text
stringlengths 746
31k
|
|---|
A 75-year-old woman presented with a left upper lid mass for a 2-week duration. She was seen in a local clinic, diagnosed as a chalazion, and was treated with neomycin/polymyxin/dexamethasone ointment and hot compresses. She was sent to our department after exacerbation of the symptoms and growth of the mass. On review of symptoms, the patient had no other significant medical history, was not immunocompromised and took no regular medications. On examination, her visual acuity was 20/20 OU; the physical examination was significant for large immobile nonfluctuating supra-tarsal mass with red and erythema surrounding the mass []. There were no orbital signs observed on examination; there was full ocular motility in both eyes, no proptosis and color vision was intact. In addition, the dilated funduscopic examination was normal. Computed tomography (CT) scan of the orbits was performed, revealing a large mass extending from the frontal sinus through the soft tissue of the eyelid [ and ]. There was extensive bony erosion with no inter-cranial extension. Initial laboratory investigations were performed, including a complete blood count, chemistry, and coagulation studies, all within the normal limits. A biopsy was performed with a combined approach; both ears, nose, and throat (ENT) team, and oculoplastic teams were present []. The ENT team approached endoscopically using a navigation system to properly locate the lesion within the area of the frontal sinus. The oculoplastic team approached through a lid crease incision, and the material was sent to biopsy. Biopsy revealed an inflammatory infiltrate with many plasma cells and granulation tissue with a lymphocytic inflammatory infiltrate with plasma cells and neutrophils. There was an abnormal ratio of kappa to lambda and a high level of CD: 138 expression. Polymerase chain reaction was also performed and a monoclonal B-cell proliferation was seen. The histopathological diagnosis was plasmacytoma. The hematology department was consulted, and a systemic workup was performed. On further review of systems, there was no weight loss, fevers, night sweats, or malaise. Further blood work was performed, including; liver function tests and immunological studies, which included immunoglobulin levels, which were normal, and immunofixation studies, which revealed polyclonal expression. The free light chains were isolated and the ratio of kappa: Lambda was two (free κ = 25.8, free λ = 13). A positron emission tomography CT scan was also performed. There was evidence of residual uptake in the frontal sinus, with no other loci of systemic uptake. A diagnosis of solitary extramedullary plasmacytoma was made with no systemic evidence of multiple myeloma. The patient was treated with radiation directed to the orbit, with a total dosage of 50 gray, divided into 25 fractions of 2 gray. At 2 weeks postradiation, she had evidence of superficial punctate keratitis. At 4 weeks postradiation treatment, there was improvement in the conjunctival hyperemia, edema, and corneal signs. During her last ENT follow-up, 1 year since diagnosis, a fiber optic examination was performed and the sinus was open and clean. At the last hematology follow-up of 22 months post diagnosis, the blood work was stable. Last PET CT scan revealed no evidence of systemic disease. |
In November 2016, a 76-year-old woman was admitted electively to Tartu University Hospital for further investigations due to atrial fibrillation and regional wall motion abnormalities that had been found previously. The past medical history of the patient was insignificant: she had been active in childhood and did not describe any issues with regular physical activities; besides two normal pregnancies and two deliveries, she had never experienced exercise intolerance and recently took part in Nordic walking tours. At presentation, the patient was asymptomatic, but previously, in June 2016, the patient had experienced palpitations and an irregular pulse and therefore underwent electrocardiography (ECG), where atrial fibrillation was found. In September 2016, the patient underwent echocardiography in an outpatient clinic, which demonstrated apical wall motion abnormalities, and therefore was referred to our tertiary care centre for additional investigations. She was started on outpatient rate control and anticoagulation for prevention of thromboembolism and diuretics due to asymptomatic left ventricular dysfunction. She had undergone outpatient Holter monitoring which demonstrated permanent atrial fibrillation and an average heart rate of 73 b.p.m.\nUpon presentation to our centre, the patient had been prescribed with metoprolol extended release 50 mg b.i.d., verapamil extended release 120 mg b.i.d., aspirin 75 mg o.d., spironolactone 25 mg o.d., furosemide 20 mg o.d., atorvastatin 20 mg o.d., and warfarin 6/7.5 mg on alternating days. The combination of verapamil and metoprolol had been selected in order to achieve an evidence-based heart rate control (a resting heart rate of <110 b.p.m.). Although neither of the used medications was on the maximum dose and this combination is generally avoided, in this case, it was decided by her prior care providers that this combination was optimal.\nUpon presentation, the ECG demonstrated atrial fibrillation with adequate rate control and a resting heart rate of 70 b.p.m. The patient was in a good general condition, no pitting oedema or cyanosis was seen and peripheral pulses were palpable on all arteries. During her hospitalization, she was monitored with telemetry and her resting heart rate was normal at all times. Both systolic and diastolic blood pressures were normal. Inpatient exercise tolerance test demonstrated low exercise capacity (4.6 metabolic equivalents of task) and significant ST-depression without anginal symptoms.\nCoronary angiography was undertaken, where no left coronary artery (LCA) was identified with standard techniques. Subsequently, a large right coronary artery (RCA) was found with collateral system to the LCA system ( and ). The coronary arteries had minimal atherosclerotic lesions. Coronary computed tomography angiography (CCTA) confirmed the anomalous origin of the LCA from the pulmonary trunk 2.2 cm above the pulmonary valve. Retrograde blood flow to the pulmonary artery was demonstrated also with CCTA ( and ).\nEchocardiography showed akinesia and apical aneurysm in the left ventricular apex, left ventricular ejection fraction of 41%, slight prolapse of the anterior leaflet of the mitral valve, and moderate mitral regurgitation. The large RCA was echocardiographically visible in the parasternal long () and short axis. Retrograde flow from the anomalous LCA into the pulmonary artery was visible on Doppler echocardiography.\nThe case was discussed at the Heart Team meeting. The patient had no anginal symptoms or dyspnoea following a lenient rate control strategy and there were no signs of congestive heart failure. The patient had good coronary collateral circulation, thus it was unclear whether there would be any benefit from either surgical ligation of the LCA or re-implanting the anomalous artery. Therefore, a medical treatment strategy was chosen and the patient was discharged in a good physical condition with a follow-up at her family doctor for rate-control and anticoagulation monitoring. The discharge medications included metoprolol extended release 50 mg b.i.d., verapamil extended release 120 mg o.d., furosemide 20 mg o.d., atorvastatin 20 mg o.d., and warfarin. As the patient was content with her previous medications, the combination treatment for her rate control was not altered, but aspirin was discontinued, as no signs of an acute coronary syndrome were found. The patient has had no cardiovascular rehospitalizations during 3 years of follow-up and is regularly attending follow-up visits at her primary care provider. No additional cardiovascular investigations have been deemed necessary. |
A 7-year-old girl reported with the chief complaint of grooves and scar marks over the cheek since birth and forwardly placed upper front teeth. Clinical and radiographic findings revealed Tessier's no. 5 (mild form) on the right side and no. 6 on the left side [] along with cleft lip and alveolus of the right side and incomplete hard palate cleft and complete soft palate cleft []. She also has bilateral accessory posterior maxilla with an extra dentition and a double soft palate. Due to transverse constriction of main maxilla posterior occlusion is possible only with the molars of accessory maxilla []. The patient is a known case of the repaired cleft lip at 6 months of age (Millard's technique) and cleft palate at 1.5 years of age. Soft-tissue sclerotic furrow on the left side cheek was attempted for repair at 3.5 years of age, but it reoccurred and is still present. Simultaneously, lip revision was also done. All the above operations were done elsewhere.\nFacial cleft on the left side of the face is on the maxilla and the zygomatic bone, opening the infraorbital fissure. This feature differentiates it from the right side no. 5 where only orbital and maxillary bones are affected []. The left side of the cheek has marked vertical sclerodermic furrow with a coloboma on the lower eyelid, in the lateral third, corresponding to the orbital cleft present []. The mandible is micrognathic and retruded, whereas the maxilla is severely prognathic. Cephalometric readings revealed her to be skeletally Class II with hyperdivergent growth pattern, increased overjet (about 15 mm), and compound open bite as well as incompetent lips [ and ]. Hands and feet are totally normal [].\nThe right side cleft alveolus, mesial to deciduous canine, is a differentiating feature of no. 5, as it is not present in no. 6. She has bilateral accessory posterior maxilla with an extra set of teeth [Figures and ]. Hard palate is shallow and narrow anteriorly [].\nOrthopantomogram and cone-beam computed tomography evaluation showed that the main maxillary arch has 53, 54, 55, 11, 22, 63, 64, and 26 erupted into occlusion, whereas 15, 14, 13, 21, 23, 24, 25, and 27 (palatally placed) are unerupted. Similarly, the accessory posterior maxillary arch has 16, 5E, 6E, 26, and 27 erupted (doubtful, may be an extra premolar), whereas 17 (tooth bud), 14, 15, 25 (successor of E), 24, and 25 are unerupted. In the right posterior alveolar cleft region, one extra premolar remains unerupted. There is agenesis of 16 in the main maxilla, whereas it is present in the accessory maxilla. Mandibular dentition is following a normal eruption pattern. Presently it is in mixed dentition stage [Figures and ]. The patient is an obligatory mouth breather and hence has a generalized gingival inflammation. No chromosomal aberrations were reported through genetic mapping.\nSurgical management of Tessier's no. 5 and 6 consists of soft tissue and bony component. Soft-tissue repair warranted only if the defect is wide and will be proceeded by bony correction wherever possible. Surgical intervention shall be delayed till the patient has not crossed the circumpubertal period and the second permanent molars are not erupted. Meanwhile, an oral screen (to increase lip competency) has been given. This also acted as a psychological support to the patient and the parents. Transverse expansion of the maxilla will be done at appropriate time. After that, either orthodontic alignment of the accessory maxilla with the main maxilla will be done or surgical repositioning of the accessory maxilla will be done, depending on the progress of the case. Final orthognathic surgery, postsurgical orthodontics, and/or plastic revision surgery will be planned postadolescence. |
A 49-year-old woman presented with a 3-month history of repeated ptosis of both eyelids and oral ulcers and erosions. Physical examinations revealed scattered ulcers and erosions in the mouth (Fig. ). Laboratory examinations showed that CA 125 was elevated (51.6 U/ml), while other tumor markers, including CA199, 153, CEA, and AFP, were normal. Autoimmune antibodies, including anti-CENP-B antibody, ANCA, anti-AchR antibody, and ANA, were all positive.\nThe patient was first diagnosed with an oral aphthous ulcer and ocular myopathy myasthenia gravis. She was treated with gentamycin and dexamethasone spray inhalation to improve her oral lesions and pyridostigmine to cure muscle weakness. However, the oral ulcers improved slightly and the myasthenia gravis persisted. An abdominal ultrasound showed a hypoechoic mass in the left adrenal gland. A further CT examination showed a 6 × 5 cm, well-defined round solid mass with central necrosis in the pancreatic tail. There was no calcification detected in the mass. The solid part of the mass had slight enhancement in the arterial phase with many serpentine feeding arteries, moderate enhancement with a draining vein around the tumor in the portal venous phase and persistent enhancement in the delayed phase (Fig. a-e). The fundus of the stomach was compressed by the mass. The boundary between the mass and the splenic artery and vein was not clear, and swollen lymph nodes were not observed in the posterior peritoneum. The mass was initially considered to be a neuroendocrine tumor in the pancreatic tail.\nAt the same time, the patient’s symptoms worsened. She could not swallow, and she felt severe pain in her mouth. She also developed a cough and expectoration. A chest CT revealed infection in the lower lobes of both lungs. Streptococcus was detected from a throat swab. Levofloxacin was administered to fight the infection, methylprednisolone to fight the inflammation, and thalidomide to alleviate the vascular inflammatory reaction in addition to pyridostigmine and immunomodulatory therapy. However, 3 days later, the patient progressed to severe dyspnea, wheezing and difficulty with expectoration. Emergency intubation and mechanical ventilation were administered. Aspergillus was detected after bronchoalveolar lavage. Immunoglobin and voriconazole were given. Four days later, the symptoms resolved and the intubation was detached. Most of the infections in the lungs were resolved according to a chest CT. The pain in the mouth was also alleviated.\nAfter a multidisciplinary discussion, the patient’s tentative diagnosis was paraneoplastic pemphigus and the myasthenia symptoms caused by the pancreatic tumor. Myasthenia gravis, in turn, led to the patient’s inability to excrete sputum. If the pancreatic tumor could not be removed, the symptoms would not completely remit, and the symptoms due to myasthenia gravis would also continue to aggravate, finally leading to the occlusion of the respiratory tract. Therefore, the patient was transferred to general surgery. During the surgery, a 4 × 5 cm dark-red tumor with medium texture and clear boundaries was detected in the pancreatic tail (Fig. ). The tumor was close to the splenic artery and vein, and the spleen was normal. Postoperative pathology confirmed the tumor was a follicular dendritic cell sarcoma with immunohistochemistry showing CD21(+), CD23(+), CD138(+), SMA(+), Des(+), CD117(−), DOG-1(−), S-100(−), CD34(−), CK(−), EBER and EBV(−)(Fig. a-c).\nThe patient continued to be treated with antifungal and anti-infection therapy. Twelve days after surgery, the patient developed sudden heart palpitation, discomfort and difficulty in breathing. Mechanical ventilation was again administered. However, the patient died of inability to excrete sputum and occlusion of the respiratory tract. |
A 60 years old separated Muslim female of middle socioeconomic status was referred from department of emergency medicine. She had multiple unpredictable, spontaneous episodes that would start suddenly, severity reaching to its peak after about 15 min and characterized by apprehension, pounding heart, difficulty in breathing, nausea, abdominal distress, fear of dying, dizziness, tingling sensations and sweating. Each episode would last up to two hours, followed by generalized body ache and tiredness for days. Symptoms started 3 years back in frequency of four or more episodes per week. Except for the hospital emergency room visits, she remained at home most of the time to avoid any episode away from home and to take a rest. She had stopped working, would remain preoccupied with future recurrence of episode and was sad due to these episodes. She did not report loss of interest, slowness in activities or worthlessness. Her sleep and appetite were reduced markedly. Mental status examination corroborated the history. She scored high on the Panic Disorder Severity Scale (PDSS=19, markedly ill). Physical examination and investigations (thyroid function test, fasting and post prandrial blood sugar, urine drug screening and electrocardiography) were within normal limit.\nIn the past, she had three episodes of severe major depression; received antidepressants (escitalopram 20 mg) and electroconvulsive therapy and maintained well after discontinuation of medication. There was no significant personal history or family history of mental illness.\nA diagnosis of panic disorder with agoraphobia was made. Tablet clonazepam 0.5 mg was started and optimized to 2 mg in two divided doses. Due to daytime drowsiness, the dose could not be increased further. The severity of symptom improved mildly, but the frequency of episodes remained the same (PDSS=16). Tablet sertraline 25 mg was added and increased by 25 mg every two weeks till 75 mg, but no improvement observed. At 100 mg the patient developed severe nausea, giddiness and loss of appetite, hence it was stopped and tablet amitriptiline 12.5 mg was started. The patient reported improvement in adverse effect, but all adverse effects reappeared when the dose hiked to 25 mg after a week. Similarly a trial of escitalopram (started with 5 mg for a week, then increased to 10 mg/day) and desvenlafaxine sustained release (started with 25 mg/day for a week, then increased to 50 mg/day) was also given for three weeks each, but no improvement was observed. Later tablet paroxetine control release was added (started with 12.5 mg/day and optimized to 25 mg/day). The number of episodes reduced by 1–2 per week, but the severity of symptoms did not change over 4 weeks (PDSS=15). With this improvement she started doing household work occasionally. An attempt to increase by 12.5 mg resulted in severe nausea and decreased appetite. Since clonazepam and paroxetine combination was helpful in symptom control, both were continued. A trial of adding tablet propranolol 40 mg/day, etizolam 2 mg/day, olanzepine 7.5 mg/day, risperidone 2 mg/day and amisulpride 50 mg/day for three weeks each did not bring further improvement. Finally, keeping in view of noradrenergic property tablet atomoxetine 5 mg was added in the morning and afternoon. She reported significant improvement in severity of symptoms and frequency of episodes (PDSS=8). After 4 weeks, the dose was increased to 10 mg and both symptoms and frequency improved markedly (PDSS=5). She resumed her routine and did not report any side effect. She was later given relaxation training and breathing exercise. On follow-up, she was maintaining well without any significant side effect.\nIn summary, initially patient partially responded to clonazepam. When clonazepam was added with sertraline, escitalopram, desvenlafaxine, she did not improve significantly until paroxetine was added. When clonazepam-paroxetine combination was added with propranolol, etizolam, olanzepine, risperidone, and amisulpride, the symptom remission did not occur until a trial of atomoxetine was done (). |
A 44-year-old male without any specific medical history visited the emergency department of our hospital with complaints of a headache and irritability that had been preceded by a fever for the past five days. After several hours, he had a generalized tonic seizure and respiratory insufficiency requiring endotracheal intubation. The cerebrospinal fluid analysis showed a white blood cell count of 45/mm3 (lymphocyte 92%), protein level of 90.1 mg/dL, and glucose level of 46 mg/dL. On neurological examination, he showed a stuporous mental status and flaccid grade 3 paralysis in both upper limbs and grade 1 in both lower limbs. We used the Medical Research Council (MRC) grading. He was generally areflexic, and there was no pyramidal tract sign.\nAn initial brain MRI showed patchy and subtle T2 hyperintensity of both the hippocampal gyri and left thalamus. Follow-up imaging performed on the 28th day revealed more marked and extended lesions in the bilateral hippocampal gyri, thalamus, and basal ganglia (). At that time, nerve conduction studies (NCSs) showed slightly decreased amplitudes of bilateral median and ulnar compound motor action potentials (CMAPs) with normal distal latencies and conduction velocities. Furthermore, the somatosensory evoked potentials of median and tibial nerves revealed normal latencies. The diagnosis of JE was confirmed by positive JE virus IgM in enzyme-linked immunosorbent assay (ELISA) and rising titer in reverse transcription polymerase chain reaction on the 31st day and 40th day, respectively.\nOn the 62nd day, the patient was transferred to the rehabilitation unit. The motor power was grade 0 to 1 in the right upper and lower limbs, grade 2 in the left upper limb, and grade 3 in the left lower limb in terms of the MRC grading and profound muscle wasting was noted. The patient showed a mixed pattern of the deep tendon reflex (DTR) as follows: hyperactive knee jerk as opposed to hypoactive biceps, triceps and ankle jerk. His score of Modified Barthel Index (MBI) was zero.\nOn the 71st day, follow-up NCSs and electromyography (EMG) was performed using Medelec Synergy EMG equipment (Oxford Instrument Medical Ltd., Surrey, UK). It revealed decreased amplitudes of bilateral median CMAPs () and profuse abnormal spontaneous activities (ASAs) in all sampled muscles of the upper and lower limbs, as well as the trunk (). The motor evoked potentials from both the abductor pollicis brevis and abductor hallucis muscles revealed decreased amplitudes of evoked potentials. A whole spine MRI on the 77th day showed syrinx formation at the C5 level of the spinal cord on the T2-weighted image (). A follow-up brain MRI and diffusion tensor tractography on the 86th day demonstrated an improvement in lesions of the hippocampal gyri, thalamus, and basal ganglia. In addition, the corticospinal tract revealed preserved integrity of the tract (). After physical and occupational therapy with sessions twice a day, five days a week, motor power was improved, progressing to grade 3 in the upper limbs and grade 3 to 4 in the lower limbs in terms of the MRC grading, and MBI also improved to 23 at discharge on the 104th day. |
A healthy looking, 50-year-old Nepali man came to our clinic with a complaint of multiple growths on his scrotum for 15 years. The growths started as a single lesion on the right side of his scrotum, with the gradual appearance of similar lesions on other parts. Several of these lesions coalesced at various places to form large-sized nodules. The condition was mostly asymptomatic with an occasional complaint of itching. There was no history of pain, burning sensation, trauma, ulceration, or discharge. The lesions did not interfere with urination or sexual activities. He was worried because of the increasing size of the growth and hence came to us for advice. He did not give a history of any systemic illness including metabolic, autoimmune, or malignant disorders. There was also no history of a similar complaint in his family.\nOn physical examination, multiple pink to brown nodules ranging in size from 0.5 × 0.5 × 0.5 cm to 3 × 3 × 1 cm involving almost half of his scrotum were noticed (Fig. ). The skin over the nodules was shiny with several yellowish points indicative of underlying calcium deposition. The skin surrounding the nodules, testis, and penis was normal on palpation. The nodules were painless and firm in consistency. On laboratory examinations the following were found to be within normal limits: serum calcium, phosphorus, parathyroid hormone, and vitamin D hormone levels; uric acid; alkaline phosphatase; and lipid profile. Based on clinical features and laboratory reports, a diagnosis of ICCS was made.\nHe was advised a scrotectomy under spinal anesthesia, which he refused. The nodules were excised under local anesthesia in several sittings. The skin was sutured using chromic catgut (4–0). His postoperative period was unremarkable with good cosmetic result and no evidence of recurrence in a 1-year follow-up period. The cut section of nodules showed solid white to yellow homogenous areas. Histopathological examination revealed skin tissue lined by keratinized stratified squamous epithelium. The underlying dermis had areas of fibrosis and calcification (Fig. ). Numerous multinucleated giant cells were also seen (Fig. a and b). An obvious cystic structure was absent. |
Our patient was an 18-year-old male who presented to the emergency department with a complaint of approximately 24 h of pelvic pain. The symptoms were worsening and associated with urinary retention, nausea, and anorexia. The pain was exacerbated by movement. He reported similar symptoms approximately 1 month prior, with a negative workup by his primary care physician at that time. Past medical history was significant for intermittent loose stools, anal fissures, and a prior cyst in his neck. Surgical history included a colonoscopy as part of a workup for hematochezia several years earlier, which diagnosed an anal fissure. Excision of a reportedly benign neck cyst was also completed previously; however, no pathology was available.\nOn presentation, he was a well-appearing young adult male in mild distress. He was afebrile, and his vital signs were within normal limits, without evidence of tachycardia, tachypnea, or hypotension. His abdomen was soft but tender to palpation in the right lower quadrant, without evidence of generalized peritonitis. Lab values were insignificant except for leukocytosis (WBC 17.4 k) and mild hyperglycemia (blood glucose level 124 mg/dl). Computed tomography imaging obtained prior to the surgical consult demonstrated dilation of the appendix up to 11 mm with periappendiceal fluid (Fig. ) and a 3-cm abscess adjacent to the appendiceal tip (Fig. ) consistent with appendicitis with perforation and locally contained abscess.\nTreatment options included appendectomy, treatment with antibiotics, and percutaneous drainage of the abscess, all of which were discussed with the patient and his family. After considering options, the patient and team elected to proceed to the operating room for laparoscopic appendectomy and drainage of the abscess. Antibiotic treatment with piperacillin/tazobactam (Zosyn) was initiated and the patient brought to the operating room and placed under general anesthesia for the procedure. Operative findings included purulent fluid throughout the peritoneal cavity with the appendix laying down in the pelvis. Appendiceal inflammation with obvious perforation to the appendiceal tip and adjacent abscess was noted. The patient’s postoperative course was significant for persistent nausea for 12 h after the procedure, which was treated with antiemetics and resolved. He was discharged to home on postoperative day #1 with a plan to complete a 10-day course of oral amoxicillin/clavulanic acid (Augmentin).\nSeveral hours after his discharge, an urgent call was received from the pathologist reviewing the appendix specimen. Surprisingly, the appendix demonstrated a high grade transmural lymphoid malignancy with extra-appendiceal deposits (Figs. and ). The pathological diagnosis was initially classified as Burkitt lymphoma, which was later reclassified based on additional pathologic staining as a B-cell lymphoma with features between diffuse large B-cell lymphoma and Burkitt lymphoma. Positive tumor markers included CD20 (Fig. ), CD10 (Fig. ), BCL6, and Ki67. Urgent surgical follow-up and hematology/oncology consultation was obtained.\nGiven the Burkitt-type features and the potentially rapid progression of a Burkitt lymphoma, the decision was made to treat as a confirmed Burkitt lymphoma. The patient promptly underwent PET scanning, lumbar puncture, and port placement. PET imaging revealed no evidence of distant disease. He also had sperm banking performed to preserve the potential for future fertility. After sperm banking, the patient underwent a total of four cycles of cyclophosphamide, vincristine, doxorubicin, high-dose methotrexate, ifosfamide, etoposide, high-dose cytarabine (CODOX-M/IVAC) chemotherapy with an excellent response. Now more than 30 months out from treatment, he remains in complete remission. |
A 73-year-old man was referred to our hospital complaining of having had bloody stools five to seven times/day for 1 month. He had no noteworthy medical or familial history, including inflammatory bowel diseases. Colonoscopy showed moderate mucosal inflammation throughout the rectum to the sigmoid colon and multiple erosions from the sigmoid colon to the cecum. The findings also included a well-circumscribed raised tumor, which was revealed to have a type IV to VI pit pattern, 15 mm in diameter, in the sigmoid colon (Figure ). Step biopsying was performed at 18 points from the rectum to the terminal ileum, there being no findings of dysplasia lesions microscopically. The pathological findings revealed UC Matts’ grades 3 to 4 in the rectum to the sigmoid colon and Matts’ grades 1 to 2 in the left-sided colon to the cecum. He was given mesalazine (2,400 mg/day) as the initial medical treatment. Endoscopic mucosal resection was also performed to remove the sigmoid colon tumor at 1 month after the initial diagnosis. Histological examination showed a 15 × 10-mm well-differentiated adenocarcinoma with submucosal deep invasion (4,000 μm) that detect diffusely p53 protein accumulation in immunostaining. There was no intravenous or lymphatic invasion microscopically, and the horizontal and vertical margins were negative. The circumference mucosa around the cancer lesion did not show dysplasia, and the circumference and unaffected UC mucosa were considered negative for the p53 protein overexpression because only a few weakly positive cells were detected (Figure ).\nFor this case, additional surgical resection with lymphadenectomy was required because of the submucosal deep invasion. At 3 months after the initial diagnosis of UC, the bloody stools had disappeared, and clinical improvement was attained with mesalazine (3,600 mg/day) and prednisolone (15 mg/day). Also, an endoscopic examination showed improvement and Matts’ grade was 2 to 3 in the rectum to the sigmoid colon pathologically. We performed laparoscopy-assisted sigmoid colon resection with lymph node dissection. The decision to perform partial resection was made for two reasons. First, the initial diagnosis was sporadic cancer. Second, his UC was well controlled with no precious history, and his colon was not likely to develop dysplasia or colitic cancer. Sporadic cancer was diagnosed based on the distinction from colitic cancer: late onset and short duration of UC clinically, no characteristic endoscopic findings of colitic cancer, no poorly differentiated adenocarcinoma or signet-ring cell carcinoma, and no detection of dysplasia pathologically. In addition, his UC was well controlled with medical treatment and the unaffected UC mucosa did not detect p53 protein overexpression, which has been reported a predictor of dysplasia and colitic cancer within the next few years. The resected specimen showed no residual carcinoma tissue at EMR sites in the sigmoid colon. The examined 38 lymph nodes showed no evidence of a metastatic carcinoma. The postoperative clinical course was uneventful. We added granulocytapheresis (GCAP) therapy at 1 week after operation, in order to prevent the UC from getting worse and to reduce the amount of steroids. One year after the operation, there was no evidence of cancer recurrence, and the UC was in the remission state with only mesalazine (3,600 mg/day), that is, no steroid therapy. |
A 69-year-old male ex-smoker presented to the emergency department with acute-onset right-sided chest pain with dyspnoea. His past medical history included chronic obstructive pulmonary disease stadium-3, well controlled with medications. On presentation, his oxygen saturation was 93%. Physical examination of the patient showed no abnormalities. Laboratory findings showed a normal full blood count, normal venous blood gas and C-reactive protein levels, and no evidence of clotting disorders. Conventional chest radiography showed no abnormal shadows. The patient was admitted to our hospital for further management. On Day 2 of admission the patient’s general condition deteriorated. A computed tomography (CT) chest angiogram was performed which revealed a 5.7 × 4.2 × 5.0 cm mass in the right pulmonary artery; no enlarged lymph nodes or signs of metastasis were found ().\nAfter discussion with several radiologists, a decision was made to manage the patient as a case of thromboembolism occlusion in the right pulmonary artery. He received appropriate anticoagulation therapy, but no improvement occurred. A follow-up CT chest angiogram was carried out 2 weeks later, which showed no improvement; however, a new finding of 1.5 cm pleural fluid in the right lung was discovered ().\nA decision was made to proceed further with magnetic resonance imaging (MRI) of the chest which revealed increasing pleural fluid with intraluminal filling defects involving the right pulmonary artery, citing pulmonary thromboembolism as the main differential diagnosis (). A PET-CT scan was performed after a multidisciplinary conference, which revealed a large invasive obstructing homogenous mass in the right pulmonary artery with high fluorodeoxyglucose (FDG) uptake of 25.2 SUV max, no FDG uptake in mediastinal lymph nodes or other organs; the differential diagnoses included pulmonary thromboembolism and an intrapulmonary artery tumour (). The patient underwent endoscopy-guided biopsy of the mass and histopathology was consistent with the diagnosis of non-small-cell carcinoma. The patient is currently receiving ongoing chemotherapy and radiotherapy. |
A 52-year-old Caucasian male was referred to our department for surgical intervention due to ileal stricture as a complication of CD. The patient reported no past medical history, but he could recall a few episodes of bloody diarrhoea during the three-year period before the CD diagnosis was established; diagnostic evaluation with colonoscopy was negative for gastrointestinal tract abnormalities at that time. He had shown poor compliance with the proposed medical treatment, and he had not received any kind of medication since the onset of CD. The index colonoscopy, at which CD was diagnosed, revealed an area of luminal narrowing in the ileum at approximately 70 cm proximally to the ileocaecal valve. Biopsies were taken, and the pathologic report was indicative of CD.\nOn admission, one day before surgery, the patient was afebrile, with regular heart and respiratory rates. During abdominal examination, he had regular bowel sounds with no tenderness or other signs of peritoneal inflammation, whereas the digital rectal examination did not reveal any pathological findings. Laboratory tests revealed a normal haemoglobin level of 14.6 g/dl, a normal white blood cell count of 8.8 x 103 cells/μL, a platelet count of 216 x 103 cells/μL, a normal CRP level of 0.1 mg/dl and an albumin level of 4.6 g/dl.\nThe extent of disease was preoperatively assessed with ileo-colonoscopy and magnetic resonance enterography (MRE). The aforementioned stenotic region in the ileum at approximately 70 cm proximal to the ileocaecal valve was present during ileo-colonoscopy; there was an additional finding of a large ulcer in the terminal ileum, which was marked with blue dye (). The biopsies showed histologic features of mild chronic ileitis without indices of dysplasia or malignancy. The MRE revealed a long ileal segment demonstrating asymmetric mural thickening for a length of approximately 10 cm, with a homogenous enhancement pattern and imaging findings in keeping with possible pseudosacculations/pseudodiverticula formation and without prestenotic dilatation ().\nThe patient underwent three-dimensional laparoscopy (3D HD Storz system, Germany), where segmental resection of the affected part of the ileum (approximately 30 cm) was performed with end-to-end double-layer ileo-ileal anastomosis. During careful inspection of the small and large intestine for lesions compatible with CD, we found multiple non-inflamed diverticula along the jejunum extending from the Treitz ligament to the proximal ileum. (, Video 1). Our patient had an uncomplicated post-operative period and was discharged on the fifth post-operative day.\nHistopathological examination of the specimen showed focal inflammation and focal crypt architectural distortion compatible with CD in the active phase. The final diagnosis of the presented case was the stricturing phenotype of CD in the terminal ileum (based on the Montreal Classification of CD) with concomitant multiple SBD. The patient was referred to his gastroenterological team for further consultation regarding the appropriate post-operative management. At the 10-month follow-up, our patient was asymptomatic and without new episodes of intestinal haemorrhage. |
A 23-year-old female involved in a motor vehicle collision was airlifted to our center. The initial Glasgow Coma Scale score was eight at the scene. Our trauma team which is led by an experienced trauma surgeon includes emergency room (ER) attending, 2 ER residents, 3 general surgery residents including the chief resident of surgery, anesthesiology senior resident, orthopedic resident, radiology resident, experienced ER nurses, and the X-ray technicians.\nUpon arrival to the Emergency Department she had completely lost her vital signs. The Focused Assessment of Sonography for Trauma (FAST) examination revealed no cardiac motion and fluid in the abdomen. In the first 2 minutes after arrival, EDT was performed. There was very little blood in the heart, and no active source of bleeding was found in the chest. Direct cardiac massage was started followed by initiation of the massive transfusion protocol. Three units of packed red blood cells (PRBCs) were given rapidly during the Emergency Department admission period. Vital signs returned after a brief period (about 2 minutes) of direct cardiac massage. She had obvious, open pelvic fractures () with a bleeding perineal wound. The bleeding was controlled by external packing with gauze. The patient was then taken to the operating room (within 15 minutes of arrival), where a damage control laparotomy was performed. Upon entering the abdomen, a large amount of blood was noted, and an expanding pelvic hematoma was packed. The chest and abdomen were left open and a negative pressure dressing was applied. Resuscitation continued in the operating room with six units of warmed PRBCs, four units fresh frozen plasma (FFP), one unit of apheresis platelets, three liters of crystalloid, and two liters of albumin. The patient was taken to the intensive care unit (ICU) for continued resuscitation and rewarming. The patient’s initial temperature in the ICU was 94.6 F with a serum lactate of 5.7 mmol/L. In the ICU, 27 units of PRBCs, 18 units of FFP, and two units of cryoprecipitate were administered in a resuscitative fashion. The patient also received a dose of factor 7. She was on three pressors (levophed, dobutamine, and vasopressin). She received 500 cc of albumin and 300 cc of crystalloid during this time at ICU. When she was more stable, she was taken to the Interventional Radiology (IR) suite and underwent angio-embolization of the left internal iliac artery to stabilize the pelvic bleeding (). On head CT-scan, she was noted to have an intraparenchymal hemorrhage, and an intracranial pressure (ICP) monitor was placed, which measured values in the 13-15 mmHg range. Once stabilized, patient returned to the operating room for re-exploration. The chest was closed. The abdomen was explored and the pelvic hematoma was found to be smaller and stable. Clots over the spleen and a large splenic laceration with active bleeding were noted, and a splenectomy was performed. The left ovary was found to be ischemic and was removed. An intraperitoneal bladder rupture was repaired. Negative pressure dressing was reapplied to the abdomen. Intraoperatively, one unit of PRBC, six units of FFP, and two units of packed platelets were given. Within the first 24 hours the patient received a total of 36 units of PRBCs, 28 units of FFP, three units of apheresis platelets, 3300 milliliters of crystalloid, 2500 milliliters of albumin, and two units of cryoprecipitate. Two days later the patient underwent abdominal closure. She was transferred to the floor after this operation. Following that, orthopedic surgeons repaired the left acetabular fracture. She has continued to do well and was discharged after 24 days with an intact neurological status. |
A 52-year-old married lady presented to our outpatient department with a three months history of erythematous patches over the left side of the breast. The lesion was treated as an eczema by her previous dermatologist, with combinations of moderate to potent topical steroids and topical antifungals, but there was no response with the topical treatment. She had also experienced some weight loss over the last three months.\nOn examination ill-defined, erythematous macules and plaques were seen over the left breast []. There was no evident oozing, crusting, or scaling. There was no nipple retraction on the involved side. No definite mass was palpable in breast. Left axillary lymph nodes were enlarged. Medical history was negative regarding diabetes mellitus, hypertension, or any other gastrointestinal disturbances. A complete blood count and routine biochemistry analysis showed normal results. Hormonal assay showed low estrogen levels. Luteinizing hormone (LH), follicle stimulating hormone (FSH), and prolactin levels were within normal limits. Ultrasonography and mammography results were not significant. Chest radiography was within normal limits.\nFine-needle aspiration cytology (FNAC) was done with the suspicion of inflammatory breast carcinoma. As no definite mass was palpable; the FNAC was done from the each breast quadrant underlying the eczematous area. The FNAC smears were of low cellularity, but showed the presence of few dispersed highly atypical cells having marked nuclear abnormalities compatible with carcinoma cells. Afterward, core needle biopsy from breast was done, which showed occasional intravascular malignant cells in adipose tissue.\nMultiple skin punch biopsies were also evaluated from the eczematous areas; all of which showed emboli of carcinoma cells in dermal and subcutaneous blood vessels [Figures to ]. In addition, dermal extravascular invasion was present focally. Moderate perivascular lympho-mononuclear cell infiltrate was also present around many of such vessels containing tumor emboli []. On immunohistochemistry evaluation, the tumor cells stained with CK7 and CKAE1/AE3 and were negative for estrogen receptors (ER) and progesterone receptors (PR).\nWe referred the patient to a specialized oncology center, where she received sequential treatment with chemotherapy. After that the patient was lost to follow up. We contacted her family later on, and got the news of her death while on chemotherapy treatment. |
A girl aged 6 years reported with her mother to the Department of Oral Medicine and Radiology of a Tertiary Care Dental Hospital with the chief complaint of inability to open mouth along with a burning sensation of mucosa while taking spicy food for 6 months. The medical history was non-contributory. The patient reported a habit of chewing areca nut 3 to 4 times a day for the past 4 years. A long-standing history of chewing areca nut was present in her grandmother who infused this habit in her granddaughter not knowing the harmful effects of the same. General physical examination was non-contributory. Extraoral examination revealed a restricted mouth opening of 9 mm. Intraoral examination revealed blanching of upper and lower labial mucosa, bilateral buccal mucosa, and palate. There was depapillation of the anterior dorsal surface of the tongue (). The tongue movements were restricted and tongue protrusion was 28.52 mm. Vertically thick fibrous bands were palpable on bilateral buccal mucosa, pterygomandibular raphe, hard and soft palate. Positive history of chewing areca nut along with clinical findings led to a provisional diagnosis of OSMF.\nAn incisional biopsy was performed from the right buccal mucosa and histopathological examination showed parakeratinized stratified squamous epithelium with a short blunt to flattened rete ridges with stromal tissue composed of densely bundled collagen fibers, and juxtaepithelial hyalinization (). The overall picture was suggestive of highly advanced OSMF.\nThe patient and her mother were counseled regarding the adverse effects of chewing areca nut and the potential to cause oral cancer. The patient was advised to stop chewing areca nut. She was treated with sesame oil pulling for 5 minutes daily along with topical application of triamcinolone acetonide (0.1%) and curcumin tablet 300 mg once daily. The patient was given a sesame oil sachet and was instructed to perform oil pulling every day on an empty stomach by emptying the entire 10 mL of oil and swishing it in the mouth for at least 5 minutes without swallowing the oil. This was followed by spitting the oil and brushing the teeth. The patient was refrained from eating anything for at least 30 minutes. The patient was followed up at a regular interval of 1 month up to 6 months followed by follow-up at an interval of 3 months thereafter. She has stopped chewing areca nuts and showed improvement in symptoms. After 3 years of follow-up, the mouth opening is 22.29 mm () and tongue protrusion is 33.39 mm (). Patient is still under follow-up. |
A 21-year-old female patient came to our service with a complaint of unilateral right-onset headache associated with diplopia initiated 6 months earlier. She had no personal or family remarkable antecedents. She never smoked. Six months earlier, the patient started to experience one-sided right throbbing headache. She denied nausea, vomiting, or photo- or phonophobia. Fifteen days after the pain onset, she noticed double vision and medial deviation of the right eye, which forced her to wear an eyepiece to perform her activities and drive. She went to several centers and used various medications such as paracetamol, nonsteroidal anti-inflammatory drugs (NSAIDs), opioids, and triptans without improvement. Three months earlier, she started using dexamethasone 4 mg daily with partial pain control but maintenance of diplopia.\nAt the examination, the patient had cushingoid face, violaceous striae, and right VI cranial nerve palsy with no other neurological changes. Blood tests were normal (). A contrast-enhanced MRI scan of the brain did not show any remarkable features (). A spinal tap released crystalline cerebrospinal fluid (CSF) with an opening pressure of 14 cm of water. Biochemical, microbiological, and cytological analyses of the CSF were normal (). CT scan of thorax did not show any evidence of lymphoma or sarcoidosis.\nPrednisone 1mg / kg was then started. With one week of treatment, complete reversal of ocular paralysis and remission of pain were observed. However, when the corticoid was gradually withdrawn, the patient returned to pain and returned to paralysis of the VI right pair. The prednisone was increased again to 1 mg / kg this time with reversion of ocular paralysis but without pain control. Several prophylaxis attempts were made with beta-blockers, calcium channel blockers, topiramate, and tricyclics without any symptomatic control that would allow corticosteroid withdrawal.\nThe pregabalin 150mg daily was then introduced. With 7 days of medication onset there was already an important remission of pain. With 15 days of pregabalin initiation, the retitration of prednisone was started without any intercurrence and the patient reversed the exogenous Cushing syndrome. Pregabalin was maintained for one year and retracted. Currently, the patient has been free of pain for 2 years. |
A 10-day-old male infant was referred to our hospital because of suspected congenital hypothyroidism. The patient presented with symptoms of airway obstruction, such as an inspiratory stridor and retracted breathing. A hormonal test revealed subclinical hypothyroidism with a free thyroxine level (1.44 ng/dL) within the reference range, although the thyroid stimulating hormone (TSH) level (34.6 μIU/mL) was increased beyond the normal range. Laryngo fiberscopy revealed a lingual mass compressing the epiglottis (Fig. ). Enhanced computed tomography (CT) and thyroid scintigraphy revealed that the mass was an ectopic thyroid with the absence of a normal pretracheal thyroid gland (Figs , ). The patient received oral levothyroxine at a dose of 12 μg/kg/day for 4 weeks to lower the TSH level and reduce the volume of the ectopic thyroid tissue. However, we observed no reduction in the volume of the thyroid tissue and a concomitant progression in his symptoms of airway obstruction. He underwent surgery to relieve the airway obstruction when he was 2 months old. Under general anesthesia, nasotracheal intubation was performed in a sniffing position, and a transverse skin incision measuring 2.5 cm was made at the level of the hyoid bone. We split the hyoid bone at the midline, dissected the base of the tongue towards the foramen cecum, detected the ectopic thyroid mass, and suspended the mass by suturing it to the hyoid bone (Fig. ). We used 5–0 monofilament absorbable sutures and sutured between the lingual thyroid and the hyoid bone. The bite length of both the lingual thyroid and hyoid bone was about 3 mm. The points of suturing were to the lateral side of the lingual thyroid and to the front of it. The total number of suture threads was 3. The degree of suspension of the ectopic thyroid was guided by an intraoperative laryngo fiberscopy to confirm the complete elevation of the epiglottis. The patient was not extubated until postoperative day 4 and needed noninvasive positive pressure ventilation until postoperative day 22. Laryngo fiberscopy performed 6 months postoperatively revealed the complete disappearance of compression of the epiglottis by the lingual mass, and CT performed 8 months postoperatively also revealed the relocation of the lingual thyroid gland towards the hyoid bone (Fig. ). When the patient was 2 years 6 months old, his height was 94.1 cm(1.4 SD), weight was 14.0 kg(1.0 SD), free T3 was 2.97 pg/mL, free T4 was 1.48 ng/dL, and TSH was 4.178 μIU/mL. He was taking daily levothyroxine 4.5 μg/kg/day and had been kept in the euthyroid state. Since we were able to preserve his thyroid gland (which is his only functioning thyroid tissue), the postoperative control of his thyroid hormone status was relatively easy. The surgery was complicated by the development of a salivary fistula that was spontaneously resolved 5 months postoperatively. |
A 70-year-old man presented with 3 days of loose watery stool, worsening generalized weakness, 1 day of confusion, and inability to walk. He had a history of chronic medical problems including asthma/chronic obstructive pulmonary disease (COPD) requiring 4 L of home oxygen therapy, rheumatoid arthritis, sarcoidosis, and chronic kidney disease. He was on long-term 17.5 mg methotrexate weekly and 10 mg prednisone daily.\nVital signs recorded on admission included normal temperature with normal heart rate and blood pressure. On initial physical examination, he was noted to be awake but lethargic and had poor oral hygiene with multiple dental caries. On auscultation, there was reduced air entry into his lungs, and bilateral wheezing, and his abdomen was tender to palpation. He was noted to have extensive bruising over his left hand and bilateral pitting pedal edema. He was admitted and managed for COPD exacerbation and dehydration due to diarrhea.\nOn admission, he was started on intravenous methylprednisolone and bronchodilator treatments; on day 2, his mental status became more altered. He was later intubated urgently after failure of bilevel positive airway pressure (BiPAP) trial for acute on chronic hypercapnic respiratory failure. He was also started on diuretics initially and later hemodialysis for acute kidney injury. After 3 days of intubation, his mental and respiratory status had improved remarkably, and he was successfully extubated on day 5 of admission.\nOn day 9 of admission, he developed fever of 38.7 °C. Blood and urine cultures were collected, and he was promptly started on empiric vancomycin, cefepime, and metronidazole.\nBy day 10, his mental status declined, and he was again in hypercapnic respiratory failure. He failed BiPAP trial again and had to be re-intubated. At time of intubation, a pool of blood was noted in mouth and hypopharynx and 2.5 L of bloody fluid suctioned from his stomach. He was placed on pantoprazole infusion for suspected gastrointestinal (GI) bleeding and aspiration was strongly suspected. Broad antibiotics that had been started the prior day were continued. A few hours later, norepinephrine infusion and stress-dose hydrocortisone were started due to persistent hypotension. Esophagogastroduodenoscopy revealed esophageal erosion, gastric, and duodenal ulcers.\nOn day 11, he still required high doses of norepinephrine despite resolution of fever. Urine culture obtained on day 9 had >100 000 colony forming units/mL of Escherichia coli. Vancomycin and metronidazole were stopped to target urinary tract infection with E coli. Computed tomography scan of abdomen showed bilateral lower lobe consolidations suspicious for pneumonia.\nBlood cultures obtained on day 9 became positive on the fourth day of culture, with Gram-negative bacilli in one anaerobic bottle of 4 culture bottles, his antibiotic was switched to piperacillin-tazobactam and tobramycin. The isolate was identified 2 days later, on hospital day 14, as Capnocytophaga spp. The infectious disease (ID) team was consulted, piperacillin-tazobactam and tobramycin was discontinued in favor of renally dosed ampicillin-sulbactam. During a discussion with his wife by the ID team on day 15 of admission, she reported having a dog that was not usually in contact with her husband, and she reported that the patient chews tobacco, stores, and then re-chews tobacco that he stored at room temperature for varying lengths of time. Patient’s right upper extremity remained edematous and a venous duplex confirmed suspicion of a deep vein thrombosis in the right internal jugular and right brachiocephalic veins, which was associated with the central venous catheter.\nThe patient was taken off vasopressors on hospital day 16 and extubated on day 17. The patient was treated for 4 weeks with renally dosed intravenous ampicillin-sulbactam for endovascular infection due to the occlusive thrombosis detected while patient had bacteremia.\nUsing 16s rRNA gene sequencing, Capnocytophaga spp isolated was reported to be C gingivalis by Quest Diagnostics, Nichols Institute, Chantilly, Virginia. He was counseled and advised to keep up his dental appointments and stop re-chewing his tobacco. |
In February 2010, a 45-year-old white man was referred to the Oral and Maxillofacial Surgery Department of the Dental Faculty of Gazi University for further investigation and treatment of his existing lesions. His medical history was non-contributory and extraoral examination was within normal limits. The intraoral examination revealed considerable expansion at the right and left posterior vestibular area of his mandible. The overlying gingiva and mucosa in mandible were normal without any clinical signs of inflammation. All teeth had normal vitality. There was no mandibular nerve paresthesia or facial deformation. Orthopantomograph and computed tomography (Fig. ) showed multiple mostly dense mixed radiodense/radiolucent lesions closely associated with the roots of the upper left lateral incisor and canine, the lower left canine, premolars, first and second molars, the lower right second premolar, first and second molars. There was no root resorption or fusion of the lesions to the involved teeth. The occlusal images revealed slight buccal expansion at the molar region on the left and right side of the mandible (Fig. ). Intraoral incisional biopsy was performed. Biopsy specimen of this lesion composed of benign fibro-osseous tissue containing bone which ranges from woven bone trabeculae to cementum like mineralizations (Fig. ). Biochemical analysis of serum alkaline phosphatase, calcium and phosphorus were carried out for differential diagnosis with Paget’s disease and were shown to be within the normal limits. All clinical, radiographic and biochemical features were suggestive of the diagnosis of FCOD.\nBecause of the dense bone with poor vasculature found in FCOD, the periapical infection may progress into osteomyelitis. Therefore, the patient was motivated about the oral hygiene, referred to Prosthodontics Clinic to rehabilitate his edentulous dental arch. He has been followed up over the last 30 months and FCOD has remained asymptomatic (Fig. ). In the period of follow-up, endodontic treatments of the upper left canine, the upper left first molar, the lower left first and second molar, the lower right second premolar with advanced caries were performed. |
An 83-year-old male patient visited our emergency clinic because of a mental change. The initial computed tomography perfusion showed markedly decreased perfusion in the left pons, midbrain, thalamus and PCA territory, and mildly decreased perfusion in the remaining area of the posterior circulation. These findings were suggestive of occlusion of the distal basilar artery. Therefore, he was treated with intra-arterial urokinase thrombolysis for the recanalization of the basilar artery and bilateral P1 segment. Brain diffusion-weighted magnetic resonance imaging showed PCA territory acute infarction (). A physical examination on transfer revealed good grades of motor strength in both the upper and lower extremities. However, he was unable to stand or sit alone for more than 2 minutes because of tremor, and could barely stand unassisted. Tremor from his trunk and both extremities was evident while moving or at rest. His cognitive status was alert on the Korean-Mini Mental Status Examination that scored 14. He was able to obey 2-step commands. Speech evaluation showed a mild decay in vocal loudness, a harsh-strained voice quality and mild degree of dysarthria. Language evaluation using the Paradise Korean version of the Western Aphasia Battery (PK-WAB) showed an aphasia quotient of 72%.\nThe patient was able to voluntarily close both eyes, but was unable to keep both eyes opened simultaneously; either the right or left eye was randomly kept closed (). On verbal command to open an eye, the opened eye closed and the contralateral eye opened. Pursuant eye movements were unrestricted, the vestibulo-ocular reflex was preserved and both horizontal and vertical saccades were normal. There was no facial sensory change or weakness. When the closed eye was forced open by the examiner's finger, the examiner felt a forceful contraction of the OrbOcu muscle, and the opened eye closed automatically.\nVisual evoked potential study stimulated both eyes individually and a scalp recording showed prolonged P100 latencies bilaterally (). Blink reflex study showed normal findings on both sides ().\nClonazepam 2.0 mg was administered prior to sleep to control tremors. Tremor of trunk and extremities almost disappeared post-medication, and the sitting and standing balance improved. Sitting and standing endurance also improved. However, abnormal eyelid movement persisted.\nAfter discharge, the patient still complained about winking of his eyes. Bilateral eye tonic closure was presumably caused by focal dystonia of the OrbOcu muscles, and not by LPS weakness. Many reported cases of dystonia induced by cerebrovascular accident have been successful treated with botulinum toxin []. We therefore tried injection of BoNT-A 30U Botox (Allergan, Irvine, CA, USA) in the right OrbOcu muscle. The patient was capable of opening and closing both eyes simultaneously post-injection (). |
A 68-year-old male patient reported with the chief complaint of chronic, dull, localized, intermittent pain in the left mandibular first molar for the past 1 month. The pain aggravated on chewing hard food. There was no history of any radiation of pain. However, the patient gave an account of occasional enlargement of the left submandibular lymph node and mild fever. On examination, clinical probing depth of 8 mm on the buccal surface of the left mandibular first molar along with Grade 3 furcation defect was noted. The tooth had been root canal treated 3 years back and had been restored with a complete metal crow []. The patient was systemically healthy and did not report any oral abusive habits such as smoking, tobacco or betel nut chewing, or alcohol consumption. An intraoral periapical radiograph revealed incomplete obturation of the mesiobuccal root with a broken endodontic file in the root canal along with extrusion of the gutta-percha and furcal perforation []. The IOPA of the concerned tooth revealed the presence of a broken endodontic file and furcal perforation with extruded gutta percha.\nNonsurgical periodontal therapy with complete full-mouth scaling and root surface debridement was initiated. The crown and amalgam core was removed []. The access opening was enlarged and the gutta-percha that was extruding from the perforation was removed. The perforation was sealed internally using mineral trioxide aggregate [Figure –]. The broken H-file was retrieved from the root canal using an instrument removal system. The biomechanical preparation was then accomplished by a step-back technique using 2% sodium hypochlorite and 17% ethylenediaminetetraacetic acid. Obturation was completed, and core build was done with amalgam []. The radiograph at 4 months revealed a significant reduction in the periapical radiolucency at the apex of the tooth []. The gingiva showed no signs of inflammation or bleeding on probing. However, Grade 3 furcation with the horizontal probing depth of 8 mm was persistent and precluded effective plaque control in the furcation area []. Since regeneration of bone in Grade 3 furcation defect was difficult, the surgical resection of the lone remaining lingual cortical plate to create a “tunnel” was planned. The procedure was explained to the patient and a written informed consent was taken.\nFollowing administration of the local anesthetic agent, a full-thickness mucoperiosteal flap was reflected on the buccal aspect with #35, #36, and #37. An external bevel gingivectomy was done on the lingual aspect of #36 to expose the furcation area []. After thorough root surface debridement, osteoplasty and ostectomy were performed using a pear-shaped carbide bur at low-speed and copious saline irrigation in the interradicular bone. The amount of bone removed should correspond to the space required to pass an interdental brush through the furcation region to ensure adequate plaque control [Figure and ]. Care was taken to ensure that a smooth and positive architecture without any bony spicules, sharp bony margins or ledges remained in the furcal space. The flap was subsequently positioned apically and sutured using 3–0 black silk sutures []. The patient was instructed not to brush in the operated area for 15 days. The patient was advised to use an interproximal brush in the tunnel area along with 0.12% chlorhexidine digluconate mouthwash for 4–6 weeks after surgery. Daily use of mouthwash with 0.025% sodium fluoride and tooth brushing with fluoride containing dentifrices was advised.\nThe patient was recalled 15-day postoperatively for suture removal and subsequently at 1, 3, and 6 months []. Follow-up visits showed complete healing of the furcal perforation, with a significant reduction in clinical probing depth and maintenance of good plaque control by the patient with an interdental brush. The periodontal health of the tissues could be maintained even after 6 months of the tunnel preparation and supportive periodontal therapy []. |
A 53-year-old man presented with a gradually increasing mass located in the soft tissue of the oral cavity. The lesion was biopsied, and the pathology report showed increased infiltration of the buccal mucosa with monoclonal plasma cells. Immunochemistry demonstrated positivity for CD138, CIgA, and negativity for CD56, Cyclin D1 and CD20. Therefore, the diagnosis of soft tissue plasmacytoma was confirmed, for which he received localized radiotherapy with a total dose of 40 Gy, due to the absence of systemic disease as the bone marrow biopsy revealed the absence of neoplastic infiltration and serum and urine immunofixation were all negative.\nAfter five years, the patient noticed a painless swelling in his right testis. An ultrasound of the scrotum was performed that showed a hypoechoic mass in the right testicle with increased vascularization, and a normal-appearing left testis (Figure ). The patient subsequently underwent a right radical orchiectomy and the histopathology report showed testicular infiltration by a plasma cell neoplasm with identical immunophenotype (CD138+, CIgA+, CD56-, CD20-, Cyclin D1-) to the primary site in the oral cavity. Subsequently, the patient underwent a bone marrow biopsy that showed the absence of monoclonal plasma cell infiltration, and a PET/CT scan that was negative for reactive lesions suspicious of malignancy. In addition, serum and urine protein electrophoresis, as well as serum-free light chain assay were all within normal range, thus, excluding the presence of systemic disease, while complete blood count and full biochemical profile were normal.\nHowever, after one year, the patient presented again with painless swelling of his left testis that was attributed to disease relapse based on the imaging findings (Figure ). He refused to undergo left orchiectomy, thus he proceeded with systemic treatment based on lenalidomide, bortezomib and dexamethasone. Following 4 cycles of treatment, the patient underwent high dose melphalan with autologous stem cell transplantation. The blood tests of the patient revealed an increase in serum creatinine (1.3 mg/dl with 1mg/dl baseline level), normal calcium levels and normal complete blood count. Complete response was achieved with negative PET/CT scan and negative marrow minimal residual disease assessment. The patient continued on lenalidomide maintenance; however, six months later he was diagnosed with disease relapse in his left testicle (Figure ). A PET/CT scan was then performed, and showed a reactive lesion with an increased SUV max of 7 in the left testis, with no other loci suspicious of disease relapse. The blood analysis of the patient revealed no abnormal values. Since the patient refused surgery, he was initiated with next-line therapy, with bortezomib, cyclophosphamide and dexamethasone, he responded partially and still remains in remission (Figure ), while serum protein electrophoresis, immunofixation and serum-free light chain assay, all remain within normal levels. |
We obtained written informed consent from the patient after surgery to publish this report.
A 60-year-old female presented with chronic pain in the right ankle and foot. She had right foot ligament tear, which included anterior talofibular ligament, calcaneoufibular ligament and posterior talofibular ligament, followed by a modified Brostrom surgery on the right foot in March 2017. However, the patient still felt a painful sensation, the numerical rating scale (NRS) was 10 of 10, at the right foot. She also complained of allodynia, burning and tingling sensation, leg edema, and change of skin color with a dystonic posture of the right foot. The result of electromyography and nerve conduction velocity was no abnormal findings. However, bone scan showed diffusely decreased perfusion, blood pool and bone uptake of right foot and quantitative sudomotor axon reflex test suggest sympathetic postganglionic sudomotor dysfunction or sweat gland abnormality in right distal leg. Department of orthopedic surgery in our institution gave an opinion that there were no joint pathology, bony abnormality and nothing to cause the pain with orthopedic opinions. Following a clinical assessment, she was diagnosed with CRPS type 1 according to the International Association for the Study of Pain clinical diagnostic criteria []. Although she was treated with several medications, physical therapy, lumbar epidural blocks, and lumbar sympathetic ganglion blocks, her symptoms remained intractable.
In August 2018, she was considered for SCS trial. During the SCS trial, strict aseptic techniques and prophylactic antibiotics (cefazolin) were used. A guide needle for an electrode was inserted through the right L1-2 paramedian epidural space, and the tip of the electrode was placed at the T9-10 level. After the induced paresthesia was confirmed at her painful sites, the lead was fixed. During a test period, her pain and allodynia decreased from 9 to 0 on NRS. We implanted a permanent implantable pulse generator (IPG) in a subcutaneous |
A male patient, 25 years old, attended Yonsei University College of Dental Hospital complaining of pain in the maxillary right central incisor (tooth #21), which presented a history of trauma on tooth #21. After clinical and radiological examination, calcified canal was observed to be significant. Under a surgical microscope, localization of root canals was attempted twice but failed as patient continued to show clinical symptoms. Therefore, endodontic microsurgery was suggested, and patient consent was obtained. A CBCT scan was taken and apical radiolucency and completely blocked root canal with intact buccal bone were identified. Alginate impression was taken and poured up in yellow stone to obtain study cast. With conventional root-end resection, vast amount of buccal bone removal was inevitable and therefore, the use of minimally invasive guided endodontic microsurgery by using surgical template, cone-beam computed tomography and 3D printing technology was suggested as an alternative.\nThe study cast made by alginate impression was scanned and transformed to the digital data using tabletop scanner (Identica Blue; Medit Co., Seoul, Korea). Both CBCT data and digital data obtained from patient's study cast were imported to implant planning software (In2Guide; Cybermed Co., Seoul, Korea). Two sets of data were merged for the tooth image, so the surgical template was designed accordingly.\nThe guide template was designed to cover 5 teeth with maxillary left central incisor placed in the middle. Among various guide drills with different diameter contained within In2Guid Universal implant kit (Cybermed Co.), which is compatible with the guide template, anchor pin drill with 1.5 mm in diameter was selected for targeting root apex and sleeves to accommodate anchor pin drill was designed inside the template. The position and direction of sleeve were determined in consideration of approachable drill angulation as well as accessibility for minimum of 3 mm preparation depth. Finally, it was once more confirmed if the drill accurately aims for target root without damaging the adjacent root or surrounding vital structures. () Designed guide template was exported in forms of STereoLithography (STL) file and printed with 3D printer (Objet 260; Stratasys Co., MN, USA).\nLike conventional oral surgery, patient was prescribed amoxicillin (250 mg) and Ibuprofen (400 mg) 1 hour before surgery. Before starting microsurgery, surgical guide was applied to upper anterior area for checking its adaptation. Incisal opening of guide was helpful for fully adaptation between tooth and guide (). The Leubke-Oschenbein flap design was applied after 1 ample local anesthesia (2% lidocaine with epinephrine 1:80,000; Huons, Seongnam, Korea) for minimal invasion. All surgical procedures were performed with an operating microscope (OPMI PICO; Carl Zeiss, Göttingen, Germany) ().\nUnder the application of guide, surgical site was punched 3 mm depth with 2 mm straight rotary instrument ( and ). After removing guide template, punched buccal bone was checked. Only apical buccal bone was prepared again with a No.6 round rotary straight instrument (No. 6; Prima Classic Prima Dental Group, Gloucester, UK) under distilled irrigation (). Exposed root tip was confirmed with methylene blue. And then root tip was finally prepared and removed with diamond high speed bur (). After removing of all inflammatory tissues, the resected root surfaces were then stained with methylene blue and inspected with micro-mirrors (Obtura Spartan, Fenton, MO, USA) under ×20 magnification to detect the canal space. The root-end preparation was made with KIS ultrasonic tips (Obtura Spartan). ProRoot MTA (Dentsply Tulsa Dental, Tulsa, OK, USA) used with the root-end filling material. ProRoot MTA was incrementally placed under the bleeding control, after that, the wound site was closed and sutured with 5 × 0 monofilament sutures. A post-operative radiograph was taken and compared with pre-operative radiograph (). Only 30 minutes was taken for entire operation.\nAfter 1 month follow up, clinical symptom was completely resolved. No other signs of adverse effects around surrounding soft tissues were identified. |
A 21-year-old male was admitted to a local hospital for head trauma and successively underwent left decompressive craniectomy, external fixation of a pelvic fracture, internal fixation of a left femoral fracture, internal fixation of ankle repositioning, tracheotomy, and ventriculoperitoneal shunt. A month later, the patient was transferred to our hospital after being diagnosed with recurrent fever. CSF tests suggested acute septic meningitis (). The patient was empirically treated with 1.5 g of meropenem IV every 6 h and 600 mg of linezolid IV every 12 h. Given that the patient had an intracranial infection, ventricular terminal of the V-P shunt device was retained while the peritoneal terminal drainage tube was moved out of the body, making it an EVD. On the 10th day of hospitalization, CSF culture revealed carbapenem resistant MDR P. aeruginosa (). Antibiotic administrations were adjusted to 500,000 units of polymyxin IV every 8 h combined with intracerebroventricular injection of 50,000 units of polymyxin each day. The patient remained febrile, blood tests revealed leukocytosis, while sputum cultures revealed a MDR Pseudomonas aeruginosa infection. On the 13th day of hospitalization, antibiotic regimen were adjusted to 500,000 units of polymyxin IV every 8 h and 400 mg of amikacin IV every 12 h, combined with an intracerebroventricular injection of 50,000 units of polymyxin every day. After 3 days, urine cultures suggested a fungal infection, and fluconazole was also administered. Two weeks later (30th day of hospitalization), the original shunt was removed and EVD was performed for continued CSF drainage. With 24 days of treatment with intravenous and intraventricular polymyxin, CSF tests still revealed apparent leukocytosis with multiple positive CSF cultures of MDR Pseudomonas aeruginosa. Besides, sputum and feces cultures suggested the presence of carbapenem-resistant K. pneumoniae (CRKP), which was sensitive to tigecycline and CAZ/AVI. Renal functions of the patient were significantly deteriorated. On the 34th day of hospitalization, polymyxin was discontinued since it can exacerbate renal impairments, and antibiotic administration was changed to 2.5 g of CAZ/AVI IV every 8 h and 600 mg of amikacin IV every 12 h. The CSF test normalized and the CSF culture was negative after 6 days of treatment with the new antibiotic regimen. Two weeks later (54th day of hospitalization), with repeated negative results of CSF cultures, the EVD tube was removed and antibiotic administration was discontinued. Then, the patient was subjected to cranioplasty as well as ventriculoperitoneal shunt implantation and transferred to a rehabilitation facility for further treatment. CSF and susceptibility test results for Pseudomonas aeruginosa are shown in and . A summary of the clinical treatment process of Case 3 is shown in . |
The second case shows a 53-year-old female. Clinical and radiographic examination confirmed a unilateral posterior crossbite due a transverse maxillary deficiency with a significant mandibular skeletal deviation towards the side of the crossbite (Fig. ). Treatment objectives.\nSARME was planned to correct the transverse discrepancy followed by arch leveling with lingual appliances and then a second surgery to correct the mandibular asymmetry.\nSimilar to case 1 impressions were obtained and this time the lingual appliances were manufactured by DW Lingual Systems (Bad Essen, Germany).\nDuring the planning for the production of the lingual brackets, it was noted -similar to case 1- that a surgically assisted rapid maxillary expansion takes place. The transverse width of the upper jaw should be adapted to the lower jaw.\nTwo trans sagittal Benefit mini-implants were inserted in the T-Zone. A silicon impression with the transfer caps was taken. The impression was given to the laboratory together with the lingual molar bands. A Hybrid Hyrax [] was then made and laser welded to the molar bands (Fig. ). Similar to case 1, the lingual appliance was indirectly bonded with a dual cured resin and the maxillary expansion appliance was inserted. In this case the molar bands were cemented with a dual cured resin and the hybrid hyrax was fixed to the mini-implants using the Benefit fixation screws. The first lower arch wire 12 NiTi was inserted while in the upper the brackets were secured with a continuous steel ligature in each quadrant (Fig. ). SARME was performed with an activation rate of two quarter turns twice a day until crossbite correction was achieved at two weeks post-surgery (Fig. ). The Hybrid Hyrax was then blocked. The first upper archwire (12 NiTi) was placed four weeks after surgery (Fig. ). After complete leveling and radiographic re-examination the surgery to correct the asymmetry was performed.\nThe patient has a positive overbite and overjet now. The patient shows a good transversal and sagittal occlusion. |
A 64-year-old otherwise healthy female patient presented for the first time in May 2019 for a specialty consultation concerning rare diseases with oral involvement. In this consultation, the patient reported a history of OI type I. Due to this underlying disease, she had experienced frequent fractures since childhood, most recently including a multiple-fragment fracture of the humerus that occurred during a fall at her home.\nThe patient had received alendronic acid p.o. for many years to treat the underlying disease. Two years prior to the consultation, this therapy was replaced with denosumab injections. Approximately six months prior to the consultation, the patient’s last teeth were removed alio loco under perioperative, prolonged antibiosis with plastic coverage. At the time of the consultation, she was fitted with removable maxillary and mandibular dentures. The insufficient support of the mandibular denture caused her discomfort and made it difficult for her to eat. Therefore, she wished to stabilize the prosthesis with implants.\nClinically, the patient presented with an edentulous maxilla and mandible without signs of os liber. The soft tissues were closed and inconspicuous, and there was no swelling or redness. In particular, the mandibular alveolar process showed pronounced vertical and horizontal atrophy (). In addition, the patient exhibited a discoloration of the sclerae, which is characteristic of OI type I (). Preoperative panoramic view, .\nFollowing a risk assessment, the patient was offered the insertion of two interforaminal implants to stabilize the prosthesis. Augmentation measures were not used due to the underlying disease and the patient’s history of drug therapy with alendronic acid and denosumab.\nUnder local anesthesia and perioperative prolonged antibiosis (clindamycin 600 mg 1-1-1) due to penicillin intolerance for seven days in case of known penicillin intolerance, beginning on the day of surgery), a crestal incision was made without relief incisions from regions 35 to 45. After bilateral exposure of the mental nerve, two narrow areas were identified in regions 32 and 44, in which the insertion of two tissue-level implants (Straumann Standard Plus®, Basel, Switzerland, SLActive 3.3 mm × 10 mm) was possible without the use of augmentation measures ().\nThe patient’s postoperative wound healing was unremarkable, and the sutures were removed seven days after surgery. Furthermore, there were no occurrences of dehiscence or signs of drug-associated osteonecrosis. After a healing period of three months, uncovery was performed () so that prosthetic restoration could be carried out with locators () two weeks later.\nSince the surgery, the patient has attended regular follow-ups for one year and exhibited no signs of drug-associated osteonecrosis or peri-implant infection ( and ). The patient tested negative for bleeding on probing at both implants, with probing pocket depths (4-point measurements) of 2-1-3-2 at region 32 and 2-2-2-1 at region 42. Oral hygiene was very good. Radiological control was omitted given the patient’s good clinical parameters. The patient herself described a significantly improved prosthesis fit and an associated increase in quality of life. |
A 69-year-old African American male with a past medical history of hypertension, seizure disorder, but no underlying psychiatric diagnoses, presented to the emergency department with confusion and urinary incontinence. He had had recurrent episodes of hyponatremia of unclear etiology associated with weakness and a fluctuating mental status. Previous records did not exist in our hospital system, and the patient was not able to provide any information regarding the severity, diagnostic workup, treatment and the number of prior episodes. On arrival, his blood pressure was 162/62 mm Hg, the heart rate 70 beats per minute, the respiratory rate 16 breaths per minute and the temperature 98.7 F. Cardiovascular, respiratory and abdominal examinations were unremarkable. He had normal skin turgor with no peripheral edema and no focal motor deficits. Computed tomography of the head was unremarkable for any intracranial findings. In the emergency department, his serum sodium concentration was 117 mEq/l, BUN was 6 mg/dl, creatinine was 0.7 mg/dl and glucose was 96 mg/dl. The urine osmolality was 132 mosm/kg, and plasma osmolality was 250 mOsm/kg. Urine sodium was not checked initially. He received 1 liter bolus of normal saline. A second serum sodium concentration was obtained at 12 h after the bolus, and the level was 127 mEq/l. The patient produced 8 liters of urine in his first 12 h after arrival. Five percent dextrose water (D5W) was then started at 100 ml per hour to relower the serum sodium concentration and to prevent rebound increase. Fifteen hours after the initial normal saline bolus, his serum sodium concentration decreased to 123 mEq/l. His urine osmolality and urine sodium were now 315 mosm/kg and 128 mEq/l, respectively. Additional history obtained after he regained consciousness revealed an inability to maintain oral intake due to poor appetite for 3 months. However, he continued to drink fluids. He was adamant that he only drank occasionally, 2–3 drinks per month, and he denied a history of liver disease. His home medications included amlodipine, lisinopril and phenytoin. His serum sodium concentration was monitored, and the rate of D5W was adjusted to control the rate of increase in serum sodium concentration to no more than 10–12 mEq/l in 24 h and 18 mEq/l in 48 h. The patient was finally discharged at a serum sodium concentration of 130 mEq/l without any neurological sequelae. |
On March 2015, a 22-year-old right-handed male with a 2 month history of right sided weakness and numbness was diagnosed with a primary brainstem tumor on MRI. He was empirically treated with temozolomide, bevacizumab, and stereotactic radiosurgery (SRS). Six months later, while stable disease was noted on brain MRI, the patient was also treated with an additional hypo-fractionated course (~50Gy in 25 fractions over 2 months) of involved field radiation.\nPatient received empiric chemotherapy and radiation therapy for 21 months and follow-up brain MRI on December 2016 revealed a stable, necrotic left midbrain mass lesion measuring 2.5 × 2.1 × 1.8 cm with subacute hemorrhage in the inferior posterior margin [].\nNearly 2 years after the initial diagnosis, the patient presented to the clinic with progressively worsening gait instability and left greater than right weakness. Additional symptoms included transient confusion with malaise and dizziness. Brain MRI at this time revealed progression at medial and inferior margins along with interval mild ventriculomegaly consistent with obstructive hydrocephalus []. Decision was made to place the shunt and resect the tumor in a two-stage procedure during the same admission.\nThe patient underwent an uneventful right occipital ventriculoperitoneal shunt placement with utilization of volumetric image guidance and laparoscopic assistance.\nThe following day, left posterior temporal-occipital craniotomy was performed with an intention to obtain tissue for diagnosis and remove as much of the brainstem tumor as safely as possible. Volumetric image guidance, microscope, neuro-monitoring, and intraoperative MRI were utilized. The brainstem lesion was approached through the posterior temporal-occipital supratentorial plane with sectioning of the tentorium to widen the exposure. The inferior posterior temporal gyrus was partially resected, allowing mobilization and preservation of the vein of Labbe. The midbrain was entered through the lateral mesencephalic safe entry zone. The tumor itself was very firm and moderately vascular. Usual microsurgical tools, including ultrasonic aspirator, were inefficient.\nThe tumor’s firm consistency did not allow us to remove much of the lesion. The outer portions of the mass were very fibrous and could not be mobilized. Progress was very slow. The remaining tumor was “hard as a rock” in consistency, and surgical manipulation would move it as a single block, distorting the entire brainstem. Considering the circumstances, it was felt that the safest choice would be to stop further dissection/tumor removal. Intraoperative MRI showed an approximately 40% decrease in tumor volume, but the peripherally enhancing capsule of the tumor remained unchanged, as expected given the consistency of the tumor encountered intraoperatively [].\nFinal pathology confirmed PA, negative for BRAF mutation or rearrangement, and the patient was started on combination therapy with carboplatin and vincristine. Unfortunately, chemotherapy was complicated with breakthrough seizures and brain MRI revealed symptomatic interval progression of the left midbrain tumor. Carboplatin and vincristine were discontinued, and seizures controlled with levetiracetam, gabapentin, and valproic acid. The patient was subsequently started on a 3 day monthly cycle of cisplatin and etoposide.\nOn May 2018, 14 months after the first operation, the patient presented to the emergency department for worsening headache, double vision, right-sided weakness, and gait ataxia. Clinically, he was noted to have significant right upper extremity weakness to 1–2/5, hypophonia, and rapidly progressing functional decline. Brain CT showed known mass extending from the brainstem to the thalamus, slightly eccentric on the left. A hemorrhagic component within the mass and slight increase in size of the tumor was noted as well [].\nThe patient underwent suboccipital-torcular craniotomy with utilization of volumetric image guidance, microscope, and neuromonitoring. The lesion was approached through the supracerebellar infratentorial corridor through the infracollicular safe entry zone. Initially, the cystic portion was decompressed and motor oil-like fluid evacuated. The cyst walls collapsed and the brainstem relaxed. The solid portion of the tumor in the middle of the caudal midbrain and upper pons was considerably softer than in the first surgery, but more vascular with areas of hemorrhagic transformation. This tumor was successfully mobilized and grossly resected with what appeared to be normal appearing brainstem underneath.\nPostoperative brain MRI demonstrated GTR and marked decompression of the brainstem. Pathology confirmed mainly necrosis and hemorrhage with focal residual PA with little/no proliferation and Ki-67 in MID1 proliferation indices [].\nFive days after surgery, the patient experienced increased somnolence. Head CT revealed new bilateral parieto-occipital subdural and epidural retrocerebellar hemorrhage. The parieto-occipital convexity hemorrhages were likely related to intra- and postoperative brain shift and tearing of the bridging veins. Although supratentorial hematomas were not felt to require surgical intervention, the retrocerebellar hemorrhage was more significant. The patient was subsequently taken up for emergent re-opening of the torcular-suboccipital craniotomy for evacuation of the epidural hematoma. Postoperative CT revealed successful evacuation of the extra-axial hematoma.\nThree months after surgery, follow-up brain MRI demonstrated evolving postoperative changes with no residual/recurrent tumor.\nTwelve months after surgery, the patient’s dysarthria improved. Motor exam revealed persistent right hemiparesis (improved to 3–4/5), arm weaker than the leg. Patient was now able to stand and walk short distances with assistance. Chronic steroids have been successfully weaned off, and the patient had a complete reversal of cushingoid appearance. |
The patient is a 72-year-old man capable of independently performing activities of daily living. Regarding his medical history, he developed gastric ulceration at 18 years of age and underwent partial gastric resection. He was treated with rivaroxaban 10 mg / day for atrial fibrillation. Also, he regularly inhales formoterol fumarate for managing bronchial asthma. He used to smoke 20 cigarettes/day and drink more than three cups of sake between 20 and 65 years of age. He reported no positive history of food or drug allergy.\nApproximately 40 days before admission to our department, the patient developed pain in the lower left abdominal region. Eight days later, he visited a hospital where he underwent non-contrast computed tomography (CT) of the abdomen that showed multiple colonic stenosis. Colon cancer was suspected, and the patient was admitted to the facility immediately. The patient also had fever (38 °C) on admission and, therefore, underwent thoracoabdominal contrast-enhanced CT that showed pulmonary thromboembolism (Fig. ). Therefore, the dose of rivaroxaban was increased from 10 mg/day to 30 mg/day on Day 14 (days numbered from day of admission at the first facility).\nThen, he underwent fasting treatment and received maintenance intravenous fluids. On Day 14 of hospitalization, he underwent colonoscopy that showed stenosis in the hepatic flexure of the transverse colon and a circumferential ulcer of the sigmoid colon. On administration of a contrast, a 55-mm stenosis was found in the transverse and descending colon (Fig. ). Pathological examination of the stenosed colon tissue revealed intranuclear inclusion bodies and a positive immunostaining for anti-CMV antibodies and CMV antigens (CMV DNA viral load was not performed). Consequently, the patient was administered 5 mg/kg ganciclovir (GCV) every 12 h since Day 27. Although the patient’s abdominal pain was relieved by the treatment, the fever was not alleviated.\nAlthough the coagulation profile of the patient was normal on the day of admission (Day 1), an abnormal coagulation profile was seen on Day 25; the international normalized ratio of prothrombin time (PT-INR) was elevated (8.35) and the activated partial thromboplastin time (APTT) was prolonged (170.8 s). As a result, rivaroxaban was discontinued. Up till then, the patient had received a total of 18 units of fresh-frozen plasma (FFP) and 180 mg of vitamin K. However, the coagulation profile had not improved. Although the platelet count was 113 × 109 cells/L on admission, the count began decreasing since Day 25 till it reached 73 × 109 cells/Lon Day 31. Therefore, to further explore the cause of the coagulation abnormality and continue the treatment of CMV colitis, the patient was transferred to our hospital on Day 32.\nOn admission to our facility, the patient’s clinical findings were as follows: Height, 163 cm; weight, 51 kg; body temperature, 36.8 °C; pulse rate, 108 beats/min; blood pressure, 118/92 mmHg; respiratory rate, 12 breaths/min; and oxygen saturation, 90% on ambient air. Breathing sounds were heard with coarse cracks on the dorsal surface of the lungs bilaterally. The heartbeat was irregular, but no heart murmur was heard. The abdomen was flat and soft, and there was no spontaneous pain; however, there was tenderness on palpation in the right hypochondrium and iliac regions. No peritoneal irritation was observed. Bilateral to the chest, approximately 20 scattered erythematous papules (~ 1 cm in length) were found; no superficial lymph nodes were palpable. Purpuric spots and pain were present on the right fifth finger, whereas only purpuric spots were seen on the left second and third fingers (Fig. ). A peripherally inserted central catheter that was placed in the left upper arm at the previous facility was present.\nTable shows the patient’s laboratory data upon his admission to our hospital (Day 35 from the day of admission at the first facility).\nThese were as follows: White blood cell count, 14.54 × 109 cells/L; C-reactive protein, 1847.62 nmol/L; platelet count, 60 × 109 cells/L; and normocytic anemia. There was no significant abnormality in the peripheral blood; however, biliary enzymes were elevated (alkaline phosphatase: 20.02 μkat/L; γ- glutamyltransferase: 1.62 μkat/L). The coagulation disorder was apparent (PT-INR, 4.37; APTT, 154.1 s) but the D-dimer level was virtually unchanged (2.1 mg/L) and the level of fibrin degradation products was normal (3.6 mg/mL). Levels of thrombin-antithrombin complex (2.6 ng/mL) and plasmin-α2 plasmin inhibitor complex (< 0.2 ng/mL) were also normal. However, soluble interleukin-2 receptor (sIL-2R) was elevated (8540 U/mL), factor II activity was marginally reduced (49.1%), factor X activity was reduced to 59.7%, factor V activity was < 1.0%, and ADAMTS13 activity had decreased to 18%. Abdominal CT showed splenomegaly with a maximum splenic length of 9.6 cm and enlargement of axillary, left superior fossa, and paraortic lymph nodes. On Day 1, the patient had a maximum splenic length of 7.6 cm, indicating that the splenomegaly had increased since then.\nFigure shows the clinical course after admission at the first facility. The administration of 5 mg/kg GCV every 12 h was continued. The purpura on the right hand observed at the time of admission to our facility widened. A total of 16 units of FFP were transfused to the patient at our hospital for 3 days (from Day 35, Day 4 from the admission to our hospital) but the coagulation profile did not improve. Since this patient had CMV enteritis, we considered vasculitis or malignant lymphoma as the cause based on the purpura on the fingertips, truncal rash, increasing splenomegaly, high alkaline phosphatase (ALP) level, high sIL-2R level, low platelet count, and PT-INR and APTT prolongation. A biopsy of the skin rash on the right lateral surface of the abdomen and of a left axillary lymph node was performed on Day 34 and Day 36 (Day 3 and 5 from the admission to our hospital), respectively. However, there were no indications of vasculitis or malignant lymphoma.\nOn Day 35 (Day 4 from the admission to our hospital), the patient developed bacteremia caused by Staphylococcus aureus and Fusobacterium species. He was treated with meropenem (MEPM) 2 g/day and vancomycin (VCM; trough ≥15 μg/mL). On Day 37 (Day 6 from the admission to our hospital), his abdominal pain worsened, and he went into shock. Non-contrast CT of the abdomen showed extensive free air in the abdominal cavity, which led to the diagnosis of gastrointestinal perforation that warranted an emergency surgery. During the operation, scattered necrotic changes were observed in the small intestine. A 1-cm perforation was found 10 cm to the right from the top of the transverse colon; the colon was resected from the ileum to the perforated area (Fig. ). An additional excision was performed on the left side of the transverse colon because of stool drainage from that region. Subsequently, ileal colostomy was performed, and a stoma was placed in the right lower abdomen. The surgical specimen of the ileum showed a perforation in the transverse colon, necrosis due to ischemic changes associated with circulatory failure, and numerous thrombi, including microthrombi, in the small- and medium-sized arteriovenous ducts (Fig. ). There was no evidence of lymphoma, vasculitis, or ulcerative colitis on pathological examination. We performed cardiac ultrasound scan multiple times, but no valve destruction was seen. In addition, a second blood culture was negative. Abnormal coagulation and multiple thrombosis were present before the onset of staphylococcal bloodstream infection. Furthermore, the pathology of the intestine showed no invasion by S. aureus. Therefore, we thought that Staphylococcal bloodstream infection had little to do with abnormal coagulation and multiple thrombosis. Because of the drug sensitivities of S. aureus and Fusobacterium species and the presence of intestinal perforation, VCM was discontinued, and only MEPM (1 g, 12 hourly) was administered from Day 39 (Day 8 from the admission to our hospital) onward. The thrombocytopenia and coagulation abnormalities observed preoperatively improved slightly and normalized postoperatively. In addition, the activities of factor II, factor X, factor V, and ADAMTS13 normalized. There was no evidence of vasculitis, lymphoma, or any other thrombotic disease; therefore, the final diagnosis was multiple microthrombi caused by CMV enteritis that mimicked thrombotic microangiopathy-like conditions. GCV administration was continued until Day 57 (Day 26 from the admission to our hospital).\nOn Day 88 (Day 57 from the admission to our hospital), the patient was transferred to the previous hospital for rehabilitation. One year has passed since he was discharged from the hospital; no recurrence has been observed since. |
In January 2012 a 59-year-old man was referred to the ophthalmologist for a sudden blurring of vision and orbital swelling on the left eye; his medical history detailed a bilateral keratoconus and open angle glaucoma, well controlled with topical therapy. The best corrected visual acuity decreased from 8/20 till 1/50 in one week. A corneal edema in the left eye was detected by physical examination and the retina was not detectable. In order to investigate the disease, the physician required an orbital ultrasound scan, which showed an extraconal solid mass with round well-defined outline, situated in the superior lateral corner of the left orbit. The patient was then admitted to treat this intra-orbital tumor at Cranio-Maxillo-Facial Unit, University Hospital of Modena.\nThe patient had a proptosis of the left eye at the time of admission into the hospital (Fig. ). There was a swelling of the left upper eyelid. A hard and tender mass was palpated in the superior temporal left orbit. The patient complained of mild double vision in left and down directions of the gaze, with a pathologic Hess-Lancaster test. The horizontal separation of perceived images by the patient and the worsening of diplopia in left gaze suggested limitation of left lateral rectus movement, since double vision is often worse in the field of action of the weakened ocular muscle.\nComputed tomography (CT) revealed a mass which was 2 × 2.5 cm in size, well circumscribed, of ovoid shape, within the left lacrimal fossa, with a central region hypodense to muscle and homogeneous soft tissue density border (Fig. ). The tumor displaced medially the lateral rectus muscle (Fig. ). The mass did not appear well separable from the lacrimal gland and a slight scalloping of the greater sphenoid wing was evident (Fig. ). MRI showed an oval mass in the left lacrimal fossa, about two centimeters in diameter that appeared within normal lacrimal gland tissue. Tumor was heterogeneous, with mild and irregular enhancement following administration of contrast medium (gadolinium) (Fig. ). Radiologist described a solid mass within the lacrimal gland, hypothesizing a pleomorphic adenoma. However, since imaging findings were not pathognomonic, we decided to proceed with complete excision of the mass, without a diagnostic incisional biopsy. Preoperative CT and MR imaging were consistent with a completely localized disease within the lacrimal gland. To approach this malignancy we chose a coronal approach to get an easy control of the lacrimal fossa and aesthetically and functionally preserve the eyelid and periorbital skin. After general anesthesia and local injection of lidocaine and epinephrine (lidocaine and epinephrine 1:200,000), a bicoronal skin incision was made a few millimeters behind the hairline and just anterior to the tragus of the left ear, extending approximately to the superior temporal line on the opposite side. The scalp flap was developed anteriorly to expose the orbital margin from the superior orbital rim to the zygomatic arch; so the facial nerve preservation was achieved []. Then, the temporalis muscle was dissected subperiosteally and retracted posteriorly to completely expose the lateral orbital rim and the outer surface of the great sphenoid wing. The periorbita was elevated from the inner surface of the lateral wall of the orbit. After preplating the lateral orbital rim with two titanium microplates, a lateral orbitotomy was performed using a piezoelectric osteotome (Piezosurgery® Medical; MT1–10 tip; Mectron Medical Technology, Carasco, Italy), because less traumatic for orbital content and to improve osteotomic bone healing [, , ]. The former osteotomy was made just above the zygomatic-frontal suture line and the latter approximately 1, 5 cm below. The lateral orbital rim was out-fractured with a rongeur, removed and preserved in saline solution. The periorbita was opened, showing a mass of approximately 2 cm, adherent to the lacrimal gland (Fig. ). The lesion was well demarcated within the lacrimal gland and enucleoresection was performed. The periorbital fascia was relocated and the lateral orbital rim was reinserted in its correct anatomic position and fixated with previous pre-platted two microplates and screws (Fig. ) [], without the need for a bone substitute [, , , , , , , ]. A drain tube was placed; the muscular fascia, subcutaneous tissue and skin suturing is performed without any local flaps []; a firm compressive dressing is applied for 48 hours and then removed.\nOn gross examination the lesion appeared nodular, brownish, measuring about 2 × 1.5 cm. Histopathological examination demonstrated a monomorphic epithelial tumor, composed of basophilic cells with prominent nucleoli and granular cytoplasm. Microcystic and focal papillary areas were present (Fig. ). Melanin pigment deposition was occasionally revealed (Fig. ). Immunohistochemistry revealed positivity for cytokeratin 7. Immunohistochemical analyses using S-100 protein, p63 (transformation-related protein 63), CD34 (cluster of designation 34), TTF1 (thyroid transcription factor-1), CD 10 (cluster of designation 10) and muscle actin antibodies were negative. Histopathological findings were consistent with acinic cell carcinoma (AcCC) with a microcystic, focally papillary-cystic growth of pattern. The mass appeared well-circumscribed, and did not involve the margins of resection. There was no evidence of vascular nor perineural invasion. Neither mitosis nor necrosis was observed. Proliferation rate was 2–4%, according to MIB-1 (antibody against Ki-67 protein) proliferation index. According to American Joint Committee on Cancer (AJCC) Eight Edition Staging System for lacrimal gland carcinomas, the staging of this AcCC is T1N0M0 [].\nThe postoperative course was uneventful, exophthalmos and ocular pain slowly subsided. Acuity vision improved and the patient was discharged 3 days after the operation. Early postoperative head CT scan showed complete removal; contrast chest CT scan and ultrasound scan of the liver were performed to assess pulmonary or liver metastases, which resulted respectively normal. The patient's case was debated at our local head & neck cancer multidisciplinary team meeting. Given the low grade malignancy of this tumor and the apparent radical excision of the mass, the meeting decided for no other postoperative treatment and to carry out a careful follow-up in order to notice any eventual recurrence. MRI at 6 months showed an area of solid tissue of about 1.5 cm characterized by a low enhancement in the left lacrimal fossa. The patient did not present any clinical signs of disease. Considering the lack of specificity of MRI in detecting a low grade malignancy recurrence, we decided to perform the complete removal of the residual lacrimal gland under general anesthesia through the previous coronal access. Histological examination of the surgical specimen revealed normal lacrimal gland and fibrous tissue free from cancer.\nVisual acuity was 8/20 fifteen months after surgery; the keratoconus did not get worse and no corneal edema and flare were present in anterior chamber. Intraocular pressure was 14 mm Hg without changes in topical therapy. The patient did not refer diplopia. Hess-Lancaster test showed recovery of extraocular muscles action. The patient is now free from disease at 7-year follow-up. Hyaluronic acid eye drops (Xailin HA, Visufarma, s.p.a., Rome, Italy) were provided in the post-operative period for the left eye, to compensate for the reduced lacrimation that would now affect that eye. As time goes by tears from accessory lacrimal glands were sufficient to maintain a stable tear layer on the cornea, and artificial tears use have come to be not regular. No tumor recurrences where detected at 7-year follow-up. |
A 67-year-old man presented to our clinic with a 3-month history of dull pain in the right flank. He denied having experienced other symptoms. He had no remarkable past medical or family history. Physical examination elicited mild right costovertebral angle tenderness. Urine analysis, complete blood count, and routine blood chemistry results were unremarkable and urine cytology showed atypical cells. Abdominal computed tomography (CT) demonstrated that most of the right kidney was occupied by a huge irregular tumor measuring 8 cm × 6.5 cm × 6.5 cm in size (). The tumor exhibited heterogeneous enhancement and areas of necrosis. The right perirenal space exhibited strand-like infiltration and the right renal fascia was thickened. The tumor had invaded into the right renal vein and possibly the IVC. The right upper ureter experienced tumor invasion. Multiple, enlarged, para-aortic lymph nodes were seen. Under the impression of a renal pelvis tumor, we subsequently performed a right radical nephroureterectomy with replacement of the IVC with a human cadaveric aortic graft. The tumor was mobilized en bloc with the right kidney, adrenal gland, ureter, and regional lymph node. The right renal artery was divided and clamped on the left side of the IVC. The IVC was then clamped proximally, contralaterally, and distally and was resected for an extension of 12 cm in length. The vascular defect was then repaired with the cadaveric aortic graft ().\nGrossly, a huge, grayish, solid tumor measuring 8.1 cm × 6.5 cm in dimension was seen involving the whole renal pelvis and calyces. The tumor had invaded the renal parenchymal, perinephric, and peripelvic fat. Renal vein and IVC involvement were also identified (). Microscopically, the renal tumor was classified as grade III transitional cell carcinoma (World Health Organization classification) and comprised neoplastic cells arranged in irregular solid nests associated with marked tumor necrosis. The two dissected hilar lymph nodes harbored carcinoma metastasis. The patient was discharged on the eighth postoperative day and anticoagulant therapy was initiated, which was continued for 9 months. There was no sign of recurrence at 9 months after the operation (). |
A 36-year-old male, a seasoned cyclist with no past medical history, presents to the emergency department with complaints of lightheadedness and diaphoresis after a bicycle fall. Patient was participating in a bicycle race when another rider ahead of him fell causing the patient to swerve to avoid him. Patient states that he fell on his left side and hit a tree with his right leg. Patient was wearing a helmet and did not suffer any chest or head trauma. After the fall, he felt lightheaded and diaphoretic and complained of mid back pain. Patient denied any chest pains or shortness of breath. Patient was subsequently brought to the hospital directly following the accident by ambulance.\nIn the emergency department, patient was noted to be in no acute distress; initial blood pressure was 128/69 mmHg with pulse of 65 beats per minute. He was afebrile, not tachypneic, and well appearing with marked right thigh swelling and tenderness to his medial thigh. Given the dizziness and diaphoresis initially, patient had an ECG performed which showed lateral ST segment elevation () and had a subsequent troponin I that was positive, 0.49ng/mL, with a Creatine Phosphokinase (CPK) of 617 U/L.\nThere was initial concern for a possible cardiac contusion, although the patient had no chest wall trauma and thus was admitted for further evaluation. As an inpatient, an echocardiogram was performed demonstrating normal right and left ventricular function and trace pericardial effusion while the patients troponin continued to trend upwards towards a maximum of 21ng/mL. He was loaded with Aspirin and Clopidogrel as well as initiation of a heparin infusion, Lisinopril, and a Beta Blocker. Coronary angiography was subsequently performed demonstrating a spontaneous coronary artery dissection of left anterior descending coronary artery. No further diagnostic study was performed at that time. Further history revealed that he took multiple caffeine Jello shots and drank a large cup of coffee prior to participation in the race. He denied cocaine, amphetamine, or other performance enhancing drug use ().\nThe patient's CPK and troponin trended downwards on conservative medical management and his back pain resolved; therefore a stent was not placed. The patient was visiting from outside the area; discharge planning included repeat coronary angiography in 6 weeks and instructions that he will not be able to perform competitive cycling again. Should his dissection extend at that period of time or patient become symptomatic, stent placement would be considered. Patient was to continue the Aspirin and Clopidogrel until the repeat angiography was performed. Patient was discharged with plans to follow up with a cardiologist in his home state. Multiple follow-up phone calls made us unable to reach the patient and he was subsequently lost to follow-up. |
A healthy 5-year-old boy presented with an asymptomatic abdominal mass that had been noted by his mother. On abdominal physical examination, two fist-sized masses were palpated in the right flank and umbilical region. On palpation, the mass was relatively nonmobile, nontender, and hard in consistency. The results of laboratory blood and urinary analyses were within normal limits and the urinary excretion of vanillylmandelic acid, catecholamines, and homovanillic acid was also within the normal range. An abdominal computed tomography (CT) scan confirmed an 11 cm×7 cm mass that appeared to arise from the isthmus of a HK. A band of renal parenchyma was seen extending across the midline, which was suggestive of a HK (). A post-CT abdominal X-ray film revealed bilateral malrotation typical in a HK and bilateral hydronephrosis caused by extrinsic ureteral compression of the mass. Even though the results of a chest X-ray film were normal, a chest CT scan showed two small nodules in the left upper lobe anterior segment and right upper lobe posterior segment of the lung (). Fine-needle biopsy of the mass revealed the presence of blastema, stromal, and epithelial cells without anaplasia, which suggested a diagnosis of WT with favorable histology ().\nThe patient was classified as having a stage IV WT on the basis of the presence of metastatic small nodules in the chest and was treated with 6 weeks of neoadjuvant chemotherapy. We used the DD-4A regimen (pulse-intensive dactinomycin, vincristine, and doxorubicin) under the proposed Children's Oncology Group (COG) protocol (AREN0533). An abdominal CT scan revealed a decrease in tumor size from 11×7 cm to 8×5 cm and central necrotic changes (), and a chest CT scan after 6 weeks of neoadjuvant chemotherapy showed disappearance of the small nodules in the lungs (). The patient's abdomen was thereafter explored by a transperitoneal approach. There was a hard, spherical mass involving the isthmus of the HK with no infiltration of the surrounding structures. There was no paraaortic lymphadenopathy and the inferior vena cava, liver, and spleen were normal. Resection of the tumor was done with an isthmusectomy and bilateral partial nephrectomy of the lower poles. The pathologic report of the resected tumor showed 30% necrosis of the whole tumor tissue and the resection margins were free of tumor (). The perioperative serum creatinine did not change and was 0.6 mg/dl. The patient completed 25 weeks of adjuvant chemotherapy according to the DD-4A regimen postoperatively.\nAt the end of the treatment, there were no signs of any recurrent disease on the CT scans or positron emission tomography scans and the bilateral hydronephrosis had disappeared (). |
Informed patient consent was obtained prior to surgery. No patient identifying information was included in this paper.\nA 30-year-old male, farmer by occupation, presented with a history of increasing anterior chest wall pain of three years' duration. His symptoms were aggravated by exercise, sneezing, and coughing. This pain affected his ability to work and perform activities of daily living. Local examination revealed a 3 x 2 cm tender swelling over the MSJ. Terminal shoulder movements,l such as flexion and abduction, were painful and restricted. There was no associated co-morbid condition like diabetes, hypertension, or coronary artery disease.\nECG and laboratory workup, including inflammatory markers like ESR and CRP, were within normal range. Lateral x-ray of the chest (sternal view) showed OA changes involving the MSJ (Figure ).\nThe diagnosis of OA was further established by a CT scan, which also showed multiple cystic lesions (Figure ).\nThe patient was treated initially by conservative means, including NSAIDs and physiotherapy, for a period of two years, but only showed symptomatic and temporary relief. An intra-articular steroid injection of 10 mg of triamcinolone was given, which resulted in some relief in pain, but the symptoms recurred. He was therefore offered the option of surgery to alleviate his persistent pain.\nAn open reduction and internal fixation (ORIF) of the MSJ was performed under general anaesthesia in the supine position (Figure ).\nA detailed evaluation of the images of a CT scan was done prior to surgery to measure the depth of drill stop and length of screws. Surgery was done in the supine position. The exposure of the MSJ was done by an anterior midline incision. The joint was curetted out to expose the raw bleeding bony surfaces. Autologous cancellous bone graft from iliac crest was used to firmly pack the defect (Figures -).\nThe MSJ was finally fixed with a contoured cervical locking plate, which resulted in a stable fixation of the MSJ. The curetted material sent for histopathological examination was consistent with osteoarthritis with no features suggestive of an infective etiology.\nThe patient was discharged on the third postoperative day. At discharge, his pain was very much relieved (Pain score: 1/10). He was advised to avoid lifting heavy weight for the initial five to six weeks following surgery. The patient resumed his activities of daily living at six weeks and returned to his heavy manual work at three months. At his two year follow-up, the patient showed sound arthrodesis of the MSJ with no pain or other discomfort. |
The 70-year-old male patient was admitted to the Department of Neurology with isolated left upper extremity weakness and clumsiness. He had wrist drop and was unable to grip with the fingers. He complained of no sensory loss or numbness. His past medical history included long-term oral anticoagulation due to recurrent lower extremity deep vein thrombosis, glaucoma, and a non-significant aortic valve stenosis, with vascular risk factors including a 5-year history of treated hypertension, hypercholesterolemia, and a history of non-significant stenosis of the left anterior descendent coronary artery. On admission, no abnormality could be detected by physical examination, apart from the neurological signs, which included a wrist drop on the left side with decreased grip strength (Fig. ). Pronation and wrist dorsiflection were lost, as well as the ability to form a ring with the thumb and the index. The reflexes of the left upper extremity were slightly brisk, with not pathological reflexes present and no sensory deficits. Laboratory parameters were without abnormal findings except for a slightly elevated fasting blood glucose level. Cranial CT revealed contrast-enhancing, irregularly shaped lesions with diameters of 7, 10, and 9 mm (in the temporal, parietal, and frontal lobes, respectively), surrounded by perifocal edema. Carotid duplex ultrasonography did not demonstrate signs of focal atherosclerotic plaques, circulatory disturbance or stenosis on either side. In accordance with the findings of the CT scan, the cranial MRI confirmed the tumor in the right precentral gyrus, corresponding to the ‘hand knob’, accompanied by further similar lesions posteriorly in the parietal and the temporal lobes, and in the left frontal lobe (Fig. ). Electromyography and nerve conduction studies did not support a peripheral origin underlying the paresis. The neuropsychological examination revealed a deficit in the Luria three-step test as a single alteration, which performance could, however, be remarkably improved by verbal clues. Chest X-ray performed as part of the search for primary tumor revealed no abnormality. Non-contrast and contrast-enhanced chest CT detected an irregularly shaped mass in segment 10 of the left lung, with inhomogeneous enhancement of the contrast agent and multiple associated lymph node conglomerates, suggesting lung cancer as the primary tumor. Abdominal ultrasonography did not detect malignancy. The patient received palliative steroid therapy, with no improvement in the paresis during the observation period. Based on the recommendation of the tumor board, the patient was transferred to the Department of Pulmonology for bronchoscopic tissue sampling. The verification of the diagnosis by this means, however, was unsuccessful. The diagnostic process had to be suspended due to an acute bleeding duodenal ulcer, and the patient received blood transfusion and local hemostatic treatment in the Department of Surgery. In association with the antibiotic treatment, the patient developed pseudomembranous colitis caused by Clostridium difficile. In addition to the persisting colitis, fever occurred accompanied by hemoptysis and coughing. The subsequent chest X-ray did not confirm pneumonia. Despite the applied antibiotic and oxygen therapy, respiratory failure developed, and the patient passed away 2 months after the onset of the neurological symptom. The autopsy and the histopathological analysis identified an adenocarcinoma (mucinous tubular adenocarcinoma with solid anaplastic parts) both in the brain and the lung; (Fig. ). |
A 56-year-old male fell forward onto his forearm and elbow during a mountain walk. He reported immediate swelling and pain in his elbow and wrist. On examination, there was a deformity of his right elbow with pain in the ipsilateral wrist; there were no skin or distal neurovascular disorders. Initial lateral radiographs requested by the emergency doctor focused on the elbow and showed a posterior dislocation of the right elbow with a type II Mason radial head fracture with a small detached fragment <20%, associated to a proximal radioulnar joint (PRUJ) dislocation and a coronoid fracture type 2 according to the O’Driscoll classification with an anterior avulsion of an anteromedial coronoid small fragment (). There was mild widening of the DRUJ with significant ulnar negative variance ().\nAs emergency treatment, we realized a closed reduction of the elbow dislocation under general anaesthesia with X-ray control, the limb was stabilized in a posterior brachiopalmar splint. A computed tomography (CT) confirmed the stage 2 coronoid process fracture and a partial radial head fracture, the PRUJ dislocation was also demonstrated (). The DRUJ and PRUJ dislocations were suggestive of a complete disruption of the interosseous membrane. We managed a surgical treatment the second day of admission. A Kaplan approach was used to reduce the PRUJ dislocation, the annulate ligament was repaired and the radial head fracture was evaluated, as the detached fragment was <20% of the radial head circumference, no fixation was necessary. The lateral collateral ligament (LCL) and the common extensor muscle were repaired. The elbow testing objected a stable elbow from −30° of extension to complete flexion. According to that elbow stability status and the coronoid fracture stage, we decided a conservative treatment for the anteromedial coronoid fracture. Closed reduction of the DRUJ was achieved but it was instable, a fixation with a TightRope was used (). The stability was rechecked and upgrade of the stable range of motion (ROM) was assessed, the elbow was now stable from −20° extension to complete flexion. A sling was used for comfort for 2 weeks postoperatively with physiotherapy and ROM exercises initiated early.\nAt 8 months of follow-up and 2 months of physiotherapy, the patient made a good recovery in regard to pain and mobility. Mobility of the right elbow was −20° for extension and 100° for flexion; the wrist mobility was respectively 60° and 20° of flexion and extension. The elbow was stable, and the grip strength was comparable to the contralateral side (). |
A 24-year-old male with established Alagille syndrome, complicated by hemodialysis-dependent end-stage renal disease and liver cirrhosis, presented with an 8-month history of headaches and hearing loss (right worse than left). Brain magnetic resonance imaging (MRI) revealed a 3 cm, extra-axial, diffusion restricting, posterior fossa mass involving the right temporal bone posterior to the mastoid air cells, invading and occluding the transverse/sigmoid sinuses, and distorting the cerebellum [] Surgery was recommended for the goals of pathological diagnosis and maximal safe resection.\nA C-shaped retroauricular incision was made, and the underlying muscle and fascia were reflected to expose the retromastoid region. Drilling was performed to create a quarter-sized retrosigmoid craniotomy; then, dissection under the operating microscope showed an epidural white keratinizing pearly lesion displacing the cerebellum inferomedially. Samples of the lesion were removed and sent for pathological analysis. The lesion was hypovascular and removed completely with suction and microdissection to carefully elevate the capsule of the lesion from the dura. The exposed mastoid air cells were covered with muscle grafts and oxidized cellulose along the superior and anterior aspects. The lesion was further resected to the occluded transverse and sigmoid sinuses, which were filled with thrombus. The surrounding bone was thoroughly curetted, and the surgical cavity was copiously irrigated, then carefully inspected to confirm the absence of gross residual disease. A small myofascial free tissue graft was placed over the resection cavity. There were multiple small rents in the dura, which were covered with a synthetic dural graft. A titanium mesh was used to cover the entire craniectomy defect. The fascia and skin were closed in standard fashion.\nOn microscopic examination, permanent sections showed multiple portions of tumor wall containing acellular keratin debris. The tumor was lined by keratinizing stratified squamous epithelium with a granular layer. This was most consistent with an epidermal inclusion cyst with dystrophic calcification [].\nPostoperative brain MRI demonstrated gross total resection of the lesion. Postoperatively, he received hemodialysis while hospitalized and was quickly weaned off of steroids and restarted on his home antihypertensive medications. He made an uneventful recovery and was discharged on postoperative day 3, and was doing well when evaluated at 3 months postoperatively. |
A 31-year-old man, weighing 56.2 kg and 170 cm tall, was diagnosed with advanced rectal cancer, and after concurrent chemoradiation therapy, underwent laparoscopic low anterior resection. After 2 weeks from discharge, he was readmitted to the hospital for nausea and vomiting and was diagnosed with postoperative small bowel obstruction around the ileostomy. He underwent a small bowel resection because he did not improve from conservative treatment. After reoperation due to the small bowel obstruction, he reported abdominal discomfort and postprandial stabbing epigastric pain with nausea and vomiting. He showed a weight loss of 9 kg over 18 days since the readmission (). An abdominal CT scan was performed under suspicion of postoperative intestinal obstruction, which demonstrated moderate gastroduodenal dilation with compression of the SMA, and 7 mm of aortomesenteric distance, consistent with SMA syndrome (). Gastroduodenoscopy showed reflux oesophagitis grade III and a fluid-filled first and second portion of the duodenum, and stenosis of the third portion. Conservative medical treatment with high-calorie total parenteral nutrition (TPN) and anti-emetics was initially administered for 2 weeks. The administration of nutrients was set at 1500 kcal/day, and the total volume of TPN was 1440 mL. The ingredients of TPN administered during this period were glucose 187 g/day, protein 72 g/day and lipid 58 g/day. Even after TPN treatment, his weight continued to decline. Although we tried to increase the total calorie of TPN, we could not afford it due to the fluid overload. So then surgery was considered first, but the perioperative risk was expected to be high in preoperative risk evaluation due to his poor nutritional status and severe bronchiectasis. Consequently, jejunal feeding tube placement past the obstruction via endoscopy was offered for the treatment of SMA syndrome.\nAn endoscopy-guided jejunal feeding tube (Abbott’s 12 Fr) was passed through the third portion of the duodenum and successfully placed distally to the duodenojejunal junction (). After confirming that there were no complications or patient discomfort, we started both tube enteral feeding and TPN simultaneously. The initial enteral nutrition was set at 900 kcal, and the components were 143 g of glucose, 40 g of protein and 30 g of lipid. The previous calories of TPN decreased gradually from 1500 to 1000 kcal/day. Finally, the administration of total nutrients was set at 1900 kcal. On dual enteral and parenteral nutrition feeding, the patient gained 6 kg in 2 weeks and showed a relief of symptoms (). The jejunal feeding tube was removed, and an oral diet was advanced. The patient has signed the informed consent. |
A 60-year-old male with metastatic RCC treated with nivolumab and palliative radiation therapy presented to our institution in 2016 with shortness of breath and was found to be in acute respiratory failure. Computed tomography (CT) of the chest was significant for multiple new ground-glass opacities throughout bilateral lungs concerning for therapy-induced pneumonitis (Figures , ). The etiology of ground glass opacities includes but is not limited to infectious pneumonitis, bronchioloalveolar carcinoma, or interstitial disease. Given the timing of symptom onset as well as lack of response to infectious treatment, therapy-induced pneumonitis remained high on our differential.\nHe initially presented in 2011 with gross hematuria and right-sided flank pain and underwent right radical nephrectomy and lymph node dissection of a 9 cm Fuhrman grade IV RCC with negative margins and lymph nodes. Two years later, surveillance imaging and biopsy were significant for metastatic RCC in the lungs. He was initially treated with one year of sunitinib, a multi-targeted receptor tyrosine kinase inhibitor. However, given the progression of disease, he was transitioned to one year of pazopanib followed by six months of axitinib, one month of everolimus, and five months of sorafenib. Pazopanib, axitinib, and sorafenib are also tyrosine kinase inhibitors. Everolimus is an inhibitor of mammalian target of rapamycin. Given the lack of response to these therapies, our patient was started on nivolumab at 3 mg/kg in May of 2016. Over the course of four years, he received targeted palliative radiotherapy including 1900 centigray (cGy) to a left upper lobe lung mass in May 2016 and 800 cGy to an L5 lesion in September 2016.\nHe complained of chronic shortness of breath for three months felt secondary to anemia and a left pleural effusion before presenting to our hospital in acute respiratory failure with CT evidence of new diffuse ground-glass opacities occupying the majority of both lungs (Figures , ). Given high suspicion for therapy-induced pneumonitis, he was started on a treatment course of high dose steroids. However, the patient’s respiratory status continued to decline and he passed away on comfort measures.\nPathology was significant for organizing diffuse alveolar damage with hyaline membrane formation in all lobes of both lungs away from the metastatic RCC (Figures , ). There was no evidence of an infectious process from cultures and pathologic evaluation. This histologic reaction pattern is a typical finding in patients with a clinical diagnosis of acute respiratory distress syndrome (ARDS) concerning for therapy-induced pneumonitis. |
A 44-year-old male was brought with a metallic rod, obliquely penetrating through in his right eye extending into the brain and left orbit [Figure and ], following a freaky accidental trauma in the factory, while cutting a metal bar. On clinical evaluation, the patient was conscious, oriented with no vision in both the eyes. Computed tomography (CT) brain [] revealed a penetrating foreign body (FB) in the right eye extending up to middle cranial fossa. The metal bar obliquely penetrated the right orbit, extended on the anterior cranial fossa floor up to posterior clinoid process severing the optic chiasm. Metal bar also abutted the supra clinoid component of bilateral internal carotid arteries (ICA). CT angiography of cerebral did not reveal any vascular injury. Magnetic resonance imaging (MRI) brain could not be performed considering the ferromagnetic properties of the FB. The patient was taken for the removal of FB. After anesthetizing the patient, the head was fixed in 4-pin headrest in extension. Before transcranial exposure, the right ICA control was undertaken in the neck so as to prevent any unforeseen ICA rupture. Extended bifrontal craniotomy involving bilateral orbital roofs within craniotomy flaps was performed using a high-speed pneumatic drill. An offending metal bar was seen extending along the right anterior cranial fossa floor penetrating the dura, to reach just above chiasm. The FB had damaged the right optic apparatus, but no obvious chiasmal disruption was seen in -white asterix. The FB was extracted as a single piece from the orbit under vision with no intraoperative injury to neurovascular structures at the skull base. As there seemed no hope of restoring right-sided vision, the right eye was exenterated in the same operative setting. The anterior cranial fossa was repaired with a pedicle pericranial graft. Galea and the skin were closed in layers. In the postoperative period, the patient recovered uneventfully. The patient was discharged in neurologically stable condition. The metal rod was sent for analysis and found to be made of iron (Fe) []. Follow-up MRI was performed 1 year later, which revealed a severed optic chiasma and gliotic changes in the basi-frontal brain parenchyma []. |
A16 year old female lion (Panthera leo) in a zoological park became slightly lame in the right thoracic limb in March of 2011. The lioness was vaccinated against feline parvovirus, feline herpes virus type 1 and feline calicivirus. Clinical examination revealed a large, firm mass growing in the proximal third of the right humerus. The severity of the lameness increased over the course of several weeks and the animal was anesthetized with medetomidine (40 mg/kg) and ketamine (3 mg/kg), administered into the muscles of the hindquarters using a blowgun from a distance of about 10 meters. The animal became recumbent in about 10 minutes and was later intubated. Anesthesia was maintained with isoflurane in 100% oxygen.\nA clinical examination of the leg revealed a severe swelling involving the shoulder, elbow and forearm area and a firm large mass growing in the proximal third of the right humerus. Radiographic examination of the right thoracic limb was performed with the lion in right lateral recumbency. Mediolateral views of the right shoulder, elbow, and humerus, and a lateral view of the thorax were obtained. The area over the proximal humerus was clipped and surgically prepared to obtain a fine needle aspiration (FNA) for the cytological evaluation of the mass. Radiographs of the limb showed an osteolytic sclerosing lesion with irregular rim, mild periosteal reaction and irregular cortex, intramedullary extension and pathologic fracture of the metaphyseal area, severe invasion and complete detachment of the right humeral epiphysis ().\nThe radiographic examination of the thorax revealed no abnormalities. FNA from the mass yielded a moderately cellular sample composed of loosely cohesive groups or single spindle cells with basophilic cytoplasmic tails, oval nuclei with central prominent multiple nucleoli and mild anysokariosis ().\nBased on these clinical, radiological and cytopathological findings the mass was diagnosed to be a primary malignant bone tumor, and the animal was euthanized and a complete necropsy performed. The tumor was 26 × 12 × 10 cm, with an irregular smooth, brown surface and a generally firm rubbery consistence with gritty to hard areas interspersed. The mass was poorly vascularized with peripheral necrotic areas. The cut surface showed a multilobulated mass that had breached the humeral cortex, with periosteal production of reactive bone. The mass invaded the epiphysis, the synovial membrane, the joint capsule and ligaments. A mild hemorrhagic effusion appeared in the joint space while the other organs were not affected. No metastases were detected during necropsy.\nHistological examination showed malignant mesenchymal cells producing osteoid and woven bone. There was extensive osteoblastic differentiation associated with the production of collagen, as well as a population of fibroblastic-like cells associated with diffuse activation of osteoclastic giant cells. Neoplastic cells were large, pleomorphic and had hyperchromatic nuclei and prominent nucleoli. Where the tumor was more intensely osteogenic and sclerotic, the cells were rarer, and were small, with slender nuclei, dense chromatin and no mitoses ().\nThere was a diffuse and moderate infiltration of inflammatory cells including lymphocytes and monocytes, with fibroblasts arranged in a storiform pattern. Clinical and radiological findings including the growth rate of the lesion, and the histopathological appearance supported the diagnosis of fibroblastic osteosarcoma. This appears to be the first reported case of fibroblastic osteosarcoma in a lion.\nAccording to WHO classification, osteosarcoma can be classified according to its site of origin in either the intramedullary, surface/juxtacortical or intracortical bone, either with epiphyseal, methapyseal or diaphyseal localization. Location may have a prognostic significance. In this case report it was not possible to identify the exact site of origin of the tumor. At the time of necropsy, it involved epiphyseal, methapyseal, and diaphyseal areas of the humerus and extended from the periostium and cortical bone to the medullary cavity. |
The second patient died was a 39-year-old female with univentricular heart (tricuspid atresia), who had had previously two cardiac surgeries (the last was atrio-pulmonary Fontan, 33 years earlier). The patient suffered from a serious right atriomegaly with frequent episodes of atrial tachycardia, so she was a candidate for Fontan conversion surgery. Pre-operative ventricular function was mildly reduced (50%). In the post-operative, the patient suffered from severe single ventricle dysfunction resulting in LCOS and the need for ECMO implantation. Both patients could not be weaned from ECMO due to multi-organ failure.\nSeven patients required pace-maker implantation due to post-operative sinus node dysfunction or atrioventricular conduction abnormalities. All patients were discharged on oral antiarrhythmic for 3–6 months and anticoagulants for 6 months. At discharge, 15 patients were in sinus rhythm, 5 had a stable pacemaker rhythm, 2 had atrial fibrillation, and 1 atrial flutter. One patient discharged in sinus rhythm had a pacemaker implant 5 months after the operation due to the presence of sinus node dysfunction.\nDuring a median follow-up of 14 months (IQR 7–27), there was no late mortality and 17/23 patients had an improvement of NYHA functional class. Five patients in NYHA III progressed to class II and 4 to class I; eight patients progressed from class II to class I.\nAt follow up electrocardiogram, 16 patients were in sinus rhythm, 6 with stable pacemaker rhythm, and 1 with permanent atrial fibrillation.\nRecurrence of arrhythmia occurred in 2/23 (8.6%) patients, more than 3 months after surgery. These patients presented at surgical ablation with history of atrial fibrillation lasting 4 and 19 years, respectively, and both had atrial fibrillation, which was treated with right-sided Maze rather than Cox maze III due to technical issues. Sixteen (69%) patients are in stable sinus rhythm, 12 without any anti-arrhythmic therapy. At median follow up of 14 months (IQR 7–27), freedom from recurrence of arrhythmia was 90.9% and cumulative risk of recurrence was 9.6% (). |
A 6-day-old full term female baby, delivered at a peripheral hospital, was brought with continuous frothing of saliva from the mouth, refusal of feeds and a progressive respiratory distress since birth. No records were available regarding the initial resuscitation of the baby and whether a nasogastric tube was passed at birth to assess esophageal patency. She was seen at three different hospitals where a diagnosis of esophageal atresia was made before she reached our center for further management.\nOn examination, the baby was a sick-looking full-term female neonate having severe tachypnea with persistent white froth in mouth. No chest wall retractions or central cyanosis was noted. Heart rate was 162 beats per minute and respiratory rate was 54 per minute. Auscultation of the chest revealed equal air entry on both sides with coarse crepitations. Insertion of a red rubber tube through the mouth revealed obstruction at 10cms from the mouth was noted. Chest roentgenogram with the red rubber tube in situ demonstrated the tube lying at the level of the third thoracic vertebrae with presence of air in the stomach. Echocardiographic examination was normal. A clinical diagnosis of esophageal atresia with distal tracheo-esophageal fistula (Vogt type III) was made. She was stabilized by low-pressure continuous upper pouch suction, oxygen, antibiotics and chest physiotherapy.\nThe patient was taken up for a right postero-lateral thoracotomy. On exploration, the esophagus was found to be in continuity with no evidence of esophageal atresia. Careful palpation of the esophagus revealed a hard mass in the upper esophagus. Longitudinal esophagotomy over the mass showed multiple foreign bodies (beetle nuts pieces) and they were meticulously removed (Fig. 1). After removal of beetle nut pieces, a nasogastric tube could easily be passed into the stomach from the mouth. Esophagus was repaired over the nasogastric tube and chest was closed after putting an intercostal drain. Post-operative period was uneventful.\nOn retrospective enquiry to understand the motive, we found that the baby was born on a supposedly inauspicious birth star and was believed to be a harbinger of bad luck due to a misguided belief in an astrologer. The grandfather of the baby had forcefully pushed small pieces of beetle nut down the child’s throat. |
A 71-year-old female, with a betel nut-chewing habit and a history of hypertension, presented with a fever and a painful swelling on the left side of the neck which had both lasted for three days. The neck mass, which was diagnosed as a cervical lymphadenitis at a local clinic, had been present for one week, had progressively increased in size and had become red. The physical examination showed that the patient had a temperature of 38.3°C and presented with a tender mass (size, 3 cm) and skin erythema on the left side of the neck at level II-III. The total white cell count was 18.7×109/l and the C-reactive protein value was 12.3 mg/dl (normal value, <0.5 mg/dl). No additional clinical abnormalities, such as transnasal fiberoptic laryngoscopy, were identified as a result of the head and neck examinations. The patient provided written informed consent.\nAn ultrasonographic scan showed a hypoechoic and heterogeneous deep abscess between the left sternocleidomastoid muscle and the common carotid artery. A contrast-enhanced computed tomography scan of the neck was performed and a hypodense predominantly cystic lesion, exhibiting ring enhancement over the left carotid space, was observed (). The pus culture developed Staphylococcus aureus and the cytological examination via fine-needle aspiration revealed the presence of non-malignant inflammatory cells alone. Following adequate control of the infection, the patient became afebrile and the skin erythema ameliorated. However, the neck mass remained present and the possibility of a malignancy could not be excluded due to the patient regularly chewing betel nut and a concern regarding the lateral cervical cystic lesion that the patient exhibited. Therefore, an additional fine-needle aspiration of the lesion was conducted and the cytology revealed malignant epithelial cells, which were consistent with squamous cell carcinoma. The diagnostic procedures were conducted to characterize the occult carcinoma, although the results of the abdominal ultrasonographic scan, chest radiography and the bone scintigraphy were all observed to be normal. The primary fluorodeoxyglucose (FDG) uptake site was detected by F-18-FDG positron emission tomography in the lymph nodes of the left-sided level II area of the neck, with a maximum standardized uptake value of 5.7 (). Therefore, the patient was diagnosed as exhibiting a CUP with lymph node metastasis in the neck, in addition to a deep neck abscess.\nThe patient subsequently underwent a left side modified radical neck dissection, which was followed by radiotherapy treatment. The patient survived and showed no indication of recurrence within the five-year follow-up. |
A 68-year-old woman presented to the Department of Oral and Maxillofacial Surgery at Nagoya Ekisai Hospital (Nagoya, Japan) with a chief complaint of malaise and a 7-month history of swelling of the left buccal mucosa. The patient had no congenital swelling of the left buccal mucosa at birth and no history of systemic disease or relevant family history. The patient had undergone maxillary molar restoration treatment 2 years earlier, after which she reported biting regularly on her buccal mucosa. On most occasions, the wound had healed within a week, so she had not sought medical treatment. An extraoral examination revealed no facial swelling or asymmetry. However, an intraoral examination revealed an area of diffuse swelling on the left buccal mucosa measuring about 15 mm × 30 mm and containing a papillary lesion with multiple red, blue, and clear pebble-like vesicles (Figure ). On palpation, the lesion was nontender and soft. The swelling had not expanded to the veins and was pulsatile. An orthopantomogram confirmed that the adjacent bone was intact. Magnetic resonance imaging revealed a soft tissue mass with a clearly distinguishable outline of the buccinator muscle (Figure ). The lesion was surgically excised under local anesthesia with a margin of 3 mm and a depth of 2 mm via the inside surface of the fascia of the buccinator muscle. The outcome was favorable. Pathologic examination of the specimen revealed expanded lymphatic vessels lined by thin endothelial cells and containing lymphatic fluid. A diagnosis of lymphatic malformation was confirmed on histopathology and immunohistochemical studies. Immunohistochemistry was negative for vascular markers such as CD31 and CD34, and the lymphatics stained specifically for D2-40 (podoplanin) (Figures , , ). On follow-up, the wound was found to have healed with no evidence of trismus or recurrence. The patient continued to be recurrence-free at her 2-year follow-up. Informed consent was obtained from the patient, and the procedures were in accordance with the Helsinki Declaration. |
We are presenting the case of a 61-year-old African American female patient who was admitted to the intensive care unit with right-sided weakness, numbness, and slurred speech. Further workup revealed a left cortical and cerebellar hemisphere ischemic stroke. TEE was performed as part of stroke management, which was uneventful. Feeding and scheduled oral medicines were started via a Dobbhoff tube, and further stroke management was optimized. On the third hospital day, she developed acute respiratory distress, warranting endotracheal intubation. Chest radiograph revealed a near complete opacification of right hemithorax with slight mediastinal shift (). Preliminary diagnosis was aspiration pneumonia. Treatment with broad-spectrum antibiotics was started after cultures were obtained. Bronchoscopy showed copious, thick, and purulent secretions in the right middle and lower lobar area. However, quantitative culture of bronchoalveolar lavage showed no bacterial growth.\nThe pleural effusion persisted despite thoracentesis. Samples obtained were consistent with exudative effusion (low amylase, high lactate dehydrogenase, low glucose). A chest tube was inserted and drained a fair amount of purulent-appearing fluid. Overtime, her chest tube drainage slowed down but diminished-but-persistent effusion was still obvious in the chest X-ray. Due to notable clinical improvement in her pulmonary status, the patient was weaned off the mechanical ventilatory support and extubated after the 14th day of intubation. Per protocol, she was then referred to the speech therapist for a swallow assessment. A fluoroscopic dynamic swallow assessment showed a clear leaking from the esophagus. A chest computed tomography scan and esophagogram confirmed the leakage of contrast from distal esophagus (esophageal perforation) into the patient’s right chest cavity (). There was no evidence of mass lesion noted.\nThe patient underwent primary repair of the perforated esophagus with muscle flap construction. Preoperative esophagoscopy demonstrated an esophageal tear with no distal obstruction or masses. Intraoperatively, a 30-mm perforation at the distal esophagus with marked contamination of right pleural space was noted but no evidence of mediastinitis was noted. Suspicious pleural lesions were sent to Pathology and were consistent with non–small cell carcinoma. The patient had a protracted recovery but was eventually discharged home. |
This is the case of a 78-year-old gentleman with a past medical history of osteoarthritis, diabetes mellitus, and prostate cancer who presented to our institution with three years of left knee pain.\nThe history begins in 2013, when the patient began to have progressive left generalized knee pain. Symptoms were exacerbated with activity and relieved with rest. The patient denied fevers as well as history of trauma or surgery to the knee. He had tried activity modification, physical therapy, and hinged knee brace without relief. Two months prior to presentation in our clinic, in June 2016, the patient had an intra-articular steroid injection within the left knee that provided relief for 2 days. He performed bed-to-chair transfers only with the use of a walker at the time of presentation in August 2016. The patient was retired, and the remainder of the family and social history were noncontributory. He was referred for consideration for total knee arthroplasty.\nThe patient's medications included aspirin 81 mg po daily, atorvastatin 40 mg po daily, carvedilol 12.5 mg po daily, furosemide 80 mg po daily, meloxicam 7.5 mg po daily, metformin 500 mg po bid, metolazone 5 mg po daily, mirtazapine 30 mg po daily, extended release oxycodone 10 mg po q12 hours, and phenytoin 125 mg po tid. He had no known drug allergies.\nOn physical examination, this Caucasian gentleman was 5 feet 11 inches tall and weighed 262 pounds. His left knee skin was intact and without erythema. The patient had left knee pain with weight bearing and transferred from his wheelchair to the examination table with an antalgic gait. Left knee medial and lateral joint lines and femoral condyles were tender to palpation. He had no pain with passive range of motion of the left knee, which demonstrated a 20-degree flexion contracture and 100 degrees of flexion. Plain films of the left knee demonstrated joint space narrowing with erosive features on both sides of the joint ().\nGiven the atypical appearance of his radiographs, the patient elected to obtain inflammatory markers. Serum white blood cell count was 8,800/mm3 (reference range 4,000-10,000/mm3), erythrocyte sedimentation rate (ESR) was 68 mm/hr (reference range 0-10 mm/hr), and C-reactive protein (CRP) was 63.7 mg/L (reference range 0.0-7.0 mg/L). The patient's history of diabetes mellitus and prostate cancer, together with his elevated inflammatory markers and radiographic findings, suggested a differential diagnosis of septic arthritis versus malignancy. The patient was admitted to the hospital for further workup.\nComputed tomography (CT) scan of his left knee demonstrated bony destruction of both the distal femur and proximal tibia without evidence of malignancy (). Two successive left knee joint aspiration cultures were positive for Corynebacterium striatum and negative for crystals. The higher of the two aspirate white blood cell (WBC) counts was 30,548/mm3 with 96% neutrophils. |
A 54-year-old female presented with diffuse fullness of the abdomen for the past 3 months. Her past history was significant for exposure to multiple pet animals. Her examination revealed an ill-defined mass in the left upper abdominal quadrant. An abdominal contrast-enhanced computed tomography scan showed a multiseptated exophytic cystic lesion of 18 cm × 10 cm × 16 cm size from the upper pole of the left kidney displacing the spleen and pancreas. Magnetic resonance imaging abdomen showed an exophytic multicystic heterogenous hyperintense T2-weighted and hypointense T1-weighted lesion with thin hypointense internal septae seen arising from the superior pole of the left kidney []. Indirect hemagglutination test and enzyme-linked immunosorbent assay were negative. A diagnosis of multilocular renal cyst or renal hydatid cyst was made based on the imaging and planned for excision.\nOral albendazole (400 mg twice a day) was started for 2 weeks before surgery. Under general anesthesia, chevron incision was made and abdominal exploration was done. The left colon was reflected medially. A large dumbbell-shaped thick-walled cyst of size 18 cm × 12 cm × 12 cm with multiple loculi seen attached to the upper pole of the left kidney and was adherent to the distal pancreas and splenic vessels. On aspiration, thick mucoid straw-colored material was aspirated out. Scolicidal agent (5% povidone-iodine) was instilled. Renal vessels were dissected out and looped []. Renal vessels were not clamped during the excision of the cystic lesion as the cyst wall had less vascularity and its margins were well delineated. The splenic vessels and distal pancreas were carefully dissected and preserved. The cyst was completely excised [] with a margin of renal tissue. The collecting system in the upper pole of the left kidney was not entered, and it was confirmed by intraoperative injection of methylene blue through a previously placed ureteric catheter in the renal pelvis. A tube drain was placed intraoperatively and removed on the 4th postoperative day. On gross examination, the cyst was a thick-walled, multilocular cyst with a dominant loculus and no brood capsules were found. Microscopic examination revealed the features of mucinous cystadenoma arising from the pancreas []. The patient had an uneventful recovery. |
A 46-year old female patient, who had been suffering from autoimmune thyroid disease for eight years, presented at our clinic with an acute exacerbation of GO. Clinical examination revealed a convergent strabismus fixus with severe hypotropia of both eyes (Fig. ). The patient complained of increasing loss of eyesight and heavy retrobulbar pain. Visual acuity had deteriorated significantly from 0.6/0.5 to 0.1/0.1 within 3 months. A contrast enhanced orbital MRI scan showed distinct swelling of all extraocular muscles with bilateral compression of the optic nerve (Fig. ). There was no history of comorbidities except nicotine abuse. Laboratory tests showed a euthyroid biochemical status with TSH within the normal range, but elevated levels of Anti-Thyroid Peroxidase Antibody, Anti-Thyroglobulin Antibody and Thyroid Receptor Antibody. The patient’s daily medication comprised of 200 μg L-Thyroxin and 200 μg Selenium. Over many years, the patient had shown only mild to moderate symptoms of GO, but following a thyroidectomy, the symptoms had recently worsened dramatically. Since the disease could not be controlled by high-dose systemic glucocorticoid therapy, bilateral three wall orbital decompression had been performed twice previously. In the first step, the medial orbital wall had been resected via an endonasal approach. Due to ongoing findings as before, two months later partial resection of the orbital floor and fenestration of the lateral orbital wall via a combined transconjunctival/transcaruncular approach with piezosurgery had been performed. In addition, high-dose systemic glucocorticoid therapy was conducted prior to surgery and for the first two months after surgery. Glucocorticoid medication had to be gradually reduced until zero because the patient suffered from an upcoming depression and Cushing syndrome. Orbital radiotherapy for the treatment of thyroid eye disease had been considered as a therapeutic option, but the rapid progress of the disease with the growing risk of dysthyroid optic neuropathy forced us to act more quickly than orbital radiotherapy could perform []. Since the patient increasingly suffered from loss of vision and heavy pain attacks because of medial caudal squinting, we decided to correct the hypo- and esotropia surgically by releasing and repositioning the insertion points of the inferior and medial rectus muscle. Acute surgery was the last remaining treatment option.\nOperations on the left and right eye were performed consecutively with an interval of one week. The eye with the lower vision (left side) was chosen first. A forced duction test showed a complete fixation of the bulb. We opted for a transconjunctival approach (limbal incision) combined with lateral canthotomy to gain access to the dorsal part of the inferior part of the eye bulb. The insertion of the inferior rectus muscle was localized and then circuited with a squint hook (Fig. ). A non-absorbable polyethylene suture (Mersilene 4.0, Ethicon, U.S.) was placed at the anterior rim of the muscle before the muscle was detached from the outer bulb. This release in tension immediately resulted in the spontaneous elevation of the bulb. Lengthening of the muscle with an interposition graft (e.g. fascia lata) was not possible because of the deep retraction of the muscle. Instead, the polyethylene thread loop was directly fixed to the sclera at the former muscle insertion area, placing the muscle 12-15 mm dorsally with regard to its original fixation position. By marking of the original muscle insertion point with a non-absorbable polyethylene suture, an option could be preserved for a more precise muscle readaption at a later stage. Subsequently, the same procedure was carried out with the medial rectus muscle. Less tension allowed direct refixation of the muscle to the sclera without bridging by the polyethylene suture. The bulb was freely movable and remained vertically and horizontally in a primary position (Fig. ). Despite a significant exophthalmos, passive eyelid closure could easily be performed. The significant conjunctival contraction caused by the long-term hypotropia meant that only partial conjunctival wound closure with a polyglactin suture (Vicryl 7.0, Ethicon, U.S.) was possible. No postoperative complications occurred under the postoperative systemic antibiotic medication with Clindamycin of 3x600mg per day over three days supplemented by local application of Neomycin eye ointment for one week. Surgery of the right eye was conducted in the same manner (Fig. ) and under the same perioperative protocol one week later. Additionally, two mucosal grafts of 3.0 × 1.5 cm were harvested bilaterally from the inner cheek to be used for the bilateral reconstruction of the conjunctiva. The intraoral donor sites were closed primarily by using Vicryl 3.0 (Ethicon, U.S.). Starting from extreme eso- and hypotropia, the operation succeeded in repositioning the bulbs into the vertical and horizontal primary position with no restriction of passive movements. Three months postoperatively, the patient was free of pain and had a visual acuity of 0.3/0.6. Visual field testing (Goldmann perimetry) showed only slight concentric bilateral restrictions. Surprisingly, the patient did not suffer from diplopia despite the persistent restriction of active ocular mobility and a moderate bilateral exotropia (Fig. ).\nFollow-up examinations of the patient will be performed at close intervals, including ophthalmological check-ups and the testing of thyroid blood parameters. Contrast enhanced orbital MRI scans will allow the measurement of extraocular muscle volume, as described by Kolk et al. []. Orbital MRI scans were performed preoperatively and three months postoperatively (Fig. ) and the volumes of the extraocular muscles were calculated by using manual segmentation (Osirix Imaging software 5.9) (Table ). During this time interval, the total extraocular muscle volume increased from 24.91cm3 to 29.29cm3. Together with the ongoing high levels of thyroid-specific antibodies (Anti-Thyroid Peroxidase Antibody, Anti-Thyroglobulin Antibody and Thyroid Receptor Antibody), this indicated that the patient was still in an active stage of GO. Volumetric measurements of the extraocular muscles, based on follow-up MRI scans, will help to monitor the course of the disease. Further squint surgery, in terms of a precise readaption of the extraocular muscles, will be postponed to the future, when a more stable stage of the systemic autoimmune disease will be reached. |
A 30-year-old female, with right dominant upper extremity, presented 13 months after operated well-aligned right intra articular distal humerus fracture (, ) with elbow stiffness. She also underwent implant removal before the current presentation. She had a fixed flexion deformity of 20 degrees with flexion arc of 20–30 degrees () and completely free supination and pronation (). Pre-operative radiographs ( and ) and CT scan of the elbow were done. CT scan showed bony spur over medial humeral condylar articular surface anteriorly limiting flexion as well as posterior osteophyte limiting extension (, ).\nWe used two classification systems. Morrey [] classification of joint stiffness has two main groups based on etiology and anatomical location of the contracture.\nExtrinsic stiffness was limited to soft-tissues or extra-articular processes. Intrinsic stiffness related to joint processes such as defective consolidation and degenerative joint diseases. Intrinsic contracture often presents an associated extrinsic component and is thus considered to be mixed contracture []. Kay described another classification [] for elbow stiffness, based on the components involved in the process. In type I, there would only be isolated contracture of soft tissues. In Type II, there would be contracture of soft tissues associated with heterotopic ossification. In Type III, there would be contracture of soft tissues associated with a consolidated joint fracture, without dislocation. In Type IV, the contracture of soft tissues would be associated with defective consolidation of the joint fracture. In Type V, a cross-joint bone bar would be present. In this case, it was Mixed contracture (Intrinsic and extrinsic) by Morrey’s classification and Type III by Kay classification.\nIntra-articular chevron osteotomy was planned so as to access and remove the intra-articular bony spurs. Fixation of olecranon osteotomy with modified tension band principle was planned to allow early rehabilitation. Procedure was done under infra clavicular block and indwelling catheter was kept for post-operative analgesia (). Patient was placed in a left lateral position and a routine posterior incision was made over right elbow. Medial and lateral skin flaps were raised.\nUlnar nerve was isolated and retracted with rubber tube. Chevron intra-articular osteotomy was done (). The proximal osteotomy fragment was retracted so as to expose the distal humerus articular surface and ulnohumeral joint. Posterior and anterior osteophytes limiting flexion and extension were removed (, ). Fibrous tissue from the ulnohumeral joint excised thoroughly. Accessing anterior aspect of the ulnohumeral joint was made easy with intra-articular olecranon osteotomy without risk of damaging any neurovascular structure. Intraoperative 10–110 flexion arc with free supination and pronation was achieved (, ). Olecranon osteotomy was fixed with modified tension band principle (). Wound was closed in layers over a closed suction drain. Immediate post-operative active and active assisted elbow flexion, extension, supination, and pronation exercises were started (, ).\nContinuous Ropivacaine infusion through indwelling infra clavicular catheter was\ngiven along with intravenous analgesics (, ). On 7th post-operative day, infra clavicular catheter was removed. Rehabilitation was continued under supervision for 2 months and unsupervised for later 4 months. Olecranon osteotomy united well after 3 months (). Patient was followed up every 15 days.\nSix months and 1 year post-operative patient achieved 10–110 degrees of flexion arc (, ). Free supination and pronation were possible. Patient was able to perform all activities of daily living. |
A 60-year-old male with metastatic RCC treated with nivolumab and palliative radiation therapy presented to our institution in 2016 with shortness of breath and was found to be in acute respiratory failure. Computed tomography (CT) of the chest was significant for multiple new ground-glass opacities throughout bilateral lungs concerning for therapy-induced pneumonitis (Figures , ). The etiology of ground glass opacities includes but is not limited to infectious pneumonitis, bronchioloalveolar carcinoma, or interstitial disease. Given the timing of symptom onset as well as lack of response to infectious treatment, therapy-induced pneumonitis remained high on our differential.\nHe initially presented in 2011 with gross hematuria and right-sided flank pain and underwent right radical nephrectomy and lymph node dissection of a 9 cm Fuhrman grade IV RCC with negative margins and lymph nodes. Two years later, surveillance imaging and biopsy were significant for metastatic RCC in the lungs. He was initially treated with one year of sunitinib, a multi-targeted receptor tyrosine kinase inhibitor. However, given the progression of disease, he was transitioned to one year of pazopanib followed by six months of axitinib, one month of everolimus, and five months of sorafenib. Pazopanib, axitinib, and sorafenib are also tyrosine kinase inhibitors. Everolimus is an inhibitor of mammalian target of rapamycin. Given the lack of response to these therapies, our patient was started on nivolumab at 3 mg/kg in May of 2016. Over the course of four years, he received targeted palliative radiotherapy including 1900 centigray (cGy) to a left upper lobe lung mass in May 2016 and 800 cGy to an L5 lesion in September 2016.\nHe complained of chronic shortness of breath for three months felt secondary to anemia and a left pleural effusion before presenting to our hospital in acute respiratory failure with CT evidence of new diffuse ground-glass opacities occupying the majority of both lungs (Figures , ). Given high suspicion for therapy-induced pneumonitis, he was started on a treatment course of high dose steroids. However, the patient’s respiratory status continued to decline and he passed away on comfort measures.\nPathology was significant for organizing diffuse alveolar damage with hyaline membrane formation in all lobes of both lungs away from the metastatic RCC (Figures , ). There was no evidence of an infectious process from cultures and pathologic evaluation. This histologic reaction pattern is a typical finding in patients with a clinical diagnosis of acute respiratory distress syndrome (ARDS) concerning for therapy-induced pneumonitis. |
A 10-year-old healthy boy presented with a 2-day history of severe chest pain on the left side and vomiting, with no fever or sputum. There were no other remarkable findings in the physical examination, medical history, and family history yielded no other remarkable findings. The patient had not undergone antenatal ultrasound screening or a pre-incident imaging examination. Radiographs taken at a local hospital showed a high-density mass in the left thoracic cavity with a small amount of pleural effusion, which was suspected to be diaphragmatic hernia, and he was transferred to our center immediately. The patient still had chest pain with stable vital signs and exhibited no guarding during the abdominal examination after admission. Laboratory tests showed slight elevations in the white blood cell count (12.74 × 109/L), of which the neutrophils accounted for 81.1%; the myoglobin level was 38.12 ng/mL, and other values were within normal ranges. Because radiographs were available from the local hospital and in the emergency situation, we did not perform abdominal ultrasonography. Contrast medium-enhanced computed tomography (CT) of the chest and abdomen revealed a well-defined, nonenhanced mass with soft-tissue density (3.8 × 4 × 4.7 cm) in the left thoracic cavity above the diaphragm (Fig. ). The surrounding structures did not show any abnormalities except slight uplifting of the diaphragm and a small amount of pleural effusion on the left side (Fig. ). On the CT scan, a suspected feeding artery arising from the aorta could be identified (Fig. ).\nEmergency video-assisted thoracoscopic surgery was performed. Intraoperative findings included the presence of a dark-brown ovoid mass (3.5 × 4 × 4.5 cm) adherent to the aortic wall and a small amount of hemorrhagic pleural effusion in the left pleural cavity. The parietal pleura near the mass appeared to be red. The pedicle that connected the mass to the mediastinum was short (1.0 cm in length), thin (0.6 cm in diameter), and twisted 180°. The blood supply to the mass arose from the thoracic aorta, and an accompanying vein drained to the intercostal vein. The mass was clipped and then resected at the pedicle. The pathological examination confirmed the diagnosis of ELS with infarction caused by torsion. The patient recovered very well and was discharged the second day after surgery. During the 3-month follow-up period, no complication or recurrence was observed on chest radiographs. The final diagnosis was an ELS infarcted as a result of torsion. (In the emergency situation, we failed to keep the preoperative chest radiograph from the local hospital and the intraoperative pictures.) This study was approved by the Human and Ethics Committee for Medical Research at Sichuan University in accordance with the Declaration of Helsinki. Written informed consent was obtained from parents of patient involved in the study. |
We report the case of a 53-year-old male with a past medical history of gastroesophageal reflux disease and hyperlipidemia who presented to his ophthalmologist for blurred vision in both eyes. He had been noticing a black spot in the visual field of his left eye for about two weeks. He also had a rash on his forearms and chest which he had noticed around the time of his visual changes (Figure ).\nHe denied any fevers, chills, weight loss, appetite changes, nausea, vomiting, diarrhea, or joint pains. He denied any history of genital ulcer or penile discharge. He had a history of Lyme disease which had been treated in the past. He currently had cats at home. With regard to his sexual history, he identified as a heterosexual male, denied high-risk sexual behavior, and was married with five children. However, on further history taking, he reported a homosexual encounter about five years prior. He was unsure about his HIV status and had never tested positive for HIV in the past. On initial examination, he was afebrile with stable hemodynamics. It was noticed that he also had erythematous lesions in his oral mucosa (Figure ).\nHis visual acuity was 20/20 in his right eye and 20/100 in his left eye. Bilaterally, the anterior segments showed a clear cornea, deep and quiet anterior chambers, and round iris with a clear lens. The posterior segment examination of the both eyes showed an unattached posterior hyaloid and subtle fullness of optic nerve. Subtle neuritis and vasculitis were seen bilaterally with vitreous cells in the left eye. Fundus photography was done and revealed subtle neuroretinitis bilaterally, more so in the left eye (Figure ).\nEvaluation for infectious and inflammatory causes of neuroretinitis was initiated including Bartonella antibodies, Lyme antibodies, and Treponema pallidum testing. His rapid plasma reagin (RPR) testing was positive with titers at 1:128. Fluorescent treponemal antibody absorption (FTA-Abs) testing was also positive. Testing for other sexually transmissible diseases such as HIV and hepatitis was negative. He was diagnosed to have ocular syphilis and a lumbar puncture was done showing Venereal Disease Research Laboratory (VDRL) positivity in the cerebrospinal fluid (CSF). He was subsequently treated with intravenous penicillin G, four million units every four hours for a total of 14 days. He was closely followed up by the infectious diseases team and the ophthalmology team. His visual symptoms improved subjectively and objectively on follow-up with ophthalmology. Repeat lumbar puncture was done in three months and showed nonreactive VDRL and white blood cell (WBC) count of <3 . He is planned for a lumbar puncture every six months until the WBC count in his CSF normalizes and repeats RPR every six months for one to two years |
In a work-up of a 40-year-old female with a history of low back pain, a routine MRI of the lumbar spine identified an incidental lesion. The axial T\n1 weighted image showed a 21-mm round, homogeneous lesion of low signal intensity interforaminally in the left S2 segment of the sacrum. The axial short tau inversion-recovery image showed a well-defined lesion with an inhomogeneous signal intensity throughout the lesion with high peripheral rim intensity. The axial T\n1 image with fat saturation after contrast media injection showed moderate enhancement throughout the lesion and in the peripheral rim (). A radiograph of the pelvis was performed to further characterize the lesion. On clinical examination, the sacral area was not painful to palpation. Owing to the atypical appearance of the lesion and the non-specific nature of the MRI signal pattern, a bone scan was performed that showed a solitary lesion on the left side of the sacrum with increased metabolic activity. For further characterization, and in the search of a potential primary tumour, positron emission tomography (PET)-CT was performed, which showed a well-defined sclerotic lesion with mild fludeoxyglucose (FDG) avidity (average standardized value 2.5) in the S2 segment and no other abnormalities (). Owing to the metabolic activity of the lesion, the patient was referred to the orthopedic oncology department for image-guided biopsy of the lesion. The biopsy specimen consisted of a few small fragments of bone marrow, some skeletal muscle, fibroadipose tissue and blood clots. Infiltration of the otherwise normal bone marrow with scattered small groups of big foamy cells was identified (). The foamy cells had vacuolated cytoplasm and small centrally located nuclei. The cells were negative for cytokeratin AE1/AE3, CD68, barchyury, Melan A, HMB 45, desmin and smooth muscle actin but positive for S100 protein (). The cells contained multiple lipid droplets and numerous large mitochondria; the existence of the latter was exhibited with antimitochondrial marker (). A pathological diagnosis of hibernoma was made in correlation with the imaging findings.\nOwing to the clinical assessment in correlation with the history of bilateral lumbago, worse after physical activity, the patient was diagnosed with chronic lower back pain. At 1-year follow-up, the patient was being managed with analgesics and physical therapy. |
A 49-year-old woman presented with a 3-month history of repeated ptosis of both eyelids and oral ulcers and erosions. Physical examinations revealed scattered ulcers and erosions in the mouth (Fig. ). Laboratory examinations showed that CA 125 was elevated (51.6 U/ml), while other tumor markers, including CA199, 153, CEA, and AFP, were normal. Autoimmune antibodies, including anti-CENP-B antibody, ANCA, anti-AchR antibody, and ANA, were all positive.\nThe patient was first diagnosed with an oral aphthous ulcer and ocular myopathy myasthenia gravis. She was treated with gentamycin and dexamethasone spray inhalation to improve her oral lesions and pyridostigmine to cure muscle weakness. However, the oral ulcers improved slightly and the myasthenia gravis persisted. An abdominal ultrasound showed a hypoechoic mass in the left adrenal gland. A further CT examination showed a 6 × 5 cm, well-defined round solid mass with central necrosis in the pancreatic tail. There was no calcification detected in the mass. The solid part of the mass had slight enhancement in the arterial phase with many serpentine feeding arteries, moderate enhancement with a draining vein around the tumor in the portal venous phase and persistent enhancement in the delayed phase (Fig. a-e). The fundus of the stomach was compressed by the mass. The boundary between the mass and the splenic artery and vein was not clear, and swollen lymph nodes were not observed in the posterior peritoneum. The mass was initially considered to be a neuroendocrine tumor in the pancreatic tail.\nAt the same time, the patient’s symptoms worsened. She could not swallow, and she felt severe pain in her mouth. She also developed a cough and expectoration. A chest CT revealed infection in the lower lobes of both lungs. Streptococcus was detected from a throat swab. Levofloxacin was administered to fight the infection, methylprednisolone to fight the inflammation, and thalidomide to alleviate the vascular inflammatory reaction in addition to pyridostigmine and immunomodulatory therapy. However, 3 days later, the patient progressed to severe dyspnea, wheezing and difficulty with expectoration. Emergency intubation and mechanical ventilation were administered. Aspergillus was detected after bronchoalveolar lavage. Immunoglobin and voriconazole were given. Four days later, the symptoms resolved and the intubation was detached. Most of the infections in the lungs were resolved according to a chest CT. The pain in the mouth was also alleviated.\nAfter a multidisciplinary discussion, the patient’s tentative diagnosis was paraneoplastic pemphigus and the myasthenia symptoms caused by the pancreatic tumor. Myasthenia gravis, in turn, led to the patient’s inability to excrete sputum. If the pancreatic tumor could not be removed, the symptoms would not completely remit, and the symptoms due to myasthenia gravis would also continue to aggravate, finally leading to the occlusion of the respiratory tract. Therefore, the patient was transferred to general surgery. During the surgery, a 4 × 5 cm dark-red tumor with medium texture and clear boundaries was detected in the pancreatic tail (Fig. ). The tumor was close to the splenic artery and vein, and the spleen was normal. Postoperative pathology confirmed the tumor was a follicular dendritic cell sarcoma with immunohistochemistry showing CD21(+), CD23(+), CD138(+), SMA(+), Des(+), CD117(−), DOG-1(−), S-100(−), CD34(−), CK(−), EBER and EBV(−)(Fig. a-c).\nThe patient continued to be treated with antifungal and anti-infection therapy. Twelve days after surgery, the patient developed sudden heart palpitation, discomfort and difficulty in breathing. Mechanical ventilation was again administered. However, the patient died of inability to excrete sputum and occlusion of the respiratory tract. |
A 27-years-old male had a history of severe craniofacial trauma in 2015 that needed operative intervention and induced loss of vision in the right eye on presentation. The patient developed gradually progressive right orbital proptosis and chemosis months after the injury; however, due to pre-existing vision loss, he did not seek any medical attention. The patient first presented to our institute in May 2018 for an unresolved right orbital proptosis and occasional headache of a 2-year duration. Clinical examination showed right orbital bruit with chemosis. Magnetic resonance imaging (MRI) of the brain confirmed right-sided direct CCF with venous drainage into the right superior ophthalmic vein and right inferior petrosal sinus with associated aneurysmal dilatation of the right cavernous sinus (CS) (). Time-of-flight magnetic resonance angiography (TOF MRA) revealed antegrade flow into the supraclinoid internal carotid artery (ICA), which suggested an intermediate flow fistula. Absence of cortical vein opacification on TOF MRA and no abnormal cortical vein engorgement on susceptibility-weighted imaging (SWI) suggested a lack of significant cortical venous reflux. The patient was counseled to undergo a diagnostic cerebral angiogram (DSA) followed by endovascular embolization of direct CCF; however, he declined any surgical/endovascular intervention and was lost to follow up.\nThe patient returned to the emergency facility at our institute in December 2019 with sudden onset of severe headache, right orbital pain, and episodes of projectile vomiting. Clinical examination revealed proptosis and chemosis of the right eye without any orbital bruit. An emergency computed tomography angiogram showed non-opacification of the fistula with thrombosis of the right superior ophthalmic vein and a residual giant partially thrombosed right cavernous ICA pseudoaneurysm (). A DSA was done for a better understanding of angioarchitecture. The right ICA injection confirmed thrombosis of fistulous communication with a superior ophthalmic vein and preserved antegrade flow in the right supraclinoid ICA. The residual giant right cavernous segment ICA pseudoaneurysm measured approximately 24 mm (antero-posterior)×22 mm (width)×26 mm (cranio-caudal) and pointed anterior-laterally.\nA manual cross compression study of the right ICA and injections through the left ICA and left vertebral artery showed good crossflow across the circle of Willis into the right-sided intracranial circulation without any venous delay. Due to financial constraints, vessel preserving techniques like flow diversion, which was the ideal treatment in this situation, could not be considered. Further, stent-assisted coiling in such a large-sized partially thrombosed pseudoaneurysm is associated with the possibility of coil migration into the thrombus during follow-up, leading to recanalization and need for retreatment. Taking into account the presence of good cross-circulation without any venous delay, the decision was to proceed with parent artery occlusion. The pseudo-aneurysms sac was partially coiled, followed by complete occlusion of the petro-cavernous segment of the right ICA (). Left ICA and left vertebral angiogram showed normal opacification of the right-sided anterior circulation. The patient tolerated the procedure well with no post-intervention deficit. At 4 months follow-up, the patient had a significant reduction in right ocular swelling with complete resolution of the headache. |
A 57-year-old man was admitted to the emergency room after being unconscious for a day. One day earlier, the patient was found unconscious by his family. He was able to answer questions inaccurately but was unable to move his limbs and had slurred speech. The patient walked unsteadily and had difficulty urinating and had no vomiting nearby. The patient did not have limb stiffness or convulsion. Consciousness gradually worsened, and he was taken to the emergency department of the local county hospital approximately 3 hours later. Urgent head CT indicated bilateral hypodense lesions in the thalamus. The local county hospital considered the patient to have carbon monoxide toxic encephalopathy and was given hyperbaric oxygen therapy, and the consciousness disorder gradually aggravated. To obtain further diagnosis and treatment, the patient was sent to the Department of Neurology of our hospital by emergency department 120. MRI examination was conducted immediately, which suggested bilateral thalamic acute infarction (). He had no specific diseases in the past. He had no bad habits, such as smoking or drinking, no history of drugs or vaccination, and no history of exposure to toxic substances. Physical examination showed that the patient’s consciousness was in a light coma. Neurological examination revealed that the patient could open his eyes after painful stimulation, the eyeballs stared upwards, and the eyeballs could be seen involuntarily rotating. The patient’s bilateral pupils were equally large and round, with a diameter of approximately 3 mm, light response was sensitive, no spontaneous nystagmus, tongue extension did not cooperate, active movement of the limbs was observed, unable to lift off the bed, normal muscle tension of the limbs, tendon reflex (++), and bilateral Babinski signs (-). The haematology test revealed the following: On an empty stomach, blood sugar was 8.51 mmol/L, glycated haemoglobin was 9.50%, and low-density lipoprotein was 3.50 mmol/L. Other haematology tests showed no abnormalities. The electrocardiogram was normal, echocardiography showed no abnormality, magnetic resonance angiography was normal (), and digital subtraction angiography was normal. The patient gradually improved after 5 days in the hospital. During hospitalization, the patient was treated with blood sugar control, antiplatelet aggregation, plaque stabilization, circulation improvement, promotion of collateral circulation, elimination of oxygen free radicals and other treatments, and the clinical symptoms significantly improved. The patient was admitted to the hospital with a GCS score of 10 points, which increased to 15 points after treatment. The MMSE scale score was 27 points (secondary school level).\nThe patient was followed up one year after being discharged from the hospital, and he had poor memory and calculation ability. |
A 16-year-old boy living in the northeast state of Massachusetts (MA), USA, had flu-like symptoms in a summer at the age of 13 years and developed bilateral knee swelling in the following winter. A serology test was performed and interpreted as being positive for LD at that time. The patient was treated with a course of oral doxycycline for 28 days, and the arthritis resolved. Approximately 12 months after that treatment, the patient started to complain of periodic sweating, flushing, severe fatigue, migratory joint pains, nausea, stomach pain, insomnia, and blurry vision and had a skin rash that was described by a clinician as “typical Bartonella rash”. As the result of these symptoms, the patient did not attend school for 1 year. Finally, the patient was seen by a LD consultant who interpreted the ELISA serology test to be positive, but the Western blot test to be negative because the IgM blot was totally negative and in the IgG blot, only four bands were accepted as positive. Based on the consultant’s opinion, the patient was hospitalized for pure psychiatric disorders at a psychiatric hospital for 7 weeks. In the following winter month at the age of 16 years, a newly performed C6 peptide serology test showed that the patient had a positive C6 peptide Borrelia burgdorferi IgG/IgM Lyme Index of 3.46 (normal range: <0.91). A venous blood sample was tested by DNA sequencing for low-density spirochetemia at the Milford Hospital-affiliated molecular diagnostic laboratory (now Milford Molecular Diagnostics Laboratory). A brief history of this case with a typographic error, which stated that the consultant found five bands instead of four bands in the IgG immunoblots, was published under case 3 in Table 2 in a previous report. Publication of laboratory data with blinded patient identities was approved by the Milford Hospital Institutional Review Board as an ongoing research project.\nThe history presented in this report is the corrected version provided by the treating physician coauthor of the previous paper. This report records a subsequent significant laboratory finding on one of many cases previously published within a table in a peer-reviewed article, with the treating physician of the patient, as the coauthor. The consent from the legal guardian of the patient to publish the information on this case was obtained by the treating physician coauthor prior to publication of the previous article. The clinical history presented in this report is a replica of the history of case 3 in Table 2 of the previous article with a minor, but significant, correction.\nBecause of the unusual DNA sequence with numerous unresolved base-calling regions in the electropherogram of this case, the polymerase chain reaction (PCR) amplicons were resequenced with optimized Sanger reactions. Same-nested PCR amplification with a pair of borrelial genus-specific primers, followed by direct Sanger sequencing of the nested PCR amplicon using the M2 primer as the sequencing primer,, confirmed that there were two partially homologous Borrelia burgdorferi 16S rRNA (ribosomal RNA) gene sequences in the sample isolated from the patient’s blood. Visual analysis of a 210-base DNA sequence revealed a 110-base unambiguous sequence followed by an immediately downstream 100-base ambiguous segment. The ambiguous DNA sequence is obviously caused by a shift in the reading frame ().\nBasic Local Alignment Search Tool (BLAST) algorithm showed that the first unambiguous 110 bases, namely, TTAACCCAACACCTCACAGCACGAGCTGACGACAACCATGCAGCACCTGTATATAGACCCCAAACGGGGAATAATTATCTCTAACTATATCCTATATATGTCAAGCCCTG, represent a signature sequence of the B. burgdorferi sensu lato 16S rRNA gene (GenBank sequence ID CP009656; range: 445,000–445,109). Visual analysis showed that the immediately downstream 100-base segment with numerous double peaks is a composite of two superimposed sequences, shown as follows:\nA:GTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACTCTTGCGAGCATACTCCCC; and B:TAAGGTTCCTAGCGTATCATCGAATTAAACCA-CATTCTCCACCGCTTGTGGGGGCCCCCGTCAATTCCTTTGAGTTTCACTCTTGCGAGCATACTCCCCA.\nSubmission of the 100-base sequence A for BLAST alignment algorithm confirmed that this is an immediately downstream continuation of a B. burgdorferi sensu lato 16S rRNA gene sequence, with ID CP009656, range: 445, 110–445,209, with a 100% ID match.\nBLAST alignment algorithm of the 100-base sequence B showed no 100% ID match with any sequences cataloged in the GenBank. Due to deletion of a single “G” base at the position equivalent to 445,110 of the B. burgdorferi 16S rRNA gene sequence ID CP009656, there is a shift in the reading frame in , caused by a sequence B superimposed on a sequence A. Based on known sequences retrieved from the National Center for Biotechnology Information database, sequence B has a maximum 97% ID match with a highly conserved 16S rRNA gene segment commonly shared by numerous spirochete species, including B. burgdorferi (ID CP009656, range: 445,111–445,210), B. turicatae (ID KP861623, range: 237–336), B. afzelii (ID CP009058, range: 447,714–447,813), B. hermsii (ID CP011060, range: 447,836–447,935), and Treponema pallidum (ID CP007548, range: 232,098–232,197). One of these examples was copied from the BLAST report returned from the GenBank and is illustrated in .\nBLAST alignment analysis of the 210-base sequence composed of the 110-base unambiguous sequence and the 100-base sequence A confirmed that this 210-base sequence represents a B. burgdorferi sensu lato 16S rRNA gene region with a 100% ID match from position 445,000 to position 445,209 (GenBank sequence ID: CP009656.1).\nHowever, alignment of the 210-base sequence composed of the 110-base unambiguous sequence and the 100-base sequence B against the sequence ID CP009656.1 showed deletion of one “G” nucleotide at reference position 445,110 and three single-base substitutions: one C→A at reference position 445,121; one G→T at position 445,146; and one C→G at position 445,161 (). When sequencing from the homologous end of the PCR amplicon, the deletion of one “G” base and three single-base substitutions in this segment caused initial analytical difficulty due to a reading frame shift. A search of the nucleotide sequence database in the GenBank failed to find a 16S rRNA gene sequence having a 100% ID match with sequence B. Attempts to sequence from the opposite end resulted in total failures.\nBased on the 110-base unambiguous 16S rRNA gene sequence, the blood sample of this patient was diagnosed as being positive for a strain of B. burgdorferi sensu lato.\nPCR-based molecular diagnoses of B. burgdorferi infection are often criticized because of possible DNA cross-contamination in the laboratory. In the author’s laboratory, the positive control is a strain of B. coriaceae whose target 16S rRNA gene DNA can be amplified with the genus-specific M1/M2 primers, but its interprimer DNA sequence is different from the pathogenic borrelial species. Because all positive PCR products generated in this laboratory are validated with Sanger sequencing and because the sample in this case was proven to contain two partially homologous 16S rRNA gene sequences that never existed in the environment, the positive results found in this case could not have been due to laboratory DNA contamination. After the molecular diagnosis was made, the patient was referred to the infectious disease unit of a large medical center for further treatment. Clinical follow-up was not available.\nPermission to publish the data included in this paper without patient identity was granted to the author by the Institutional Review Board (IRB) of Milford Hospital. A special ethical approval was not required by, and was not sought from, the IRB of Milford Hospital prior to the work included in the current report because the subsequent work revealing new information after the publication of the first article only consisted of computer and visual analysis of the DNA sequencing electropherograms generated and used to support the molecular diagnosis of infection by a B. burgdorferi sensu lato strain already reported in the first publication |
A 45-year-old male patient presented with complaints of a nasal forehead mass which had gradually increased in size over the past 5 years and influenced his appearance.\nThe patient found the nasal-root mass 5 years ago. The mass was the size of a peanut, soft, of normal skin color and with a swollen smooth surface, often exhibiting self-absorption with no other discomfort. In October 2018, nasal mass resection was performed at a local hospital and postoperative pathology was unclear. A relapse occurred in January 2019 and the mass gradually increased in size over the next 10 months, to approximately the size of 5 cm × 2.5 cm. The patient came to our department for a clear diagnosis and treatment.\nThe patient was in good health and had no history of chronic disease. In 2012, he underwent appendectomy in a local hospital due to acute appendicitis.\nPhysical examination of the nose upon admission showed that the shape of the nose was normal. The left part of the nasal-root mass was about the size of 5 cm × 2.5 cm. It was soft, with a smooth surface, no redness or swelling, no ulceration, and no tenderness.\nNo abnormalities in terms of renal function, erythrocyte sedimentation rate (ESR), rheumatism, serum complement (C3/C4), quantitative immunoglobulin determination, immunoglobulin IgG4, antinuclear antibodies or ANCA were found. The possibility of Kimura's disease was not considered before surgery, and IgG4 and IgE levels were not detected before the operation. Positive laboratory results are shown in .\nAfter admission, computerized tomography (CT) and magnetic resonance imaging (MRI) examination of the patient's paranasal sinuses were performed. MRI showed an iso-intense signal in the T1 sequence, iso- and hyper-intense signal in the T2 sequence () and enhancement in the T1 enhanced sequence with an unclear boundary. CT showed a soft tissue signal in the nasal forehead with an unclear boundary ().\nThe pathological findings were as follows: in the hyperplastic fibrous tissue, there were hyperplastic lymphoid tissues, lymphoid follicles, a large number of eosinophils between follicles and small hyperplastic blood vessels in the follicles, which focally infiltrated striated muscle (). Immunohistochemistry findings were as follows: CD3(+), CD20(+), CD21(FDC+), CK(–), and Cyclin D1(–). |
A 37-year-old male patient went to the ophthalmic emergency room complaining of pain in the left eye, lasting for two months, with high intensity shooting and progressive ipsilateral eyelid swelling, followed by diplopia and decreased visual acuity. An external eye examination showed hard and cold edema of the lower eyelid, ocular motility with limitation in adduction, and discreet ipsilateral proptosis. Hertel exophthalmometry was used to measure the degree of ocular protrusion and the value obtained was 18,2 mm for the right eye and 25 mm for the left eye ().\nThe best corrected visual acuity was full (20/20) in the right eye and 0.8 (20/25) in the left eye. No refractive error was detected in any of the eyes. Biomicroscopic examination of the right anterior segment did not reveal any abnormal findings, although the left eye showed conjunctival hyperemia, chemosis, and keratitis.\nIntraocular pressure was measured using an applanation tonometer and it was found to be 11 mmHg in the right eye and 16 mmHg in the left eye. No pathological findings were detected during fundoscopy. The optical coherence tomography (OCT) of the left eye revealed no abnormalities. The cause for low vision in the left eye was found to be eyelid edema and keratitis. The cause for left eye motility reduction was the extraocular muscles (EOM) affected by the lesion. The affected EOM were the lateral rectus, inferior rectus, and inferior oblique. Magnetic resonance of the orbit showed left eye proptosis and thickening and increase of soft tissues associated with heterogeneous impregnation of contrast in the infralateral region of the left eyelid (Figures and ). A biopsy was performed in the lower left eyelid on the second day of hospitalization using the Posterior Inferior Orbitotomy to access the lesion.\nHistology showed a chronic inflammatory process, well-formed, tightly packed, with nonnecrotizing granulomas surrounded by lamellar hyaline collagen, and negative immune-histochemistry for mycobacteria, providing histological confirmation of sarcoidosis (). Computed tomography showed enlargement of the pulmonary hilar as a result of bilateral lymphadenopathy. AST was 450 U/L (reference value: 5–40 U/L) and ALT was 375 U/L (value: 7–35 U/L), both higher than usual. Serum angiotensin converting enzyme (ACE) levels were also above the normal levels, 145 mg/dL (reference value: <56 mg/dL). The patient was referred to the Rheumatology Service, which carried out endovenous pulse therapy with methylprednisolone 1 g a day for five days. Keratitis was treated with lubricant sodium hyaluronate based eye drops. 1 drop was applied in the left eye every 4 hours during the time the patient remained in hospital. After treatment with pulse therapy, the patient showed remission of the eyelid edema and chemosis.\nDuring ophthalmologic treatment at the time of discharge, right eye acuity was 20/20 and visual acuity at the left eye went back to normal standards. The left eye movement was totally restored. Fundoscopy showed no change in either eye. Eye pressure was 13 mmHg for the right and left eye. The patient was discharged after significant improvement of his ophthalmologic condition and with no pain. The patient was reassessed 7, 15, 30, 45, and 60 days after hospital discharge, having presented no pathological changes in the ophthalmologic exam, with complete remission of the disease. |
About 4 months back, a 25-year-old young man had high-grade fever, headache and vomiting for 5 days and later developed altered sensorium. He was admitted in the intensive care unit of a nearby hospital for 10 days. Investigations revealed a positive dengue NS1 antigen test. He was treated symptomatically and over the next 15 days, the sensorium gradually improved. During the recovery phase, the patient was found to have dysarthria and reduced speech output. Two months following encephalitis, he developed slowness while walking and a feeling of stiffness in both lower limbs. He required one-person support to walk and had toe walking with bent knees. In addition, he developed snapping of fingers of left-hand which was repetitive, purposeless and non-goal directed. It was present for most of the day and was partially suppressible. There was no feeling of discomfort or urge to perform these movements on voluntary suppression. It was sometimes associated with tremulousness of left index finger. The patient was aware of the symptoms but could not control them completely. These movements would subside during sleep. There was no progression in the severity of these snapping movements till the time he presented to us.\nHe was born to a non-consanguineous parentage with normal birth and developmental history. There was no history of neurological illness, movement disorders (dystonia/parkinsonism) or psychiatric illness in the family. There was no history of psychiatric illness in the past and he was never treated with dopamine blockers or other medications. There was no history of alcohol or substance abuse. Our patient hails from north Karnataka state in the southern part of India which is endemic for dengue. He was working in a grocery shop and there was no history of exposure to alcohol or chemicals/solvents.\nOn examination, the patient was conscious, alert and responsive to commands. His vital parameters were within normal limits. On neurological examination, he had mild up-gaze restriction along with jerky pursuits and normal saccades. He also had reduced facial expression. His speech was severely hypophonic with palilalia. Examination of other cranial nerves was normal. Paratonia was observed in both the upper limbs and spasticity in lower limbs. There was a mild head flexion to left with dystonic posturing of right hand. Hand grip of both sides were normal. Lower limb movements were restricted due to spasticity; however, he was able to lift against gravity. All deep tendon reflexes were brisk with bilateral extensor plantar responses. Sensory examination was normal.\nHe had repetitive, coordinated and patterned snapping movements involving the left thumb and middle finger which were partially suppressible. In addition, there was slow and coarse tremor of the left index finger (). Generalized bradykinesia was present along with micrographia. He had a stooped posture with knees flexed, severe freezing of gait and needed one-person support to walk, (). Other systemic examinations were unremarkable.\nHis routine blood investigations- complete hemogram, liver and kidney function tests were normal. Serum IgM antibodies against dengue virus were detected. Antibodies against chickungunya and Japanese encephalitis infections were negative. Screening for HIV, Hepatitis B, hepatitis C and valuations for autoimmune encephalitis were negative. Serum copper/ceruloplasmin were within normal limits. CSF was acellular and normal protein and glucose. Ultrasound abdomen was normal. Brain MRI showed atrophy with bilateral basal ganglia T2/FLAIR hyperintensities without any contrast enhancement (). He was treated symptomatically with combination of levodopa-carbidopa (400 mg/day), baclofen (30 mg/day), pramipexole (0.75 mg/day), amantadine (100 mg/day), tolperisone (50 mg/day) and diazepam (6 mg/day). In addition, the patient also underwent physiotherapy, neurorehabilitation and speech therapy. There was minimal improvement in parkinsonism symptoms with no improvement in stereotypy. |
A 22-year-old male presented to our clinic with recurrent episodes of hemoptysis over a 4-week period with 3 distinct events. He stated that this started with an incidence of heavy coughing. He then would cough up to 2–4 tablespoons of blood. After presentation to the emergency room, it was initially thought this was related to epistaxis, and he was sent home with treatment for allergic rhinitis. He had no other symptoms, denying fever, weight loss or gain, chest pain, easy bruising, dyspnea, or rash. He did complain of chronic postnasal drip, nasal congestion, and occasional pruritis, which he attributed to allergies. He had a past medical history of eosinophilic colitis, obsessive-compulsive disorder, history of an aneurismal bone cyst status post-removal, and allergic rhinitis. He had also been recently diagnosed with hypogonadism over the last 5 months, and was on injectable testosterone supplementation. He denied smoking, alcohol, and illicit drug use and had no known inhalant exposures and trauma to the airway that he could recall. His family history included a brother with eosinophilic colitis and his mother had vascular ectasias of her spinal cord. He did note that these episodes seemed to occur 5 days after his dose of intramuscular testosterone. Physical exam was otherwise unremarkable and laboratory values were unrevealing. Computed tomography did not reveal any notable lesion of the upper airway or lung parenchyma.\nUpon flexible bronchoscopic evaluation, the following lesion was seen in the distal trachea (). The purple, vascular lesion was approximately 1–1.5 cm in size located 3 cm from the carina at the 5 o'clock position along the posterior wall attached by a short pedicle. A biopsy was taken at that time which only showed fibrin products and inflammatory cells. Hemostasis was difficult to obtain without use of cold saline, several injections of topical epinephrine and Argon Plasma Coagulation. Due to unavailability of pathology and the location of the lesion, the patient was taken to the operating suite where a therapeutic flexible bronchoscope was used with utilized. The lesion was obtained by electrocautery loop snare and endoscopic basket. The pathology revealed the diagnosis of lobular capillary hemangioma (Figures and ). The superficial portions of the lesion had undergone secondary, nonspecific changes including stromal edema, capillary dilation, inflammation, and a granulation tissue reaction. It demonstrated diagnostic, lobular arrangements of capillaries at its base, which consisted of discrete clusters of endothelial cells. The cellular architecture was made up of an inflammatory infiltrate of neutrophils and monocytes.\nUpon followup, the patient had no hemoptysis episodes and has subsequently stopped his testosterone therapy. |
The patient is a 7-month-old twin boy who presented to our institution's emergency department with increased work of breathing and desaturations (70 s). He was born at 33 weeks gestational age with Down syndrome, developed chronic lung disease (CLD) of prematurity, and was also found to have a moderate size secundum atrial septal defect (ASD) as a newborn. Prior to the current illness, he had been in the hospital multiple times for failure to thrive and respiratory distress, requiring mechanical ventilation with high amount of supplemental O2 and inhaled nitric oxide (iNO) as he developed pulmonary hypertension (PH). Echocardiography showed progressive enlargement and hypertrophy of his right ventricle and at times bidirectional shunting across his ASD. A diagnostic cardiac catheterization as a preoperative evaluation was performed, which showed elevated pulmonary vascular resistance indexed (PVRi) at baseline (8.8 WU·m2), which decreased with inhaled oxygen alone and iNO (3.8 WU·m2). Additional catheterization data at baseline condition showed a right atrial mean pressure of 6 mmHg, right ventricular end diastolic pressure of 6 mmHg, and pulmonary artery pressure 51/19 mmHg with mean 32 mmHg. The patient was started on home O2 therapy with nasal cannula. The current hospitalization occurred prior to a planned fenestrated patch repair of his ASD.\nHe was initially admitted to the general ward and soon transferred to the pediatric ICU for severe hypoxemic respiratory failure requiring mechanical ventilation. Respiratory syncytial virus (RSV) infection was diagnosed with the positive antigen test. He continued to have paroxysmal severe hypoxic events compatible with PH crisis. He was treated with sedation and neuromuscular paralysis, increased FiO2, optimization of O2 carrying capacity with packed red blood cells transfusions, and iNO. Milrinone infusion was added as the right ventricular function was depressed on echocardiogram (TAPSE 6 mm, Z-score −4), which demonstrated evidence of systemic to suprasystemic right ventricular pressure and bidirectional shunting across the ASD (Figures and ). No other cardiovascular intravenous drips were given during the ICU stay. Sildenafil was initiated enterally and escalated to maximal dose (2 mg/kg/day) without hemodynamic compromise. He was on diuretic therapy (bumetanide infusion up to 10 mcg/kg/hr) as chest X-ray demonstrated evidence of bilateral interstitial edema with bilateral pleural effusions on admission () and confirmed by chest ultrasound. Bilateral chest tubes were placed after failure of diuretic therapy to reduce effusions on hospital day #6. The drained fluid was milky in appearance bilaterally, with a white blood cell of 1,004/mm3 with lymphocyte predominance (88%) and elevated triglycerides (1008 mg/dl), and hence a diagnosis of chylothorax was made. Low IgG level (249 mg/dl) and hypoalbuminemia (2.5 g/dl) were noted at the time of pleural effusion drainage. Intravenous immunoglobulin and 25% albumin solution were administered. His feeding formula was changed to medium-chain triglyceride formula. The milky drainage became serous; however, the volume of chest tube drainage remained unchanged. Enteral feeding was discontinued and total parenteral nutrition was initiated, which decreased the volume of pleural effluent but small to moderate amount of pleural effusion was intermittently observed by chest X-ray for over sixty three days until the patient's death. Venous Doppler ultrasound of the upper extremities and the neck was performed on hospital day #7 and 4 weeks later, and compression, thrombosis or obstruction of the superior vena cava, and upper extremity were ruled out. A central venous catheter was placed in the right jugular vein soon after admission and was removed on hospital day #7 and replaced by a peripherally inserted central line. The patient required chest tubes for drainage until hospital day #22. Since then, intermittently small to moderate pleural effusion was observed by chest X-ray, but chest tubes were not placed.\nHe continued to be critically ill with persistent hypoxemic respiratory failure without improvement in PH with several PH crisis episodes. Therapy with an endothelin (ET) receptor antagonist (Bosentan) was added. The hospital course was complicated by bacterial tracheitis from Pseudomonas and E. coli. The patient remained on mechanical ventilator support for 6 weeks due to failed weaning of ventilator support from hypoxemia despite high levels of supplementary FiO2 and iNO. Cardiac catheterization performed 6 weeks after admission showed PVRi of 7 WU m2 on 100% FiO2 and 20 ppm of iNO under general anesthesia, pulmonary venous desaturation, and bidirectional shunting through ASD. Additionally, interval increases in right atrial pressure (mean 13 mmHg), right ventricular end diastolic pressure (12 mmHg), and pulmonary artery pressure (52/24 mean 36 mmHg) were noted. Given his severe and irreversible lung injury from mechanical ventilation in addition to baseline chronic lung disease, he was deemed not a candidate for lung transplant. Considering that the patient had Eisenmenger physiology due to severe PH and poor prognosis, the palliative care team was also consulted. Weaning from the mechanical ventilator was tried multiple times, but failed. At 9 weeks of his ICU hospitalization, he developed severe hypoxemia unresponsive to medical therapy that ultimately caused his death.\nAn autopsy showed bilateral small straw-colored pleural effusions (right 17 ml and left 10 ml), and the lung parenchyma was red-brown, poorly aerated, and diffusely congested with focal consolidation. The heart had an ASD (0.8 × 1.2 cm) with right ventricular hypertrophy secondary to PH. Microscopically, both lungs showed subpleural cysts lined by pneumocytes and containing macrophages, sloughed pneumocytes, and neutrophils. Acute multifocal bronchopneumonia was present with neutrophils in the bronchioles and alveoli. Chronic interstitial lung disease is diffusely present with alveolar septal thickening, capillary disorganization, and hemosiderosis. Small pulmonary arterial branches demonstrate moderate to marked medial smooth muscle hypertrophy with lumen narrowing, while large pulmonary arteries were normal with minimal changes. No lymphatic dilatation was observed on H&E or D2-40 immunostained slides; therefore, lymphangiectasia was ruled out (). From the autopsy results, hypoxia due to progressive PH was considered as a cause of death. |
A Romanian 5-month-old girl was referred to our hospital after being diagnosed with CCO in her country of origin. She was sent to the University Clinic of Ophthalmology of Turin in order to undergo penetrating keratoplasty (PKP) surgery on her left eye. We performed a complete physical examination of the patient through autorefractor, puff tonometer, slit lamp examination, as well as direct and indirect ophthalmoscopy under anesthesia. We managed to carry out the whole examination only on the left eye, which was emmetropic; the right eye had such a significant opacity as to prevent a complete analysis. Upon examination, the left eye, the healthy one, had a corneal diameter within the limits of age, 12.5 mm, pupil reflexes were normal, and the red fundi reflex was present. The right eye had a complete full-thickness corneal opacity; its diameter measured 10 mm and there were no irregularities detectable on the surface. Because of the complete corneal opacity, we were not able to explore the remaining structures. In both eyes there were no structural abnormalities of the ocular adnexa; there was no sclerocornea in the nasal sectors. The patient presented a natural tendency to esotropia; this is why during the preoperative phase, we informed the parents that one of our aims was to make the patient regain, through specific exercises, visual fixation. The patient's tendency to esotropia is not sufficient to uniquely determine the diagnosis of strabismus, but must be considered a wake-up call for the development of amblyopia.\nWe took into account two different surgical techniques: PKP and lamellar keratoplasty. The latter was technically impossible to carry out because of the full-thickness corneal opacity. PKP was the only technique that could lead to the achievement of the objectives set. The donator was a 27-year-old man. In order to preserve our patient's visual acuity (VA) and avoid the risk of her developing amblyopia, we did not wait for a younger donator. The donor's graft was 6.5 mm, the recipient's bed was 6 mm. The reason for the 0.5-mm difference was to ensure the possibility of growth of the patient's bulb (only 5 months), despite controversies in the literature, and to avoid subsequent surgery or postoperative ocular hypertension.\nThe whole surgery lasted 60 min. The operating room had been equipped so that we could carry out intraoperative optical coherence tomography (OCT) to confirm the full-thickness corneal opacity. The use of OCT also allowed to check the point of contact between the graft and the receiving cornea to verify correct positioning. During the operating session, the transplant was centered, the patient's iris was regular, there were no signs of Rieger's syndrome, there was a sustained positive vitreous pressure, and the crystalline was transparent. To avoid positive vitreous pressure, we administered mannitol. To avoid postoperative ocular hypertension, we performed iridectomy at 1 o'clock and we chose a viscoelastic with specific characteristics such as no proven correlation with postoperative hypertonicity. After the graft had been centrally placed, we sutured it with an interrupted suture using a nylon thread, alternating 11-0/10-0 threads. The position of the detached points between donor and recipient was adjusted to reduce residual corneal astigmatism. For the calculation of residual astigmatism, an objective examination under anesthesia will be necessary with subsequent prescription of lenses for its correction. In our case, the residual astigmatism was assessed with the operating microscope resulting regular and low grade. Once the sutures were done, we performed another intraoperative OCT of the anterior segment to check the possible remaining astigmatism. The donator's graft was regular without a significant astigmatism.\nThe first day after surgery there were no reactions of any sort: the donor's graft was well connected to the recipient's bed, the anterior chamber was formed, the lens was in place, and the red fundi reflex was present. The patient's postoperative treatment included netilmicin + dexamethasone (1 drop 3 times a day), dorzolamide (1 drop 3 times a day per the first 7 days and then 1 drop every other day for another 7 days). To avoid the patient from touching her eye we wrapped a dressing over it for 24 h. Then we replaced the bandage with a little plastic cup. During the second day after surgery the eye was exactly like the day before, there were no signs of complications. At the 1-week follow up visit the patient had lost the tendency to touch her eye, there were no signs of reactions of any sort, the graft was always well supported, and all the remaining structures were within normal limits. During the visit we explained to the patient's family the management to regain fixation with the right eye. We gave them a covering plaster to put on the left eye for an increasing amount of time: first 4, then 6, then 8 h, up to 10 h a day within 1 month of surgery.\nWe performed another visit 20 days after surgery: the patient had a 3/10 VA in the operated eye. At the 1-month visit the improvement of the preferential VA reached 4/10. At the 4-month follow-up visit the patient's VA was 4–5/10; since the latter examination, the patient had been treated with dorzolamide (1 drop per day) and clobetasol (2 drops per day). |
The patient is a 47-year-old Caucasian female who presented to the Emergency Department of an academic tertiary-care hospital in the Midwestern United States with complaint of left-sided weakness of the upper and lower extremities and right gaze preference three weeks after a right pontomedullary infarct complicated by Posterior Reversible Encephalopathy Syndrome (PRES) [that initial infarct had been treated in a different state]. Imaging revealed an acute infarct in the posterior limb of the right internal capsule without hemorrhagic transformation and an acute punctate infarct in the right parietal subcortical white matter with corresponding diffusion restrictions, as well as remote evidence of subcortical chronic diffuse microhemorrhages (). The Psychiatry Consultation & Liaison service was consulted on hospital day 2 after the patient reported, “I want to strangle myself with my oxygen cord.”\nOn initial evaluation, the patient reported history of anxiety treated previously by her primary care physician (PCP). She reported she had been frustrated with her medical condition but really did not intend to harm herself. She reported fluctuating mood since her initial stroke and had “good days and bad days.” She denied prior history of inpatient or outpatient psychiatric care or prior suicide attempts. She was oriented to person and place, but not time, was able to state the days of the week forwards, but not backwards, and endorsed visual hallucinations during her hospitalization. This presentation was felt to be consistent with delirium, and she was started on quetiapine 25 mg.\nFollowing a six-day medical admission, the patient was discharged to the acute inpatient rehabilitation unit housed within the hospital. Extensive diagnostic studies did not reveal an underlying etiology for the strokes, which were thought to be due to uncontrolled hypertension.\nPsychiatry was reconsulted by the rehab physicians for management of problematic behaviors. The patient exhibited ego-dystonic behaviors for which she would later apologize including repeatedly climbing out of bed, shouting for nursing assistance without clear need for help, shoving her fist into her mouth to induce vomiting, and periodic, purposeless screaming. These behaviors were disruptive to staff and other patients on the unit. While initially conceptualized as residual hyperactive delirium, her behaviors persisted and continued testing for underlying causes of delirium including electrolyte derangement, occult infection, new or evolving cerebrovascular event, or excess medication burden which were unrevealing\nAfter 60 days of acute rehab, she had reached maximal benefit of that intervention and continued exhibiting behaviors incompatible with nursing home disposition. The patient was then transferred to the university's geriatric psychiatry inpatient unit on an involuntary mental health commitment for behavioral management.\nIneffective medication trials prior to transfer included quetiapine (25 mg at bedtime and 25 mg several times daily as needed), mirtazapine (7.5 mg at bedtime), olanzapine (initial trial of 2.5 mg at bedtime and 2.5 mg several times daily as needed and a second trial of 15 mg and 2.5 mg several times daily as needed), buspirone (15 mg TID), divalproex (initial trial of 750 mg at bedtime and a second trial of 500 mg TID with lactulose and levocarnitine for hyperammonemia), melatonin (9 mg at bedtime), propranolol (40 mg QID), trazodone (150 mg at bedtime), gabapentin (200 mg several times daily as needed), dextromethorphan (20 mg BID, given as Robitussin), and clonazepam (0.5 mg AM and 1 mg PM).\nThroughout this period, the patient remained intermittently apologetic for her behaviors. Orientation was typically attuned to person, sometimes place, and generally not to month or year. She consistently denied depressed mood, anxiety, visual hallucinations, auditory hallucinations, paranoia, suicidal ideation, or homicidal ideation. Thought process remained concrete and perseverative with limited spontaneous speech output and paucity of thought content. Language remained intact without evidence of aphasia. Recent and remote memory were difficult to assess formally due to behavioral disturbance, but she had difficulty remembering recent details of her hospital course and remote details of her life prior to moving to her current city. She required staff assistance for completion of toileting, dressing, and feeding. She had deficiencies in executing complex motor tasks, such as getting out of bed, and was frequently found diagonal in bed with a limb tossed over the side-rail. These deficiencies were in excess of the residual motor effects of her strokes and suggestive of alterations in visuospatial skills, executive function, and planning. Her aberrant vocalizations did not appear goal-oriented and were not ameliorated by staff presence. This presentation persisted and was thought to represent a new cognitive baseline meeting diagnostic criteria for major vascular neurocognitive disorder with behavioral disturbance.\nNonpharmacological strategies including music, sensory stimulation, one to one time with staff, and frequent repositioning were tried without improvement in her symptoms. Additional ineffective medication trials following transfer to inpatient psych included fluoxetine (60 mg per day), retrial of dextromethorphan with fluoxetine as an enzymatic inhibitor (again to 20 mg BID), retrial of quetiapine (up to 600 mg total per day), haloperidol (5 mg several times daily as needed IM), oxycodone (5 QID), lorazepam (up to 6 mg daily), carbamazepine (200 TID), and chlorpromazine (50 QID). Throughout these trials, the patient continued to exhibit frequent periods of severe psychomotor agitation requiring vest restraint and purposeless screaming alternating with periods of oversedation following medications. Other than providing intermittent sedation, no particular combination of medications proved effective in treating the target symptoms.\nAt this point, having exhausted all reasonable behavioral and pharmacologic options, the inpatient psychiatric team recommended ECT as a last intervention prior to pursuing a palliative approach. Medical Ethics was consulted and felt ECT to be consistent with her previously articulated beliefs and wishes.\nThe patient was formally evaluated by the ECT service and, given her incapacity to consent, a court order was obtained for the procedure. She underwent an acute course of bitemporal ECT using a MECTA Spectrum 5000Q machine. She received methohexital and succinylcholine as anesthetic and relaxant agent, respectively. A dose-titration method was used to determine stimulus intensity. She received treatments at 50% over seizure threshold with the following parameters: pulse width: 1 millisecond, frequency: 20 Hz, duration: 2 sec. Treatments were given three times per week. She was maintained on chlorpromazine (50 mg QID) and lorazepam (1 mg QID) during the treatments. Following the sixth ECT treatment, the patient rarely engaged in purposeless yelling, and remained quiet most of the day, experienced normalization of her sleep wake cycle, but still exhibited purposeless movements and psychomotor agitation requiring a vest restraint at night.\nFollowing the third week of ECT treatments, she was consistently having low scores on the Pittsburgh Agitation Scale (PAS) and had minimal requirements for as needed medications for agitation []. While she still required a vest restraint overnight, her psychomotor agitation had improved dramatically. She resumed feeding herself with her right arm and tolerated pureed foods for the first time in six months. Following an acute course of 16 treatments, ECT was tapered to twice weekly and she started sertraline 25 mg in preparation for further decrease in ECT frequency. She remained stable and was successfully discharged to a nursing home with continuation of ECT as an outpatient. Following the expiration of the original court order for ECT, outpatient ECT was discontinued and the patient's family chose to not pursue a renewal of the order for continued treatment. She received 29 treatments in total. Nursing home staff reported that her behaviors remained in control after stopping ECT and she was thereafter able to return home with her parents. |
A 52-year-old female patient, without any previous illnesses, was sent to our medical office since she had been suffering from spinal and radicular pain radiated to her left leg for a month. Her clinical exam showed both lumbar and radicular pain in her left leg without any motor loss, with hypoesthesia of the external side of her left leg and the dorsum of her left foot.\nStanding and dynamic radiographs demonstrated a 4 mm instability at the L4-L5 level and a laminar inclination angle of 120° (it is the angle measured between the line that connects the top and bottom edges of the superior articular process and the line that connects the anterior cortex with the posterior cortex of the vertebral body) (). The CT study showed degenerative facet changes and vacuum phenomenon at the left L4-L5 level, with a 10° of facet tropism (difference between the right and left L4-L5 facet angle in an axial view) (). MR images showed moderated to severe disc degenerative changes at L4-L5/L5-S1, as well as lesions that were hypointense on the T1 sequence and hyperintense on the T2 and STIR sequences in both L4-L5 facet joints, compatible with bilateral synovial cysts, the largest being on the left, which relates to her radicular symptoms ().\nInitially, the patient was treated conservatively with physiotherapy sessions and analgesics. After six months due to poor response to the conservative management, she underwent cyst aspiration and infiltration of the facet joint, under radioscopic control in prone position using coronal and oblique planes of the left L4-L5 joints. A 22 G × 100 mm spinal needle was used and, to ease joint access, the end of the needle was slightly bent (Figures and ). A percutaneous aspiration of the cyst was performed, obtaining 3 mm of a light liquid, followed by the infiltration of 2 cc of 2% mepivacaine and 2 cc of betamethasone (Figures and ). After the procedure, radicular symptoms improved almost up to their total disappearance, but lumbar pain remained. A year after the procedure, the patient started having left radicular pain again and persisting lumbar pain, so surgical treatment was proposed. Under general anaesthesia and antibiotic prophylaxis, with the patient positioned in prone decubitus, a posterior approach was performed with the subperiosteal dissection of paravertebral muscles up to the tip of the transverse processes, a hybrid L4-S1 fusion, via left unilateral transforaminal (TLIF) with interbody polyether-ether-ketone (PEEK) implants, bilateral L4, L5, and S1 pedicle screws, and autologous bone from both the surgical field and the left posterior-superior iliac spine was performed.\nThe postoperative period was uncomplicated, and after a five-year follow-up, the patient remains asymptomatic living a normal life with job reinsertion. The radiology study shows an adequate implant position, without signs of loosening, compatible with solid fusion (). |
A 19-year-old male with no medical history was referred to our service with approximately 2 weeks of headache and 2 episodes of vomiting. Detailed history from his parents revealed a change in behavior, including apathy and uncharacteristically poor university grades, over the prior 12 months. With the exception of a right pronator drift, his neurological examination was normal. CT brain revealed a large extra-axial heterogeneous mass involving the left frontal and temporal lobes with well-defined lobulated margins and avid enhancement of the high-density areas. The lesion eroded the inner table of the left frontal bone with the outer table almost completely eroded []. MRI brain with contrast demonstrated a large extra-axial ovoid heterogeneously enhancing left frontal convexity mass measuring 6.2 cm ×7.1 cm ×7 cm []. There was considerable susceptibility artifact, suggesting calcification and/or hemorrhage. There was also evidence of destruction and erosion of the calvarium, and a small extracranial component of the tumor was noted. The diagnosis of hemangiopericytoma was entertained and surgery planned.\nIntraoperatively, the tumor was found to have breached the dura and as suggested by preoperative imaging, had invaded bone []. The involved bone (including the lateral sphenoid wing) and a generous cuff of dura were resected. The tumor was soft and moderately vascular. The tissue plane between tumor and brain was easily developed using standard microsurgical technique. A gross total resection was achieved. The dural defect was repaired with pericranial graft, and titanium mesh used to repair the bony defect.\nThe patient’s postoperative recovery was uneventful and he was discharged home day 5 after surgery. Postoperative MRI revealed no evidence of residual tumor. PET scanning did not reveal any other lesions. The patient was referred to a local specialist sarcoma unit for adjuvant chemotherapy with VIDE (vincristine, ifosfamide, doxorubicin, and etoposide), to be followed by focal irradiation and second round of chemotherapy with VAI (vincristine, dactinomycin, and ifosfamide).\nThe patient is now 1-year postsurgery with no clinical or radiological evidence of recurrence or metastatic disease.\nUnder light microscopy, the specimen showed a durally based, highly cellular tumor composed of relatively monotonous small blue cells with slightly irregular nuclei and thin rims of cytoplasm [] displaying PAS- positive material []. The mitotic rate was high at 34 mitoses per 10 high-power fields. There were numerous vessels, some displaying thrombosis and there were areas of hemorrhage and hemosiderin deposition. There was no necrosis. The tumor cells were positive for FLI-1, MIC-2, and vimentin []. The cells were negative for STAT6, CD 34, DUX-4, WT1, desmin, myogenin, ERG, synaptophysin, chromogranin A, pan-CK, EMA, P40, CK8/18, LCA, SOX10, CD 20, CD3, and TDT. Ki67 was positive in 30% of the cells, visually estimated. The specimen was sent for FISH and tested positive for EWSR1 (22q12) rearrangement. |
A 21-year-old man with a body weight of 85 kg ingested 100 mL of diquat (20 g/100 mL) 5 hours before admission because he had been quarrelling with his family. Fifteen minutes after ingestion, he developed nausea and vomiting. The patient was sent to the emergency intensive care unit, and gastric lavage was performed. Three months earlier, the patient had been diagnosed with depression. He had no history of allergy, smoking, hypertension, diabetes, coronary heart disease, or infectious diseases such as hepatitis or tuberculosis.\nAfter admission, physical examination showed that the patient’s vital signs were stable and that his oral mucosa was eroded. He had remarkable subxiphoid tenderness without rebound pain or muscle tension. Cardiopulmonary function was normal. The laboratory examination results are shown in . Hemoperfusion was performed twice daily after admission. Anti-infection, organ protection, and anti-oxidation drugs were administered. Two days after admission, chest computed tomography showed patchy hyperdensities with poorly defined boundaries in the upper lobe of the right lung and the lower lobes of both lungs. The daily urine volume was 100 mL. Continuous renal replacement therapy and continuous venovenous hemodiafiltration with hemoperfusion were performed. The patient received methylprednisolone (80 mg twice daily in the first 3 days and 40 mg twice daily thereafter), sulbenicillin (4 g three times daily for 10 days; this treatment was then changed to moxifloxacin at 0.4 g for 5 days), ulinastatin (200,000 IU twice daily for 10 days), and acetylcysteine (8 g once daily for 7 days). Five days after admission, the patient developed disturbance of consciousness. Considering the disturbance of consciousness and significantly increased creatinine level, renal encephalopathy was suspected. Ten days after admission, the patient exhibited quadriplegia, chewing and swallowing disorders, and positive bilateral Babinski signs. Head computed tomography was performed to exclude concomitant damage in the central nervous system as the cause of the consciousness disorder, and hypodensity in the pons was found. At 11 days, brain magnetic resonance imaging showed a pontine lesion with slight hypointensity on T1-weighted imaging, hyperintensity on T2-weighted imaging, and heterogeneous intensities on diffusion-weighted imaging and apparent diffusion coefficient imaging (). A diagnosis of acute pontine demyelination was made by collaboration among poisoning experts, neurologists, and neuroradiologists. At 15 days after admission, the patient died of multiple organ dysfunction syndrome. |
A 56-year-old Caucasian man was admitted to the cardiology ward of our hospital due to lethargy and muscle weakness, attributed to the presence of bradycardia. Routine admission laboratory tests revealed high plasma sodium levels (Na+: 157 mEq/L), which motivated, on the following day, a request for nephrology evaluation. At nephrology consultation, the patient was found to be in apparent good health. He was conscious, without obvious motor deficits. On physical examination, his blood pressure was 140/70 mmHg and his heart rate was 54 b.p.m. There were no clinical signs of decreased extracellular volume. The patient was not taking any kind of medication. His wife reported that he had been loosing weight in the last years. His past medical history revealed that 9 years previously he had had a hemorrhagic stroke and needed brain surgery to clamp a ruptured aneurysm of the anterior communicating artery and to drain a cerebral hemorrhage. A representative figure of patient’s cranial computed tomography (CT) done at that occasion is presented in . The stroke resulted in some impairment of the capacity of space location, moderate reduction of the recent and fixation memory and a certain aversion to water. There was no history of polyuria. New laboratory tests were ordered and confirmed hypernatremia: plasma sodium of 155 mEq/L and plasma chloride of 116 mEq/L. Urinalysis: urine-specific gravity of 1026, no blood or protein and a normal sediment. Plasma potassium, creatinine and urea were, respectively, 4 mEq/L, 1.07 mg/dL and 41 mg/dL. In the 24 h that followed nephrology consultation, the patient passed only 400 mL of urine. The diagnosis of possible hypernatremia secondary to post-stroke hypodipsia was then made and supervised water intake of ∼2 L a day was initiated. After this simple measure, there was an increase in diuresis and plasma sodium was reduced to 150 mEq/L on the third day and to 144 mEq/L on the fourth day after admission. Two weeks after hospital discharge, he had gained 3 kg and referred marked improvement in lethargy and muscle weakness. His plasma sodium level was normal. The evolution of the patient’s laboratory tests, including the ones collected 2 weeks after hospital discharge, are presented in . |
A 79-year-old Caucasian male, with a past medical history of atrial fibrillation on warfarin and metoprolol, and coronary artery disease on atorvastatin with previous coronary artery bypass grafting and placement of a dual-function pacemaker/ implantable cardioverter defibrillator (ICD), was on a motor boat in a remote location. The patient’s boat went over a wake of a larger boat passing by. He bounced off his seat in a vertical direction and subsequently landed on his tailbone. After the high impact fall, he complained of both immediate lower back and diffuse abdominal pain but did not seek out urgent medical help.\nTwo days after the initial incident, he started to become pale and diaphoretic; additionally, his ICD delivered three shocks over a 30-min period. He presented via ambulance service to a local community hospital in hemorrhagic shock with a blood pressure of 63/22 and heart rate of 118 beats/min. A primary survey was pertinently positive for hemodynamic instability and diffuse abdominal and lower thoracic spine tenderness.\nHe was resuscitated with 1 L of normal saline leading to an improvement of his pressure to 106/88. Initial laboratory investigations included a hemoglobin of 95 g/L, lactate of 6.1 mmol/L, creatinine of 129, and a supratherapeutic INR of 8.8. An initial non-contrast CT abdomen and pelvis showed moderate hemoperitoneum with sentinel clot in the left upper quadrant and pericolic gutter, as well as the area adjacent to the posterior wall of the stomach. An additional finding of a severely comminuted, minimally displaced burst fracture of the T10 vertebral body was noted (). Further interventions included INR reversal with 3 mg of Vitamin K and 3000 units of prothrombin complex concentrate, and administration of 2 units of packed red blood cells and 2 L of normal saline. Based on clinical severity, the patient was transferred to the trauma service at a tertiary-care Level 1 trauma center.\nPrimary survey revealed a protected airway, spontaneous and bilateral air entry, and hemodynamic stability with a blood pressure of 100/60 and a heart rate of 88 beats/min. His abdomen continued to be mildly distended and tender without peritoneal signs, however the patient reported it had improved since his original presentation to the local hospital. Repeat laboratory investigations revealed a stable hemoglobin of 94 g/L, and correction of his INR to 1.2. Given his stable condition, he underwent a CT RIPIT (Rapid Imaging Protocol in Trauma) [] and CT angiogram (CTA) of the abdomen and pelvis. His imaging revealed pseudoaneurysms of the left gastric artery measuring up to 6 mm with another 9 mm rounded area of increased attenuation along the lesser curve of the stomach (, ). No extravasation was seen. Decision was made to monitor the patient closely with serial abdominal exams and repeat imaging in 72 h, or sooner if the patient exhibited any signs of deterioration.\nOver the next 72 h, the patient’s vital signs and abdominal exams, improved and his hematological profile remained stable. Given the patient’s CHADS score of 2, it was decided to hold therapeutic anticoagulation until the patient’s bleeding risk decreased, however deep venous thrombosis prophylaxis was initiated. A repeat CTA was performed to follow the evolution of the two pseudoaneurysms. The imaging study revealed unchanged pseudoaneurysms but noted the distal aspect of the left gastric artery was attenuated in keeping with a focal dissection and intramural thrombus. Secondary to the dissection, the patient was started on 81 mg of aspirin daily. Over the next few days the patient continued to improve clinically, and was discharged home. The patient lived outside of the local area, and arrangements for close follow up were made. |
A 22-year-old male nursing student presented to the emergency department with complaints of retrosternal pain and dyspnoea for one day. The patient also complained that he could feel some air passing through the tissues below the skin in the neck. The patient had a history of throat pain and intermittent cough for three days and a history of ingestion of hot water a day before the presentation. He denied any history of trauma to the neck or any strenuous activity over the past one week. His other medical history was unremarkable. He had no addictions and not undergone any surgeries in the past.\nPhysical examination revealed a healthy-looking young man with tachypnoea. His pulse rate was 112 beats/min and blood pressure was 120/70 mmHg, his respiratory rate was 24/min. Crepitations were felt in the neck region extending up to the left nipple over the chest. The breath sounds and heart sounds were normal. Other systemic examinations were within normal limits.\nLaboratory values (complete blood count, renal function test, electrolytes) and arterial blood gas were within normal limits. His electrocardiogram (ECG) was normal. X-ray neck and chest showed pneumomediastinum and subcutaneous emphysema (Figures -). Laryngoscopic examination did not reveal any mucosal lesion or foreign body. Computed tomographic scan of the head, neck and chest with oral gastrograffin was done which was suggestive of pneumomediastinum (Figures -). There was no evidence of any oesophageal perforation, pneumothorax, pleural disease and lung pathology. Upper gastrointestinal endoscopy and bronchoscopy was also normal. The patient was admitted and managed conservatively. He was given oxygen by mask, analgesics, cough suppressants, and steroid nebulisation. His symptoms settled with conservative management in three days and hence the patient was discharged. The patient was followed up for six months and there was no recurrence of symptoms. Chest X-ray was repeated after three and six months and there was no evidence of pneumomediastinum (Figure ). |
A 39-year-old woman, who had been taking medication of quetiapine as an antipsychotics for depression, experienced mild dysarthria and visited the department of neurology in our hospital. Her symptom was diagnosed as drug-induced lip dyskinesia, which disappeared in a week. Screening head magnetic resonance imaging (MRI) at this time revealed stenosis of the left MCA with no brain parenchymal lesions (), why she was consulted to our department. We performed angiography, confirming moderate M1 portion stenosis (Figures and ). SPECT showed no apparent laterality in CBF, thereby we decided to observe her with no treatment.\nSeven months later, the patient experienced mild weakness and numbness in her right hand and visited our department. Although MRI showed no apparent ischemic change in her brain, arterial spin labelling (ASL) of MRI detected the decrease of CBF in the left cerebrum (), which was thought to well correspond for her symptoms. She was admitted and treated with an antiplatelet agent. Two weeks later, she still complained of numbness in her right hand; thereby, we decided to perform left STA-MCA anastomosis to prevent deterioration of her symptoms. Preoperative SPECT showed no apparent laterality in CBF (). On operation, left temporal craniotomy was performed, and the parietal branch of the STA was anastomosed with the M4 portion on the temporal lobe (Figures and ). The intraoperative course was uneventful, and the patient recovered from anesthesia without any new neurological symptoms\nPostoperatively, her speech was normal until postoperative day 1 (POD1). On POD2, she exhibited mild speech disturbance, which worsened day by day finally resulting in complete motor aphasia on POD6. Her comprehension was kept normal. On POD3, generalized convulsion occurred, which ceased quickly by diazepam, and levetiracetam was initiated. On the same day, she presented with mild weakness of right upper extremity, which improved gradually and disappeared on POD7. MRI and CT showed no ischemic or hemorrhagic changes, but ASL and SPECT revealed remarkable increase of CBF in the left cerebrum (Figures and ), by which the symptoms were diagnosed as CHPS. Despite the treatment with strict blood pressure and the administration of edaravone and minocycline, complete motor aphasia remained unchanged on POD21. MRI showed no abnormality except slightly hypointense changes on T2 weighted images and FLAIR (). At this point, the patient was discharged partly because of the request from the patient, and we continued to follow her in outpatient visit. One month after the surgery, the patient started to utter words that were not fluent, when SPECT and MRI showed normalization (). Thereafter, the improvement of her speech was slow, and totally more than three months was taken for full recovery after the surgery. |
A male patient aged 15 years reported to the Department of Oral and Maxillofacial Pathology with a chief complaint of swelling in the right side of the upper and lower jaws. It had started as a small swelling that increased in size over 10 months. On examination, the swellings were found to be firm and slightly tender.\nAn orthopantomograph [] revealed multiple radiolucent lesions on both sides of the maxilla and the right side of the mandible. Impacted teeth were present on both sides of the maxilla and on the right side of the mandible that were displaced by the enlarging cysts [Figures and ]. He also had hypertelorism and synophyrs []. Computed tomography (CT) scan of the brain did not reveal calcification of the falx cerebri [Figures and ]. Skin lesions like basal cell nevus or keratosis were absent. However, a chest radiograph showed the presence of a bifid rib on the right side []. The presence of multiple cysts in the jaws and extra oral features raised suspicion of GGS. Routine biochemical and hematological evaluations were carried out and the patient was hospitalized. Under all aseptic precautions, general anesthesia was administered. Local anesthesia with adrenaline was injected and flaps were raised intraorally in all quadrants one after the other. A surgical window was needed only in the third quadrant to reach the cyst. No vital structures were seen near the lesions. A slow speed straight hand piece (E-type Nosecone; NSK) with tungsten carbide burs (tapering fissure and flame shaped) and a surgical curette were used with saline irrigation for enucleating the cysts. Curettage was done using a curette and a round bur. The remnants of the cysts were removed using chemical cautery with Carnoy's solution (2.5%) for 3 min without chloroform followed by irrigation with saline. The cysts were enucleated from all four quadrants followed by extraction of impacted teeth 17, 18, 28, 38 and 48. The tissues removed were put in separate bottles containing formalin and the corresponding quadrant number was noted. As bone regeneration in children is faster, bone grafts were not used. The enucleated tissues were sent for histopathological evaluation. All three lesions were sectioned and studied using hematoxylin and eosin stains. The sections showed a cystic lining of corrugated parakeratinized stratified squamous epithelium consisting of 6-10 layers of uniform thickness. The basal layer showed palisading nuclei and tombstone appearance []. Epithelial connective tissue separation was seen []. The underlying connective tissue showed odontogenic epithelial islands, blood vessels and inflammatory cells. All three lesions were diagnosed as odontogenic keratocysts. The presence of two major signs (bifid rib and multiple odontogenic keratocysts) and one minor sign (hypertelorism) confirmed that our patient was a case of GGS. The patient is being followed up at 3-month intervals and no recurrence has been noted. |
An 80-year-old man was admitted to our hospital for the treatment of small bowel obstruction. Initial management involved nasogastric tube insertion and fluid resuscitation with central venous (CV) catheters. His small bowel obstruction did not resolve, and on the 8th day, he presented fever and hypoxemia. He had a history of stage IV chronic kidney disease secondary to hypertensive nephrosclerosis for 15 years, and distal gastrectomy for gastric cancer 20 years before. He did not have smoking history and risk factors for HIV infection, and drank alcoholic beverages occasionally. Physical examination revealed poor oral hygiene only. The chest x-ray revealed multiple nodules in the right upper lung field, and also mixed ground-glass and airspace opacities in the entire right lung (Figure ). The chest CT scan showed multiple small cavitary lesions and nodules surrounded by ground-glass opacities, and also bilateral pleural effusion (Figure ). Examination of sputum showed no predominant pathogen and no acid-fast organisms on staining. Laboratory tests revealed elevated serum β-D-glucan (483 pg/ml, normal, < 20 pg/ml) positive serum Candida antigen latex agglutination test, and negative serum Aspergillus galactomannan antigen test. Two sets of blood culture specimens were drawn on the 8th day which yielded Candida albicans. Transbronchial biopsy and bronchial washings of the cavitary lesion in the right upper lobe were performed, however, non-specific inflammation of the lung tissue without any bacteria was revealed. Moreover, transbronchial biopsy did not reveal aspergillus hyphae. The patient was diagnosed as affected with invasive candidiasis. Therefore, potentially contaminated CV catheter was removed and antifungal therapy with intravenous fluconazole was started. The patient became afebrile after the 3rd day of the initiation of antifungal therapy, and blood culture of the same day did not yield any organisms. The treatment was continued for three weeks, and on the 15th day of antifungal therapy the chest CT findings showed a remarkable improvement (Figure ).\nCandida spp. exist as normal flora of the human skin, oropharynx, lower gastrointestinal tract, and genitourinary system. Candida spp. are now one of the most common causes of nosocomial blood stream infections worldwide []. Invasive candidiasis is a fungal infection that can occur when Candida spp. enter the bloodstream. Once the fungus is in the bloodstream, it can spread to other parts of the body and cause infection. There are risk factors for invasive candidiasis, such as central venous catheter, surgical procedure, acute renal failure, disseminated intravascular coagulopathy, parenteral nutrition and the use of broad-spectrum antibiotics []. In our case, parenteral nutrition with CV catheter was thought to be the risk factor for invasive candidiasis. Moreover, small bowel obstruction was also thought to be the risk factor because the protective mechanisms of intestinal mucosa were thought to be broken.\nThe few available studies on this topic indicate that pulmonary manifestations of invasive candidiasis are seen in no more than 0.2 to 8.0% of at-risk ICU patients and cancer patients []. As with other opportunistic mycoses, sputum cultures are unreliable for diagnosis, because the organism frequently colonizes in the upper airways, and a definitive diagnosis requires culture of Candida from blood, normally sterile organ or body cavity [,]. We could diagnose our case as invasive candidiasis by the positive blood culture and chest CT findings. The most common chest CT findings were reported as multiple bilateral nodules often associated with air-space consolidation, however these findings are nonspecific and the differentiation from other fungal infections (especially aspergillosis) is difficult. In pulmonary fungal infections cavitation has been considered to represent concomitant bacterial infection or hemorrhagic lung infarcts, and the surrounding ground-glass or air-space opacity has been considered to represent a mixture of edema and hemorrhage []. The multiple cavitary lesions seen in our patient were thought to represent septic pulmonary infarcts due to blood-stream infection of Candida albicans, and this CT finding is rare in invasive candidiasis. It was reported that cavitary lesions were less common in invasive candidiasis (4%) than in aspergillosis (16%) [], and, to our knowledge, this is the first case report describing multiple pulmonary cavitary lesions in invasive candidiasis. |
A 26-year-old Korean male was diagnosed with stage IV poorly differentiated gastric adenocarcinoma of the lower body with multiple liver metastases in August 2009. The initial diagnosis was made at an outside hospital using abdominopelvic computed-tomography (CT) and endoscopic biopsy of stomach. The pathologic specimen at the time of diagnosis was not procured. The patient was initially treated with systemic chemotherapies, including three cycles of S-1 and subsequently four cycles of FOLFOX chemotherapy, resulting in the progression of liver metastasis. After second-line chemotherapy, the patient was transferred to our institute (Asan medical center, Seoul, Korea) for further management in September 2008. Baseline tumor tissue was obtained via endoscopic forceps biopsy before treatment. As third-line chemotherapy, the patient was enrolled in an open-labeled, phase II trial evaluating the efficacy of everolimus 10 mg/day, and he achieved a partial response by the Response Evaluation Criteria in Solid Tumors (RECIST) as the best response after 1 year and 2 months (Figure A and B). The tumor remained stable with a partial response over 2 years in this initial treatment of everolimus. However, after 29 months of initial everolimus treatment, abdominopelvic CT revealed the progression of liver metastasis. An episodic pneumonia due to streptococcus occurred right after disease evaluation, and the patient underwent antibiotic treatment for a month. Subsequently, the patient underwent salvage chemotherapy with FOLFIRI but failed after 3 cycles with disease progression. Sequential three cycles of oral paclitaxel and six cycles of docetaxel chemotherapy were applied to the patient for 4 months to maintain stable disease. During the period of docetaxel treatment, however, the patient suffered from general weakness accompanied by poor compliance and eventually failed the treatment. In such circumstances, we decided to resume the everolimus monotherapy as salvage chemotherapy.\nBefore re-treatment with everolimus, according to results from our previous retrospective data [], we investigated the mutation of the PIK3CA gene in the tumor tissue obtained just before re-treatment of everolimus. DNA was amplified using oligonucleotide primers specific for mutational hotspots in exons 9 and 20 of human PIK3CA. The mutational analysis revealed one of the classical activating PIK3CA hotspot mutations: E545K in exon 9 (Figure ). In addition, we performed immunohistochemical (IHC) staining for pS6 at serine 235/236 (pS6Ser235/236, 1:150 dilution, rabbit monoclonal, Cell Signaling Techmology) and at serine 240/244 (pS6Ser240/244, 1:200 dilution, rabbit polyclonal, Cell Signaling Technology) and PTEN (1:50 dilution, rabbit monoclonal, Cell Signaling Technology) with tumor tissues obtained just before and 2 months after re-treatment with everolimus. The tumor cells were strongly positive for pS6 in more than 50% of the tumor, and PTEN was weakly positive in tumor cells relative to the internal controls of endothelial cells (Figure A). From January 2012 to February 2013, during the re-treatment with 10 mg everolimus daily, we evaluated the tumor every 2 months by APCT and observed stationary state of liver metastasis. After two months of everolimus re-treatment, the patient underwent follow-up endoscopic biopsy and IHC staining for pS6 and PTEN. Strikingly, the tumor cells in the follow-up biopsy were completely negative for pS6, whereas the intensity of PTEN was notably increased in all tumor cells (Figure B). As a result of re-treatment with everolimus, this patient was able to maintain stable disease for more than 1 year but unfortunately died in March 2013 (Figure ). |
An 18-year-old male volleyball player presented to the clinic with a three-week history of lower back pain. The patient was otherwise healthy, with no history of trauma. Spinal extension with his arms overhead during jumping elicited lower right back pain (Figure ).\nA review of systems did not reveal any other pertinent findings. On examination, the patient showed normal responses to the straight leg raise test and no neurologic signs. His range of motion was normal with extension and flexion of the lumbar spine, but associated pain occurred over the paravertebral muscles. Palpation of the proximal lumbar spine vertebrae revealed mild tenderness. Paraspinal spasms were noted. No signs suggestive of inflammation were evident. The stork test caused mild pain over the lower back (Figure ).\nConservative treatment was initiated which included rest for two weeks and icing of the painful area of his back for 15-20 minutes a day, up to three times a day. The patient was also advised to avoid any activities and positions that might lead to back pain. He was advised to take ibuprofen as needed for pain and cyclobenzaprine as needed for spasms. He was referred to physical therapy for local modalities and core-strengthening exercises. His back pain had resolved by the two-week follow-up. Approximately three weeks later, he was pain-free, even during activities.\nDiagnosis\nIn this athlete, treatment was geared towards mechanical back pain and spasms, and it appeared to be effective. The patient had expressed desire at the time of the consultation to participate as soon as possible in a college-level volleyball competition. The lengthy symptomatology (three weeks) in this adolescent collegiate athlete who performed repetitive hyperextension as a volleyball player who was planning to participate in an upcoming competition, combined with the physical examination findings and positive stork test, indicated a need for radiography due to increased suspicion of spondylolysis [-]. Anteroposterior view of the lumbar spine was normal (Figure ). Lateral radiography views of the lumbar spine in flexion and extension views (Figures , ) showed a well-corticated triangular osseous focus at the anterosuperior aspect of the L5 vertebral body. These findings are classic for a limbus vertebra at L5 and no further workup was required.\nA single-photon emission computerized tomography scan or magnetic resonance imaging would have been an appropriate next step had spondylosis been noted on radiography or had the patient not responded to conservative treatments [-]. |
An 82-year-old man with a history of schizophrenia fell and was transferred to our hospital by ambulance. Upon initial physical examination, tenderness and swelling were noted over the right trochanteric region. His right leg was immobile because of severe right hip pain. Moreover, he had no neurovascular deficits or other extremity or systemic injuries. Radiography revealed an AO type 31A2.2 [] and Jensen type 3 [] trochanteric fracture in the right femur (). For treatment, the patient underwent a closed reduction and internal fixation with a gamma 3 long nail (Stryker, Kalamazoo, Michigan, US) according to the manufacturer's instructions. The lag screw was the appropriate length and reached to the subchondral bone of the femoral head. However, the lag screw was inserted anteriorly and a varus malalignment remained (Evans classification was type 1 group 3) in AP view () []. Complications did not occur during the surgery or throughout the 1-month period of hospitalization. The patient was an elderly and had a history of schizophrenia; hence, rehabilitation did not proceed after surgery. Thus, he was unable to walk by himself and was wheelchair-bound when he was discharged. One year after surgery, the patient presented to the clinic for a regular follow-up. Although there were no additional falls or subjective symptoms, radiograph revealed that the intramedullary nail was disassembled with bone fragment displacement. The lag screw penetrated into the pelvis through the femoral head and acetabulum (). No intra-abdominal organ injuries were confirmed on a contrast-enhanced computed tomography scan. The lag screw was located between the internal and external iliac vessels, and tangent to the small intestine; however, no signs of pneumoperitoneum or hematuria were present ().\nTo prevent future concomitant injury of the blood vessels, ureter, and intestine, we decided to remove the implants. If the lag screw had been adhering to the intestine, the threaded part of the screw could damage the intestine when removing the lag screw from the femoral side. Therefore, we considered that removing the lag screw under direct view from the pelvic side would be safer. Laparoscopic removal of the lag screw was then performed by gastrointestinal surgeons. Intestinal damage was not observed, and after peeling the peritoneum around the lag screw, the screw was pulled out with forceps (). The nail and distal locking screw were then removed by orthopedic surgeons. Furthermore, it was found that the set screw was not inserted to the proper depth. Considering invasion and the fact that he was already unable to walk, we decided to perform implant removal rather than hip replacement.\nThe postoperative period was uneventful. At 1 year postoperatively, the patient remained wheelchair-bound without pain. A follow-up radiograph revealed nonunion of the right trochanter of the femur (). |
A 48-year-old male presented to our neurosurgery clinic with a complaint of pain in the bilateral lower limbs along with progressive weakness in all four extremities for the past 4 years as well as urinary incontinence for the past 1 year. He became bed bound and catheter dependent. He was treated for suspected cervical spine tuberculosis for 6 months by antituberculosis therapy at an outside institute, but there were no confirmatory tests done. He did not provide us with any other relevant history.\nOn examination, he was a middle-aged male with a body mass index of 30 kg/m2 and wheel chair bound. He was alert, awake, and oriented to time, place, and person. He did not exhibit any cranial nerve deficits. His motor examination showed normal bulk, increased tone, and power of 0/5 in all muscle groups of both upper and lower limbs bilaterally. He also had hyperactive deep tendon reflexes of the biceps, triceps, brachioradialis, patellar, and Achilles tendons. Planters were up going along with sustained clonus bilaterally. Anal tone was lax.\nComputed tomography (CT) scan [Figures and ] showed ossification of the entire cruciform ligament along with pseudarthrosis of C1 and C2 vertebra. Magnetic resonance imaging (MRI) [] revealed severe cervical cord stenosis.\nThe patient was explained in detail about the following three options: prolonged application of hard collar, halo ring traction, and surgical decompression. Due to chronic nature of his symptoms and belonging to a remote area making regular follow-ups difficult in case of halo traction and hard collar, the patient opted for surgical decompression. He was counseled about the risks including but not limited to cervical cord injury, visceral injury, failed decompression, and persistence of symptoms. After developing an understanding on risks and benefits, informed consent was taken and we did a neuronavigation-guided transoral decompression of C1 and C2. Highly vascular pseudarthrosis along C1 and C2 anterior arches and ossification of cruciate ligament (both transverse and longitudinal components) were noticed. Maximum safe debulking was performed.\nDue to the main bulk of the ossified ligament seen anterior to the cord as well as the anterior compression of the cervical spine, we opted for an anterior approach as opposed to a posterior or 360 approach. Our patient and his family were kept in confidence that there may be a need of another procedure if complete debulking could not be done anteriorly.\nPostoperative CT [Figures and ] scan was also performed which showed nonvisualization of the anterior tubercle, anterior arch, part of posterior arch of the atlas, and dens and pedicle of axis vertebra, with resultant widening of the spinal canal. Postoperative MRI was not done as the patient showed subjective and objective improvement. He had severe financial issues and MRI is a costly investigation in our country.\nHe was shifted to the intensive care unit for 24 h postoperatively and later shifted out. His neurological signs improved after 2 weeks with a power of 4/5 in the left hand and 3/5 both proximally and distally in left the lower limb, right upper limb, and lower limb. He had no pain or any other postoperative complication. Physiotherapy and rehabilitation program were initiated. On 3-month follow-up, he was able to stand with support and his motor examination improved to 4+ power in all groups bilaterally in both upper and lower limbs. |
A 10-year-old girl born out of second degree consanguineous marriage presented with complaints of regression of both motor and mental milestones from the age of 4 years. She was born naturally at full term followed by mild delay in milestones; however, she was fully ambulant and communicating in sentences by the age of 3. Then it was noticed that she developed difficulty in walking in the form of abnormal posturing of the trunk which aggravated during attempted motor tasks of the limbs and exertion. Later she developed plantar flexed posture at both ankles, dystonic posturing and choreiform movements of both upper limbs followed by self-mutilating behavior in the form of biting at the base of her thumb, biting the lips and the tongue. Later she developed difficulty in chewing, swallowing and became bed bound. She could comprehend simple commands and was communicating through sounds and gestures which her mother could comprehend.\nExamination showed an emaciated patient. Her head circumference was 42 cm, weight 11 kg and height 102 cm. She was able to understand simple commands. Examination of her lips showed ulcerated, swollen lower and upper lips []. Several parts of the lower lips were missing. The ulcers were showing yellowish slough with areas of bleed. Her angle of the mouth showed ulceration and pigmentation. Minor ulcerations were also seen over the tongue and two of her incisors were missing in the lower jaw. She was in ophisthotonic posture and the right thigh had crossed over to the left thigh with the right leg placed below the left knee []. Any attempt to move the right leg produced severe pain. Examination of her nervous system showed pallor of both optic discs. She had orofacial dystonia and apraxia for swallowing. There was retrocollis, opisthotonus of the trunk [] with partial flexion at elbow, wrist, hip and knee. Choreiform movements were seen in both upper limbs. Her reflexes were well elicited and plantars were extensor.\nShe was investigated with blood tests and imaging. Her liver enzymes were elevated: Alanine transaminase was 173 U/l and aspartate transaminase was 534 U/l (normal value 8–50 U/L). Lactate dehydrogenase levels were elevated at 1208 U/l (normal < 248 U/l). Serum ceruloplasmin levels were 37 mg/dl (normal 20-35 mg/dl). Her peripheral smear showed normocytic to microcytic hypochromic blood picture. Her ferritin levels were in the lower limit of normal. There was no KF ring. Serum uric acid, serum copper and 24 hour urinary copper were normal. Urine screening for abnormal metabolites and tandem mass spectroscopy for inborn errors of metabolism was non-contributory. Her hip X-ray showed posterior dislocation of right hip []. Abdominal ultrasound showed coarseecho texture of liver suggestive of chronic liver disease. Cardiac evaluation was normal. Magnetic resonance imaging of Brain showed isointensity of the basal ganglia structures in T1-weighted images, hypointensity in the anteromedial putamen in T2-weighted images, and fluid attenuated inversion recovery (FLAIR) sequence. Susceptibility Weighted (SW) sequences showed hypointensity in the putamen suggestive of iron deposition[] [Figures -] Quantification of iron could not be done due to technical reasons. Genetic testing could not be carried out because of financial constraints.\nThe patient was treated as follows: Ulcerations in the lips healed with local applications and antibiotics. Her general condition improved with Ryle's tube feeding. Endoscopic gastrostomy was planned but parents were not willing for the same. Considerable improvement in dystonia occurred with oral trihexyphenidate and baclofen. Orthopedic consultation was done and suggested surgery after good control of dystonia. |
A 73-year-old male, known case of diabetes mellitus, was diagnosed as autoimmune hemolytic anemia a year ago and was started on oral steroids at another center. He continued to take these medications for a year, without further consultation or blood tests. He presented to us with a 1-month history of memory deficit and gait imbalance. On examination, he had a right inferior quadrantanopia and a Grade 4 power in his right upper and lower limbs.\nMagnetic resonance imaging (MRI) brain with contrast showed multiple, large, predominately cystic lesions in the left parieto-occipital region with significant edema and local mass effect. The contents of the cyst demonstrated restricted diffusion. Following contrast, most of these lesions enhanced in a smooth ring fashion. Some of the ring-enhancing lesions were peripherally placed with dural thickening and enhancement. Susceptibility imaging is showed small areas of low signal within the affected region in keeping with hemorrhagic areas. A diagnosis of multiloculated brain abscess was made. A differential of high-grade glioma was also considered [].\nSince the lesion was close the motor cortex, he underwent navigation-assisted left parietal burr hole and biopsy of the lesion under general anesthesia. Intraoperatively, the dura was thickened with subdural pus and granulation tissue. Tissue was taken for bacterial and fungal cultures and tuberculosis diagnostic panel.\nPostoperative computed tomography scan showed the biopsy tract up to the lesion [].\nOn bacteriological assessment, direct Gram stain of brain abscess showed occasional inflammatory cells, and no organisms were seen. The sample was inoculated on nutrient agar, blood agar, MacConkey agar, and brain–heart infusion broth and incubated at 37°C.\nColonies grew on media after 48 h of incubation. On blood agar, chalky white irregular growth of colonies was seen []. Gram stain from colony showed Gram-positive filamentous branching bacilli with beaded appearance []. Acid-fast bacillus stain using 1% sulfuric acid showed pink-colored bacilli of about 4–7 μm × 0.5 μm []. Culture was sent for matrix-assisted laser desorption-ionization–time-of-flight mass spectrometry (MALDI-TOFMS) for identification of the pathogen, which was reported as N. araoensis. Mycobacteria were not detected in culture and gene expert. No fungus was isolated from the sample.\nThe corticosteroids were slowly tapered and stopped. He was started on injection meropenem and combination of oral trimethoprim/sulfamethoxazole for 6 weeks with monitoring of the serum creatinine and complete blood picture. An MRI was repeated at 1 month which showed a minimal reduction in size of the left parieto-occipital abscess. The lobulated lesion had compartmentalized into few discrete ring-enhancing lesions. No new lesions were noted []. He developed altered renal parameters at the 2nd month of oral trimethoprim/sulfamethoxazole combination and was hence switched to amoxicillin and clavulanate. A repeat MRI at 6 months showed the lesion further shrinking in size with reduction of the edema []. The treatment was continued for a period of 12 months. The patient improved clinically to a Grade 5 power in his right upper and lower limbs, and visual assessment also showed complete resolution of the visual field defect.\nHis MRI at 12 months showed complete radiological resolution of the lesion and the surrounding edema []. |
An 18-month-old boy presented with abdominal pain and distension for the past 2 days and bilious vomiting for 1 day. On examination, the child was lethargic and mildly dehydrated with a heart rate of 130/min. His abdomen was distended and tender. A vague mass was felt over the umbilical and epigastric regions. The abdominal radiographs revealed a ground-glass appearance along with a prominent bowel loop with an air-fluid level. An ultrasound (US) showed free fluid within the peritoneal cavity and an elongated, dilated, thick-walled loop of bowel in the epigastric region with inflamed mesentery. A presumptive diagnosis of small bowel volvulus with gangrene was made.\nAt laparotomy, approximately 200 ml of dark-red fluid was sucked out and a 25 × 9 cm tensely cystic, shiny, edematous, tubular mass with necrotic walls was found. The mass had a separate mesenteric pedicle arising from the base of the ileal mesentery, approximately 20 cm from the ileocecal junction. The pedicle had undergone torsion of three turns with resultant gangrene and perforation of the wall of the cyst. A loop of the ileum was adherent at the site of the perforation. A second cyst (8 cm in length) was present between the leaves of the ileal mesentery in the adjacent ileum, sharing a common wall with the ileum, suggesting an enteric duplication cyst. The straight arteries from the vasa recta traversed on both sides of the cyst to the adjacent bowel. The pedicle of the isolated cyst was divided between ligatures and the cyst excised. The enteric duplication cyst was excised along with the adjacent ileum and an ileoileal anastomosis performed. On sectioning the wall of the enteric duplication cyst, gastric-type mucosal folds were seen, whereas the CIDC showed a flattened inner lining. The postoperative period was uneventful. Histopathology of the CIDC revealed intestinal-type mucosa along with areas of necrosis and gangrene, while the duplication cyst adjacent to the ileum was lined entirely by gastric mucosa. |
In April 2018, a 69-year-old man with a history of DM and chronic kidney disease and undergoing dialysis treatment was admitted to Okinawa Miyako Hospital after complaints of slight bloody sputum for the past seven days and weight loss of 5 kg in the past six months.\nOn admission, he was afebrile and did not present with respiratory distress; vital signs were normal. Auscultation revealed clear respiratory sounds, and other physical examinations also yielded unremarkable findings. However, blood tests revealed elevated white blood cell count (12,700 cells/µL) and C-reactive protein levels (14.76 mg/dL). A computed tomography (CT) scan of the chest showed multiple consolidations with cavities in both lung fields (). The patient had routine chest X-rays every three months, due to ongoing dialysis treatment, to check his cardio-thoracic ratio and the chest radiographs from one, four, and six months ago also showed multiple interstitial infiltrations. The locations of these infiltrations were consistent with the lung abscesses revealed by the CT on admission; these results indicated that the abscesses had existed for at least six months (). He was hospitalized based on the diagnosis of multiple lung abscesses. Additional examinations such as urine culture, cardiac ultrasonography, and CT scans of the abdomen and head were performed to determine whether this patient had other primary source or metastatic infections. Other sources of primary and metastatic infections, such as infective endocarditis, liver abscess, brain abscess, or ocular infection, were all absent.\nTo determine the causative pathogen, we performed a bronchoscopy. Gram-stain of bronchoalveolar lavage fluid (BAL) showed only capsulated gram-negative rods (), and the microorganism was identified as K. pneumoniae by conventional methods. The involvement of other pathogens, such as anaerobes, was not evident from the BAL cultures. Two sets of blood cultures were also negative for other microorganisms. String test of the isolate was positive (the string reached a length of 12 mm), which is characteristic of the hypermucoviscous phenotype. The isolate was susceptible to all routinely tested antibiotics except ampicillin. We initially treated the patient with ampicillin/sulbactam for three weeks. Next, he received oral amoxicillin/clavulanic acid suppression therapy for four weeks, after which he recovered without recurrence.\nWe performed multiplex PCR () and multilocus sequence typing as described previously., We determined the capsular serotype of the isolate to be K2 and ST 375: K2-ST375; the isolate possessed rmpA (a positive regulator of capsular polysaccharide production), iutA, entB, and mrkD. The isolated strain produced a positive string test and a positive PCR amplification of the rmpA gene; therefore, we identified the isolated strain as hypervirulent. |
A 41-year-old female patient with an 18-year history of schizophrenia was referred to the emergency department of the local general hospital. She was presented with mutism, staring gaze, rigidity, negativism, and stupor. The symptoms developed over a period of 3 days. The patient had no history of general medical illness or alcohol/substance abuse. She had been treated in a community mental health service [] for several years and was clinically stable during the last semester under treatment with haloperidol decanoate 150mg monthly. According to the information given by her family, she was drinking excessive amounts of water for several days prior to the development of the catatonic symptoms. The patient was admitted to the internal medicine ward for further evaluation and treatment. At admission, she was afebrile and awake, with no alteration of consciousness or other signs of confusion. A full clinical and laboratory investigation was employed. The computed tomography of the brain was normal, as well as the electroencephalogram. The blood sample analysis revealed moderate hyponatremia, with sodium levels 124mEq/L. The urine analysis did not reveal any significant findings. The patient received treatment with water restriction and isotonic saline and was discharged in 2 days, in good clinical condition, with sodium serum levels 138mEq/L. The physicians’ instructions at discharge were water restriction, laboratory re-examination, and psychiatric evaluation. She was examined by the treating psychiatrist the next day of discharge and did not present any signs of catatonia. Her clinical condition was stable over the following weeks, and sodium serum levels were 138mEq/L 4 weeks after discharge.\nA search in the PubMed database revealed 10 previous reports of the hyponatremia-associated catatonic syndrome, involving 11 patients which are summarized in Table . Seven cases involved patients with a mental disorder. The first report was from India and involved a male patient with bipolar disorder. The patient presented catatonic symptoms (mutism, negativism, rigidity) in the context of severe hyponatremia of unknown cause. All symptoms abated with the restoration of sodium serum levels []. Maxwell et al. [] reported two cases of young females who presented with catatonic stupor after the consumption of 3,4-methylenedioxymethamphetamine (ecstasy) and the development of hyponatremia. Both recovered completely within several hours with conservative management. A subsequent report involved a 45-year-old male patient with schizophrenia, who developed catatonic symp- toms, such as grimacing, posturing, stereotypy, and negativism, which were associated with hyponatremia. The patient had symptoms of confusion as well. The administration of lorazepam was employed for the resolution of the catatonic symptoms []. In another report of hyponatremia-associated catatonia, a young male patient with schizophrenia was presented with stupor, staring gaze, akinesia, negativism, mutism, and muscular rigidity. The patient had suffered a brain injury that had been accounted for the development of hyponatremia, although he had a normal brain image and no neurological sequelae. All symptoms resolved with the correction of hypo- natremia []. There is also a reported case of hyponatremia-induced persistent and recurrent catatonic syndrome in a non-psychiatric patient due to adrenal insufficiency. The symptoms did not respond to serum sodium levels restoration or lorazepam, and a course of electroconvulsive therapy (ECT) was required for symptom resolution []. On other occasions, a middle-aged female patient developed catatonic symptoms (immobility, withdrawal, rigidity, negativism, mutism, and posturing) and delirium in the context of hyponatremia induced by venlafaxine. Treatment with lorazepam improved the symptoms, which were completely resolved with the correction of hyponatremia []. Novac et al. [] reported the case of a young female patient with depression and papillary thyroid cancer, who was presented with confusion, psychosis, and catatonic symptoms due to hyponatremia in the context of iodine-131 therapy for metastatic cancer. Treatment with clonazepam and the restoration of sodium serum levels improved the catatonic symptoms. In another report, a female patient with schizoaffective disorder and medical multi-morbidity was presented with stupor, mutism, posturing, stereotypy, and staring due to hyponatremia secondary to psychogenic polydipsia. The catatonic symptoms resolved with lorazepam administration []. A unique case of a 69-year-old male patient who developed two discrete episodes of catatonia associated with hyponatremia was reported by McGuire et al. [] Symptoms of confusion and psychosis were recorded as well. The two episodes had taken place over a 3-year interval. During the first presentation of the patient, treatment with diazepam resolved the catatonic symptoms, whereas on the second occasion, the correction of sodium serum levels sufficed for symptom resolution. Finally, there is a recent case of the development of catatonic symptoms in an elderly male patient in the context of hyponatremia induced by imiquimod treatment that the patient had received for actinic keratosis. The catatonic symptoms improved with lorazepam []. |
A 25-year-old male, known case of XP, presented with a non-healing bleeding ulcer over the scalp following a minor trauma of 9 months duration. In addition, he had two other lesions below the left eyelid and the right occipital region of 4 months duration. He had a history of prior surgery done for a lower lip lesion (squamous cell carcinoma) and for two lesions over the scalp (myoepithelial carcinoma of dermis, benign skin adnexal tumor of hair follicle differentiation). Two of his 2nd- and 3rd-degree relatives on the maternal side had a history of XP. There was no history of consanguinity present in the family.\nOn examination all three lesions were distinctly different. There was a 10 cm×5 cm ulcer with irregular, rolled out edges over the frontoparietal region of the scalp []. The underlying bone was clinically eroded. The lesion over the right occipital region was a 2 cm×2 cm hyperpigmented macule and that below the left eyelid was a 1.0 cm×0.50 cm hyperpigmented papule [Figures and ]. Classical stigmata of XP with dry atrophic skin and patchy hyperpigmentation were present all over the body. Detailed neurological and ophthalmological examination revealed no abnormality. In view of the high index of suspicion of malignancy biopsies from all three sites were taken and sent for histopathological examination.\nBiopsy from the scalp lesion revealed disordered proliferation of atypical endothelial cells with hyperchromatic markedly pleomorphic nuclei and eosinophilic cytoplasm. Small vascular channels with red blood cells were seen lined by similar cells dissecting through the dermis and around the adnexal structure []. Tumor cells expressed Clusters of differentiation (CD) 34 and CD31, and were negative for cytokeratin []. These histological findings were suggestive of poorly differentiated angiosarcoma. Biopsies from the occipital region and face were consistent with basal cell carcinoma.\nComputed tomographic scan of the skull showed erosion of both outer and inner table of the frontal and parietal bones. Whole body positron emission tomography scan was performed which ruled out distant metastasis. Megnatic resonance venogram revealed tumor invading the superior sagittal sinus [].\nIn view of unresectability due to the involvement of the superior sagittal sinus, the patient was not considered a candidate for surgery. Scalp lesion and occipital lesion were treated with external beam radiotherapy. Radiotherapy to the scalp in the doses of 72 Gy in 36 fractions was given. Face lesion was treated by interstitial brachytherapy at the doses of 35 Gy in 10 fractions. The patient was advised to adopt strict sun protection life style and was offered genetic counselling with blood DNA banking and instructed to come for regular follow-up. |
Case 3 is a 45-years-old woman with an initial diagnosis of MS who was referred to our center to establish care. She initially developed bilateral lower extremity numbness and impaired balance at age 21. Her past medical history was significant for oral contraceptive pills (OCPs) since the age of 17 and cigarette smoking. Due to the mild symptoms when first evaluated, she was not started on any disease-modifying therapy and was managed conservatively. Several years later in her mid-30s, she saw a neurologist secondary to experiencing word-finding difficulty, short-term memory loss, and difficulty walking. Her past medical history was remarkable for migraine, depression, mild short-term memory loss, ataxia, restless leg syndrome, urinary urgency, and stroke. She was on a 3-months course of glucocorticoids for her MS symptoms at that time. The family history was significant for migraine headaches. She underwent a lumbar puncture at a different center, which was reportedly positive for MS; however, the report of cerebrospinal fluid (CSF) study was not available to us. In addition, an MRI of the brain demonstrated periventricular and subcortical white matter hyperintensities in the frontal and parietal lobes.\nShe was started on short-term intravenous steroids. A few years later, she returned with several new neurological deficits including numbness and dysesthesias around the mouth, right leg weakness, and right foot drop which were thought to be MS relapses. At that time, the brain MRI demonstrated periventricular and subcortical white matter T2 hyperintense lesions in the frontal and parietal lobes (). The clinicians diagnosed her as having an aggressive form of relapsing-remitting MS and decided to start dimethyl fumarate (disease-modifying therapy). Reviews of the MRI at some later visits suggested findings inconsistent with MS and more suggestive of a vasculopathy. She was referred to a vascular neurologist, who performed a cerebral angiogram that was negative for vasculopathy. Shortly thereafter, she developed a deep vein thrombosis requiring a workup of coagulation profile that revealed mild elevation of factor VIII and fibrinogen. She was started on rivaroxaban and advised to stop OCPs. She continued to be stable on dimethyl fumarate with no MRI changes and did not report any side effects from the medications. After almost 6 years of being on dimethyl fumarate and no significant improvement, she was evaluated by another vascular neurologist for a second opinion. The genetic testing revealed that the patient had a cysteine altering mutation in higher domains of the NOTCH3 gene (NM_000435.2:c.3691C>T [p.Arg1231Cys]) that causes a milder form of CADASIL () (, ). The patient was taken off the disease-modifying agent and continued to follow up with the stroke neurologist and immunologist for symptomatic treatment and management of her new diagnosis. |
A 69-year-old woman with a past surgical history for a poorly differentiated thyroid cancer presented with a 2 × 2 cm mass between the trachea and the esophagus. The patient already had right recurrent laryngeal palsy from the first treatment. This recurrence was detected by computed tomography (CT), and was shown to be rapidly enlarging over the course of two months (Figure \n). The lesion was also examined by fluorodeoxyglucose (FDG) positron emission tomography (PET), which showed high FDG uptake (maximum standardized uptake value, 15.45) and demonstrated a recurrence of thyroid cancer (Figure \n). After providing written informed consent, the patient underwent surgical resection of the recurrent thyroid cancer with the new procedure. The patient was positioned under general anesthesia in a supine position on the operating table with her neck hyperextended. Through a transverse cervical incision made just along the previous surgical scar, a tracheotomy was performed. The tumor was easily detected through the tracheostoma, then delineated by palpation. The mucous membrane of the trachea was minimally incised along the right-hand border of the tumor and a mucosal flap was elevated (Figure \n). The left-hand side of the trachea including the membranous wall and cartilage of the tracheal mucosa was maximally preserved, to maintain the vascular supply to the trachea. Finally, the membranous wall of the trachea was preserved to within one-third of the left-hand side (Figure \nA). Bleeding from both cut edges of the tracheal mucosa was confirmed. There was no extracapsular spread and the tumor was removed completely with the muscular layer of the esophagus. Intraoperative frozen examination revealed that the tumor was completely resected. A right sternocleidomastoid muscle flap was elevated and inserted into the cavity resulting from the tumor resection and sutured between the esophagus and the trachea. The membranous wall of the tracheal mucosa was also sutured submucosally. A temporary tracheocutaneous stoma was made. |
A 32-year-old right-handed female with T-cell ALL admitted to the hematology service for chemotherapy and anticipating cord blood transplant. She had a complicated medical course after chemotherapy including admissions into the Medical ICU for septic shock, febrile neutropenia, acute hypoxic respiratory failure, clostridium perfringens bacteremia, persistent vancomycin resistant enterococcus (VRE) bacteremia, and pulmonary aspergillosis. The diagnosis of aspergillosis was made on hospital day 33 with CT-chest findings of a diffuse severe pneumonia with a positive serum Galactomannan EIA confirmed twice. Repeated chest radiographs revealed the development of a cavitary lesion, a radiographic finding that can be seen with aspergillosis. She was started on voriconazole and followed by the transplant infectious disease service for therapeutic voriconazole levels. She also underwent evaluation for endocarditis with a normal transthoracic echocardiogram on hospital day 35 and normal cardiac MRI on hospital day 44. She was unable to safely undergo a transesophageal echocardiogram due to a persistently low platelet count. Hospital day 45 was the last positive blood culture for her persistent VRE bacteremia with subsequent negative blood cultures. She had no invasive procedures in the week prior to the event described below.\nOn the morning of hospital day 55, a normal neurologic exam was noted at 9 am. At 9:40 am, the patient rose from bed, felt dizzy, and slid to the floor. She was initially able to explain that she felt weak. Nursing noted no jerking movements of her extremities or bowel or urinary incontinence. Capillary blood glucose and vitals were unremarkable with glucose of 160, pulse 90 s, BP 120 s/60 s, and O2 96% on room air. When primary team arrived, they noted a right facial droop, severe aphasia, with right upper and right lower extremity paresis. They called a stroke code at 9:53 am with neurology evaluation starting at 9:58 am. Her initial exam confirmed a global aphasia and right-sided hemiplegia. Her initial NIH stroke scale was 18. She was taken for emergent CT and CT-Angiography of the head and neck. She was found to have foci of intravascular air within the distal portion of the M1 segment of the left MCA, as well as additional foci of intravascular air in the branches of the inferior division of the left MCA (). Hyperbaric service was emergently contacted to get her treatment with eventual transport to chamber by 6 pm. She completed a US Navy Treatment Table 6 protocol with no significant difficulties. After the HBOT, she had improvement of motor strength in her right arm. Her speech was spontaneous but she provided inappropriate words for the questions asked.\nTo workup her air embolism, a chest CT confirmed the small left pneumothorax, along with a 2.8 × 2.4 cm consolidative focus in the right upper lobe with an air crescent sign, favored as developing necrosis. This was thought secondary from an angioinvasive aspergillosis infection into her left pulmonary vein with demonstration of intravascular air (). Repeated transthoracic echocardiogram revealed negative saline microcavitation study immediately and after Valsalva which was unrevealing for a cardiac shunt. An MRI brain on hospital day 57 confirmed multiple areas of restricted diffusion within the left MCA territory ().\nBy the end of hospital day 57, her right side returned to baseline strength. She was able to speak in several word sentences appropriately but still had paraphasic errors and difficulty with repetition. By time of discharge on hospital day 68, speech therapy only noted minor paraphasic errors (95% accuracy with short story reading) with intact comprehension, repetition, and ability to communicate successfully in conversational speech. Her discharge NIH stroke scale was 1. |
A 50-year-old Caucasian female, with no previous smoking history or pancreatic cancer family history, presented to our clinic for surgical evaluation of a biopsy-proven PDA noted at the junction of the body and tail of the pancreas. The patient had previously undergone a classic pancreaticoduodenectomy (Whipple) procedure with concurrent hemicolectomy 6 years prior (in 2011) for a T3N0M0 adenocarcinoma of the pancreatic head that had invaded the mesentery of the proximal transverse colon. After the 2011 surgery, pathology revealed a poorly differentiated PDA along with a PanIN grade 2. The final pathology showed negative surgical margins, positive perineural spread, and 0/33 specimen lymph node involvement. From June 2012 to October 2012, the patient underwent and completed adjuvant chemotherapy with gemcitabine, capecitabine, and radiation at an outside hospital. She was carefully followed by her medical oncology team with serial CA 19-9 monitoring and abdominal MRIs on an ongoing basis. Due to her young age, in 2011, she underwent genetic screening and no germline mutations were identified. Since the time of the primary resection, the patient had been high functioning and healthy, with the exception of some problems of early satiety and recurrent cholangitis. These sequelae were attributed to close proximity of the gastrojejunostomy and hepaticojejunostomy, with possible reflux of intestinal contents up the afferent limb, all partially managed by diet changes.\nIn 2017, a biannual screening MRI with intravenous contrast showed a new pancreatic lesion measuring 2.3 × 2.2 cm in the tail of the pancreas (). Esophagogastroduodenoscopy and endoscopic ultrasound-guided biopsy identified it as a poorly differentiated adenocarcinoma. From 2011 to 2017, she had had close followup with serial CA 19-9, and a measurement of this marker after identification of the lesion on MRI showed an elevation, which was confirmed on repeat testing (61 and 55 U/mL; normal <37 U/mL). This was the first instance of two consecutive CA 19-9 measurements outside of the normal range since resection of the primary cancer 6 years prior. When the patient presented to our institution a few months later, the CA 19-9 had returned to normal at 32 U/mL (), and there was a moderate increase in CEA (16.9 ng/mL; normal <3 ng/mL). The patient received a second MRI of the abdomen and pelvis with contrast to identify distant disease, which showed the lesion to be confined to the pancreas. Along with the MRI of the abdomen, a CT of the chest was preformed, which showed no gross metastatic lesions. A completion pancreatectomy was scheduled with revision and lengthening of the jejunal limb proximal to the gastrojejunostomy to resect the tumor and treat her episodes of early satiety and recurrent cholangitis.\nIntraoperatively, the patient's three Whipple anastomoses were noted to be grossly intact and there was no evidence of metastatic disease. First, the stomach was divided approximately two centimeters proximal to the prior gastrojejunostomy. The jejunostomy was closed, and gastrocolic and gastrosplenic ligaments were divided. The splenic artery was ligated, and the splenocolic ligament was divided. The spleen and pancreas were mobilized out of the retroperitoneum. The jejunum was divided between the pancreaticojejunostomy (PJ) and hepaticojejunostomy. The proximal jejunum, prior PJ, remaining pancreas, and spleen were removed. The tumor was noted to be grossly confined to the pancreas. The distal end of the stomach was delivered through the mesocolon and a retrocolic gastrojejunostomy was undertaken 60 cm downstream from the hepaticojejunostomy. The anatomy before and after this operation is shown in .\nThe patient tolerated the procedure well and had an uncomplicated hospital course. The patient was closely followed postoperatively and did well. She completed two cycles of adjuvant chemotherapy with gemcitabine and capecitabine from January 2018 to April 2018, but did have some neutropenia at the end of her adjuvant therapy requiring pegfilgrastim. Her intermittent fevers, early satiety, and abdominal pain resolved after the surgery. She became an obligate insulin-dependent diabetic after the completion pancreatectomy procedure and now requires exogenous pancreatic enzymes to support her nutrient absorption.\nThe specimen was found to be consistent with a poorly differentiated invasive adenocarcinoma. Resection margins were negative, and 2 of 17 lymph nodes were positive for metastatic cancer. We sent representative slides of the patient's 2017 tumor and 2011 tumor to Perthera (McLean, VA) for next-generation sequencing (NGS) and histological analysis, which tested for mutations in a total of 315 genes and stained for various predictive biomarkers (). Both lesions showed the same mutations in KRAS (G12R), CDKN2A (splice site 151-1 G to A), and TP53 (Y220C). In addition, her 2011 tumor had a mutation in ACVR1B (S4) that was not present in the 2017 tumor, and the 2017 tumor had amplifications of MYC and mutant KRAS that were not present in the 2011 tumor (). Upon histological analysis, staining for MLH1, MSH2, MSH6, PMS2, pAKT, and HER2 was similar in both samples, but in the 2017 tumor, there was 60% increased staining for RRM1 and 20% increased staining for ERCC1, which changed the classification from low to high staining for ERCC1. |
Mr. A, a 57-year-old, single, administrative assistant sought treatment at our hospital almost 30 years ago after seeing a TV show about SAD. He argued being shy and reclusive since early childhood. Mr. A has always been ashamed of performing in front and interacting with other people. His symptoms progressively worsened as he grew up. By adolescence, he started presenting physical symptoms (like tremors, sweat, and heart palpitations) every time he exposed himself to social interactions. Mr. A had never dated until he was 31 years old when he had a brief romantic relationship strictly over the phone. He always lived with his mother.\nDespite his qualifications and performance, Mr. A could not remain in the same job for more than 1 year, as he feared his coworker's judgment every time he had to eat in front of them. He also dreaded taking the bus due to being the center of attention while entering public transportations and quit the coding course because of the intense discomfort of having to type in front of people.\nDuring the time Mr. A has been regularly seen in our service, he was treated for his social anxiety symptoms with clonazepam alone or in combination with multiple antidepressants, which were often interrupted because of intolerable side effects. No effective form of psychotherapy was available for him during the follow-up, and his conditions were managed exclusively with pharmacotherapy. Despite claiming he felt less anxious because of the treatment, Mr. A remained severely incapacitated and avoided going out and exposing himself. During this time, he never attained remission status. By the time he was 37 years old, he developed a depressive episode characterized by sadness, anhedonia, insomnia, and weight disturbances. After treatment with nortriptyline 150 mg/day (the only antidepressant he tolerated in a therapeutic dose), his depressive symptoms remitted. However, his social anxiety remained unchanged until age 49, when Mr. A went to a bank to withdraw money. While parking in an alley behind the building, armed assailants jumped out of a car and ambushed him. They hit him in the head with the gun and put him in the car. He was kept hostage for hours before being let go. He thought he would die. Of note, regardless of the emotional and financial injuries caused by the kidnapping, Mr. A never claimed or received any kind of insurance money or benefit because of the event.\nDespite the hardship of the situation, Mr. A believes he has handled it well and repeats: “At the end of the day, I'm alive. I feel like a winner.” He denies ever displaying flashbacks of the event, affective distancing/numbing, hypervigilance, or avoidance of situations that remind him of the traumatic event. Further, despite remaining under the same pharmacotherapy scheme and not starting any effective form of psychotherapy during this whole process, his anxiety symptoms drastically improved after the traumatic event, and he finally attained remission status. “I used to care about what other people thought about me and feared their judgment badly. After the kidnapping, this sort of belief feels completely irrelevant,” he claims, “The kidnapping made me realize that the problem was inside of me. I can choose what affects me.”\nSometime after the trauma, Mr. A's salary was cut in half because of financial issues in the company he worked for. His symptoms did not worsen after this, and he says, “because of what happened to me, I'm much stronger. If I were like I was before, I wouldn't be able to handle it. But now I know that if being kidnapped didn't kill me, this won't either.” Still today, years after the traumatic event, Mr. A doesn't fear others' judgment. He eats in front of his coworkers without feeling heart palpitations or sweating and does not avoid social gatherings because of anxiety symptoms. Since the trauma, he has dated more often, has joined the gym, and has moved out of his mother's home. He likes going out and is happier while doing leisure activities. He says that “life is more colorful than before.” depicts periodical assessments of the three dimensions of social anxiety symptoms (physical symptoms, fear and avoidance of social interactions) according to the Social Phobia Inventory (SPIN). As can be noted, there is a sustained improvement in Mr. A's SAD symptoms after the trauma. |
A 56-year-old Iranian woman presented with a one-month history of low-grade fever with generalized malaise, loss of weight, and loss of appetite, and she had noticed swelling of neck glands for the similar duration. She denied any joint pains, increased hair loss, or oral ulcers. She did not have chronic cough, sore throat, or ear discharge. The patient denied any alteration of bowel habits or melena. She denied any past history and contact history of tuberculosis or any high-risk sex behaviours. Her past medical history was significant for hypertension and dyslipidemia. One month prior to this presentation, she was seen by a rheumatologist with inflammatory bilateral knee joint arthritis. Her investigations were significant for thrombocytopenia of 109 × 109/L (150–400 × 109/L). There was no involvement of other cell lines. In the workup for the ANA, rheumatoid factor and anti-CCP were negative.\nOn examination, she was febrile. She was neither pale nor icteric. She had firm, tender discrete lymphadenopathy, the largest measuring 2 cm, in the right upper cervical region. Respiratory and cardiovascular system examinations were normal. Abdominal examination was normal without evidence of organomegaly.\nNeck ultrasonography revealed multiple cervical lymph nodes in the cervical region, the largest of which was 24 mm in size in the right submandibular, as well as numerous lymphadenopathies were seen in the right axillary region. Her blood investigations are summarized in .\nThe patient was treated with a course of oral antibiotics considering the possibility of bacterial lymphadenopathy (co-amoxiclav and metronidazole). No improvement in symptomatology was observed over 7-day course of antibiotics, and in addition, she was noted to have a generalized urticarial skin rash.\nShe underwent excision biopsy of the cervical lymph node. Histopathology revealed areas of necrosis, infiltrated with nuclear dust, paucity of granulocytes, and surrounding tissue showing mononuclear cells and reported as “benign acute necrotizing lymphadenitis” which was compatible with Kikuchi's disease. She made an uneventful recovery with normalization of hematological and biochemical parameters without a specific treatment over a period of few weeks.\nOne year later, she was seen in the hospital with low-grade fever, malaise, loss of appetite, and loss of weight with cervical lymphadenopathy, and repeat biopsy of the cervical lymph nodes revealed similar histopathology compatible with Kikuchi's disease. She was managed conservatively, and the patient made a full recovery. Currently, she is asymptomatic and under follow-up. |
The patient is a 7-month-old twin boy who presented to our institution's emergency department with increased work of breathing and desaturations (70 s). He was born at 33 weeks gestational age with Down syndrome, developed chronic lung disease (CLD) of prematurity, and was also found to have a moderate size secundum atrial septal defect (ASD) as a newborn. Prior to the current illness, he had been in the hospital multiple times for failure to thrive and respiratory distress, requiring mechanical ventilation with high amount of supplemental O2 and inhaled nitric oxide (iNO) as he developed pulmonary hypertension (PH). Echocardiography showed progressive enlargement and hypertrophy of his right ventricle and at times bidirectional shunting across his ASD. A diagnostic cardiac catheterization as a preoperative evaluation was performed, which showed elevated pulmonary vascular resistance indexed (PVRi) at baseline (8.8 WU·m2), which decreased with inhaled oxygen alone and iNO (3.8 WU·m2). Additional catheterization data at baseline condition showed a right atrial mean pressure of 6 mmHg, right ventricular end diastolic pressure of 6 mmHg, and pulmonary artery pressure 51/19 mmHg with mean 32 mmHg. The patient was started on home O2 therapy with nasal cannula. The current hospitalization occurred prior to a planned fenestrated patch repair of his ASD.\nHe was initially admitted to the general ward and soon transferred to the pediatric ICU for severe hypoxemic respiratory failure requiring mechanical ventilation. Respiratory syncytial virus (RSV) infection was diagnosed with the positive antigen test. He continued to have paroxysmal severe hypoxic events compatible with PH crisis. He was treated with sedation and neuromuscular paralysis, increased FiO2, optimization of O2 carrying capacity with packed red blood cells transfusions, and iNO. Milrinone infusion was added as the right ventricular function was depressed on echocardiogram (TAPSE 6 mm, Z-score −4), which demonstrated evidence of systemic to suprasystemic right ventricular pressure and bidirectional shunting across the ASD (Figures and ). No other cardiovascular intravenous drips were given during the ICU stay. Sildenafil was initiated enterally and escalated to maximal dose (2 mg/kg/day) without hemodynamic compromise. He was on diuretic therapy (bumetanide infusion up to 10 mcg/kg/hr) as chest X-ray demonstrated evidence of bilateral interstitial edema with bilateral pleural effusions on admission () and confirmed by chest ultrasound. Bilateral chest tubes were placed after failure of diuretic therapy to reduce effusions on hospital day #6. The drained fluid was milky in appearance bilaterally, with a white blood cell of 1,004/mm3 with lymphocyte predominance (88%) and elevated triglycerides (1008 mg/dl), and hence a diagnosis of chylothorax was made. Low IgG level (249 mg/dl) and hypoalbuminemia (2.5 g/dl) were noted at the time of pleural effusion drainage. Intravenous immunoglobulin and 25% albumin solution were administered. His feeding formula was changed to medium-chain triglyceride formula. The milky drainage became serous; however, the volume of chest tube drainage remained unchanged. Enteral feeding was discontinued and total parenteral nutrition was initiated, which decreased the volume of pleural effluent but small to moderate amount of pleural effusion was intermittently observed by chest X-ray for over sixty three days until the patient's death. Venous Doppler ultrasound of the upper extremities and the neck was performed on hospital day #7 and 4 weeks later, and compression, thrombosis or obstruction of the superior vena cava, and upper extremity were ruled out. A central venous catheter was placed in the right jugular vein soon after admission and was removed on hospital day #7 and replaced by a peripherally inserted central line. The patient required chest tubes for drainage until hospital day #22. Since then, intermittently small to moderate pleural effusion was observed by chest X-ray, but chest tubes were not placed.\nHe continued to be critically ill with persistent hypoxemic respiratory failure without improvement in PH with several PH crisis episodes. Therapy with an endothelin (ET) receptor antagonist (Bosentan) was added. The hospital course was complicated by bacterial tracheitis from Pseudomonas and E. coli. The patient remained on mechanical ventilator support for 6 weeks due to failed weaning of ventilator support from hypoxemia despite high levels of supplementary FiO2 and iNO. Cardiac catheterization performed 6 weeks after admission showed PVRi of 7 WU m2 on 100% FiO2 and 20 ppm of iNO under general anesthesia, pulmonary venous desaturation, and bidirectional shunting through ASD. Additionally, interval increases in right atrial pressure (mean 13 mmHg), right ventricular end diastolic pressure (12 mmHg), and pulmonary artery pressure (52/24 mean 36 mmHg) were noted. Given his severe and irreversible lung injury from mechanical ventilation in addition to baseline chronic lung disease, he was deemed not a candidate for lung transplant. Considering that the patient had Eisenmenger physiology due to severe PH and poor prognosis, the palliative care team was also consulted. Weaning from the mechanical ventilator was tried multiple times, but failed. At 9 weeks of his ICU hospitalization, he developed severe hypoxemia unresponsive to medical therapy that ultimately caused his death.\nAn autopsy showed bilateral small straw-colored pleural effusions (right 17 ml and left 10 ml), and the lung parenchyma was red-brown, poorly aerated, and diffusely congested with focal consolidation. The heart had an ASD (0.8 × 1.2 cm) with right ventricular hypertrophy secondary to PH. Microscopically, both lungs showed subpleural cysts lined by pneumocytes and containing macrophages, sloughed pneumocytes, and neutrophils. Acute multifocal bronchopneumonia was present with neutrophils in the bronchioles and alveoli. Chronic interstitial lung disease is diffusely present with alveolar septal thickening, capillary disorganization, and hemosiderosis. Small pulmonary arterial branches demonstrate moderate to marked medial smooth muscle hypertrophy with lumen narrowing, while large pulmonary arteries were normal with minimal changes. No lymphatic dilatation was observed on H&E or D2-40 immunostained slides; therefore, lymphangiectasia was ruled out (). From the autopsy results, hypoxia due to progressive PH was considered as a cause of death. |
A middle-aged male of 46 years old, who is a chronic alcoholic, presented to the emergency department with multiple blisters and hemorrhagic crusting involving both upper and lower limbs and trunk for the last two months. The lesions started on the upper limbs as blisters and erosions following which the patient consulted a dermatologist (Figure ). With a clinical suspicion of psoriasis, the patient was prescribed oral methotrexate weekly and topical steroids by a private practitioner. However after two weeks of the medication, the lesions increased resulting in multiple necrotic ulcers and hyperpigmented papules, macules distributed on the chest, the lower limbs and upper limbs bilaterally and erosions and necrotic ulcers on the back, some covered with crusts (Figure ). This was followed by high-grade fever and difficulty in breathing. There was also a history of bleeding from the gums, mouth, and nasal cavity five days prior to admission. The patient went into a stage of altered sensorium and was rushed to our center for further management. On examination, the patient had mucositis of the buccal mucosa, active bleeding from the gums and nasal cavity. Examination of the skin lesions revealed multiple blisters and erythematous to hyperpigmented, scaly, and crusts on the neck, trunk, and limbs. There were multiple ulcers over these lesions with some of them were showing hemorrhagic crusts (Figure ).\nHis baseline saturation was 60% at room air and 91% with high flow oxygen therapy. Systemic examination revealed basal crepitations on respiratory examination and Glasgow Coma score of 5/15 with no focal neurological deficits. A CT brain was down to rule out any intracranial hemorrhage which did not show any obvious abnormality. Laboratory investigations revealed severe pancytopenia with hemoglobin of 6 gm%, total leucocyte count (TLC) of 300/cumm, platelets of 5000/cumm, and a reticulocyte count of 0.08%. Peripheral blood smear showed macrocytic anemia with target cells, leukocytopenia with lymphocytosis, and severe thrombocytopenia. Biochemical parameter like serum lactate dehydrogenase (LDH) was raised (475 IU/L) and serum procalcitonin was elevated (25.24 ng/mL). His serum creatinine was 2.5 mg/dL and serum urea was 150 mg/dL. Bone marrow study revealed hypocellular marrow with marked suppression of erythroid, myeloid, and megakaryocytic cell lineages favoring myelosuppression. Residual erythroid and myeloid cell lineages also showed megaloblastic changes (Figure ). His bone marrow culture and blood culture had significant growth of methicillin-resistant Staphylococcus aureus (MRSA) which was sensitive to vancomycin. His chest X-ray was suggestive of a right lower lobe consolidation (Figure ). His skin biopsy taken from an intact lesion on the medial aspect of the left foot showed features of psoriasis (Figure ). With the background history of worsening symptoms after the intake of methotrexate, the multiorgan dysfunction was suspected to be due to methotrexate toxicity, however, serum methotrexate estimation could not be carried out. All the investigations are tabulated in Table and Table . Since low doses of methotrexate are unlikely to cause severe life-threatening complications a detailed history of the doses taken by the patient was obtained and it was found that the patient had consumed methotrexate daily at the dose of 10 mg for two weeks which was then followed by the increase of the cutaneous lesions and other complications. Based on the above clinical and laboratory findings with no other contributing factors, a diagnosis of methotrexate toxicity was made. Naranjo Algorithm-Adverse Drug Reaction Probability scale was 1 to 4.\nThe patient was intubated and ventilated on the day of admission. He was managed on the line of severe sepsis with acute kidney injury, pneumonia, and pancytopenia with supportive skincare of the ulcerated lesions. The patient was started on intravenous leucovorin calcium, 25 mg every 6 hours on day 1, followed by 10 mg every 6 hours on days 2 and 3. Apart from intravenous antibiotic therapy and intravenous fluid, he received 2 units of packed red blood cells and 16 units of platelet concentrate due to upper gastrointestinal bleeding and bleeding from gums, nasal cavity, and buccal mucosa. Total parental therapy was continued for seven days. He responded to the medical treatment and on the 10th day of intensive care therapy, he was extubated and continued with supportive care. His lesions healed with the continuation of antibiotic therapy and daily dressing with povidone-iodine followed by the application of silver sulfadiazine cream. He was discharged on the 28th day of his hospital stay. |
A 68-year-old woman presented to the Department of Oral and Maxillofacial Surgery at Nagoya Ekisai Hospital (Nagoya, Japan) with a chief complaint of malaise and a 7-month history of swelling of the left buccal mucosa. The patient had no congenital swelling of the left buccal mucosa at birth and no history of systemic disease or relevant family history. The patient had undergone maxillary molar restoration treatment 2 years earlier, after which she reported biting regularly on her buccal mucosa. On most occasions, the wound had healed within a week, so she had not sought medical treatment. An extraoral examination revealed no facial swelling or asymmetry. However, an intraoral examination revealed an area of diffuse swelling on the left buccal mucosa measuring about 15 mm × 30 mm and containing a papillary lesion with multiple red, blue, and clear pebble-like vesicles (Figure ). On palpation, the lesion was nontender and soft. The swelling had not expanded to the veins and was pulsatile. An orthopantomogram confirmed that the adjacent bone was intact. Magnetic resonance imaging revealed a soft tissue mass with a clearly distinguishable outline of the buccinator muscle (Figure ). The lesion was surgically excised under local anesthesia with a margin of 3 mm and a depth of 2 mm via the inside surface of the fascia of the buccinator muscle. The outcome was favorable. Pathologic examination of the specimen revealed expanded lymphatic vessels lined by thin endothelial cells and containing lymphatic fluid. A diagnosis of lymphatic malformation was confirmed on histopathology and immunohistochemical studies. Immunohistochemistry was negative for vascular markers such as CD31 and CD34, and the lymphatics stained specifically for D2-40 (podoplanin) (Figures , , ). On follow-up, the wound was found to have healed with no evidence of trismus or recurrence. The patient continued to be recurrence-free at her 2-year follow-up. Informed consent was obtained from the patient, and the procedures were in accordance with the Helsinki Declaration. |
A 70-year-old woman with a personal history of non-insulin-dependent diabetes mellitus was seen on consultation because of rapid development of an eruption consisting in several ulcerative and painful lesions located on her left leg. Initial lesions were boggy violaceous plaques with pustules that rapidly enlarged for two weeks prior to presentation. The patient was treated with oral and topical antibiotics without results. At the same time, the patient had fever and discomfort and complained of redness and pain and visual acuity decreased in her left eye.\nCutaneous examination revealed scattered shallow ulcers with a necrotic base which were confined to the left leg. The ulcer border was raised, serpiginous, and irregular and it was surrounded by an inflammatory area of erythema (). There were no other cutaneous findings.\nA wedge-shaped cutaneous biopsy showed neutrophilic abscess formation under areas of ulceration, as well as a dense inflammatory dermal infiltrate composed primarily of polymorphonuclear leukocytes but including occasional mature lymphocytes. No vascular involvement was observed (). Cultures from the skin lesions were negative for fungi, mycobacteria, and bacteria.\nOcular examination with slit lamp revealed ulceration and peripheral stromal infiltrates in the upper and lower limb on her left eye ().\nAll the following laboratory evaluations were in the normal range: biochemical parameters, complete blood cell count, white blood cell count, differential count, erythrocyte sedimentation rates, serum protein electrophoresis, quantitative serum immunoglobulins, C3 and C4 levels, antinuclear antibodies, anti-double stranded DNA antibodies, rheumatoid factor, and Venereal Disease Research Laboratory (VDRL) test. Chest X-ray examination, ultrasound examination, and thoracic-abdominal-pelvic computed tomography were all carried out although no systematic involvement was found.\nThe patient was diagnosed with pyoderma gangrenosum and unilateral peripheral ulcerative keratitis. Therapy was started with a course of systemic corticosteroid (prednisone 1 mg/Kg daily) obtaining a favourable response with improvement of the skin ulcers and the ocular damage after four weeks of treatment. When the dose of prednisone was reduced to 0,5 mg/Kg daily, mild relapse of the cutaneous and ocular lesions occurred, so the patient was treated with cyclosporine A 3 mg/Kg daily and prednisone 20 mg daily. After three months, the disease was totally resolved with no ocular residual damage and no new active skin lesions were detected. |
A 61-year-old woman presented to our skin department with complaints of yellowish brown swellings around both the eyes since 5 years. These lesions were mostly asymptomatic other than the occasional itching. She also complained of restriction of her field of vision, which was worse on the right side. Lesions were gradually progressive in nature. On examination, there were soft to firm, non tender, yellowish brown nodules and plaques present over bilateral infraorbital areas []. They were not fixed to underlying tissues. Both upper eyelids were also involved with the yellowish plaques and nodules. An ophthalmological examination revealed swellings around the orbital area with involvement of lids and restriction of the temporal field of vision. The skin over the nodules and plaques showed few senile comedones and dermatosis papulosa nigra. A physical examination revealed that the patient had pallor but no associated regional lymphadenopathy or hepato-splenomegaly. On investigations, she was found to have anaemia (Hb, 7.7 g/dl) and raised ESR (45 mm at the end of 1 h). Her peripheral smear and bone marrow examination showed no significant findings. Her biochemical parameters were within normal limits. The coagulation profile and fasting serum lipid profile were also normal. Serum electrophoresis revealed no paraproteinaemia. Incision biopsy was done. Histopathology showed atrophic epidermis with dermis showing sheets of epitheloid histiocytic granulomas, numerous dispersed foreign bodies and Touton giant cells. These granulomas were seen entrapping the dermal structures. Focal lymphoid aggregates and degenerated collagen were also seen [Figures and ]. Features were suggestive of NXG. Surgical excision was planned for lesions around each eye with a 2-week gap between the procedures. Both procedures were done under local anaesthesia. Lesions over upper eyelids were excised and wounds were closed with continuous sutures. Lesions over the infraorbital region were removed in the same way. However, considering the close proximity of the lesions to lower eyelids, subsequent eversion of the same and lack of skin in the inner canthus for wound closure, a repair using a flap was planned. A full thickness flap over the cheek was released and advanced []. Wound closure was done by continuous sutures. Suture removal was done after 7 days. She was followed up once in 2 months for 12 months, and still continues to be on follow-up. We did not observe any recurrence []. |
A 75-year-old female presented acutely with a history of sudden onset paraesthesia and ischemic rest pain involving the left foot and ankle. Motor function was retained, capillary and superficial venous return were reduced, the foot was cold, and there were no palpable pedal pulses. The calf remained soft to palpate. There was no history of palpitations or arrythmia, and the patient was in sinus cardiac rhythm both clinically and on electrocardiography. Plain chest radiography and computed tomography angiography (CTA) excluded a proximal arterial source of embolism. Furthermore, there was no previous trauma, (local or systemic) infection or inflammation, collagen, connective tissue or genetic syndromes, or arteritis; nor was there a family history of aneurysmal disease. Positive cardiovascular risk factors included hypercholesterolaemia and hypertension. Baseline haematological and biochemical analyses were normal, as were the renal and liver function. The creatinine kinase was within normal limits. The right foot was well perfused with a palpable PTA pulse.\nCTA demonstrated no significant stenosis in the supragenicular vessels bilaterally. On the symptomatic left side, the tibioperoneal trunk (TPT) and anterior tibial artery (ATA) were patent proximally, with the ATA and peroneal artery occluding in the distal calf. The dorsalis pedis was occluded; however, the plantar arteries reconstituted. Dominant flow to the foot was via the PTA, which occluded in the distal calf (). These findings were considered reflective of embolic disease within the left-sided tibial arteries. The asymptomatic right leg demonstrated dominant flow to the ankle via the PTA. The ATA and peroneal arteries occluded in the midcalf.\nDue to the acute nature of the patient's symptoms, emergent thromboembolectomy of the popliteal and tibial arteries was performed via a medial approach to the distal popliteal artery. Selective thromboembolectomy using Fogarty catheters for each tibial artery was unsuccessful. Urokinase was also injected into each tibial artery without effect. Subsequent exposure of the dominant PTA at the ankle demonstrated a thrombosed 10mm diameter aneurysm. A PTA thrombectomy was performed and subsequent angiography demonstrated flow to the foot via the aneurysmal PTA (). The aneurysm was opened and demonstrated a mixture of old, organised, and fresh thrombus (). The PTA aneurysm was excised and thrombectomy established adequate inflow and backflow to the excised PTA segment. The PTA was repaired using an interposition long saphenous vein graft (). Postoperatively, the PTA pulse was present, the foot had brisk capillary refill, and motor and sensory function normalised. Follow-up at 16 months demonstrated the patient to have a well perfused left foot with a palpable PTA pulse.\nAlthough the patient's contralateral foot was asymptomatic, she opted to have this repaired electively considering the aneurysmal right PTA aneurysm was the single arterial supply to the foot. Repair was performed via excision of the 8mm PTA aneurysm and a spatulated primary end-to-end PTA anastomosis. Completion angiography was satisfactory, and the right foot was well perfused with a palpable PTA pulse postoperatively. Histopathology of the right-sided PTA aneurysm demonstrated findings consistent with atherosclerotic degenerative aneurysmal disease. Specifically, there was intimal thickening, extensive lamina disruption, and broad areas of media replaced by collagenous fibrous tissue, with calcification of the media. There was no inflammation or mural necrosis seen. |
A 76-year-old caucasian woman presented to the emergency department (ED) with growing tiredness, melaena and left upper quadrant discomfort that worsened in the previous 10 days. Past medical history included a thyroidectomy due to multinodular goiter, and a hysterectomy with bilateral salpingo-oophorectomy with pelvic and paraaortic lymphadenectomy due to an endometrioid adenocarcinoma (pT1aN0M0, G3), which was diagnosed 2 years prior to the patient attending the ED. A follow-up computed tomography (CT) had ruled out any secondary lesions and tumour markers remained within normal limits. The patient was then started on vaginal brachytherapy and for 2 years had no recurrence documented.\nThe patient was also being studied in our outpatient clinic for a symptomatic iron deficiency anaemia and had an upper gastrointestinal (GI) endoscopy performed the day before attending the ED. The endoscopy revealed a proliferative and ulcerated lesion involving the transition between the second and third portions of the duodenum (D2–D3; ).\nDue to the haemorrhagic risk, no biopsies were taken. She had no prior complaints of weight loss, nausea or vomiting. The full blood count revealed a haemoglobin of 7.5 g/dl and an haematocrit of 24%. She remained haemodynamically stable and, after optimization with a transfusion of 2 units of packed red blood cells, a second endoscopy and a colonoscopy were performed to obtain biopsies and exclude other causes of GI bleeding. She was admitted to the ward for further investigation.\nDuring the hospital stay, an imaging workup was carried out while awaiting the histological diagnosis and the patient had a thoracic, abdominal and pelvic CT done ().\nIt described an almost circumferential thickening of the second and third duodenal portions consistent with the lesion described in the endoscopy, extended for 4 cm, with 12 mm of width, and several perilesional adenopathies, the largest measuring 9 mm.\nThe histologic examination revealed a poorly differentiated adenocarcinoma, with a negative CDX2 and positive PAX8 immunostaining, hence compatible with a secondary lesion of endometrial origin ( and ).\nThe case was discussed in a multidisciplinary meeting and the patient started palliative chemotherapy with carboplatin and paclitaxel, remaining to this day with adequate symptomatic control. |
The patient, a 16-year-old male, was referred with right facial asymmetry and multiple unerupted maxillary posterior teeth. There was no history of pain. The palatal enlargement was observed on the right side of the maxilla. The overlying soft tissue on the palatal side of the right posterior portion of the maxilla was soft and fluctuant without gingival ulceration and inflammation. In clinical examination, several cutaneous nodular masses and hyperpigmentations were observed. Periauricular soft tissue swelling on the left side with extension to the posterior portion of the auricle and also external auditory meatus were observed. Hypoglobus and proptosis of the left eye were detected.\nIn the panoramic view, a deep sigmoid notch, an elongated left coronoid process and separated pericoronal radiolucency were found. Impaction of the right maxillary molar teeth and destruction of the overlying bone were also observed ().\nCBCT was carried out for better evaluation of the extension and form of the maxillary and mandibular lesions ( and ). Axial views from the mid portion of the ramus to the level of the maxillary sinus revealed large pericoronal mass on the right side of the maxilla from the right maxillary canine to the tuberosity area with extension to the posterior portion of the right maxillary sinus and push the lateral and posterior wall of the right maxillary sinus to the antral cavity.\nDeformity of the zygomatic bone and lateral bowing and thinning of the ramus were observed. Due to preauricular soft tissue swelling and a previous history of soft tissue mass in the left infratemporal fossa, MRI was performed for re-evaluation of the left infratemporal fossa. In MRI, a huge sized tumor was seen adjacent to the parotid gland which involved the infratemporal fossa ().\nIn the evaluation of the patient’s past medical history, we found that he was a known case of intraorbital neurofibroma when he was 3 years old. Multislice CT without contrast enhancement revealed proptosis of the left eye, thick optic nerve, preseptal soft tissue density with swelling of the upper and lower eyelids and bony defect of the greater wing of the sphenoid bone ().\nIncisional biopsy of the maxillary lesion was performed. In the histopathological examination, a neoplastic structure was found in the connective tissue of the gingival mucosa, composed of spindle and ovoid cells in the fairly loose stroma and some of them had wavy nuclei (). Methylene blue staining revealed numerous mast cells, especially near to the vessels. Histopathological findings and positive reaction for S100 protein confirmed the diagnosis of neurofibroma. |
A 45-years-old male engineer with no history of trauma, presented to us with progressive upper back pain for two months that eventually became severe and disabling. The pain was non mechanical and was present even at rest and night. He denied any constitutional symptoms. He had no significant medical history except that he was a smoker for over 20 years.\nOn neurological examination, patient indicated altered sensation from T8 dermatome and below; however, upper and lower limb motor power was normal. He had an unsteady gait and exaggerated deep tendon reflexes in both lower limbs.\nInitial X-rays of the thoracic spine were unremarkable, but MRI demonstrated abnormal marrow replacement and enhancement of the entire T6 vertebra including its posterior elements and right 6th posterior rib. MRI axial cuts at T6 level revealed right postero-lateral epidural extension of the lesion causing severe spinal canal, right lateral recess and right exit foraminal stenosis (, ). In addition, an irregular right lung nodule was noted. CT evaluation confirmed the vertebral involvement () and the presence of a lobulated right lung nodule with emphysematous changes in bilateral upper lobes. Further radiological assessment revealed no other lesion elsewhere.\nDuring the course of the work up, he developed bilateral lower limb weakness and was unable to stand. A diagnosis of thoracic myelopathy due to cord compression was made and immediate surgical management in the form of T6 decompression laminectomy along with T3-T8 posterior instrumentation was performed (). Surgery was uneventful; patient had good recovery and was ambulating independently.\nTissue biopsy from T6 right pedicle revealed presence of metastatic tumour cells with moderate amount of eosinophilic cytoplasm in the marrow spaces suggestive of a metastatic carcinoma with neuro-endocrine features (). Tumour cells were positive for cytokeratin AE1/3, carcinoembrionic antigen (CEA), chromogranin and synaptophysin. Proliferation marker Ki67 was found to be 40%.\nEarly post-operative MRI showed adequate decompression of the spinal canal at T6 level and the patient had interval resolution of symptoms; but there was abnormal fluid collection from the surgical site extending up to the subcutaneous layer, likely to be seroma, which was conservatively managed. Chemotherapy with Carboplatin and Etoposide was initiated after satisfactory wound healing three weeks after surgery.\nOne month after the index surgery, patient developed significant motor deficit in the lower limbs (Right L2-L5 = 2/5; Right S1 = 4/5; Left L2-S1 = 4/5) and had bowel and bladder incontinence. An urgent MRI was done which revealed recurrence of the lesion causing near total obliteration of the spinal canal ().\nA second surgery at this stage was considered high risk and the decision was made to initiate concurrent site specific T4-T7 radiotherapy (30 Gy in 10 fractions) along with chemotherapy. Interestingly at the end of radiotherapy and four courses of chemotherapy (4 months post-op), there was significant clinical improvement of neurology and complete resolution of the soft tissue enhancement surrounding the spinal cord was evident in the MRI (). With appropriate physiotherapy and rehabilitation, patient gradually regained full power in both lower limbs by 6 months. He continues to be under oncology follow up and is ambulant with support. |
A 5-year-old girl presented to her pediatrician's office for a routine well-child visit. She was asymptomatic and developmentally normal. Parents reported that she participated in all activities but was not as active as her siblings. She was taking no medications. She had never been hospitalized or undergone surgery. Her examination was notable only for bradycardia with a heart rate (HR) of 52 beats per minute (bpm). She had normal weight, height, and blood pressure, with no evidence of thyromegaly. Both parents were healthy, as were the girl's older sister and younger brother. There was no family history of congenital heart disease, seizures, syncope, early sudden death, or family members requiring pacemakers or defibrillators.\nThe patient's ECG showed sinus rhythm at 50–60 bpm with normal PR, QRS, and corrected QT (QTc) intervals (). Due to the bradycardia, a Holter monitor was performed to evaluate her HR variability. The monitor showed sinus bradycardia with an average HR of 59 bpm and a minimum of 37 BPM. There was no atrioventricular (AV) conduction delay, and repolarization appeared normal. At rates greater than 110–120 bpm, there were frequent polymorphic premature ventricular contractions (PVCs) and bigeminy with runs of nonsustained bidirectional ventricular tachycardia (VT) at 211 BPM, suspicious for a clinical diagnosis of CPVT. Additionally, brief runs of a supraventricular tachycardia (SVT) at a rate of 220 bpm were also noted (). The parents reported that their daughter was active at these times and free of any symptoms.\nAn echocardiogram performed to assess cardiac anatomy and function revealed an overall normal appearing heart with normal LV chamber size and systolic function, but with heavy trabeculations in the LV apex, suggestive of LVNC. Cardiac magnetic resonance imaging showed similar noncompacted myocardium in the LV apex with normal LV chamber size and function and no other abnormalities. Initial laboratory testing including basic metabolic profile, inflammatory markers, complete blood count, and liver and thyroid function tests were within normal limits. The patient underwent an exercise treadmill test (ETT) to assess for inducible arrhythmias in a controlled setting. She had sinus rhythm at 55–70 bpm at rest and developed polymorphic PVCs and bigeminy at HRs greater than 110 bpm (). The ETT was terminated at 7 minutes (min) due to the complex ventricular ectopy, although the girl had no symptoms. The PVCs dissipated by 1 min of recovery, as her HR dropped below 100 bpm.\nBeta-blocker therapy was initially considered to prevent the tachyarrhythmias, but due to her profound baseline bradycardia, a class 1C sodium channel blocker antiarrhythmic medication (flecainide) was started. A repeat ETT showed no reduction of PVCs during exercise. Therefore, the flecainide was discontinued and a beta-blocker trial was started with esmolol (infusion rate of 250 mcg/kg/min). This short-acting intravenous (IV) beta-blocker was chosen, so that the medication could be discontinued immediately if her basleine bradycardia was exacerbated or the beta-blocker resulted in hemodynamic compromise. A repeat ETT showed resting sinus rates of 50–60 bpm and a peak HR of 118 bpm at 9.5 min of exercise. Rare PVCs were noted with exercise and suppressed completely at peak HRs (). Due to potential exacerbation of her underlying bradycardia with beta-blocker therapy, a dual chamber epicardial pacemaker was implanted, and she was started on a long-acting oral β-blocker, nadolol (1.0 mg/kg/day). Immediately postoperatively, she had intermittent PVCs and mild hypertension that resolved by increasing nadolol to 2.0 mg/kg/day. Prior to pacemaker implantation, there was a lengthy discussion regarding her arrhythmia substrate and possible implantable cardioverter defibrillator (ICD) placement for primary prevention. Since our patient had no history of syncope and appeared to have an excellent response to beta-blockade, the decision was made against ICD implantation for primary prevention.\nRepeat ETT, performed 6 weeks after pacemaker implantation, showed a resting sinus rate of 70 bpm and peak HR of 117 bpm at 10 min of exercise. Rare single monomorphic PVCs noted with exercise suppressed completely at peak HRs. She reported mild fatigue during daily activities, and her pacemaker was reprogrammed on for rate response to allow more physiology heart rate with daily activities. At her 5-month followup she had improvement in her fatigue and no palpitations or syncope. She continued on nadolol with exercise restrictions. Her Holter monitor showed sinus alternating with atrial pacing with good beta-blockade effect and no ventricular arrhythmias. Her echocardiogram was unchanged.\nCandidate gene testing was performed due to her history of arrhythmias. A long QT syndrome panel revealed no disease-causing mutations. A pan cardiomyopathy microarray designed to identify mutations in genes associated with cardiomyopathy and CPVT revealed three mutations: ryanodine receptor (RyR2) Arg169Gln, calsequestron (CASQ2) Asp398del, and titin (TTN) Lys4455Arg. These were all single nucleotide changes resulting in missense mutations. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.