text
stringlengths 746
31k
|
|---|
A 41-year-old female, with a past medical history of minimal change disease, diagnosed two years ago, being treated with a tapering dose of prednisone (on 7.5 mg daily at the time of admission) and biliary cancer status post percutaneous cholecystostomy drain placed 10 days prior, presented to the emergency department with nausea, vomiting, fever, and diarrhea of one-day duration. This was associated with a decreased output from the cholecystostomy drain.\nSix weeks prior to this presentation, the patient had routine monthly blood work done by her nephrologist and was noted to have bilirubin in her urine. Her liver function tests were then ordered which were abnormal and a right upper quadrant ultrasound showed moderate to marked diffuse intrahepatic bile duct dilation with a suspected obstructing mass at the porta hepatis. Outpatient work-up including alpha-1 antitrypsin, ceruloplasmin, antimitochondrial antibody, Hepatitis B, Hepatitis C, cytomegalovirus, iron, and ferritin were all negative or within the normal range. Her antinuclear antibody titer was at 1:40. Given concern for an obstructing mass, the patient was referred to the emergency room for expedited endoscopic retrograde cholangiopancreatography (ERCP). A computed tomography (CT) of the abdomen was done and it confirmed a mass at the hepatic hilum with associated biliary obstruction.\nThe patient had ERCP where she was found to have a high-grade stricture at the hepatic bifurcation. A sample was collected and sent for cytology and a stent was placed within the left intrahepatic biliary tree. The cytology from the ERCP returned as rare atypical cells with no malignant cells. A follow-up magnetic resonance imaging (MRI) of the abdomen was ordered and again showed a solid mass at the porta hepatis. A CT-guided liver biopsy was performed and pathology was pending when the patient was referred to interventional radiology due to continued significant hyperbilirubinemia. The patient underwent a cholangiogram and after some difficulty passing a wire, an internal/external biliary drainage catheter was placed. The drain was putting out 500-600 ml per day of bile.\nShe was undergoing prep for colonoscopy to rule out a colonic source of malignancy when her biliary output began to decrease and she developed the symptoms which prompted her return to the emergency room.\nIn the emergency room, she appeared to be in distress, with a temperature of 99.3ºF, heart rate 142/min, blood pressure 92/52 mmHg, respiratory rate 18/min and SpO2 98% on room air. Her physical exam was significant for dry mucous membranes, scleral icterus, and a non-tender abdomen. Her laboratory investigations revealed sodium 133 mmol/L, alkaline phosphatase 486 U/L, aspartate transaminase 122 U/L, alanine transaminase 212 U/L, bilirubin 14.6 mg/dL (direct bilirubin 8.0 mg/dL), and international normalized ratio 1.4. Management, according to the sepsis protocol, included intravenous (IV) fluids and the broad-spectrum antibiotics cefepime and vancomycin. A contrast-enhanced CT of the abdomen confirmed good biliary drain position. It also revealed vicarious excretion of bile and an enlarged periportal lymph node. Metronidazole was added to the treatment regimen. The patient received aggressive fluid resuscitation in the intensive care unit, with a total of 8.5 L of IV fluid being given over 30 hours. Initial blood cultures grew gram-negative rods, so Vancomycin was discontinued and infectious disease was consulted. Eventually, blood cultures revealed Cedecea davisae identified on micro scan and crystal identification, resistant to ampicillin, ceftriaxone, and cefuroxime. Repeat blood cultures were negative at 48 hours. Infectious disease recommended transitioning to Ciprofloxacin 500 mg orally every 12 hours and Metronidazole 500 mg orally every 8 hours to complete a 14-day course. At the time of discharge, she was feeling well and her vital signs were all within normal limits. |
An 82-year-old woman with a hiatal hernia was admitted to our hospital for a detailed examination. She reported repeated postprandial syncope once a year, and the frequency had increased in recent years. She had undergone close examination in other hospitals at the time of the syncopal episodes, and the presence of cardiovascular disease, cranial nerve disease, and endocrine disease was excluded.\nThe patient had a short, stocky build; she was 143-cm tall and had kyphosis. She was undergoing treatment for diabetes mellitus. Hematological examination showed mild anemia. Electrocardiography (ECG) showed sinus rhythm with a heart rate of 64 beats/min and complete right bundle branch block. Esophagogastroduodenoscopy revealed a pedunculated polyp of the stomach antrum that fit into the pylorus (Fig. ). It showed a mixed type of hiatal hernia but no reflux esophagitis. In the upper gastrointestinal contrast study, the entire stomach had relocated to the thoracic cavity and the body of the stomach was located above the fundus, resulting in a so-called upside-down stomach (Fig. a). Contrast-enhanced computed tomography revealed that a large portion of the stomach, transverse colon, and part of the pancreas were present in the mediastinum (Fig. b). These structures compressed the left atrium.\nThe cause of syncope was suspected to be circulatory failure due to compression by the contents of the hiatal hernia. Therefore, we performed transthoracic echocardiography followed by a water pouring test using a nasogastric tube (Fig. ). The test involved gradual instillation of saline into the stomach in the sitting position while performing blood pressure, ECG, and echocardiography monitoring. After 2000 ml of saline had been instilled, the left atrium was markedly compressed and the area of the mitral annulus was reduced. No obvious ECG changes or syncope were observed, but a slight decrease in cardiac output was evident.\nSurgery with curative intent was performed (laparoscopic hiatal hernia repair and endoscopic gastric polypectomy). The esophageal hiatus was dilated to about 50 mm, which revealed that a large portion of the stomach was present in the mediastinum. The hernia orifice was sutured closed after reduction of the hernia contents. Because this patient showed no evidence of reflux esophagitis, fundoplication was not performed. Finally, we performed polypectomy for removal of the gastric polyps by the usual method using a detachable snare. The postoperative course was good, and the patient was discharged uneventfully. She experienced no syncopal episodes for 5 months postoperatively. |
The patient, a 37-year-old woman, was admitted to our hospital on July 7, 2018, after 5 days of sudden headaches with nausea and vomiting. On July 3, 2018, with no obvious cause for symptoms, her family sent her to the local hospital for treatment. On July 3, 2018, head computed tomography (CT) showed subarachnoid hemorrhage (Fig. ). On July 4, 2018, CT angiography revealed no obvious abnormalities. After she underwent conservative treatment at a local hospital for 5 days, she achieved relief from the headaches. To obtain a diagnosis and further treatment, she visited our hospital. Physical examination revealed a positive meningeal irritation sign and a positive Kernig sign, and the 2 transverse fingers displayed positive cervical rigidity; no other obvious abnormalities were found. There was no history of hypertension, heart disease, diabetes, or other conditions. She denied a history of trauma or surgery. Head digital subtraction angiography (DSA) performed at our hospital on July 8, 2018, showed fenestration at the junction of the middle and upper portions of the basilar artery with an aneurysm; spontaneous pseudoaneurysms could not be excluded, the bilateral posterior communication was obviously open, and the posterior cerebral artery was well developed (Fig. A, B).\nThe patient underwent stent-assisted fenestration and channel occlusion under general anesthesia. An Enterprise stent 4.5 × 22 mm in size was placed in the normal fenestration malformation channel with the 2 ends of the stent completely covering the openings of the lesion channel. Target 360 NANO (1.5 mm × 3 cm) and helical (1.5 mm × 2 cm, 1 mm × 2 cm) spring coils were placed to fill in the fenestration malformation channel. Intraoperative routine heparin saline irrigation and continuous anticoagulation therapy were performed. After stent placement, tirofiban was administered intravenously at 10 mL/kg/h to prevent angiogenesis in the stents. Following the procedure, the stents were found to be well positioned, with no lesion channel or aneurysm visible (Fig. A, B). After embolization, the patient was lucid and exhibited good limb movement. At 24 hours after the operation, the oral administration of 100 mg of aspirin and 75 mg of Plavix once per day was prescribed to continue the anticoagulation treatment and prevent thrombosis in the stents. Five months later, no abnormalities were found by head magnetic resonance imaging (MRI). The stents were well positioned, and no occluded branches or aneurysms were present (Fig. A, B).\nInformed written consent was obtained from the patient for publication of this case report and accompanying images. |
A 25-year-old female was referred to our hospital for cardiac evaluation. She had no previous medical history. She was asymptomatic. The clinical examination was normal. Accordingly, a complete transthoracic 2D echocardiography with color Doppler examination using Philips ultrasound machine (EPIQ-7) was performed. In parasternal short-axis view, the MV orifice showed an accessory tissue between both leaflets, but it was not clearly identified as two orifices []. Two papillary muscles were clearly visualized []. Apical two-chamber view showed the division of MV opening into 2 by an accessory tissue. The MV was functioning well (no regurgitation or stenosis). The other valves were normal in function and morphology. To obtain a detailed description of MV apparatus, transesophageal echocardiography (TEE) was performed using the same machine and X7 matrix probe that enabled to do 2D and 3D images at the same time. At mid-esophageal level, the MV orifice was divided into two unequal orifices with normal function [ and ]. The 3D en face view of MV from both atrial and ventricular aspects clearly showed that the MV orifice was divided by a complete anteroposterior bridge into two asymmetrical orifices. The orientation of leaflets from both atrial and ventricular aspects showed that each orifice had its own annulus, leaflets, and commissures []. 3D planimetry measurement of orifice area of the anterolateral one is 0.9 cm2 and the posteromedial one is 2.1 cm2 []. There were no other associated cardiac anomalies. Despite normal blood pressure and absence of radiofemoral pulse delay, it was important to exclude associated mild degree of coarctation. 2D echocardiography showed turbulent color flow across the descending aorta, but the maximum pressure gradient recorded by continuous Doppler was 12 mmHg. That is why computed tomography scan was performed to rule out associated coarctation. The diagnosis was established as an isolated congenital DOMV with normal valve function, and no further step is needed. |
A 33-year-old man presented with a 6-month history of insidious low back pain intermittently. Twenty days before admission to our hospital, his back pain was significantly aggravated, which caused him to have difficulty in walking and sleeping. He denied the history of systemic disease and trauma. Recently, the pain severely affected his life and work especially when movements. There was no history of exposure to TB, including his family. The patient had systemic TB symptoms and signs including night sweats and decreased appetite with weight loss and progressive low-grade fever. He admitted a history of smoking, alcohol consumption without drug abuse. Physical examination demonstrated there was no visible or palpable spinal deformity, but definite tenderness could be elicited over the spinous processes of the extensive lower thoracic vertebrae. Neurologic examination represented no specific findings including that his reflexes of knee and ankle were normal. Subsequently, muscle strength and tension of lower limbs were also normal, and the straight leg raise test was negative in bilateral lower limbs. No other positive findings were found on physical examination. Laboratory investigations revealed red blood cells count, hemoglobin level, and white blood cells count were all within a normal range in spite of high erythrocyte sedimentation rate (ESR, 48 mm/hour), high C-reactive protein (66.9 mg/L). TB antibody and purified protein in derivate of tuberculin (PPD) test and human immune deficiency viral infection (HIV) were negative, but the TB spot (T-Spot) test was positive. Besides, the result of bone marrow puncture and serum protein electrophoresis (SPE) were all negative. Other laboratory tests were within reference range.\nDuring the hospitalization, the patient underwent thorough radiographic examinations.\nRoutine image analysis demonstrated normal chest X-ray and abdominal ultrasound evidenced normal findings. A thoracolumbar spine X-ray was unremarkable. Whereas further computed tomographic of whole spine images surprizing us, indicated multifocal diffuse lesions located in cervical, thoracic, lumbar, and sacral vertebrae showing multiple level worm-eaten and osteolytic bony destruction, including C5, T1-T5, T7-T12, L1-L5, and S1 (Fig. ). At the bodies of C5, T1, T2, T4-T5 (spinous processes and adjacent ribs), T8-T11, L1-L5, and S1 vertebrae, osteolytic bone lesions were noted along with the similar lesions at the transverse process of T7 (neural arch), T11-T12 (spinous processes, neural arch, and adjacent ribs), L1, and L4. Intervertebral discs spared. There was a paravertebral mass at the T9-T10 level (Fig. ). On whole spinal magnetic resonance imaging (MRI) examination, there were heterogeneous mixed high-intensity changes at C3, C5, T1-T5, T7-T12, L1-L5, and S1 segments on T2 weighted images and decreased signal intensity on T1 weighted images. Besides, the epidural abscess at the posterior of the spinal canal at T7 and T12 compressed the dural sac distinctly and a fusiform paraspinal abscess located at T9-T10 without obvious collapse of the adjacent vertebral body (Fig. ).\nAccording to the constitutional symptoms of TB and all imaging and laboratory findings of this patient in our department, we hold a multidisciplinary conference including oncologists, radiologists, and orthopedists. Eventually, differential diagnoses such as lymphoma, multiple myeloma, and metastatic disease were suspected. Considering the risk of spinal cord compression and pathologic fracture, which may cause progressive severe neurological symptoms and deformity, could happen at any time. An open biopsy rather than computed tomography (CT)-guided needle biopsy was conducted by our experienced surgeon at the T11 level to make a clear diagnosis. Intraoperatively, we located at the spinous process of T11, then resected the partial lesion of the right transverse process. The excised specimen resembled a kind of cheese with necrosis material.\nPathological examination indicated a chronic granulomatous inflammation with abundant caseous necrosis, considering tuberculous inflammation (Fig. ). And, negative microscopy for acid-fast bacilli from the specimen. However, in some cases, it was difficult to distinguish the lesions caused by Mycobacterium tuberculosis from other bacterial granulomas that may be still misdiagnosed. Meanwhile, we acquired the consent from the patient and his family to start on anti-TB trial chemotherapy, including rifampicin (450 mg/day), isoniazid (300 mg/day), ethambutol (750 mg/day), pyrazinamide (750 mg/day), and levofloxacin (500 mg/day), paying attention to nutrition supplement at the same time. The treatment turned out to be successful based on the lab test results, showing his ESR is reduced to 18 mm/hour, CRP to 11.3 mg/L, and significant improvement of systemic TB symptoms within 8 weeks of starting antitubercular trial therapy. Then the final diagnosis was an unusual presentation of skipped multifocal extensive spinal TB. As a consequence, we switched to a standard anti-TB chemotherapy without levofloxacin for a total duration of 12 months. Furthermore, the patient had achieved complete recovery without any complications. At 18-month follow-up, all the worm-eaten and osteolytic bony lesions were healed apparently, showing the disappearance of paravertebral and epidural abscess, and there was no evidence of recurrence on CT scan (Figs. and ). |
A 10-year-old boy presented with painless swelling of the right chest, diagnosed as a pectus carinatum-like chest wall deformity, slowly increasing in size over 5 years. Chest X-ray and computed tomography (CT) incidentally revealed a mass in the upper anterior mediastinum (\n). The patient had previously been healthy, with an insignificant medical history. Besides an indolent swelling of his right chest, other assumed symptoms, such as chest pain, dyspnea, systolic heart murmurs, or shortness of breath, were not present in our patient.\nDiagnostic assessment: further diagnostic workup included a complete physical examination, laboratory examinations, including β-human chorionic gonadotropin, and α-fetoprotein as unspecific tumor markers, to be within normal range. Sonography of the abdomen showed signs of hepatomegaly due to venous stasis caused by the mediastinal tumor but no splenomegaly or enlarged lymph nodes. Additional tumor staging imaging included a magnetic resonance imaging (MRI) of the thorax with contrast medium. It revealed a large tumor in the upper anterior mediastinum with irregular absorption of contrast medium, circumferentially surrounding the brachiocephalic trunk, with the right internal mammary artery as the main feeding vessel. The mass was extruding the heart into the left hemithorax, pushing aside the ventral thoracic wall, and lowering the right diaphragm into the left liver segments II and IV. This caused lower venous stasis. The diagnostic workup suggested an expansive but not invasive growth of the tumor. At an interdisciplinary assessment, a unanimous decision against a biopsy or any neoadjuvant therapy but for a complete surgical tumor removal was made.\nIntraoperative course: the patient underwent a median sternotomy, resecting the mass from the brachiocephalic vein along the common carotid artery on both sides, performing a simultaneous thymectomy. An inseparable adhesion of the tumor with the right pericardium required a partial resection of the pericardium. Further inseparable adherence of the caudal aspect of the tumor with the right diaphragm also required a partial resection of the right diaphragm. This resulted in a diaphragmatic defect of 80 mm × 80 mm, which was closed later during the procedure with a Gore-Tex Patch. Adherence of the tumor with the aorta and superior cava vein above the pulmonary vessels required meticulous preservation of the large vessels, resulting in a complete extirpation of the tumor (\n). Total operating time was 318 minutes.\nThe resected tumor showed a polylobulated, beige-yellowish surface, ranging from firm, elastic to cartilaginous hard consistency, 320 mm × 145 mm × 100 mm in size and 637 g in weight (\n). Histological examination revealed a hypocellular lesion with hyalinized, collagenous stroma, lymphocellular inflammation, and psammomatous calcifications. Immunostaining and molecular pathology showed no evidence for immunoglobulin (Ig)-G4-associated diseases and no ALK (anaplastic lymphoma kinase gene)-rearrangement. The resected thymic tissue showed no abnormalities. The results coincide with the diagnosis of CFT. The boy's postoperative course was generally good, remaining 2 days in the intensive care unit and being discharged on the postoperative day 9.\nFollow-up: at the 3- and 9-month follow-ups, routine blood testing, X-ray, and MRI of the thorax showed no residual tumor and no signs of tumor recurrence. The boy is currently healthy with full cardiopulmonary resources. Further follow-up with routine blood testing, chest X-ray, and MRI has planned at a s6-month interval. |
Miss R. B. is a 36-year-old female clerk admitted via the accident and emergency on account of inability to bear weight of five-week duration and continuous leakage of urine five days prior to presentation. Patient was involved in a pedestrian motorcycle accident in which she was hit by a power bike on a trunk C road. There was immediate loss of consciousness lasting about thirty minutes but no craniofacial bleed, vomiting, or seizures. There was bleeding from associated perineal laceration on the right side of the perineum. She was initially taken to a private hospital where she was noticed to have a perineal avulsion exposing the pelvic bone. She had closed reduction of pelvic fracture with pelvic banding and primary repair of perineal laceration in addition to initial fluid, analgesic, and antibiotic therapies. She was also catheterized with catheter draining clear urine following an initial period of total haematuria for about three days. However, she was referred on account of dehiscence of repaired perineal laceration with protrusion of fleshy mass from vulva with associated continuous leakage of urine per perineum. Following the injury, patient lost the sensation or feeling of bladder fullness. There was no history of loin pain, fever, chills, anorexia, nausea or vomiting.\nExamination revealed a young lady, conscious and alert, pale, afebrile, not dehydrated, and nil pedal oedema. Abdominal examination was essentially normal. External genitalia examination revealed a fleshy mucosa-like mass protruding per perineum anteriorly measuring about 6 cm × 6 cm with a bridge of tissue containing the labia majora between it and right anterolateral vaginal wall (). Upward pressure on this mass reveals the bladder neck and ureteric orifices. Urethra was located in bridge of tissue but deviated laterally to the left. There was a palpable wide pubic diastasis. Posterior vaginal wall was intact and cervix was situated in normal position. Digital rectal examination was essentially normal with no communication between the rectum and posterior vaginal wall. Straight leg raising test was zero degree on the right and 30° on the left. Pelvic X-ray revealed unstable B1 fracture with wide pubic diastasis, fractured left upper ischial ramus, and widening of both sacroiliac joints ().\nPatient was optimized for surgery and had perineal and pelvic exploration under G.A. Findings at surgery were prolapsed completely everted dome of the bladder wall through a transverse rent in the anterior bladder wall about 1.5 cm above the bladder neck, laterally deviated urethra to the left, pelvic disruption with approximately 10 cm symphyseal separation, shear injury to the body of the right pubis, and a big defect between the right anterolateral vaginal wall and disrupted pubis symphysis.\nShe had repair of the ruptured everted and prolapsed bladder, double-plate and screw fixation of the disrupted pelvic disruption, and repair of the perineal defect in layers (Figures and ). Urethral catheter was discontinued about three weeks after surgery. Patient had irritative symptoms initially which subsided with the use of Tolterodine and was fully continent of urine after the surgery. She commenced physiotherapy and ambulation with walking frame and now walks normally. |
A 62-year-old gentleman with squamous cell carcinoma of the mid oesophagus (Stage T4aN1M0) was evaluated for MIO following neoadjuvant chemotherapy that had resulted in a good response. It is the institutional protocol to perform a minimally invasive Mckeown procedure with a modifed three-field lymphadenectomy.\nThe computed tomography findings of the anatomical variation had revealed a complete mirror image pattern of the viscera and vasculature in the abdomen and thorax []. It was hence decided that the patient would initially undergo a left thoracoscopic mobilization of the esophagus (Phase 1) in the prone position followed by laparoscopic gastric mobilization of the stomach (Phase 2) and finally a neck anastomosis (Phase 3).\nPatient was placed in the prone position on double-lung ventilation using a single lumen endotracheal tube was the standard approach. Operating surgeon, camera and surgical assistants stood on the left side of the patient with monitor on the right side. Abdominal part of the procedure was done in the supine position with split legs apart.\nAn initial optical trocar (10 mm) was placed, and thoracoscopic inspection of the anatomy was done. A left sided azygos arch was initially noticed arching above the left main bronchus. Mediastinal pleura were opened using monopolor hook in a U and inverted U fashion above and below the azygos vein respectively. The azygos vein was isolated skeletonised and divided in between sutures []. A bulky mid esophageal tumor was noted.\nInfracarinal dissection [] was commenced with en bloc clearance of the carinal group of lymph node and further dissection in the plane just posterior to the pericardium until the OG junction. The supracarinal dissection was followed by identifying the left vagus and following the same proximally until the left recurrent laryngeal nerve arching underneath the left subclavian artery. Lymph nodes in the left parathracheal and along the lateral reticular nucleus were cleared []. The aortopulmonary window was cleared of the lymph nodes and inferior dissection along the right side of the esophagus continued clearing the paraesophageal group of nodes on the right until the OG junction [].\nThe patient was turned over to the supine position and ports were placed in an appropriate comparative configuration to the ports placed in the patient without situs inversus and were found to have mirror image of the normal anatomy []. After the division of gastrocolic omentum, trifurcation lymphadenectomy was done. The left gastric artery was clipped and divided and an en bloc lymph nodal tissue mass is left with the lesser curve. The tissue in the posterior aspect of the stomach up to the crus is cleared with a completely mobilized stomach from the hiatus to the pylorus []. The gastric conduit formed using Endo-GIA staplers that would form the neo esophagus was not completely detached from the remnant specimen to enable extraction through the cervical wound.\nThe cervical part of esophagus was exposed via left collar incision with neck slightly extended and turned toward right in the supine position. Mobilized part of esophagus along with gastric tube retrieved in continuity. A side to side linear stapled esophagogastrostomy fashioned using a double stapling technique and the remainder of the specimen detached in the process.\nThe recovery period was uneventful, and enteral feed was started on 7th postoperative day and discharged on 11th day. The total operative time was 286 min. Histopathological report was suggestive of moderately differentiated squamous cell carcinoma (pT3 N1). Follow-up after 18 months remains uneventful. |
A 59 year-old man presented with a history of intermittent and disabling pain in his left knee for 2 years. There were no other complaints such as fever, weight loss, or coughing. He had undergone arthroscopy a year earlier to treat osteoarthritis. A second arthroscopy was performed with synovial tissue biopsy in July 2010; microbiological analysis revealed the presence of M. tuberculosis and acid-fast bacilli (AFB). Antibiogram showed a normal sensitivity pattern. Histopathological assessment revealed granuloma with caseous necrosis, suggesting tuberculosis. Chest radiography revealed bilateral diffuse pulmonary infiltrates with a micronodular pattern. Immunological examination for the human immunodeficiency virus (HIV) was negative. The patient began receiving treatment with anti-tuberculosis drugs as part of a regimen, including rifampicin, isoniazid, pyrazinamide, and ethambutol. Pain symptoms initially improved. However, 2 months after starting the treatment, he started experiencing pain and swelling, and developed a fistula in the contralateral knee. Magnetic resonance imaging (MRI) showed signs of osteomyelitis in the right femur and tibia (Fig. ), and surgical drainage with bone biopsy suggested tuberculosis. However, there was no microbiological growth in mycobacteria-selective culture medium. After 6 months of treatment, the patient presented with a fistula in his left knee, which was positive for AFB. M. tuberculosis was isolated from a selective medium in a reference laboratory. However, sensitivity tests could not be performed. Once again, immunological assessment and real-time PCR results were negative for HIV. Immunoglobulin values were normal. His therapeutic regimen was subsequently extended. In the eighth month of treatment, the fistula was still observed in his right knee, and the collected material revealed the presence of AFB. MRI revealed the presence of periarticular collection. One year after the initiation of isoniazid/rifampicin treatment, there were no fistulas and findings of MRI suggested improvement. In August 2012, after 24 months of isoniazid/rifampicin treatment, the patient returned to the outpatient clinic presenting with a new fistula in his right knee. MRI revealed periarticular and intraosseous collection in the left femur as well as a large collection in the right calf. Surgical drainage of a large volume of purulent material was performed, and the contents were sent to 3 laboratories; M. tuberculosis was not isolated in any of the laboratories, but the results of tests conducted in 2 laboratories indicated that the material was positive for AFB and M. tuberculosis was detected by real-time PCR. By February 2013, the patient had been treated with isoniazid/rifampicin for 30 months and he began to experience clinical improvement with the disappearance of the fistulas. The final MRI scan showed improvement of osteomyelitis signs. The treatment was discontinued in January 2013, and the patient is currently in clinical follow-up. |
A 70-year-old male with a past medical history significant for recurrent angioedema and anaphylaxis with no known etiology, coronary artery disease (s/p coronary bypass graft surgery in 2007), and systolic congestive heart failure with a left ventricular ejection fraction (LVEF) of 35–40% presented to the hospital with an episode of severe angioedema and anaphylaxis. No specific trigger was identified for this event. Vitals on presentation were unremarkable with physical exam only significant for facial swelling and erythema. The remainder of the systemic examination was within normal limits. His initial EKG on presentation is shown in . For the treatment of anaphylaxis, he received intramuscular epinephrine (with sodium metabisulfite preservative) in the ER to which he responded well. Of note, his previous episodes of hypersensitivity reactions were also treated with epinephrine with similar composition. He also received antihistamines and prednisone along with his home medications as aspirin, carvedilol, atorvastatin, and furosemide.\nOn Day 2 of his hospitalization, the patient developed chest discomfort along with worsening of shortness of breath. His troponin U trended up from normal range on presentation to 8 ng/ml (normal < 0.80). The follow-up EKG is shown in . The non-ST elevation myocardial infarction (NSTEMI) clinical protocol was initiated and the patient underwent a coronary angiogram (Figures –). Of note, the patient did not have any significant tachycardia after the epinephrine administration.\nThe angiogram revealed severe native vessel CAD, patent coronary grafts with a calculated LVEF during the left ventriculogram estimated at 15%, a significant decline from his baseline LVEF of 35–40% a year ago. The patient was medically managed for systolic congestive heart failure and non-ST elevation myocardial infarction, with clinical improvement. Allergy and immunology workup to identify particular triggers for the hypersensitivity reactions were negative. Workup on complement enzyme defects was also negative. The patient was later discharged home on appropriate medications with outpatient cardiology and allergy-immunology follow-up. |
A 62-year-old woman was referred to the authors' hospital for evaluation of a corneal ulcer in her left eye. With the patient's consent, a review of the clinic record was conducted. Ten years previously she received an allogeneic hematopoetic stem cell transplant for treatment of myelodysplasia syndrome. Her course was complicated by the development of cGVHD affecting the liver, skin, esophagus, mouth, and eyes. Severe keratoconjunctivitis sicca had been treated with a PROSE lens for more than 2 years prior to developing this corneal ulcer. Her medical status was compromised by systemic steroid dependence and by steroid induced diabetes mellitus.\nAfter presenting with a corneal ulcer in her left eye, the patient was empirically treated with topical 0.5% moxifloxacin (Vigamox, Alcon) that was applied 6 times a day (once before the PROSE lens was inserted in the morning, 4 times during the day inside of the PROSE lens reservoir, and once again at night after the PROSE lens was removed). After failure to improve on 4 days of this treatment, she was referred to Massachusetts Eye and Ear Infirmary for additional corneal ulcer evaluation, culture and modification of treatment. Upon presentation, the central cornea was opaque and neovascularized with tissue loss of approximately 60% of the corneal thickness. There was an epithelial defect that measured 2.5 mm by 1 mm, with an underlying 2 mm by 1 mm infiltrate. Microbiological smears and cultures were performed with the specimen from corneal scraping. No bacteria or fungi were evident with Gram stain or Calcofluor white stain. At the time, frequency of application of topical moxifloxacin was increased to every 2 hours while awake (approximately 8 times per day), delivered as one drop added to the PROSE reservoir after removal and cleaning reinsertion of the device and replenishment of the reservoir with preservative free saline (B).\nFour days after culture and modification of antibiotic delivery regimen, the corneal ulcer resolved, with re-epithelialization of the cornea surface and resolution of the infiltrate. A strain of E. coli cultured from the lesion in 5% sheep blood agar media exhibited resistance to fluoroquinolones, trimethoprim/sulfamethoxazole and ampicillin and ampicillin-sulbactam according to breakpoints set by the Clinical Laboratory Standard Institute-CLSI (). The strain carried multiple single point mutations in the quinolone resistance-determining region (QRDR) of gyrA (Ser83Leu, Asp87Asn), parC (Ser57Thr, Ser80Ile) and parE (Leu416Phe) genes. These mutations were correlated with varying levels of resistance to the fluoroquinolones: ciprofloxacin (MIC 256 μg/mL), levofloxacin (8 μg/mL) and moxifloxacin (16 μg/mL), as determined by reference broth microdilution. |
A Turkish 11-year-old female patient suffered from falling, and referred to Tokat GOP pediatric dentistry clinic three days after trauma. Clinically, the cooperation level of the child with the dentist was low and had poor oral hygiene. Intraoral examination showed that tooth 21 was intruded into the alveolar socket (). It was also observed that there was a complicated crown fracture in tooth 21. The cemento-enamel junction of intruded tooth 21 is located more 6 mm apically than in adjacent non-injured tooth 11 and 22. Radiographs confirmed a completed root formation in tooth 21, and periodontal space was absent ().\nAt the first appointment, pulp sensitivity of all anterior teeth was evaluated with an electric pulp test. Teeth 13, 12, 22, and 23 responded positively; only tooth 11 gave a late positive response. The patient and her parents were informed about treatment options and the expected prognosis of each procedure.\nGiven that the tooth apex was closed and the intrusion was approximately 7 mm, it was decided to perform surgical re-positioning. After the administration of local anesthesia, the surgical re-positioning procedure was completed by loosening the tooth in the socket by using a dental extracting forceps to extrude it and then stabilizing it through suture and fiber splint after being positioned according to the adjacent tooth (). Augmentin (400 mg, 2*1,5), a penicillin-derived antibiotic, a mouthwash containing chlorhexidine, and Parol, an analgesic agent, were prescribed for 7 days against the risk of pain and infection. Eating habits and oral hygiene maintenance were instructed to the patient and her parents.\nThree days after the surgery, the root canal treatment for tooth 21 was initiated, the pulp tissue was removed and was irrigated with 2.5% sodium hypochloride (Cerkamed). The root canal was filled with calcium hydroxide for 15 days. Before removing splint, the root canal treatment for tooth 21 was completed with gutta-percha. Tooth 11 gave a negative response to the vitality test and was done root canal treatment, too. Aesthetic restoration of the tooth 21 was performed (). 4 weeks after the surgery, the splint was removed, and a follow-up radiograph was taken. In the first month after surgical reposition, the patient was called for clinical examinations at first, second and fourth weeks. Clinical and radiographic images of the treatment condition were examined in months 3, 6, 9 and 12. In follow up sessions, clinically, there were no clinical symptoms such as mobility, sensitivity, periodontal bleeding, periodontal pocket, and colour change. The radiographic examination revealed the absence of a periapical lesion and inflammatory root resorption of the treated teeth (Figs. , ). |
We present a 15-year-old female patient with a past medical history pertinent for major depressive disorder and anxiety disorder, who was brought to the emergency department by emergency medical services with a primary concern of abdominal pain. The pain began approximately two hours before her presentation, and she described it as diffuse and stabbing with a 10/10 severity on the visual analog pain scale. She also indicated the pain was nonradiating, not exacerbated with movements, and associated with nausea and multiple episodes of nonbilious, nonbloody emesis. The patient did not report any history of diabetes, pancreatitis, gallbladder stones, trauma, or autoimmune disorders. At the time, the patient did not report the use of any medications.\nThe patient was alert and cooperative. Her initial vital signs were within reference ranges except for slightly elevated blood pressure (128/86 mmHg) and respiration rate (21 breaths per minute). We noted dry oral mucosa, but no other findings of the physical examination were remarkable. Her initial blood work was remarkable for a minor elevation in aspartate transaminase (AST)/alanine transaminase (ALT) and a positive acetaminophen level (Table ).\nTwo hours after the patient’s arrival at the hospital and upon further questioning, she disclosed that the night before her presentation, she ingested 20 pills of Coricidin. Additionally, she reported that she ingested the pills with an energy drink for recreational purposes and denied any other recent consumption of drugs or alcohol. The Center for Poison Control was contacted, and treatment with N-acetylcysteine (NAC) was started. She received NAC at an initial loading dose of 150 mg/kg over one hour, followed by a second dose of 50 mg/kg over four hours.\nFive hours after starting the NAC regimen, a second laboratory assessment showed an increase in AST (460 U/L) and ALT (449 U/L; Table ). She continued to receive a third and fourth dose of NAC at 100 mg/kg, infused over 16 hours each.\nOn day 2 of hospitalization, the patient developed intermittent abdominal pain, this time located in the epigastric region. She described the pain as stabbing, nonradiating, with an intensity of 10/10 and exacerbated with movements. Her physical examination revealed active bowel sounds, no abdominal distention, and was notable for epigastric tenderness with superficial palpation with no rebound or guarding. We noted no jaundice, and she had a preserved mental status. Additional blood work revealed elevated lipase (>600 U/L). Routine management for pancreatitis was started with intravenous fluids. Biochemical studies obtained two hours before finalizing the fourth NAC infusion are detailed in Table .\nOn hospital day 3, the patient’s blood work was significant for a marked increase in AST/ALT levels. We contacted the Center for Poison Control again, and they suggested contacting the hepatic transplant team for transfer and further management of the patient. Finally, the patient was transferred to an external institution for evaluation by a liver transplant team. Based on the patient’s notes from the outside hospital team, the patient was admitted for observation, given supportive treatment, and had a gradual decrease in liver enzymes and lipase levels over the next two days. The patient did not require liver transplantation and was discharged on hospital day 6. |
A 50-year-old woman underwent a cataract operation on her right eye in January 2019. She had diabetes but was well-controlled on oral hypoglycemic agents. Following successful surgery, a refractive correction was prescribed, and she was discharged from the cataract clinic after one month with a best-corrected visual acuity of 20/20. In late March 2019, the patient presented to the ED with pain, photophobia, and decreased vision. On examination, her visual acuity was 20/80, her intraocular pressure was normal, and dilated fundus examination showed a good fundal glow without any evidence of posterior segment pathology. The anterior segment of her right eye showed evidence of acute anterior nongranulomatous uveitis, and a small but noticeable lesion with hairy margins was observed at the 11 o'clock position on the anterior surface of the iris close to the pupillary margin (Figure ).\nThe appearance of the lesion suggested a possible fungal origin. The patient was immediately subjected to an anterior chamber wash. The lesion was gripped with tooth forceps, removed from the iris and plated onto sabouraud dextrose agar (SDA). An aqueous tap was also plated onto standard chocolate and blood agar. The patient was administered an intracameral injection of 0.1 mL containing 100 µg voriconazole using an insulin syringe.\nThe examination the next day showed that the eye was mildly inflamed but less so than before the treatment. She was subsequently treated with topical steroids and topical 1% voriconazole drops, six times daily. Culture of the fungus on SDA on day five showed that the pathogen was Penicillium Spp. (Figure ),\nwhich was further confirmed on day 14 (Figure ).\nAs her blood tests showed borderline increases in liver transaminases and an absence of any other risk factors for fungemia, she was not treated with any systemic antifungal agents. The patient was gradually tapered off both steroids and voriconazole over the next six to eight weeks. At three months, the patient had a best-corrected visual acuity of 20/20 and a noninflamed eye (Figure ). |
A 70-year-old man with antecedent of follicular lymphoma in complete remission presented at the Timone University Hospital (Marseille, France) in 2016 for a squamous cell carcinoma of the hypopharyngeal region. The patient categorically refused any treatment, including preservative surgery, radiotherapy, chemotherapy or supportive care.\nOne year later, he was addressed to our palliative care unit by the hand-surgery department after attempting suicide. The patient explained his action by the fear of suffering. No depressive state was diagnosed by our psychiatrists. Despite persistence fear of suffering, the patient rejected the idea of suicide because of his family, but still wanted to die and asks for assistance. Information on Claeys-Leonetti law was given, especially on assisted-suicide banishment and on the possibility to relieve suffering with adapted treatments.\nOne week after discharge, the patient was readmitted to our department for dyspnea and anxiety. Symptoms were managed by appropriate treatments (oxygen and low dose of midazolam in an anxiolytic purpose). Despite stabilisation, the patient was afraid of dying suffocated and asked for deep and continuous palliative sedation until death. Apart from the fear he expresses, the patient has no symptoms of anxiety, depression or pain after the introduction of appropriate treatments. On the other hand, he clearly states that he refuses to live again knowing that his death is approaching and that he is apprehensive of suffering. He says he wants to rush his death. For us, this is a request for assisted-suicide (active help from a third party for the administration of a lethal product) or euthanasia (act of a third party which intentionally provokes the death of another to put an end to his sufferings), rather than a real demand for deep and continuous sedation. It seems important to note that patient’s requests for deep and continuous sedation until death are not registered officially. The law does not even impose a written request. Thus, the request is most often made orally in the presence of several doctors and clinicians.\nIn order to try to objectify this request and therefore our answer, the patient’s request was examined and denied by palliative multidisciplinary board, in accordance with by the French Oncology Coordination Centre guidelines. This situation did not fulfil the criteria requested by Claeys-Leonetti law. Indeed, prognosis appeared not short term committed (no visible clinical progression of the disease, which commits for sure the short-term vital prognosis), symptoms were managed with appropriate treatments and no life-sustaining treatment arrest could lead to potential unbearable sufferings. Regarding the short-term criterion of life-threatening prognosis, the patient was offered to have a Computed Tomography (CT) scan to measure the progression of the disease. Indeed, no imaging had been performed for one year (time of diagnosis of recurrence). The patient refuses this proposal. The request for deep and continuous sedation was reiterated several times by the patient, who was still refusing any investigations to define the progression of his cancer and wanted parenteral hydration to be maintained. Daily, he questioned each caregiver about the rationale for the refusal of his request. How can the medical staff be sure that his prognosis is not short-term compromise? Why his psychological distress could not be considered as refractory? One week after refusing further investigation, the patient finally agrees to undergo a CT scan. Three days after the exam he dies peacefully, according to our team (no specific questionnaires or objective elements to judge the quality of death exists), of a not predictable respiratory distress certainly linked to the evolution of his cancer of the hypopharyngeal region without introduction of deep and continuous sedation, but with introduction of midazolam for anxiety. Opiates were not introduced because the patient was saying not being painful. The CT scan results, unknown at the time of death, reveal nothing conclusive (pulmonary metastases, but no lymph node involvement) and would have required additional analyzes. |
A 16-year-old boy presented with progressively increasing deformity of the chest wall and spine for the past 3 years. He was unable to sleep supine on his back and preferred lateral position for 3 years. For about 6 months, he had pain in the nape of neck and noticed that he was not able to run as fast as his classmates. He also had tingling paresthesia and weakness of the right hand that lead to difficulty performing fine tasks and holding heavy objects. He complained of breathlessness on exertion. On further enquiry, he admitted to having difficulty in breathing at night; sleep apnea's leading to sudden awakening. Neurological examination revealed spasticity in all 4 limbs. There was mild (Grade 4/5) weakness in the right handgrip. There was spasm of the muscles of nape of neck. There was no neck deformity. His Goel clinical grade was Grade 2.[] Investigations of the spine and chest revealed dorsal kyphoscoliosis. His preoperative scoliosis curve measured using the Cobb's angle was 60° and his thoracic kyphosis was 40°. Dynamic computed tomography of the cervical spine did not reveal any abnormal alteration in the atlantodental interval or any evidence of neural compression. However, there was evidence of rotatory atlantoaxial dislocation[] []. The patient underwent atlantoaxial fixation using lateral mass plate and screw technique as described by us earlier.[] During surgery, the atlantoaxial facetal articulation was identified to be remarkably unstable. The articular cavity was widely opened, articular cartilage was denuded, facets were realigned using the technique of manual manipulation described earlier and subsequent instrumentation was done. The muscles attached to the spinous process of axis were sharply cut, bones of the posterior elements of axis and atlas were decorticated to make them suitable host for bone graft. Bone graft was harvested from iliac crest.\nThe patient improved in his clinical features in the immediate postoperative period. Relatives noticed improved volume of voice. He could sleep in supine position in the postoperative period, a position that he had not adopted for months. He also improved in all his limb symptoms, could walk better and the power in the right hand grip recovered. At a follow-up of 18 months, there was improvement in his SKS. His neurological examination was normal and he had joined back school and was performing all his normal activities. Postoperative investigations revealed atlantoaxial arthrodesis. Postoperative X-ray of chest and dorsal spine revealed improvement in his SKS. The coronal Cobb's improved to 50° and the thoracic kyphosis improved to 38° []. |
A 50-year-old man presented with neck pain, numbness of the left hand and clumsiness in the legs while walking for 1 year. On examination, he had hyperreflexia in all 4 limbs with bilaterally extensor plantar reflexes. There was subtle sensory impairment in the left hand, however, motor power was preserved in all four limbs.\nOn MRI, T2-weighted imaging abnormal cord signal intensity was observed at the level of C2 vertebra, suggesting an ongoing dynamic cord compression without any evidence of Chiari malformation. Axial sections at the level of C2 vertebra revealed an intradural location of the right VA with a hypoplastic left VA coursing normally through the bony foramen [-]. CT imaging of the CVJ area revealed an abnormally increased anterior atlanto-dental interval suggesting an anterior AAD. There was the assimilation of the atlas at the level of the lateral mass, however, both the arches were free. The C2/3 joint on the right side was malformed with hypoplasia of the inferior articular process of C2 and an abnormally long C3 lateral mass forming the C2/3 joint. On CTA, a dominant right VA was seen entering the spinal canal below the pars of C2 vertebra before becoming vertical again. The C2 pars was thin and VA foramen on C2 as well as C1 were present, despite the aberrant course of the artery. Contralateral VA was hypoplastic with a normal course. The distal BA and posterior cerebral arteries could not be visualized clearly, unlike the first case.\nWe took the patient for posterior fixation to address the dynamic instability. Bilateral joint exploration and preparation of the joints proceeded normally. VA course was confirmed intraoperatively using a careful dissection. We performed C1 lateral mass-C2 pars interarticularis rod and screw fixation but resorted to C1–C3 (lateral mass) fixation on the right side, in view of the dominant VA coursing below a thinned out C2 pars. The thickness of the left C2 hemilamina did not permit us a translaminar screw placement. There was no gross injury to the VA [].\nThe patient was shifted to neurosurgical intensive care unit unreversed on a ventilator. At this point, he was neurologically intact. When the patient was re-assessed the next morning for possible extubation, a lack of response and sluggishly reacting pupils led to an urgent CT scan of the head and the CVJ. While the spinal CT showed a complete correction of the dislocation and well placed screws the cranial CT revealed hydrocephalus with diffuse cerebral edema including an effaced posterior fossa. An urgent external ventricular drainage ensued, however, without any improvement in the patient's status. The patient continued to deteriorate and eventually expired the next day. We speculated the cause of death to be thrombosis of the dominant VA secondary to the operative manipulation (discussed further). |
A 73 year old female with stage IV hormone-sensitive breast cancer to bone presented with rash on the face and arms. She presented twelve years prior with a large right breast mass. She was treated with modified radical mastectomy revealing multifocal invasive lobular carcinoma with 25 of 25 lymph nodes involved with immunohistochemistry staining revealing ER-positivity, PR-positivity, and HER2-negativity. Staging workup revealed bone metastases and she was treated with anastrozole and zolendronic acid. After eight years, progression of osseous metastatic disease was noted and anastrozole was switched to exemestane 25 mg daily. Eighteen months later, progression in the bones occurred and she was treated with investigational orteronel 400 mg twice daily. Two years later, progression in the bone was noted and she initiated fulvestrant 500 mg intramuscular every month. After one year, progression was again noted in the bone, along with increased CA27-19 tumor marker which reached 358 U/ml. Fulvestrant was discontinued and patient was started on capecitabine 2500 mg twice daily for 14 days on and 7 days off for 21-day cycle at the beginning of summer. The patient had minimal symptoms, remained active, and spent much of the summer months out of doors. After 3 cycles, she developed a mild rash on the face, arms, but the tumor marker fell to 256 U/ml. Therapy was continued and after two additional cycles the rash worsened as the tumor marker continued to decline and imaging showed sclerosis of bony metastases, suggestive of healing. The rash appeared in a photo-distributed pattern but the patient was uncertain if the rash was worsened by sun exposure.\nThe rash was initially described as scattered macules and papules with thin raised plaques that were mildly pruritic on her cheeks and forearms. After the rash became more severe, capecitabine was held and she was referred to dermatology. Other medications at the time were zolendronic acid 4 mg IV every 3 months, calcium 600 mg/vitamin D 200 IU twice daily, guaifenesin, ondansetron, and acetaminophen as needed.\nDermatologic evaluation revealed the rash remained localized to her face, upper chest, and forearms. (Fig. ). Shave biopsies were obtained of lesions located on her left cheek, right shoulder, and left upper arm. All three biopsies demonstrated a lichenoid tissue reaction with rare eosinophils. The histopathologic differential diagnosis included lichen planus and lichenoid drug eruption, but the presence of eosinophils supported a diagnosis of a medication reaction. Clinically, this patient’s presentation is most consistent with photosensitive lichenoid drug eruption, most likely to capecitabine. (Fig. ). She was treated with topical triamcinolone 0.1% ointment to arms and chest twice daily, hydrocortisone 2.5% ointment twice daily to her face with instructions to limit sun exposure, and to use regular sunscreen. She did not undergo any phototesting because it was not felt to be clinically indicated in this case. She was evaluated about 2 weeks after starting steroid treatment and was noted for improvement in her rash and capecitabine was resumed with sun protective measures and without recurrence of the rash. |
A 64-year-old white male with a past medical history of atrial fibrillation, coronary artery disease requiring previous cardiac bypass surgery in 1997, and coronary artery stents in 2003 was brought in by ambulance. Upon evaluation by emergency medical services (EMS) personnel, he was found to have atrial fibrillation with a rapid ventricular response. The patient’s heart rhythm later deteriorated to VF and torsades de pointes. He was cardioverted back to sinus rhythm, started on an amiodarone drip, and brought to the emergency department. On the day of admission, the patient had a total of nine cardiac arrests with VT and VF storms. These occurred while he was heavily sedated and on the ventilator. He required more than 30 defibrillations. In addition, he required vasopressor support with norepinephrine and vasopressin due to cardiogenic shock. After a successful return of spontaneous circulation (ROSC), the patient underwent emergent cardiac catheterization. He was found to have graft disease in both the circumflex and right coronary systems, with the distal vessels being non-revascularizable. The left internal mammary artery graft to the left anterior descending artery was patent. Echocardiography showed an ejection fraction of 60% - 65% with mild valvular heart disease. Due to cardiogenic shock, an intra-aortic balloon pump was placed via the right common femoral artery.\nAfter unsuccessful attempts to terminate the VT/VF with antiarrhythmic medications and cardiac defibrillation, the patient eventually had an ultrasound-guided left stellate ganglion block, which terminated the refractory ES, with no complications. Figures - show cardiac tracings before and after the procedure. Since the stellate ganglion block is usually temporary, lasting for hours to weeks, Cardiothoracic Surgery (CTS) was also consulted to perform a left cardiac sympathetic denervation with left stellate ganglionectomy.\nLeft stellate ganglion block procedure\nAfter obtaining informed consent from the patient’s next of kin, the patient was placed in the supine position. The left neck was sterilized with sterile prep and draped. The anesthesiologist identified Chassaignac's tubercle, the skin was anesthetized with 1% lidocaine, and then an ultrasound-guided stimulating needle (22 Ga x 5 cm) was inserted to the C7 transverse process, above the Collis Longus muscle. After negative aspiration, a mixture of 15 ml of 0.5% ropivacaine with 4 mg of dexamethasone was slowly injected. The procedure was completed with no apparent complications, and the patient had a positive Horner's sign. The procedure resulted in the resolution of ES, as illustrated in Figure .\nLeft cardiac sympathetic denervation with left stellate ganglionectomy procedure\nThe patient was placed in the supine position. General anesthesia was successfully obtained by double-lumen endotracheal intubation. The patient was then placed in the right lateral decubitus position. The left chest was prepped and draped in the usual sterile fashion. Ventilation to the left lung was stopped by anesthesia. Cardiothoracic surgery attempted a video-assisted thoracoscopic sympathectomy. However, due to adhesions and an obstructed view, the procedure was stopped, and the decision was made to proceed with thoracotomy.\nA left posterior muscle-sparing thoracotomy incision was made. The incision was extended down to the level of the auscultatory triangle. The fourth interspace was identified, and the chest was entered at that level. Upon entering the chest, the pleura overlying the 4th rib was incised using a cautery device. The sympathetic chain was identified at this level. The chain was then unroofed, both using sharp and blunt dissection, up to the level of the 2nd rib. The sympathetic chain was then excised using both cautery and sharp dissection up to the level of the 2nd rib. The pleura was opened more proximally using sharp dissection, and the sympathetic chain was dissected up toward the ganglion, again using sharp dissection. The sympathetic ganglion on the left was then identified. The branches of the sympathetic chain into the chest were identified. The stellate ganglion was divided in half just above these thoracic branches, using sharp dissection. The specimen was then passed off the field and sent to pathology. A fresh-frozen analysis revealed ganglion cells at the resected portion of the stellate ganglion. The patient tolerated the procedure well. There were no complications.\nThroughout his hospital course, the patient received amiodarone, lidocaine (which was weaned and switched to mexiletine), and isoproterenol. A cardiac electrophysiologist was consulted, and ultimately, an AICD was placed. Eventually, after several weeks in the hospital, the patient was hemodynamically stable and free of further episodes of VT/VF. He was discharged home. |
Prior to referral to our clinic, a 49-year old female patient with no history of chronic disease was examined in a gynecology clinic in September 2015 due to complaint of abnormal vaginal bleeding. Cervical thinprep cytology test (TCT) showed atypical glandular cells. Subsequently, the patient underwent laparoscopic radical hysterectomy, bilateral salpingo-oophorectomy and pelvic lymphadenectomy. Pathologic examination of surgical tissues revealed moderately differentiated endometrioid adenocarcinoma, involving the lower uterine segment invading the muscular layer and left side of the uterus. Results from immunohistologic analysis were positive for ER, PR, P16, CerbB-2 (3+), Ki67 (70%) and negative for P53, vimentin, and CEA. The patient was diagnosed with T3bN1M0 (stage IIIC) endometrioid adenocarcinoma according to the 2009 TNM/FIGO classification. From the time of diagnosis to May 2016, the treatment regimen of the patient included 2 cycles of adjuvant chemotherapy with liposomal paclitaxel and carboplatin, 4 cycles of chemotherapy with synchronous radiotherapy and 4 cycles of chemotherapy with liposomal paclitaxel and carboplatin. Despite having received multiple lines of chemotherapy and radiotherapy, the patient developed pulmonary metastasis in early June 2016. After 3 cycles of liposomal doxorubicin and nedaplatin chemotherapy, treatment response of the pulmonary lesions were assessed with thoracic computed tomography (CT) which revealed disease progression based on RECIST 1.1 criteria. The treatment regimen was then switched to gemcitabine and cisplatin; however, the patient remained refractory to treatment and developed metastasis to the lungs, abdomen and pelvis in early September 2017. A ureteral stent was implanted on her right ureter due to hydronephrosis following ureteroscopy. The patient also underwent pelvic brachytherapy for the pelvic metastases in late September. In late November, the patient presented with incomplete intestinal obstruction. The patient underwent stereotactic gamma knife radiosurgery for the lung metastases in December 2017.\nUpon referral to our clinic in January 2018, the patient, refractory to multiple lines of chemotherapy and radiotherapy, with partial intestinal obstruction, scored 3 upon assessment of her ECOG performance status (PS) and had unknown genetic status. To understand the mutation profile of the patient, both plasma and preserved endometrial tissue sample from the previous hysterectomy were subjected to targeted sequencing using a panel consisting of 295 cancer-related genes. Mutational analysis revealed HER2 (ERBB2) amplification with a copy number of 4.22 and 22.19 in the plasma and tissue samples, respectively. In addition, ARID1A and TP53 mutations were also detected from both plasma and tissue samples. CTNNB1, SPEN, ACVR1B mutations and CCNE1 amplification were only observed in the plasma sample. Due to no information on the standard of care available and a PS of 3, we have decided to administer afatinib to the patient. After one month of treatment with afatinib at a dose of 40 mg once daily, the dose was adjusted to 30 mg once daily due to severe diarrhea. No other adverse effect was observed. After 2 months of afatinib treatment, the patient achieved partial response (PR) reflected by the reduction of pulmonary lesions according to RECIST (). In addition, serum levels of CEA, CA19-9, CA125, CA15-3 and CY211 gradually decreased in response to the treatment, with reductions between 62–79% after 2 months. On the other hand, neuron-specific enolase (NSE), a specific tumor marker for small cell lung cancer, remained constant (). However, abdominal CT could not accurately assess pelvic lesions due to severe intestinal adhesions. Partial response was maintained from January 24 until her death on April 18, 2018. Disease progression was not observed until her death. The cause of her death was suspected to be complications from intestinal obstruction, including diffuse intravascular coagulation and gastrointestinal bleeding following sepsis. |
This is a case of a 30 year-old gentleman with a history of Crohn's disease. He was on a regimen of infliximab, infused every 8 weeks and oral methotrexate daily. He had no other significant medical history. He was in his usual state of health until he developed a sore throat and fevers on day 0. His symptoms began while he was traveling in Europe. During his trip, he took a 10-day course of amoxicillin and felt some improvement.\nAfter returning to the US he felt well but on day 14 he developed fevers and sore throat again. He was evaluated at an urgent care clinic and sent home with a diagnosis of a viral syndrome and instructed to treat this with non-steroidal anti-inflammatory agents. He felt some improvement initially but presented again on the day of admission with concern that he may not be well enough for his infusion of infliximab. He was found to have a temperature of 38.3 C and on day 30 was sent to the emergency department for further evaluation.\nIn the emergency department, he reported a non-productive cough, fevers, and sore throat. He had elevated liver enzymes: aspartate aminotransferase (AST) 340, alanine aminotransferase (ALT) 540, alkaline phosphatase 145. Additional testing was sent including a Monospot test, cytomegalovirus (CMV) and Epstein's Barr virus (EBV) serum viral levels, respiratory viral panel by PCR, adenovirus serum viral level, HIV antibody/antigen as well as HIV viral level, viral hepatitis serologic panel, human herpesvirus type 6 (HHV6) serum viral level, Varicella zoster virus (VZV) serum viral level, and syphilis IgG. He was admitted to the inpatient medicine service for fevers and hepatitis of unknown origin. His social history was remarkable for frequent trips to the Midwest for work. He did not pursue outdoors activity while traveling. He did not smoke, drink alcohol or use illicit drugs.\nOn day 31 he developed daily fevers to 40 C and subsequently progressed to hypoxemic respiratory failure that required high-flow supplemental oxygen and transfer to the intensive care unit. He had a chest CT showing ground-glass opacities at the lung bases and a left upper lobe nodular opacity (, ). His CT also demonstrated tonsillar enlargement and splenomegaly. He had a laryngoscopy performed that revealed an exudative pharyngitis. He was noted to have atypical lymphocytosis that peaked to 12,000 cells/uL on day 33. He was started on broad-spectrum antibiotics for presumed hospital-acquired pneumonia; including coverage of atypical organisms. He underwent a bronchoscopy on day 33. Bronchoalveolar lavage (BAL) fluid was negative for Legionella culture, AFB stain and culture, pneumocystis stain, and bacterial culture. Mycoplasma, zygomycetes and Mycobacterium tuberculosis were not detected by PCR. A respiratory viral panel by PCR from the lavage fluid was positive for Bocavirus and one of 2 samples for aspergillus galactomannan was moderately elevated but later determined to be negative on repeat testing.\nOn day 33 his AST peaked at 351 and his ALT at 662. His viral studies sent earlier returned negative. He had further serologic testing for atypical organisms including Blastomyces, Coccidioides, Q fever, Bordetella pertussis, as well as urine Legionella antigen that all returned negative. He was started on methylprednisolone and his fevers improved. His antibiotics were discontinued when his bacterial cultures were negative at 48 h. On day 37 the fungal PCR from BAL returned positive for Histoplasma capsulatum and cultures from that fluid later grew the organism. Urine Histoplasma antigen testing, sent earlier during his hospitalization, ultimately returned with a titer of 2.16 ng/mL (normal high 0.1 ng/mL). His Coccidioides antibody was also positive, but this was felt to be due to cross-reactivity from his Histoplasma infection.\nOn day 37 he was started on liposomal amphotericin B and 6 h later he had his highest fever to 42 C along with hypotension, tachycardia and worsening hypoxemia despite having received a dose of methylprednisolone earlier that day. He was felt to have a paradoxical worsening with treatment and exacerbation of immune reconstitution inflammatory state rather than an infusion reaction due to amphotericin given this time course . His infliximab was restarted the following day with subsequent resolution of his fever, hemodynamic instability and improvement in his respiratory status within hours of this infusion. He continued amphotericin B for one week before transitioning to oral itraconazole. His ALT/AST improved significantly. He was discharged on oral itraconazole with continued clinical improvement and recovery as an outpatient. |
A 24 year old man presented with on and off fever and diffuse abdominal pain since one week. He also had constipation, vomiting and abdominal distention since two days.\nHe was apparently normal a week ago when he developed abdominal pain for which he visited a peripheral hospital. An Ultrasonography (USG) abdomen was done, which revealed the possibility of a mild appendicular inflammation. He was treated with oral antibiotics and analgesics following which his abdominal pain subsided. Few days later he developed abdominal distention and vomiting.\nOn examination he was afebrile and vitals were stable. Abdomen was soft, distended and non tender. Free fluid was present in peritoneal cavity and bowel sounds were absent. Routine blood investigations were normal except for leucocytosis of 30,400 with neutrophilia. Plain X-ray of abdomen showed dilated jejunal and ileal loops with multiple air-fluid levels. Paracentesis yielded hemorrhagic ascetic fluid. USG abdomen revealed gross ascites and thickened bowel wall with absent peristalsis. Contrast enhanced CT abdomen showed small bowel obstruction and massive ascites.\nMeanwhile patient was kept nil per oral with nasogastric aspiration. He was started on prophylactic intravenous antibiotics and analgesics. On reassessment patient's condition remained unaltered. A diagnosis of mechanical intestinal obstruction of unknown etiology was made and he was scheduled for emergency laparotomy.\nAbdomen was opened with a midline vertical incision. Three litres of hemorrhagic fluid was drained. Dilated jejunal loops were seen. These loops were traced up to a segment of ischemic ileum. The ileal segment was strangulated by a band composed of inflamed appendix and omentum (Fig &). The band was running from caecum to ileum producing a window underneath. Through this window the intestine had protruded (Fig ).\nThe attachment of the band was released from the ileum and omentum, following which appendicectomy was done. The bowel was found viable and hence no resection was needed. Post op period was uneventful and patient was discharged on 7th day. Histopathology report confirmed acute appendicitis. On three month follow up he is doing well. |
A 26-year-old female presented to office with an insidious onset of pain in her left distal femur that had been present for several months. The patient reports no history of trauma. Physical examination reveals that the patient was a febrile. There was no evidence of a rash or wound and weakness or numbness, but the patient did note swelling of the involved extremity. Normal pulse times were noted in all four extremities. Pushing/pulling provoked pain. Of note, the patient reported a recent molar extraction as her only past surgical history. The pain persisted and increased in severity over the course of several months before amagnetic resonance imaging (MRI) was obtained. MRI interpretation revealed a large marrow-replacing lesion in the distal femoral shaft with a posterior cortical breach and associated posteromedial soft tissue component ( and ). Subsequent biopsy demonstrated osteomyelitis, and cultures revealed methicillin-resistant Staphylococcus aureusas the offending microorganism. The patient elected to proceed with surgical intervention to ream and irrigate the femur and debride the abscess present in the posteromedial aspect of her Cierny–Mader 3A distal femoral osteomyelitis. Pre-operative antibiotics were held until more cultures were obtained.\nA thorough review of the MRI revealed that the main foci of infection of her distal femur and posteromedial fluid collection were roughly 12 cm proximal to the superior pole of the patella. On measuring 12 cm from the superior pole of the patella to the lateral thigh, a 6-cm longitudinal incision was made. Bovie electrocautery was used throughout the procedure to coagulate superficial vasculature. A longitudinal incision was made in the iliotibial band in line with that of the skin. The anterolateral compartment of musculature was identified, and Bovie was used to gently lift the compartment off the lateral intermuscular septum, revealing the femoral shaft. The periosteum of the femoral shaft was longitudinally incised, and a Cobb was used to circumferentially elevate the periosteum. Using blunt dissection, the posteromedial periosteum was separated resulting in a rush of fluid. Following decompression, samples were sent for biopsy and culture. After thorough decompression, a 3.5-mm drill was used to drill the lateral cortex. The lateral wound was irrigated and temporarily covered with a wet lap.\nWe then addressed the RIA component of the procedure. X-ray was used to identify a start point roughly 8 cm proximal to the tip of the greater trochanter where a 4-cm incision was made in line with the femoral shaft. The guidewire was used to identify the tip of the greater trochanter on an anteroposterior view and to confirm alignment with the femoral shaft on the lateral view. The guidewire was advanced to the level of the lesser trochanter, and a 12-mm reamer was used to open the proximal femur. Based on measurements of the femoral isthmus, a 12-mm head was selected for the RIA system. On assembly of the RIA, a ball-tipped guidewire was passed into the femur and seated into the physeal scar of the distal femur. The RIA was then introduced over the ball-tipped guidewire and advanced distally with the cutting head moving in a forward direction. The RIA was slowly advanced through the medullary cavity with periodic retraction to allow proper suction of infected graft particulate. Progress was slowed upon reaching the level of the infection due to severe sclerosis of the distal isthmus (). One pass of the medullary cavity was made without complications or mechanic malfunction. The infected bone graft collected was stored in two containers. On obtaining cultures, anesthesia administered intravenous vancomycin. The proximal femoral wound was thoroughly irrigated and closed. Vancomycin powder was used locally over the lateral thigh incision.\nThe patient remained in the hospital for 4days following surgery. She received empiric antibiotics and was discharged home when the surgical cultures and sensitivities resulted with final infectious disease antibiotic recommendations made.The patient was made 50-pound partial weight bearing on her left leg as precaution for 6 weeks. At 2 weeks following surgery, the patient had a decrease in pain and no signs of recurrent infection were noted. The patient was followed by infectious disease in the hospital and after surgery as well and completed 30 days of linezolid followed by Bactrim to finish the 6-week course. At 3month follow-up, the patient continued to show improvement clinically with complete resolution of the thigh pain she described preoperatively. Her white blood cell count, sedimentation rate, and c-reactive protein all returned to normal levels 6 weeks after surgery. An MRI was also obtained and revealed reactive changes evident of canal reaming but no osteomyelitis or abscesses (). At the 7-month follow-up, she continued to have resolution of all symptoms with normal laboratories and X-rays and was released from orthopedic and infectious disease follow-up ( and ). The patient was made aware that her case would be written for publication, and informed consent was completed after she agreed. |
A 62-year-old female patient was referred by her oncologist for a routine dental evaluation. The patient’s medical history revealed a cutaneous melanoma of the left dorsum diagnosed six years before she was referred to our dental service. The tumor was primarily treated by surgery and developed two local recurrences (one and three years following surgery, respectively), which were also managed by surgical resection. Disease progression was identified five years after the first treatment and confirmed by a computed tomography (CT), which revealed multiple organ involvement including the lungs, skin (subcutaneous nodules on the dorsum) and bone (osteolytic lesions in the iliac and femur bones, ribs, vertebrae, sternum and scapula).\nThe patient was undergoing a palliative treatment protocol based on dacarbazine, zoledronic acid and radiotherapy in the lumbar region (total dose of 20 Gy) and in the left supraclavicular fossa (total dose of 36 Gy) when she was referred to our dental facility. An extraoral clinical examination identified a pigmented subcutaneous nodule on the patient’s dorsum, measuring 5 cm in diameter, and scarring from the previous surgical resections.\nThe patient’s chief complaint was the loss of the dental crown of her upper left incisor. She denied oral pain or the existence of any relevant oral soft tissue lesion. Intraoral soft tissue examination revealed a nodule with an ulcerated surface and areas of telangiectasia, on the posterior left lateral border of the tongue, measuring approximately 1 cm in diameter, adjacent to a partial edentulous mandibular area (Fig. A). Based on the clinical features of the tongue lesion and on the patient’s medical background, the diagnostic hypothesis included metastatic melanoma, squamous cell carcinoma and fibrous hyperplasia.\nAn incisional biopsy was performed under local anesthesia. The histopathological analysis showed nests and solid sheets of non-pigmented atypical cells with an epithelioid phenotype infiltrating the sub-epithelial connective tissue. A high mitotic index was observed (Fig. B). Tumor cells displayed diffuse immustaining for S100 protein. Other melanocytic markers such as HMB-45 and Melan-A were negative. (Fig. C).\nAfter the diagnosis of a metastatic lesion on the tongue, the patient was referred back to the clinical oncologist who maintained her in a palliative protocol of chemotherapy with cisplatin, dacarbazine and vinblastine (CVD). Unfortunately, the patient died due to disease progression four and a half months after the diagnosis of tongue metastasis. |
A 28-year-old woman, gravida 3 para 1, had a medical termination of a miscarriage at seven weeks, with no dilation and curettage, in 2008. In 2015, a baby was delivered by caesarean section in the breech position, weighing 3900 g. She had no significant past medical history, and her antenatal care had been uneventful. On August 9, 2018, at 19:15, she was admitted to our hospital due to a pregnancy of 9+ months and irregular contractions for 4+ hours. Periodic uterine contractions occurred every 6–8 min. The patient was not accompanied by abdominal pain or vaginal bleeding and had intermittent term after contractions. Clinical examination showed that her body temperature was 36.7 °C, blood pressure was 102/65 mmHg, pulse rate was 100 bpm, and oxygen saturation was 100%. Blood tests showed mild leucocytosis (16.61 × 109/L), normal platelet count, normal coagulation test, and haemoglobin of 102 g/L. Vaginal examination showed the cervix was tightly closed; no vaginal bleeding or fluid was found. The ultrasonography indicated that the foetal head was located above the uterine cavity, the foetal size was consistent with the gestational age, the placental position was normal, and the scar thickness of the previous caesarean section was approximately 0.2 cm. Uterine contractions declined after admission. During admission, the patient was clinically and biochemically stable, and daily cardiotocograms showed a reassuring foetal heart rate pattern. Because of the patient’s progressive anaemia (blood tests revealed a slow decline in haemoglobin to 93 g/L, 87 g/L) and sudden increasing abdominal pain, ultrasound was used but did not show ruptured abdominal fluid. An urgent laparotomy was performed and revealed a massive haemoperitoneum caused by the rupture of the uterine posterior wall. A haemoperitoneum with approximately 1 liter of blood was recovered. The lower uterine segment was intact and not ruptured. A boy with a body weight of 2900 g was delivered. Apgar scores were 9 at 1 min and 10 at 5 min. The amniotic fluid was clear, the placental was completely delivered, and no placental abruption occurred. The patient’s uterus was closed in two layers. After removing the blood and clots, a 12 cm-long tear in the posterior wall and active bleeding from the uterine rupture were found. Uterine tissue adhered to the bowel (see Fig. ). After separation of the adhesions between the bowel and the uterine wall, two layer of uninterrupted stitches restored the uterine integrity, and interrupted stitches closed the mesentery defect (see Fig. ). It was suspected that future conceptions would be dangerous, so bilateral tubal ligation was performed at the same time, under the permission of the patient and the patient’s family member. Our patient’s uterine and pelvis showed no abnormalities and, particularly, no evidence of endometriosis. Inspection of her liver showed no rupture. The placenta was sent for pathological examination. Syntocinon (oxytocin) (Ma an Mountain Company, China, SFDA approval number: H34020474) was administered intravenously. The operation was uncomplicated, and the estimated total blood loss was 2500 ml. Ten units of blood and 400 ml of blood plasma were transfused. The patient’s postoperative course was regular, and she was discharged 6 days later. |
A 45 years old Saudi male was admitted because of symptoms of Intestinal obstruction started 6 days prior to presentation. He presented with constipation and vomiting. He also noticed that his abdomen was getting distended for the past four months. His past medical history was not significant. On examination, his vital signs were stable, his abdomen was very distended and tympanic, but not tender. Strikingly he had a gigantic right middle finger (). The left hand was amputated because of the massive size which was too heavy to lift. The whole left arm was hypertrophied and he also had a large diffuse lipoma occupying his left chest wall. His face was elongated and he had mild slanting eyes. The speech was very coherent and he maintained good mentation with Glasgow score of 15 all the time. There was no obvious abnormality in the lower limbs and no evidence of any dermatological changes. Though not married, he was fully independent, engaged in a full time job, running a business with 300 employees under his care, and he drove his own car. His blood investigations showed a white count of 13.2, Hb of 12.1 gm/dl, platelets of 252,000 per micro l. His PT, PTT and INR were within the normal range, however his sodium was 107 meq/dl, and his Cl was 75 meq/dl and his potassium was 3.6 meq/dl. Rest of his blood test showed normal liver function and normal renal function. Computer Tomographic scan of his abdomen confirmed diagnosis of small bowel obstruction. He was admitted for conservative treatment initially, however in the next 24 h he became unwell and his abdomen became more tender, more distended with guarding in the upper right quadrant. His plain XR of his abdomen confirmed small bowel obstruction and the patient was taken to the operating theatre where an exploratory laparotomy was done. The findings were hugely dilated small bowel forming a volvulus which was twisted 180 degrees around its elongated mesentery, the caecum and the appendix were found in left upper quadrant. The point of twist was just 8 cm distal to the ileocecal junction. There was also a small perforation right at twisting point.\nResection of the twisted bowel was done due to its dusky colour and lack of motility and shine, and opening the specimen revealed numerous intraluminal lipomas (, ). With end to end anastomosis was done, 170 cm were removed of ileum, and over 200 cm of small bowel was left intact. Patient was admitted in the Intensive care unit where he spent a stormy 40 days, during which time he was taken back to the operating theatre and a second look was done, where an anastomotic leak was discovered. The anastomosis was taken down and an ileostomy and a mucus fistula was created. This was reversed five months later, prior to his discharge mainly because of his severe weight loss from the continuous loss from the stoma, which could not be compensated by his naso-gastric feed, and partly because of the local complication of the stoma. During his hospital stay he developed few grand mal fits which were controlled using Keppran and valproic acid. His brain CT revealed pontine demylination, which most likely were due to a rapid correction of his hyponatraemia. |
A 69-year-old man presented to our hospital in August 2004 for an evaluation due to one month history of right knee joint pain with fever, and two plaques showing on his abdomen and scalp for 10 and 2 years, respectively. The lesion on the abdomen began as an asymptomatic small light red macule following scratch. It enlarged gradually over the past ten years, and formed an unhealed ulceration plaque with thick crusts on its surface. He was seen by several different dermatologists in the past, but no definitive diagnosis was given. He had a failed trial of topical antibiotics. Two years earlier, an additional similar lesion on his front scalp developed from a linear wound due to hair shaving. One month prior to his visit, he developed an acute onset of right knee joint pain and swelling with decreased range of motion that was worsening with activity. Ten days after the onset of joint pain, he spiked a fever of up to 38.7°C, and went to a local hospital where he was diagnosed with acute arthritis and skin ulcers. He was treated with clindamycin and indomethasone and discontinued them after two weeks of no response. He also had 5 kilograms of unintentional weight loss in one month. The patient’s past medical history includes chronic bronchitis, 20-year history of Parkinson’s disease, and 30-year history of ankylosing spondylitis. He had no painless ulcer or rash on his penis and scrotum, urethral discharge, blurred vision or headache. He admitted engaging in several acts of unprotected heterosexual intercourse, with the last sexual encounter occurring 3 years prior. He had never traveled out of the province.\nPhysical examination on admission revealed a fever of 38.5°C. Two solitary erythematous plaques were observed with rupioid aspect covered with thick, tightly-adherent, dirty-appearing crusts, including one on his abdomen measured about 10×10 cm2 with irregular, boggy and necrotic border (Figure \nA), and the other one on his front scalp measured as 3×4 cm2 in size (Figure \nB). Right knee exam revealed swelling, warmth, redness and tenderness. Laboratory analysis showed a C-reactive protein (CRP) of 9mg/dL and erythrocyte sedimentation rate (ESR) was >140mm/hr. HLA-B27 test was positive. Cell counts, urine analysis, hepatic panel, fasting blood glucose, serum immunoglobulin, tumor markers of carcinoembryonic antigen (CEA), alpha-fetoprotein (AFP), cancer antigen (CA)-199, and prostate specific antigen (PSA) were within normal limits. Serum rheumatoid factor, anti-nuclear antibodies, anti-neutrophil cytoplasmic autoantibodies, anti-tuberculosis antibody and PPD test, and blood culture were negative. Further studies revealed negative HIV antibody by enzyme-linked immunosorbent assay, positive rapid plasma reagin test (RPR) titer 1:16, and positive reactive treponema pallidum hemagglutination assay. CD3 proportion was 70.8% (normal range 60-85%), CD4 52.3% (normal range 24.5-48.8%), CD8 22.8% (18.5-42.1%) and the CD4/CD8 ratio was 2.3 (normal range 1.5-2.1). Urethral swab culture was negative for gonorrhea, chlamydia and mycoplasma. Right knee ultrasound revealed effusion of the posterior patellar tendon, and MRI scan showed lateral and medial meniscus degeneration, suprapatellar bursa and joint space effusion. Microscopic study of thick, turbid and yellowish synovial fluid aspirated from his right knee showed white blood cells >200/HP, red blood cells 5-10/HP, but no crystals or organisms. Culture of joint aspirated specimen collected before antibiotics revealed 100% staphylococcus epidermidis with sensitivity to clindamycin, rifampin and vancomycin. Abdominal rash biopsy showed irregular psoriasiform epidermal hyperplasia with overlying crust and confluent parakeratosis containing many neutrophils, degenerative and necrotic keratinocytes, papillary dermis edema with dense lymphohistiocytic infiltration containing numerous plasma cells, scattered eosinophils and neutrophils without granulomatous process (Figure \nA and B). Immunohistochemical studies showed no evidences of lymphoma. Culture of the skin biopsy was negative for bacteria, mycobacterium tuberculosis and fungi. Silver staining for treponema was not conducted due to technical difficulties. Syphilis and septic arthritis were diagnosed based on clinical features, histological and laboratory findings.\nCefmetazole was administered intravenously on the second day of admission after collecting blood, aspirated and skin biopsy specimen. However, he continued having fever. His knee joint symptoms and skin rashes remained unchanged after 5-day of treatment. Infection disease service was consulted on day-6 of admission. He was recommended to receive intravenous norvancomycin for 5 days, but that showed no improvement. On day-12 of hospitalization, intramuscular benzathine penicillin 2.4MU was administered in a form of 3 doses with 1 week apart after getting a diagnosis of syphilis. One week after intramuscular benzathine penicillin he returned to afebrile, and the severity of his knee pain and swelling reduced significantly. Additionally, the thick crusts covering two plaques gradually shed and finally left well-demarcated red, rough and scaling surface (Figure \nC and D). His skin lesions and joint pain continued improving and he was discharged after completing a course of penicillin. Repeated labs showed CRP 2.4mg/dL, ESR 32mm/h, and RPR1:8. His skin lesions continued improving with some desquamation and postinflammatory hyperpigmentation, and his knee problem was completely resolved over the following one month.\nTwo months after discharge, the patient was readmitted due to a fever of 39.2°C, recurrent right knee pain and swelling with the flare-up skin lesions. Repeated laboratory tests showed marked inflammation process (CRP, 7.6mg/dL and ESR, >140mm/h). Blood cell counts were within normal limits. Blood and skin rash specimen revealed no organisms. Urethral swab culture for gonorrhea, chlamydia and mycoplasma were negative. RPR was 1:8, and HIV was negative. Right knee MRI scan showed subcutaneous edema with no joint effusion. Symptoms were improved after a consecutive 10-day intravenous benzylpenicillin. The patient left hospital against medical advice, and did not complete the course of antibiotics. One month later, he was sent back to hospital by his family with a fever of 39.6°C, suddenly enlarged skin lesions, and a newly developed groin dark red plaque (2×3 cm in size) with thick crusts. Right knee pain and edema significantly limited his gait and range of motion. He took ibuprofen with minimal improvement. He had no leukocytosis, labs showed CRP 15.5mg/dL, ESR 126mm/h, RPR 1:16, and negative HIV antibody. Right knee MRI scan revealed a similar finding as found at his first admission. Culture of the knee aspirate revealed no growth of bacteria. A skin biopsy from the newly formed groin lesion showed features compatible with the finding of his abdominal skin biopsy. Immunohistochemistry (IHC) stain by using a rabbit/mouse polyclonal anti-T. pallidum (1:200, Biocare Medical, CA, USA) demonstrated the presence of syphilis spirochetes in both skin lesions (Figure \nC and D). Typical spiral and thread-like organisms highlighted by brown chromogen were observed in the lower layers of the epidermis, at dermo-epidermal junction and upper dermis with a perivascular pattern. Due to elevated RPR titer of 1:8 to 1:16 and syphilis spirochetes found in the skin biopsy and joint aspirate, intramuscular benzathine penicillin 2.4MU was given once a week for consecutive 4 weeks and doxycycline 100mg twice daily for 28 days. Over the next few days, the pain was increasing leading to difficult sleeping. Methylprednisolone 16mg daily was added to the therapeutic regimen. His fever, skin lesions and joint pain were gradually improved in 2 weeks. He was weaned off methylprednisolone over a period of 6 weeks after his symptoms all gradually resolved. A repeated RPR test performed 3 months after treatment was 1:4. Two years later, RPR became negative. Follow up visits of the patient continued for the next 7 years. No relapse of the symptoms occurred, indicating the patient’s successful treatment and full recovery. |
A 68-year-old asthmatic male patient presented to our center with 12 days history of melena. He denied any previous episode of melena or hematochezia or bleeding from another site. The patient did not have any other associated symptom, and had no other co-morbidities, or medication use. Upon referral, he was uncomfortable and looked pale. He was vitally unstable, with a blood pressure of 90/60 mmHg and a pulse rate of 120 beats/min. The examination revealed the presence of clotted blood on the anal verge, and some tarry stool on digital rectal examination. The hemoglobin level was 7.7 g/dl, the hematocrit was 22.8, and the blood urea nitrogen was 8 mg/dl. The prothrombin time and the partial thromboplastin time were normal.\nResuscitation was performed with transfusion of 2 units of packed red blood cells and intravenous fluids. He was admitted to the ICU for intensive monitoring. After admission and stabilization, upper and lower endoscopies were performed without demonstrating the bleeding site. They only revealed clotted and red blood throughout the colon.\nTechnetium-labeled red blood cell bleeding scan was done to localize the site of bleeding. This scan showed no evidence of early focal increased uptake in the abdomen to indicate active gastrointestinal bleeding during early images, but in the delayed images, it revealed that there was a focal uptake in the right and transverse colon. After that, capsule endoscopy was also performed without findings. As the angiography became available, the patient underwent selective angiography without findings noted at that time. These tests were inconclusive because they were performed while the episodes of bleeding ceased.\nAfter 8 days of conservative management and negative investigations to define the cause of the bleeding, a sudden drop in hemoglobin level from 10.8 mg/dl to 6.9 mg/dl occurred over 12 h, which mandated operative management. Exploratory laparotomy was performed. Extensive jejunal saccular pouches were found 10 cm distal to duodenojejunal junction extending 1.6 m distally Fig. . The bleeding was difficult to control and the decision to clamp the major branched was performed. Division of the small bowel proximal and distal to the diseased part using gastrointestinal stapler was performed with side to side primary anastomosis Fig. . The specimen was a part of small bowel, 117 cm in length, with congested wall and multiple pouches at the mesenteric site. Opening of the specimen showed normally looking mucosa with active bleeding that stopped after awhile. No polyps or masses were detected. We reviewed the angiography achieve after that and a suspicious shadow reflecting the diverticular outpouching was detected.\nMicroscopic examination of the specimen revealed many diverticula; some of which being true diverticula, while the others are devoid of muscularis propria (false diverticulae). Within the diverticula and in the intervening portions of the bowel wall, there were numerous dilated thick- and thin-walled small blood vessels in the submucosa. Additionally, submucosal intermediate-sized vascular clusters and feeder vessels in the muscularis propria and serosa were present. The overall features were those of small intestinal diverticulosis and arteriovenous malformations. The latter involves the diverticula and intervening portions of the bowel wall Fig. .\nPostoperatively, the patient was doing well, discharged home on day 5 postoperatively, with an uneventful postoperative course. He was followed up 2 years after that without complications. |
A 38-year-old woman suffered sudden right hemiplegia with aphasia 8 hours ago and was transported to our hospital in June 2018. She was diagnosed with SLE 20 years ago, and neuropsychiatric SLE was considered 8 months before this onset. One month ago, glucocorticoids were discontinued by herself because of deterioration of bilateral femoral head osteonecrosis. Three days before this onset, patient reported transient aphasia for 15 minutes and another aphasia lasted for about 20 minutes 1 day before. She did not go to any medical institution for further assessment until this attack. She had no history of cancer, addictive drug use or oral contraceptive use. On admission, this patient was alert and oriented, vital signs was normal. On physical examination right central facial palsy and right hemiplegia was present with a National Institute of Health Stroke Scale (NIHSS) score of 13. Both complete blood cell count and coagulation parameters were normal. Serum fibrinogen (4.84 g/L) and D-dimer levels (1200 μg/L) were increased. No other abnormal laboratory result was present.\nA non-contrast computed tomography (CT) was normal with Alberta stroke program early CT score of 10, but computed tomography angiography (CTA) revealed occlusion of the left middle cerebral artery (MCA). The computed tomography perfusion showed that the volume of penumbra and core infarct volume was 53 mL and 13 mL respectively, and the mismatch ratio was 4.1. AIS with large vessel occlusion (LVO) was diagnosed, intravenous alteplase was not recommended since onset was more than 4.5 hours.\nTherefore, this patient met both DAWN and DEFUSE 3 eligibility criteria, and according to the updated guidelines, mechanical thrombectomy (MT) was recommended. This patient was sent to neurointerventional suite for revascularization within 60 minutes after arriving at our hospital. The angiography of left common carotid artery showed occlusion of M1 segment of left MCA and left anterior cerebral artery supplied the collateral blood flow to MCA territory at late arterial stage (Fig. A, B). A SolitaireFR 6 × 30 mm (Covidien) was deployed through Rebar18 microcatheter and angiography showed normal cerebral blood flow was restored. After first thrombectomy a small amount of clot was removed from the vessels (Fig. E), a grade 3 of modified thrombolysis in cerebral infraction was restored (Fig. C, D). Ten minutes later a second angiography showed the blood flow of left MCA worsened obviously (Fig. F, G). Tirofiban was continuously given at the speed of (400 μg/h) after an intravenous bolus of 500 μg. Ten minutes later another cerebral angiography showed normal blood flow of left MCA (Fig. H, I). Patient was transferred to neurological ward for further treatment.\nTwenty four hours later oral antiplatelet was given after intracranial hemorrhage was ruled out. Her erythrocyte sedimentation rate increased mildly (26 mm/h). Further lab examination demonstrated her antinuclear antibody (ANA) (1:80) and anti-double-stranded DNA antibody was positive (140.4 IU/mL), these examinations were normal (ANA negative and anti-ds DNA 75.4 IU/mL) 8 months ago. Although her antiphospholipid antibody was negative, a SLE-related ischemic stroke was diagnosed. 40 mg methylprednisolone was daily given orally and intravenous immunoglobulin was refused by the patient. On the thin slice contrast-enhanced magnetic resonance (MR) an obvious enhancement of vessel wall at left M1 segment was detected comparing with the contralateral vessels (Fig. A), and magnetic resonance angiography (MRA) revealed stenosis at the same site (Fig. B). Her neurological symptom improved with NIHSS score of 7 several days later. She was transferred for further rehabilitation.\nAt 4 months follow-up she can live independently with mild hypophrasia (modified rankin scale scored 1). Her T1 weighted MR showed multiple encephalomalacia foci (Fig. C, D). She continuously took 75 mg clopidogrel and 5 mg methylprednisolone daily and no ischemic stroke was observed in the 1 year follow-up. |
A 65-year-old female weighing around 40 kg presented with swelling of the face, over the nasal bridge []. The mass was progressively increasing in size. The angiogram showed AV malformation which was partially thrombosed and calcified. The patient was planned for embolization of the malformation, under general anesthesia. We were informed to be careful while anesthetizing the patient as the swelling was fragile and there was a risk of rupture.\nThe preanesthetic evaluation was done. She was a diabetic and hypertensive on treatment and well controlled. On the evaluation, there was a swelling on the face which measured around 7 cm × 7 cm in size, adjoining the left medial canthus of eyes, extending to the nasal bridge, and alae nasae []. There were cracks and ooze from the surface. It was also observed that swelling could come in the way of direct laryngoscopy. Mouth opening was adequate, and Mallampati was Class 2. Neck extension was adequate. Investigations were normal. The patient was optimized and kept nil per orally for 8 h. Cath Laboratory was prepared with difficult airway cart including flexible fiberoptic scope and equipment for emergency cricothyrotomy. Our plan was to try normal intubation.\nOn the day of the procedure, the patient was shifted onto the table. Wide bore cannula was secured, and monitors were connected. Premedication was done with 1 mg midazolam and 50 μg fentanyl. Preoxygenation was tried with size 5 face mask by gently keeping the mask above the face to give oxygen enriched air, taking care not to pressurize on the swelling. Induction was done with 50 mg propofol. Mask ventilation was tried with size 5 face mask, with the view of taking the swelling inside the mask, but the swelling was too big to be included. Then, size 1 face mask and Rendell-Baker-Soucek (RBS) mask were used just to cover the mouth, but we failed to get effective ventilation with both masks as the swelling was coming in the way. Next option was to introduce size 3 I-Gel. We could get effective ventilation with I-Gel. Succinylcholine 50 mg was given. Direct laryngoscopy was done through the right side carefully not to press on the swelling, trying to keep the axis of scope handle on the right side. After creating enough space for intubation, the trachea was intubated with size 7.5 mm cuffed oral endotracheal tube. Bilateral air entry was checked, and the tube was fixed. The patient was maintained with oxygen and nitrous oxide. Atracurium boluses were given as muscle relaxant. Intraoperative period was uneventful. After the procedure, the patient was extubated fully awake. |
We present a case of a 60-year-old female with no relevant past medical history who initially presented to our emergency department with complaint of sudden onset of shortness of breath for 1 day. Patient stated that she woke up from her sleep gasping for air. She denied chest pain, palpitations, wheezing, or cough. Her symptoms were getting progressively worse, prompting a visit to the emergency department. Patient also complained of dull left flank pain, 5/10 in intensity, radiating to the suprapubic region, aggravated by movement and deep inspiration, and relieved partially with analgesics. The pain was not associated with nausea, vomiting, change in her bowel habits, dysuria, urinary urgency or frequency. Her past surgical history was significant for a cesarean section. Family history was remarkable for diabetes and hypertension in mother and breast cancer in sister. She denied active smoking history and no illicit drug use but admitted to consuming 3 - 4 drinks of alcohol once a week. She denied taking any prescription or over the counter medications at home. Review of systems was significant for shortness of breath and minimal fatigue. She denied any changes in her weight or appetite.\nOn physical examination, her vital signs at the time of presentation were: temperature of 97.8 °F (36.5 °C), respiratory rate of 18 breaths/min, pulse rate of 122 beats per minute and blood pressure of 89/69 mm Hg. The vitals shortly thereafter in the emergency department were heart rate of 93 beats per minute and blood pressure improved to 103/67 mm Hg. She was not icteric or pale and no cervical or axillary lymphadenopathy was appreciated. Lungs were clear to auscultation, with decreased breath sounds in the left lung base. No wheezes, rhonchi or crackles were appreciated. Cardiac examination was normal too. Abdominal examination was remarkable for a well-healed cesarean section scar. She had moderate tenderness in the left upper quadrant, with no rebound tenderness. No visceromegaly was appreciated. She had normal bowel sounds in all four quadrants. Rectal examination demonstrated a normal sphincteric tone and no external or internal hemorrhoids could be felt. Fecal occult test was negative. Neurological examination was unremarkable and extremity examination was within normal limits.\nPatient was admitted for further management of her shortness of breath. Pulmonary embolism was high on the list of differential diagnosis. D-dimer levels were also elevated, prompting a computerized axial tomography with contrast (CAT) of the chest. CAT ruled out pulmonary embolism but did reveal severe circumferential wall thickening of the visualized splenic flexure highly suspicious for colitis or malignancy. It also revealed a 4 mm nodule in the left upper lobe of the lung. Dedicated CT imaging of the abdomen and pelvis with oral contrast was advised for further evaluation. CT of abdomen () demonstrated complex fluid regional to the spleen and complex fluid or mass-like focus of decreased enhancement extending from the anterior lateral aspect of the spleen to the descending colon and to the pancreatic tail which could be inflammatory but was suspicious for malignancy. Fluid adjacent to the spleen was extending to the posterior cardia of the stomach. Irregular enhancement was noted in the lateral part of the spleen. Adjacent fat infiltration and enlarged regional lymph nodes to about 9 mm each were also noted.\nGastroenterology consult was requested and a colonoscopy was performed. Colonoscopy () revealed a large tumor circumferential at the splenic flexure. It was friable and multiple biopsies were obtained from the tumor and the surrounding areas. Specimens were sent for pathological evaluation which revealed moderately differentiated invasive adenocarcinoma of the splenic flexure. Surgical intervention was planned and the patient underwent exploratory laparotomy followed by Hartmann’s procedure (proctosigmoidectomy). Exploratory laparotomy revealed a tumor that was firmly adherent to the lateral wall of the colon and invading and extending into the spleen. The tumor appeared to be perforated but was contained within the abscess cavity and approximately 15 mL of pus was drained from the site. Liver appeared normal without any evidence of gross metastases. Patient tolerated the procedure well. After the surgery, she was assessed by oncology. Final pathology demonstrated a tumor, about 6 cm in greatest dimension in the splenic flexure with visible macroscopic perforation. Histologically it was a high grade poorly differentiated adenocarcinoma. Tumor has penetrated the surface of the visceral peritoneum. Vascular invasion was identified. The tumor was staged as stage III C tumor (T4b, N2a, M0). Also identified was a large area of acute inflammation, inflamed granulation tissue, abscess formation, vascular congestion, and hemorrhage associated with the area of tumor perforation at the splenic flexure region. Carcinoembryonic antigen which was ordered postoperatively was found to be elevated at 53.9 ng/mL (normal is less than 4.8 ng/mL). She was arranged for chemotherapy in an outpatient setting. Of note, during the hospital course, preoperatively the patient spiked a temperature of 100.4 °F (38 °C) and blood cultures sent during that time grew gram negative anaerobic bacilli in one anaerobic bottle, later identified as Bacteriodes species. |
We present the case of a 60-year-old man presenting at the ED of our non-PCI-capable hospital with a complaint of breathlessness at rest and on exertion over the past two days. The patient's medical history was unremarkable apart from obesity. Upon presentation, he was hemodynamically stable, and clinical examination revealed moderate wheezing and diffuse rales at lung bases bilaterally on auscultation (Killip Class II). His ECG revealed a normal sinus rhythm with a left anterior fascicular block (LAFB); shallow T wave inversion at leads I, aVL, and V6; and T wave flattening at lead V5. A measurement of cardiac troponin T (cTnT) yielded a value of 71 ng/L (normal value < 40 ng/L), and the diagnosis of a NSTEMI was highly likely. TTE revealed a reduced LVEF of 40% with no regional wall motion abnormalities. However, a difference of blood pressure values of about 20 mmHg between the two arms prompted a CT angiography of the aorta before the initiation of antiplatelet therapy. It revealed no aortic pathology but visualized a short LMCA which then split into two distinct branches of the same caliber descending toward the apex in the anterior interventricular groove, compatible with the course of the LAD artery (). The patient was started on antiplatelets and intravenous diuretics. His stay at the CCU remained uneventful with gradual remission of symptoms and improvement of myocardial enzymes. He was referred to a tertiary center for coronary angiography which revealed an atherosclerotic lesion at the middle segment of the LCx causing a luminal stenosis of about 40% and one lesion at the second obtuse marginal branch of the LCx also causing a stenosis of 40%. Moreover, a short LMCA was confirmed (, left anterior oblique caudal “spider” view), which in turn gave rise to the LCx and a common LAD trunk (which we denote as LAD-proper). The proper LAD bifurcated into two arteries, one giving rise to long septal perforators (short LAD) and one reaching the apex (long LAD), giving rise to shorter perforating arteries and diagonals (Figures and ). The patient was discharged on DAPT (aiming for a maximum duration of one year), an ACE inhibitor, a b-blocker, a statin, and furosemide. Follow-up echocardiography was performed three months post angiography revealing a markedly improved LVEF of 52%.\nSpindola-Franco et al., in 1983, classified dual LAD variants into distinct types (Types I, II, III, and IV) by studying a cohort of 2140 patients who underwent coronary angiography []. The prevalence of a dual LAD was 1% in their study (23 patients). Our case fits the angiographic description of a Type I dual LAD according to the abovementioned classification. Since the original classification of Spindola-Franco et al., three more dual LAD types have been described in the literature, raising the total types to seven [, ]. Regarding our current case, the opinion of expert interventional cardiologists who were asked to evaluate the angiographic findings was wavering between a dual LAD and a long diagonal branch, a situation that was to be expected considering the rarity of such a variant. |
A male patient aged 5-year-and-1-month was referred for genetic evaluation of development and speech delay, intellectual disabilities at the genetic counselling clinic in Shenzhen Maternal and Child Healthcare Hospital. The parents described that an affected brother also presented the same clinical phenotype but was not available for the clinical examination. The chromosome karyotype and chromosomal microarray analysis (CMA) in the proband were normal. The mother was pregnant again and pursued genetic counseling. The proband was subject to comprehensive neurological testing including the Gesell Developmental index. Molecular genetic tests and biochemical and neurochemical analysis were performed on the proband. The present study was approved by the hospital’s Institutional Review Board and written informed consent was obtained from their parents.\nThe proband was the second boy of healthy nonconsanguineous parents (pedigree in Fig. ). He was born at 39 weeks of gestation from an uneventful pregnancy and delivered by Caesarean section (weight, 3600 g; length, 50 cm; head circumference, 36 cm). He showed head control at 12 months, ability to sit by himself at 15 months, and walking with aid at 20 months. His verbal language was nearly absent and he made no visual contact. He suffered from seizures from 6 months old. He had no craniofacial dysmorphism. Gastrointestinal problems such as chronic constipation or nausea were noted in the proband. The physical examination on the proband showed 95 cm height, weight 18.2 kg and developmental and language delay. The proband also had an electroencephalogram (EEG) test, which showed sharp and slow waves in sleep during 24-h EEG monitoring. A brain stem auditory-evoked potential (BAEP) test showed mild abnormality. The proband had a Children’s Autism Rating Scale (CARS) score of 33, which indicated mildly autistic characteristics. The Gesell developmental scale test was used to evaluate the proband. Both the development age (DA) and developmental quotient (DQ) data showed extremely low grades which suggested severe development delay (adaptability, DA = 14.23mo., DQ = 23; gross motor, DA = 26.37mo., DQ = 43; fine movement DA = 15.87mo., DQ = 26; vocabulary DA = 13.07mo., DQ = 21; personal-social skill DA = 13.3mo., DQ = 22). The test results are depicted in Additional file : Figure S1A. The affected brother of the proband (II:1) was not available for the physical examination. The parental description of the clinical phenotype of the brother was mostly the same as the proband. The parents were physically healthy and indicated no significant past medical, surgical or family history.\nDNA samples were provided from the index patient and other family members, which were extracted as previously described []. The present study used the TruSight One Sequencing Panel and NextSeq 500/550 Mid Output v2 kit (300 cycles) with high depth of coverage for 4813 target genes (approximately 62000 target exons) that are associated with clinically relevant phenotypes. An average sequencing depth of 136.88x was achieved and 98.25% of targeted variants were covered at least to a 10x depth, and 97.04% of targeted variants were covered at least by 20x. The total detected variants numbered 24594, which included 21,733 SNPs, 1,182 insertions and 1,679 deletions respectively. The data were analyzed on the TGex (Translational Genomics Expert) platform featuring with the VarElect scoring system []. A missense mutation, c.1181C > A (p.Thr394Lys), in the SLC6A8 gene was called with high probability as a candidate mutation.\nSanger sequencing was performed to confirm the SLC6A8 gene c.1181C > A mutation (forward primer 5’ ACGGAACTTGTCAGATTGT3’, and reverse primer 5’CAACAGCATGAAGAAGAACA3’). The father (I:1) was wildtype and the mother (I:2) was heterozygous for the c.1181C > A variation. The affected brother (II:1) and the proband (II:2) both carried the hemizygous variation of c.1181C > A. The pregnant mother had an amniocentesis at 22 weeks and Sanger sequencing targeting the SLC6A8 gene c.1181C > A was performed. The result showed a wild-type allele (II:3) and the mother gave birth to a healthy baby girl (Fig. ). In silico variant prediction analysis methods, including SIFT, PolyPhen2, PROVEAN, and Mutation Taster demonstrated this variant had probably damaging or diseasing-causing effects.\nBiochemical screening was performed with blood and urine samples from the proband and his mother. The creatine/creatinine (Cr:Crn) ratio was determined by liquid chromatography-mass spectrometry with deuterated internal standards in two urine samples taken on different days. A urine creatine test of the proband showed significantly elevated levels of creatine (0.805 mg/ml, normal control 0.160 ± 0.177 mg/ml) (Additional file : Figure S1B), and the creatine/creatinine ratio was significantly elevated compared to controls. Proton magnetic resonance spectroscopy (MRS, Magnetom Skyra 3.0-T, Siemens Healthcare GmbH, Erlangen, Germany), examination using a 3.0-T system at the brain left parietal lobe, right parietal lobe and genu of corpus callosum all showed marked reduction of the brain creatine peak (Fig. left part). Brain MRI showed a thin corpus callosum in the proband (Fig. right part). The MRS and MRI examination of the mother (I:2) showed normal results (Additional file : Figure S1C). |
A 48-year-old woman was admitted to the Epilepsy Center in July 2005 because of refractory seizures. Seizures began when she was 22 years old, after a bus accident while she was going to work. The bus crashed into a motorcycle, with no loss of awareness. Once outside the bus, she remembered her face was covered with blood and having seen the motorcycle rider being thrown from his motorcycle. After the accident she was admitted at an intensive care unit for a few days and was studied for the THI. During the recovery period it was very difficult for her to walk, and because of continuing lack of sensitivity in both legs she underwent electromyogram (EMG) three months after the accident. The EMG results were normal.\nFour months, from the accident seizures began, were characterized by paroxysmal behavioral and motor episodes with a frequency of two to three seizures in a week. She also had absences (lack of response) and sometimes got lost in the street (compatible with dissociative fugue). She received a diagnosis of posttraumatic epilepsy and was treated with antiepileptic drugs like phenytoin, carbamazepine and diazepam. Despite this medication, seizures continued. At this point she was referred to psychotherapy and a psychiatrist prescribed antidepressants for associated depression. That treatment lasted ten years. Because of lack of response to the treatment (the same seizure frequency), many years later she was referred to our Epilepsy Reference Center.\nAfter evaluation by a neurologist she was admitted at the Epilepsy Monitoring Unit in July 2005 and underwent Video-EEG. Neurologic examination was normal, as were an MRI of the brain, interictal SPECT, and interictal electroencephalogram (EEG). Video-EEG monitoring data were obtained with a digital system through 24 hour continuous scalp recordings, with electrodes placed according to the 10–20 international system. The patient was filmed 24 hours a day using a CCD-Panasonic video.\nAt admission she was taking carbamazepine, phenytoin, and diazepam.\nMedication was tapered to discontinuation. Three attacks were recorded during five monitoring days. Video-EEG showed typical episodes characterized by jerking of her trunk at onset, followed by bizarre movements, shaking legs, spitting out, and crying. She complained that it hurt, pointing to her head with her left hand.\nThese events lasted approximately one minute and she had no total loss of consciousness, with no apparent confusion afterward as she could understand and answer the questions posed by the attending nurse.\nThese episodes showed no accompanying epileptiform activity on the EEG and because of that, the diagnosis on discharge was PNES. The diagnosis was communicated to the patient and she was referred to us for psychiatric evaluation.\nHistorical and psychiatric data together with information about social background were obtained, supplemented by information from family and friends. Psychiatric assessment was made by interviews using DSM IV instruments: SCID I Spanish Clinical Version for axis I for psychiatric disorders, SCID II to determine the presence of personality disorders [, ], and Hamilton anxiety rating scale [] for anxiety disorders.\nThe history of the crash and symptoms triggered including increased arousal, anxiety, nightmares, avoidant symptoms like not taking a bus, and somatic symptoms such as chronic headaches, led to the diagnosis of posttraumatic stress disorder (PTSD) in axis I according to DSM IV []. Hamilton anxiety rating scale scored 32 points [] corresponding to the diagnosis of anxiety disorder. The Structured Clinical Interview for axis II (SCID II) [] scored for cluster b and c personality disorder [] with a marked tendency in dependence personality traits.\nAfter psychiatric assessment the patient was told about the emotional origin of her seizures and also that PNESs are often identified in people who suffered traumatic events like hers. Explanation of the PNES diagnosis served as a positive event emphasizing that there was no need to go on antiepileptic drugs was the first terapeutic step. Because of her psychiatric disorder she was prescribed paroxetine, low doses of risperidone and diazepam, and was referred to psychotherapy. A few months later risperidone was tapered off and one and a half years later paroxetine was discontinued. Three years after the evaluation in our center she was diagnosed with panic disorder and was prescribed citalopram 20 mg/d which she remains on at the present time. At present, almost four years after PNES diagnosis, seizure frequency is approximately once a month. She is working now and she is no longer taking antiepileptic drugs. |
A 50-year-old female with a past medical history significant for pericarditis had been presenting to her primary care provider with concerns about ongoing epigastric pain, worse with food ingestion, and intermittent radiation towards the back, worsening for the last few months. The pain was associated with nausea, vomiting, diarrhea, and early satiety. The severity of pain was moderate to severe and sometimes causing nocturnal awakenings. There was minimal response to a bland diet, the over-the-counter pain medications, and treatment with antacids, which she tried for almost three months. Physical examination was unremarkable. Her initial lab work including a complete blood count with differential kidney functions, liver functions, electrolytes, thyroid function tests, serum lipase, serum amylase, immunoglobulin E level, and urine culture and sensitivity were all reported as unremarkable. Subsequently, she underwent stool testing including hemoccult testing, stool white blood count, stool fecal fat, Clostridium difficile polymerase chain reaction, and calprotectin which were also reported unremarkable. The patient was referred to a gastroenterologist, who ordered a computerized tomography of her abdomen with contrast, which showed evidence of marked narrowing at the origin of the celiac artery, secondary to compression by the median arcuate ligament of the diaphragm (Figure ). The scan reported soft-tissue stranding of the celiac artery, but the superior mesenteric and the inferior mesenteric artery were found to be patent (Figures , ).\nSubsequently, she was referred to a cardiothoracic surgeon who ordered abdominal ultrasound with a duplex that showed elevated velocities (above 200 cm/s) at various segments of the celiac artery concerning hemodynamically significant stenosis due to a compression by a prominent arcuate ligament (Figures -).\nThe findings and the underlying pathophysiology were discussed in detail with the patient who was deemed a candidate for surgical intervention. She also underwent an upper gastrointestinal endoscopy which was unremarkable. Finally, she underwent a laparoscopic procedure to divide the median arcuate ligament, which resulted in the freeing up of the celiac artery and thus in the resolution of the stenosis (Figure ).\nThe patient's post-operative period was unremarkable, and she was discharged after 24 hours of the surgery. The patient has since had complete resolution of her symptoms, and she has been having regular follow up with both her primary care physician and her gastroenterologist. |
A 48-year-old Japanese woman was referred to our clinic for various symptoms and the fear of side effects of vaccines. She had a dog bite on her face 2 months prior to the visit to us. At a hospital she visited, she received tetanus toxoid twice. Shortly after the second injection, she started to develop chill, back pain, and neck and shoulders stiffness. She also suffered polydipsia, shortness of breath, and chest discomfort, and she visited the hospital again. There she was reportedly told by an emergency physician that she had “abnormal electrocardiogram that could be fatal.” She also developed pins-and-needles sensations on four limbs. The pain radiated from shoulders to her elbows and from lateral aspects of her hips to her knees. Because of her back pain, she feared zoster and visited a dermatologist, but she was told she did not have this. She also suffered insomnia, which she ascribed to pain and anxiety, but she never woke up because of pain after she fell asleep. She also developed headache, abnormal genital bleeding, and frequent watery diarrhea. She visited a gynecologist, and her hormonal workup was normal. She visited a neurologist for her limb pain and was prescribed vitamin B 12 tablet without specific explanation. She also visited a psychosomatic medicine specialist for her insomnia and was prescribed gabapentin and alprazolam. She also visited a rheumatologist due to fear of Sjogren syndrome because of her thirst, but the laboratory tests did not suggest any kind of collagen vascular diseases. The rheumatologist suspected potential side effects of tetanus toxoid, and she was referred to our clinic.\nOn physical examination, she appeared anxious and was in agony. Her vital signs were normal. Head and neck examinations were normal including thyroid palpation. Her eyes and mouth appeared appropriately wet. Her trapezius muscles were stiff, and her symptoms improved by massaging them. She did not have tender points suggestive of fibromyalgia, nor any other part of her body. She also did not have any rash, lymphadenopathy, or arthritis. The rest of her physical examination, including thorough neurological examination, was entirely normal.\nShe received all recommended immunization during her childhood. We called the emergency physician for the details of her cardiac workup. It turned out that her electrocardiogram merely showed J-point elevations in the ST segments, and they were wrongly interpreted as “possible Brugada pattern.”\nBecause of the broadness of her symptoms’ categories, which were medically unexplainable, painful sensation on all four limbs but only proximally led us to consider that she was suffering from a functional syndrome secondary to tetanus toxoid injection. With symptoms such as palpitation, dry mouth, diarrhea, pains in arms and legs, and disability she suffered from these symptoms, while excluding other relevant differential diagnoses, fulfilled the diagnostic criteria of bodily distress syndrome. We told her what we considered, for which she expressed her delight with relief. By further history taking, she disclosed that she received another tetanus toxoid 2 years ago when she had a dog bite. She thought she received too many tetanus toxoids, and she wondered whether these could have been toxic to her. The comment by the rheumatologist and referral to us, the infectious diseases department, and “abnormal ECG” augmented her fear.\nWe prescribed amitriptyline 10 mg daily, Kakkonto, and Keishikaryukotsuboreito 1 packet 3 times a day. Her symptoms disappeared shortly, except for occasional back and left upper arm pain, and her medications were continued. |
A male patient aged 5-year-and-1-month was referred for genetic evaluation of development and speech delay, intellectual disabilities at the genetic counselling clinic in Shenzhen Maternal and Child Healthcare Hospital. The parents described that an affected brother also presented the same clinical phenotype but was not available for the clinical examination. The chromosome karyotype and chromosomal microarray analysis (CMA) in the proband were normal. The mother was pregnant again and pursued genetic counseling. The proband was subject to comprehensive neurological testing including the Gesell Developmental index. Molecular genetic tests and biochemical and neurochemical analysis were performed on the proband. The present study was approved by the hospital’s Institutional Review Board and written informed consent was obtained from their parents.\nThe proband was the second boy of healthy nonconsanguineous parents (pedigree in Fig. ). He was born at 39 weeks of gestation from an uneventful pregnancy and delivered by Caesarean section (weight, 3600 g; length, 50 cm; head circumference, 36 cm). He showed head control at 12 months, ability to sit by himself at 15 months, and walking with aid at 20 months. His verbal language was nearly absent and he made no visual contact. He suffered from seizures from 6 months old. He had no craniofacial dysmorphism. Gastrointestinal problems such as chronic constipation or nausea were noted in the proband. The physical examination on the proband showed 95 cm height, weight 18.2 kg and developmental and language delay. The proband also had an electroencephalogram (EEG) test, which showed sharp and slow waves in sleep during 24-h EEG monitoring. A brain stem auditory-evoked potential (BAEP) test showed mild abnormality. The proband had a Children’s Autism Rating Scale (CARS) score of 33, which indicated mildly autistic characteristics. The Gesell developmental scale test was used to evaluate the proband. Both the development age (DA) and developmental quotient (DQ) data showed extremely low grades which suggested severe development delay (adaptability, DA = 14.23mo., DQ = 23; gross motor, DA = 26.37mo., DQ = 43; fine movement DA = 15.87mo., DQ = 26; vocabulary DA = 13.07mo., DQ = 21; personal-social skill DA = 13.3mo., DQ = 22). The test results are depicted in Additional file : Figure S1A. The affected brother of the proband (II:1) was not available for the physical examination. The parental description of the clinical phenotype of the brother was mostly the same as the proband. The parents were physically healthy and indicated no significant past medical, surgical or family history.\nDNA samples were provided from the index patient and other family members, which were extracted as previously described []. The present study used the TruSight One Sequencing Panel and NextSeq 500/550 Mid Output v2 kit (300 cycles) with high depth of coverage for 4813 target genes (approximately 62000 target exons) that are associated with clinically relevant phenotypes. An average sequencing depth of 136.88x was achieved and 98.25% of targeted variants were covered at least to a 10x depth, and 97.04% of targeted variants were covered at least by 20x. The total detected variants numbered 24594, which included 21,733 SNPs, 1,182 insertions and 1,679 deletions respectively. The data were analyzed on the TGex (Translational Genomics Expert) platform featuring with the VarElect scoring system []. A missense mutation, c.1181C > A (p.Thr394Lys), in the SLC6A8 gene was called with high probability as a candidate mutation.\nSanger sequencing was performed to confirm the SLC6A8 gene c.1181C > A mutation (forward primer 5’ ACGGAACTTGTCAGATTGT3’, and reverse primer 5’CAACAGCATGAAGAAGAACA3’). The father (I:1) was wildtype and the mother (I:2) was heterozygous for the c.1181C > A variation. The affected brother (II:1) and the proband (II:2) both carried the hemizygous variation of c.1181C > A. The pregnant mother had an amniocentesis at 22 weeks and Sanger sequencing targeting the SLC6A8 gene c.1181C > A was performed. The result showed a wild-type allele (II:3) and the mother gave birth to a healthy baby girl (Fig. ). In silico variant prediction analysis methods, including SIFT, PolyPhen2, PROVEAN, and Mutation Taster demonstrated this variant had probably damaging or diseasing-causing effects.\nBiochemical screening was performed with blood and urine samples from the proband and his mother. The creatine/creatinine (Cr:Crn) ratio was determined by liquid chromatography-mass spectrometry with deuterated internal standards in two urine samples taken on different days. A urine creatine test of the proband showed significantly elevated levels of creatine (0.805 mg/ml, normal control 0.160 ± 0.177 mg/ml) (Additional file : Figure S1B), and the creatine/creatinine ratio was significantly elevated compared to controls. Proton magnetic resonance spectroscopy (MRS, Magnetom Skyra 3.0-T, Siemens Healthcare GmbH, Erlangen, Germany), examination using a 3.0-T system at the brain left parietal lobe, right parietal lobe and genu of corpus callosum all showed marked reduction of the brain creatine peak (Fig. left part). Brain MRI showed a thin corpus callosum in the proband (Fig. right part). The MRS and MRI examination of the mother (I:2) showed normal results (Additional file : Figure S1C). |
A 66-year-old male presented with a three-month history of progressive dysphagia. The chest X-rays, barium swallow and computed tomography (CT) confirmed the presence of SIT and middle third esophageal cancer (Fig ). Endoscopic ultrasound revealed an ulcerated tumor diagnosed as squamous cell carcinoma by biopsy (Fig ). Three-dimensional (3-D) images were constructed to demonstrate the surrounding structures around the esophagus (Fig ). The patient was diagnosed with middle third esophageal cancer (cT2N2M0, Stage III) and total minimally invasive McKeown esophagectomy was performed because the patient declined neoadjuvant chemoradiotherapy.\nDouble lumen trachea insertion and single-lung ventilation were applied for anesthesia. The operation was divided into three phases: (i) the thoracoscopic operation phase to mobilize the esophagus and dissect the mediastinal lymph nodes; (ii) the laparoscopic operation phase to mobilize the stomach, dissect abdominal lymph nodes and create a gastric conduit; (iii) the cervical operation phase to perform anastomosis and dissect cervical lymph nodes through a right (not left) neck incision. CO2 insufflation was applied in both phase 1 and phase 2 with a pressure of 6 and 12 mmHg, respectively. In phase 1, the patient was placed in the right lateral-prone position using four ports (Fig ). The camera port was set in the seventh intercostal space at the posterior axillary line. Two operation ports were set at the third intercostal space (left hand of the surgeon) and fifth intercostal space (right hand of the surgeon), respectively, both of which were at the anterior axillary line. Another port was set in the sixth intercostal space anterior to the tip of the scapula to assist the physician. The surgeon performed the surgery in a sitting position at the ventral side of the patient (Fig ). The thoracic duct was dissected in a gross specimen with the esophagus and the paraesophageal tissues and recurrent laryngeal nerve on both sides were preserved (Fig , d). In phase 2, the patient was placed in the supine position with legs split apart (Fig ). Five ports were placed in an arched shape on the upper abdomen, consisting of a camera port below the umbilicus, two operation ports on the left midclavicular line 3 cm above the umbilicus and left anterior axillary line below the costal arch, respectively, and two assistant ports on the right midclavicular line 3 cm above the umbilicus and right anterior axillary line below the costal arch, respectively. The surgeon sat at the left side of the patient while the camera-holding assistant stood between the legs of the patient (Fig ). A gastric conduit was made via a 4 cm vertical median incision in the upper abdomen after the laparoscopic operation was completed. In phase 3, the gastric conduit was pulled upward to the right neck incision via the retrosternal space, and cervical esophago-gastric end-to-side anastomosis was performed with the use of a circular stapler.\nA total of 48 lymph nodes were harvested during surgery. Total operative time from incision to closure was 480 minutes and the estimated blood loss was 80 mL. Postoperative examination was normal (Fig ), and the patient was discharged on postoperative day 7 without any remarkable complications. Histopathology of the resected specimen confirmed squamous cell carcinoma with pT3N1M0, stage IIIB disease (Fig ). |
A 15-year-old girl presented to our hospital on September 13, 2018 with a 2-month history of pain in the left lower extremity that worsened for 1 month. Major clinical manifestations included lumbago and radiating pain along the femoral nerve distribution with decreased sensation and paresthesia of the left lower extremity. She also had limitation of motion of the lower limb, which was relieved after rest. The patient visited a local hospital in July 2018 and received no definite diagnosis. She was given vitamins and calcium supplementation, but her pain was not alleviated. In August 2018, her pain worsened and swelling also appeared in the left thigh. She visited the Department of Neurology of our hospital on September 6, 2018. Electromyography revealed injury of the left femoral nerve; she received mecobalamin and vitamin B12, but pain failed to improve. The patient had no history of trauma. Her medical history was unremarkable.\nPhysical examination at admission revealed firm, tender mild swelling of the left proximal thigh, with normal overlying skin. Adduction and flexion of the left hip were limited and elicited pain. There were no other remarkable abnormalities. Plain radiographs showed increased density of the greater trochanter of the left femur (Fig. ). CT displayed thickened cortex in the anterior surface of the left proximal femur with specks of calcification and inhomogeneity of the adjacent bone marrow cavity (Fig. ). Preoperative magnetic resonance imaging (MRI) showed an oval mass in the bone marrow cavity of the proximal femur, which was 5.5 × 2.1 cm in size and hypointense in the T1-weighted image and hyperintense in the fat-suppressed T2-weighted image. The intertrochanteric bone had slightly sheet-like hyperintense signal on fat suppression and a sharp protrusion was seen anterior to the lesion and its wide base was connected to the bone. The adjacent soft tissue showed a long curved shadow on T2 fat-suppressed signal. The local cortical bone was interrupted. No obvious soft tissue shadow was seen (Fig. ). Considering that pain was the predominant symptom in the patient and the fact that osteoid osteoma is more common, especially in the proximal femur [], based on the radiological (X-ray, CT and MRI) findings, a diagnosis of left femur tumor with a high likelihood of osteoid osteoma was made.\nThe patient underwent surgical exploration. Soft tissue swelling was observed adjacent to lesion in the proximal femur and massive granulation tissues were present in the medullary canal. The periosteum, and the granulation tissue and cartilage tissue were excised by curettage and pathological study revealed thickening of the periosteum and bone (Fig. ). Iliac crest grafting in the femur lesion was performed. The surgery was uneventful and postoperative X-ray examination showed a hypodense area in the left proximal femur. A final diagnosis of enchondroma of the proximal femur was made. The patient received conventional postoperative care and was discharged from the hospital 16 days after surgery. The patient received follow-up at the hospital at 1, 3, 5 and 18 months postoperatively. At the last follow-up visit, the left hip showed good range of motion including flexion, adduction and medial and lateral rotation. The patient could ambulate without difficulty. Signs of left femoral nerve injury disappeared. Roentgenography showed irregular patchy inhomogeneous hypodense shadows with an indistinct border. No other abnormalities were seen. The imaging and pathological findings of the patient are shown in Table . |
In May 2016, a 67-year-old woman came primarily to our hospital for a consultation about painless mass of the left lower gingiva. Intra-oral examination showed a 46 × 25-mm tumor with induration on the left lower gingiva (Fig. ). A submucosal mass, independent of the gingival tumor, was palpable in the left buccal region. Several cervical lymph nodes on the left side were also palpable. Pathological examination of a biopsy sample taken from the gingival tumor revealed a well-differentiated squamous cell carcinoma.\nA computed tomography (CT) scan with contrast showed a large gingival tumor, with destruction of the adjacent mandibular bone, and four metastatic left-cervical lymph nodes that were markedly enlarged, non-homogeneously enhanced, and partially necrotic. These lymph nodes included two left submandibular and two left upper jugular nodes. CT imaging showed no metastases to the lungs. Magnetic resonance imaging (MRI) showed a large primary tumor on the left side, with its epicenter located in the lower gingiva. The tumor appeared to extend into the sublingual space medially and into the buccinator muscle laterally. A non-homogeneously enhanced mass was identified in the buccinator space along the facial vessels, anterior to the anterior edge of the masseter muscle, and lateral to the buccinator muscle (Fig. ). This mass lay on the cranial side of the primary tumor. The mandibular ramus and pterygoid region that are on the cranial side of BN were not invaded by primary tumor (Fig. ). Moreover, T1-weighted MRI showed a thin layer with high signal, indicative of fatty tissue, between this mass and the primary tumor, indicating that the mass was independent of the primary tumor. Based on its anatomic location, the mass appeared to be metastatic disease to BN. Greyscale sonogram showed some metastatic cervical lymph nodes on the left, and metastatic BN. These cervical lymph nodes were markedly enlarged, round in shape, heterogenous hypoechoic, and without an echogenic hilus. Metastatic BN was round in shape, hypoechoic, with well-defined borders, and without an echogenic hilus.\nThe tumor was diagnosed as a cT4aN2bM0 squamous cell carcinoma of the lower gingiva. The patient received neoadjuvant chemotherapy, consisting of docetaxel 60–70 mg/m2 and cisplatin 70 mg/m2 on day 1, and 5-fluorouracil 700 mg/m2/day 96 h continuous infusion. Gross examination after two cycles of chemotherapy showed marked shrinkage of the primary tumor. A slight reduction in BN size was observed. According to the Response Evaluation Criteria in Solid Tumors (RECIST) guidelines, version 1.1 [], this patient showed a partial response to treatment.\nThree weeks after the end of neoadjuvant chemotherapy, the patient underwent surgery, consisting of suprahyoid neck dissection (levels I–II) on the right side, classical radical neck dissection (levels I–V) on the left side, segmental mandibulectomy, and oromandibular reconstruction with a scapular osteocutaneous flap. The primary tumor and buccinator space including BN were dissected in continuity with neck dissection. Histopathological examination of the segmental mandibulectomy specimens showed that the alveolar bone and part of the bone trabeculae of the mandible had been resorbed and replaced by fibrous connective tissue. This tissue contained a few nests of squamous cell carcinoma, composed mainly of necrotic tissue with a small number of viable cancer cells and remnants of keratin pearls. The surgical margins were free from tumor. Metastatic disease was detected in five cervical lymph nodes, including one left submandibular aggregated-node, three left upper jugular nodes, and one left middle jugular node. No metastatic nodes revealed extra-nodal extension. Metastasis to BN was also present (Fig. ). These metastatic regions contained few viable cancer cells and consisted primarily of necrotic tissue.\nFollowing surgery, the patient was treated with adjuvant radiotherapy (50 Gy/25 fractions) with concurrent oral chemotherapy (S-1, 100 mg/day for 5 days per week for 5 weeks) []. Two years later, there has been no evidence of tumor recurrence or metastasis. |
A 52-year-old man presented at the emergency room with complaints of retrosternal discomfort during swallowing for 7 days, and a history of tarry stool and hematemesis were found in the last 12 h. He gave a history of swallowing a bone by mistake. The patient felt dizzy and nauseous. There was no other digestive tract symptom or systemic symptom such as fever. He had a past history of alcoholism, but no history of chronic liver disease or peptic ulceration. His blood pressure was 105/70 mm Hg, pulse rate was 105 beats per minute and respiratory rate was 22 breaths per minute. He was administered 20 ml of 5% glucose and omeprazole 80 ml static push, 100 ml of 5% glucose and 40 mg omeprazole continuous infusion, 0.9% sodium chloride 500 ml plus 6 U insulin. No abnormality was detected on physical examination, except diaphoresis and mild pallor. Haematological investigations revealed mildly elevated white cell count 11.8 × 109/l, with neutrophilia of 10.34 × 109/l. His hemoglobin was 97 g/l. Standing chest and plain abdominal radiographs were normal. Computed tomography scan of the mediastinum showed indistinct esophagus middle, slightly higher density of the esophageal wall, the surrounding fat tissue had disappeared, part of the descending aorta showed aorto-esophageal fistula, and there was an esophageal foreign body. Emergency endoscopy revealed no upper esophageal FB. There was a fresh red thrombus at 26 cm, with no active bleeding. The foreign body was not visible. Foreign body was also not found during surgery with thoracoscopy. Then a second endoscopy examination was performed, and the blue cotton method was conducted after water washing, then a small piece of cotton was located at 26 cm, and a tiny part of a fish bone was found under the cotton (). The foreign body was extracted by the endoscope. The patient was discharged without any complications after 23 days. |
A 17-year-old female with no significant medical history presented to the emergency department after sustaining a gunshot injury to the left hip while exiting a vehicle. On initial examination, she was found to have 4/5 power in her left tibialis anterior (TA) and extensor hallucis longus (EHL) as well as decreased sensation to light touch in the L5 dermatomal distribution with an otherwise intact examination. A small entry wound on the left lateral flank at the level of the iliac crest was observed. CT of the lumbar spine revealed a comminuted fracture of the left iliac crest with a bullet lodged in the left L5 neural foramen associated with a comminuted fracture of the left S1 superior articular facet, suggestive of a trajectory through the iliac bone in a superior-medial direction (Figure ). Bony spinal elements appeared otherwise grossly intact around the foreign body (FB).\nGiven the patient’s new incomplete neurological deficit, attributable to active nerve root compression by the FB, the decision was made to take her to the operating room urgently for removal of the FB and decompression of the left L5 nerve root. The patient was positioned prone on a Jackson table and intraoperative fluoroscopy was used to localize the FB. A left L5 lateral laminotomy and L5-S1 facetectomy via a unilateral opening were performed, preserving the posterior tension band and contralateral muscle. The bullet was visualized wedged in the L5 neural foramen causing upward displacement of the left L5 nerve root (Figure ). The facetectomy was widened until the space was wide enough for the bullet to be dissected out of the foramen, taking precautions to avoid traction or trauma to the nerve root superiorly or the thecal sac medially. The dural sheath of the nerve root and the thecal sac were inspected and appeared intact without evidence of breach or cerebrospinal fluid (CSF) egress (Figure ). Intraoperative fluoroscopy confirmed complete removal of the major FB fragments (Figure ). The FB was removed in two large intact pieces; a copper full metal jacket was noted superficially and the bullet was found deeper (Figure ). After hemostasis was achieved, a Valsalva maneuver was performed without any evidence of CSF egress into the field. Post-operatively, the patient’s strength improved to 5 in TA and 4+ in EHL as well as improvement in L5 dermatomal sensation to near baseline. |
A 66-year-old male with a history of hypertension, diabetes mellitus, and hepatitis B (carrier) was admitted to the intensive care unit (ICU) with an acute ST-segment elevation myocardial infarction (STEMI). Immediate echocardiography revealed severe aortic valve stenosis, including a valve area of 1.2 cm2, moderate aortic and mitral regurgitation, and a left ventricular ejection fraction of 45%. Following this, a left heart cardiac catheterization was done, displaying a triple-vessel coronary artery disease with 80% occlusion of the mid-right coronary artery, 99% occlusion of the obtuse marginal artery, and diffuse disease of the left anterior descending artery (Figure ) that warranted four coronary artery bypass grafting (CABG) with a single implanted aortic valve replacement (AVR). Laboratory investigations were standard, except for the severe thrombocytopenia with a 24 × 109/L platelet count (normal count: 150-400 × 109/L). Peripheral blood film displayed normocytic and normochromic red blood cells with low platelet levels. The finding of this severely low platelet count prompted a trephine biopsy, which showed a cellular marrow with trilineage hematopoiesis and normoblastic erythropoiesis. A presumptive diagnosis of immune thrombocytopenic purpura (ITP) was made on the basis of these findings. The patient's condition deteriorated quickly, and the procedure was scheduled with little time to significantly stabilize the platelet count. Preoperative patient optimization was done in collaboration with a multidisciplinary team, which included a hematologist. The goal remained to aggressively try and raise the platelet count while simultaneously treating the underlying ITP to minimize the risk of morbidity and intraoperative complications (Table ). On this basis, the patient was given 1000 mg methylprednisolone daily for two days, including the surgery day, along with 50 mg oral azathioprine twice a day (BID). On the day of the surgery, blood sugar level was controlled with an insulin sliding scale, and the reported platelet count was 29 × 109/L on complete blood count (CBC). The patient was then transfused with 10 units of platelets, four units of packed red blood cells, and four units of fresh frozen plasma two hours prior to the surgery. Then, 1000 mg each of methylprednisolone, ceftriaxone, and vancomycin was administered prior to skin incision, followed by intraoperative infusion of one unit of whole blood and six units of platelets. Postoperatively, 1000 mg of tranexamic acid was administered. Chest tube drainage was done, followed by timely extubation in the cardiac intensive care unit (CICU). The postoperative findings on the first day were unremarkable on clinical examination, but peripheral blood examination showed persistent thrombocytopenia with a platelet count of 32 × 109/L, a white blood cell count of 9.5 × 109/L (normal count: 4-10 × 109/L), and hemoglobin of 14.2 g/dL (normal range: 13.7-16.3 g/dL). A consultation with the hematologist resulted in a decision to continue low-dose corticosteroids and a follow-up in two weeks. The total chest drain output was 350 mL in the CICU, and chest tubes were removed on the third postoperative day (POD). The postoperative course was uneventful, and the patient was discharged on the eighth POD. Peripheral blood examination on discharge still showed thrombocytopenia with a platelet count of 44 × 109/L, a white blood cell count of 8.3 × 109/L, and hemoglobin of 15.1 g/dL. |
A-79-year-old male complained of visual hallucination for last 1 year. The visual hallucinations included sentences written on the wall, bright coloured flowers in a garden, unfamiliar people moving around him, and the dead people waving at him. For the last few months, he was specifically seeing a Japanese lady waving at him. He described that the image changes with an eye blink. The visual hallucinations included static and moving objects. The images disappeared on closing eyes. Till 2 months back, visual hallucinations were infrequent and lasted for 1–2 min. However, for the last 3 months, the visual hallucinations occurred many times each day and lasted for 15–30 min. He was fully aware that these images were unreal. However, due to sleep deprivation and no respite despite resorting to sleeping pills and with the feeling that he was taken to a surreal world through his blindsight, he requested for medical help. There was no history of auditory or tactile hallucination, delusion, forgetfulness, and change in personality, behavioural problems or any involuntary movements. He had open-angle glaucoma for 25 years (operated 22 years back) that led to progressive bilateral vision loss for the last 5 years. He had hypertension for 2 years that was well controlled with 5 mg of amlodipine.\nOn examination, his visual acuity was the perception of hand movements at 1 m with either eye. He had intraocular pressure of 14 mmHg in the right eye and 16 mmHg in the left eye. His fundus examination revealed secondary optic atrophy. His higher mental functions were normal. He was aware of the fact that his visual hallucination was unreal. He did not have a mood disorder or any other psychiatric disease.\nHis blood counts, hepatic, renal and thyroid function tests, electroencephalography, and cranial MRI was normal. In view of complex visual hallucination with preceding visual impairment and normal neurological/psychiatric evaluation, he was diagnosed with Charles Bonnet syndrome (CBS). He was prescribed oral pregabalin 75 mg twice daily and clonazepam 0.5 mg at bedtime. His formed visual hallucination improved over the next 4 weeks. He was last seen 1 month back. He still sees coloured shapes. However, he can sleep normally. |
The patient is a 67-year-old man who presented with the complaint of a multiyear history of persistent severe neck pain with rotation. Incidentally, he had previously undergone an anterior cervical discectomy with fusion at C5-6 and C6-7.\nPlain radiographs demonstrated severe multilevel cervical degeneration. He had near-ankylosis of the C1 ring to the dens anteriorly in addition to severe articular facet degeneration. A computed tomography (CT) scan was obtained, which also demonstrated severe degenerative disease as well as an anomalous course of the left VA (). Magnetic resonance angiogram (MRA) was also reviewed to further characterize the course of the left VA (). At C2, he had a markedly enlarged left transverse foramen due to a larger left VA. The enlarged foramen extended medially into the path through which a C2 pedicle screw would be inserted. Both the diameter of the left VA and the distance from the left VA to midline were measured by a fellowship-trained neuroradiologist.\nHe had complete relief of his rotational pain with fluoroscopically guided C1-2 injections administered by an interventional radiologist. After failure to improve with exhaustive nonsurgical interventions and treatments, we discussed the potential risks and benefits and he elected to proceed with instrumented posterior spinal fusion (PSF) at C1-2.\nOur initial plan was to perform an instrumented PSF at C1-2 using the Harms technique with pedicle screws at C2 and lateral mass screws at C1. On review of the CT, we were concerned that placement of a left C2 screw was precluded by the enlarged transverse foramen. He had had an MRA 4 years prior. This study also demonstrated the course and size of the left VA.\nAfter induction of a total intravenous anesthetic technique, with the use of neurologic monitoring services intraoperatively, patient was placed in a Mayfield head holder and positioned prone on a Jackson table with his bony prominences padded. The posterior cervical spine was prepared and draped in a sterile fashion. A longitudinal midline approach was carried out, exposing out to the lateral mass of C1 and the facets of C2. The C1 roots were retracted inferiorly once hemostasis was obtained. The C1 roots were not sacrificed. A drill hole was made in the lateral mass of C1, and a 26-mm partially threaded screw was placed on each side without difficulty.\nThe C2 level on the right side had normal anatomy, and a 26-mm fully threaded C2 pedicle screw was placed uneventfully using Harms technique and position was acceptable, verified with anteroposterior (AP) and lateral fluoroscopic X-ray.\nOn the left side at C2, because of the course of the left VA in the enlarged transverse foramen, standard placement of a C2 pedicle screw was precluded (). Standard Harms positioning of a C2 pedicle screw would have placed the VA at a high risk for perforation with the potential for a posterior fossa infarct. Decision was made to proceed with a C2 laminar screw, as first described by Wright. The high-speed burr was used to open the dorsum of the lamina on the left-hand side. The gearshift probe was placed down, heading at an angle of approximately 45° to 50° from left to right, and a 30-mm screw was placed. Of note, there are male/female variations in screw length, and a more typical length would be 20 to 25 mm. Acceptable position was verified with AP and lateral fluoroscopic X-ray (). Rods of appropriate length were used to connect the screws. The C1-2 articular facet was then packed with morselized local bone graft. Irrigation was completed, and hemostasis was obtained, and the wound was closed primarily in layers. Postoperatively, the patient underwent standard treatment and pain management protocols and had a stable recovery as determined by the 6-month postoperative follow-up visit. Postoperative CT reading indicated anatomical position with no periprosthetic lucency or signs of hardware failure for the right C1-2 and left C1 pedicle screw as well as the left C2 laminar screw. There was no neurological change or injury. |
A 35-year-old male with a history of hyperlipidemia and seizure disorder presented to an outside hospital following a breakthrough seizure, where he was incidentally also found to have punctate areas of acute cerebral infarcts in multiple vascular territories. Additional workup revealed the presence of a left atrial thrombus and newly diagnosed atrial fibrillation. He was ultimately discharged to home on apixaban. The patient then re-presented a month later for evaluation of transient diplopia, expressive aphasia, daily right temporal headaches, and right facial and left leg weakness. MRI of the brain showed new areas of diffusion restriction in the left cerebellar hemisphere and left medial occipital lobe (Figure ). CTA showed no signs of carotid occlusion or stenosis. The etiology of his multifocal strokes was thought to be related to his newly diagnosed atrial fibrillation and left atrial thrombus.\nThe patient was then transferred to our hospital for further evaluation. His initial NIH stroke scale was 8 (primary deficits were including unilateral facial palsy, bilateral lower extremity pronator drift and ataxia). Stroke labs, including lipid panel and hemoglobin A1C, were unremarkable. MRI of the brain with contrast showed a new infarct in the splenium of the corpus callosum in addition to prominent generalized meningeal enhancement (Figure ). MRI of the spine with contrast showed possible meningeal enhancement as well as punctate areas of encephalomalacia in the C3-4, C7, and T3 spinal levels. A bedside LP revealed a mildly elevated opening pressure of 24 cm H20, lymphocytic pleocytosis (WBC 150 K/cumm, 61% lymphocytes), protein 170 mg/dl, hypoglycorrhachia of 15 mg/dl, and presence of cryptococcal antigen. Other notable CSF labs included the presence of 11 oligoclonal bands. He was diagnosed with cryptococcal meningoencephalitis and started on a four-week course of amphotericin B and flucytosine. A repeat LP after several days of treatment showed a normal opening pressure of 14 cm H20, mildly improved pleocytosis (WBC 130 K/cumm, 84% lymphocytes), protein 172 mg/dl, and glucose 14 mg/dl. He did not require any additional lumbar punctures, and his symptoms (including headaches and left lower extremity weakness) gradually improved. The patient was discharged to an inpatient rehabilitation facility prior to returning home.\nThough our patient in Case 1 had a history of an unknown autoimmune disease, our patient in Case 2 had no history of autoimmune disease or other existing immunodeficiency. Both patients developed multiple cerebral infarcts in multiple vascular territories in the setting of cryptococcal meningoencephalitis, though our patient in Case 2 also had recently diagnosed with atrial fibrillation which further confounds the underlying etiology of his strokes. |
A 32-year-old female with a history of hyperthyroidism status after radiation resulting in hypothyroidism and no history of seizures presented with an acute onset of behavioral changes and witnessed seizure activity. Family history is remarkable for thyroid disease in multiple relatives, but negative for seizure or psychiatric disorders. Behavioral changes included uncontrolled laughter, screaming, signs of agitation, spitting on the floor, complete lack of appetite, and speaking in a British accent. A further history revealed that the patient is of Caucasian descent, was born in Germany, moved to the United States when she was a baby, and has no ties to Britain.\nShe had two seizures both involving tongue biting and postictal confusion with combative behavior. Her workups for seizures, including but not limited to head CT, urine drug screen, and electrolyte levels, were all within normal limits. She, as well as her family, refused MRI and subsequently was discharged on levetiracetam for new onset seizures. On the fourth day of illness (DOI), the patient was admitted to a local community hospital with continued behavioral changes, where an MRI and lumbar puncture (LP) were found to be unremarkable, with a WBC count of 1 cell per mm3. Other CSF parameters include a RBC count of 10 cells per mm3, glucose of 53 mg per dL, and protein of 26 mg per dL. She was subsequently transferred to our hospital care on the fourteenth day of illness because of persisting and worsening behavioral changes. Upon revisiting the initially unremarkable impression of the MRI, abnormal T2 flair hyperintensity in the mesial temporal lobes was noted, with left lobe hyperintensity greater than that of the right lobe (). These features raised suspicion for limbic encephalitis.\nTiters for serum anti-NMDAR and paraneoplastic antibody panel were sent on clinical suspicion. Video EEG () showed frequent focal onset electrographic seizures from the left frontocentral and left frontotemporal region. Some of these electroclinical seizures showed delta brushes (). With strong clinical suspicion for an anti-NMDAR or paraneoplastic antibody related encephalitis, before even receiving antibody titer results, the patient was started on five-day IV steroids on the fourteenth DOI, and IVIG course started on the fifteenth DOI.\nAt this point, multiple differential diagnoses were being considered including autoimmune encephalitides. During hospital admission, the patient continued to remain afebrile. Repeat LP showed lymphocytic pleocytosis, with a quantitative value of 54 cells per mm3 with 98% lymphocytes, after which she was started on empiric acyclovir until HSV PCR was later confirmed to be negative. All other CSF findings were insignificant, with a normal protein level of 16.8 mg per dL, no RBCs, and an elevated glucose level of 95 mg per dL. She continued to have seizures requiring Lacosamide followed by an addition of Lamotrigine. On the fifth day of IVIG course and twentieth DOI, NMDAR antibody was found to be positive in the serum. CT of the chest, abdomen, and pelvis showed no evidence for neoplasms and a transvaginal ultrasound was negative for ovarian teratoma. CSF was positive for NMDAR antibody with a titer of 1:64. After completion of IV steroids and IVIG, there was no significant clinical improvement. She was started on rituximab on DOI 27 for a total of 4 weeks given weekly, with subsequent clinical improvement in addition to no clinical seizures on EEG and resolution of her new onset British accent.\nThe patient continued to have subclinical focal seizures, catatonia, and orofacial dyskinesias with subsequent gradual improvement in her behavior at discharge. When seen for follow-up as an outpatient, she still was found to have some residual memory and cognitive processing deficits. The patient continues to follow up in the hospital for rituximab infusions which is controlling her anti-NMDAR encephalitis and she has now returned back to baseline health. |
A 61-year-old male patient in good general health presented with an episode of significant lower GI bleeding. The patient had had a minor similar episode 4 months ago. One month ago, he had felt fatigue and repeated episodes of fever without any other specific symptoms.\nUpon primary admission to another hospital, the patient was tachycardic and slightly hypotensive but improved after massive hydration and was transferred to our center. An upper endoscopy revealed only a small Mallory-Weiss type ulcer, which seemed unlikely to have been the source of bleeding. An angio-CT-scan of the abdomen revealed extensive diverticulosis with signs of transverse colitis but without a precise source of bleeding. The patient was treated conservatively but, in the following days, he developed fever and an important inflammatory syndrome (CRP 253 mg/L, normal leucocyte count) with rhabdomyolysis, acute renal failure, and high levels of LDH (1451 U/L) and ferritin (1200 mg/L) along with anemia and progressive thrombocytopenia. Three days after his admission, he once again became hemodynamically unstable due to recurrent massive low GI bleeding. From the time of patient's entry to that point, he had received a total of 10 units of RBC. Emergency laparotomy with intraoperative colonoscopy and enteroscopy was performed. Findings were an important inflammatory status around the transverse colon, a small intestinal perforation at the distal ileum, and 10–20 ulcerated inflammatory lesions in the ileum, one of which was actively bleeding. A resection of 60 cm of ileum was carried out and the patient was admitted to the ICU for postoperative surveillance. Histopathology of the ileum revealed a high grade NK-T lymphoma Epstein Barr virus (EBV) positive.\nTwo days after surgery, the patient became septic. A thoracoabdominal CT-scan showed bilateral pleural effusions but no specific septic source. In the absence of radiological signs that would explain the patient's septic status, a “second look” laparotomy was performed but no source of sepsis was identified. Subsequently, the patient's condition deteriorated rapidly. He developed disseminated intravascular coagulation and finally a new episode of GI bleeding. Based on the above listed observations together with ferritin levels at 15000 mcg/L, HLH was suspected and a treatment with CHOP regimen (cyclophosphamide 750 mg/m2 day 1, doxorubicin 50 mg/m2/day 1, Oncovin 1.4 mg/m2/day 1, and prednisone 60 mg/m2/day 1 to 5) plus etoposide was initiated. No bone marrow biopsies were performed as death due to hemodynamic instability followed the next day. Autopsy revealed a NK-T extranasal EBV + lymphoma with intestinal localization. Bone marrow presented with massive hemophagocytosis without any evidence of tumor infiltration (see ). |
A 51-year-old healthy female underwent uneventful cataract surgery in her right eye. During the procedure, viscoelastic and vancomycin (1.0 mg/0.2 mL) were injected into the anterior chamber. Visual acuity on the first postoperative day was 20/20 and no other postoperative complication was detected.\nOn the seventh postoperative day the patient complained of acute painful visual deterioration. Visual acuity was 20/32 in her right eye with minimal anterior chamber and vitreous reaction, not suggestive of endophthalmitis. She was referred to our clinic 2 days later (post-op 9 days) for further investigation. Ophthalmic examination revealed best corrected visual acuity of 20/32 and 20/25 in the right and left eye respectively. Intraocular pressure was 15 mmHg in both eyes, pupil reaction was normal. Slit lamp examination of the right eye revealed 1+ cell in the anterior chamber and 1+ cell in the anterior vitreous. Fundus examination of the right eye was notable for mild vitritis, vascular attenuation, and peripheral artery occlusion, as well as scattered intraretinal and perivascular hemorrhages.\nFluorescein angiography revealed delayed retinal filling, peripheral vascular occlusion, extended areas of non-perfusion, and scattered areas of perivascular staining (Fig. ). Optical coherence tomography examination was unremarkable (Fig. ). A 6 × 6 zone was acquired using optical coherence tomography angiography demonstrating the junction between perfusion and non-perfusion areas showing the choroidal vasculature intact.\nDiagnosis of hemorrhagic occlusive retinal vasculitis was suspected based on the recent cataract surgery where intracameral vancomycin was used and characteristic clinical findings of the disease. As with previous reports of vancomycin-induced HORV, thorough systemic workup was unremarkable. Based on reports in the literature indicating the poor prognosis of the disease, the poor therapeutic effects of steroids and immunosuppressive treatment, we decided to proceed with early anti-VEGF treatment in an attempt to halt the progression of vision loss and reduce the risk of neovascular glaucoma. An intravitreal injection of bevacizumab (Avastin; Genetech, South San Francisco, CA) was administrated.\nThe following days the patient reported gradual pain relief and an improvement in her vision. Best corrected visual acuity was 20/25. Fundus examination showed no change, while fluorescein angiography showed reduced vascular staining. Οn the 25thpost-operative day best corrected visual acuity was 20/20.\nDespite visual acuity restoration, extended peripheral zones of non-perfusion were noted on fluorescein angiography. We discussed our concerns with the patient and we proposed continuation of anti-VEGF for at least 3 months to minimize the risk of neovascularization development. A total of three intravitreal injections were administrated in a 3-month period after surgery. We decided to proceed with photocoagulation treatment only in the occurrence of neovascularization.\nAt a 6-month follow-up examination best corrected visual acuity was 20/20 with no sign of neovascularization. Fundus examination and fluorescein angiography revealed no sign of disease activity. We decided to closely monitor the patient at regular intervals over the next 2 years in order to promptly, detect and treat a possible occurrence of neovascularization. The patient was provided a written informed consent in accordance with the tenets of the Declaration of Helsinki to having their medical data used for research purposes. Written informed consent was obtained from the patient for publication of this case report and any accompanying images. |
A 26-year old man presented to us 8 weeks after injury to his right elbow with a motorbike accident. The patient complained of pain in the right elbow immediately after accident though he was able to flex and extend the elbow. Thinking it to be a trivial injury he went to a bone setter for treatment, who applied wooden splints after oil massage to the elbow. After 4 weeks the patient was asked to start his normal elbow movements. However, the patient had pain in the elbow and presented to us after further 4 weeks with gross limitation of supination and pronation. There was no previous history of elbow injury or arthritis. On examination, there was minimal swelling over the elbow and tenderness over the radial head, which appeared displaced backwards. There was a flexion attitude of the right elbow. Although he had good flexion and extension of the elbow, forearm pronation and supination were grossly restricted and painful. (Fig.5 and 6). There was no evidence of posterior interosseus nerve palsy. Radiographs showed posterior dislocation of the radial head with no associated fractures of the radius, ulna or disruption of the distal radio-ulnar joint. (). Patient was operated under brachial block. Radial head excision was done. The elbow was tested for stability post surgery and was found to be stable. Immobilisation was done in flexion and supination and continued for three weeks with serial radiographs done at week 1 and 2 to make sure the superior radio-ulnar joint was in reduced position (). Elbow mobilisation was started after removal of the plaster, under supervision of the physiotherapist. The patient was followed up at 3 and 6 months. At 6 months he had no residual pain at the elbow and movements of elbow flexion / extension and supination / pronation were normal. (). There was no evidence of instability of the elbow. |
A 31-year-old male patient was bought to psychiatry OPD by family members with acute onset, complaints of disturbed sleep, appetite, muttering to self, and gesturing in the air from the past 3 days. He had a history of alcohol consumption from the past 4 years in an on and off pattern. His recent pattern of drinking was about 90–180 ml 3–4 times a week and his last drink was about 7 days before the admission and on the day of admission, he had no withdrawal symptoms. He had no significant family history of any major illness. He had a well-adjusted pre-morbid personality and his early developmental period along with childhood history was also unremarkable. He was admitted and all his routines blood workup was done which revealed an elevated serum glutamic oxaloacetic transaminase (174 U/l) and serum glutamic pyruvate transaminase (132 U/l) with normal bilirubin. Apart from this, all his blood parameters were within the normal limits. His ultrasonography revealed Grade I fatty liver. His non contrast computed tomography (NCCT) head was normal. On MSE, the patient had a kempt appearance with normal psychomotor activity and was fearful. He reported 2nd person auditory hallucinations which were derogatory in content. In a further interview, the patient gave a vivid explanation about seeing a flying statue of a deity that was wrapped in his mother's clothes and subsequently, he caught up that flying statue and he burnt it. He further described that the family deity is punishing him for his wrong deed. Although his family members denied any such incident, the only thing they corroborated was that he burnt his mother's clothes without any apparent reason. Because of psychotic symptoms and concurrent use of alcohol, a diagnosis of alcohol-induced psychosis with dependence syndrome was kept. At that time, he was started on olanzapine 5 mg which was up titrated to 20 mg, but he had no response to that medication even after 1 month.\nIn view of his nonresponse to olanzapine, his diagnosis and history were again reviewed. On further enquiry about the visual images, he explained that these images were intrusive in nature and he could get rid of this image by distracting himself by drawing the image of that deity. Also, he explained in detail that first he would get a thought about burning that deity, and then he would hear derogatory comments in form of a female voice stating “Why did you kill me.” He would never see these images while he was engaged in some work. During this interview, a jerky movement of one hand of the patient was observed. On further enquiry, he told that from past 3 years, he was gettingthisjerky movement in his hand, which he described as sudden and brief.\nThese jerky movements interfered with his work. He would get these jerks in his sleep, which would wake him up, but he never consulted any doctor. The description of these jerks was typical of myoclonus and an alternate diagnosis of focal seizure was considered. An EEG was done which came out to be normal, but on a clinical basis he was started on clobazam 5 mg which was up titrated to 10 mg. He reported overall improvement, particularly in his sleep. His olanzapine was stopped gradually and given his alcohol dependence that has a negative outcome on seizures divalproex sodium 500 mg was added as an anti-craving agent and up titrated to 1000 mg, after which he reported complete resolution of his symptoms. For co-morbid alcoholism, the patient was given psycho-education and four sessions of Motivational Enhancement Therapy. On follow-up after a month, he was symptom-free and abstinent from alcohol. |
A 20 years old female presented to us with history of difficulty in walking since childhood and pain in both hips for last two years. She had been suffering from these problems since childhood but had not taken any definitive treatment.\nOn examination patient was walking with waddling gait. All hip movements were painfully restricted and extension, adduction and rotational movements were not possible. 15° and 20° flexion deformities were present on right and left sides respectively. 20° and 10° Abduction deformities were present on right side and left side respectively. 3 centimeters shortening was present on left side.\nOn radiological examination X-ray pelvis with both hips AP view [] revealed proximally migrated dysplastic head of femur with dysplastic shallow empty acetabulum. Acetabular angles on both sides were 60 degree.\nOperative technique:\nPreoperative planning included templating to determine position of acetabulum and required length of osteotomy. The length of subtrochantric osteotomy was determined so that it would not lengthen the leg more than 3 cm to prevent sciatic nerve stretching. All necessary investigations were done and anesthetic clearance was taken. Patient was planned for Bilateral Uncemented THA in two stages. Patient was positioned in Lateral position. Hip joint was approached by a postero-lateral incision over posterior aspect of greater trochanter curved over buttock. Exposure in such cases are challenging because of distorted anatomy. Soft tissues are contracted with tight adhesions. It should be kept in mind, that femoral neuro-vascular bundle and sciatic nerve may not be present at usual anatomic positions.\nAfter splitting gluteus maximus, external rotators were cut to reach the hip joint. True acetabulum was identified by direct palpation and using C-ARM. Acetabulum was cleared of fibrous tissues and progressively large reamers were used to enlarge the shallow acetabulum. Using power reamer it was shaped spherical and a trial implant was used to determine the coverage of the cup. Ischial and pubic bone were exposed proximally along with tear drop to get a clear idea of available bone stock. Medial wall was sufficient to re-shape a proper Acetabulum. No structural Bone Grafting was required in Acetabular reconstruction. Appropriate diameter uncemented modular acetabular prosthesis was used. Acetabulum was stable and well seated per-op with coverage of more than 90% [].\nA sub trochanteric femoral osteotomy of five centimeters was done to facilitate the reduction. Osteotomized segment was vertically splitted and used to re-enforce osteotomy site as a cortical strut graft. It was stabilized with cables []. Excessive ante version of femoral neck was corrected by placing the prosthesis eccentrically in the medullary canal. To facilitate the reduction the proximal femur was pulled down by thorough soft tissue release []. Capsule and iliopsoas tendon were released and abductors were lengthened by pi crusting. The prosthetic joint than can be reduced without undue tension []. Left hip was reconstructed using similar technique after two weeks []. We used acetabular Cup (Stryker) 44mm (both side), Head (Smith Nephew) 28mm (metal, both side) and femoral Stem (Smith Nephew) Size ten on Right side and Size nine on left side. |
The patient, 78 year old female, was diagnosed for recurrence of oral mucosa carcinoma. The patient was diagnosed for squamous cell carcinoma of the left tongue seven years before when she underwent resection of the tumour with marginal mandibulectomy and unilateral modified neck dissection. The surgical margins were clear and the patient was followed up. Three years after the recurrence of the squamous cell carcinoma in the left mandibular gingiva and left remanent tongue was detected. The patient underwent left mandibulectomy with reconstruction with fibular flap. Three years later the recurrence of squamous cell carcinoma was detected in the union of fibular flap and buccal mucosa. The patient underwent resection of lesion in oral mucosa with safety margins in block with posterior maxillectomy. The intraoral defect was reconstructed with temporal flap. The patient presented no complications in the early postoperative period. On the sixth day of the postoperative period a fluctuating mass of 5 cm in the left parotid region appeared (Fig. ). The percutaneous puncture of the mass was performed obtaining 40 cl of yellow liquid. On the next day the recurrence of fluctuating mass was observed. The biochemical analisis of the liquid obtained on puncture showed the level of amylase of 180000 IU/l. The distal end of the Stensen’s duct was resected at the time of surgery thus the diagnosis of iatrogenic sialocele was made. The puncture of the mass was performed transorally with over- the- needle cannula, 40 cl of liquid was obtained and the facial swelling was resolved. The intraoral cannula was fixed with non- resorabable stitches. No recurrence of sialocele was observed after placement of cannula. The salivation was observed via cannula. The cannula was maintained during four weeks. After the retirement of cannula the intraoral salivary fistula formation was observed. The patient did not present the recurrence of sialocele during the three months follow up. |
A 5-year-old girl was referred for further cardiac evaluation, as she was found to have a systolic murmur on routine cardiac examination by her general pediatrician. Her family did not give any history of recurrent pneumonia or cyanosis, although she was underweight for her age. Her dysmorphism and the mild developmental delay were under evaluation by the concerned experts. She weighed 10 kg and was 90-cm tall. On cardiac examination, she had mild cardiomegaly and a machinery murmur.\nThere was mild cardiomegaly and increased pulmonary blood flow on chest radiograph with ECG not showing any major abnormalities. An echocardiogram showed hemodynamically significant PDA of size 3.5 mm and normal pulmonary artery pressures. As the child had otherwise normal intracardiac findings and was not very cooperative, we could not appreciate the exact course and drainage of the IVC. Because of these findings and the fact that we did not anticipate any major systemic venous anomalies, the child was electively posted for percutaneous transcatheter closure of PDA.\nAs per our unit’s policy, catheterization and the device closure were performed under intravenous sedation. The standard digital palpation was used to establish the right femoral vein (max 6Fr) and right femoral artery (max 5 Fr). A descending thoracic angiogram (DTA) using 5 Fr pigtail in lateral view showed a 3.5-mm PDA with L → R shunt with good aortic ampulla (Fig.a in the panel), decided to use 6/4 ADO I device through standard venous approach to close the defect. When we were unable to enter the right atrium (RA) using a 5 Fr multipurpose (MPA) catheter, we suspected IVC interruption. An IVC angiogram showed interrupted infrahepatic IVC with azygous continuation into the superior vena cava (SVC) (Fig. b in the panel). The option of internal jugular venous access was considered difficult due to short neck and we did not have any experience of transhepatic access then. We thought to proceed with the standard approach using soft hardware rather than arterial approach to avoid arterial trauma. Arteriovenous loop formation was our back up plan. A 5.0 Fr multipurpose (MPA) (COOKTM) catheter was used to enter the pulmonary artery. The pulmonary artery pressures were normal (30/12, mean 18 mmHg). The same catheter was used to cross PDA using straight tip guidewire (TERUMOTM) which was exchanged with extra stiff exchange length wire (AMPLATZERTM). This was followed by implantation of 6/4 ADO I (COCOONTM) through a 6 Fr delivery system manipulated with the utmost care, avoiding injury to the various chambers especially at azygous vein—SVC junction and pulmonary artery to PDA vessels on the way. As there was no residue on repeat DTA angiogram and echo did not show any flow acceleration in the pulmonary artery (LPA) and DTA, device was released. Post device release echo did not show any flow acceleration in the pulmonary artery (LPA) and DTA (Fig. c–f in the panel). The procedure was uneventful. Hemostasis was achieved with digital compression and was monitored in the ICU for 12 h with subsequent uneventful stay. |
A 50-year-old male patient with aortic dissection originating just above the aortic valve and extending down to the common iliac arteries (Stanford A, Figure ) underwent immediate surgery with repair of the ascending aorta in moderate hypothermia under cardiopulmonary bypass. The arterial line was inserted in the right axillary artery, the vent was placed in the right upper pulmonary vein, and two-stage venous line was inserted through the right auricula. The intact aortic valve was resuspended. Extracorporeal circulation was suspended after induction of moderate hypothermia (25°C) and the aortic cross-clamp from the ascending aorta was removed. The false lumen was then glued and an open distal anastomosis to a prosthetic graft was constructed. Then, extracorporeal circulation was resumed, systemic circulation was deaired and the patient was warmed.\nEarly on the first postoperative day, CT of the aorta was requested because of marked elevation of lactate-dehydrogenase (129 μkat/l) and signs of acute renal insufficiency (creatinine 292 μmol/l). CT showed good postoperative result in the ascending aorta, but large amount of air in the branches of the superior mesenteric artery up to the arcades was found (Figure ). There was absolutely no air in the portal-venous system including the liver. The bowel loops were not distended, and there were no signs of bowel paralysis.\nAt midnight on the first postoperative day, a biphasic CT scan of the abdomen was requested due to elevated intra-abdominal pressure (18 mmHg). The CT showed distribution of the intra-arterial gas more into the periphery and into the wall of the bowel loops that still did not display signs of ileus (Figure ). The next morning, surgical exploration was performed due to increasing intra-abdominal pressure as a sign of imminent abdominal compartment syndrome. An extensive bowel resection from oral ileum down to the splenic flexure had to be performed due to extensive necrosis of the bowel. Shortly after the operation, the patient became hypotensive with signs of overwhelming vasoparalysis and died on the third postoperative day of multiple organ dysfunction syndrome (MODS) with systemic inflammatory response syndrome (SIRS). |
A 66-year-old woman presented at a hospital with chest pain. Her history included diabetes, hypertension, and hyperlipidemia. On examination, the patient had a pulse of 100 beats/minute and blood pressure of 150/80 mmHg. Her electrocardiogram, echocardiogram, and blood test results were normal. Multislice computed tomography (CT) showed a saccular LMCA aneurysm and significant stenosis in the LAD artery (Fig. ). Coronary angiography revealed a saccular LMCA aneurysm measuring 9.8 × 7.5 mm with 75% stenosis in the proximal portion of the LAD artery. The operation was performed under general anesthesia. A median sternotomy was performed, and after a longitudinal pericardial opening was made, the heart was inspected. The LITA was removed from the inner chest wall in a skeletonized fashion using electric cautery. A distal segment of 1.5–2 cm was procured and reserved for use as a patch repair. Before aortic cannulation, the ascending aorta was dissected from the pulmonary artery. Under cardiopulmonary bypass, coronary artery bypasses of the left internal thoracic artery to the LAD artery were constructed in the beating heart. After aortic cross-clamping, the LMCA saccular aneurysm was exposed without main pulmonary artery transection. The saccular LMCA aneurysm was carefully dissected and completely excised. There was no thrombus in the lumen. Then, the LITA was longitudinally divided and trimmed to fit the incised LMCA. The small internal thoracic artery patch was sutured to the normal and firm lateral coronary arterial wall with a continuous 7–0 Polypropylene suture. Resection of the saccular aneurysm and closure using a small internal thoracic artery patch was then complete. The aortic cross-clamp time was 120 min, and the CPB time was 147 min. The patient had an uneventful hospitalization and was discharged on aspirin therapy. Follow-up multislice CT 10 days after the operation revealed the complete disappearance of the aneurysm and a successful repair with no luminal stenosis by the internal thoracic artery patch. The LITA graft was also found to be patent (Fig. ). The patient has been followed up yearly since 2009. Fortunately, at the 9-year follow-up, the patient was still asymptomatic, and there were no changes in the ECG and UCG. The patient included in the follow-up had preserved preoperative left ventricular function, and there was no coronary incompetence. Pathology of the aneurysm revealed that the aneurysm wall was very thin due to a lack of trilaminar arterial structure from the remarkable atherosclerotic changes (Fig. ). |
A 62 years old male presented with recurrent SCC of the left nasal bulbar conjunctiva. The patient's previous medical history detailed multiple interventions at this site. Initially, the diagnosis of a left nasal pterygium (a wing-shaped growth that starts on the conjunctiva and can spread across the limbus to the cornea affecting visual function) was made 3 years prior to the reported presentation, and was surgically removed with local excision. The lesion recurred 1-year post-surgery, and was subsequently managed surgically with a wide local excision. At this time, pathology revealed positive margins for SCC. A further recurrence 6 months later was treated with Plaque Therapy to a dose of 50 Gy in 5 fractions. Subsequently, the lesion was re-excised with adjuvant cryotherapy 7 months later.\nOn presentation 3 months post-cryotherapy, a recurrent lesion (10 × 5 × 2 mm) was detected on the nasal bulbar conjunctiva (Fig. ). The patient declined enucleation following this SCC recurrence. Subsequently, multidisciplinary consultation offered SXRT as an alternative treatment option (Fig. ).\nThe patient also presented with a history of Crohns Colitis (treated with immunotherapy) and a previous excision of a non-melanoma skin cancer from the right temple, and a subsequent skin graft of the area. The patient was on no other medications and had no allergies.\nThe patient was prescribed a dose of 48.4 Gy in 22 fractions, to a depth of 3 mm. This resulted in a skin surface dose of 54.4 Gy. A 2.0 cm diameter direct applicator was used with a 3 mm margin on the treatment region (Fig. ). To allow for an acceptable treatment margin that encompases the target volume and accounts for set up variability, the left inner canthus and tear duct were included in the treatment field. A single en-face beam of 2.0 mm Aluminium energy (2 mm Al) was used to meet the previously articulated dose prescription. The risk of ulceration, scleral perforation, ischemia and nasolacrimal duct obstruction was explained to the patient. This risk was further exacerbated in this case due to re-irradiation of the previously treated area, and a particularly sensitive region post-cryotherapy, surgery and plaque therapy. Topical anaesthesia (Tetracaine eyedrops) was administered to the left eye prior to retractor positioning, to ensure eyelids remained open throughout SXRT delivery. After positioning of the retractors the patient was instructed to maintain gaze on a target positioned to the left side of the room, and the eye was monitored throughout treatment delivery by video surveillance. Lubricating eye drops were prescribed for use prior to treatment administration to prevent drying of the ocular surface, and for the patients self-use between fractions to relieve dry eye symptoms. Total set up and treatment time for this patient was approximately 20 min, with the retractors in place on average less than 10 min. The anaesthetic drops and ocular surface lubricants induced limited sensation and the patient found it mildly uncomfortable. As a precaution, the patient was informed to avoid contact with the anaesthetised eye and wear a protective patch for 60 min post-treatment delivery daily. |
A 42-year-old man of Greek origin presented with an episode of left intermittent lumbar pain. Abdominal examination did not reveal any tenderness and laboratory data were not remarkable.\nUltrasound sonography revealed a 5 cm, solid, well-defined mass with mixed echogenicity in the left paraspinal region, with no further pathology. A 5 cm, well-defined mass in the left paraspinal region at the L5 level was also showed in CT (Figure ) and MRI (Figure ) demonstrating homogeneous low signal intensity on the T1-weighted and a high signal on the T2-weighted abdominal MRI images. There was contrast enhancement, contrary to left psoas muscle that didn't have any scintigraphic uptake. The lesion was in association with the L4-L5 interspinal space and seemed to derive from the spinal root. Lumbar spine MRI (Figure ) showed an encapsulated ovoidal retroperitoneal lesion in the L4-L5 level along the posterior side of left psoas muscle with great scintigraphic uptake. The tumor demonstrated a cystic degeneration with surrounding collagenous fibrous tissue and was in close relation to L5 spinal root. A CT guided FNA was performed in order to establish a preoperative diagnosis of the tumor. The cytologic examination revealed typical features of benign schwannoma (Figure ).\nThe patient was operated with extra peritoneal approach, through a left paramedian incision. The mass seemed to originate from the nerve root of the L4-L5 lumbar spinal space and the excision was complete. On the third postoperative day, the patient complained for strong postural headache that worsened when sitting up and improved after lying down. This was attributed to a leak of the cerebrospinal fluid (CSF) in the spinal membrane, probably caused by minor laceration of the CS canal. The patient's condition was improved with bed rest, paracetamol and hydration. He was discharged on the fifth postoperative day, with no headache, but with a sensory deficit at the site of the left lateral femoral region. The deficit was attributed to left L5 spinal nerve's branch excision, probably occurred during the removal of the mass.\nHistology showed a well circumscribed spindle-cell tumor with hemorrhage and necrosis, cellular atypia but no mitotic figures, myxoid degeneration, and vessels with hyalinized walls, while S100 immunohistochemistry was strongly positive (Figure ). Proliferative index Ki-67 was positive, but low. Final diagnosis was ancient schwannoma. |
In March of 2007, a 73-year-old Chinese woman presented to our ER department due to would discharge and right leg swelling after having received revision of right hip replacement because of recurrent dislocation.\nShe was admitted to ward under the impression of wound infection and deep vein thrombosis evidenced by serum D-Dimer level of 32.76 mg/L. Her vital signs were stable at the time of admission and the pertinent coagulation data were unremarkable and therefore 30 mg of subcutaneous enoxaparin was given every 12 hours for thromboprophylaxis.\nSudden onset of left flank pain and cold sweating occurred on the fourth day of admission. Bed-side sonography revealed heterogeneous echogenic fluid collection at the left retroperitoneum. Her blood pressure dropped to 53/33 mmHg with pulse rate of 102 per minute. The administration of enoxaparin was discontinued immediately and the patient was transferred to intensive care unit where she received 4 units of FFP and 12 units and PRBC. After fluid resuscitation, her hemodynamic status remained unstable with pulse rate of 121 per minute and blood pressure 79/56. An emergent CT was performed that showed a large hematoma at the left retroperitoneum (Figure. ). Emergent angiography was performed which included abdominal aortogram and arteriogram of lumbar arteries at variable levels. The study revealed contrast medium extravasation from left lumbar arteries and branches of left internal iliac artery (Figure. ). Transcatheter arterial embolization of the lumbar artery and internal iliac artery attempted with deployment of absorbable gelatin sterile sponge. Cessation of bleeding was confirmed on the post embolization angiogram and patient became hemodynamically stable. Two days later, repeat angiography was executed due to unaccountable drop of hemoglobin level and contrast extravasation from a different lumbar artery away from the initial episode was confirmed and embolized again by the same mean. The rest of the hospital course was uneventful and she was discharged three weeks later. |
A previously healthy, obese, 48-year-old female presented with a 1-year history of clear fluid draining from the nose and associated dull headaches. The patient had no other signs of increased intracranial pressure (ICP) such as vision changes or papilledema on history and physical exam. Beta-2 transferrin testing of the fluid was positive, indicating a CSF leak. Computed tomography (CT) scan of the sinuses showed near-complete opacification of the sphenoid sinus with an air fluid level, small amount of fluid in the posterior nasal cavity, and a small focal bony dehiscence of the optic canal in the superior sphenoid sinus with adjacent pneumocephalus (). Coronal T2-weighted magnetic resonance imaging (MRI) also showed the site of leak at the optic canal in the right sphenoid and did not show encephalocele or meningoencephalocele (). She underwent endoscopic repair of the CSF leak via a unilateral transsphenoidal approach.\nA lumbar drain was placed to start the case for use post-operatively and to allow for the use of intrathecal fluorescein in case the defect could not be visualized intraoperatively. However, fluorescein was not needed due to endoscopic confirmation of the site of the leak as the optic canal in the sphenoid roof ( and ). Surrounding mucosa was removed and bone edges were prepared carefully with a diamond drill. Preparation of the bone was performed in a delicate manner with blunt-tipped instruments given the sensitive position of the defect adjacent to the optic nerve. Repair was performed in a multilayer fashion with a small piece of abdominal fat, mucoperiosteal free graft from the middle turbinate, and packing with bovine microfibrillar collagen, compressed gel foam, and merocel sponge packing. Patient was noted to have normal vision immediately after surgery. Lumbar drain was removed on post-operative day #2 without complications. Her post-course was uneventful. She returned to work 6 weeks after surgery. She remains free of CSF rhinorrhea 24 months after surgery and continues to have normal vision. No post-operative imagine was performed due to our ability to monitor the right sphenoid cavity endoscopically, which continues to show no evidence of recurrent CSF leak. |
A 25-year-old male sustained a left diaphyseal femoral shaft fracture (Winquist 4, OTA classification 32-C3) [] in a roll-over motor vehicle accident (). He underwent stabilization of his femur fracture on post-injury day 1 with a statically locked 13 mm x 400 mm retrograde intramedullary nail. Radiographs 2 months later demonstrated acceptable alignment with limited callus formation at the fracture site.\nFive months follow-up radiographs demonstrated hardware loosening and backing out of the distal interlocking screws along with halo lucency in the distal femoral metaphysis adjacent to the intramedullary nail (). There was minimal bridging callus at the fracture site, and the patient reported thigh pain localized to the surgical site. There was concern for development of an atrophic non-union at the fracture site. Erythrocyte sedimentation rate and C-reactive protein were elevated. The patient underwent reamed exchange retrograde femoral nailing of his non-union fracture along with open debridement of the fracture site and placement of a large-size rhBMP-2 sponge with cancellous bone allograft. Intraoperative tissue cultures obtained during the non-union repair procedure failed to grow any organisms. On post-operative day 1 the patient complained of increasing pressure and pain in the left thigh. He returned to the operating room urgently for hematoma evacuation and the skin overlying the operative area was noted to be edematous and thickened. The use of the rhBMP-2 was questioned as a possible cause. His symptoms were significantly reduced postoperatively, and he was discharged to home, however, he presented emergently 5 days later with increased thigh pain and pressure. Repeat operative debridement of all non-viable tissue (primarily vastus lateralis muscle) and extensive lateral thigh fasciotomy were performed due to elevated intraoperative compartmental pressure measurements (anterior thigh systolic compartment pressures of 95 mmHg, diastolic pressures were 70 mmHg on average). The large rhBMP-2 sponge was removed. Vastus lateralis muscle biopsy specimens were obtained revealing ischemic changes with granulation tissue. Skin closure was not performed, and a negative pressure wound V.A.C. (KCI Inc.; San Antonio, TZ) dressing was applied to the fasciotomy site. There was no evidence of acute post-operative infection, and all intraoperative cultures were negative. The patient ultimately required a split thickness skin graft at the fasciotomy site for definitive soft tissue coverage. He was placed on a 6 weeks course indomethacin (25 mg by mouth 3 times daily) for prophylaxis against heterotopic ossification.\nSeven months after the non-union repair procedure, radiographs revealed persistent fracture non-union with exuberant ectopic bone in the thigh musculature (). At that time, his exam was significant for minimal pain without obvious deformity. Despite multiple attempts to contact him the patient has been lost to follow-up. |
A 14-year-old Afghan boy was admitted to our hospital, presenting with right shoulder and left thigh pain with prior history of moderate trauma. The pain had gradual onset, increasing over the last 8 weeks.\nPhysical examination during this visit revealed a febrile patient with oral temperature of 38°C and other vital signs normal. Range of motion of the left ankle was normal but was reduced in the right shoulder. Left ankle, left fibula, and right humerus were tender, and swelling existed in lateral side of the left ankle.\nSerological tests showed mild leukocytosis (white blood cell, WBC = 12,000 cells/mL) accompanied with mild polymorphonuclear predominance (70%), elevated alkaline phosphatase (350 IU/L), increased erythrocyte sedimentation rate (119 mm/h), and negative CRP. Results of serum biochemical profile including liver and renal function tests were within normal values.\nX-ray imaging identified mixed density, periosteal reaction, and cortical disruption with soft tissue swelling in metaphysis of right humerus and left fibula that primarily represented bone malignancy and osteomyelitis (Figs. , ). Computed tomography scan of right humerus and left fibula detected two lesions involving medulla and cortex in head of humerus and body of fibula. In addition, periosteal reaction with soft tissue component and bone marrow infiltration was identified at both sites. On magnetic resonance imaging (MRI), signal abnormalities were found in medulla, metaphysis, and diaphysis of the left fibula, associated with cortical irregularity and diffuse hypersignal areas of soft tissue (Fig. ). Tibia and knee were normal. Staging of the patient was completed with a whole-body bone scan on which only involvement of right humerus and left fibula was reported. There was no significant inflammation in other parts of the body. Consideration of the radiological and clinical manifestations was useful in development of appropriate differential diagnoses such as metastasis originated from carcinoma (renal cell carcinoma, neuroblastoma), Langerhans cell histiocytosis, and osteomyelitis.\nTo rule out differential diagnoses, bone biopsy of proximal humerus was done. Grossly, the specimen was soft and yellowish. Microscopically, diffuse inflammatory infiltration containing neutrophils and lymph-plasma cells admixed with foamy macrophages was reported, consistent with xanthogranulomatous osteomyelitis (Fig. ). Furthermore, a deep fluid sample was analyzed for microbiologic survey. According to histopathology, the patient was started on empiric cloxacillin. Afterwards, cultures exhibited growth of Staphylococcus aureus sensitive to cloxacillin. During hospitalization, the patient’s general condition improved. Erythrocyte sedimentation rate measurement was decreased to 35 mm/h, the pain resolved, and he was able to walk. There was no discharge from the site of biopsy, and shoulder range of motion improved. Unfortunately, he left hospital abruptly without surgical debridement or completing the duration of treatment. There was no relapse of pain or discharge at his follow-up appointment within 4 months in an outpatient clinical setting. The patient was informed that data concerning the case would be submitted for publication, and he consented prior to being included in the study. |
A 14-year-old female patient was presented for orthodontic evaluation; her chief complaint was the absence of both lower canines. During the clinical assessment, it was noted that the deciduous lower canines were still present and a class I malocclusion with crowding, deep bite, and a straight profile was diagnosed (). Dental casts, intraoral and extraoral photographs, and panoramic and lateral cephalogram X-rays were taken. On the panoramic X-ray, it was determined that both mandibular canines were impacted and the left one was in a Mupparapu type 2 transmigration position. Another critical issue was that the crown of the right canine was above the contralateral one. In the lateral cephalogram X-ray, it is possible to see that both canines were towards the vestibular side; however, the right one was closer to the incisors' roots (). According to the Ricketts cephalometric analysis (), it was diagnosed that the lower incisors were retroclined, possibly because of the absence of the canines.\nThe objectives of the treatment were (a) to open the space for the impacted and transmigrated canines, (b) to traction both canines to a functional position within the dental arch, (c) to improve the buccolingual inclination of the lower incisors, and (d) to correct the deep bite.\nAfter the analysis of the studies, the patient was presented with the following treatment options: (a) surgical exposure of the canines and orthodontic traction and (b) surgical removal and an orthodontic opening of the spaces for future restoration. The orthodontist explained to the patient's parents that the first option presented a risk of damaging the incisors roots, so the biomechanical design had to consider that. Also, the time of treatment could be longer than when choosing the second option. On the other hand, given her young age, the second option also had a disadvantage in that the patient would wear the restorations for a long time. Moreover, the increment in cost that the restorations would represent should be considered. In light of this information, the patient chose the first option of treatment.\nFull fixed 0.018-inch metal Roth brackets were placed and bonded in both arches. The leveling and aligning phase was carried out in both arches using the next sequence of nickel-titanium wires: 0.012, 0.014, and 0.016. This phase lasted six months. Once the patient reached the 0.016 stainless steel (SS) wires, the canines were surgically exposed and two golden chains were cemented for traction. At the same time, to open the space for the canines, a couple of open coil springs were placed and the golden chain was ligated to the distal end of each one to initiate the traction with an up-and-distal vector ().\nPosteriorly, three wires were used, a 0.016 SS wire, which played an anchorage role, and two 0.014 nickel-titanium accessorial wires (one per side) to apply the traction force on the impacted teeth. As can be seen in , the accessorial wires were tied around the SS wire and their mesial ends were introduced through the link closest to their respective chains (left and right). To prevent the mesial end of each accessorial wire from coming out, they were covered with a composite; meanwhile, their distal ends were bent to hold a power chain that would be tied to their respective first molar tube. With this system, the canines kept receiving a force with an up-and-distal vector. Given the caliber and the alloy of the accessorial wires, the forces were small and the moments were reduced. This scheme translated into having better control of the traction movement.\nAfter seven months, the right canine made erupted and a bracket was fixed on it to be included in the arch. In addition, a new accessorial wire was made to move the crown of the left canine away from the incisors' roots (0.018 nickel-titanium); this wire was tied at the right side (quadrant 4), and it would apply a force towards the vestibule. At the same time, the accessorial wire of quadrant 3 was changed to a 0.016 SS wire, and its mesial end was passed through the first link of the golden chain exposed in the mouth; to keep it from coming out, it was also covered with a composite. The distal end was bent to tie up a power chain that would exert a force with a distal vector (). The new wire of quadrant 4 was tied up near the distal end of the sectional wire of quadrant 3; this way, the first would have the freedom to slide through the latter while tractioning the transmigrated canine towards the vestibular end.\nFinally, after the eruption of the left canine, a bracket was fixed on it so it could be included in the dental arch. The next steps were to level the arch again, close the remaining spaces, and do the final detailing. After three years of treatment, the brackets were removed and a fixed retainer was placed in the lower arch while a Hawley retainer was given for the upper section with the indication of full-time use. shows the case's final photographs. |
The blind and painful right eye of a 38-year-old man was eviscerated in September 2016. The patient stated that his right eye had been blind since early childhood due to a unilateral congenital anomaly complicated by secondary glaucoma. He received the diagnosis of SO in January 2017 after he experienced visual loss in his only seeing (left) eye. At the time of diagnosis, the patient was admitted to the hospital and meticulously investigated for possible infectious and noninfectious causes to rule out other uveitic entities, but without any positive findings. At that time, his best-corrected visual acuity was 6/10. Slit-lamp examination yielded some vitreous cells in the left eye. Fundoscopy showed a few scattered pigmented chorioretinal scars and discrete yellowish round choroidal lesions throughout the left fundus (). Fluorescein angiogram delineated the active lesions as early hypofluorescent () with late staining. Left macular contour was normal on optical coherence tomography (OCT) examination (). He was started on oral prednisolone (64 mg) for 2 weeks with gradual tapering of 8 mg per week. Despite initial visual improvement, he experienced another episode of visual decline while taking 32 mg of prednisolone. His best-corrected visual acuity decreased to 2/10 and he had grade 4 vitreous haze according to the Miami grading. Fundus examination showed marked yellowish-white discoloration of the macula with some evidence of intraretinal hemorrhage ( and ). He was hospitalized and treated with pulse methylprednisolone 1 g (250 mg 4 times daily) for 3 days. Following pulse therapy, 64 mg oral prednisolone and 150 mg (50 mg 3 times daily) azathioprine were co-administered. Two weeks after the completion of pulse therapy, his visual acuity was still 2/10 despite a significant reduction in vitreous haze. Fluorescein angiogram and OCT demonstrated type 2 choroidal neovascularization (). Five intravitreal 2 mg aflibercept injections were given within a period of 8 months. His final visual acuity was 6/10 with a stable-looking macula ( and ) and he was continued on a treatment regimen of 150 mg azathioprine and 8 mg prednisolone daily. |
A 67-year-old female, with a typical presentation of carpal tunnel syndrome in the right hand, presented initially with numbness in digit IV and V a year later. A few months later, she developed numbness in all five fingers on the left side. Furthermore, the patient mentioned that she had had a burning sensation in both feet for a few years. Another few months later she complained of weakness in all four limbs and was sent for a neurological consultation with electromyography. Clinical examination revealed a Hoffmann-Trömner reflex on the left side, mild loss of strength in both hands, loss of vibratory sense and hypoesthesia in the distal end of all four limbs and loss of proprioception in both legs. The electromyography showed disturbed sensorimotor signals in the left hand and mildly disturbed sensorimotor signals in the right hand. The disturbed electromyography was attributed to carpal tunnel syndrome, which was presumably less severe on the right side due to treatment with long acting corticosteroid injections. The paresthesia in digit IV, digit V and both feet, however, could not be explained with the diagnosis of carpal tunnel syndrome. Therefore, magnetic resonance imaging (MRI) of the cervical spine was performed. Imaging showed an extra-dural soft tissue mass posterior to the odontoid process of the axis. The mass extruded through the transverse ligament of the atlas with severe compression of the myelum and myelomalacia at the level of C1 (Figures , and ).\nA plain radiograph of the cervical spine was performed to check for atlanto-axial instability. The radiograph during flexion shows a slightly widened atlantodental interval, measuring 4 mm (normal value: <3 mm) (Figure and ).\nPre-operative imaging of the cervical spine also revealed an anatomical variant of the craniocervical junction, atlanto-occipital assimilation of the massa lateralis bilaterally (Figure ).\nThe patient was treated with laminectomy of C1 to decompress the spinal canal followed by posterior fixation of C1-C2 for stability. |
A 10 year-old girl presented with the complaint of palpitation to a cardiologist. She had normal physical examination and laboratory tests, except tachycardia (heart rate = 130 per minute) and low TSH levels (0.005) with normal T3 (9.46) and T4 (145). She was referred to endocrinologist for possible hyperthyroidism evaluation. The thyroid gland was normal size, with no nodularity. She was diagnosed with possible thyrotoxicosis, but due to the normal physical examination, she underwent thyroid scan to rule out possible thyroiditis, which did not show any uptake in the thyroid gland, while there was an increased uptake in the right ovary (). Pelvic trans-abdominal sonography showed a heterogeneous complex solid mass of 113 × 112 × 100 mm with volume of 670 cc in the right ovary with no ascites. The patient had no complaint of abdominal pain or pelvic pain or abnormal uterine bleeding.\nShe was treated with methimazole 10 mg daily and propranolol 40 mg daily and were candidate for surgery after being euthyroid. The patient was referred to a gynecologist with the possible diagnosis of struma ovarii for further evaluation. She underwent right oophorectomy with the presumption of teratoma combined with thyroid-stimulating hormone (TSH)-suppressive therapy following treatment with I131. Total thyroidectomy was performed to permit evaluation for metastatic disease and monitoring for recurrence by thyroglobulin levels. The pathology report of the ovary mass indicated teratocarcinoma with 60% well-differentiated follicular thyroid carcinoma and 40% well differentiated follicular-variant with tumor necrosis, microscopic capsular invasion and peritumoral lymphovascular invasion, considering stage IC of PTC () and the thyroid gland did not show pathologic features of PTC.\nFurther evaluation with whole body scan with Iodine 123 (I123) showed metastasis to lymph nodes. She had high levels of thyroglobulin and received iodine therapy (150 mCi) twice. In the follow-up whole body scan, there was no trace of iodine uptake and the patient was symptom free.\nThe patient is now under treatment with levothyroxine 0.1 mg daily. Following 8 months after surgery and iodine therapy, she is totally symptom free. |
A 65-year-old man had undergone invasive aponeurectomy for DupuytreiYs disease in the right 5th finger 3 years before. Although recurrence was observed about 1 year after the initial surgery, the patient was observed as there was no activity of daily life disturbance. However, a skin ulcer () was noted at the scar of the recurrence site, and the patient re-visited our hospital. On the revisit, the angle of extension of the right 5th finger was -90 at the proximal interphalangeal (PIP) joint and -45 at the metacarpophalangeal (MP) joint, and the Tubiana stage was IV. Surgery was selected to treat the skin ulcer in the scarred area.\nSurgery was performed with a tourniquet applied to the brachium (250 mmHg) under brachial plexus block. Dermofasciectomy was performed including the diseased skin and scar tissue showing ulcer formation. The restriction of extension after surgery was -45 at the PIP joint and 0 at the MP joint. A skin defect was noted between the PIP and MP joints on the palmar side of the 5th finger, and the flexor tendon and neurovascular bundle were exposed (). A flap, which was fusiform in the longitudinal direction and had a width of 20 mm, covering the area from the ulnar side of the MP joint to the ulnar side of the hypothenar region was designed () and elevated, including the fascia of the abductor muscle of the 5th finger (). A penetrating branch of the palmar artery of the 5th finger was identified, and, using it as a vascular pedicle, the flap was rotated over 180 as an island flap and applied to the skin defect ().\nWhile the flap was congested early after surgery, it survived. Presently, 6 months after surgery, the restriction of extension is - 45 at the PIP joint and 0 at the MP joint, and no recurrence has been noted (-). The 5th finger flexes adequately, and the patient can hold objects. |
A 28-year-old woman presented to the Department of Otolaryngology, Juntendo University Hospital, with frequent epistaxis and nasal obstruction. Ten years ago, she had received surgical treatment in another hospital, the details of which were unknown to us. Anterior rhinoscopy revealed a reddish mass that filled both nasal cavities. Computed tomography (CT) showed a soft tissue mass that filled the bilateral nasal cavities and maxillary sinuses without bony destruction (Figures and ). Computed tomography angiography showed that the main feeder of right-side tumor was right greater palatine artery () and that of left-side tumor was left infraorbital artery (). Magnetic resonance imaging showed the mass as having heterogeneous signal intensity and arising from the bilateral maxillary sinus and extending into the nasal cavity on T1- and T2-weighted images (). These findings were indicative of a VM. To avoid severe hemorrhage during operation, the right greater palatine artery and left orbital artery were selectively embolized using metallic coils before the operation. Endoscopic sinus surgery (ESS) was then performed under general anesthesia. Because the tumor fully occupies the maxillary sinus on both sides, EMMM was performed on both sides. A mucosal incision was made from the anterior part of the lateral nasal wall. The mucosa was elevated from the lateral nasal wall. The lateral nasal wall was removed, and the nasolacrimal ducts were exposed with a diamond burr. The inferior turbinates and nasolacrimal ducts were completely preserved. The inferior turbinates and nasolacrimal ducts were displaced medially. Enlarged resection of the lateral wall allowed complete removal of the tumors in both maxillary sinuses. These tumors contained partially necrotic tissue due to preoperative embolization. The operating time was 113 min, and the intraoperative blood loss was 80 mL. Permanent histopathologic examination of the tumor showed large blood-filled spaces lined with flattened endothelium, and the tumor was found to be a VM, so-called cavernous hemangioma (). The postoperative course was uneventful. The endoscopic view revealed preservation of both the inferior turbinates (). Postoperative CT showed that both sides of the nasolacrimal ducts and inferior turbinates were preserved (). Nasal breathing was found to be satisfactory. No nasolacrimal duct obstruction was observed. The patient showed no evidence of disease recurrence at 12 months postoperatively. |
A 54-year-old Japanese male suffered from urothelial carcinoma (UC) of the right urothelium, which was completely excised. Three years later, a metastasis to the lower lobe of the right lung arose, and was treated by resection and chemotherapy. At the age of 62 years, the patient presented with a subcutaneous nodule around the surgical scar on the right lower abdomen, measuring 20 mm in diameter (). One year after we performed an excisional biopsy, we performed a lymph node dissection (LND) of the right inguinal lymph node (LN), which was swollen. The next year, a LND of the swollen left inguinal LN () was performed. A hematoxylin and eosin (H&E)-stained specimen of the nodule from the right lower abdomen demonstrated an expansive nodule from the dermis to the subcutis, not involving the epidermis (). The neoplastic cells possessed oval nuclei and ample eosinophilic cytoplasm, and were densely grouped (). Clear cells were mixed in part (). Although decapitation secretion could not be seen, intracytoplasmic lumens were partially detected (). Cell atypia was severe, with some giant cells and occasional atypical mitoses (). In some areas, there was a significant deposit of pale-staining mucin in the stroma. The histologic findings of the dissected bilateral inguinal LNs were completely the same as those of the right lower abdomen. An H&E-stained specimen of the right urinary tract showed a nodule radially proliferating from the urothelial epithelium (). The neoplastic cells possessed oval nuclei and ample eosinophilic cytoplasm, and were densely grouped (). There were no intracytoplasmic lumens. Cell atypia was severe, with occasional atypical mitoses. Mucin deposition was not significant in the stroma. The neoplastic cells of the resected specimen in the lower lobe of the right lung were the same as those of the urothelium. Neoplastic cells in the subcutis and LNs were positive for CK7, GATA-binding protein 3 (GATA3) (), and GCDFP15 () expression, and negative for CK5/6, CK20, p63, CD10, PAX8, HER-2, and uroplakin-II expression. Neoplastic cells in the urothelium and the lung were positive for CK7, CK5/6, and GATA3 expression, and negative for CK20, p63, GCDFP15, and TTF-1 expression. The differential diagnosis could include EMPSGC and AC. However, EMPSGC typically has solid papillary pattern and prominent mucin deposit. And, AC could be accompanied by decapitation secretion. Such characteristic findings could not be detected in the present case. The final diagnoses were confirmed as adnexal adenocarcinoma NOS metastasizing to the bilateral inguinal LNs and UC metastasizing to the lung, respectively. Fluorodeoxyglucose-positron emission tomography/computed tomography (FDG-PET/CT) after excision demonstrated no other hot spots. Neither local recurrence nor distant metastasis has appeared during 12 months of follow-up after the last LND.\nThe written informed consent about publishing all photographic materials was obtained from all patients. |
A 48-year-old female attended the gynecology outpatient department for abnormal uterine bleeding. The patient was a follow up case of right-sided clear cell RCC that had been operated 3 years back by the procedure of radical nephrectomy. She had also been operated for meningioma right sphenoid wing () by the procedure of craniotomy 6 years back following which, the patient developed recurrence. The removal of residual tumor was done by gamma knife therapy. On histopathological examination, the tumor showed features of transitional meningioma (WHO grade I). During follow up, the patient started developing right-sided lumbar pain for 3 months. Ultrasonography revealed a hypoechoic lesion measuring 6.7×6.9 cm in the middle pole of right kidney with displacement of the pelvicalyceal system. CT scan revealed features suggestive of RCC () which was proven on histopathology, when the tumor was removed by the procedure of radical nephrectomy. A Technetium99 MDP bone scan revealed no metastatic foci. Also VHL gene sequencing studies did not show any evidence of mutation.\nPatient has been under constant follow up since then, when she started developing abnormal uterine bleeding. On ultrasonography, an echogenic lesion was identified on the right side of pelvis. Intra-operatively, a 5×4×3 cm ovarian mass was identified. The ovarian mass was solid with yellowish-grey and hemorrhagic areas with tiny cystic spaces ().\nA frozen section examination was done along with intra operative cytology in the form of imprints and scrape smears. Cytological smears showed cells dispersed singly along with focal clusters of clear cells. There was mild nuclear pleomorphism and presence of prominent nucleoli in some of the cells, however no mitosis or necrosis was identified. Frozen sections showed clear cells arranged in cords, nests as well as tubular pattern with mild nuclear atypia. A diagnosis of malignant epithelial tumor was given. A Total abdominal hysterectomy with bilateral salphingoopherectomy was performed. Histopathology of the right ovarian mass revealed a tumor composed of sheets, nests and glandular structures consisting of cells with abundant clear cytoplasm and small nuclei. Sections showed nests of clear, polygonal tumor cells arranged in sheets or nests surrounded by delicate, thin-walled vascular septa (). Nuclei were bland and without mitoses or pleomorphism. Many areas showed tubules lined by attenuated tumor cells and filled with serous fluid or blood. Desmoplasia was absent in the surrounding stroma. There was no evidence of lymphovascular invasion at the periphery of either ovary or of metastatic spread to uterus, fallopian tubes or to the contralateral ovary. The tumor cells showed positive staining with periodic acid Schiff (PAS) and oil red O stain (). On immunohistochemistry, the tumor cells expressed epithelial membrane antigen (EMA) and CD 10 () and were negative for Thyroglobulin and Inhibin. The uterus showed adenomyosis along with presence of intramural leiomyomas ranging in size from 1-2 cm in diameter. The cervix and left sided ovary as well as bilateral tubes were unremarkable. On histopathology, a final diagnosis of clear cell RCC grade II metastasizing to the ovary was given. The post-operative recovery of the patient was normal and she has been kept under follow up since then. |
A previously well 72-year-old female presented to a tertiary hospital for an elective colonoscopy. The indication was anemia, intermittent abdominal pain, and recently altered bowel habits. The patient had had several colonoscopies in the past although not for a number of years. Her previous colonoscopies were noted as being difficult and on the most recent attempt, the endoscopist failed to reach the cecum. The difficulties encountered in those procedures were attributed to significant diverticulosis.\nIn anticipation of a challenging colonoscopy, a pediatric colonoscope was used. Per rectum exam was unremarkable, and the bowel prep was described as average. After some initial difficulties, the endoscopist had some success advancing the scope using water irrigation to distend the bowel. However, due to significant looping, the scope could not be advanced past the splenic flexure. At this point, the endoscopist encountered resistance and was unable to retrieve the colonoscope. Fluoroscopy was performed, and a tight angulation in the sigmoid colon was observed.\nThe patient was given a general anesthesia and paralyzed in an attempt to retrieve the colonoscope. However, this too was unsuccessful. In conjunction with the on-call colorectal surgeon, a decision was made to transfer the patient to the operating theater for an exploratory laparotomy. Intraoperatively, significant intraabdominal adhesions were encountered, and a large phlegmonous mass was noted abutting and constricting the patient's sigmoid colon. It became apparent that the adhesion between the patient's sigmoid colon and this inflammatory mass were responsible for the unusual predicament. The scope had looped in the sigmoid colon, and both the afferent and efferent limbs were fixed at the same level. Furthermore, the loop had twisted in a volvulus-type configuration. This meant that as the surgeon tried to either withdraw or advance the scope, the whole loop would move against the fixed adhesions, and the scope would not progress. The surgeon performed a limited adhesiolysis in order to free the sigmoid colon from the inflammatory mass. The colonoscope was then finally able to be retrieved. On withdrawing the colonoscope, the surgeon carefully examined the mucosal wall for signs of any injury, but none were noted.\nThe patient was carefully monitored on the ward and discharged four days later. The patient has been reviewed as an outpatient and has recovered well from the procedure. |
A 61-year-old female with medical history of hypertension, diabetes mellitus type 2, and chronic kidney disease stage V was transferred to our institution from an outside hospital for further evaluation and definitive management of a migrated intracardiac stent.\nShe initially presented to the outside facility with progressive dyspnea on exertion, orthopnea, and bilateral lower extremity edema. She was initially diagnosed with acute heart failure and pneumonia and treated with diuretics and antibiotics. Subsequently, a transthoracic echocardiogram was performed, which revealed a foreign body within the right ventricle. On transfer to our facility, a transesophageal echocardiogram revealed a long stent straddling the tricuspid valve from the right atrium with the other end lodged in the trabeculation of the right ventricle with severe tricuspid regurgitation ().\nOn further investigation, we learned that the patient had undergone peripheral endovascular intervention for May-Thurner syndrome with placement of a self-expanding Nitinol Protege (14 mm × 60 mm) stent to the left iliac vein 6 months prior to presentation.\nA percutaneous endovascular approach with a 35- mm Medtronic-Covidien Amplatzer Gooseneck Snare was initially attempted to retrieve the migrated stent. However, the snared proximal segment fractured, leaving behind 2 stent fragments. After ensuring there was no myocardial perforation or pericardial effusion with intracardiac ultrasound, the patient was referred for surgical extraction via median sternotomy with use of cardiopulmonary bypass.\nDuring the operative procedure, the stent was found to be densely adherent to the tricuspid leaflets and the subvalvular apparatus, with majority of the primary chords to the anterior and posterior leaflets ruptured (). After successful extraction of the stent and native tricuspid valve, she underwent valve replacement with a 29-mm Carpentier-Edwards bioprosthetic valve. Her postoperative course was complicated by hemopericardium secondary to anticoagulation resulting in cardiac tamponade that was drained percutaneously, and small thromboembolic cerebellar stroke from atrial fibrillation. She was discharged to an inpatient rehabilitation facility and did well on 8-month follow-up. |
A 49-year-old Caucasian lady with history of polysubstance use disorder and related complications including, recurrent cutaneous abscesses, spinal diskitis and septic thrombophlebitis presented to the emergency room with complaints of intermittent fevers and right hip pain. A month prior to the presentation, she had left another hospital against medical advice after being diagnosed with Methicillin-resistant Staphylococcus aureus bacteremia and right hip septic arthritis. Post discharge, she was off antibiotics, but continued heroin and methamphetamine and was taking multiple dose of ibuprofen in addition for pain control. On admission, her physical exam was notable for severe tenderness in her right hip, marked bilateral lower extremity edema and multiple deep, circular, punched-out looking atrophic scars involving all extremities at prior skin popping (subcutaneous injection of illicit drugs) sites. Pertinent laboratory data included chronic anemia with a hemoglobin of 9.8 g/dL, WBC count of 10.23 k/uL and a platelet count of 395 k/uL. She had negative HIV, Hepatitis B antibodies and elevated Hepatitis C antibody with undetectable Hepatitis C viral load. Her basic metabolic profile noted a sodium of 140 mmol/L, potassium of 3.5 mmol/L and a creatinine of 2.9 mg/dL (estimated glomerular filtration rate of 17 ml/min) which was a significant rise from the normal creatinine levels a month earlier. Her urine analysis noted >500mg/dL proteinuria with a protein/creatinine ratio of 28.25. She had no monoclonal proteins on serum or urine electrophoresis. CT scan of her right hip noted marked degenerative changes in the right hip, with right acetabular protrusion and cortical disruption of the medial acetabular wall. She was diagnosed with right hip osteomyelitis and was in acute renal failure with evidence of nephrotic range proteinuria. She was placed on antibiotics (daptomycin) and underwent hip arthroscopy with irrigation and debridement along with lavage shortly after admission. Differential diagnoses considered for her renal disease included acute tubular necrosis due to sepsis, post infectious glomerulonephritis, focal segmental glomerulosclerosis associated with heroin use, acute interstitial nephritis from NSAIDs and membranoproliferative glomerulonephritis associated with Hepatitis C. She underwent a renal biopsy which revealed acute tubular necrosis and secondary (AA) amyloidosis with the classic apple green birefringence when stained with Congo red () and positive immunohistochemical stain for serum amyloid A protein (). Two weeks after admission she underwent Girdlestone arthroplasty. During the hospital stay, she developed intermittent hypotension, had evidence of primary adrenal insufficiency attributed to amyloidosis and was initiated on steroids. She was discharged home after completion of prolonged antibiotic therapy with daptomycin and was maintained on oral doxycycline. She was referred to outpatient opioid treatment program. Eight months after her admission, she remained committed to be off all illicit drugs and underwent right total hip replacement. Her creatine levels normalized (estimated GFR of 82 ml/min) but she continued to have proteinuria from renal amyloidosis (protein/creatinine ratio of 28.25) and required diuretic therapy for symptomatic management of her edema. |
A previously healthy 21-year-old woman riding on the back seat of a vehicle with a fasten seat belt was involved in a car accident, leading to a direct left knee trauma. After initial assessment at the emergency department, she complained of diffuse left knee pain, which was aggravated by passive extension and palpation, mostly around the posterolateral corner. Anteroposterior and lateral plain films of the left knee were then taken for initial evaluation () and revealed a transverse radiolucent line with corrugated borders across an ossified fabella—regarded as a complete fracture—and also a small avulsion cortical fracture at the medial aspect of the medial femoral epicondyle. An ultrasound of the knee was performed to assess the superficial tendons and ligaments around the knee, especially at the posterolateral corner, as well as to confirm the presence of joint effusion. Posterolaterally, the fabella was depicted with a central cortical defect related to the fabellar fracture seen on radiographs. To further evaluate and rule out injury of the internal structures of the knee, a routine magnetic resonance imaging (MRI) of the left knee was performed.\nMRI was performed in a 1.5 Tesla scanner using sagittal T1-weighted fast spin-echo and triplanar intermediate-weighted fast spin-echo fat suppressed sequences, which confirmed the transverse fracture of the fabella associated with edema-like changes within the bone marrow and within the proximal fibers of the lateral head of gastrocnemius (Figures , , and ). Multiple foci of bone edema-like changes consistent with bone contusions at the femoral condyles, tibial plateau, and the fibular head were also detected. The avulsion fracture of the medial aspect of the medial femoral epicondyle, located close to the insertion of medial collateral ligament, was also confirmed. No other abnormalities were detected.\nA conservative management strategy and symptomatic treatment for pain were adopted in the acute setting for this case, as no definitive surgical indication was present. At three months followup, the patient has recovered well and has no current knee complaints. |
A 56-year-old woman developed double vision and Hashimoto thyroiditis 3 months before admission to our department. Within 2 months she developed severe dysphagia, dysarthria and proximal arm muscle weakness and was diagnosed with MuSK-antibody positive MG. She was treated with pyridostigmine (510 mg per day) and oral steroids (40 mg per day) in another hospital for 4 weeks. Due to deterioration of bulbar symptoms she was transferred to our intermediate care unit. Fiber endoscopy revealed a hypotonic and slowed swallowing act with penetration of food at the epiglottis. Due to risk of aspiration, the patient received a transient PEG fistula. Initial clinical examination revealed 29 points on the MG composite scale. Arm extension time was 92 s, leg extension time 39 s and head holding time 12 s (Besinger score 1.3). She received 20 g methylprednisolone, 270 mg pyridostigmine and 100 g IVIG within the first five days, but did not improve. Subsequently methylprednisolone was elevated to 30 mg per day and pyridostigmine to 440 mg daily. Three PE procedures and two IAs with insufficient response were performed during the second and third weeks of her stay, followed by rituximab 250 mg at the end of the fourth week. Again, intravenous immunoglobulins were reapplied at a dosage of 60 g during the fifth week. Due to the severity of the disease, in particular of the bulbar symptoms (see ) that necessitated a PEG fistula, we decided to further escalate immunotherapy. Nineteen days after rituximab therapy, bortezomib subcutaneously (s.c.) according to the standard scheme (bortezomib 1.3 mg/m2 body surface s.c. four times within 2 weeks and protective co-medication with aciclovir 400 mg twice daily and cotrimoxazole 960 mg BID three times weekly for 2 months) was given. After the first injection of bortezomib there was some improvement of dysarthria and after the second injection progressive improvement of dysphagia, head holding and dysarthria could be observed, as demonstrated in . CD19-positive cells were reduced to 0.5% (about 3.5/µl). After the third injection of bortezomib the patient showed transient diplopia and ptosis, but apart from this the Besinger score improved from 1.14 before bortezomib to 0.62 after the last injection of bortezomib. Speech and swallowing improved to almost normal, allowing for removing the PEG fistula. Double vision still occurred after 11 s when looking to the left side, but ptosis had resolved completely. Her arm extension time improved to 172 s, leg extension time to 67 s and head holding time to 40 s, reflected by only two points on the MG composite scale. MuSK-antibody titer declined from over 12 U/ml to 1.76 U/ml (normal below 0.4 U/ml). Pyridostigmine therapy was continued at 180 mg/day. The patient was dismissed after 2 weeks. After 3 months her CD19 cells were still depleted with 46 cells/µl. She stayed in pharmacological remission for 6 months. In contrast to other MuSK patients, she profited from low-dose pyridostigmine.\nDue to mild deterioration after 6 months and increase of CD19 cells to 177/µl, as well as of MuSK antibodies to 7.24 U/ml, oral steroids were reintroduced at 60 mg for 3 days, and then 40 mg and 20 mg for 3 days each, and the patient was treated with rituximab 500 mg again. The patient is stable since then under 5 mg methylprednisolone and pyridostigmine 180 mg per day. |
A 44-year-old female visited our dermatology clinic with repeated labial and perilabial swelling for months (). Her symptoms were confined to the skin, and there were no symptoms such as facial palsy or fissured tongue. The physical examination revealed erythematous induration and swelling on the right lower lip and perioral area. She had been diagnosed with herpes simplex infection and received several antiviral treatments, but there was no improvement in symptoms.\nTwo weeks ago, because of both temporal headaches, she underwent the brain computed tomography scans and magnetic resonance imaging exam. Radiologically a mass was found on the petrosal apex and involving left clivus (). The brain tumor and skin lesions were contralateral. The transsphenoidal tumor removal was performed for the brain tumor. During tumor section, the pulsating vessel was found. Considering the high probability of complication, tumor removal could not be completed. Finally, he was diagnosed as cavernous hemangioma. There was no postoperative complication such as neurologic symptoms, but her cutaneous symptoms seemed worse after the surgery.\nWe prescribed oral methylprednisolone 8 mg/day and injected intralesional corticosteroid intermittently. Oral methylprednisolone was adjusted and tapered according to her symptoms but could not be completely withheld. Histologic examination revealed exocytosis of some lymphocytes and dense perivascular, perifollicular lymph histiocytic infiltration throughout the dermis (). Despite treatment with triamcinolone intralesional injection and oral methylprednisolone for 3 months, symptoms got worse. Oral doxycycline 200 mg/day for 3months was ineffective also.\nSeven months after the first visit, she was referred to a tertiary referral hospital for gamma knife surgery (GKS) on the brain tumor. After the GKS, although we prescribed the same dose of methylprednisolone as before, symptoms improved and showed less relapsing. Two months after GKS, oral methylprednisolone was discontinued and an intralesional injection was performed solely. Radiologically, brain mass was reduced in size (), and her symptoms are improving consistently (). We received the patient's consent form about publishing all photographic materials. |
A 36-year-old Caucasian male with no significant past medical history presented after an episode of loss of consciousness and fall. Patient reported waking up from sleep and feeling dizzy while walking to the restroom. When he was about to urinate he passed out, fell, and hit his head. He regained consciousness as soon as he hit the floor. He denied palpitations, chest pain, or diaphoresis before or after loss of consciousness. He is a social drinker and nonsmoker and denied using any recreational drugs.\nOn physical examination, he was found to be fully alert and had normal orthostatic vitals. Except for a 5 × 0.5 cm bruise over the right eyebrow and tenderness over the site, he had no abnormal findings. Urine toxicology screen was negative. EKG showed normal sinus rhythm at 70 beats per minute. Computed tomography of the head ruled out any acute intracranial pathology. Telemonitoring at night showed periods of sinus arrest (with the longest pause being 5.6 seconds, ) with baseline bradycardia at a rate of 30 to 45 beats per minute. Patient was asymptomatic and sleeping during these pauses. Serum electrolytes, thyroid stimulating hormone, liver function tests, and serological tests for Lyme's disease were normal. Transthoracic echocardiogram showed normal ejection fraction and no valvular abnormalities. His sinus pauses progressively increased in duration () every successive night and the longest pause lasted for 8.6 sec (). During the day, his telemetry was normal at a rate ranging between 65 and 75 beats per minute without any episodes of sinus pause. On exercise, patient showed an appropriate increase in heart rate. After a thorough literature review, a very rare diagnosis of REM sleep related bradyarrhythmia syndrome with malignant vagotonia was considered.\nPolysomnographic study () was done to evaluate sleep apnea and time sinus pauses with sleep cycle. Study did not involve video monitoring but snoring was generally absent. A few mild central respiratory events were noted. However, these did not reach frequency threshold for diagnosing sleep apnea. Cardiac telemetry showed normal sinus rhythm. During REM sleep, he demonstrated prolonged sinus pauses. Five sinus pauses of at least 3.5 seconds were noted during REM sleep. The longest one lasted for 7.8 seconds. Minimum pulse rate in wake and NREM cycle was 48.0 and 46.0, respectively. The patient appeared clinically asymptomatic all through the study and denied any symptoms compatible with REM sleep behavior disorder.\nElectrophysiological study was done to further evaluate his bradycardia and need for a permanent pacemaker. Patient was found to have sinus pauses lasting up to 4070 msec (). Considering his worsening duration of sinus pauses and lack of rescue from an escape rhythm, his risk of cardiac arrest appeared very high and a dual chamber pacemaker was placed. Pacemaker is the only established therapeutic option for these types of sinus arrests. Patient continues to follow with us as an outpatient and no episodes of syncope or night time symptoms have been reported thus far. |
A 2-year-old boy presented with left periscapular and upper back paraspinal tender masses. He was referred from pediatricians to our hospital (Imam Reza) and subsequently admitted. He was the third child of 37-year-old mother delivered by cesarean section with good Apgar score, normal birth weight (4100gr), head circumference (HC) of 35 cm and length of 53 cm. His parents were non consanguineous and the similar disease was not observed in the family. The mother was a general physician and the father was an engineer. The patient’s sister and brother were healthy. In the past medical history, atopic dermatitis and lacrimal duct obstruction were seen at infancy. Growth and development was normal in the past two years.\nPresent disease began one year ago with painful swelling of the forehead after a mild trauma. Similar swelling in the arm and shoulders started later subsiding spontaneously. At this admission, he had paraspinal (upper thoracic and lower neck) and periscapular muscle swelling which was painful, tender and indurate, without redness and inflammation over the skin (). The shoulder girdle had normal ranges of motion.\nIn physical examination of the limbs, bilateral hallux valgus was observed ().\nHe was referred with the primary diagnosis of multiple hematomas due to coagulation disorders, in which routine blood tests were normal twice and only hypochrome microcytic anemia was present. Ultrasonography showed solid hypoechoic masses with the largest diameter of 85 mm and thickness of 26 mm adhered to the scapula and spine. Sonographic differential diagnoses were mesenchymal tumor, bone tumor and aneurysmal bone cyst.\nThe first CT scan indicated soft tissue masses, 25 Hounsfield Unit in density without bone destruction or calcification propounding mesenchymal or vascular masses ().\nIn spite of typical clinical and imaging findings for the early stage of FOP such as the congenital malformation of bilateral hallux valgus as a hallmark in this step, the diagnosis was not made and an unnecessary biopsy was performed on the periscapular mass. It may have lead to catastrophic disability. The pathology report showed proliferation of fibro-connective tissue with large islets of compact cartilage cells and lacunars cells with blades and specula of bone and osteoblastic activation, compatible with fibrodysplasia ossificans progressiva. The patient was discharged with non steroid anti-inflammatory drugs. Almost one year later, extensive ossification was detected in foot and neck radiographies (), chest CT scan () and reconstructed CT (). |
A 38-year-old male with no significant past medical history presented to an urgent care with complaints of cough, fatigue and decreased appetite for the past five days. Initial evaluation with a chest X-ray (CXR) was concerning for a right-sided lung mass, and he was subsequently referred to the emergency department for further evaluation. Although his symptoms of fatigue and decreased appetite were already resolving, he decided to seek medical attention for a continued non-productive cough. Initial physical exam was unremarkable, and his basic laboratory work was within normal limits with the exception of a positive influenza A on a rapid enzyme-linked immunosorbent assay (ELISA) test. An electrocardiogram (ECG) done on admission revealed an ectopic atrial rhythm, right axis deviation, right ventricular hypertrophy and an incomplete right bundle branch block pattern (Figure ).\nSubsequent evaluation of this possible right lung mass with a contrast-enhanced computed tomography (CT) angiogram of the chest showed no evidence of a lung mass or a pulmonary embolism but rather anomalies of the venous vasculature. There was a large anomalous SVC receiving drainage from the right jugular, subclavian vein and possibly the innominate vein, extending caudally in the anterior pleural space (Figure ), subsequently descending medially and communicating with the intrathoracic IVC at the junction of the IVC and right atrium (Figures , ). A prominent left intercostal vein was visible, but a large left-sided SVC was not appreciated. Additionally, a large right lower lobe anomalous pulmonary vein was draining into the anomalous SVC at the junction with the IVC and a right upper lobe pulmonary vein was also found to be draining into the anomalous SVC proximal to the IVC/right atrial junction (Figure ). The right atrium and right ventricle were enlarged, and the pulmonary artery appeared to be dilated. Additionally, mild left ventricular hypertrophy was present, but no large atrial or ventricular septal defects were appreciated. |
A 50-year-old male patient presented with a 2-year history of left-sided typical HFS. Painless irregular clonic contraction of the facial muscles began initially in the orbicularis oculi muscle of the lower lid. It gradually spread to other muscles innervated by the facial nerve on the left side of the face, including platysma. The paroxysm was induced or aggravated by emotional tension, stress, and voluntary and reflexive movements of the face. He had significant difficulty in his work and social life despite 2 times of botulinum toxin injection. Medical treatment with carbamazepine (up to 600 mg) and baclofen (30 mg) was not effective. He was referred for surgical treatment. His medical history was unremarkable. His physical and neurologic examinations were normal, including hearing. No tinnitus or discernible noise heard in his left ear was found. Only typical nature of clonic hemifacial spasm was evident. Abnormal synkinesis between the orbicularis oculi and orbicularis oris muscles was found by the electromyographic examination of the blink reflex. Despite typical HFS, there was no discernible vascular structure in the REZ of left facial nerve (). However, a meatal loop of AICA abutting to the cisternal portion of the facial nerve was found.\nUnder the impression of HFS caused by neurovascular compression of distal facial nerve, standard microsurgical procedure was performed as described previously [, , ]. In addition to intraoperative monitoring of BAEPs, LSR, which is an abnormal muscle response demonstrated by EMG recordings from mimic muscles that are innervated by a different branch of the facial nerve [], was also monitored throughout the operation. The entire course of the facial nerve and offending arteries were exposed under microscopic vision. Upon exposure of the REZ of the facial nerve, there was no offending vessel in the REZ as expected (). The distal, cisternal segment of the facial nerve was found to be bent by a meatal loop of the AICA (). A small piece of Teflon felt was interposed between the facial nerve and the meatal loop of the AICA with extreme care not to stretch the internal auditory artery and the distal facial nerve (). After interposition of Teflon felt, LSR immediately disappeared and BEAP was stable also (). The closure of the dura and wound was performed in routine manner. The HFS resolved completely following the surgery. The postoperative course was uneventful with no signs of facial weakness or hearing impairment by pure-tone audiometry. No recurrence of HFS or neurologic sequelae was evident at a 12-month follow-up. |
22 years old male presented with acute pain and tenderness with deformity of right elbow joint with inability to move the elbow joint after he fell down due to episode of seizure, there was no neurovascular deficit. He was a known case of epilepsy on medical management. He had an history of injury to same elbow five years back following which immobilisation in a plaster cast was done for four weeks but any documentation regarding the injury was not available with the patient. Radiological examination (Fig.) confirmed anterior dislocation of elbow joint with a ununited medial epicondyle fracture.\nManagement One attempt of closed reduction was done in emergency but reduction could not be achieved. Another attempt of closed reduction was done in operating room under general anaesthesia and muscle relaxants was successful and elbow was stable during complete range of motion and no restrictions of motion was present. Reduction technique included distal traction on the wrist and backward pressure on the proximal forearm, a coupling was felt as the joint was reduced. care was taken not to hyperextend the elbow as it may lead to traction and potential injury to anterior neurovascular structures. A smooth K wire was used to transfix the ulno humeral joint (Fig.) along with application of long forearm slab as the patient was having epilepsy and another similar episode may happen. No attempt to fix the medial epicondyle was done in view of soft tissue stripping may compromise joint stability, also under fluoroscopic examination medial epicondyle appeared to be stable suggestive of fibrous union. K wire was removed after 2 week time and active and active assisted elbow mobilisation exercises were started. Patient regained complete range of elbow motion after 15 days of physiotherapy and was pain free. He again had episode of seizure after 2 months of injury but his elbow was not affected this time. |
A 78-year-old male with multiple comorbidities, including hypertension, hyperlipidemia, and type II diabetes mellitus, presented to our emergency setting with complaints of recurrent bouts of abdominal pain and fluctuating fevers for the previous two weeks. The patient reported that the pain is a new manifestation of a previously dull aching pain that had waxed and waned over the last decade. His description alluded to a pain that was sharp and intermittent with localization in the right upper quadrant. He could not attribute the intermittent nature of his predicament to any aggravating or relieving influences. The pain was associated with fluctuating low-grade fevers (99°F-100°F), anorexia, and an associated 13-pound weight loss, which culminated in a visit to our clinical setup.\nFurther interrogation disclosed that the patient underwent a laparoscopic cholecystectomy in 2003. The ensuing year was relatively pain-free but was followed by recurrent bouts of right upper quadrant pain, albeit less upsetting than his current presentation. He was subsequently diagnosed in 2005 with gallstone spillage. The patient chose conservative treatment for his abdominal pain, rather than invasive interventions, which included the administration of acetaminophen and non-steroidal anti-inflammatory drugs (NSAIDs). This treatment modality was sufficient for the duration of a decade. He presented to another medical facility with similar complaints of fever and abdominal pain in 2016. A computed tomography (CT) scan of his abdomen disclosed the presence of a necrotic phlegmon, which was subjected to aspiration. Its composition included a combination of fibrous material, granulation tissue, and inflammatory infiltrate. The aspiration provided considerable relief of symptoms and he was discharged on a gabapentin prescription that was well-tolerated and produced sustained amelioration of his pain, with only occasional wavering with respect to his baseline.\nThe initial assessment showed an elderly gentleman, who was alert and well-orientated but under considerable distress due to the abdominal pain and accompanying chills. He had a fever of 104°F, a heart rate of 120 beats per minute, a blood pressure of 95/70 mm Hg, and a respiratory rate of 19 per minute. An abdominal exam revealed a non-protuberant, soft, and tender abdomen with marked sensitivity in the right upper quadrant. He had perceptible bowel sounds, an absence of dullness on percussion, and a clear rectal vault. Pertinent initial laboratory investigations included an elevated white blood cell (WBC) count of 16,900/µL, C-reactive protein (CRP) of 6.5 mg/dL, and a random blood glucose (RBG) of 280 mg/dL. The patient subsequently underwent a whole body CT scan, which revealed a large 19-cm sub-diaphragmatic, right retroperitoneal abscess, which was inferior and posterior to the right hepatic lobe (Figure ).\nIn lieu of these findings, the patient was admitted and started on a combination of intravenous fluids, intravenous (IV) vancomycin and piperacillin-tazobactam due to an underlying suspicion of sepsis secondary to a hepatic and/or perihepatic liver abscess caused by a lack of gallstone retrieval following his cholecystectomy. He was subsequently subjected to a percutaneous CT-guided drain placement, which allowed for the evacuation of approximately 700 mL of grossly purulent material and provided prompt pain relief. The fluid sample was sent for a gram stain, culture, and a bilirubin assay. The gram stain of the abscess fluid revealed branching gram-positive rods concerning for Actinomyces, Nocardia, and Streptomyces; therefore, the patient remained on IV vancomycin and piperacillin-tazobactam, with the addition of trimethoprim-sulfamethoxazole (TMP-SMX) to the antibiotic regimen. Remarkably, the culture growth was positive for Propionibacterium and ampicillin-sulbactam was added to the list of antibiotics. Two days later, the patient was shifted to the intensive care unit (ICU) following unrelenting fever and persistent tachycardia, even after his abdominal drain placement was supplemented with vigorous antibiotic and antipyretic therapy. His ICU stay was complicated by episodes of dyspnea, tachypnea, and pleuritic chest pain, while a chest auscultation unveiled a decrease in breath sounds at the right basal region. A repeat CT scan confirmed the reduction in the size of the abscess and showed a new right-sided pleural effusion, which explained the patient’s breathing difficulties (Figure ).\nThe patient underwent an ultrasound-guided chest tube placement, which evacuated 10 mL of purulent fluid, followed by two doses of lytic therapy with tissue plasminogen activator (tPA) via the catheter. The following morning, he described an aggravation in his pleuritic chest pain, and an episode of shortness of breath, whereby, the oxygen saturation dipped to 90%. A new chest CT scan was ordered, which showed an interval increase in the right basilar opacity with a moderately sized pleural effusion (Figure ).\nHe was subsequently upgraded to a larger catheter via a CT-guided approach that evacuated a total of 900 mL of purulosanguinos fluid. The patient tolerated subsequent lytic therapies well and showed vast clinical improvement following this procedure, with a reduction in dyspnea, pleuritic chest pain, and fever, as well as a down-trending of his inflammatory markers.\nA repeat CT scan was performed on the 10th day of admission, which revealed a near-complete resolution of his right-sided pleural effusion, and a decrease in his right-sided retrohepatic intrabdominal abscess (Figure ).\nThe chest drain was removed and the patient was subsequently discharged with a transhepatic drainage catheter, daily intravenous ampicillin-sulbactam, and acetaminophen, as needed for pain control. The patient was shifted to oral amoxicillin-clavulanate a month after the resolution of his pain, fever, and stabilization of inflammatory markers. The transhepatic percutaneous drain was left in place in order to allow for the formation of a chronic drainage tract, with hopes of localizing the perpetrating gallstones at its base.\nTwo months after discharge, the patient underwent a procedure for upsizing the drain in order to accommodate for a choledochoscope into the abscess cavity and the maturing sinus tract. He subsequently underwent an abscess cavity endoscopy, whereby a catheter and scope were advanced into the cavity for exploration. An abscess catheter study was performed through the existing catheter and showed no filling defects, after which the catheter was removed and an endoscope was inserted for direct visualization of the main cavity, as well as the two “fingers” branching out of the abscess cavity. Two small stones were expelled after flushing the main cavity multiple times. Following the expulsion of the gallstones, a replacement catheter was advanced into the cavity and a second catheter study was performed to rule out the possibility of any other stones. The patient tolerated this intervention well and had no further drainage from the intra-abdominal drain.\nFollowing a lack of drain output and resolution of symptoms after his last endoscopic procedure a month ago, the patient's intra-abdominal drain was removed. The patient is currently stable and is being followed as an outpatient to date. |
A 4-month-old male was diagnosed with HUS and treated with peritoneal dialysis from the 5th day of disease onset. The patient had a bad evolution, with renal failure, anemia, severe hypertension, and peritonitis by Staphylococcus Epidermidis, and after 20 days he suffered a second HUS episode and was transferred to our Hospital. At that moment, in addition to altered hematologic parameters, complement analysis indicated very low C3 levels (35,4 mg/dL; normal range: 77-135) with normal C4 (43,8 mg/dL; normal range: 14-60); Factor H, Factor I, and MCP levels were on the normal range. Hematological parameters and glomerular filtration normalized after 1 month, but hypertension remained partially uncontrolled and hemolysis markers such as haptoglobin were persistently low. After 6 months, the patient suffered a third episode with severe hypertension which required as many as six hypotensive drugs. Moreover, he endured two episodes of acute pulmonary edema with respiratory distress caused by hypertensive crisis. He developed a severe anemia that required 17 erythrocyte concentrates, mild thrombocytopenia, proteinuria in the nephrotic range, and cardiac insufficiency. He also suffered acute renal failure which required diuretic and hemodialysis support. A renal biopsy performed during this episode indicated thrombotic microangiopathy, with major vascular involvement and mild glomerular damage ().\nThe patient suffered 5 subsequent HUS episodes; treatment with immunosuppressive drugs (vincristine and prednisone) and several plasma exchanges courses were tried without success. Uncontrolled hypertension with hemodynamic instability required prolonged hospitalizations. He underwent chronic dialysis at the age of three years, and 10 months later both kidneys were removed in an attempt to avoid the severe complications associated to HUS episodes (). Nonetheless, the hypertension continued after bilateral nephrectomy, and the patient had several episodes of acrocyanosis on all the fingers of the lower extremities (Raynaud’s phenomenon) because of systemic microangiopathy ().\nAlthough hematological parameters normalized after bilateral nephrectomy, the clinical course of the patient under chronic hemodialysis continued to be torpid, with severe hypertension with cardiac repercussion, stroke-like episodes not clearly explained, and bad tolerance to hemodialysis sessions. All the time, plasma levels of complement C3 were low, while levels of C4 and C5 were normal. When he was 5 years-old, a pathogenic gain-of-function variant in complement Factor B (FB) was identified (); genetic studies also showed the presence of the two aHUS-risk haplotypes CFH(H3) y MCPggaac in heterozygosis. This molecular diagnosis opened the possibility of a combined liver kidney transplantation (CLKT), since by that time complement inhibition with Eculizumab was not available. While waiting for CLKT, the patient continued with a regimen of hemodialysis and plasma infusions.\nAt the age of 9 years, the patient received a CLKT from an 8-year-old child. Immediately before the surgery, he was treated with intensive plasma exchange to ensure removal of his circulating FB; two other plasma exchange sessions were performed the third- and fourth-days post-transplantation, coinciding with mild anemization without signs of hemolysis. Systemic heparinization was used as part of our liver transplant protocol. Normal kidney and liver functions were evident 2 weeks post-transplantation (), and plasma levels of complement C3 reached normal values for the first time in the patient’s life (). The patient remained in hospital for 30 days. Suspicion of hepatic acute rejection in early postoperative period was treated with a pulse of metilprednisolone, with good response; histopathology of the biopsy discarded the rejection. The patient continued stable for 4 years under immunosuppressive treatment (induction with Basiliximab, and maintenance with corticosteroids, tacrolimus and mycophenolate mofetil).\nOn September 2013, the patient was diagnosed with a diffuse large B cell non-Hodgkin’s lymphoma stage 3, with infiltration in scalp and skull, and was treated with chemotherapy (R-CHOP/R-COPDAM) and rituximab. At the beginning of the treatment, he suffered a septic shock and endured at Intensive Care Unit for 9 days. The infectious episode induced coagulopathy and multiorgan failure (with hepatic, kidney, and cardiac involvement) with good outcome. After 3 months, the chemotherapy was ended with evident signs of remission. All along the chemotherapy treatment, tacrolimus and mycophenolate mofetil were stopped and only corticosteroids were maintained.\nOn February 2014, he suffered from a liver graft dysfunction with a light increase of transaminases without ultrasonographic signs of dilated biliary tract. He received intravenous antibiotics and ursodeoxycholic acid by suspicion for cholangitis. Liver biopsy showed moderate periportal fibrosis, but no histological features of chronic rejection. Subsequently to liver rejection in 2014, the patient developed high levels of de novo donor-specific antibodies (DSA) against DQ9 (MFI: 21705). These DSA were maintained with a similar MFI (between 21000 and 32000) at least until February 2020, just before the second liver graft; moreover, serological viral studies were negative. Sirolimus was included in the immunosuppressive treatment, and the corticosteroids and ursodeoxycholic acid doses were increased. Following several cholangitis and infectious episodes, in 2018 a second liver biopsy showed ductal proliferation with inflammation and branding fibrosis. Diagnosis of chronic liver rejection was established, and tacrolimus and mycophenolate mofetil were reintroduced. Percutaneous transhepatic cholangiography showed multiple biliary structures of the biliary tree without obstruction in the anastomotic site. Several biliary dilatations and external biliary drainage were performed, and finally, a biliary stent was positioned. However, the patient continued suffering cholangitis episodes by multidrug-resistant bacteria, requiring frequent hospitalization. During all this period, the glomerular filtration rate decreased during the acute infection episodes but normalized afterwards, with no signs of kidney rejection. On February 2020, the patient received a second cadaveric liver graft. By that moment, creatinine-based glomerular filtration rate was normal (> 90 ml/min/1.73 m2).\nCurrently, the patient has a good clinical condition, although he displays a low height for its expected genetic height (height: 158.5 cm (-3.18SD); weight: 56.2Kg (-1.79 SD); data related to Spanish population). He receives immunosuppressive treatment with corticosteroids, tacrolimus and mycophenolate mofetil, with maintained hepatic function after his second liver graft: AST 34 UI/L (<40); ALT 48 UI/L (<35); GGT 30 UI/L (<73); total bilirubin 0.79 mg/dL (0.30-1.20), albumin 4.3 g/dL (2.9-5.2). Kidney function is also good, with a normal GFR calculated both by Creatinine and by Cystatin C (creatinine 1 mg/dl (0.70-1.30); GFR calculated by CKD-EPI >90 ml/min/1.73 m2 (N >75); Cystatin C 1.20 mg/L (0.64-1.23); GFR calculated by CKD-EPI Cyst C 72 mL/min/1.73m2 (N>60); protein/creatinine ratio 0.08 (N<0.2).\nThe main clinical and treatment events after CLKT are shown in ; as shown in , plasma levels of C3, C4, and the C3/C4 ratio, have always remained within the normal range. Now, the patient is under the supervision on a different hospital (adult section) for the hepatic and kidney post-transplantation follow-up. |
A 36-year-old Caucasian male presented to the emergency room complaining of a one-day history of abdominal pain. His main symptoms were that of nausea and vomiting, but he also reported periods of diarrhea. In the emergency room, his initial evaluation was significant for lab studies demonstrating a mild metabolic acidosis with a bicarb of 16.6 mEq/L, an elevation of his creatinine to 1.93 mg/dL, and a serum lactate level of 5.4 mmol/L. A computed tomography (CT) scan of the abdomen and pelvis was obtained and reviewed. The appendix was thought to be normal. There was no evidence of free intraperitoneal air, abscess, or volvulus. There did appear to be evidence of enterocolitis involving the ilium, cecum, and the proximal ascending colon. There was no evidence of pneumatosis or obstruction. Over the course of 12 hours the patient underwent conservative medical management, which included intravenous hydration, intravenous steroids, Toradol and Dilaudid for pain management, and the occasional dose of Ativan for agitation. Failure of conservative management along with medical decline lead to an exploratory laparotomy with a right hemicolectomy for an ileocolic intestinal infarction. Postoperative repeat CT scan of the abdomen incidentally showed pulmonary nodules in the lower lobe. A CT scan of the chest was then obtained, which revealed air in the left chest wall and axilla (Figure ). On physical exam there was very subtle mottling of the left shoulder. The patient was emergently taken back to the OR for further exploration of the shoulder with excisional debridement. Seropurulent fluid and extensive subcutaneous emphysema along the fascial planes of the left chest wall were consistent with necrotizing fasciitis. Both wounds were packed with a gauze bandage roll soaked in saline and then the patient was transferred back to the intensive care unit.\nOver the course of 15 days the patient underwent repeat trips to the OR for re-exploration, incision and drainage of the wounds, and dressing changes (Table ). On postoperative day 17, the wound, ostomy, continence nurse (WOCN) was consulted to evaluate the wound and make treatment recommendations.\nOn exam, there was still a significant amount of nonviable tissue in the base of the left chest and axilla wound. The left chest wound measured 8 x 19 x 8 cm and the left axilla wound measured 6.5 x 25 x 4 cm. NPWTi-d with ROCF-CC was applied to these wounds to aid in the removal of the nonviable tissue. Figures - show the presentation of the wounds prior to the application of the NPWTi-d with ROCF-CC.\nDuring the application of the NPWTi-d with ROCF-CC, care was taken to ensure that the contact layer of the dressing was in contact with the entire wound base. Barrier rings were applied to the skin creases along with any area that presented as a high risk for inadequate seal of the drape (Figure ). The therapy settings for the left axilla were 85 ml of hypochlorous acid solution (Vashe®, SteadMed, Fort Worth, TX), dwell time of 10 minutes with NPWT every hour at -125 mmHg. Therapy settings for the left chest wound were 50 ml of hypochlorous acid solution, dwell time of 10 minutes with NPWT every hour at -125 mmHg.\nDuring the first dressing change after the application of the NPWTi-d with ROCF-CC, there were notable improvements in the quality of the tissue in the wound bed (Figure ). The left chest wound bed was noted to have 100% red healthy tissue and the left axilla wound bed had a decrease in nonviable tissue. There was, however, seropurulent drainage noted deep within the intramuscular structures of the left axilla wound.\nNPWTi-d with ROCF-CC was reapplied to the axilla wound ensuring that the contact layer was placed deep into the wound bed to facilitate the removal of the seropurulent drainage. The left chest wound was transitioned to NPWTi-d to continue to promote granulation tissue (Figure ). The instillation solution was switched to normal saline due to blockage alarms we encountered with the hypochlorous acid solution without resolution.\nThe current treatment regimen was continued for two days until the next dressing change. At that time both wound bases were 100% red with granulation tissue present (Figure ). The seropurulent drainage deep in the intramuscular structures was no longer present. Since there was adequate removal of nonviable tissue and the quality of the tissue had significantly improved, the WOCN made the decision to transition both wounds to NPWTi-d instilling normal saline solution with a dwell time of 10 minutes and NPWT every two hours at -125 mmHg.\nFor the next two weeks the treatment regimen utilizing NPWTi-d to the wounds continued. The dressings were changed three times a week at the bedside by the WOCN. During initial assessment, the axilla wound measured in total volume 650 cm³ and the chest wound measured 1,216 cm³. After 17 days utilizing the combination of NPWTi-d with and without ROCF-CC, the axilla wound measured in total volume 342.25 cm³ and the chest wound measured 554.4 cm³. This presents a significant decrease in overall measurements. At this time, NPWTi-d was discontinued and standard NPWT with black granufoam was utilized to both wounds at -125 mmHg (Figures -).\nNPWT was utilized for approximately a month to promote granulation tissue and assist with wound contraction (Figures -). Once the wound had made vast improvements, NPWT was discontinued and a non-adherent antimicrobial alginate dressing (Silvercel™ Non-adherent, Acelity, San Antonio, TX) was lightly packed into the wound bed and covered with a dry sterile dressing. This dressing was then changed three times a week by a visiting nurse association. The wound measurements prior to discharge showed significant improvement in comparison to the wound measurement at presentation, with the left axilla wound measuring 1.5 x 10.5 x 0.3 cm and the left chest wound measuring 3.5 x 9 x 5 cm. |
A 4-year-old boy was presented to our unit on referral with a three-week history of high-grade fever and a five-day history of generalized abdominal pain and abdominal distension. There was an associated history of headaches and body weakness. He had no history of jaundice. He had several episodes of vomiting which was initially none bilious, but later became bilious. There was an associated history of passage of diarrhea stools two days before presentation, although the patient had not passed stools on the day of presentation. He had no history of passage of melena or of hematochezia. His parents complained that he had been passing scanty urine for about five days before presentation. He had been receiving medications from the referring hospital for about two weeks before presentation.\nAt presentation, he was chronically ill looking with a toxic facie, febrile (temperature 38.5°C), pale, dehydrated, anicteric, and had no pedal edema. His respiratory rate was 28/minute; he had reduced air entry on both lung bases posteriorly. His pulse rate was 128/minute, which was regular but of small volume. Only first and second heart sounds were heard. Abdominal examination showed a distended abdomen which did not move with respiration. He had generalized tenderness with guarding. The bowel sounds were absent. A digital rectal examination showed an empty rectum with a full and tender rectovesical pouch. An initial assessment of a generalized peritonitis was made. The patient was placed on NPO with nasogastric tube for gastric decompression. He was commenced on IV fluid resuscitation and broad spectrum IV antibiotics (ceftriaxone and metronidazole) and was worked up for surgery. Initial laboratory investigations showed a hematocrit of 24% and hypokalemia (2.5 mmol/l) and a serum urea of 10 mmol/l. After an initial fluid resuscitation and correction of serum potassium, he had 300 ml of whole blood transfused. He had an exploratory laparotomy on the second day of admission. At surgery, about 600 ml of a feculent peritoneal fluid was drained, and a single perforation on the antimesenteric border of the terminal ileum was closed in two layers. An intraoperative diagnosis of perforated typhoid enteritis was made. Blood and tissue cultures were not done. He was continued on IV fluids and the same empiric antibiotics after the surgery.\nOn the third day of postoperation, the abdominal wound had a purulent discharge from the distal end. The wound was opened and stitches were removed from the site of drainage, with the institution of daily wound dressing. By the fifth day of postsurgery, a dark patch was noticed to have developed in the skin over the right iliac fossa and measured about 5 cm in its widest diameter. At about the 7th day of postoperation, the dark dry patch had extended to the right hypochondrium, and a similar patch had appeared along the edges of the abdominal incision and the left iliac fossa. A diagnosis of anterior abdominal wall gangrene was made. On the 8th day of postsurgery, the patient was noticed to have developed a complete wound dehiscence () and a fecal fistula. He had fluid resuscitation and was taken back to the theatre on the 10th day after the first surgery, for wound exploration and debridement of the anterior abdominal wall gangrene. A new intestinal perforation was seen at about 2 cm from the initial perforation. The intestinal perforation was exteriorized as an ileostomy, and the abdominal wound closed with tension sutures. Postoperatively, the patient's condition remained unstable, with intractable shock. He died six days after the reexploration of septic shock. |
A healthy 36-year-old Caucasian woman gravida 1 was referred to our hospital at 6.3 weeks of gestation due to the presence of a cervical heterotopic pregnancy after an IVF cycle for tubal infertility with transfer of two embryos. She brought an ultrasound exam, performed at 5.5 weeks, showing the presence of two gestational sacs, one intrauterine and one cervical, each with an embryo with a heartbeat and yolk sac (Fig. ). On admission, transvaginal ultrasound confirmed the presence of two gestational sacs with corresponding embryos and cardiac activity, one located in utero (40 × 21 mm; CRL 6.9 mm) and the other in the cervix (32 × 19 mm; CRL 6.9 mm). On specular examination, the cervical gestational sac was visible in the cervical canal at about 1 cm from the external cervical os, dilated by about 1 cm. No blood loss was present. After an extensive consultation where the woman expressed her intention to do everything possible to safeguard the intrauterine pregnancy, while being aware of the risks related to the termination of cervical pregnancy, and after a multidisciplinary counseling between gynecologists and radiologists, we proposed to use MWA. After written informed consent was obtained, at 6.5 weeks, the patient received one session of MWA. Under transabdominal ultrasound guidance, the microwave antenna was introduced transvaginally inside the cervical gestational sac, and ablation was performed with 100-W output for 90 s (Emprint Ablation System with thermosphere Technology Medtronic; Medtronic, Minneapolis, MN, USA) (Fig. ). With this MW technology, the output and exposure time are evaluated based on the volume of the target lesion. It was considered that these parameters were the most suitable for obtaining better control and more accurate predictability of the ablated volume, so as to avoid nontargeted ablation. The procedure lasted 15 min overall was performed without anesthesia and with no discomfort for the patient; 1 g cefazolin was given intramuscularly at the same time. The patient did not require any pain medication after the procedure.\nAt the end of the procedure, the ablated gestational sac appeared as a homogeneously hyperechoic area, with a mean diameter of 1.8 cm and no flow signal at Color-Doppler US. Neither bleeding nor uterine contractions occurred after the procedure and in the following 3 days, when she was discharged. She was then followed on a regular basis and with monthly obstetric visits and ultrasound examinations that showed the persistence of nonhomogeneous, vascularized material within the cervical canal that was approximately 46 × 42 mm at 15.6 weeks and 25 × 25 mm at 33 weeks (Fig. ): however, as specular examination and cervical length were always regular, the hypothesis of a cervical cerclage was discarded. Pregnancy was otherwise uneventful.\nWith an elective cesarean section planned at 39 weeks, at 37.6 weeks, the patient was admitted at the hospital due to abundant vaginal bleeding with irregular uterine contractions, no cervical effacement or dilation present. An emergency cesarean section was performed in the suspicion of placenta abruption, not confirmed neither by the histological examination nor during surgery when it was seen that the blood loss came from the cervico-isthmic area, likely residual of the cervical pregnancy ablation. A live female of 2780 g, Apgar score 10/10, and umbilical arterial pH 7.31 was delivered. A Bakri balloon was placed to prevent further blood loss, which was 800 mL in total. The balloon was removed on the first postoperative day; hemoglobin concentration dropped from 12.2 g/dl before to 9.5 g/dl, 1 day after the cesarean section.\nThe postpartum course was regular, and the patient was discharged after 4 days, before discharge ultrasound revealed regular endometrium and endocervical canal. |
A 33-year-old male presented with a 1-week history of acute onset of difficulty in breathing, right-sided pleuritic chest pain with intermittent low-grade fever. Physical examination revealed an obese middle-aged man in severe respiratory distress using accessory muscles of respiration, tachypnoeic (RR 38 bpm), and severely hypoxic with SPO2 of 78% in room air. He was not cyanosed. His respiratory examination was significant for presence of diffuse course crackles bilaterally. He had a BP of 110/70 mmHg and PR 110 beats/min. The rest of physical examination was unremarkable. His chest X-ray showed diffuse alveolar and interstitial infiltrates bilaterally and the initial laboratory investigations were significant for Positive HIV antibodies. A provisional diagnosis of severe pneumonia due to Pneumocystis carinii infection was entertained with differential diagnoses of severe bacterial pneumonia and pulmonary tuberculosis. On the emergency basis, he was managed as per our standard treatment protocols in the ICU with 10 L of Oxygen, cotrimoxazole 1920 mg per oral q8hourly along with prednisolone 40 mgs per oral q12 hourly for probable PCP infection. He was also given intravenous ceftriaxone 1 g q 12hourly in combination with azithromycin 500 mg per oral q 12hourly for coverage of both typical and atypical bacteria. The patient rapidly deteriorated that and in spite of all the efforts he died just 10 h after admission. A consent was obtained for autopsy which was only limited to the chest. The gross histopathologic examination of the lungs revealed heavily congested lungs oozing blood-stained fluid with hyperemic and frothy small airways (Fig.). On microscopic examination of the tissue sections, interstitial edema which was mixed with hemorrhage with few lymphocytic infiltrates was seen. There was also presence of desquamated cells in the alveoli. Several round organisms with a thick capsule in the interstitial and alveoli together with foreign body giant cells were seen in some areas (Fig.). Periodic acid Schiff (PAS) staining was positive, and very thick capsulated organisms were highlighted (Fig.). According to our pathologist, these findings are consistent with pulmonary cryptococcosis. However, we did not see any hyaline membrane or foamy amorphous material-containing cell debris which is typical for PCP infection. The silver stain was not available in our settings. No acid-fast bacilli (AFB) which were detected on the Ziehl– Nielsen stain. A serum result which was traced later was positive for cryptococcal antigen. |
A 7-year-old girl presented with a slowly progressive corneal opacity in the left eye (OS). The parents first noticed opacity 1 year before, which slowly increased in size. The patient also had gradual diminution of vision for the past 6 months. The decrease in vision was not associated with any other ocular symptoms such as pain, redness, watering, or discharge. There was no history of trauma to the affected eye or contact lens usage. The patient did not have any complaints in the other eye and had not undergone any treatment for the pathology.\nOS examination revealed an intrastromal corneal cyst involving the nasal half of cornea and covering the pupillary axis (Fig. ). It measured 8 mm (vertical) by 6 mm (horizontal). It seemed to arise from a smaller-sized, intrascleral cyst (3 mm by 2 mm; Fig. ). The conjunctiva was freely mobile over the intrascleral portion of the cyst. The corneal cyst was filled with turbid fluid with multiple opaque particles floating in it. The surrounding stroma outside the cyst margin was clear. There was absence of corneal vascularization or any signs of trauma. The anterior chamber was well formed and clear. The rest of the anterior segment examination was normal along with a normal fundus.\nThe right eye had normal anterior and posterior segment on examination. BCVA in the right eye was 20/20, N6 and 20/200, N36 in OS. Based on the examination findings, a provisional diagnosis of primary corneoscleral cyst was made.\nAfter obtaining informed consent from the parents, surgical intervention was planned as the cyst covered the pupillary axis. Localized peritomy was performed to expose the underlying scleral cyst. The anterior wall of the cyst was removed by excision of the scleral roof. There was a narrow passage through the limbus, connecting the scleral cyst to the corneal cyst. Fluid was drained from the intrastromal part of the cyst, and the cavity was repeatedly washed with balanced salt solution (BSS). After thorough wash of the intrastromal cavity, the cyst collapsed. The base and sidewalls of the scleral cyst were scrapped to remove the epithelial cells. Bipolar wet-field cautery was used to cauterize the connecting track at the limbus. The partial thickness defect in sclera was covered with the preserved scleral graft to reduce the risk of complication due to scleral thinning. The conjunctiva was closed over it with 8–0 Vicryl sutures. The anterior chamber remained formed throughout the procedure, confirming the absence of communication with the cyst cavity.\nPostoperatively, the corneal cyst had collapsed with no recollection of fluid (Fig. ). The patient was followed up on days 1, 7, and 30, and 3 times monthly thereafter. The last follow-up was 18 months postoperatively. There was no recollection of fluid in the scleral part of the cyst, and the corneal cyst also did not recur. The patient regained BCVA 20/20, N6. Though the optical axis was clear, the affected part of the corneal stroma showed remnants of the debris in form of opacities, which persisted until the last follow-up. The study adhered to the tenets of the Declaration of Helsinki. Histopathological examination of the scrapped wall tissue showed epithelial cells. |
A three-year-old girl was referred from Niger to the Cheikh Khalifa International University Hospital for hepatic encephalopathy and deep pancytopenia progressing for three days before her admission. She had a pathological history of chronic constipation since the age of 18 months, treated regularly with large amounts of oral Senna preparations (2-3 g of dry Senna leaves added to a cup of water, given to the patient more than three times a week). She had previously been hospitalized eight months ago, in another hospital structure, for a severe clinical picture of acute hepatitis and bicytopenia (thrombocytopenia and leukopenia), with a good clinical and biological outcome under intravenous corticosteroid therapy with an oral relay. A follow-up blood test taken two months after this episode was strictly normal. She had no particular family history. The story of her current illness began with the onset of sharp abdominal pain, vomiting, greenish diarrhea, anorexia, fever of 40° C, and deterioration in general condition. She was first hospitalized in Niger, where a workup was carried out showing hepatic cytolysis with negative hepatitic serologies and a blood smear negative for the malaria parasite. She received treatment based on third-generation cephalosporin and aminoglycoside. Due to the worsening of her condition, with the appearance of disturbances in consciousness, hair loss, facial erythroderma and bicytopenia in biology, she was transferred to us for continued treatment.\nOn admission to the pediatric intensive care unit (ICU), the child was unconscious with a Glasgow score of 11/15 and generalized hypotonia, but without sensorimotor deficit or signs of brain engagement. She was febrile at 40° C and polypneic at 40 cpm, with rhonchi in the pulmonary fields and correct saturation at 98% in ambient air. She was hemodynamically stable with a heart rate of 97 bpm and blood pressure of 118/88 mmHg. She presented with gum bleeding, mild facial erythrosis with scaly cheeks, mild jaundice, telogen effluvium, and vesicular and erythematous lesions of the anal margin. Otherwise, she had no lymphadenopathy or hepatosplenomegaly, and her throat was clean.\nHer blood count revealed anemia at 9.5 g/dl, severe thrombocytopenia at 20,000/mm³, severe leukopenia at 730/mm³, with neutrophils at only 370/mm³ and lymphocytes at 300/mm³. The level of C-reactive protein had returned very high to 218 mg/L, procalcitonin had increased to 2.20 ng/mL, aspartate transaminase (AST) to 290 IU/L and alanine transaminase (ALT) to 186 IU/L, total bilirubin level was at 34 mg/L, unconjugated bilirubin level at 9 mg/L, conjugated bilirubin level at 25 mg/L, Gamma-glutamyl transpeptidase level at 65 UI/L, alkaline phosphatase at 730 UI/L, prothrombin time at 47%, and creatinine serum level at 5.4 mg/L.\nRadiologically, a brain MRI, carried out on admission, showed no abnormalities. A chest scan revealed a double focus of bilateral pneumonia (Figure ). Abdomino-pelvic ultrasound and abdominal CT scan revealed diffuse fatty liver disease (Figure ). The cardiac ultrasound was normal.\nRegarding the infectious assessment, the urine analysis revealed hematuria, without leukocyturia or bacteria, the cytobacteriological examination of the sputum was also sterile, the thick smear test was negative, the serological tests for viral hepatitis A, B, and C were negative. The HIV serological test, screening for Epstein-Barr virus, cytomegalovirus and parvovirus B19 in blood by polymerase chain reaction (PCR) were also negative. Blood cultures on standard media and on Sabouraud agar did not identify any bacteria. Tests for autoimmune hepatitis were negative. Toxicological screening in blood and urine were negative. The inflammation assessment was not in favor of a macrophage activation syndrome, with serum fibrinogen level at 4.68 g/L, serum ferritin at 423 ng/mL, sedimentation rate at 150 mm, serum triglycerides at 1.24 g/L, and total serum cholesterol at 0.63 g/L. The myelogram, carried out on the second day of hospitalization, showed regenerative marrow with moderate inflammation. There were no signs in favor of malignancy. A liver biopsy was not done due to hemostasis disorders.\nThe diagnosis was acute hepatitis associated with pancytopenia, most likely toxic, based on the child's history. Admission treatment included oxygen therapy, central line placement, intravenous rehydration, broad-spectrum antibiotic therapy with ceftazidime and amikacin, because she was neutropenic and was on ceftriaxone three days earlier with persistent fever and aggravation of C-reactive protein and procalcitonin serum levels. In addition, she was given antifungal and antiviral drugs, red blood cell transfusions and platelets. The clinical course was marked by the persistence of fever and coma for the first three days with recurrent digestive bleeding and loss of all hair. On the fourth day, the child began to wake up with a regression of the fever but with the appearance of painful edema of the left lower limb. A venous Doppler ultrasound revealed the appearance of left femoro-popliteal thrombophlebitis extending to the common iliac vein. The catheter was removed, and treatment with curative-dose enoxaparin was started. Follow-up blood work showed an increase in platelets at 157,000/mm³, leukocytes at 2,227/mm³, and neutrophils at 900/mm³. C-reactive protein dropped to 30 mg/l (Table ). The liver function test was appropriate. The clinical course was favorable, with appetite recovery and hair regrowth.\nShe was released from the hospital after 15 days and put on anticoagulant treatment for three months. A follow-up blood tests one month and three months after discharge were completely normal. Doppler control ultrasound of the femoral vein revealed complete resolution of the thrombosis three months later. |
A 51-year-old female with a history of hypertension and atrial fibrillation taking warfarin presented to the emergency department after sustaining a ground level fall. Her Glasgow coma scale (GCS) score was 7 (E: 2/V: 1/M: 4). She was intubated for airway protection. Her neurological exam was significant for withdrawal from painful stimulus, bilaterally reactive pupils, brisk deep tendon reflexes (DTR), and bilateral upgoing toes. Computed tomography (CT) head showed a right temporal contusion with surrounding vasogenic edema and a small right frontal subdural hemorrhage (). Computed tomography angiography (CTA) was negative for any vascular abnormality. Her international normalized ratio (INR) was 1.8. The coagulopathy was rapidly reversed with 4-factor prothrombin complex concentrate (25 U/kg). She was admitted to the neurosciences intensive care unit. An external ventricular device was placed with opening ICP of 14 mmHg. Overnight, the ICP increased to 25 mmHg and remained between 18 and 22 mmHg for the next 24 to 48 hours. She was treated with osmotherapy (i.e., mannitol and hypertonic saline) and propofol sedation for elevated intracranial pressure (ICP). Her CEEG showed moderate diffuse background slowing and excessive beta and spindle activity likely from sedation. Her elevated ICP responded to cerebrospinal fluid (CSF) drainage, osmolar therapy, and sedation. 72 hours after admission, her ICP became refractory to these treatments, and she required pentobarbital coma which was titrated to burst suppression. Her ICP was controlled between 7 and 20 mmHg. Repeat CT head showed increased vasogenic edema with no new hemorrhages. Over the next few days, pentobarbital was weaned and transitioned to propofol for sedation. CEEG on propofol now showed diffuse slowing and generalized periodic discharges with TW (). She then developed paroxysmal episodes of intracranial hypertension with ICP ranging up to 50 mmHg lasting a few minutes. During these episodes, CEEG showed attenuation of TW (). Once her intracranial hypertension was reduced with osmotic therapy and sedation, TW reappeared to the pattern shown in . Patient's EEG patterns never showed seizures throughout the entire course of monitoring. She continued to improve clinically and was eventually discharged to rehabilitation center for further therapy. |
A 31-year-old female, gravida 2, para 2 (G2 P2), referred to the gynecologic clinic with a main complaint of secondary infertility during the last twelve months. Written informed consent was obtained from the patient for publication of this case report and any accompanying images. The patient had two previous C-sections. Her menstrual cycles were ovulatory. Spermogram was unremarkable and hormonal assay did not show any abnormality. HSG was performed and revealed a migrated copper IUD with its long tail out of the uterine cavity (Fig. ). Plain abdominopelvic radiography also indicated a rotated T-shaped IUD in the pelvis (Fig. ). A transvaginal ultrasound was also performed by a skilled radiologist who reported a copper IUD in the bladder lumen with a small portion of it within the bladder musculature. The patient had taken multiple courses of antibiotics for urinary tract infection (UTI), but her symptoms never disappeared. The patient also underwent cystoscopy for recurrent infection last year, but no pathological finding was detected. Eventually, the patient said that her symptoms were related to the possible adhesions following two previous operations. The patient had a history of IUD insertion following her last C-section about eight years ago. After three years, however, the patient decided to remove it due to recurrent vaginal secretions. Three years later, her IUD was expelled, and another copper IUD was inserted. The patient removed the other copper IUD for becoming pregnant about two years ago. The patient was very confident of its removal, but her recent HSG, interestingly, demonstrated a rotated copper IUD in the pelvic cavity. Physical examination was essentially normal. A baseline complete blood count, urea, and creatinine levels were normal. The patient was candidate for a hysteroscopic cystoscopy. Hysteroscopy was normal except for a small fibrotic defect at the lower segment of the uterus. During cystoscopy, the long tail of the copper IUD was found on the posterolateral border of the bladder far from ureteral offices (Fig. ). The two short arms adhered to each other were embedded in the mucosal and muscular layer (Fig. ). No calculus was observed within the bladder cavity. Using glycine as the media, a mono-polar loop entered the bladder. A gentle and brief cautery was applied on the mucosa where the shadow of a short arm of the device was observed. The copper IUD was safely removed through the urethra using a special grasper. There was no major defect in the place of the copper IUD in the bladder. The bleeding points were effectively cauterized (Fig. ). The patient was discharged the next day with an indwelling catheter. After catheter removal, the patient did not complain of any urinary symptoms. |
A 59-year-old Japanese woman was transferred to the emergency unit of our hospital for evaluation of acute abdominal pain. She had a history of conservative treatment for a spontaneous NLC rupture 1 month previously in another hospital (Fig. ).\nOn examination, she had a pulse rate of 115 beats/min, blood pressure of 112/68 mmHg, and no fever. Her abdomen was flat but hard and painful. She also exhibited obvious tenderness and muscular defense upon arrival. Blood tests revealed acute inflammation and anemia (Table ). The levels of the tumor markers carcinoembryonic antigen and carbohydrate antigen 19-9 were within normal limits. Enhanced CT showed hepatic cysts and ascites. The largest cyst was found on the lateral segment; it exhibited an irregularly shaped surface and was present within a partially high dense lesion (Fig. ). The cyst volume had obviously decreased during the 1-month period before presentation to our hospital (Fig. , below). However, no neoplastic features such as thickened walls, papillary projections, or calcifications were found. The ascitic fluid collected by abdominal puncture was brown and muddled. The bilirubin level of the ascitic fluid was normal; however, the neutrophil and hemoglobin levels were high. Bacterial culture of ascetic fluid was negative (Table ).\nBased on the patient’s clinical course and investigation findings, we diagnosed panperitonitis associated with rerupture of the liver cyst and accompanied by hemorrhage. Laparotomy was performed for cyst fenestration and intraperitoneal drainage.\nDuring the operation, we found the perforation site on the ventral side of the cyst (Fig. ). The perforation was approximately 3 cm, and the cyst wall was fibrous. Although no obvious hematoma was detected, approximately 600 ml of ascitic fluid was found. The ascitic fluid was brown and slightly muddled. No nodules or other specific findings, indicating signs of malignancy, were found. We resected the ventral wall of the cyst followed by cholecystectomy and cholangiography. Cholangiography showed no bile leakage on the inner wall. We performed cyst argon beam coagulator ablation of the inner wall and covered the site with an omental transposition flap. The patient tolerated these procedures well and was transferred to the intensive care unit in a hemodynamically stable condition. Pathological examination showed only fibrous connective tissue covered with simple cuboidal epithelium; there was no evidence of malignancy (Fig. ). The patient received antibiotics (PIPC/TAZ) until postoperative day 5. She recovered without any adverse events and was discharged on postoperative day 8. She was in good condition without recurrent symptoms 2 years postoperatively. |
A 22-year-old woman presented with increased abdominal girth which she had experienced for 5 months. Physical examination and pelvic ultrasonography revealed a 15 cm right ovarian solid mass. The patient underwent an exploratory laparotomy. The intraoperative findings were unremarkable except for the right ovarian mass. Peritoneal washing fluid was collected for cytology. A right salpingooophorectomy, right pelvic and para-aortic lymph node and omental biopsies, and appendectomy were performed. The initial diagnosis of the right ovarian mass was FIGO stage IA endometrioid adenocarcinoma grade 2. Postoperatively, the patient was referred to Chiang Mai University Hospital for further management. The review of the histologic slides of the initial tissue samples raised a differential diagnosis of Sertoli cell tumor. Immunohistochemical staining was performed and the residual gross specimen was reviewed with additional tissue sampling. The pathological diagnosis was reported as proliferative struma ovarii with atypical features, and a clinical metastatic work-up was recommended.\nThe patient underwent a thyroid scan which showed no evidence of a primary thyroid lesion. No clinical evidence of a metastatic lesion was detected in the chest X-ray and abdominal computed tomography (CT) scan. Close surveillance was planned, but the patient was lost to follow-up. Fifteen months after surgery, she presented with a dry cough for 1 month. A chest X-ray and CT scan revealed multiple and bilateral pulmonary nodules, consistent with metastatic lesions. No intra-abdominal disease was identified in the CT scan. The serum thyroglobulin level was 247.3 ng/mL (normal range ≤ 40 ng/mL). Recurrence of malignant struma ovarii was clinically considered. A pulmonary biopsy was not performed. The patient underwent a total thyroidectomy, followed by high dose radioactive iodine (I-131) therapy. The resected thyroid specimen was unremarkable. The clinical condition of the patient was stable and there was no progression of the pulmonary nodules seen after 3 episodes of iodine treatment during a 2-year period.\nForty-two months after the surgery, the patient developed hemoptysis and dyspnea. Chemotherapy (cisplatin and Adriamycin) was started and continued for 6 cycles. Five years after surgery, there was a progressive enlargement of the pulmonary nodules, accompanied by weakness of her left arm due to intramedullary spinal cord metastasis. The patient died of the disease 7 years after the initial surgery.\nMacroscopically, the right ovarian mass was a solid yellow white mass with areas of necrosis and hemorrhage (). The capsule was intact. The review of the residual gross specimen with additional serial sectioning revealed few gelatinous tan foci and a 1 cm focus of gray sebaceous material.\nMicroscopically, the ovarian mass was composed of relatively uniform cuboidal to columnar cells with round to oval nuclei, predominantly arranged in a tubular pattern (Figures and ). Dilated gland-like spaces with papillary-like infolding lined by elongated columnar cells simulating endometrioid adenocarcinoma were focally observed (Figures and ). Solid tubules, a trabecular arrangement, and solid cell nests or an insular pattern were also present. The insular pattern () accounted for approximately 20% of the tumor tissue. Mitotic activity was variable, ranging from absent or rare in the tubular areas to 11 in 10 high-power fields in the solid areas (). Large zones of previous infarction with hyalinized fibrosis were observed in the macroscopically necrotic areas. However, small foci of coagulative tumor cell necrosis were present within the neoplastic cell sheets (). Neither true papillary structures with fibrovascular cores nor ground glass/grooved nuclei were observed. Areas of typical thyroid-type tissue () and a focus of mature cystic teratoma (dermoid cyst with cartilage) were identified in the second round of tissue sampling. Neither capsular involvement nor lymphovascular invasion was detected. Immunohistochemical stains showed a diffuse positive reaction for pancytokeratin (AE3/AE3), cytokeratin 7, and thyroglobulin (), with focal reactions for epithelial membrane antigen (EMA) and vimentin. The immunostains for calretinin, CD99, chromogranin A, and synaptophysin were negative. |
The authors have obtained the patients' parent's informed written consent to publish this case report.\nA 10-year-old boy (Case 3) presented with back pain after performing a handstand without a fall during a physical education session. He had no significant past medical history. At the initial visit, there was tenderness on his back, especially on the spinous process at T11. Neurologic findings were normal. Plain radiographs were unremarkable. MRI scans indicated low signal on T1WI, relatively high signal on T2WI, and high signal on short tau inversion recovery (STIR) images in the upper part of the vertebral body at T11 without deformation of the cortical endplate (). There was no high signal in the posterior elements of the spine, such as the interspinous ligament. A diagnosis of VBB was made. The patient was treated conservatively with a soft thoracolumbar brace and instructed not to participate in physical activity for a month. At follow-up 1 month later, the patient had no back pain, the tenderness on the spinous process had diminished, and the signal changes in the vertebral body seen on T1WI, T2WI, and STIR images had disappeared (). There was no residual deformation of the cortical endplate.\nThe other 5 children had similar clinical manifestations (). The onset of back pain in all 6 children coincided with mild physical activity, such as performing a handstand, jumping rope, or Japanese box vaulting. None of the children reported a fall. We did not check any blood test for all 6 patients because they had no past medical history. There was tenderness on the corresponding spinous process at the initial visit in all cases. Imaging findings were similar; plain radiographs were unremarkable, and MRI scans showed low signal on T1WI and high signal on T2WI and STIR. In all cases, the back pain and signal changes seen on MRI resolved after conservative treatment with a brace and rest for 1 month. |
A 56-year-old male patient was referred to our hospital after being diagnosed with thoracic esophageal cancer. Upper gastrointestinal endoscopy revealed a 9-cm, type 2 tumor in the middle thoracic esophagus. Histological examination of biopsy specimens confirmed squamous cell carcinoma. Computed tomography (CT) of the chest revealed a thick wall around the middle thoracic esophagus, a mediastinal lymph node metastasis, and a giant 9-cm bulla at the apical portion of the right lung (Fig. ). The clinical stage was IIIa (T3, N1, M0) according to the Union for International Cancer Control, seventh edition. Since it appeared that dissection of the upper mediastinum would most likely require resection of the right giant bulla, a two-stage operation for esophageal cancer was planned, as it is our hospital’s policy to plan a two-stage operation for risky cases.\nDuring the first-stage operation, right thoracic subtotal esophagectomy and cervicothoracic lymph node dissection were performed under general and epidural anesthesia. There was marked adhesion between the giant bulla and the chest wall, and bullectomy was performed. During dissection of the lower thoracic esophagus, an approximately 3-cm pleural window was made in the left mediastinal pleura, which led to a connection between the right and left thoracic cavities. The thoracic esophagus was dissected above the diaphragm, the mediastinal pleural window was not closed, a drainage tube was inserted from the right side of the thorax to the apical portion of the right lung, and the chest was closed. Esophagostomy was performed at the neck, while jejunostomy was performed by laparotomy. After the surgery, aspiration via a drainage tube at −10 cmH2O was performed continuously, and the drainage tube was removed on postoperative day 5. The patient’s course after the first-stage operation was uneventful, and no clear respiratory symptoms occurred. Although we gave the patient loxoprofen 600 mg/day and buprenorphine 0.4 mg/day as analgesic drugs in addition to epidural anesthesia, the patient complained of postoperative pain and was unable to expectorate sputum sufficiently.\nFourteen days after the first-stage operation, the patient underwent laparotomy as the second-stage operation to reconstruct a narrow gastric tube via a retrosternal route. The abdominal esophagus was dissected from the esophageal hiatus. The esophageal hiatus was sutured. Neither dyspnea nor hypoxemia was observed after the second-stage operation. PaO2 of the patient was 71 mmHg in room air. However, an inflammatory reaction associated with a white blood cell count of about 11,000/μl and C-reactive protein levels of 6.21 mg/dl continued; on day 27 after the first operation, thoracoabdominal CT was performed, showing retrocardiac pulmonary atelectasis. Blood flow from the left pulmonary artery to the atelectatic lung was observed, and the patient was diagnosed with a retrocardiac left lung hernia in which the left lower lobe was displaced into the right thoracic cavity (Fig. ). At bronchoscopy, bronchial occlusion was observed at the base of the left lung, and although it was possible to pass the bronchoscope, the occlusion was not resolved (Fig. ). This was thought to be due to bending of the bronchus. Assuming that the inflammatory reaction was due to the effect of the lung hernia, a diagnostic thoracoscopy of the left chest cavity was performed.\nAt diagnostic thoracoscopy, the left basal segment of the lung was atelectatic and reddish and had herniated into the right thoracic cavity through an opening between the aorta and pericardium (Fig. ). The herniated lung tip adhered strongly to the subcarina, and a repair operation by thoracotomy was necessary. At a left seventh intercostal thoracotomy, synechiotomy was performed. The left basal segment was re-integrated into the left thoracic cavity, and neither ischemia nor necrosis was observed. The hernial orifice was closed by suturing the mediastinal pleura. A drainage tube was inserted into the left apical portion of the pleural cavity, while another was inserted into the portion of the mediastinum into which the lung had herniated, both via the left thoracic cavity, and the chest was then closed. The patient’s postoperative course was uneventful. The patient is currently being followed as an outpatient, and no recurrence of the lung hernia has been observed.\nIn the present case, the mechanism of retrocardiac lung hernia development was likely due primarily to the resection of the giant bulla in the apical portion of the right lung. It is possible that, because the volume of the right thoracic cavity was reduced by the removal of the giant bulla, the left lung intruded into the right thoracic cavity to compensate for the reduced volume. In addition, the complication may have occurred because the contralateral pleura was opened at the time of dissection of the thoracic esophagus, as often happens, and because the left lung developed atelectasis as a consequence of insufficient expectoration of sputum due to postoperative pain. Thus, the left lung was likely displaced into the right thoracic cavity as a result of the combined effects of all of the above possible causes, resulting in the retrocardiac lung hernia.\nRegarding continuous drainage in the thoracic cavity, we believe that the lung displacement occurred toward the side of continuous drainage. As we did in the present case, continuous drainage in the right thoracic cavity was performed by John et al. [] in the published case of retrocardiac lung hernia, and in both cases, the left lung herniated into the right thoracic cavity. The pressure in the thoracic cavity on the side of the drainage became slightly lower than that in the contralateral thoracic cavity, and this may have caused the herniation to occur more easily.\nIn the present case, gastric tube reconstruction was performed via the retrosternal route. Therefore, the space created at the site of the esophagus could also have contributed to this complication. On the other hand, in the case of John et al. [], the lung hernia developed between the heart and a gastric tube that was reconstructed via a retromediastinal route. Therefore, it remains unclear whether the reconstruction route could be the cause of a retrocardiac lung hernia.\nCT and bronchoscopy are useful for the diagnosis of retrocardiac lung hernia. CT, in particular, should demonstrate an atelectatic lung in the retrocardiac position, making it easy to diagnose the hernia. During bronchoscopy, an occlusion due to the bending of the bronchus of the herniated lung is expected. Characteristically, although the bronchoscope can pass through the occluded part, it will not resolve the occlusion.\nIn our case as well as in that of John et al. [], the patient needed surgical repair. In our case, because of the adhesion of the herniated lung to the sites of esophagectomy and cervicothoracic lymph node dissection, spontaneous recovery was unlikely. Thus, the most effective treatment for retrocardiac lung hernia may be synechiotomy via thoracotomy. |
A 42-year-old male with unremarkable medical or surgical history presented to our hospital with a 3-month history of progressive left ankle pain and swelling, associated with low grade temperature, sweating and weight loss. There was no history of trauma. Systemically, his vital signs were stable and he was limping but was able to walk with a walking stick. Local examination indicated pronounced swelling and warmth, dark discolorations of the skin with moderate-to-severe tenderness of the ankle and distal third of the leg. No palpable lymph nodes were detected. His ankle range of motion was restricted due to pain and swelling. The blood work revealed normal erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), white cell count (WCC), procalcitonin and hemoglobin (Hgb) level. Left ankle radiography showed soft tissue swelling around the joint with an abnormal bone density at the distal end of the left tibia ().\nMagnetic resonance imaging (MRI) with and without contrast of the ankle revealed extensive bone marrow and soft tissue edema affecting the distal metadiaphysis of the tibia with a reactive small joint effusion and a subchondral small fluid-like collection (2.5 × 2 × 1.55 cm3) in dimension, indicating an aggressive lesion most likely an inflammatory process/(osteomyelitis) ().\nEarlier images of a three-phase bone scan showed an increase uptake over the left ankle joint with intense hyper vascular activity which could be related to bone infection ().\nA gallium scan followed by whole body scan /T/ HYBRID SPECT CT of the knee showed multiple intense gallium uptake drainage lymph nodes in the popliteal and inguinal regions with the possibility of a neoplastic process as a differential diagnosis ().\nCT of the chest showed two ground glass pulmonary nodules at the left upper lobe and the apical segment of the left lower lobe ().\nA tissue biopsy was strongly recommended. Patient was taken to the operating room and after preparation, draping under spinal anesthesia, two milliliters (2 mL) of serous fluid was aspirated from the ankle joint with a soft tissue and a bone biopsy taken and sent for histopathology studies. It showed diffuse infiltration of large atypical lymphocytes with frequent mitotic figures and a destructive behavior toward the bone and the surrounding soft tissue consistent with diffuse large B-cell NHL. It is worth mentioning that after the biopsy the patient disclosed that his younger brother was previously diagnosed with the same disease and is currently in complete remission. Neoplastic cells were found to be diffusely positive for CD10, CD20, CD45, CD79a and MUM1, faintly positive for BCL2 and BCL6, while negative for EBER ISH-, CD5-, CD30-, CYCLIN D1-, C-MYC and ALK1. The proliferation fraction on Ki-67 was 80% positive. It was confirmed that the cell of origin is germinal center–type diffuse large B-cell lymphoma (GCB—DLBCL) ().\nPatient was referred to the Hematology Oncology Center where he had six cycles of immunochemotherapy regimen (R-CHOP) in the form of rituximab, cyclophosphamide, doxorubicin hydrochloride, Vincristine and Prednisone combined with involved-field radiation therapy (IFRT) at a dose of 30 Gy in 15 fractions to his left lower limb and regional lymph nodes with no refractoriness to therapy in between. An end of treatment 18-FDG PET/CT imaging revealed interval regression in FDG activity of previously described left distal tibial lesion at 12 months after combined chemoradiotherapy with no new FDG avid focal bone lesions, lymphadenopathy or lesions elsewhere. At 16 months of follow-up, he showed marked improvement in his symptoms and the 18-FDG PET/CT imaging was consistent with complete metabolic response. |
A 34-year-old male of mixed African American and Southeast Asian (Cambodian) descent presented to a regional hospital with progressive dyspnea on exertion. He had a known history of beta thalassemia major (β0/β0) previously managed with splenectomy and jaw surgery due to extramedullary hematopoiesis. The patient had been lost to follow-up after the patient moved away from the immediate area and the patient reported limited contact with medical care for approximately 15 years. His last RBC transfusion was approximately one year prior to this hospitalization, but it was noted that he had very few blood transfusions during his adult life and was never placed on an exchange transfusion protocol.\nPhysical examination on presentation to our facility was significant for labored breathing, slight stature, proximal muscle wasting, frontal bossing, fine crackles and wheezing at the lung bases, and sinus tachycardia. Sensorium, including orientation, was fully intact. The patient reported marked fatigue with generalized weakness, but no focal deficits or cranial nerve abnormalities were observed.\nEarly in the hospital course, the patient was transferred to our tertiary facility for management of acute hypoxemic, hypercapnic respiratory failure. This presentation was complicated by cor pulmonale secondary, presumed to be secondary to beta thalassemia, and required prolonged high-pressure face mask ventilation. The initial laboratory values are presented in Table . Initial hemoglobin electrophoresis revealed HbF 96% and HbA2 4%, HbA or hemoglobin S (HbS) were unmeasurable. Transthoracic echocardiography at the outside facility revealed a preserved ejection fraction of 55%, severe tricuspid regurgitation, severe dilatation of the right atrium and right ventricle, patent foramen ovale, and right ventricular systolic pressure of 76 mmHg. Iodine contrast-enhanced computed tomography imaging of the thorax was negative for pulmonary emboli and showed “multiple soft tissue masses in the anterior left hemithorax, as well as bilateral in the posterior paraspinal region, largest lesion on the right measuring over 9cm in size” (Figure , ). During the course of the evaluation, a biopsy was planned to confirm the diagnosis of extramedullary hematopoiesis but was changed to Nuclear Medicine Bone Marrow Scan due to technical difficulty and concern for unnecessary risk (Figure -).\nThe patient was initially managed with pressure support ventilation and diuresis with intravenous furosemide, which were tolerated with good urine output. Hydroxyurea was added to try to reduce extramedullary hematopoiesis and the associated masses, initially with 1 gram daily, which was then increased to 1.5 grams daily. Though hydroxyurea is known to increase HbF, it was added to the regimen in an effort to reduce extramedullary hematopoiesis and the associated masses. Epoprostenol nebulization was used to manage pulmonary hypertension with plans for right heart catheterization once the patient was more stable. However, the patient evolved poorly, with the need for inotropic support with infusional milrinone.\nOnce the patient’s blood pressure stabilized, automated RBC exchange transfusion was planned due to the high baseline hemoglobin level. A separate vascular catheter was placed, for the purposes of exchange transfusion, and four units of donor-matched RBCs were transfused via automated exchange transfusion with subsequent hemoglobin electrophoresis showing HbF 55%, HbA 42%, and HbA2 3%. Following this procedure, the patient clinically improved, coming off pressure-supported ventilation to high-flow nasal oxygen as well as milrinone, and was weaned to nasal cannula oxygen within one week. He was discharged with plans for monthly outpatient RBC exchange transfusions. |
A 38-year-old Brazilian man presented with a 4-day history of chest pain radiating to his abdomen and back. He was diagnosed with an extensive Stanford type B aortic dissection originating at the base of left subclavian artery extending into the iliac arteries. With the exception of the left renal artery, visceral branches were supplied by the true lumen. He was managed conservatively with blood pressure control and discharged home. On computed tomography (CT) aortogram 8 weeks later, the dissection appeared stable, however, the diameter of the distal thoracic descending aorta had increased to 64 from 59 mm. His arch was deemed unsuitable for stent grafting due to an acute angle (60-degrees), resulting in a Gothic arch; and he was planned for open surgical repair.\nThree months later, the patient represented with severe left sided chest pain. A CT aortogram demonstrated fusiform dilatation of the distal arch and aorta measuring 73 × 69 mm () with interval false lumen dilation. The decision was made to proceed with an open thoracoabdominal aortic aneurysm (TAAA) repair utilising cardiopulmonary bypass with deep hypothermic circulatory arrest. A pre-operative cerebrospinal drain was placed to decrease the risk of spinal ischaemia. The patient was positioned in left lateral position with a thoracoabdominal incision made through the fifth intercostal space. Retroperitoneal dissection revealed vessels of good calibre and an extensive TAAA (). Peripheral cardiopulmonary bypass was instituted via the left femoral artery and vein utilising an 8 mm Dacron graft, and a 25Fr venous cannula. The patient was cooled to 18 degrees Celsius and placed in Trendelenburg positioning for clamping of the mid-thoracic aorta.\nThe aneurysm was incised and the dissection flap unroofed with a 2 cm cuff created for the proximal anastomosis using a 26 mm Dacron graft. Arterial inflow was established via an 8 mm sidearm, with clamping of the femoral line, deairing of the cerebral circulation and rewarming of the patient. The Dacron graft was then clamped proximal to the arterial inflow and femoral bypass reinstated with the clamp moved to above the diaphragm. Multiple small intercostal arteries were oversewn, with two large intercostals at T10 controlled with Fogarty catheters and anastomosed utilising separate 8 mm Dacron grafts. The cross-clamp was moved to above the renal arteries, allowing a Carrel patch containing the coeliac trunk and superior mesenteric arteries to be fashioned. Continuous perfusion to the superior mesenteric artery was provided via a 12Fr cannula. The femoral inflow was clamped, and the abdominal aortic clamp removed, with fenestration of the aorta to ensure the left femoral artery was supplied by the true lumen. A size 28 mm Dacron graft was anastomosed to the suprarenal aorta, a clamp placed superior to the suture line, and femoral inflow restored. The Carrel patch containing mesenteric vessels was anastomosed to the anterior aspect of the graft.\nThe graft was positioned through the aortic opening in the diaphragm and the 8 mm Dacron graft supplying the intercostals anastomosed towards the posterolateral. The 26 and 28 mm Dacron grafts were anastomosed in the mid-thoracic aorta with deairing and clamping of femoral inflow. The patient was weaned from bypass without difficulty and the venous line removed with repair of the femoral vein. The femoral and thoracic 8 mm Dacron inflow grafts were ligated and divided, with repair of the diaphragm and costal margins undertaken. The bypass time was 312 minutes and upper body circulatory arrest time 39 minutes. He was transferred to intensive care in a stable condition. His immediate postoperative course was complicated by vasoplegia, requiring noradrenaline, and coagulopathy requiring massive transfusion.\nThe patient became febrile on day 6 postoperatively and was diagnosed with ventilator-acquired pneumonia and commenced on tazocin and vancomycin. He remained febrile, with surgical wound dehiscence and escalation of his antibiotics to meropenem and vancomycin. Despite adequate treatment of his pneumonia and wound dehiscence with antibiotics and surgical debridement, 3 weeks later the patient had persistent tachycardia to 180 bpm without haemodynamic compromise. Transthoracic echocardiography revealed moderate global impairment with trivial pericardial effusion. Postural telemetry () demonstrated a sitting heart rate of 101 bpm that increased to 144 bpm on standing and 164 bpm on mobilisation without incrementation of the blood pressure (110/54 mmHg sitting, 100/67 mmHg standing), consistent with POTS. The patient was commenced on metoprolol, fludrocortisone and ivabradine with improvement in tachycardia. He received multiple blood transfusions with increase in haemoglobin from 90 to 110 g/L. He was discharged home 6 weeks after his operation with no disability. |
A 37-year-old gravida 4, para 4 was referred to our gynecology clinic by her general practitioner 16 months after vaginal delivery, with symptoms of postcoital bleeding for a month. There was no history of itching or offensive smell. She was in the period of lactation without cycle of menstruation. Routine smear test and screening for high-risk HPV test were both negative 3 years ago. The general practitioner referred the patient to the gynecology clinic after finding an abnormal cervix when he intended to take a smear. The gynecological examination revealed a vegetative mass protruding from cervical canal to vagina, 4 × 3 cm in diameter (Fig. ).\nIn the ultrasonographic examination, uterus was retrovert in position, myometrium was homogeneous, the thickness of endometrium was normal, and intrauterine device was seen in the uterine cavity. Magnetic resonance imaging (MRI) showed a suspicious hyperintense 4 × 3 × 1 cm solid mass arising from posterior lip of the cervical canal reaching fornix. No parametrial involvement or significant retroperitoneal lymph node enlargement was detected. Clinical diagnosis of stage 1B2 (International Federation of Gynecology and Obstetrics [FIGO] 2009) was made based on the findings. Punch biopsies of the tumor were taken and sent for histopathological examination.\nThe diagnosis was moderately differentiated endocervical adenocarcinoma originating from the cervix. Radical hysterectomy with bilateral salpingo-oophorectomy as well as pelvic and para-aortic lymph node dissection was performed. The final pathology result was consistent with the previous report which showed moderately differentiated mucinous endocervical adenocarcinoma. The tumor size was 4 × 2.5 × 1 cm. The depth of tumor in the hysterectomy specimen was 1 cm. No parametrial invasion was detected. There was no invasion to uterine corpus or vagina. In total, 30 lymph nodes were extracted. There was no evidence of metastasis to the lymph nodes or lymphovascular invasion. The patient did not receive adjuvant therapy following the hysterectomy. |
A 45-year-old Haitian American female with no significant medical history presented with a six-month history of progressive solid food dysphagia and a one-month history of odynophagia. The patient had lost 15 pounds and was only able to tolerate pureed food or liquids. She had experienced no symptomatic relief on omeprazole 40 mg twice daily for the past two months and did not use tobacco, alcohol, or illicit substances. Her initial blood count and metabolic panel were unremarkable. An esophagogastroduodenoscopy (EGD) revealed erythematous and friable mucosa with ulcerations in the proximal esophagus (). There was a stricture encountered at 15 cm from the incisors through which the gastroscope could not be traversed. Biopsies were taken from the inflamed esophageal mucosa and the proximal lumen of the stricture. Brush cytology was collected through the stricture as there was a concern for malignancy. A subsequent barium esophagram and upper GI series demonstrated 2 cm irregular narrowing in the cervical esophagus, but no abnormalities in the rest of the esophagus, the gastroesophageal junction, stomach, duodenum, or proximal jejunum. Contrast-enhanced computed tomography (CT) of the chest showed no acute esophageal, mediastinal, pulmonary, or cardiac pathology. The esophageal biopsy indicated acute and chronic inflammation with filamentous sulfur granules consistent with Actinomyces; rare fungal hyphal elements were additionally identified (Figures , , and ). The cytology was negative for malignant cells and the acid-fast bacilli (AFB) stain was negative, ruling out Nocardia as a potential pathogen. The patient was started on intravenous (IV) Penicillin for a diagnosis of esophageal actinomycosis and oral Fluconazole for a presumed Candida coinfection given concurrent fungal elements. Her human immunodeficiency virus (HIV) status was negative and her fasting blood glucose was within the normal range. She was discharged on Fluconazole 200 mg daily for 2 weeks and IV Penicillin G 3 million units every 4 hours for 6 weeks followed by oral Penicillin to complete a total of 6 months of antibiotics. Her esophageal culture eventually grew normal oropharyngeal flora and rare Candida albicans. The patient returned to the hospital 6 weeks later due to an acute right upper extremity deep venous thrombosis (DVT) associated with her peripherally inserted central catheter (PICC). Her odynophagia had improved but she was still not able to advance her diet. Repeat EGD was performed, which showed resolution of her esophagitis, but a remaining stricture in the proximal esophagus (). During an attempt to dilate the stricture, a small mucosal tear was induced. The dilation had to be deferred at that point pending mucosal healing. A repeat barium esophagram illustrated the previously identified stricture with no perforation. The patient's PICC was removed and she was discharged on oral amoxicillin 875 mg twice daily to complete the 6-month course. The patient was given a follow-up appointment in our GI clinic where she would be reassessed for esophageal stricture dilation. Unfortunately, she was lost to follow-up. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.