what about sending documents to non techies" issue: It
doesn't seem to apply for this article since he can write the whole thing in
emacs and then send the final copy to his editor after copying and pasting
into Word.
~~~
shabble
copy & pasting only works if you don't have any markup to transfer.
There's usually some intermediate format that you could, say, write in Emacs
and use markdown or asciidoc or latex, compile to html or rtf or whatever, and
then import into Word.
------
bergie
The mention about the Psion PDA is spot on. I also used to do a lot of writing
with those in the 90s. Relatively small device, almost laptop-quality
keyboard, and battery life of several days with AAs that you could buy
anywhere.
I haven't seen devices like that in last ten years or so. Undistracted, small,
great text input.
Back then I'd connect the Psion with infrared to my cell phone to FTP stuff to
our processing system that would eventually convert the document format on the
device to HTML and post it online.
------
brohee
"Eventually the Psion broke, and nothing as good has replaced it as an
ultramobile writing tool. So much for progress."
There is definitely a market for a device with a Psion quality keyboard and
maybe an e-ink based screen (not sure they can react fast enough to feel
snappy actually...) It would make a top notch writing platform... Smartphone
keyboards are a joke when they have one and e-reader are even worse...
------
AlexC04
<http://celtx.com/index.html> is a very good, free and open source writing
package that may be of interest to anyone who wants good writing software.
It has a lot of that sort of index-card functionality like in Scrivener.
It's often listed as a competitor for final draft (the screenplay software).
It's been built for Windows, Mac and Linux
------
jarin
This might be taking a step back toward fluff from programs like WriteRoom,
but I really like typing up blog posts with OmmWriter:
<http://www.ommwriter.com/en/>
It's just relaxing.
Edit: The site makes it look like it's only for iPad at first glance, but it's
also available for Mac/PC
------
vangale
Anyone else fondly remember Interleaf? I now have a love/hate relationship
with OOWriter but expect I would pay a lot for a working clone of Interleaf on
Linux. I used it both on Apollo workstations and on PCDOS.
~~~
cicero
I used Interleaf on a VaxStation in the late 1980s. It was great at handling
the huge (thousands of pages) government documents we had to produce.
------
Gaussian
Love it. He had me at: "Scoured of Word, my computers feel clean, refreshed,
relieved of a hideous and malign burden."
Could have walked into the sunset right there. But I understand his need to
fully skewer MSFT.
------
PelCasandra
I really like the simplicity idea behind WriteRoom.
I think it would be great for this kind of apps to auto-save directly to
Evernote API or iCloud instead of the file disk.
------
nhangen
Pages has full screen writing mode, can open doc, and can export in doc and/or
PDF. I never understood why it wasn't more popular than.
~~~
andfarm
Pages' full-screen mode is relatively new -- as far as I'm aware, it wasn't
added until the Lion update. Scrivener et. al. have had the market to
themselves up until now.
That being said, the fullscreen mode in Pages actually seems like a pretty
nice compromise between features and non-distraction. Apple's obviously been
taking some notes. :)
~~~
nhangen
Not sure when it was introduced, but I know I had it with iWork 2009 on Snow
Leopard.
------
watmough
I started getting annoyed with Word when it couldn't even force the caret to
black when typing. Watch your caret, it's flashing, now type and it stays
black.
If a "Word Processor" can't even manage such a basic thing, it's lost the
plot. I think this was likely Word 6.0 that did this, and was also about where
they brought the Mac and PC code-bases into alignment, though others may know
better.
Word 2.0 on Windows is for sure my favorite PC version, after the 'just right'
Word 5.1 on the Mac.
------
rbanffy
It can be totally irrelevant to this discussion, but I think the screenshot is
from Word 6. 5, IIRC, had flat controls.
~~~
rbanffy
This is how I remember it:
[http://school.anhb.uwa.edu.au/personalpages/kwessen/web/soft...](http://school.anhb.uwa.edu.au/personalpages/kwessen/web/software/mac/word5.gif)
Guess I'll have to fire my Mac SE (and the Word 5 disks) to be sure...
------
gcb
So, people are writing adverts* for discovering full screen editors?
c'mon, i remember my editors of choice doing that since the late 80s. even
under windows. under linux it's not even fair play to mention this.
Those people will have their heads blow away when the find out that /modern/
text-editors not only have full screen but better way to navigate the text and
perform auto correction. ...just let them catch up with the progress made on
the 90s. heck, vim can have word count on the status bar since what? the 70s?
* i consider the article to be an advertisement for the mac editor, even if unintentional
~~~
X-Istence
WriteRoom uses a standard Mac OS X text field IIRC, and as such uses Mac OS
X's built-in auto correction and spell check...
~~~
gcb
exactly my point. the guy makes a living writing, and never bothered to look
for better text editors.
he is chanting about the progress of default text editors when all that was
available from day one of his career.
it's like a developer with 30yr of experience just finding out version control
------
aboodman
The design of this website is uncomfortably close to Khoi Vinh's
subtraction.com.
~~~
spoole
<http://stevenpoole.net/colophon/>
~~~
aboodman
Thanks. I did actually look for something like this, but I was looking for it
under 'about'.
I still personally think the resemblance (not just the monochrome, but the
overall look - the layout, the individual entries, the top nav, the bottom
nav) is pushing the limits of good taste, but oh well.
| {
"pile_set_name": "HackerNews"
} |
WordPress Core is Secure - austingunter
http://wpengine.com/2013/05/wordpress-core-is-secure-stop-telling-people-otherwise/
It’s time to clear up the debate once and for all. Despite all the doubts (and some haters), WordPress core, is without a doubt one of the most incredibly secure platforms you can choose to put a site on.
======
carbocation
Fundamentally, "X is secure" has no meaning (to me, a non-expert in any
security field). If it's a term of art, so be it, but make it clear you're
using it as a term of art. In the absence of that, I think "X is secure" only
makes sense in comparison to other things, not as a standalone statement.
What is Wordpress as secure as? This is a flabbergastingly empirical question
that could be tackled on different fronts. It hinges on which way(s) you
define security.
Is security based on the number of users of your application? (I would dismiss
that outright, but the author uses it as evidence.)
Is security based on the number of publicly disclosed vulnerabilities as
compared to competitors?
Is security based on some formally-definable metric that can be created by
examination of the code itself?
Is security based on some financial guarantee from the backers of an
application?
In the end, I understand that this is a puff piece and so I shouldn't read too
much into the article. But _saying "X is secure" actually doesn't make it so._
(Note that I'm not saying that I think WP is or is not insecure; I just don't
feel any better qualified to make that assessment after reading this article.)
~~~
dotBen
I'm curious, what the answers to the comparisons you mentioned would make you
conclude positively in WordPress's favor?
_Is security based on the number of users of your application?_
1 in 6 websites on the Internet runs WordPress.
_Is security based on the number of publicly disclosed vulnerabilities as
compared to competitors?_
It's open source code so every discovered vulnerability is public knowledge.
Many competitors are closed source and may not disclose vulnerabilities
(doesn't mean there aren't any). On this point, I'm not sure what could be
improved on given it's FOSS or what "winning" would look like.
_Is security based on some formally-definable metric that can be created by
examination of the code itself?_
If you can come up with the metric, I'm sure it can given the code is FOSS.
Perhaps I don't follow what you're looking for here.
_Is security based on some financial guarantee from the backers of an
application?_
It's Free Open Source Software, no FOSS I know of has a financial guarantee by
its very nature. Examples like RHEL are not free (as in beer). The guarantee
of FOSS comes from the degree of sunshine placed upon the code that everyone
has an aligned interest to disclose vulnerabilities.
Perhaps you could elaborate on what would make you feel "X is secure"?
~~~
wglb
_It's open source code so every discovered vulnerability is public knowledge._
Well, there is public knowledge, and there is actual action. Several examples
come to mind. OpenSSL, which has been available for a very long time, does not
have that good a track record. There is the example of 10-year old
vulnerabilities disclosed in TOSSA that only recently came to light. The BEAST
attack's underlying target was written about before.
From the point of view of labeling anything to be "secure" (whatever that
means), I like to think what Steve Brown used to say about some new output
from his science lab: "Not known not to work". Translated to the security
world, "Not known to have security vulnerabilities."
------
tptacek
If you say so.
Everyone else: if you can avoid it, don't run Wordpress. You can run a safe
Wordpress site, but you do it the same way you drive fast without a seatbelt:
by playing the odds.
~~~
jiggy2011
What do you recommend instead?
Build a custom CMS for your website, on the basis that even though you
probably won't do a better job than wordpress in terms of security you will be
obscure enough that nobody will bother you?
I've actually done this in the past with no (known) compromises on something
that I'm sure I could pay a smart teenager who watched a few defcon talks to
rip apart in an few hours.
Or is there some platform you would recommend that is inherently more secure
by design? Like an OpenBSD of the CMS world.
~~~
tptacek
Use a static site generator to the extent that you can. But, honestly: I think
you'd stand a good chance of doing better than Wordpress starting from
scratch. There are a couple of very difficult design decisions embedded into
Wordpress that make life much harder for them than it needs to be for you.
~~~
mikeschinkel
What are those "very difficult design decisions embedded into WordPress that
make life much harder for them than it needs to be for you" prey tell?
~~~
marcinw
For one, a built-in theme editor that exposes you to remote command execution
in the presence of another vulnerability, such as cross-site scripting (XSS).
------
cheald
This is a pretty poor strawman of an argument. Wordpress Core may be secure,
but it's also not what people deploy. Nobody uses "Just Wordpress" - you have
to use a custom theme and a half-dozen plugins just to get a basic Wordpress
install into a usable shape, and therein lies the problem - the number of
Wordpress installs compromised through these "necessary" plugins is
staggeringly huge.
Until that stops being a problem, "Wordpress The Product That Has 64 Million
Installs" cannot be considered secure, even if wp-core is the most secure
product ever written.
~~~
smacktoward
This is just not true. There's _lots_ of people who run their personal sites
quite happily using just WP core and one of the bundled themes.
I agree that the quality of community-contributed themes and plugins is all
over the map, and I fight with clients constantly to try and keep them from
installing plugins on a whim for exactly that reason. (It's amazing how many
people grab plugins to do stuff that WP can actually do itself, just in a way
that isn't immediately obvious to the user.) But it's not impossible to run a
site on just WP core.
~~~
dkuntz2
Right, but that's not all 64 million of them. Or even a large fraction of them
(provided that number's the self-hosted installs).
------
heydonovan
Here is my opinion on that matter. As part of the security team at WP Engine,
it's not only my job to educate our users on how to better stay secure, but
also figure out _why_ their site was compromised in the first place. The
majority of the time, it's because of some out of date plugin that I've never
even heard of. Simply searching for "plugin + version" in Google brings up
publicly known exploits.
The hardest issue, will be keeping WordPress Core up to date. It's easy if you
have one website, but if you're managing hundreds, it's going to be a pain to
update each manually, or even through Git/SVN. I do agree though, that
WordPress needs to have an "automatic update" feature for both core, and
plugins. Personally, I would rather have a broken site, than a compromised
one. Both scenarios will require work to fix anyways. Our latest deployment of
WordPress only broke a handful of websites (I only remember working on about 4
sites that actually had to rollback to a previous version of WordPress).
That's pretty impressive.
~~~
smacktoward
Mostly I agree. I'm not sure there's _any_ way for you to guarantee the
security of WP as long as users can install arbitrary plugins and themes. At
least as WP is currently architected.
Insofar as there's a WPEngine specific piece of this problem, it's that (IMO)
you guys don't do a great job of making users understand _before they install
that stuff_ that installing it can have severe consequences. If installing
arbitrary plugins is how users get their sites hacked, installing arbitrary
plugins (except maybe for a few whitelisted "known good" ones) should be a
Very Scary Thing, full of dire warnings you have to click through before the
plugin installs. Users mostly won't understand what the warnings are saying,
but most have at least been conditioned to click "Cancel" when warnings start
flying.
I've talked to a lot of people who think that just moving to WPEngine has
solved security for them, so they don't get how their massive collection of
Super Awesome Plugins are putting them at risk. They think you all are
protecting them from that. Which you can't, I know, but you can make the users
understand that better.
------
smacktoward
The problem with this argument is simple: to _stay_ secure, you have to keep
WordPress core current with updates. And the only way to apply updates is for
an administrator to apply them, either through the admin backend or directly
through the filesystem.
The vast, vast, vast majority of WordPress users are not that diligent about
doing this, and their hosts don't do it for them. So they just sit on whatever
version they happened to be running when they first set up the site for years.
I do a lot of consulting work on WP sites and see this all the time.
So while I would be the first to agree that the WP core team has gotten much,
much better about writing secure software, until there's a way for that
software to stay secure _when used as average users use it_ , it will never be
truly secure.
There is a market for WP hosts who will take this administrative burden on for
you in exchange for costing you more -- WPEngine is a big player in that
market. But I'm at the point now where I think the only way forward is for WP
to just update itself automatically when updates are released, no user
intervention required. It's not acceptable for security to be something you
only get from a few high-priced hosts; most people will never use those hosts.
It needs to be secure for everybody, including those who run it on commodity
shared hosting run by semi-competent admins, as long as "runs great on
commodity shared hosting run by semi-competent admins!" is a selling point for
the software.
EDIT: They illustrate this problem right in the post!
_"WordPress users must be responsible for their own security, maintain strong
Passwords, and keep plugins and themes up to date, as well as WordPress
itself."_
How many decades of experience with non-technical users will it take to get us
to understand that _they just don't do that stuff?_ They don't maintain strong
passwords. They don't run updaters. All that stuff that the post puts on their
shoulders, is stuff we know for a fact that many (most?) of them will _never
even think of doing._
If you know that's the audience for your software, and you don't design it to
be secure when used as you know that audience will use it, the responsibility
for the eventual hacks are as much yours as theirs.
~~~
tptacek
Having to keep up with an continuous stream of patches is not a property of a
secure system. "Secure as long as you keep it patched" is a bar that almost
any piece of software can clear.
~~~
smacktoward
Yes, this is my point exactly. Except much more succinctly stated :-D
In WP's defense, though, it is not the only blog/CMS product that works this
way -- the vast majority I've used require some kind of user or admin
interaction to apply updates, mostly to avoid people complaining if an update
should break something. And WP's update process is _much_ easier and
friendlier to non-technical users than most are.
But in practice that turns out not to matter much, because no matter how easy
making that intervention is, some percentage of users are going to skip it.
The only way to get around that is to not require the interaction at all. That
may risk breaking some stuff, but I'd rather work in an ecosystem where
everybody's secure and poorly written extensions break occasionally than one
in which poorly written extensions never break at the cost of security.
------
mixedbit
The problem is that security is not a feature. It can not be simply added at
some point if software was not designed with security in mind.
For example, if authorization code is spread all over the code base and mixed
with business logic no patching will make this secure, at some point problems
will emerge again.
I'm not saying WordPress is not secure, because I don't know its architecture.
But the argument that after few critical vulnerabilities had been fixed no
more were discovered does not convince me. A better argument would be to
actually explain the WordPress architecture and why it is a good base for a
secure system.
For example Ruby Rack architecture is in my opinion a wise design from a
security perspective, because it allows to nicely isolate security critical
pieces from business logic.
~~~
smacktoward
The biggest problem with WordPress security isn't WordPress itself, it's with
WordPress' extension APIs.
You extend WordPress by writing "themes" and "plugins". Themes are supposed to
change how the site _looks_ , while plugins are supposed to change how the
site _works._ But in practice, there's no isolation of capabilities in either
case, so it's entirely possible for a plugin to do theme-like stuff and a
theme to do plugin-like stuff. Users don't understand this, so they think
things like "oh, it's safe to install, it's just a theme."
Worse, there's no isolation between code that comes in via either of these
extension mechanisms and WordPress itself. As far as the server is concerned
it's all just a big bag of PHP that runs with the same privileges. So a
malicious theme or plugin has a lot of scope to do Very Bad Things once it's
convinced a user to install it. Users don't understand how the attack surface
increases as your installed plugins/themes increase, so they install tons of
stuff, sometimes just because "oh this looks fun!"
I don't know how you untangle all this, unfortunately, especially in a system
that needs to run well in commodity shared hosting. The only real defense is
to be extremely judicious in what extensions you choose to install.
~~~
mixedbit
Couldn't some kind of PHP level sandboxing be used to isolate plugins and
themes? So for example a theme would not be able to spawn OS processes, access
DB connection or create a new one, read and modify HTTP headers.
------
calhoun137
Wait, isn't WordPress insecure?
~~~
tptacek
Yes.
------
arrowroot
Great post! "Up to date software is secure. Out of date software is a target."
- this is true of Operating Systems too (like Windows and Apple). If you're
running an old version of Windows....good luck.
~~~
nfoz
"Up to date software is secure." lol no it isn't.
~~~
arrowroot
good point. i like your logic.
------
alinajaf
Pertinent Bruce Schneier quote:
Anyone can invent a security system that he himself cannot break. I've said
this so often that Cory Doctorow has named it "Schneier's Law": When someone
hands you a security system and says, "I believe this is secure," the first
thing you have to ask is, "Who the hell are you?" Show me what you've broken
to demonstrate that your assertion of the system's security means something.
[http://www.schneier.com/blog/archives/2011/04/schneiers_law....](http://www.schneier.com/blog/archives/2011/04/schneiers_law.html)
------
snowwrestler
Out of the box Wordpress is configured to allow itself to overwrite its own
application files--either via the GUI update process, or via the GUI theme
editor. This means almost any exploit can result in arbitrary PHP code
execution--which can have many nasty results all over your server.
A CMS application should not be able to write arbitrary PHP code to the server
under any circumstance. It's possible to configure Wordpress this way, but
that is the exception not the rule.
------
astrodust
Does WordPress have a pwn2own style event? That would prove this more
effectively.
~~~
tptacek
Maybe, but remember that it's not just the money for Pwn2Own; it's also that
the Pwn2Own contest uses prestige targets. It's probably not quite true that
nobody cares if you find a Wordpress vulnerability, but it's certainly nothing
resembling weaponizing a Chrome vulnerability.
~~~
frankacter
Assuming the competition is attacking the core (with no 3rd party or themes),
wouldn't the 64 million installs be the prestige given all of them could then
be an attack vector to the billions of pageviews they serve?
~~~
tptacek
No, the number of Wordpress installs does not make Wordpress a more
prestigious target for real vulnerability researchers.
------
jmcvearry
Great read and excellent clarity brought to the subject.
------
mikezielonka
Super secure!!!!!!!!!!!!!!
| {
"pile_set_name": "HackerNews"
} |
Police use new tool to source crowds for evidence - a_olt
http://hosted.ap.org/dynamic/stories/U/US_CROWDSOURCING_EVIDENCE?SITE=AP&SECTION=HOME&TEMPLATE=DEFAULT
======
calcsam
"Designers say users can post anonymously and should strip metadata from files
they send."
Talk about poor design. Instead of automatically stripping metadata, they rely
on users to do so. On a mobile phone.
~~~
pavel_lishin
Would you trust them if they auto-stripped the metadata for you?
~~~
aidenn0
I think I would strip the metadata, but also want them to auto-strip.
~~~
Canada
They should prompt the user. Let the user decide what metadata to include and
review it before submission. Personally, I would probably leave all the
metadata intact and leave contact information if I were submitting pictures of
a riot.
I don't agree with Nate Cardozo. If you're in public then you may be
photographed and those photos may be shared with other parties, including law
enforcement. More concerning is access to the database of photos. Anyone who
is accused must have full access. It wouldn't be right if prosecutors were
able to withhold exculpatory evidence.
------
aidenn0
I live in Santa Barbara (neighboring Isla Vista). At least judging by
portrayal in local media, there has been a lot of locals sympathetic to the
police; the general feeling I get is that those living in IV blame all the
out-of-towners for the various parties getting out of control (Including
Floatopia/Deltopia and Haloween).
With similar party-turned-riots at the college I went to, the majority
involved were students, so I think something like this would get less
assistance.
------
cushychicken
Anyone who remembers the complete fiasco of Reddit trying to catch the Boston
Marathon bombers can tell you one scenario in which this technology can go
horribly, horribly wrong.
------
elwell
My startup automatically collects photos & videos that are shared (Instagram,
Twitter, Vine, Flickr, Youtube) that were taken at events (geotag, hashtag,
contextual analysis). It can consequently be used for this purpose as well.
Example event: [http://wesawit.com/events/bruce-springsteen-and-the-e-
street...](http://wesawit.com/events/bruce-springsteen-and-the-e-street-band-
at-bbt-center-2014-04-29-52fa03f7165dc)
------
wil421
>And since it uses remote database servers that police access online, floods
of data won't cause system crashes or be expensive to store. Most agencies,
Edson said, "don't have lots of bandwidth lying around."
I dont really get what they mean here. Are they saying since the DB is in the
_cloud_ /remote it isnt subject to crashing?
~~~
r00fus
I read it as this: the police are outsourcing the crowd-sourcing to a "valued
partner" who may or may not have ties with the commissioners, legislators or
city officials that have decision making power.
ie, it's yet another public-private partnership that is ripe for crony
capitalism. Also absent is any discussions of ramifications on misuse (what
happens when this turns into a snitch-line?)
~~~
afarrell
What is the difference between a "snitch-line" and the specific purpose for
which this was designed? What is wrong with a "snitch-line"?
~~~
tedks
It promotes "snitch culture." Which you might pattern-match with gang talk
about "no snitching" until you realize that the ultimate snitch culture was
the Soviet Union and satellites.
What's wrong with a snitch line is that everyone has _something_ to hide, and
that everyone also does things that look unsavory at times. Nobody wants to
live looking over their shoulder every minute of the day. Nobody wants to live
thinking that their being in an unusual place at an unusual time will lead to
someone "saying something."
That's not even going into malicious use.
------
sukuriant
This link doesn't work for me. I'm taken to AP's "pick where you live" page :/
~~~
aylons
Same here. At first, I though selecting any state would lead me to the
article, but it just opened a drop-down menu, and clicking it does nothing.
Very frustrating. Any ideas, anyone?
~~~
tbrake
Looks like the querystring was cut off :
[http://hosted.ap.org/dynamic/stories/U/US_CROWDSOURCING_EVID...](http://hosted.ap.org/dynamic/stories/U/US_CROWDSOURCING_EVIDENCE?SITE=AP&SECTION=HOME&TEMPLATE=DEFAULT)
takes me to the story.
| {
"pile_set_name": "HackerNews"
} |
Y Combinator Demo Day: The Ultimate Roundup - brendanlim
http://techcrunch.com/2011/08/23/y-combinator-demo-day-the-ultimate-roundup/
======
zhyder
My Picks for:
\- Most likely to succeed in a big way: Parse
\- Most interesting/clever (want it to succeed): Verbling
\- Most scary (wary of it succeeding): Double Recall
~~~
thisisfmu
Double Recall looks like one of the very few startups that would make the
world a worse place if they succeed :(
~~~
jeremymims
Keep in mind that Double Recall works with news publishers. The number one
thing that publishers need is more money to pay for content production. Most
publishers are toying with a paywall model right now. I hope they go the
Double Recall route. I'd rather type in two words once a day and have an
advertiser pay for my content than pull out my credit card to hop over a
paywall.
So, here's the alternative. If the Double Recalls have figured out a nice
sustainable way to pay for a good chunk of the journalism you enjoy, wouldn't
that make the world a better place?
~~~
iconfinder
"I hope they go the Double Recall route. I'd rather type in two words once a
day and have an advertiser pay for my content than pull out my credit card to
hop over a paywall."
Well, that depends on the price of the paywall, the quality of the content and
how much you value your time, right?
~~~
zidar
Well, what people value more depends on each individual. Some people have more
time than money, so DoubleRecall is perfect for them, while others have money
and no time.
What DoubleRecall does, is give a chance to everyone to view the article. If
you take a look at a DoubleRecall client Finance, where people can still
choose to pay monthly fees to get the content without DoubleRecall. Other
people, like myself, can now still view the premium content without having to
pay anything. I may still later decide to but a subscription and have
uninterrupted access, but I probably wont, when someone else might.
------
tuomasb
No one mentioned Mixrank in the comments, I like the idea. Maybe someday it
will be one of those essential marketing tools like SEOmoz. I for one, am lazy
and would prefer just mimic my competitors ads instead of making 10 different
ads and A/B testing them.
Coverage seems quite narrow at least for .fi domains. They probably need to
get some ad-crawler servers with IP addresses(according to GeoIP) from Finland
or any other country they want to have coverage in.
<http://www.mixrank.com/a/groupon.com> lol @ "90% off"
------
cooperadymas
I'm amazed at how many "Groupon for X" startups have been popping up. In this
group there is Munch On Me (restaurants) and Aisle50 (groceries), but if you
look through a site like <http://startupli.st/startups> there are a lot of
others. Opez also says they want to turn independent professionals into their
own Groupons, which doesn't really equate. I presume they really mean giving
the independent professionals the ability to publish their own coupons.
With as much criticism as GroupOn has received, and the suspect way they have
measured their success it seems there must be a better model of comparison.
Saying you want to be the LivingSocial of X would likely give a better
impression.
Still, I'm not sure applying that business model to a specific industry like
restaurants or groceries will lead to success. For restaurants, LivingSocial
and GroupOn already give out a lot of restaurant deals. Google will soon be
moving in the market also. It's quickly becoming saturated. How long can
restaurants give away meals for half price?
Aisle50 is at least attacking an area that isn't really covered by existing
businesses.
------
qasar
The S11 demo day writes up are probably one of the best ways to get a sense of
what the early stage ecosystem looks like right now. Its not a bad picture
either. These are some great startups - mature and refreshingly diverse. It's
a good time to be an entrepreneur in the valley.
------
prpon
Quite a few of the companies mentioned have traction and that is pretty
impressive.
I haven't seen anyone else say it but kicksend looks a lot like getcrate from
sahil lavingia with facebook integration added to it.
~~~
ayanb
Infact, traction could be one of the key drivers behind some of the companies
getting selected into YC.
~~~
jorde
It would be interesting to get an overview on how many of the startups in the
current batch had their products out 1) before getting funded by YC, 2) during
YC.
------
whichdan
Bushido sounds really interesting. I've always liked the Add-Ons for Heroku,
and a platform-independent version of that would be a huge help.
------
bdr
I'd say Codecademy has the potential to create the most value. Lowering the
barrier to learning to code will create a lot more coders.
------
cyberguppy
MarketBrief sounds like a home run to me. If the product works as described
it's a tremendous value proposition.
~~~
thisisfmu
It's basically search engine spam generated from SEC docs. Adds needless
verbosity to when people want the info in a concise format. When looking for
actionable financial info I hate having to read through sentences when a table
or graph will do. Consider why audio podcasts never really caught on for non-
entertainment.
~~~
randall
I don't know how to read an S1, which is why I go to places like CNBC and the
sort in the first place. Granted, I'm not a financial services kind of guy,
but it's useful to have that info generated in a digestible format. I don't
think the podcast analog works quite right... it's more like taking a blog
post from tech crunch, and automagically repurposing it for usa today by
adding relevant context programmatically. There's definitely value in that,
but I don't think it's "Bloomberg" money.
------
brlewis
Go Snapjoy! I'm looking to them for market validation.
------
coderdude
I wonder when exactly it was that TechCrunch was like, "wow, all we really
need to do is write YC articles all day." They're playing this site like a
violin.
------
tomlin
VidYard isn't really much of an innovation, in fact, Bits on the Run has been
doing this - better - for quiet some time. VidYard is caught in between trying
to emulate YouTube and being a streaming hosting provider without convincing
me of either strengths.
BOTR offers an elegant API, skin-able players, pay-as-you-go usage, statistics
and, as an option, a totally configurable ad platform plugin for the player
that works with more than one ad platform. FWIW, I know VidYard does a lot of
this, too, but what's the YouTube angle doing for them? Other than having a
chart comparing them to _community-based_ video platforms?
EDIT: Down-vote if you want, but provide a reason. Otherwise, I'll assume: "he
said something about my startup, get him!"
| {
"pile_set_name": "HackerNews"
} |
The Pleasure of Practicing: A Musician’s Account of Overcoming Impostor Syndrome - sexbomb
http://www.brainpickings.org/2015/01/07/glenn-kurtz-practicing/
======
gull
A big takeaway:
Everyone who gives up a serious childhood dream — of
becoming an artist, a doctor, an engineer, an athlete —
lives the rest of their life with a sense of loss, with
nagging what ifs.
------
steeples
This article tells a great story about overcoming certain hangups about one's
ability, but never touches on talent not being matched to an audience. In some
industries it's not what you know, but who you know, and the context. Take for
example that famous experiment with Joshua Bell playing the violin in DC Metro
Station:
[https://www.youtube.com/watch?v=UM21gPmkDpI](https://www.youtube.com/watch?v=UM21gPmkDpI)
Nobody even noticed, and having known it was Joshua Bell, they certainly would
have. Practicing all alone with a musical instrument in my bedroom is no more
exaltation than it is a mismatch of talent and audience. If anything my
neighbor will be filing a noise complaint...
~~~
ThomPete
It's not really about audience but about context. There is a reason why
something is music to a whole generation of kids while their parents think it
sounds like noise.
------
agumonkey
Last paragraph is nice:
> I sit down to practice the fullness of my doubts and desire, my fantasies
> and flaws. Each day I follow them as far as I can bear it, for now. This is
> what teaches me my limits; this is what enables me to improve. I think it is
> the same with anything you seriously practice, anything you deeply love.
More than work, with time you see it as a journey. You try something and you
see how it goes. Experience just slowly builds a map of that weird space we
call art.
------
codeisawesome
> And I struggle to harmonize them, to find my way between them, uncertain
> whether this work is worth it or a waste of my time.
I don't know I think I would say pick something to do in life that, even if
you never achieve that mastery, you never regret a single moment spent doing
it, because it was awesome.
------
steeples
One word: Practice time - By Mr Positivity
[https://www.youtube.com/watch?v=SlCRfTmBSGs](https://www.youtube.com/watch?v=SlCRfTmBSGs)
------
mikestew
So if he doesn't get to play Carnegie Hall, he just ups and drops the whole
thing? Yeah, well, welcome to the topsy-turvy world of rock and roll. I'll
admit I only skimmed it, because the opening came across as whiny, but I guess
the gist is that practicing should be taken as a pleasure unto itself. Well,
duh. If you don't like playing your instrument for its own sake, I would guess
you'd never make it as a pro regardless of your skill.
It became evident at an early age that I was not the next Jimmy Page. That
didn't keep me from continuing with the guitar for the next forty years. Oh,
I've been paid for my playing from time to time, but I'd never make a living
at it. Just like the huge numbers of musicians who are far, far better than
I'll ever dream to be: they can't make a living at it, either. It's a tough
business. Oh, you had to go be an editorial assistant? Hey, beats waiting
tables, which is what even more skilled musicians are doing every day in
cities around the world.
There is no danger of anyone paying to hear me play the mandolin I bought this
year, either. Doesn't stop me from playing the hell out of it. I _like_
playing it, knowing I'll never make a dime off doing so. I've not even
concluded that I'll ever be any _good_ at it, let alone paid. But my wife
doesn't mind my playing (that she says, anyway), I like it, so I'll stick with
it.
The imposter syndrome part I never got (I might have skimmed the article, but
I specifically looked for that). How can a musician have imposter syndrome?
Developers, eh, I may not find out for a month or two that they suck (which is
what "imposters" worry about). A musician? Pick up that Fender, knock out
_Crossroads_ for me, we'll find out really quick whether you're any good.
(Feel free to down vote me for mouthing off about an article I barely read, I
probably deserve it. I'll take the hit, but frankly what I read was whiny and
kind of boring/obvious, yet I couldn't let it go without comment.)
~~~
rquantz
This comment was clearly made by someone who has never practiced art or music
at a high level. You are trying to compare your experience as a musician with
someone who has worked toward and dreamed of being one of the best there ever
was since some time in, most likely, early adolescence.
I was among the best in my year on my instrument in the country. I went to one
of the top music schools in the world, and then I moved to New York to keep
studying and start working as a musician. Some time in the middle of the
financial crisis, I got tired of being broke all the time, and of constantly
battling injuries (that's thing you've probably never had to worry about, as
an amateur musician. Your arm is sore? You get to take a few days off!), and
teaching music to the spoiled children of the masters of the universe. I
learned to code and started working as a programmer.
Everyone who has ever been among the best, but didn't quite make it, has to,
at some point, decide they didn't make it, and quit. Once I quit, I barely
touched my instrument for two years. Playing when you're out of practice can
be pretty painful to someone who is highly trained. You've worked for years
toward perfection and then you just have to start accepting... less than that.
Here's another thing that happens when you quit: you have a constant voice in
the back of your mind wondering whether you gave up too easily. You were there
with the best people in the world, and now you watch them take their place
among the leading lights of the art, and you can't stop picturing yourself
among them. It's not whining, it's the painful experience of giving up your
lifelong image of yourself. Being a musician, a top level, professional
musician, dominates your whole identity. Try to imagine this: rather than
finding out at an early age that you're not the next Jimmy Page, you get very
good very quickly at a young age, and people start telling you, hey, you could
be the next Jimmy Page. You work for decades to get good enough, sacrificing
your personal relationships, your childhood, choosing over and over again to
stay in and work instead of doing whatever else you could be doing, and then
at age 30 after years of near misses and barely scraping by, you realize
you're just not the next Jimmy Page. It's not an early realization, it's a
gradual defeat. And it's devastating.
Regarding imposter syndrome, there have been studies of musicians using the
standard "sandwich method" of delivering criticism, in which the criticism is
sandwiched between two compliments. Trained musicians often don't hear or
register the compliments at all. I had this experience with my girlfriend
recently. She played some excerpts for me, I said, "wow you sound great, I
liked X and Y. Here are a few things you should work on." She asked me later
if I thought she was complete shit. I said, "I said you sounded great," and
she said "You did?" She literally had not even heard me say I thought she
sounded great.
Here's another fact about the music world. People are often loath to tell you
that you don't sound good (or don't sound great). Musicians know this, and so
every time someone tells you that performance was great, there's a little part
of you that wonders if you're being lied to. Often you'll get hired by a
contractor to play a gig, and then never get called by them again. Sometimes
that's because they have their regular people and you were just a stand in, or
because they died or moved or whatever. Other times it's because they didn't
like your playing. But they never tell you which one it is. So every time you
don't get called back for a gig, regardless of what the actual reason is,
there's a chance it's because you weren't good enough. Feedback is not
consistent and it is not reliable.
So given those two facts, is it a wonder musicians can suffer from imposter
syndrome? It's not a question of, "people will realize I can't play guitar,"
it's the very fine line between being very very good, and being great.
Regardless of which side of the line you're on, you're always wondering.
Does that clear things up?
~~~
cousin_it
Here's something I've wanted to ask a professional musician for a while. It
seems like most listeners' enjoyment doesn't actually depend much on your
technique, which you've spent years perfecting. Practicing your instrument (or
more general "musicianship") might not even be the main limiting factor for
becoming a sought-after musician, as opposed to things like charisma and
theatrics, or songwriting, or imagination... I don't know. What do you think?
~~~
rquantz
I think of technique in very different terms. Technique is the ability to
execute very precisely what's in your head on your instrument. That ability is
meaningless without all the things you list, especially, I'd say, imagination,
but so too are those things meaningless without technique. You can have all
the imagination in the world, but if you can't execute what's in your head
exactly, that imagination will not be illuminated for the audience.
------
marktangotango
So this piece is essentially comments on another piece by this Kurtz guy, and
the commentary is quite banal. Luckily the author seems to thoroughly
reproduce the original piece which really wasn't too bad.
~~~
rquantz
It's a book review. Is that not a valid form of writing to you?
| {
"pile_set_name": "HackerNews"
} |
You Don't Know JavaScript - mwbiz
http://www.w2lessons.com/2011/04/you-dont-know-javascript.html
======
raganwald
This 'irritating problem' of people claiming that they know _____ when they
actually don't, is best solved with... drum roll... Source code. Don't tell me
you know _____, show me what you did with _____.
Today that problem can be solved with Github, Sourceforge, Google Code or
whatever. A decade ago I remember asking for a job as a Java developer by
taking the source code for a Scheme interpreter written in Java into the
interview. A checklist of features is a nice starting point for things to look
for for when learning, but there is no substitute for solving problems with
the language. Thus, one day you will be able to say what you did with it,
rather than which features you understand.
So my feedback for the author is this: Write a followup suggesting some sample
projects to write, organized by level of difficulty, just as you've organized
language features by difficulty. The projects shouldn't be large, just things
that will tend to force the developer into an in-depth understanding of one or
more of the advanced features you have suggested. For example... You mentioned
timers. What could/should I build if I want some experience using timers?
~~~
nxn
"This 'irritating problem' of people claiming that they know _____ when they
actually don't, is best solved with... drum roll... Source code. Don't tell me
you know _____, show me what you did with _____. Today that problem can be
solved with Github, Sourceforge, Google Code or whatever."
That isn't really a complete solution to the problem, take my situation as an
example: I've been working as a C# dev for some years now, but since the
company I worked for ended up owning all the code, and since almost all the
applications I helped create for them are internal, I have nothing to really
show for it. Why don't I have any side projects I've done with C#? It's just
simply not my first choice of language for personal projects due to the fact I
have to use it so much on a daily basis; instead, I tend to go with lesser
known languages that I'm certainly not as familiar with just because it makes
writing some of the code a little more exciting. In essence, I'm claiming to
know the language, but the only proof I can give is saying "Well, I used it
daily for X amount of time".
~~~
raganwald
This came up a while back, and I feel your pain. That Java job I told you
about? All the Java and C++ code now belongs to Quest, who bought my employer.
And I did some good work on ING Direct (USA), but I can't show that to you,
either.
My wife once bought a bunch of postcards from a printer to promote her
business as a photographer. Right on their price list was a charge for a
credit waiver. basically, every postcard had to have a small "Printed by
FooCorp 1-800-888-8888" on it. If you didn't want that, you paid extra.
I have reached the point where I feel the same way about the code I write.
Naturally, nobody can see trade secrets. But if there's a portion of the code
that is not a trade secret, perhaps a Rails or jQuery plugin that gets
developed along the way, I want that open sourced. If the answer is "No, we
want to own everything 100%," I need to make extra money to make up for the
fact that I am going to go dark, just as that printer needs to charge extra
money to make up for the lost advertising opportunity.
~~~
bergie
Our employment contracts actually require us to open source everything our
hackers build (except some client-specific configurations or templates of
course)
------
nsfmc
So despite the mostly vapid nature of this article one thing called out to me:
_"Given the lax nature of JavaScript, it's easy for your application to
spiral into a mess of unmaintainable spaghetti code."_
Let's not forget: it's entirely possible to create a mess of unmaintainable
code in _any_ language. Or, _"guns don't kill people, people kill people"_
The other half of this complaint i think is somewhat elitist (unwittingly so?)
and it seems to do with the notion that because there is a such a low barrier
to entry, that much js code is cargo-culted, but i've seen this from
developers in every language. What I find even worse than cargo-cult code is
Pattern Zealots going about specifically coding up Pattern X in javascript.
It's like they studied Design Patterns but the point of it just went over
their heads.
Knowing the principles of software development doesn't prevent you from making
ridiculous decisions[1]. It seems like everyone wants checklists of coding
standards or _something_ for measuring code quality / standards compliance
these days in js. But these are hollow measures if the code behind the
module/black box/library is just plain wrong.
Maybe i'm missing something here, but _why_ is this article getting voted up?
[1]: [http://stackoverflow.com/questions/1635800/javascript-
best-s...](http://stackoverflow.com/questions/1635800/javascript-best-
singleton-pattern) (found when googling 'javascript singleton')
~~~
quanticle
_Let's not forget: it's entirely possible to create a mess of unmaintainable
code in any language. Or, "guns don't kill people, people kill people"_
That's true. You can write FORTRAN in any language. However, some languages
make certain classes of mistakes easier. For example, C makes it very easy
leak memory. Java, with its automatic garbage collection, makes it
considerably harder.
Does this mean that memory leaks are impossible in Java? Of course not. But
I'd still rather have memory management than not.
~~~
nsfmc
an aside: i have been asked three times in separate technical interviews
(several years apart even) how to leak memory in java (once in python).
~~~
zlapper
I would like you to show us some examples!
~~~
quanticle
I can't remember any Java examples at the moment, but I do recall a memory
leak that I had created in C#.
Registering an event handler in .Net creates a reference to the handler. This
means that an event handler that doesn't un-register itself from it's event
will never be garbage collected. In the context of a GUI application, this
means that you have to be careful to ensure that child windows remove their
event handlers when they're closed. Otherwise, your application will leak
memory, as the closed windows will never be garbage collected.
------
ionfish
The author apparently has a rather low bar for attributing an advanced level
of understanding.
> Understanding a methods 'arguments' variable and how it can be used to
> overload functions through arguments.length and make recursive calls through
> arguments.callee
The arguments object is one of the first things anyone learning about
functions in JavaScript is introduced to. arguments.callee is a little more
obscure, but not a particularly difficult concept.
> Advanced closures such as self-memoizing functions, partial functions, and
> the lovely (function(){})() call
Using an immediately-executed anonymous function to enforce a scope change and
hide variables is a pretty common pattern. I suppose memoisation might belong
on an 'advanced' list. As indicated later, the author clearly doesn't know
what a partial function actually is.
> Function and html prototyping, the prototype chain, and how to use base
> JavaScript objects and functions (e.g. Array) to minimize coding
Surely this should be part of the basic level of understanding required of any
JS programmer. Understanding the basic semantics of a language's object model
is pretty essential to doing anything much with it.
> Object type and the use of instanceof
I once had to teach some novice programmers about JavaScript. We dealt with
objects and the 'instanceof' operator in, I think, around the third session.
Understanding the JS object model is basic knowledge.
> Regular expressions and expression compiling
This should be meat and drink for any professional programmer. There's nothing
particularly weird about regular expressions in JavaScript. Fine, you can
create regular expressions by writing new RegExp("my pattern as a string"),
but so what? A quick read of any JS reference will reveal this fact; it's not
exactly arcane knowledge.
> Knowing how to handle and use partial functions
Err, what? All functions in JavaScript are partial, insofar as there are
arguments at which the value of the function is not defined. Perhaps the
author meant _partially applied functions_ , which are a completely different
thing.
> With statements and why you shouldn't use them
The concept of 'with' statements is fairly straightforward. I admit that
understanding just why they're generally a bad idea (and the problems they
cause for people writing JS interpreters) requires an understanding of some
subtleties of the scope model.
> The most difficult part of all, knowing how to tie all these tools together
> into clean, robust, fast, maintainable, and cross browser compatible code.
Finally, something that uncontentiously belongs on an 'advanced' list! Note
that unlike the others, it doesn't turn on grasping how some particular
language (mis)feature works. In other words, there's more to knowing what
you're doing than knowing what the language does.
~~~
kragen
> there's more to knowing what you're doing than knowing what the language
> does.
Sure, but knowing JavaScript isn't just knowing how to program; it also
involves grasping how the various language (mis)features work.
~~~
ionfish
Obviously. All I'm claiming is that knowledge of the language attributes
listed isn't sufficient for being an advanced JavaScript programmer, not that
it's not necessary.
~~~
dts
Understood, but I think providing a list of attributes that you consider
sufficiently advanced would be far more constructive / interesting.
~~~
ionfish
I think raganwald has already put the case better than I could, further up the
thread: the mark of an advanced programmer is being able to use her knowledge
of the language to write programs that solve interesting or difficult
problems. Admittedly that's not JavaScript-specific, but one can easily
specialise this general criterion by reference to specific language attributes
and types of tasks which the language is commonly employed to solve (DOM
scripting etc.).
That's all a bit hand-wavy, so here are some more concrete suggestions. Even
in these days of Node.js et al, JS is mainly used for developing web
frontends, so this will be heavily slanted towards those sorts of issues. An
advanced JavaScript programmer should be able to:
* Develop her own DOM library along the lines of the functionality provided by jQuery or YUI: a CSS selector engine, DOM traversal, element manipulation, all wrapped in a clean and well thought-out API.
* Build an extensible UI toolkit suitable for writing the frontend of a CMS, capable of handling numerous different object types, and communicating with the backend via a specified serialisation protocol.
* Write a testing framework with an equal level of features and stability as common current ones, such as QUnit.
* Create a form validation DSL capable of handling not just simple binary cases and regex-based validation of input fields, but the specification of more complex dependency relationships and requirements. For bonus points, tie it into the backend so the same code generates the frontend DSL code and the backend validation rules, ensuring that they always harmonise.
* Develop complex (as in, complex to implement using the DOM) interface elements such as sliders, drag-and-drop controls etc.
Again, I'm not saying our hypothetical advanced JS hacker should have _done_
all this—just that she should be able to. Note that while some of these
require quite extensive knowledge of the DOM and cross-browser issues, one
could easily construct examples which pitched more towards different
specialities—those above are just problems I'm somewhat familiar with.
------
alexgartrell
Obviously the author is knowledgable about javascript, but this article would
have carried more weight with me if he'd taught me something more instead of
just alluding to all of these concepts that I haven't encountered yet. It kind
of makes the whole thing come off like he has an inferiority complex about
being "just a front-end developer"
~~~
mwbiz
Alex, I'm actually a back-end developer, there is no inferiority complex.
~~~
lawnchair_larry
I think altering the tone with which you use to deliver your message will have
a beneficial effect in reaching people.
For example, I am not going to read this because it sounds really pretentious,
and you are replying to everyone here to argue trivial things. If you don't
have a complex, you don't need to bother with this.
Also, because it ends with this:
>As for the resume decoration, I would say that if you've covered the beginner
level and are venturing into the intermediate stages it is justifiable to put
it on your resume. Once you find yourself developing your desired functions
rather than copying and pasting them, you can then claim to know JavaScript,
until then, please don't advertise it.
_Really?_
~~~
kragen
Are you skeptical of the idea that there are really people so dishonest that
they would claim on their resume to know a language of which they have only
copied and pasted chunks? Don't be. I've interviewed some of these people. I
wish I could add them to some kind of global blacklist to stop others from
wasting their time on them.
------
StavrosK
Huh, apparently I know JavaScript. I didn't think I did.
------
andrewhoyer
The fact that developers add languages to their resumes that they have only
touched on is a result of job postings that list incredible numbers of skills
which are probably only touched on in the job itself. It took me 10 seconds to
find a job posting on Craigslist, titled "Web Applications Programmer". Here
are only a few lines from the "Position Requirements"
Fluent with PHP, Python, JavaScript, MySQL, HTML, XML, CSS, web services
(SOAP, XML – RPC…) Knowledge of java, ActionScript, Flex and C# is an asset
Experienced with AutoCAD, SolidWorks, Inventor, 3D Studio Max, Flash,
Photoshop, Dreamweaver, Adobe Illustrator
The list goes on to include a bunch of other stuff, plus an array of other
non-technical skills.
What do companies expect? Just to get an interview one might need to add
something they've only touched on.
------
d0m
"You Don't Know JavaScript". Then, it says "With statements and why you
shouldn't use them" is an advanced concept. I guess this post doesn't apply to
hacker news :)
------
bauchidgw
>Understanding a methods 'arguments' variable and how it can be used to
overload functions through arguments.length and make recursive calls through
arguments.callee
seems he doesn't know "use strict"
~~~
mwbiz
Yes I do, if you're using strict this won't work.
~~~
bauchidgw
just saying, mentioning a well known anti pattern as "advanced level of
understanding" is kinda odd.
other than that i believe most of us know that there are shitloads (and then
some) of bad javascript devs out there.
~~~
mwbiz
It is an anti-pattern but it's one that every framework takes advantage of.
jQuery and Dojo use it heavily and it can be dangerous if you plan on
incorporating it in strict mode. I will note strict mode in the article,
thanks for pointing it out.
------
walkon
You don't know what I know.
------
georgieporgie
_I've seen a repetitive pattern of programmers dressing their resumes with
technologies that they don't really know, but have merely touched on._
I always find attitudes toward resumes to be interesting. The entire reason we
mention technologies on resumes is because we used them, and (assuming we're
not completely desperate) we want to use them again. The mere fact that you
have done _anything_ in a language gives you a foot up on the person who truly
has zero exposure to it. Experience is compounding, and each small step can be
worth dramatically more than the last.
I've met too many people who believe that in order to list a technology on
your resume, you must be an 'expert' in it, where the meaning of 'expert'
varies wildly. These tend to be the same people who think that "evaluating a
prospective hire," means, "find any point of weakness and exploit it." It's a
weird, insecure defensiveness. A need to prove candidates wrong, rather than
gaining an understanding of their skill set and experience.
~~~
prodigal_erik
A former coworker once caught someone whose claimed PostScript experience
consisted of clicking "Print to File". I consider that nothing short of fraud.
If a skill is on my résumé, I am offering to rent it to you for substantial
money, which means at a minimum that I have already developed it to the point
of being commercially useful. If there is no honest way for me to claim I've
dabbled a little and I hope to be useless for less time than some others, it's
because nobody has much reason to believe my uninformed self-assessment or
care very much even when it's true.
That said, we once hired a guy who didn't know any Java (actually it was the
same guy as above), because the interview made it perfectly obvious that given
his intelligence and fluency in similar languages, picking up Java was not
going to be a problem for him. He did not try to find an excuse to smuggle
Java into his résumé, he was honest and let us make the call, and it worked
out fine for both of us. If he had cram-studied Java and tried to pass himself
off as experienced, we would have caught him being incompetent or dishonest or
both, and that would have ended the interview.
~~~
georgieporgie
_A former coworker once caught someone whose claimed PostScript experience
consisted of clicking "Print to File"_
Was that deceit, or tremendous ignorance?
It seems to me that there's a huge problem with resumes and interviewing
regarding unknown unknowns. 1-10 ratings, for example, vary wildly depending
on how much you don't know that you don't know. When I graduated college, I
was a 9/10 in C++. Now I'm about a 6, even though I'm ten times the C++
programmer that I was. :-) But I don't dare tell a recruiter that...
I do agree entirely with this statement of yours: _at a minimum that I have
already developed it to the point of being commercially useful_
Which is sort of my point. You can have employed a language or technology,
professionally, to solve a problem, gaining very meaningful experience,
without coming anywhere close to being an expert, or even meeting most
people's requirements for 'knowing' something. I'm certainly not saying that
people should list anything technology they can conceive, on the most tenuous
bases they can rationalize.
| {
"pile_set_name": "HackerNews"
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.