text
stringlengths 746
31k
|
|---|
A 68-year-old man presented with a 4-month history of a painless swelling in both parotid area. The mass was multiple and fixed at the parotid region. He had no medical or operation history. Neither facial palsy nor tumor extension to oropharynx was seen.\nFine needle aspiration cytology revealed that the lesion was consistent with a few clusters of ductal epithelial cells and stromal cells. An enhanced CT scan showed multiple tumors within bilateral parotid gland. In view of these investigations and clinical presentation at that stage, the presumed diagnosis was the Warthin’s tumor.\nWe conducted a parotid duct preserving bilateral superficial parotidectomy by one-stage operation to remove the multiple tumors. A lazy S incision was made in both preauricular area and the peripheral branches of the facial nerve were identified using surgical landmark (main parotid duct and posterior facial vein without nerve stimulator). After dissecting the branches of the facial nerve and parotid duct, main parotid duct was preserved but only small fine ductules from the superficial lobe were ligated. Parotid gland was excised from its anterior aspect with about 1 cm of normal parotid tissue margin (). Histological examination of the specimen postoperatively confirmed 5×2×1.5 cm-sized Warthin’s tumor in right superficial parotid gland and five segments of Warthin’s tumors (1.5 cm in diameter of the largest one) in left superficial parotid gland.\nPatient was followed up for 6 years to evaluate postoperative parotid gland function. The preoperative and postoperative photographs with the computed tomography scans were taken (). Patient was satisfied with no significant complication such as sunken changes in facial contour, facial nerve function.\nHowever, increased sweating and mild edema on left preauricular area was noticed after 6 months of follow-up period, which was revealed as Frey’s syndrome after conducting Minor starch test. At the follow-up date of 6 years, the symptoms of sweating and edema were all gone. |
A 61-year-old woman with a heavy medical history of arterial hypertension, sarcoidosis, hypothyroidism, and bilateral optic nerve atrophy was referred to the Emergency Department for severe headache, vomiting, and alteration of consciousness. Her Glasgow Coma Score on admission was 15/15 but the patient had a slurry speech and exhibited choreic movements of the upper limbs. The admission brain computed tomography (CT scanner) revealed a Fisher grade 4 SAH with initially mild intraventricular bleeding uncomplicated by hydrocephalus. Angiographic examination confirmed the presence of a saccular aneurysm at the junction of the left pericallosal and callosomarginal arteries, which was successfully treated by coiling. The neurological status worsened a few hours after the procedure and an early follow-up brain CT scanner was performed with increased hydrocephalus and the de novo constitution of a subpial hematoma collected at the upper border of the corpus callosum (). Extubation was possible soon after surgery for intraventricular drainage. The neurological examination showed spontaneous eye opening and some spontaneous movements of the upper and lower limbs with a mild left hemiparesia. When stimulated, the patient remained completely mutic but demonstrated some orientating reactions toward the source of intense verbal and/or auditory stimulation. A brain magnetic resonance imaging (MRI) performed on day 6 failed to reveal vasospasm or ischaemic injury in both ACA territories (Figures -). In contrast, there was a significant impingement by the mass effect of the subpial hematoma on the superior border of the corpus callosum. Expectedly, major haemorrhagic contamination of the whole ventricular system was still present.\nEvent-related evoked potentials were recorded on days 13 and 28, using an auditory oddball paradigm (at least two independent acquisitions of 100 stimuli, consisting of an 85 dBHL binaural tone burst at 500 Hz for the frequent stimulus and 750 Hz for the rare stimulus, with a standard/deviant ratio of 85/15 and an interstimulus interval of 0,8 Hz). Exogenous activities were normal (N100: 85 ms; P200: 120 ms). In contrast, no endogenous activities were obtained.\nThe patient was discharged from the Intensive Care Unit on day 11 with persisting mutism and some uncontrolled movements in the right hemibody and left hemiparesia. Levodopa (125 mg orally t.i.d) had been initiated from day 7 but was stopped at the time of her transfer to the rehabilitation clinic on day 27. At this moment, the patient was still mutic and unable to produce spontaneous movements. Mutism almost resolved after 6 weeks. At 6-month follow-up, the patient had a fluid speech with minor episodes of dysarthria. The recovery of neurocognitive functions was very satisfactory, with a mild fatigability impairing attention demanding tasks. Memory was well preserved. Slower improvement was noted regarding motor recovery. After 6 months, the patient was able to walk with some help and could return home to follow an outpatient rehabilitation program. At 7-month follow-up, brain MRI was repeated and documented the integrity of cingulate gyri (). At 12-month follow-up, some postural instability persisted but language had completely recovered. |
This 74-year-old female patient was seen in September 2007 with a three-month history of disseminated itching cutaneous erythematous hyperpigmented plaques affecting the face, chest, and arms to then disseminate to most of body surface except in palms, soles, and scalp. A skin biopsy was reported as reticular erythematous mucinosis and treatment was started with topical steroids and hydroxychloroquine with no response. In December 2007 the treatment was changed to thalidomide, again with no response. In April 2008 a new skin biopsy was reported as compatible with Mycosis Fungoides by having an atypical CD4 lymphocytic infiltrate. Extension studies which included cervical, thoracic, abdominal, and pelvic CT scan as well as a bone marrow biopsy were negative so she was staged as IIIA. Right after, she started treatment with oral methotrexate at increasing doses starting at 10 mg/m2 weekly up to 40 mg/m2 until September 2008 when she achieved a maximum response in the size and extension of plaques. However, no improvement in itching was achieved. In October 2008 her lesions worsened affecting almost 80% of body surface plus the presence of ulcerated and nonulcerated nodules in the scalp. By December 2008, she entered into a clinical protocol with single agent enzastaurine. Nonetheless, after the first course of treatment she had progression with lesions affecting almost the totality of body surface area. In January 2009 after an extensive information and discussion with the patient and her daughter, she accepted to receive hydralazine and magnesium valproate in a compassive manner. Representative pictures of the disease status at this point and after treatment are shown in Figures and .\nThe epigenetic therapy consisted on magnesium valproate at 30 mg/Kg and hydralazine at a total daily dose of 182 mg as she was typed as rapid acetylator (slow-acetylators receive a dose of 83 mg/day, the acetylator phenotype is performed with the sulfametazine test, where patients take P.O. sulfametazine and urine is collected by 6 hours, then the ratio of acetylated/nonacetylated metabolites is measured). These medications are formulated in slow-release tablets. Within the next week she started to feel decreasing in the severity of pruritus and decreasing in size and erythema of plaques. After two weeks the patient reported complete resolution of pruritus and there was no need of taking gabapentin due to the disappearance of neuropathic symptoms in both hands. In the ensuing weeks the erythrodermia vanished only remaining a slightly hyperpigmented skin in the previous diseased areas. This dramatic response was however accompanied by side effects. Soon after starting medication the patient complained of somnolence (which did not interfere with the normal-life activities), fatigue, nausea, dysgeusia, anorexia, and weight loss. In addition, the patient had dehydration and a paradoxical hypertension which required antihypertensive drugs. Most likely, both factors conditioned acute renal failure (a maximum creatinine of 6.5 mg/100 mL which required hospitalization for hydration and pharmacological control of hypertension.) Ten days after, serum creatinine returned to normal. This episode led to withdrew hydralazine and valproate. In March 2009 the patient continued taking no epigenetic drugs and commenced again with pruritus and mild erythrodermia in previously affected areas, hence valproate only was restarted and after three weeks the patient became again asymptomatic. Currently, she remains free of symptoms and the skin condition with no signs of active disease at 14 months of treatment, except for a persistent but decreasing dandruff. |
A 21-year-old boy was referred to our center 8 months after a road traffic accident. He presented with the complaint of inability to abduct the left shoulder from the time of the accident. There was a displaced, nonunited fracture of the left clavicle for which no active intervention was suggested at that time. The patient was able to move the elbow, wrist, and fingers normally.\nAt admission, there was atrophy of the left deltoid muscle. He was able to abduct the shoulder to around 20°–30° but not beyond. The power at the elbow and wrist were 4/5. Finger movements and handgrip were intact. Deep tendon reflexes in the left upper limb were diminished. There was 60%–90% sensory loss in the distribution of left C5 dermatome. Otherwise, the neurological examination was normal.\nMagnetic resonance imaging of the brachial plexus did not show any evidence of pseudomeningocele. The nerve conduction velocity (NCV) showed low amplitude in the left musculocutaneous and left radial nerve, whereas the amplitude over axillary and supraspinatus nerves were nonrecordable.\nThe aim was to augment the shoulder abduction beyond the initial 30°. Elbow and wrist functions were already satisfactory (4/5) and were not considered for surgical reinforcement. As the elbow extension was adequate, we planned a LHT branch of the radial nerve to the anterior division of the axillary nerve.\nDuring the surgery, an aberrant innervation of the long head of the triceps muscle from the axillary nerve was noted []. At the same time, we could not find the long head branch in the triangular interval, confirming the abnormal innervation of the LHT in our patient. Therefore, we decided to utilize the medial head branch (both the fascicles) for neurotization and completed the anastomosis with a combination of 9-0 sutures and fibrin glue.\nPostoperatively, the patient was kept on an arm sling for 3 weeks after which passive exercises were started along with transcutaneous electrical nerve stimulation. After around 3 months of the surgery, the patient started to show improvement in his shoulder abduction clinically. A similar pattern was also evident in the NCV. At 8 months follow-up, the patient had excellent improvement in the deltoid function and a shoulder abduction to almost 90 degree. |
An 81-year-old male presented to the emergency department (ED) with bilateral lower quadrant abdominal pain for two-day duration. The patient noted that the pain was band like in distribution, moving entirely from one side of his abdomen to the other, and had been coming and going in 15–20 minute intervals for the previous two days. Several hours prior to admission, the pain began to change and was now a persistent, dull, nonradiating left lower quadrant pain. This changing character of pain made the patient nervous and prompted him to call 911. Associated with the pain, he had an episode of diaphoresis. The patient noted that he had a regular bowel movement earlier in the day. There were no exacerbating or alleviating factors. His review of symptoms was otherwise negative. The patient had a past medical history of a previous urinary tract infection for which he was treated as an outpatient with a course of cephalexin that was completed 7 days ago. Additionally, the patient had a history of atrial fibrillation, hypertension, and benign prostatic hypertrophy. His medication list included cardizem, olmesartan, metoprolol, and a baby aspirin daily.\nPhysical exam revealed a stoic gentleman in moderate distress from his abdominal pain, although the patient was appearing to be nontoxic. The patient's abdomen was soft and was tender to palpation in the suprapubic region. There was no rebound, guarding, or costovertebral angle tenderness. There were no appreciable masses. The patient's cardiac, pulmonary, vascular, and skin exams were all normal. The patient was noted to be in rate-controlled atrial fibrillation.\nGiven the patient's description of increasing pain along with a history of atrial fibrillation without anticoagulation, a computed tomography (CT) of the abdomen and pelvis with IV contrast was ordered to look for possible mesenteric ischemia. Additionally, a complete blood count, comprehensive metabolic panel, lactate, and urinalysis with culture and sensitivity were ordered. All blood laboratory values were found to be within normal limits. The patient's urinalysis showed small blood and trace ketones.\nThe patient's CT of the abdomen and pelvis revealed multiple posterior bladder diverticuli with stranding on the left and enhancement of a left-sided diverticulum consistent with acute bladder diverticulitis (). Additional CT findings included a mid-left ureteral calculus with mild left hydronephrosis and multiple nonobstructing bilateral renal calculi.\nThe patient was subsequently admitted to the hospital under the medical service for IV antibiotics and pain control, with a Urology Consult. The patient was scheduled to be taken to the operating room the following day for cystoscopy and stone removal. However, the patient felt better in the morning and refused further treatment. He left the hospital against medical advice with a prescription for a five-day course of levofloxacin. |
A 22-year-old female patient presented to the outpatient department of Oral and Maxillofacial Surgery at Ziauddin University Hospital complaining of an aching pain in the upper right quadrant. Inspection revealed slight redness of the upper right gingiva with sporadic spontaneous bleeding on probing. The patient had been previously assessed by a general dentist who carried out oral hygiene measures and referred the patient for a specialist opinion.\nA complete history was taken, and examination performed. There was no significant past medical, surgical or dental history. She was fit and well, with vital signs within normal range, weighed approximately 65 kg and apyrexic. Extra oral examination revealed a minor facial swelling on the right zygomatic-maxillary region [], with no skin discoloration or elevated temperature. A slight displacement of the right eye was noticed, without any limitation in ocular movement. Intra oral inspection revealed a dusky red swelling of the right upper gingivae extending from the right upper first molar till the last standing wisdom tooth []. There was also a smooth homogenous, dusky red swelling in the right palatal region.\nThe patient was advised computed tomographic (CT) scans with axial and coronal sections in 3–4 mm slices along with an incisional biopsy of the affected area. Biopsy report confirmed an OM and CT images [Figures and ] revealed the mass extending from the mesial half of the upper bicuspid till the last standing tooth and from the roots of the upper right dentition till the naso-ethmoid regions, involving and displacing the orbital floor and lateral nasal wall and nasal septum.\nSurgical resection followed by reconstruction with a prosthetic obturator was recommended to the patient.\nA Weber–Ferguson flap was raised with a Lynch extension (to gain access to the ethmoids). The skin incision was given with a number 15 blade [], followed by local anesthetic injection, the subsequent deeper incision (from the muscle till the periosteum) was given with monopolar electrocautery. Skin hooks were used for skin retraction switched to cats-paw retractors for the deeper layers. Infra-orbital incision was given to expose the orbital floor. Wide tissue dissection was carried out to isolate and identify the surgical margins of the tumor. The infra-orbital and the angular artery were identified and ligated. The ethmoidal and nasal extent of the tumor was identified with gentle but firm tissue retraction []. Margins of the intraoral extent of the tumor were incised with a number 15 blade, from the distal aspect of the canine till the posterior limit of the hard palate. An oscillating saw was used to make osteotomies of bone (with a safe margin of 0.5–1 cm) from the lateral nasal wall till the intraoral extent. The intra-orbital extent was identified and a decision was made to enucleate the lesion rather than perform an osteotomy due to the paper-thin bone (the orbital floor was found to be breached and virtually absent). After the facial aspect of the tumor was resected (with the help of osteotomies with an osteotome and saw), the ethmoidal mass was more visible and identifiable. Interior of the nasal cavity with the turbinates was cleared of the tumor mass followed by resection of the mass from the ethmoids [Figures and ].\nA titanium mesh was adapted and conformed to act as an orbital floor, where it was secured with two 1.3 mm screws []. The soft palate was saved in its entirety. The cavity was washed with normal saline and after minor venous or arterial bleeder was cauterized, it was packed with Bismuth iodoform paraffin paste (BIPP) pack in ribbon gauze and the flap was closed in 2 and 3 layers. A temporary acrylic plate was placed intra orally to hold the BIPP in place.\nThe patient was reviewed on the following postoperative day and 1-week thereafter, without any signs of complications. She was then subsequently reviewed after 1-week, 1-month, 3rd month and 6 months []. During the 1st month epiphora was noted from the right eye was noticed, for which the patient was advised to wear dark glasses to avoid light. She was referred to the department of prosthodontics so that an obturator appliance could be constructed.\nThe surgical resection included a part of the palate and posterior teeth of the affected side. When surgical resection of the tumor was carried out, an interim obturator plate was given to the patient which was worn for a period of 7 days. The patient was given a series of interim obturators till a satisfactory healing of the soft tissues [] was achieved and an acrylic obturator with teeth was planned.\nA perforated stock tray was selected for taking the initial impression of the upper arch. The stock tray was modified corresponding with the defect []. The primary impressions of the upper and the lower arches were recorded using irreversible hydrocolloid (Cavex, Holland BV) and study casts were obtained over which custom made acrylic resin trays were fabricated.\nTray adhesive (Caulk tray adhesive, Dentsply) was applied over custom made upper and lower trays and final impression of upper [] and lower dentition were recorded using putty-wash technique with addition cured silicone (3M ESPE Express, 3M ESPE St.Paul, USA). Beading and boxing [] of the impression was carried out and master casts obtained []. Face-bow (Whipmix Corporation, USA) transfer was carried out and centric relation was recorded. The upper and lower master casts with were mounted on a semi-adjustable articulator (Whipmix Corporation, USA) using the face-bow transfer.\nThe arrangement of the artificial teeth was carried out and the trial denture was checked intraorally. Aesthetics and function were checked before processing of the prosthesis and final denture [] was inserted in the patient mouth []. The patient has been reviewed several times since then; she is satisfied and seemingly happy with her appearance and function. A hollow bulb obturator, with cast partial framework and required components is planned to be fabricated in future once the patient comfortably accepts the current denture. |
A 56-year-old female presented to our hospital with a right abdominal palpable tumor and pain of 7 days’ duration. She had slight tenderness at the right abdomen on physical examination. Laboratory tests that included a coagulation test showed no remarkable findings. Serum levels of carcinoembryonic antigen and carbohydrate antigen 19-9 were 0.9 ng/mL and 14 U/mL, respectively.\nContrast-enhanced computed tomography (CT) revealed a 73 × 63 mm homogenous mass lateral to the second part of the duodenum and medial to the right kidney with IVC thrombosis (Fig. ). Anticoagulant therapy was performed with heparin, which was infused at 5000 U/day for first 24 h. The dosage was then increased to 20,000 U/day until the APTT value increased to twice the standard value. Magnetic resonance (MR) imaging revealed a mass with ring-like enhancement on T1- and T2-weighted images, and thrombus was seen in IVC (Fig. ). After 4 days, enhanced CT was used to evaluate the mass and thrombus. It showed that there was no remarkable change in the mass, but there was proliferation of the thrombus (Fig. ).\nTherefore, based on the diagnosis of retroperitoneal tumor with thrombosis of the IVC, an IVC filter was installed, followed by resection of the tumor and thrombectomy.\nIntraoperatively, the hematoma was seen below the liver between the second part of the duodenum and the right kidney. The tumor was separated on all sides while carefully avoiding damage to the right renal artery and other veins. The communication between the hematoma and IVC was identified. The right and left veins, and VC were clamped above and below the tumor before the tumor was excised, and the thrombus was seen extruding from the neck of the tumor. After thrombectomy, the venotomy was sutured with fine nonabsorbable sutures. During venotomy, about 1000 mL of rapid blood loss occurred, although several main veins were clamped. This bleeding was assumed to be from the lumbar veins.\nHistopathological examination found smooth muscle cells in layers of the tumor wall and hematoma. Therefore, this tumor was diagnosed as aneurysm of the IVC with thrombosis (Fig. ).\nOn day 4 after the operation, the IVC filter was retrieved. On day 7 after the operation, CT revealed thrombosis of the peripheral pulmonary artery, although there was no thrombosis of the reconstructed caval segment (Fig. ). The patient was started on anticoagulation therapy and continued to be asymptomatic. Three months later, CT did not detect thrombosis, and anticoagulation therapy was stopped. At the present time, one year after the operation, the patient is asymptomatic without any sign of recurrence. |
A 76-year-old woman reported to the Outpatient Department of Oral and Maxillofacial Surgery of A Coruña University Hospital, with a chief complaint of painless swelling on the left cheek for the past 6 months. The swelling was initially smaller in size and had gradually increased to its present state. Her medical history included allergy to acetylsalicylic acid, arthrosis, osteoporosis, dyslipidemia, hypothyroidism, and high blood pressure controlled with antihypertensive medication. There was no history of any trauma or tooth extraction.\nThe clinical examination revealed a mass about 1 cm × 1 cm on the left cheek and anterior to the masseter muscle. The swelling was nontender and nonfluctuant and had well-defined margins. The overlying skin was not attached to the lesion and was freely movable. Intraoral examination was unrevealing. A fine-needle aspiration (FNA) was performed, the result of which was compatible with a diagnosis of lipoma []. Computed tomography (CT) scan revealed a partitioned hypodense mass in the subcutaneous cellular tissue of approximately 8.5 mm in diameter and adjacent to the left malar bone []. Density was not compatible with fat, but a tentative diagnosis of a lymph node enlargement or a tumor was made. An ultrasound-guided FNA biopsy showed mononuclear cells compatible with lymphoid tissue, without evidence of malignant or epithelial cells. At follow-up, the lesion increased in size, and a second ultrasound-guided FNA confirmed the diagnosis of lymphadenopathy. There were multiple anechoic and hypoechoic areas in the parotid gland corresponding to duct dilatation or small areas of inflammation []. Both submaxillary glands showed a heterogeneous structure []. These findings were compatible with Sjögren's syndrome. A minor salivary gland was biopsied under local anesthesia. Histopathologic examination disclosed nonspecific lymphadenitis without evidence of malignant cells together with acinar atrophy with fibrosis and foci of lymphoid cells clustered around the ducts []. The magnetic resonance imaging (MRI) scan disclosed a heterogeneous nodule, 17 mm × 13.7 mm, compatible with cystic degeneration and necrosis []. The left parotid gland was decreased in size too. Based on all these findings, the patient was diagnosed with primary Sjögren's syndrome and was referred to the Department of Rheumatology of our institution for further workup studies, treatment, and follow-up. |
An 88-year-old woman with acute abdomen was emergently transferred to the department of surgery at our hospital. She complained of gradually worsening abdominal pain over 4 days. Of note, her general condition deteriorated so that she could not walk on the day of transfer. She had a history of hypertension and angina pectoris, both treated with medication. On examination, she had tachycardia (103 bpm) but normal blood pressure (105/57 mmHg) and no fever (35.1°C). Laboratory investigations revealed leukocytosis of 11,900 × 10\n6/L and elevated level of C-reactive protein (CRP) at 16.29 mg/dL. A preoperative gynecological examination was not performed due to her emergent presentation. She did not complain of any atypical genital bleeding or abnormal increase in vaginal discharge. She had not received any examinations for uterine cancer for over 20 years. Urgent computed tomography (CT) revealed a fluid collection and free air in the upper abdomen (). In the pelvic cavity, the uterine cavity was dilated with fluid and contained free air. Since generalized peritonitis due to gastrointestinal (GI) tract perforation was suspected, emergency laparotomy was performed. A midline incision in the lower abdomen, approximately 15 cm in length, was made during laparotomy;purulent ascites was found in the entire peritoneal cavity. During peritoneal irrigation, surgeons found a perforation in the uterine fundus with purulent discharge leaking from the uterine cavity (), which led to the diagnosis of SPP. Gynecologist was consulted;the gynecology team performed a hysterectomy and bilateral salpingo-oophorectomy. Although there were no findings of GI tract perforation, surgeons found an abnormal mass that was strongly suspicious for malignancy in a segment of the sigmoid colon. Subsequently, surgeons resected the sigmoid colon. The operative time was 7 hours and 24 minutes; intraoperative blood loss was 2,270 ml. Postoperative histopathological examination revealed leiomyoma and pyometra from the myometrium to the serosa, with no evidence of uterine malignancy but adenocarcinoma of the sigmoid colon (pT4a N0 M0 stage II) (). Stenosis of the uterine cervix was noted. Culture of the peritoneal pus grew E. coli. Postoperatively, the patient received comprehensive treatment consisting of several antibiotics (CMZ, MEPM, IPM/CS, and LVFX were selected based on bacterial culture results from purulent material) in the intensive care unit. Diastasis of the sigmoid colon anastomosis occurred a month after surgery. Despite exhaustive treatments, the patient died on postoperative day (POD) 189 due to peritonitis and pneumonia that grew progressively worse. |
A 33-year-old woman, gravida 3, para 3, non-obese and with no chronic diseases, underwent TLmRH as curative treatment for clinical stage IA1 cervical cancer. Two months later, she presented to our department with abdominal pain and genital bleeding after her first sexual intercourse after surgery from the previous day.\nWe sutured the vaginal cuff with absorbable sutures during initial surgery. We performed colpotomy with ultrasonic device and monopolar device in both cases.\nBoth patients were immediately diagnosed with VCD (Figure ). The prolapsed organ was found to be the intestine and it remained within the vagina without evisceration out of the vagina. The color of the intestine was normal, indicating that there was no ischemia present. After washing of the prolapsed intestine, we pushed back the prolapsed intestine, with sterilized gauze to prevent herniation outside of the vagina until operation. Vaginal approach repair (repair from the vaginal cavity), open approach repair, or laparoscopic approach repair were treatment choices. Suturing from the vagina could shorten vaginal length. To prevent recurrence, we thought it would be better to suture the peritoneum. We already resected the vagina about 2 cm in the initial surgery in both cases; thus, we would like to avoid further shortening. We thought that the open approach should be avoided considering its invasiveness if we could safely avoid this complication laparoscopically. Thus, we initially employed total laparoscopic repair.\nThe ureter was separated from the paravaginal tissue during initial cancer surgery, losing its normal anatomical position. This may cause ureteral damage during repair (Figure ). Thus, in order to avoid ureteral injury and to create a tight suture, the vaginal wall was separated by 1.0 cm, to the extent that concrete vaginal cuff suture could be made (Figure ), and suturing was complete (Figure ). The peritoneum was sutured to prevent recurrence, hematoma, and infection. The postoperative course was good. The cuff remained intact at 1-, 2-, 3- and 6-month examination. We suggested that sexual intercourse is safe 6 months after surgery.\nInterviews conducted on these cases after the 6-month examination revealed that normal sexual intercourse was performed without troubles in both cases. |
A 59-year-old Japanese woman had a history of poor vision in her right eye since childhood. At the age of 54, she had cataract surgery in that eye, but her vision did not improve. She was referred to our clinic for further evaluation.\nOn examination, her facial features were normal, exhibiting no evidence of the transsphenoidal form of basal encephalocele such as hypertelorism, a flattened nasal bridge, or a midline notch in the upper lip, commonly associated with morning glory disc anomaly. Her best-corrected visual acuity was hand motion in the right eye and 25/20 in the left eye. There was a right esotropia of 20 degrees. The pupil of the right eye was mildly dilated, and there was a relative afferent pupillary defect. The intraocular pressure was 13 mmHg in both eyes. Slit-lamp examination was unremarkable.\nFunduscopic examination was normal in the left eye but disclosed a morning glory disc anomaly in the right eye. The right optic disc was excavated and enlarged. It was surrounded by an elevated and pigmented choroid. In the center of the disc there was a white membrane-like glial material overlying the cup. Retinal arterioles, some of which were sheathed and attenuated, emerged radially from the disc. The retina was largely atrophic, but there was no retinal detachment.\nWith observation, the optic disc contracted and expanded in 5 to 7-s intervals with an irregular pattern (Fig. , supplemental video). In contraction, the diameter of the optic disc became smaller, and the retinal veins became mildly dilated and hyperemic. After the maximum contraction, the disc rapidly expanded and returned to its original shape. Contraction was provoked by strong light stimulation to the fellow eye, although not to the affected eye. It had no correlation with the respiratory cycle, Valsalva maneuver, forced eye closure, or intraocular pressure change induced by pushing on a contact lens. It was difficult to see an effect of the accommodation because the affected eye was largely esotropic. Optical coherence tomography (OCT) showed that the base of the optic disc moved slightly forward during the contraction phase (Fig. ).\nFluorescein angiography revealed a prolonged retinal circulation time of 10 s. When contraction occurred, some hyperfluorescent fluid ejected from the temporal part of the morning glory disc into the vitreous cavity (Fig. ).\nThe right eye visual field was restricted to a small area of 5° in diameter in the inferior nasal area. Magnetic resonance (MR) imaging of the brain was otherwise normal except for esotropia and posterior elongation of the right eye. It did not show brain malformations such as the transsphenoidal form of basal encephalocele or agenesis of the corpus callosum. MR angiography revealed no sign of intracranial vascular anomalies including moyamoya disease. The patient experienced no change over 6 months of follow-up. |
Mrs SS presented with secondary infertility for 6 months. She had a full-term normal delivery female baby aged 4.5 years alive and healthy, after which she used barrier contraception for 3 years and IUCD for 1.5 years for spacing. HSG done outside on February 7, 2007, showed right tubal block with the left tube filling poorly. Cannulation was done under fluoroscopic guidance, after which both the tubes showed free spill. Endometrium was positive for tuberculosis PCR. She had undergone four cycles of ovulation induction, two with clomiphene citrate and two with gonadotrophins. She ovulated in all the cycles but her endometrium was thin and lesser than 7.5 mm in all four cycles.\nHer first scan done at our clinic was on day 19 of the menstrual cycle. The uterus was normal, but the endometrium was only 7.8 mm thick. Both ovaries were normal with a volume of 4.96 and 4.20 cm3 and an antral follicle count (AFC) of seven. With this history and investigation report, the patient was planned for OI with IUI. Two cycles of IUI were performed with tablet Letrazole 5 mg given from days 3–7. The dermal application of EstroGel was done once the follicles were >16 mm for the treatment of thin endometrium. The ovulation occurred on days 13 and 15. The endometrial thickness on the day of IUI was 12.8 and 12.3 mm. We did two more cycles of IUI with gonadotrophins. Ovulation was documented on days 11 and 14 of the cycle and the endometrial thickness was 11.6 and 11.1 mm. As there was no pregnancy, the patient was counselled for in vitro fertilization (IVF). Hysteroscopy was done prior to IVF, which revealed adhesions at the fundus and both cornu. The endometrium was fibrotic and pearly white in color except for a small portion on the anterior wall. The cavity was smaller than normal in size. Adhesiolysis was done and the patient was put on conjugated estrogen (Premarin) 1.25 mg twice a day for 25 days with medroxyprogesterone 10 mg twice a day for the last 10 days. This hormone replacement therapy (HRT) was given for 3 months. A repeat hysteroscopy done after 3 months revealed reformation of adhesions at the fundus which were cut using scissors and HRT given again for 3 months. Before IVF, hysteroscopy did not show any adhesions but the endometrium was thin and fibrotic on the posterior wall.\nThe protocol used for IVF was long luteal down-regulation from day 21 with gonadotrophins started on day 3 of the cycle when the estradiol was 18 pg/ml and progesterone was 1.15 ng/ml. She was started on urinary FSH 300 IU and as the estradiol level on day 8 of the cycle was 6 pg/ml and the follicular size was 8–12 mm, the dose was increased by 75 IU and continued till day 13. On day 14, Rec. hCG 250 mcg was given subcutaneously when there were six follicles 16–18 mm in diameter. On the day of hCG, estradiol was 3265 pg/ml and progesterone was 2.8 ng/ml. Oocyte retrieval was done 35 h later. Luteal phase support was given with intramuscular inj. Gestone 100 mg (Ferring Pharmaceuticals, India). The luteal phase was monitored for ovarian hyperstimulation syndrome (OHSS). Ten days after ET, β-hCG was 53 mIU/ml and a repeat level after 7 days was 1030 mIU/ml. At that time, a single gestational sac was seen with a mean gestational sac diameter (MGSD) of 4.5 mm corresponding to 5 weeks and 1 day. Two days later, the patient complained of minimal bleeding per vaginum. The β-hCG level was 1258 mIU/ml, the MGSD was 4.6 mm and both adenexa showed multiple corpora lutea. No gestational sac was seen in the adenexa. One week later, the MGSD had increased to 8.5 mm which corresponded to 5 weeks and 5 days, but no fetal pole was seen and the bleeding had stopped. Despite the increase in the MGSD, there was no corresponding increase in the β-HCG levels which were 1567 mIU/ml. Two days later, the patient had three syncopal attacks. On examination, the vitals were normal but there was tenderness in the right iliac fossa and fornix. On TVS, the IU sac with yolk sac was seen, but there was also a complex mass of 90 × 70 mm in the right adenexa with free fluid in POD, which was turbid. Diagnosis of right EP with coexisting IU pregnancy was made. In view of an IU pregnancy and right adenexal mass, the decision for laparoscopy was taken. At laproscopy, right partial salpingectomy for ruptured EP was done. One week later, the TVS showed a irregular gestational sac with MGSD of 5.8 mm and the β-hCG level was 820 mIU/ml. The repeat hCG level after 5 days was 418 mIU/ml and the gestational sac had not increased in size. Decision for a curettage was taken. One week later, the β-hCG level was 5 mIU/ml. A frozen embryo transfer was done in a natural cycle, and a biochemical pregnancy was documented with the β-hCG level going to 378 mIU/ml. |
A 19-year-1-month-old Caucasian female presented with a chief complaint of “I do not like my underbite.” Her medical history was noncontributory. She had a symmetrical, mesofacial face and a concave soft tissue profile (). Her upper lip was slightly retruded. She presented with maxillary hypoplasia and flat malar eminences. She had a permanent dentition with class III malocclusion in both molars and canines (). The maxillary arch was tapered with moderate crowding and the mandibular arch was ovoid with moderate crowding. All third molars had been previously removed (Figures and ). She had both anterior and bilateral posterior crossbites. Her maxillary midline was centered to her face and the mandibular midline was 1 mm to her right with an overjet of 0 mm and an anterior open bite tendency. The cephalometric analysis indicated a retrusive maxilla and protrusive mandible (Figures and ). No growth was anticipated in this patient. Both TMJs were normal and no habits were apparent. Dental treatment objectives included resolving upper and lower crowding, achieving both Class I molar and canine relationships, and correction of the anterior and posterior crossbite and midlines. Facial treatment objectives were to increase her upper lip fullness and malar eminences. Treatment was with nonextraction, comprehensive edgewise mechanics with slow maxillary expansion with a bonded expander and protraction facemask to develop the patient's cheek bones and create a fuller face which was not felt to be attainable with class III elastics alone. The acrylic of the maxillary expander covered the first premolars through the second molars bilaterally. The patient had an excellent attitude toward treatment and was highly compliant. During the slow expansion (1 turn or 1/4 mm per day) the midpalatal suture opened, and rapid expansion (two turns or 1/2 mm per day) was continued from that point on. The expander was activated with a total of 5 mm over a period of 16 days and then stabilized with light cured composite. The facemask had forehead and chin anchorage pads secured to a vertical bar. The 14 oz 1/2 inch elastics used to deliver a force of 500 gm bilaterally were attached to hooks on the expander in the maxillary canine areas and a crossbar on the facemask with a downward direction of about 30 degrees. The patient agreed to four months of protraction (during the summer while out of school) for 18–20 hours per day. At the completion of expansion and protraction, the patient's molar and canine relationships were overcorrected to a slight class II tendency. Overall treatment and malar development were highly successful (Figures , , and ). The patient's malocclusion was primarily corrected with maxillary protraction and clockwise/vertical rotation of the mandible (Figures , , and ). A point moved forward 1.5 mm and downward 2 mm (). Pogonion moved 2 mm down and 2 mm backward. Her upper lip moved forward 2 mm. The patient was incredibly pleased with the overall results. She exhibited great cooperation with her treatment, especially with the wearing of the facemask and intraoral elastics. This undoubtedly greatly contributed to her successful treatment result. An honest evaluation of the expected patient cooperation is always important in orthodontic treatment but especially with a teenager with several different patient compliance dependent appliances. She was retained with a maxillary Hawley and fixed mandibular canine to canine retainer. Treatment was completed in 17 months and proved to be stable following the active treatment. |
A 30-year-old female with no known medical condition, underwent a caesarian section in 2014 and started to complain of abdominal mass 2 years later. She underwent resection in another institution and the pathology showed insufficient resection reaching the superior margin, <1 mm from the lateral margin, and 1 mm from inferior and deep margins. The patient was offered radiotherapy, however she refused.\nShe was followed up with biannual MRI’s with no recurrence. Two years later, the patient noticed a growing mass. The follow-up MRI revealed development of a well-defined oval-shaped soft tissue lesion at the site of the previously resected anterior abdominal wall desmoid tumor measuring 4.3 × 2 cm, heterogeneously hypertense on T2, hypointense on T1 and significant enhancement on the delayed post contrast images, in keeping with a recurrent desmoid tumor (Fig. ). Following the MRI, the patient was referred to our institution.\nThe mass presented with a gradual increase in size and moderate pain. On physical examination there was a 5 × 3 cm hard, well-defined mass in the right lower quadrant. There were no skin changes. An MRI revealed a well-defined soft tissue mass confined to the right rectus abdominus muscle. A Tru-cut biopsy from the mass revealed a spindle cell neoplasm consistent with recurrent desmoid tumor. The patient’s family history was insignificant for malignancy. All her laboratory investigations and tumor markers were normal. After counseling the patient, resection was performed, using the advantage of intra-operative ultrasound (US) to localize the margin providing the patient maximal surgical benefit with minimal risk of a positive margin.\nRather than simply using palpation, intraoperative ultrasound guidance was used to determine the margins of the desmoid tumor. The ultrasound was used to define a 2 cm margin at each qudrant, which was then marked using electrocautery. The marks were then connected in a ring giving a 2 cm margin around the entire tumor via which excision was performed and an additional 2 cm were measured. Circumferential dissection was performed around the tumor until the previous surgical mesh (Fig. ).\nFinal reconstruction of the abdominal wall using anterior or posterior wall component separation was postponed because of the uncertainty of the safety margin prior to final pathology and also because the patient plans further conception. A dual mesh was utilized in underlay fashion to bridge the large defect.\nThe postoperative course was uneventful, and the patient was discharged home on Day 5 in a stable condition. The patient was seen after 3 weeks and the final pathology report revealed completely free resection margins. In the 6 months follow-up, the patient reported no functional limitations or recurrence. |
A 13-year-old male child presented with complaints of a symptom of breathlessness of grade III for the past 3 weeks. There was a history of dental extraction done one month back following which he developed a fever on and off which was of high grade and associated with chills and myalgia. On examination, the child was afebrile with a heart rate of 120/min, blood pressure of 130/52 mmHg, respiratory rate of 24/min. On auscultation, Early diastolic murmur of grade 3/4 heard at the aortic area and pansystolic murmur of grade 3/6 heard at the mitral area. Initial transthoracic echocardiography showed severe aortic regurgitation with vegetation attached to the noncoronary cusp of the aortic valve, moderate mitral regurgitation with prolapse of AML with LVEF of 65%. Blood culture was positive for Streptococcus viridans. Antibiotics were started based on the sensitivity and were administered for six weeks following which the symptoms resolved. He was kept on medical followup as per his parental wish. After six months, the child presented with signs of right heart failure. Repeat Echocardiography showed severe aortic regurgitation with vegetations and perforation on the noncoronary cusp, severe mitral regurgitation with perforation of AML with aneurysm formation [Figures and ], severe tricuspid regurgitation, severe PAH with RVSP of 75 + RAP, LVEF of 40-45%. Aortic annulus measured was 17 mm. Therefore, the patient was planned for Aortic root replacement/Ross procedure with mitral and tricuspid valve repair. After induction, Transesophageal echocardiography also confirmed the preoperative transthoracic echocardiographic findings [Videos and ]. Intraoperatively there was vegetation attached to the noncoronary cusp of the aortic valve with perforation and destruction of the noncoronary and right coronary cusp and an aneurysm of size 1 × 1 cm was seen arising from AML with a perforation at its summit. The tricuspid annulus was dilated but leaflets appeared normal. Pulmonary annulus was dilated with mild to moderate pulmonary regurgitation and due to the young age of the child, aortic root replacement was done with 19 mm Aortic Homograft along with bovine pericardial patch repair of AML aneurysm and De Vegas repair of tricuspid valve were performed [ showing mitral valve and aortic valve after repair]. Post repair transesophageal echocardiography showed no aortic regurgitation, mild mitral regurgitation [] and trivial tricuspid regurgitation with LVEF of 40%. The child underwent tracheal extubation on day 2 and was discharged on day 10 and is on regular follow-up. |
A 50-year-old female of Filipino heritage received a living unrelated renal transplant in August 2013. Her past history included end-stage renal failure of unknown aetiology, hypertension, transient ischaemic attack and cervical cancer treated with transabdominal hysterectomy and radiotherapy. Post-transplant immunosuppression consisted of Prednisolone and trough level controlled Tacrolimus. Post-operatively she developed multiple complications including recurrent ureteric obstruction and failed ureteric stents necessitating long-term nephrostomy. She suffered from recurrent urinary tract infections caused by multi-resistant Escherichia coli and Pseudomonas sp. Despite the above, her transplant functioned well with a baseline Creatinine of 140 µmol/L and estimated glomerular filtration rate of 34 mL/min/1.73 m2. Following risk assessment, TB prophylaxis was considered but not prescribed due to her multiple complications and illnesses in the immediate post-transplant period.\nIn October 2014 she was admitted with abdominal and back pain. A computed-tomography (CT) revealed new lytic lesions in multiple vertebral bodies and iliac bones, confirmed on magnetic resonance imaging (MRI) (Fig. ). Following a negative myeloma screen, she was given a provisional diagnosis of metastatic malignancy of unknown primary. The patient declined a tissue diagnosis at that time and opted for palliative management of her symptoms. She received a course of palliative radiotherapy for impending cord compression and for pain control. She had several admissions in rapid succession with fever and rigors which were thought to be due to sepsis that resolved quickly with intravenous antibiotic administration. Pain control was always worse during these episodes, but sites of reported pain did not fit with her known spinal lesions.\nIn November 2015, the patient was admitted with chest pain and breathlessness. CT scan revealed progression of her bony lesions with bilateral pulmonary nodules, pleural thickening and new unilateral pleural effusion initially thought to be lung malignancy (Fig. ). The effusion was drained twice for symptomatic relief. Pleural fluid analysis revealed an exudate with LDH of 525 U/L and protein 38 g/L. Cytology was negative but Acid-Fast Bacilli were grown from TB culture 3 weeks later, subsequently confirmed to be Mycobacterium tuberculosis.\nShe was treated with Rifampicin, Isoniazid, Pyrazinamide and Ethambutol, with the latter 2 discontinued 2 months later. Following 2 months introduction of anti-tuberculous therapy, her pulmonary nodules and pleural effusion resolved completely (Fig. ). Bone biopsy to conclusively rule out malignancy was offered but declined by the patient. Subsequent follow-up MRIs showed significant improvement of her spinal lesions. |
A previously healthy 10-year-old Asian girl presented to the emergency department with headache, vomiting, and one week of mild nonproductive cough. Her headache started the evening prior to presentation, was gradual in onset and frontotemporal in location, and improved with acetaminophen but subsequently woke her from sleep. It was accompanied by two episodes of emesis. On presentation to the ED, the patient described her headache pain as 3 out of 10 in severity. She denied photophobia, had no further nausea, and denied abdominal pain. She reported that the headache worsened with standing and improved with lying down. Review of systems was significant only for pallor.\nThe patient was otherwise healthy with no prior medical issues and taking no regular medications. She was fully vaccinated and had no known allergies. Her family history was significant for frequent headaches in her mother and maternal aunt. She was living with her parents and brother and attending 4th grade.\nVital signs demonstrated blood pressure 111/56, pulse 104, temperature 37.1°C, respiratory rate 22, and oxygen saturation 100% on room air. Initial exam revealed a well-appearing female and was unremarkable including a normal fundoscopic exam and a normal complete neurologic exam.\nThe patient received ibuprofen and oral rehydration and her headache further improved. A presumptive diagnosis of migraine headache was made and was discharged with primary care follow-up the following day.\nTwo days after her initial emergency department visit, the patient returned to the ED with worsening headache, myalgia, subjective fever, and diffuse weakness. The patient's mother reported that the patient was unable to stand or walk and as a result her mother had been carrying her, including to and from the bathroom. The patient endorsed nausea but no further vomiting.\nVital signs demonstrated blood pressure 105/49, pulse 123, temperature 36.9°C, respiratory rate 30, and oxygenation saturation of 97% on room air. On exam, the patient was moderately ill appearing, lying in bed responding slowly to questions. Her lips were noted to be cracked and with some oozing blood. No oral lesions were noted in the mouth. Pupils were equal, round, and sluggishly reactive bilaterally. Neck was supple with no adenopathy noted. Cardiovascularly, she was noted to be tachycardic with a regular rhythm and II/VI flow murmur. Her respiratory exam was normal. Her abdominal exam was benign with no organomegaly. Neurologically the patient was noted to be slow to respond to questions and moving slowly but without focal deficits. She was, however, unable to walk without assistance. Skin exam revealed diffuse ecchymoses on the lower extremities bilaterally.\nLaboratory studies were ordered along with a rapid brain MRI, and pediatric neurology was consulted.\nLaboratory results were as follows: hemoglobin 2.6 g/dL, hematocrit 8.3%, platelets 10K/uL, and WBC 60.5K/uL with 83% blasts in the differential. CRP was 15.7 mg/L, and ESR was 125 mm/h. Electrolytes showed sodium 139 mmol/L, potassium 4.0 mmol/L, chloride 100 mmol/L, carbon dioxide 24 mmol/L, BUN 11mg/dL, creatinine 0.56 mg/dL, glucose 129, magnesium 2.5mg/dL, and phosphorus 3.6 mg/dL. LDH was 359 U/L, uric acid was 2.3mg/dL. PTT was 29.4 seconds, PT was 19.5 seconds, and INR was 1.7. Fibrinogen was 117 mg/dL and D-dimer was >10,000 ng/mL. Review of peripheral blood smear () demonstrated many primitive cells with round and lobated nuclei, numerous cytoplasmic granules with Auer rods readily identified, and some cells with multiple Auer rods.\nRapid MRI Brain () was obtained which demonstrated leptomeningeal enhancement in the supratentorial parenchyma suggestive of leptomeningeal carcinomatosis, a hemorrhagic lesion in the corpus callosum, multiple subdural hematomas with mild mass effect, and petechial hemorrhages throughout the brain.\nPediatric Oncology was consulted and treatment initiated emergently with ATRA, dexamethasone, allopurinol, cefepime, and blood products including packed red blood cells, platelets, and cryoprecipitate. The patient was subsequently admitted to the pediatric intensive care unit.\nIn the pediatric ICU the patient received several transfusions with platelets, cryoprecipitate, and fresh frozen plasma to manage DIC. She was continued on an induction course of chemotherapy including ATRA, dexamethasone, idarubicin, and arsenic trioxide. Molecular analysis of the peripheral blood was positive for PML-RARA, confirming the diagnosis of APL. After the coagulopathy improved and the patient stabilized, lumbar puncture was performed with administration of intrathecal chemotherapy. The cerebrospinal fluid was notable for the presence of leukemia cells, confirming the involvement of the central nervous system. The patient's encephalopathy gradually improved and she returned to her baseline mental status by day 7 of treatment. The patient was noted to have elevated opening pressure on lumbar punctures, which worsened over the course of induction, attributed to pseudotumor cerebri secondary to ATRA.\nUpon completion of the first 28 days of induction therapy, repeat lumbar puncture and bone marrow studies demonstrated no morphologic evidence of acute promyelocytic leukemia, consistent with remission. |
A 26-year-old woman with family history of hypothyroidism on her mother side was referred to our endocrine clinic because of clinical hypothyroidism and a thyroid hot nodule (). After hypothyroidism diagnosis, the thyroid hormone replacement (500 micg/week) has been started and a thyroid sonography requested due to the feeling of lump in the neck by the patient. The ultrasonography findings were an enlarged thyroid gland with diffusely hypo echogenic pattern and heterogeneous echo texture. A 13*6 mm solid isoechoic nodule with regular and sharp margin has been detected in the thyroid isthmus without significant lymphadenopathy. Her first physician had requested a sonography guided fine needle aspiration cytology (FNAC) from the thyroid nodule. The cytology showed a hyper cellular smear containing monolayer sheets, nests, micro follicles and mild nuclear follicular cells pleomorphism in addition to pigment laden macrophages and multinucleated giant cell in hemorrhagic and colloid background.\nThe final cytological diagnosis was “suggestive of thyroid neoplasm”. The patient was referred to our clinic because of hot area in the thyroid gland isthmus (compatible with thyroid nodule) according to 99mTc pertechnetate thyroid scintigraphy report. Residual thyroid tissue had low uptake ().\nWe requested an I131 thyroid scintigraphy to rule out the false hot nodule report by 99mTc scintigraphy, which confirmed the hot condition of nodule (). So we decreased the thyroid hormone replacement dosage for definitive assurance of the hypothyroidism diagnosis. Three months after reduced drug doses, the TSH level increased to 25 IU/L. Color flow Doppler ultrasonography performed by a thyroid ultrasound specialist revealed a solid hypoechoic nodule of approximately 21*19*9 mm in diameters (compared to first sonography which the nodule was isoechoic and lower in size) with well demarcated margin. Increased blood flow was reported in thyroid nodule periphery in addition to thyroid parenchyma ().\nL-T4 substitution therapy was started again with full dose (700 micg/week) and fine needle aspiration (FNAC) was repeated because of increase in nodule size. Cytology report revealed an adenomatous nodule in background of lymphocytic thyroiditis. The thyroid function tests were acceptable in follow-up .The nodule size diminished to 11*5 mm at the four months full dose levothyroxine replacement therapy and disappeared after 8 months follow-up according to sonography report (). |
A 16-year-old girl, who was the fourth child of a third- degree consanguineous couple, was under our follow-up for persistent unconjugated hyperbilirubinemia. She developed neonatal jaundice at 24 h after birth. She has one healthy 24-year-old brother. The second and third siblings also had severe unconjugated hyperbilirubinemia with the onset at 24 hours of life. They, in contrast, developed kernicterus and expired at 10th and 30th neonatal day, respectively. No definitive diagnosis could be made for these children at that point of time.\nOur patient was born as full term with a birth weight of 2800 g. There was no blood group incompatibility for the parents. She did not have cephalhematoma or hepatosplenomegaly. She passed pigmented stools and normally colored urine. Her reticulocyte count was only 2%, and the peripheral smear did not show any evidence of hemolysis. Her thyroid function tests were normal. She needed phototherapy from 24 h of life and underwent two exchange transfusions on Days 5 and 20 postnatally. Abdominal ultrasonogram did not reveal any abnormality. Her liver function tests were normal. There was no improvement following cessation of breast feeding for a few days. Serum unconjugated bilirubin fluctuated between 20 and 25 mg% for several days following which it settled to a level of 14 to 18 mg% by the age of 1 month, and the values are remaining in the same range even now. The phototherapy could be discontinued by the 30th neonatal day. She received oral phenobarbitone since second neonatal day at a dose of 15 mg/day, and her present dose is 60 mg/day. The serum bilirubin level rose up to 27 mg% during multiple occasions whenever the phenobarbitone treatment was stopped intermittently by the family.\nShe attained all developmental milestones at an appropriate age. She is not having any neurologic deficit and has normal intelligence. She never required any blood transfusions after the neonatal period.\nBased on the disease course and the family history, the provisional diagnosis of Crigler-Najjar syndrome type 2 was entertained. Sequence analysis of all five exons of the UGT1A1 gene and of the promoter region was performed. This led to the identification of a proline-to-leucine substitution at amino acid position 176 (p.Pro176Leu) encoded by exon 1, for which the patient was homozygous. Parental analysis revealed that her mother was a heterozygous carrier of the P176L exchange and that she also carried a glycine71 → arginine substitution encoded by the other allele, which is the most common mutation resulting in Gilbert's syndrome among Asians.[] |
A 74-year-old, right-handed, male smoker was taken to an outside hospital after he became confused at a gas station. This episode was preceded by 1 month of cognitive decline, personality changes, and urinary incontinence, as well as self- reported clear rhinorrhea while eating. His neurologic exam was notable for a flat affect and a relative paucity of speech.\nA head computed tomography (CT) was obtained and demonstrated a large, hyperdense left frontal extra- axial mass along the floor of the anterior cranial fossa, with bony erosion into the frontal sinus []. A subsequent magnetic resonance imaging (MRI) revealed a 7.0 cm×5.0 cm×4.9 cm heterogeneously enhancing mass with intrinsic T1 shortening, suggestive of prior hemorrhage, and subacute blood products posterior to the tumor margin, abutting the frontal horn of the left lateral ventricle. T1 postcontrast imaging revealed a dural tail and T2-weighted images demonstrated a partial cerebrospinal fluid cleft around the periphery of the lesion; both findings suggested that the mass was extra-axial in origin []. Given the aggressive appearance of the lesion and the patient’s smoking history, there was a concern that the lesion was a dural-based metastasis from an unknown primary. Therefore, a metastatic workup was completed, including a contrasted CT of the chest, abdomen, and pelvis. The CT scans revealed multiple small, hypodense liver lesions concerning for metastases [] as well as pulmonary emboli.\nAn inferior vena cava filter was placed, and the patient was subsequently taken to the operating room for resection of the intracranial tumor. A two-piece bifrontal craniotomy was performed since the tumor was noted to invade both the frontal sinus and the superior sagittal sinus on the preoperative imaging. The lesion was of mixed consistency, with both firm and soft components. There was significant hypervascularity, which was controlled with bipolar electrocautery. The involved portions of the superior sagittal sinus and frontal sinus were removed. The frontal sinus was subsequently obliterated with an abdominal fat graft and reconstructed with a combination of methyl methacrylate and titanium plates. Intraoperative frozen section analysis was consistent with a high-grade neoplasm (SFT/HPC vs. anaplastic meningioma vs. metastasis). A gross total resection (GTR) was achieved. The patient tolerated the procedure well; his speech and affect improved postoperatively. A postoperative MRI confirmed GTR.\nThe pathological assessment revealed that the left frontal tumor was a SFT/HPC. The tumor was histologically characterized by a proliferation of relatively small cells with round to oval nuclei, some with small nucleoli, and scant or indistinguishable cytoplasm. The cells were arranged haphazardly among staghorn-like vessels. There were >5 mitotic figures in 10 high-power microscopic fields and foci of tumor necrosis, and thus, the neoplasm was designated as anaplastic (WHO Grade III). Immunoperoxidase stains demonstrated nuclear expression of STAT6 by many of the neoplastic cells indicating fusion of the NAB2 and STAT6 genes []. Three weeks postoperatively, a CT-guided biopsy of one of the liver lesions was performed. Histologic sections revealed neoplastic cells that were morphologically similar to those in the intracranial tumor specimen and immunohistochemistry confirmed the NAB2/STAT6 fusion [].\nThe patient underwent adjuvant CyberKnife stereotactic radiation therapy to the intracranial resection cavity. He received a total dose of 50 Gy (in 25 fractions). In addition, stereotactic body radiation therapy (SBRT) was used to treat the liver lesions: a segment 6 liver lesion was treated with 40 Gy in one fraction and a segment eight liver lesion was treated with 60 Gy in five fractions.\nSequential surveillance MRIs of the brain and abdomen were obtained following the completion of radiation treatment. MRIs of the brain remained stable, with no evidence of disease recurrence at 18 months postoperatively []. An MRI of the abdomen obtained 6 weeks following liver SBRT demonstrated mild growth of the previously noted lesions. These were initially observed; subsequent MRI 2 months later demonstrated persistent, but stable hepatic tumors. Given the abdominal MRI findings, the patient was offered additional treatment with chemotherapy. Two regimens were discussed: (1) pazopanib (800 mg daily) versus (2) temozolomide (150 mg/m2 on days 1–7 and 15–21/28-day cycle) and bevacizumab (5 mg/kg on days 8- and 22/28-day cycle). The patient ultimately opted to proceed with temozolomide and bevacizumab, and he completed 6 cycles and was then placed on observation. Follow-up abdominal MRIs over the next 6 months have demonstrated partial regression of the liver lesions. The patient is now 18 months from initial diagnosis and is alive and doing well, with no evidence of disease progression. He is on observation, with surveillance MRIs of the brain and abdomen obtained every 3 months. |
A 63-year-old woman with metastatic breast carcinoma presented to the ophthalmology clinic with diplopia in right gaze and head turn to the right. Medical history revealed that she was diagnosed with estrogen receptor (ER)-positive and progesterone receptor (PR)-positive invasive ductal carcinoma 1 year earlier with mediastinal lymph node and bone metastasis at the time of diagnosis. She was treated with zoledronic acid 4 mg monthly and paclitaxel 80 mg/m2 weekly for 12 weeks, followed by endocrine therapy with letrozole.\nOn ophthalmological examination, best corrected visual acuity was 20/25 in both eyes. Slit-lamp examination of the anterior segment and fundus was unremarkable other than bilateral posterior chamber intraocular lenses. On motility exam, abduction was totally limited in the right eye with globe retraction and narrowing of the palpebral fissure on attempted abduction (). Abnormal head position towards the right side was noted. Magnetic resonance imaging (MRI) revealed isolated enlargement of the right medial rectus muscle (). Clinical evaluation and laboratory studies were carried out for differential diagnosis. There were no clinical findings suggestive of thyroid eye disease and thyroid function tests were normal. Rheumatologic assessment for inflammatory and vasculitic diseases was not contributory. Biopsy of the right medial rectus muscle was performed to establish a definite diagnosis and initiate appropriate treatment.\nHematoxylin and eosin staining of the biopsy specimen revealed large, round to polygonal epithelioid tumor cells arranged in loosely cohesive clusters and sheets infiltrating fibrocollagenous tissue and muscle fibers (). Immunohistochemical analyses using streptavidin-biotin peroxidase complex method revealed panCytokeratin and cytokeratin 7 positivity (). ER, PR and human epidermal growth factor receptor 2 (HER2/neu) were negative (triple-negative). Based on the patient’s clinical history and the morphological and immunohistochemical features of the tumor, she was diagnosed with breast carcinoma metastasis to the right medial rectus muscle. Pathological examination demonstrating a triple-negative breast carcinoma indicated discordance with the primary tumor, which was ER- and PR-positive at the time of diagnosis.\nThe patient was referred to the radiation oncology department for external beam radiation therapy. The orbital mass was irradiated with 45 Gy in 15 fractions. Following radiotherapy, chemotherapy with docetaxel 100 mg/m2 once every 21 days was initiated. After 15 months of follow-up, abduction of the right eye has partially recovered; the patient is stable and continuing to receive palliative chemotherapy. |
A 76-year-old man presented with prolonged dull back pain for 3 months. One year prior to being referred to our hospital, he underwent BCG intravesical instillation therapy for bladder cancer. Computed tomography (CT) at a neighboring hospital revealed both thoracic and abdominal aortic aneurysms (AAAs). Follow-up CT at 4 weeks after the initial examination showed enlargement of both aneurysms. The saccular-shaped thoracic aneurysm enlarged from 39 × 35 mm to 52 × 47 mm, and the size of the abdominal aneurysm also increased from 26 × 23 mm to 41 × 34 mm. The surrounding tissue showed typical findings of inflammation, such as thickening of the adventitia and faint contrast effect (Fig. ). Although he had no symptom except for dull back pain, laboratory tests showed only a slight increase in the inflammatory response (C-reactive protein 4.95 mg/dl, procalcitonin 0.127 ng/ml), and blood culture was negative, he was diagnosed with an impending rupture of both infectious thoracic and AAAs and was referred to our hospital. Considering the risk of rupture and the possibility of infectious aneurysms, urgent surgical treatment was planned. Although open surgical resection of both aneurysms and vascular reconstruction were ideal, these operations were considered highly invasive for the patient who had a poor general condition due to prolonged dull back pain. Therefore, a hybrid operation consisting of simultaneous endovascular repair of the thoracic aneurysm and open surgery of the abdominal lesion was performed.\nUnder general anesthesia, the AAA was exposed through a midline abdominal incision. Prior to abdominal aortic replacement, a stent-graft (GORE C-TAG: W. L. Gore & Associates Inc. Flagstaff, AZ) was inserted via the left femoral artery and deployed at the level of the saccular TAA. After confirming the precise placement of the endograft and no endoleak, the abdominal aorta was clamped, and the aneurysmal sac was opened. The aneurysmal wall was quite thin and fragile. A thick mural thrombus was removed, and a large defect of the right-posterior wall was observed. The aneurysm wall was removed as much as possible, and the abdominal aortic replacement was performed using a straight prosthetic graft of 16 × 10 mm (Terumo, Gelsoft: Tokyo, Japan).\nMycobacterium was identified in the resected sample from the aneurysmal wall by acid-fast staining. Triple antituberculosis therapy (rifampicin 600 mg/day + isoniazid 300 mg/day + ethambutol 750 mg/day) was started. Furthermore, tubercle bacilli were identified as a mycobacterium using a transcription-reverse transcription concerted reaction method. The detected tubercle bacilli were proved to be a BCG “Tokyo-172” strain, same as previous BCG intravesical instillation therapy for bladder cancer by a repeated sequence polymorphism analysis. No Mycobacterium tuberculosis was detected in the sputum, and CT showed no findings suggestive of pulmonary tuberculosis; therefore, the patient was diagnosed with tuberculous aortic aneurysm caused by BCG therapy. Postoperative course was uneventful. Postoperative CT showed no endoleak, migration, or anastomotic abnormalities, and no signs of recurrent infection were observed (Fig. ). He was discharged at 30 days postoperatively. He continued to receive oral antituberculosis drugs for 6 months postoperatively, and no sign of recurrent infection was observed. He is doing well 1 year after the operation. |
A 68-year-old man was admitted to our hospital due to aortic arch anastomotic pseudoaneurysm with concomitant aortic root enlargement and coronary artery stenosis. At 56 years of age, the patient had undergone a total arch replacement at another hospital, with three-branched island reconstruction performed using the T-graft technique for a chronic aortic dissection, expanding from the ascending aorta to distal aortic arch (Figs. and ). In the aortic arch island reconstruction, the adventitia and intima of the arteries were combined and reinforced externally by a felt, and end-to-end anastomosis was performed with a 30-mm synthetic vascular graft with one branch. Thereafter, the patient was followed up by a local physician; however, a computed tomography (CT) scan was not performed, as no relevant symptoms were observed. A CT scan at another hospital, however, showed a giant pseudoaneurysm at the site of the island reconstruction 11 years later. Though endovascular repair was considered, the patient was ultimately determined to be inoperable by the other hospital, as enlargement of the aortic root was also observed. He was subsequently referred to our hospital and he opted to undergo surgery at our institution.\nAt the time of presentation, the patient was 168 cm in height and weighed 71 kg. His vital signs were as follows: body temperature, 36.1 °C; blood pressure, 120/60 mmHg (no difference between left and right arms); pulse rate, 70 bpm (regular); and SpO2, 100% (room air). Upon physical examination, his consciousness was clear, but expressed hoarseness in his voice. The patient had a median sternotomy scar. A diastolic murmur was detected in the third intercostal space at the left sternal border on thoracic auscultation. Breath sounds were normal, and the abdomen was soft and flat. An electrocardiogram showed normal sinus rhythm. A chest X-ray revealed enlargement of the left 1st arch and elevation of the left diaphragm. His cardio-thoracic ratio was 55.4%.\nThere were no abnormal laboratory findings nor did echocardiography reveal abnormal cardiac function upon admission.\nContrast-enhanced CT (Fig. ) showed that a giant arch pseudoaneurysm (81 mm wide) had formed in the island-shaped arch branch. No false lumen was observed in the aneurysm, and its enlargement was omnidirectional. The diameter of the aortic root was also enlarged to approximately 56 mm in size. In addition, coronary angiography indicated that there was 99% stenosis of the left anterior descending coronary artery at #7, collateral circulation from the right coronary artery, and 75% stenosis of the left circumflex artery at #13.\nBased upon these observations, the patient underwent a repeat total arch replacement, aortic root replacement (i.e., Bentall procedure), and coronary artery bypass grafting [the left internal thoracic artery (LITA) and saphenous vein graft (SVG) were used]. Under general anesthesia, extracorporeal perfusion was initiated. We re-performed a median sternotomy and successfully opened the thorax without causing any damage to the aneurysm, while gradually decreasing the rectal temperature to 28 °C while sending blood to the right femoral artery and right axillary artery, while removing blood from the right femoral vein. We were able to switch the cannula from the femoral vein to the superior and inferior vena cava, as needed. After removing the previously used vascular graft, the coronary ostia on the right and left were confirmed and excised in the shape of a button. A 23 mm Carpentier-Edwards Perimount (CEP)® bovine pericardial bioprosthesis (Edwards Life Science, Irvine, CA) and a 28 mm Vascutek® Gelweave Valsalva Graft (Terumo Vascutek, Renfrewshire, Scotland, UK) were combined with a running suture, and the skirt portion and the aortic valve annulus were attached with a 3–0 PROLENE running suture (Ethicon, Somerville, NJ, USA), with a felt strip between them. The right and left coronary arteries were continuously sutured with 5–0 PROLENE (Ethicon, Somerville, NJ, USA) for reconstruction of the Carrel patch. When the rectal temperature reached 28 °C, circulation of the lower body was arrested and antegrade selective cerebral perfusion was initiated by the insertion of balloon-occludable catheters to each cervical branch of the aorta. Upon incision of the aneurysm, it was revealed that the inner wall was covered by atheroma, although no false lumen was observed inside the aneurysm or arch branches. After removing as much of the aneurysm as possible, three separate perfusions of cervical branches were performed. On the distal side, another vascular graft was retained and connected to a 26 mm, four-branched synthetic vascular graft (J-graft SHIELD NEO®, Japan Lifeline, Japan) with 3–0 PROLENE (Ethicon, Somerville, NJ, USA) using the open distal technique. After a restart of blood flow from the synthetic vascular graft branch, the left subclavian artery was reconstructed. In addition, the SVG and LITA were sutured to #14 and #8, respectively, and the Valsalva graft and the 26 mm J-graft were attached with running sutures of 4–0 PROLENE (Ethicon, Somerville, NJ, USA). The central side of the SVG was then anastomosed to the J-graft to allow the release of the aorta clamp. Finally, the left common carotid artery and brachiocephalic artery were reconstructed.\nThe operation was completed under stable hemodynamics. The operation time was 660 min, extracorporeal circulation time was 363 min, aortic clamp time was 172 min, circulatory arrest time was 38 min, the lowest rectal temperature was 27.6 °C, and intraoperative bleeding was 3240 mL.\nAlthough the patient was re-intubated on the fourth postoperative day after extubation for ventilator failure, he was extubated again and discharged from the ICU on the eighth postoperative day. An indwelling pacemaker was inserted on the 40 s postoperative day due to sick sinus syndrome and the patient was ultimately discharged from the hospital on the fiftieth postoperative day (Fig. ). He has been visiting the hospital as an outpatient and is in favorable condition. |
The patient is a 17-year-old blind female who presented to the sleep medicine clinic with four years of treatment-resistant insomnia. At her initial appointment, the patient reported no current difficulty with sleep initiation, but consistently awakens during the night and is unable to return to sleep. Sleep difficulties tend to wax and wane across months, such that there are periods of no disturbance alternating with periods of progressively worse sleep. The patient had tried melatonin (including immediate as well as sustained release formulations), eszopiclone, zolpidem, sublingual vitamin B12, clonidine, trazodone, valerian root, and gabapentin, all of which were either temporarily effective or completely ineffective. Her medications at the initial evaluation included naproxen, topiramate and magnesium for migraines, in addition to 5 mg immediate release melatonin and gabapentin 100 to 300 mg for insomnia. The patient’s social history was remarkable for attending high school full time and maintaining a consistent routine including a consistent bedtime of 10 PM and waketime of 6AM on weekdays and weekends. She was not employed outside of school.\nShe reported a history of multiple years of having an urge to move her legs that is worse at night, better with movement, and keeps her awake several nights out of the week. She was taking 100 to 300 mg gabapentin nightly for restless leg syndrome, which she reports has helped intermittently, but still complains of urge to move her legs some nights that awakens her at night after initially having fallen asleep. She was unable to tolerate gabapentin doses higher than 300 mg secondary to residual daytime sleepiness the following morning. She also tried magnesium for her restless leg syndrome, but it did not help. She did report a history of heavy menses which started at age 12 but denied a previous diagnosis of anemia.\nThe patient was diagnosed at one year of age with bilateral retinoblastoma, which was treated with bilateral enucleation. At age 13, patient underwent polysomnography, which showed wake time after sleep onset of 83 minutes and a sleep efficiency of 76 percent. Periodic limb movement index was elevated at 12/hour (normal is <5 in children). The periodic limb movement with associated arousal index was 8/hour and there was an association with nocturnal awakenings. Respiratory parameters were normal, with no evidence of central or obstructive sleep apnea.\nBased on the history of cyclical insomnia and total blindness, the patient was evaluated for N24 using actigraphy. Example actigraphic data is presented in . Over the 14-day recording period, the patient exhibited a pattern of progressively delayed bed times followed by a compensatory night of going to bed early, which is consistent with N24. This was initially managed with 5 mg continuous release melatonin nightly to treat her sleep maintenance insomnia based on previous studies in adolescents [,] as well as the reported previous lack of efficacy of immediate release melatonin. Given the patient’s elevated periodic limb movement index as well as reported restless leg syndrome symptoms, serum ferritin was checked and reported to be 19 ng/ml. She was started on 325 mg ferrous sulfate daily and continued on gabapentin.\nAt follow-up four months later, the patient reported improvement of her restless leg syndrome symptoms after iron replacement. However, for the past several weeks, she was taking 2 to 3 hours to fall asleep nightly, as well as falling asleep during the daytime. This was thought to be secondary to her N24 given she no longer reported symptoms of restless leg syndrome. Given her persistent symptoms on continuous release melatonin, and her previous lack of response to immediate release melatonin, tasimelteon 20 mg nightly was started for her N24.\nThree months after starting tasimelteon, family reported that she was sleeping well and had no concerns at that time. She was able to reduce her gabapentin dose to 100 mg nightly. At her next follow-up two months later, patient reported tasimelteon made her sleepy in the evening without needing other medications or supplements. She was taking tasimelteon at 11 pm with sleep initiation shortly afterwards and would wake at 6 am. She denied any daytime sleepiness. She did note that her sleep was worse in the last two weeks following discontinuation of ferrous sulfate. Patient endorsed urge to move legs at night and that this was disrupting sleep. Serum ferritin was retested and reported at 25 ng/ml. Patient was instructed to resume iron supplementation and to continue gabapentin for restless leg syndrome, in addition to continuing to take 20mg tasimelteon for N24. |
A 23-year-old male presented with high-grade fever for which he was treated empirically. After the fever subsided, he was discharged. Eleven days later the patient developed headache, vomiting, and giddiness, not associated with convulsion, unconsciousness or any ear discharge. Neurologically and hemodynamically, the patient remained stable and routine blood investigations were within normal limits. There were no visual abnormalities and fundus examination was normal. A contrast magnetic resonance imaging (MRI) [] showed evidence of well-defined altered signal intensity lesion involving foramen of Monro of which appeared hyperintense on T1-weight images, T2-weigth images and short tau inversion recovery images. The lesion did not show restriction of on diffusion weighted imaging. There was mild perilesional edema seen on fluid attenuation inversion recovery images. The lesion caused obstruction of the foramen of Monro bilaterally resulting in hydrocephalus. Postcontrast study revealed peripheral rim enhancement of the lesion. A differential diagnosis of either Colloid cyst or NCC was made.\nAfter preanesthetic evaluation, the patient was planned for endoscopic excision of the lesion. Through a precoronal right frontal burr hole, an endoscope was introduced to assist excision of the lesion. The whole degenerative lesion was excised except small islands of the capsule that was strongly adherent to the ventricular wall []. The lesion was pale, fluffy, avascular and was blocking both foramen of Monro. Considering that ventricular cysticerci may induce a local inflammatory reaction, and fluffy part of the lesion may migrate toward the third ventricle leading to aqueduct blockage, endoscopic third ventriculostomy was done in the same setting. On the 5th postoperative day, patient developed signs of raised intracranial hypertension as well as deterioration in level of consciousness which was treated with emergency ventriculostomy followed by endoscopic visualization of foramen of Monro and third ventriculostomy opening which was found to be patent. On inspection, it was observed that there was an inflammatory reaction throughout the ventricular system due to ruptured degenerated cysts causing ependymitis and basal arachnoiditis. The condition was treated with ventriculoperitonial shunt and steroid therapy. Albendazole was started for 4 weeks after the histopathological report was conclusive for NCC. The postoperative period was uneventful, and the patient remained symptoms free for 1 year follow-up. Postoperative MRI images are shown in .\nHistopathological report [] revealed reactive glial tissue with abscess formation. There was well-defined parasitic structure consisting of microvilli having a corrugated wall with wavy eosinophilic membrane suggestive of cysticercosis. |
A 53-year old Black female presented to the emergency department (ED) with sudden onset of a facial droop and slurring of her words. The patient was last seen well 45 minutes prior to arrival. She had previously been seen three days earlier in the ED for hypertension and admitted to stopping her antihypertensives four months prior. She was prescribed antihypertensives at that time with recommendations to follow up with her primary care provider. A day prior to her presentation she had restarted lisinopril 20 milligrams (mg) daily, amlodipine 5 mg daily, and furosemide 20 mg daily as instructed by her primary care provider. Additional home medications included metformin 500 mg twice daily and potassium chloride.\nThe patient denied any headache, visual changes, dizziness, or numbness. She was found to be hypertensive upon arrival with blood pressure of 200/106 millimeters mercury (mm Hg), heart rate 130 beats per minute, respiratory rate 20 respirations per minute, pulse oximetry of 98% on room air, and temperature of 98.7° Fahrenheit. Initial neurologic exam showed the patient to be oriented to person, place, and time, with an obvious right-sided facial droop, deviation of tongue to the right side, and slurred speech. There were no initial motor deficits noted in her extremities as she was able to lift both her upper and lower extremities against gravity. Visual fields were grossly intact as was finger-to-nose testing. The remainder of her physical exam was otherwise unremarkable. Initial National Institutes of Health (NIH) stroke scale score was calculated to be approximately 2–3. The patient was taken for a computed tomography (CT) angiography of head and neck with and without contrast immediately after her initial exam.\nThe CT angiography of head and neck with and without contrast showed no acute intracranial findings, and no high-grade stenosis or occlusion in the head and neck through the internal carotid arteries. Vertebral artery imaging was obscured secondary to movement, and a thyroid goiter was also present. Upon return from CT, serial neurological exams were performed, which revealed right upper extremity weakness, thus increasing the NIH stroke scale score to 3–4. Tele-neurology was consulted and tPA was recommended. The patient and her husband agreed with the treatment plan regarding recommendations for tPA infusion. Tissue plasminogen activator was then administered for a total of 72.19 mg. A single dose of labetalol for 10 mg intravenous (IV) was initiated for blood pressure control.\nDuring tPA infusion, the patient developed swelling of the right upper lip and right side of the tongue. It was believed that the tPA was the cause of her angioedema, and she was subsequently given diphenhydramine 50 mg IV in addition to methylprednisolone 125 mg IV. The infusion of tPA had coincidentally finished as the patient first began to develop angioedema. As a result, there was no need to discontinue the infusion, which is usually recommended when angioedema occurs. The patient remained hemodynamically stable, was able to maintain her airway, and did not require intubation while observed in the ED. She was subsequently admitted to the intensive care unit with the diagnosis of acute ischemic stroke.\nPrior to leaving the ED, serial neurological exams revealed improvement in her right upper extremity weakness, but she continued to have lingering facial droop. Reassessment of the patient’s angioedema showed improvement with only minimal swelling of the right upper lip and right side of tongue. She continued to maintain a patent airway. Initial laboratory studies included complete blood count, electrolyte panel, and prothrombin time/international normalized ratio and returned normal, except for mild hypokalemia of 3.1 millimoles per liter (mmol/L) (reference range 3.5–5.0 mmol/L) and elevated glucose of 226 (60–126 mg/dL).\nAfter admission to the hospital, the patient underwent magnetic resonance imaging, which identified a subacute evolving infarct in the posterior left frontal lobe with a possible additional area of evolving infarct in the right frontal lobe as well. Magnetic resonance angiography revealed no primary vascular lesion such as an aneurysm, arteriovenous malformation, or arterial narrowing. During her hospital course, she continued to show improvement in her right upper extremity weakness and some improvement in the facial droop. Continued observation showed improvement in the angioedema over the course of a couple of days as well. |
A 19-year-old male patient reported with the complaint of unsatisfactory facial appearance due to prominent upper front teeth and backwardly placed lower front teeth. On clinical examination, on profile view, he had a convex profile with retrognathia [Figure -]. The upper and middle face, eye, nose, and ear measurements were within normal limits. However, cephalometrically, there was a mandibular corpus deficiency of approximately 8 mm in the sagittal plane. The dental arches were U shaped and well aligned with minimal compensation in the lower anterior teeth, incisor-to-mandibular plane angle being close to 90°. Based on the above findings, it was diagnosed as a case of mandibular body deficiency of 8 mm, which was planned to be addressed by mandibular advancement by bilateral sagittal split osteotomy using the SFA [Figure and ]. The presurgical steps remained the same as explained for Case 1, i.e., construction of a splint after face bow transfer and articulation of the diagnostic cast. However, the orthodontic appliance was applied just prior to surgery in order to avoid the inconvenience to the patient in the immediate postoperative state. Bilateral sagittal split ramus osteotomy (BSSRO) was performed, and the mandible was advanced by approximately 8 mm []. The prefabricated splint was used to determine the final position for fixation of the mandible [].\nThe patient was treated with injection augmentin 1.2 g intravenous (IV) 12 h, injection amikacin 750 mg IV OD, injection metronidazole 500 mg IV 8 h, injection paracetamol 1 g IV 12 h, and injection dexamethasone 8 mg iv 12 h for 5 days, thereafter followed by oral antibiotics and pain killers for 3 days. Silk sutures were removed after 7 days, and the patient was discharged on the 8th postoperative day. Orthodontic treatment was started after 2 weeks, as soon as the postsurgical tenderness has subsided. The treatment was completed within 8 months [Figure -]. |
A 73-year-old female patient reported to the Department of Oral and Maxillofacial Pathology of Guru Nanak Institute of Dental Sciences and Research, Panihati, Kolkata, India, with a chief complaint of swelling involving the left side of the face for the past 8–9 months. The patient gave a history of extraction of her maxillary left first, second, and third molar teeth 8–9 months back and followed by the development of a swelling, involving the molar region, which had gradually increased in size accompanied by localized intermittent pain.\nExtraorally, there was a diffuse swelling involving the left middle third of her face. Overlying skin appeared normal without any regional lymphadenopathy.\nIntraoral examination revealed the presence of a diffuse, large, moderately tender, noncompressible, firm to hard swelling involving the partially edentulous maxillary left molar region associated with marked expansion of buccal and palatal cortical plates. Orthopantomogram and paranasal air sinus view revealed the presence of a large lesion having a mixed radiographic appearance characterized by the presence of radiolucencies interspersed with multiple areas of radiopacities produces a typical “driven snow” type of appearance, without encroaching the left maxillary antrum []. Routine hematological investigations were within the normal limits. Based on the above clinical and radiological findings, the provisional diagnosis of fibro-osseous lesions and odontogenic neoplasms was made.\nEthical clearance to this study was received. Following this, incisional biopsy was performed from the representative site of the lesion after obtaining informed consent from the patient. The light microscopic features revealed the presence of sheets of polyhedral, neoplastic, odontogenic epithelial cells with prominent cellular outlines and intercellular bridges along with the presence of homogeneous, eosinophilic, amorphous materials. Calcified areas were also noted within the sheets of epithelial cells []. One of the most interesting features was the presence of clear cells having vacuolated cytoplasm within the odontogenic epithelial islands which stains positively with periodic acid–Schiff (PAS). Our provisional diagnosis was clear cell variant of odontogenic tumor, and to confirm this diagnosis, we had gone for immunohistochemical (IHC) evaluation. IHC markers such as cytokeratin 8 confirmed the presence of odontogenic epithelium within the neoplasm. Congo red-stained, amyloid-like material produces a typical apple-green birefringence viewed under a confocal microscope with polarized light [].\nAfter considering the microscopic features, the diagnosis of clear cell variant of CEOT was made, and the patient was referred for surgical treatment and management. However, she had refused to undergo any surgical treatment because of her old age. Hence, any follow-up treatment could not be possible. |
This is a case of a 30 year-old gentleman with a history of Crohn's disease. He was on a regimen of infliximab, infused every 8 weeks and oral methotrexate daily. He had no other significant medical history. He was in his usual state of health until he developed a sore throat and fevers on day 0. His symptoms began while he was traveling in Europe. During his trip, he took a 10-day course of amoxicillin and felt some improvement.\nAfter returning to the US he felt well but on day 14 he developed fevers and sore throat again. He was evaluated at an urgent care clinic and sent home with a diagnosis of a viral syndrome and instructed to treat this with non-steroidal anti-inflammatory agents. He felt some improvement initially but presented again on the day of admission with concern that he may not be well enough for his infusion of infliximab. He was found to have a temperature of 38.3 C and on day 30 was sent to the emergency department for further evaluation.\nIn the emergency department, he reported a non-productive cough, fevers, and sore throat. He had elevated liver enzymes: aspartate aminotransferase (AST) 340, alanine aminotransferase (ALT) 540, alkaline phosphatase 145. Additional testing was sent including a Monospot test, cytomegalovirus (CMV) and Epstein's Barr virus (EBV) serum viral levels, respiratory viral panel by PCR, adenovirus serum viral level, HIV antibody/antigen as well as HIV viral level, viral hepatitis serologic panel, human herpesvirus type 6 (HHV6) serum viral level, Varicella zoster virus (VZV) serum viral level, and syphilis IgG. He was admitted to the inpatient medicine service for fevers and hepatitis of unknown origin. His social history was remarkable for frequent trips to the Midwest for work. He did not pursue outdoors activity while traveling. He did not smoke, drink alcohol or use illicit drugs.\nOn day 31 he developed daily fevers to 40 C and subsequently progressed to hypoxemic respiratory failure that required high-flow supplemental oxygen and transfer to the intensive care unit. He had a chest CT showing ground-glass opacities at the lung bases and a left upper lobe nodular opacity (, ). His CT also demonstrated tonsillar enlargement and splenomegaly. He had a laryngoscopy performed that revealed an exudative pharyngitis. He was noted to have atypical lymphocytosis that peaked to 12,000 cells/uL on day 33. He was started on broad-spectrum antibiotics for presumed hospital-acquired pneumonia; including coverage of atypical organisms. He underwent a bronchoscopy on day 33. Bronchoalveolar lavage (BAL) fluid was negative for Legionella culture, AFB stain and culture, pneumocystis stain, and bacterial culture. Mycoplasma, zygomycetes and Mycobacterium tuberculosis were not detected by PCR. A respiratory viral panel by PCR from the lavage fluid was positive for Bocavirus and one of 2 samples for aspergillus galactomannan was moderately elevated but later determined to be negative on repeat testing.\nOn day 33 his AST peaked at 351 and his ALT at 662. His viral studies sent earlier returned negative. He had further serologic testing for atypical organisms including Blastomyces, Coccidioides, Q fever, Bordetella pertussis, as well as urine Legionella antigen that all returned negative. He was started on methylprednisolone and his fevers improved. His antibiotics were discontinued when his bacterial cultures were negative at 48 h. On day 37 the fungal PCR from BAL returned positive for Histoplasma capsulatum and cultures from that fluid later grew the organism. Urine Histoplasma antigen testing, sent earlier during his hospitalization, ultimately returned with a titer of 2.16 ng/mL (normal high 0.1 ng/mL). His Coccidioides antibody was also positive, but this was felt to be due to cross-reactivity from his Histoplasma infection.\nOn day 37 he was started on liposomal amphotericin B and 6 h later he had his highest fever to 42 C along with hypotension, tachycardia and worsening hypoxemia despite having received a dose of methylprednisolone earlier that day. He was felt to have a paradoxical worsening with treatment and exacerbation of immune reconstitution inflammatory state rather than an infusion reaction due to amphotericin given this time course . His infliximab was restarted the following day with subsequent resolution of his fever, hemodynamic instability and improvement in his respiratory status within hours of this infusion. He continued amphotericin B for one week before transitioning to oral itraconazole. His ALT/AST improved significantly. He was discharged on oral itraconazole with continued clinical improvement and recovery as an outpatient. |
Our patient is a 17-year-old African American male who was transferred to the Children's Hospital of Wisconsin (CHW) emergency room from a local inpatient psychiatric unit, for further workup of elevated serum calcium and iPTH levels. The patient had been admitted with acute psychosis a week prior to his transfer to CHW, where on a routine laboratory screening he was found to have serum calcium of 16.5 mg/dL (8.9–10.7). The serum iPTH level was markedly elevated: 315 pg/mL (9–69). During the preceding 2-3 weeks, the patient had intermittent episodes of aggressive, hostile, and angry moods associated with paranoia. He reported hearing of voices, visual hallucinations, and delusional ideation. His mother reported that he had been having difficulty initiating sleep and frequently paced in his bedroom throughout the night. He also had frequent arguments with his father and girlfriend and was reported to have suicidal and homicidal ideations. He subsequently suffered a fracture of the right radius after jumping out of a moving car. Consequently, he was admitted to an inpatient psychiatric unit with diagnosis of acute psychosis.\nAt the time of presentation, he was in the 12th grade with average school performance. He reported being sexually active and smoked marijuana about 2-3 times per week. He denied history of bone pain, abdominal pain, passage of red colored urine, or stones in the urine. He had a normal birth history and developmental milestones during childhood and no history of head injury. He had a history of behavioral problems since the 2nd grade and was assessed by the school social worker and the psychologist, who attributed them to underlying learning disability, and was placed in special education. He never had any prior psychiatric evaluation nor was he ever placed on psychiatric medications. His past medical and surgical history was unremarkable. There was no family history of hypercalcemia or major medical or mental illnesses.\nOn physical exam he appeared healthy looking, alert, oriented, and cooperative. He had normal vitals, physical exam, and speech. He appeared to be of average intelligence and moderately agitated. His psychiatric symptoms were unchanged since his first presentation in the local psychiatric hospital. He had no hyperactivity, tics, or stereotypic movements, gait was normal, and recent and remote memories were intact.\nHe had an elevated serum iPTH 242.0 (9–69 pg/mL) and alkaline phosphatase 156 IU/L (50–130), low serum 25 hydroxy vitamin D 18 ng/mL (20–100), and an elevated 1,25-dihydroxy vitamin D 102 pg/mL (27–71) (Quest Diagnostics, San Juan Capistrano, CA), consistent with PHPT. Thyroid hormone screening, electrolytes, urine drug screen, and vitamin A levels were normal. His 24-hour urinary calcium to creatinine ratio (mg Ca/mg Cr) was 0.60 (<0.21), and urinary calcium excretion rate was 12 mg/kg/day (<4). Phosphate/creatinine clearance ratio was 0.22 (0.02–0.22) and the percentage tubular reabsorption of phosphate (%TRP) was 78 (78–98). Urinary vanillyl mandelic acid was 2.2 mg/24 hours (<3.9) and urinary homovanillic acid was 2.2 mg/24 hours (1.4–7.2). He had a normal electrocardiogram, ultrasound, and MRI of neck and ultrasound of the kidney. A Sestamibi scan showed a positive signal just inferior to the left lobe of the thyroid gland. Multiple endocrine neoplasias type 1 (MEN-1) and MEN-2 gene analysis were negative (Mayo Medical Laboratories, Rochester, MN). Hypercalcemia was treated with intravenous fluids and calcitonin. His calcium levels were moderately decreased by intravenous calcitonin (2–4 U/kg/day); however calcitonin effect was not sustained. The patient underwent surgery for the removal of the parathyroid gland, 5 days after hospitalization (about a month after the acute onset of psychotic symptoms). Intraoperative and postoperative serum iPTH were <2.5 pg/mL, confirming the completeness of the procedure. The calcium levels gradually normalized in 48 hours (9.7 to 10.7 mg/dL), . The gland weighed 1.3 grams and its histopathology evaluation revealed a hypercellular parathyroid gland containing oxyphil and chief cells with no features of malignancy. Although his paranoid and violent behavior gradually resolved about 2-3 months after surgery, he remained under psychiatric care for behavioral issues for about 6 months after surgery. |
A 27-month-old girl with trisomy 13 presented with OSA. She was born at 38 weeks’ gestational age and hospitalized because of low birth weight. She was deaf and had been diagnosed with mosaic-type trisomy 13. Tracheomalacia and central apnea required ventilation support, but tracheomalacia had resolved 3 months after the birth with her growth, and central apnea had shown gradual improvement. She had been discharged without respiratory support at 8 months old. OSA had appeared at 2 years old due to increasing adenoid hypertrophy. Her parents reported snoring and apnea at night. She was on the monitor of peripheral oxygen saturation (SpO2) at home, and home oxygen therapy started after identifying SpO2 ≤ 80% on room air. Tonsillectomy under general anesthesia was scheduled for OSA and repeated otitis media.\nAt the time of hospitalization for surgery, her height was 76 cm, and her weight was 10 kg. Growth and development were equivalent to a child of about 18 months old. Preoperative chest X-ray and electrocardiogram examinations were normal. She had a patent ductus arteriosus that had been followed-up until this hospitalization. The latest transthoracic cardiac ultrasonography showed that the shunt flow was left-to-right, with a maximum velocity of 4.30 m/s, a maximum pressure gradient of 74.0 mmHg, and a pulmonary/systemic blood flow ratio of 1.1. Microcephaly and retrognathia were apparent (Fig. ). Intermittent central apnea was present as one of the central nervous system complications of trisomy 13.\nWe did not provide her premedication before the induction of general anesthesia. General anesthesia was induced with sevoflurane up to 5% and 33% nitrous oxide in oxygen []. OSA made mask ventilation difficult even though two anesthesiologists were involved in positioning the head, moving the mandible forward, and opening the mouth to facilitate ventilation. She was placed in a lateral position and administered 100% oxygen immediately after SpO2 began to decrease. Spontaneous respiration resumed in the lateral position, and SpO2 improved. She became apneic intermittently with 100% oxygen and 5% sevoflurane, but assisted mask ventilation was easy in the lateral position. Then, we inserted a peripheral venous line. We administered 0.01 mg/kg of atropine and 1 mg/kg of rocuronium intravenously. We performed tracheal intubation easily using a Macintosh-type laryngoscope. Two percent sevoflurane and 33% nitrous oxide in oxygen remained throughout the rest of the case. Vital signs remained stable during the procedure without opioids and benzodiazepines. We administered 10 mg/kg of acetaminophen suppository for postoperative analgesia.\nThe operation took 36 min, and spontaneous breathing resumed 10 min after discounting inhalational anesthetics. We administered 4 mg/kg of sugammadex sodium before extubation in the operating room. Her respiratory condition was monitored postoperatively in a high-care room with a stand-by ventilator for the rest of the day. It was because congenital central apnea due to trisomy 13 is prone to happen even with inhalational anesthetics. No apnea or desaturation was apparent. She was transferred to the general pediatric ward on postoperative day 2 and went home on postoperative day 4. Radiographs confirmed that the nasopharyngeal airway was open following the tonsillectomy (Fig. ). Home nasal oxygen was no longer needed postoperatively.\nTwo years later, we reapplied the same anesthetic protocol successfully during tube insertion into both eardrums for repeated otitis media. At this time, she had grown to 88 cm in height, and weight had increased to 13 kg. Growth and development were equivalent to a child of about 30 months old. We did not provide her premedication. General anesthesia was introduced and maintained only with 2–5% sevoflurane and 33% nitrous oxide in oxygen. We initially tried to maintain her spontaneous breathing effort during surgery. However, we noticed mild OSA and intermittent apnea. Therefore, we intubated the patient and controlled her ventilation, given the previous experience of easy tracheal intubation. The operation took 20 min, and we extubated the patient under a stable breathing pattern in the operating room. The patient was fully awake and was, therefore, moved directly to a general pediatric ward with SpO2 monitor only at that time. No postoperative analgesics were needed. |
A 45-year-old Caucasian man first noticed a change in his normal state of health with some hoarseness in his voice. This hoarseness persisted for just over a week with no other associated symptoms. As the hoarseness resolved, the patient began to experience significant dysphagia to both hard and soft foods. Associated symptoms included nausea and regurgitation, but no emesis. He had also developed a new persistent cough, which was productive of clear mucus and sometimes scant hemoptysis. The patient reported fatigue, mild dyspnea on exertion, and a 10–15 pound weight loss over the ensuing 6–8 weeks. The patient was a lifetime nonsmoker and up until 3 years earlier had drank approximately 24 twelve ounce beers per week for several years. The family history was reviewed and was negative for any malignancy or familial syndromes with a predisposition for malignancy. The patient was seen by his primary care physician who ordered a chest CT scan, revealing multiple small polypoid lesions, all measuring less than 5 mm, along the wall of his distal trachea and proximal left main bronchus. There were also multiple enlarged calcified lymph nodes in the superior mediastinum. The work up continued with an esophagogastroduodenoscopy, which showed an ulcerated lesion extending from 20 to 30 cm from the incisors (). Endoscopic ultrasound (EUS) was limited but did confirm a large mass in the right posterior margin of the upper esophagus. Biopsies were taken and showed mitotically active spindle cells and focal areas containing eosinophilic stromal hyaline-like material—osteoid. The tumor cells were noted to be vimentin positive, but negative for cytokeratin, desmin, CD117, Melanin, CD45, CD3 and CD20—further supporting the diagnosis of EOO (). The patient underwent bronchoscopy showing multiple endobronchial masses; biopsies were taken and again showed pleomorphic spindle cells. The patient also had a palpable lymph node in his right supraclavicular region; this was biopsied, and pathology results were consistent with EOO. A PET/CT revealed an extensive, calcified, lobulated esophageal mass () with intense FDG avidity extending from T1 to T8, approximately 16 cm in length. In addition, he had bilateral FDG-avid level VI cervical lymph nodes, FDG-avid lymphadenopathy in the mediastinum, multiple bilateral pulmonary nodules, and calcified FDG-avid gastrohepatic lymph nodes.\nThe patient underwent placement of an esophageal stent, which helped relieve his dysphagia. Medical oncology was consulted to determine the role of systemic therapy. The patient was seen, evaluated, and scheduled to receive 4 cycles of doxorubicin and cisplatin. Given the advanced disease present in the patient, chemotherapy consisting of doxorubicin and cisplatin was decided to be the best course of treatment. The patient went to the OR for placement of a port with repeat esophagoscopy. The tumor had increased considerably from the previous endoscopy and the patient was not able to be extubated due to significant local invasion of the tumor involving his entire trachea. He was eventually extubated and the patient and his family decided on placement in hospice care. |
A 49-year-old man with repeated cough and exertional dyspnea for 1 year was admitted to our hospital on January 8, 2019. Dating back to the patient’s clinical history at the local hospital, previous chest CT images showed a “tracheal foreign body”, but no specific foreign body was found by laryngoscope. Thus, the patient was only treated with chronic obstructive pulmonary disease (COPD) at that time. He had a 20-year history of one pack a day tobacco smoking. In fifteen out of the twenty years before hospital admission, the patient was exposed to coal dust without any respiratory protective equipment because coal was his primary source of winter heating (4 to 5 months per year). With an improvement in living conditions, he was not exposed to coal dust in the past five years. The patient denied having a history of coal work and large foreign body inhalation.\nThe patient’s wheezing could be heard in the suprasternal fossa when the patient inhaled and exhaled, but the three depressions sign was negative. The other examinations were unremarkable. Pulmonary function tests showed mild obstructive ventilatory dysfunction and a decrease in small airway function. The values of FEV1/FVC and FEV1% predicted were 68.64% and 76.6%, respectively. The bronchial dilation test was negative.\nA routine blood test showed that white blood cells were 9.39 × 109/L, with the differential of 88.8% neutrophils and 7.0% lymphocytes. There were no other significant abnormalities in residual blood and biochemical indicators. The tumor markers and sputum samples for tuberculosis were all negative.\nThe admission chest radiograph showed a high-density nodule in the trachea at approximately the level of the 7th cervical vertebra, while there was no obvious abnormality found in either lung (Fig. a). Chest CT images also revealed a high-density nodule in the trachea at the same level as seen on the chest radiograph. The image showed the nodule inserting into the right thyroid. The foreign body was well-defined, irregular, about 35 mm × 19 mm × 25 mm in size, and measured 1750 HU for its CT attenuation value. The widest space between the tracheal wall and the foreign body was only about 6.5 mm (Fig. b, c). Fiberoptic bronchoscopy revealed a black foreign body with an irregular shape in the subglottic trachea. The tracheal lumen was mostly blocked, and granulomatous hyperplasia could be seen at the interface between the foreign body and the tracheal mucosa. However, the fiberoptic bronchoscope failed to pass through the trachea due to its severe stenosis (Fig. d).\nThe patient was placed in the supine position and general anesthesia with extracorporeal membrane oxygenation (ECMO) support was administered. A transverse incision was made in the neck about 3 cm above the superior sternal fossa to separate the banded muscle and the tissues around the anterior wall of the trachea. Following a cut from the 4th to 5th tracheal ring and the creation of a U-shaped fistula to insert the endotracheal catheter, the ventilator was connected. Through the incision, the bilateral thyroids were exposed. A black tracheal foreign body penetrated the right wall of the trachea and inserted into the lower pole of the right thyroid. The cicatrization in the thyroid tissue around the foreign body was very serious, and required the resection of most of the right thyroid. A cut from the 1st to 2nd tracheal ring exposed the black foreign body. The irregularly-shaped foreign body was fixed and could not be removed as a whole. A clamp was used to clip the foreign body into pieces and remove them one by one until there was no foreign body residue remaining. We explored the trachea again and observed a proliferation of granulation tissue around the rupture in the right tracheal wall. The tracheal rupture was sutured with Prolene sutures and covered with a neck muscle flap. The neck was then sutured by the standard fashion. The patient recovered uneventfully and his dyspnea was completely relieved after operation.\nIn follow-up treatment one month after the operation, the patient underwent a chest CT and fiberoptic bronchoscopy. No tracheal abnormality was found on the CT images and the fiberoptic bronchoscopy only showed a slight tracheal stenosis at the original surgical site (Fig. a, b). In the subsequent 3-month follow-up period, the patient reported no acute clinical episodes, and no general problems in his work or ordinary activities.\nTo further identify properties of the tracheal foreign body (Fig. a), we compared it with samples of bituminous (Fig. b) and anthracite (Fig. c) coals and performed a quantitative analysis of energy spectrum CT (Revolution CT, GE Healthcare, Milwaukee, Wisconsin). Spectral HU curves and the gemstone spectral imaging (GSI) scatterplot showed very good agreement between the foreign body and the bituminous coal, but low agreement between the sample and the anthracite coal (Fig. d, e). The results of effective Z-value analysis showed that the distribution range of the foreign body was 19.0–21.8 and the highest peak was 19.0–19.6, which were also highly similar to the distribution range (18.4–20.4) and the highest peak (19.0–19.6) of the bituminous coal, but different from the distribution range (11.8–16.2) and the highest peak (13.2–15.4) of the anthracite coal (Fig. f). |
A 48-year-old female patient presented to our outpatient clinic two years ago with complaints of severe muscle weakness. She stated that muscle weakness had been troubling her for more than 10 years and she had presented to a hospital with muscle weakness, fatigue, and respiratory distress at the time. The epicrisis drafted for the patient back then showed the proximal muscle strength in both upper and lower extremities to be between ⅖ and ⅗ as identified in physical examination. No family history was indicated in the given report. According to the laboratory analyses, the patient had a creatine kinase (CK) level of 4,267 (29-200 U/L) and tested negative for antinuclear antibodies and extractable nuclear antigens. Electromyography findings were suggestive of inflammatory myopathy in the proximal muscles of both lower and upper extremities. Furthermore, muscle biopsy performed back then led to the observation of necrosis in the deltoid muscle fibers, which was considered to be suggestive of PM. Neither thoracic computed tomography nor electrocardiographic examination indicated pathologies. At the time, the patient was put on a 1,000 mg/day of methylprednisolone treatment for three days, and the treatment was continued with 1 mg/kg/day of methylprednisolone and 15 mg/week of methotrexate, and the dose of methylprednisolone was gradually reduced to 4 mg/day. The patient benefited from the treatment to a certain extent; however, she had to come back to the clinic within eight months because of recurrence of the previous complaints, upon which hydroxychloroquine was added to her treatment regimen. Nine years ago, the clinic shifted to 1 mg/kg/day of prednisolone and 3 mg/kg/day of azathioprine because of insufficient improvement in the patient’s condition. Seven years ago, subcutaneous administration of 15 mg/week of methotrexate was added to her treatment regimen, upon which the patient suffered further deterioration and muscle weakness and received a course of intravenous immunoglobulin, followed by 40 mg/day of leflunomide in the next years. She also received 1,000 mg of intravenous ritixumab twice with a two-week interval nearly a year ago. No positive effects were observed after these treatments, and the CK levels of the patient was identified to be above 1,000 U/L all the time, ranging between 1,000 and 4,000 U/L. A written informed consent was obtained from the patient.\nThe patient received a total hip replacement because of aseptic necrosis in the right femoral head that developed due to the use of steroids. Our physical examination indicated the muscle strength to be ⅕ in the proximal side of the bilateral upper extremities and ⅖ in the proximal side of the lower extremities. There were no marked findings of atrophy in the muscles. We found the body mass index to be 30 kg/m2. With a level of CK at 3,025 U/L, the patient was put on a monotherapy regimen of 125 mg/week of abatacept. After two months of treatment, muscle strength was found to be ⅗ in the upper extremities and ⅘ in the lower extremities, and the CK level dropped to 1,950 U/L (Figure 1). Muscle strength was found to be ⅗ in the upper extremities and ⅘ in the lower extremities in the fourth month of the treatment, with CK level coming down to 1,200 U/L. Her examinations at month eight showed a muscle strength of ⅘ in both upper and lower extremities and a CK level of 1,003 U/L. The patient was put on resistance exercises. The whole cycle of a 12-month treatment was completed in November 2018 with full muscle strength achieved and a CK level of 484 U/L. The patient, who is being regularly followed-up, is still receiving a monotherapy of 125 mg/week of abatacept, and her condition is stable. |
A 69-year-old man was brought to the emergency room due to shortness of breath. The patient had diabetes and a history of cerebral infarction 10 years ago. The sequelae of cerebral infarction included slight motor weakness of the left leg that did not interfere with activities of daily life. He had received conservative treatment for symptoms such as myalgia, fever, and chills at a nearby hospital 2 weeks prior. He was transferred to Dankook University Hospital for shortness of breath that had started 1 day before admission. Left-sided hydrothorax was observed on an initial chest X-ray conducted in the emergency room. Consequently, thoracostomy was performed for chest tube placement. The drainage was also very turbid. Subsequent chest computed tomography (CT) revealed left thoracic empyema (). Laboratory tests revealed an initial C-reactive protein level of 30.76 mg/dL, a white blood cell count of 15.71×103/μL, and a negative tuberculosis test result. A pleural fluid culture study, the results of which came back on the sixth hospital day, showed the growth of Streptococcus constellatus and an anaerobe. The patient was admitted with the chest tube, and ceftriaxone and clindamycin were used as empirical antibiotics. When the total amount of drainage reached 1 L on the day of admission, tube clamping was performed considering re-expansion edema. The next day, natural draining resumed. From that day onward, redness, warmth, swelling, and tenderness were observed in the left flank. On the following day, symptoms worsened, and another CT scan was performed. On chest CT, signs of infection, including gas formation, were found in the soft tissue and the muscle layer of the left chest wall (). At this point, an internal medicine doctor contacted cardiovascular and thoracic surgery department, and we performed surgery immediately, after making a diagnosis of necrotizing fasciitis (NF). Surgery was performed under general anesthesia, with the patient in the right lateral position. Wide sterilization and draping were performed from the axilla to the buttock. An approximately 60-cm horizontal incision was made along the left flank from the scapula tip to the anterior superior iliac spine. There was a large amount of pus, and the anatomy of the muscle was indistinguishable due to severe infective necrosis. Necrotic tissues were removed, including those at the subcutaneous tissue, latissimus dorsi, teres muscle, serratus anterior muscle, and gluteus muscle, using a scalpel and electrocautery (). The surgery was completed with an open-dressing using betadine wet gauze. NF was confirmed by pathology (). The antibiotics were switched to meropenem and vancomycin as empirical therapy. Acinetobacter baumannii complex growth was noted in cultures of samples collected during surgery; therefore, we changed vancomycin to tigecycline based on antibiotic sensitivity. Wound irrigation and open dressing were performed daily under consultation with the orthopedic surgery department. On postoperative day 6, we applied negative-pressure wound therapy. Extubation was performed on postoperative day 12, and the patient was transferred to the general ward. On postoperative day 35, delayed wound closure was performed. C-reactive protein levels decreased gradually after surgery and reached 0.31 mg/dL at discharge. The patient was discharged from the hospital on day 98 and currently continues to be monitored via follow-up through outpatient visits.\nThe study was approved by the Institutional Review Board of Dankook University Hospital (IRB approval no., 2020-09-018). The requirement for informed consent was waived. |
A 70-year-old man with antecedent of follicular lymphoma in complete remission presented at the Timone University Hospital (Marseille, France) in 2016 for a squamous cell carcinoma of the hypopharyngeal region. The patient categorically refused any treatment, including preservative surgery, radiotherapy, chemotherapy or supportive care.\nOne year later, he was addressed to our palliative care unit by the hand-surgery department after attempting suicide. The patient explained his action by the fear of suffering. No depressive state was diagnosed by our psychiatrists. Despite persistence fear of suffering, the patient rejected the idea of suicide because of his family, but still wanted to die and asks for assistance. Information on Claeys-Leonetti law was given, especially on assisted-suicide banishment and on the possibility to relieve suffering with adapted treatments.\nOne week after discharge, the patient was readmitted to our department for dyspnea and anxiety. Symptoms were managed by appropriate treatments (oxygen and low dose of midazolam in an anxiolytic purpose). Despite stabilisation, the patient was afraid of dying suffocated and asked for deep and continuous palliative sedation until death. Apart from the fear he expresses, the patient has no symptoms of anxiety, depression or pain after the introduction of appropriate treatments. On the other hand, he clearly states that he refuses to live again knowing that his death is approaching and that he is apprehensive of suffering. He says he wants to rush his death. For us, this is a request for assisted-suicide (active help from a third party for the administration of a lethal product) or euthanasia (act of a third party which intentionally provokes the death of another to put an end to his sufferings), rather than a real demand for deep and continuous sedation. It seems important to note that patient’s requests for deep and continuous sedation until death are not registered officially. The law does not even impose a written request. Thus, the request is most often made orally in the presence of several doctors and clinicians.\nIn order to try to objectify this request and therefore our answer, the patient’s request was examined and denied by palliative multidisciplinary board, in accordance with by the French Oncology Coordination Centre guidelines. This situation did not fulfil the criteria requested by Claeys-Leonetti law. Indeed, prognosis appeared not short term committed (no visible clinical progression of the disease, which commits for sure the short-term vital prognosis), symptoms were managed with appropriate treatments and no life-sustaining treatment arrest could lead to potential unbearable sufferings. Regarding the short-term criterion of life-threatening prognosis, the patient was offered to have a Computed Tomography (CT) scan to measure the progression of the disease. Indeed, no imaging had been performed for one year (time of diagnosis of recurrence). The patient refuses this proposal. The request for deep and continuous sedation was reiterated several times by the patient, who was still refusing any investigations to define the progression of his cancer and wanted parenteral hydration to be maintained. Daily, he questioned each caregiver about the rationale for the refusal of his request. How can the medical staff be sure that his prognosis is not short-term compromise? Why his psychological distress could not be considered as refractory? One week after refusing further investigation, the patient finally agrees to undergo a CT scan. Three days after the exam he dies peacefully, according to our team (no specific questionnaires or objective elements to judge the quality of death exists), of a not predictable respiratory distress certainly linked to the evolution of his cancer of the hypopharyngeal region without introduction of deep and continuous sedation, but with introduction of midazolam for anxiety. Opiates were not introduced because the patient was saying not being painful. The CT scan results, unknown at the time of death, reveal nothing conclusive (pulmonary metastases, but no lymph node involvement) and would have required additional analyzes. |
A 31-year-old male presented to the hospital with slow-growing swelling in the left proximal tibia for 7–8 years. The patient gave a history of fall 1–2 months before presentation and was unable to bear weight on the affected limb. On examination, a large mass was palpable arising from the proximal tibia extending posteriorly, laterally, and superiorly across the knee joint. Popliteal pulsation could not be felt, but dorsalis pedis was palpable and the patient had no neurological deficit. The patient had a fixed flexion deformity of 60° with no further range of motion possible at the knee joint.\nThe X-ray showed large calcific lesion arising from the upper end of tibia and likely from fibula( and ). The calcification was chunky and irregular in nature and appeared to be a secondary sarcomatous change in a case of long existing osteochondroma. The MRI suggested of an irregular osteochondromatous lesion extending toward the posterior neuromuscular bundle but not invading it ( and ). All pre-operative investigations were normal and a decision was taken to widely resect this tumor and implant a proximal tibia replacement megaprosthesis to allow limb salvage. A gross 13 cm long proximal tibial segment was resected and sent for intraoperative histological analysis. The tumor was lobulated with a cartilaginous cap and measured 10 cm×9cm×6 cm( and ). The tumor had eroded the posterior cortical margins. Also resected was a 4cm stump of proximal fibula which showed involvement intraoperatively. The histopathology revealed irregular mass of bony trabeculae with island of hyaline cartilage with extensive enchondral ossification. The newly ossified bone showed characteristic blue coloration in the intratrabecular space with no atypical cellular proliferation, thus confirming the diagnosis of BPOP. On regular post-operative follow-up, the patient recovered good quadriceps and hamstrings strength with knee range also recovering between 0 and 90°. No signs of recurrence were seen on a 7-year follow-up (.) |
A 24-year-old primigravida with 6-week pregnancy was brought into emergency department with severe abdominal pain which started two days earlier and had worsened suddenly in the morning she was admitted. She was referred with a suspected diagnosis of ruptured ectopic pregnancy. Initial examination showed tachycardia of 124 beats per minute, marked pallor, and generalised tenderness in abdomen. The rest of her physical examination was normal. There was no history of vaginal bleeding. Her initial blood counts showed haemoglobin of 4.5 g/L. A FAST (Focused Assessment with Sonography in Trauma) scan appeared to suggest intraperitoneal bleed. Abdominal pain with pallor, low haemoglobin, and positive FAST scan was very suggestive of ectopic pregnancy. Therefore, a CT scan of abdomen was arranged. The scan showed large left retroperitoneal hypodense mass with hyperdense strikes. There was evidence of compression on the left kidney, pancreas, and bowel loops with associated moderate amount of ascites. Findings were consistent with massive retroperitoneal haematoma extending from diaphragm (Figures and ) displacing left kidney (Figures and ) and extending into pelvic cavity. The pregnancy was however found intact within uterus (Figures and ).\nThe haematoma was causing marked displacement of the left kidney and was showing varying shades of hyper- and hypodensities. Varying shades of hyper- and hypodensities were suggestive of haemorrhages of different ages which were periodic and of slow episodes (Figures and ). The main source of bleeding was found to be the apical portion of left kidney which appeared as a cystic lesion in continuity with the haemorrhage ().\nPatient was kept in intensive care unit under observation and blood was transfused to her to support haemodynamics and achieve a target of Hb% of 10 G/L. Unfortunately, the lesion could not be evaluated with MRI due to technical problem with the MRI scanner.\nInitial attempt of embolisation of the lesion failed and next day the haemoglobin level started dropping and therefore a decision was made to intervene. She was taken to operation theatre and partial nephrectomy with evacuation of haematoma was carried out through retroperitoneal approach. Preoperative findings showed a small cystic lesion on upper pole of left kidney which was later confirmed to be renal angiomyolipoma on histopathology. Postoperative period was uneventful and she was discharged back to the care of obstetrician. An uneventful delivery via elective caesarean section was later reported.\nThis case highlights the silent behaviour of renal angiomyolipomas with slow episodic haemorrhage which can cause damage and displacement of adjacent structures and can actually prove lethal. This patient could have died secondary to haemorrhagic shock. In particular the retroperitoneal haemorrhage could have been easily missed and recurrent haemorrhage on top low haemoglobin could have proven fatal. |
Case 3. A 54-year-old housewife who was living with her husband was referred to our clinic after complaining of a tingling sensation on her teeth when they were touched (left mandibular second premolar and first molar), which had been treated, and an uncomfortable feeling on her provisional prosthesis that made it unbearable to keep the caps on. She had a history of dysautonomia, gastritis, pyloric ulcer, and stomach polyps. She was taking mirtazapine, alprazolam, domperidone, and rebamipide. Twenty days before her visit to our department, she had visited a mental health clinic that was introduced to her by her primary physician. The diagnosis of her condition was unclear. She had no other family history. No particular psychological factors could be identified at onset.\nFive months before the initial visit, she had visited a dental clinic after a metal inlay on her left mandibular first molar had detached. An extension bridge treatment was recommended and a bridge was attached to her left mandibular second premolar, first molar, and second molar. After that, an uncomfortable feeling and pain were caused by the bridge. She attended another dental clinic, where she underwent pulpectomy of her left mandibular first molar and insertion of a new bridge; however, there were no changes in her symptoms. She consulted another dental clinic and was referred to our university hospital department for endodontics, and she visited them 3 months afterwards. There were no specific problems in her pulp treatment, so she was referred to the pain clinic of our hospital by the department for endodontics. Her symptoms did not change, so she was referred to our department by the pain clinic. She was also referred to psychiatry by her family physician 2 days before her first visit.\nAlthough the patient had anxiety and irritability, obvious signs of depression were not observed. The patient strongly requested a prescription of 7.5 mg of mirtazapine at our hospital, which had been prescribed by the psychiatry department 2 days before her first visit. Thus, we started her pain treatment with 7.5 mg of mirtazapine. After 2 weeks, she said that the pain in her teeth was getting better but the uncomfortable feeling in her provisional teeth remained and she still felt that it was unbearable to keep the caps on. Therefore, we added 1 mg of aripiprazole. Twenty days later, the uncomfortable feeling had slightly improved. Afterwards, we gradually increased the dose of mirtazapine to 30 mg and the dose of aripiprazole to 2 mg, which led to the subsidence of the pain and discomfort. Also, she stated that the time spent thinking about her teeth had decreased. Although the discomfort occasionally reappeared, aripiprazole could be reduced to 1 mg 5 months after her initial visit, and a final prosthesis was attached after the provisional prosthesis (Fig. ). |
A 46-year-old male presented to the emergency department with several-month duration of exertional dyspnea after taking only a few steps with subsequent nonproductive coughing episodes leading to syncopal events. These episodes were ongoing over the past 8 months and had worsened over the 2 months prior to presentation. The patient was unable to work or drive for fear of coughing and suddenly losing consciousness. The patient also had 2-month duration of bilateral lower extremity edema, abdominal distension, and generalized fatigue with diagnoses of portal venous thrombosis at the same time, with anticoagulation noncompliance.\nOn presentation during this admission, the patient’s vital signs were within normal limits, and the patient was afebrile and had an oxygen saturation of 97% on room air. Physical exam was significant for an elevated jugular venous pressure, a loud S1, an early diastolic tumor plop but no murmurs, a positive hepatojugular reflux, and 1+ pedal edema in bilateral lower extremities. Lungs were clear to auscultation bilaterally. Pertinent laboratory work included a brain natriuretic peptide level of 1411 pg/mL and an erythrocyte sedimentation rate (ESR) of 12 mm/h.\nIn the emergency room, the patient underwent a computed tomography (CT) of the chest (), which demonstrated a 6.1 cm by 4.5 cm mass in the left atrium. A transthoracic echocardiogram with contrast was performed for further evaluation. Left ventricular ejection fraction was 60% to 65%, and the right ventricle was moderately dilated with moderate systolic dysfunction. The left atrium was moderately enlarged and a massive echodensity occupied the entire left atrium. Severe obstructive stenosis across the mitral valve was suggested by the mean transmitral gradient. The tricuspid valve showed moderate regurgitation with a jet velocity suggestive of severe pulmonary hypertension. Cardiac catheterization performed prior to surgery showed mild nonobstructive coronary artery disease.\nThe patient underwent cardiothoracic surgery for removal of the left atrial mass, which was subsequently determined to be a left atrial myxoma. A transesophageal echocardiogram () was performed preoperatively and postoperatively. Preoperative findings included the left atrial mass, which appeared to be attached to the interatrial septum, biatrial enlargement, and a severely dilated and hypokinetic right ventricle. Postoperative findings showed complete removal of the mass and trivial mitral and tricuspid regurgitation. Histopathology confirmed the diagnosis of the cardiac myxoma.\nThe patient was discharged on postoperative day 3 with the following medications: rivaroxaban, losartan, metoprolol tartrate, and aspirin, and the patient was to follow-up with a primary care provided and continue taking rivaroxaban.\nHypercoagulability workup when not on anticoagulation was significant for a low protein C level. The patient was discharged home on long-term anticoagulation secondary to portal vein thrombosis with protein C deficiency. |
The patient was a 16-year-old girl who presented at the urology clinics with pain on the left side of the abdomen radiating to the back. Her past medical history was insignificant. Computerized axial tomography scans of the chest, abdomen, and pelvis revealed a 70 × 70 × 60 mm left renal mass (Fig. ), bilateral pulmonary nodules (the largest being 16 mm in diameter), and widespread bone metastases in vertebrae, sacrum and left femoral head. A biopsy from the tumor in the kidney through laparotomy was performed followed by left radical nephrectomy after the diagnosis of malignancy.\nTumor occupied the entire upper half of the kidney, extended into the renal sinus, was a solid white unencapsulated lesion with sharp borders, measuring 7.5 × 7 × 7 cm in size (Fig. ). Microscopical sections showed diffuse infiltration of the neoplastic tissue in kidney parenchyma separating normal renal elements from each other. The neoplastic cells were small, monotonous and epithelioid with clear to pale eosinophilic cytoplasm, and were arranged in single files, cords, nests or irregular aggregates in collagenous matrix (Fig. ). Nuclei were generally round to oval, with indistinct nucleoli. Hypercellular areas alternated randomly with hypocellular densely hyalinized or at times myxoid stroma. Additionally, a peculiar lobular organization was noted in many regions where a renal tubule in the center was surrounded by concentric inner hypo and outer hypercellular zones of neoplastic cells (Fig. and ). These lobules were separated from each other by myofibroblasts. Tubules entrapped in the tumor were lined by single layered Pax-8 positive cuboidal cells without atypia, some showed shallow papillary hyperplasia and rare mitosis. Mitotic rate was 1/10 hpf in the neoplasm and there were occasional areas of necrosis in the tumor. Hypercellular areas occasionally contained vague nodules of collagen mimicking those seen in hyalinizing spindle cell tumor with giant rosettes (HSCTGR). The surrounding kidney showed no specific pathologic changes. By immunohistochemistry, neoplastic cells were immunoreactive diffusely and strongly for vimentin, bcl-2 and CD99; EMA labelled them in a weak and patchy fashion (Fig. ). They were negative for pan-cytokeratin, Pax-8, WT-1, CD34, S-100, GFAP, Melan-A, HMB-45, desmin, and estrogen and progesterone receptors. Smooth muscle actin (SMA) stained myofibroblastic cells in-between the neoplastic lobules (Fig. ). INI-1 was preserved. Then, an immunohistochemical stain for MUC4 was performed which showed strong positivity throughout the tumor (Fig. ). Finally, FISH analysis with the EWSR1 Break Apart probe revealed loss of one copy of the Spectrum Green labeled probe flanking the 3’ (telomeric) side of the EWSR1 gene as well as the presence of a single fused EWSR1/CREB3L1 signal (represented by a juxtaposed orange signal and green signal) consistent with the presence of an unbalanced der(22)t(11;22)(p11;q12) (Fig. ), confirming the diagnosis of sclerosing epithelioid fibrosarcoma. FISH study was negative for a rearrangement of the FUS gene locus.\nPatient was given chemotherapy with multiple agents. She is alive with disease after 30 month follow-up. |
A 28-year-old Caucasian Greek woman presented to the emergency department after sustaining an injury to her right knee during dancing. The mechanism of her injury compromised vigorous internal rotation of the femur on the tibia with the knee in flexion. She complained of mild pain in both the medial and lateral aspects of her knee joint. Her right knee was locked in 35° of flexion.\nPhysical examination demonstrated negative Lachman-Noulis and anterior drawer tests. Clicks or catches were not detected by palpation during flexion, extension, and rotary motions of her knee joint. There was tenderness in her medial and lateral joint line. Results of standard anteroposterior and lateral roentgenograms were normal. A magnetic resonance imaging (MRI) evaluation demonstrated the tears in both menisci of the right knee (Figure ), while the anterior and posterior cruciate ligaments were found to be intact (Figure ).\nOur patient had no relevant medical history. Her physical examination and laboratory tests were unremarkable. No diseases of the connective tissue or other deficiency of the ligaments were detected.\nShe underwent a knee arthroscopy in the next 24 hours, and the diagnosis of combined injury of bicompartmental bucket-handle tears with an intact anterior cruciate ligament was confirmed (Figure ). Arthroscopic evaluation also revealed a discoid lateral meniscus. Moreover, a grade III chondral lesion (graded on the Outerbridge classification), less than 1 cm2 in size, was detected on the medial femoral condyle []. A partial medial and lateral meniscectomy was then performed. The decision was made because of the discoid lateral meniscus and the quality of the ruptured part of the medial meniscus. The torn tissue - approximately 40% of the mediolateral width of each meniscus - was removed. The cartilage defect was repaired by drilling therapeutic holes (approximately 0.5 to 1.0 mm in diameter) into the subchondral bone marrow space underlying the region of the cartilage lesion (microfracture technique) [].\nAt our patient's follow-up examination six months after her injury, clinical tests demonstrated that her right knee was stable, had a full range of motion and had no tenderness. The functional outcome was evaluated using Lysholm scoring. At the time of her presentation to our emergency department she had a Lysholm score of 75, while six months after her injury, her Lysholm score had increased to 85 []. She was satisfied with the outcome of the operation and returned to her pre-injury activities. |
A 53-year old female was admitted to the Intensive Care Unit of Kingston General Hospital in Kingston, Ontario, Canada with diabetic ketoacidosis (DKA). She had a past medical history of type 1 diabetes with recurrent DKA and end stage renal disease secondary to diabetic nephropathy on intermittent hemodialysis. Prior to admission, she was being dialyzed through a left arm arteriovenous fistula.\nShortly after admission, her left arm fistula thrombosed, and a right internal jugular (IJ) tunneled double-lumen catheter was inserted for dialysis along with a peripherally inserted central catheter (PICC) via right basilic vein for intravenous access. The patient had a previous failed right arm AV fistula so the left arm was avoided in hopes of future recovery of the left AV fistula.\nTwo weeks later during the course of her admission, she continued to have episodes of DKA, and inadvertently her PICC line was dislodged, requiring removal. The patient had poor peripheral intravenous (IV) access and multiple attempts to insert peripheral IVs under ultrasound guidance were unsuccessful. Ultrasound examination of the patient's left internal jugular showed significant narrowing. The patient declined an attempt femoral venous access because she had previous lower extremity venous grafting for her AV fistula and she was told to avoid cannulization of any of those vessels. A 7 French, 16cm triple-lumen CVC was placed into the right internal jugular vein with sonographic guidance without difficulty. The puncture site for the CVC insertion was significantly distal to the tunneled dialysis catheter. Post-procedure, all three lumens were able to draw blood and flush saline. A chest X-ray confirmed placement of the catheter adjacent to the tunneled dialysis catheter () close to the cavoatrial junction. The patient did not have any immediate complaints or discomfort. Approximately six hours later, the on-call resident was called by nursing staff to assess the patient for new neck discomfort and jaw pain which had begun two hours prior.\nAt the time of assessment, the patient's heart rate was 95 beats per minute and regular. Her blood pressure was 188/84, respiratory rate was 18 and oxygen saturation was 99% on room air. She was afebrile. On examination, the patient had distended neck veins, pronounced facial edema and plethora (). She also had bilateral upper-extremity edema primarily manifesting in her digits. The rest of her cardiorespiratory examination was unremarkable.\nAll three lumens of the CVC were withdrawing blood and flushing without difficulty.\nPoint of care ultrasound of the right internal jugular vein revealed no thrombus at the site of CVC entry or distal to it. The SVC was not visualized directly. The CVC was removed promptly. There was no visible clot on the catheter, and no clot was pulled along with the catheter. Within an hour, the patient's facial swelling and plethora began to resolve, and her neck pain began to improve. The next morning, pain and swelling had resolved completely ().\nA retrospective chart review revealed a fistulogram performed months prior that showed significant stenosis at the left subclavian vein and mild narrowing at the junction where the two brachiocephalic veins merge to form the SVC (). At that time, angiography was attempted to alleviate the stenosis. However, the patient did not tolerate this, and the procedure did not lead to a significant change in the degree of stenosis.\nThe events surrounding the SVC syndrome and the previously identified SVC stenosis were disclosed to the patient. In order to prevent a similar event from occurring in the future, a note was made in the chart that would be more visible should the need for further CVCs arise. |
A 63-year-old Japanese woman was referred to our department because of an abnormal shadow at the left side of her chest wall on computed tomography. She had undergone total hysterectomy and radiotherapy for cervical carcinoma 4 years prior. One year after the first surgery, three metastatic lung nodules appeared at the upper lobe of her right lung, the lower lobe of her right lung, and the lower lobe of her left lung. Wedge resection for upper and lower lobe of her right lung was initially performed via three-port thoracoscopic surgery. Then, wedge resection for the lower lobe of her left lung was performed via eighth intercostal single incisional thoracoscopic surgery. After the surgery, an intrathoracic chest wall mass developed which increased in size gradually. Her gynecologist introduced her to our department for surgical resection of the mass. Her family, including her parents and two sisters, had been healthy and had no inheritable diseases. She had no symptom, drug history, tobacco smoking history, or psychosocial history, and she was a social drinker. She had not received any medications since the mass developed and until admission to our hospital. She had undergone an operation three times as mentioned above and had been a carrier of type B hepatitis.\nAfter her admission to our department, her general condition was good, and there were three operative scars at both sides of her chest and lower abdomen. Her chest sounds were clear and there was no neurological abnormality. She was 151.1 centimeters tall and weighed 49.8 kilograms. Her heart rate was 77/minute, blood pressure was 135/87 mmHg, and body temperature was 36.1 °C. The laboratory findings were white blood cells 5.25 × 103/μL, hemoglobin 12.7 g/dL, and platelets 156 × 103/μL. A liver function test revealed: albumin 4.6 g/dL, aspartate aminotransferase 15 U/L, alanine aminotransferase 13 U/L, and total bilirubin 0.3 mg/dL. A renal function test revealed blood urea nitrogen 13.6 mg/dL and creatinine 0.79 mg/dL. An electrolyte test revealed sodium 143 mEq/L, potassium 3.8 mEq/L, and chlorine 106 mEq/L. A tumor marker test revealed carcinoembryonic antigen 3.4 ng/mL and squamous cell carcinoma antigen 0.80 ng/mL. Another test revealed positive reaction to type B hepatitis surface antigen and C-reactive protein < 0.1 mg/dL. Computed tomography demonstrated a gradually increasing low-density mass measuring 2.0 × 1.8 cm in diameter (Fig. ). Magnetic resonance imaging demonstrated a low-intensity mass in T1-weighted imaging and a high-intensity mass in T2-weighted imaging (Fig. ). The mass was thought to be a singular cyst; however, this type of cyst was rare and the mass was increasing. Therefore, dissemination of cervical carcinoma could not be excluded, and surgical removal of a part or tissue of the mass was performed.\nIn the right lateral position, thoracoscopic excision of the mass was done with two ports (3 mm and 2 cm access ports) by two general thoracic surgeons (Fig. ). First the 3 mm port was set at the sixth intercostal space on the inframammary line. Most of her left lung was attached to her chest wall; therefore, the second port was set above the cyst and lysis of adhesions was done. After the lysis, the cystic mass was found adhering to the upper lobe of her left lung. The adhesion of the mass to her lung was not strong and could be separated without injury to the visceral pleura. Therefore, the mass was thought to derive from the chest wall pleura and was resected by adhesiolysis.\nThe mass was a unilocular cyst containing mucinous fluid. On microscopic examination, the cyst was lined with a single layer of cuboidal epithelium (Fig. ); immunohistochemistry showed positive staining of calretinin and D2-40 (Fig. ). Thus, the cyst was diagnosed as mesothelial cyst derived from the chest wall pleura. Five years after the surgery, our patient had no evidence of cyst or cervical carcinoma on computed tomography. |
A 4-year-old boy was presented to our unit on referral with a three-week history of high-grade fever and a five-day history of generalized abdominal pain and abdominal distension. There was an associated history of headaches and body weakness. He had no history of jaundice. He had several episodes of vomiting which was initially none bilious, but later became bilious. There was an associated history of passage of diarrhea stools two days before presentation, although the patient had not passed stools on the day of presentation. He had no history of passage of melena or of hematochezia. His parents complained that he had been passing scanty urine for about five days before presentation. He had been receiving medications from the referring hospital for about two weeks before presentation.\nAt presentation, he was chronically ill looking with a toxic facie, febrile (temperature 38.5°C), pale, dehydrated, anicteric, and had no pedal edema. His respiratory rate was 28/minute; he had reduced air entry on both lung bases posteriorly. His pulse rate was 128/minute, which was regular but of small volume. Only first and second heart sounds were heard. Abdominal examination showed a distended abdomen which did not move with respiration. He had generalized tenderness with guarding. The bowel sounds were absent. A digital rectal examination showed an empty rectum with a full and tender rectovesical pouch. An initial assessment of a generalized peritonitis was made. The patient was placed on NPO with nasogastric tube for gastric decompression. He was commenced on IV fluid resuscitation and broad spectrum IV antibiotics (ceftriaxone and metronidazole) and was worked up for surgery. Initial laboratory investigations showed a hematocrit of 24% and hypokalemia (2.5 mmol/l) and a serum urea of 10 mmol/l. After an initial fluid resuscitation and correction of serum potassium, he had 300 ml of whole blood transfused. He had an exploratory laparotomy on the second day of admission. At surgery, about 600 ml of a feculent peritoneal fluid was drained, and a single perforation on the antimesenteric border of the terminal ileum was closed in two layers. An intraoperative diagnosis of perforated typhoid enteritis was made. Blood and tissue cultures were not done. He was continued on IV fluids and the same empiric antibiotics after the surgery.\nOn the third day of postoperation, the abdominal wound had a purulent discharge from the distal end. The wound was opened and stitches were removed from the site of drainage, with the institution of daily wound dressing. By the fifth day of postsurgery, a dark patch was noticed to have developed in the skin over the right iliac fossa and measured about 5 cm in its widest diameter. At about the 7th day of postoperation, the dark dry patch had extended to the right hypochondrium, and a similar patch had appeared along the edges of the abdominal incision and the left iliac fossa. A diagnosis of anterior abdominal wall gangrene was made. On the 8th day of postsurgery, the patient was noticed to have developed a complete wound dehiscence () and a fecal fistula. He had fluid resuscitation and was taken back to the theatre on the 10th day after the first surgery, for wound exploration and debridement of the anterior abdominal wall gangrene. A new intestinal perforation was seen at about 2 cm from the initial perforation. The intestinal perforation was exteriorized as an ileostomy, and the abdominal wound closed with tension sutures. Postoperatively, the patient's condition remained unstable, with intractable shock. He died six days after the reexploration of septic shock. |
A 50-year-old male patient with aortic dissection originating just above the aortic valve and extending down to the common iliac arteries (Stanford A, Figure ) underwent immediate surgery with repair of the ascending aorta in moderate hypothermia under cardiopulmonary bypass. The arterial line was inserted in the right axillary artery, the vent was placed in the right upper pulmonary vein, and two-stage venous line was inserted through the right auricula. The intact aortic valve was resuspended. Extracorporeal circulation was suspended after induction of moderate hypothermia (25°C) and the aortic cross-clamp from the ascending aorta was removed. The false lumen was then glued and an open distal anastomosis to a prosthetic graft was constructed. Then, extracorporeal circulation was resumed, systemic circulation was deaired and the patient was warmed.\nEarly on the first postoperative day, CT of the aorta was requested because of marked elevation of lactate-dehydrogenase (129 μkat/l) and signs of acute renal insufficiency (creatinine 292 μmol/l). CT showed good postoperative result in the ascending aorta, but large amount of air in the branches of the superior mesenteric artery up to the arcades was found (Figure ). There was absolutely no air in the portal-venous system including the liver. The bowel loops were not distended, and there were no signs of bowel paralysis.\nAt midnight on the first postoperative day, a biphasic CT scan of the abdomen was requested due to elevated intra-abdominal pressure (18 mmHg). The CT showed distribution of the intra-arterial gas more into the periphery and into the wall of the bowel loops that still did not display signs of ileus (Figure ). The next morning, surgical exploration was performed due to increasing intra-abdominal pressure as a sign of imminent abdominal compartment syndrome. An extensive bowel resection from oral ileum down to the splenic flexure had to be performed due to extensive necrosis of the bowel. Shortly after the operation, the patient became hypotensive with signs of overwhelming vasoparalysis and died on the third postoperative day of multiple organ dysfunction syndrome (MODS) with systemic inflammatory response syndrome (SIRS). |
A 40-year-old female, with 3-month history of nasal obstruction and tinnitus was admitted in August 2012. Nasopharyngeal endoscopy and biopsy already had been performed in another hospital, showing nonkeratinizing undifferentiated NPC. This histopathologic diagnosis was confirmed in our center. Magnetic resonance imaging (MRI) of the nasopharynx and neck revealed the tumor was confined to the nasopharynx and the bilateral locoregional cervical lymph nodes enlarged with its greatest dimension of 2 cm. Chest computed tomography (CT) scan, ultrasound of abdomen, and whole-body bone scan ruled out distant metastases. So clinical staging was determined to be T1N2M0, IIIA according to American Joint Committee on Cancer TNM Staging System for NPC (7th ed, 2010).\nThe patient was treated with definitive IMRT to 7050 cGy for primary tumor and 6600 cGy for infiltrated regional lymph nodes. Concurrent chemotherapy based on cisplatin and 5-flurorouracil was administrated for 2 cycles and then 2-cycle chemotherapy was given subsequently to consolidate the efficiency with the same regimen. At the end of therapy, she obtained clinical complete response by nasopharynx and neck MRI.\nIn the initial therapy, the patient had undergone abdominal ultrasonography for 4 times, and no hepatic lesions were noted during this period. Nevertheless, when she came to our hospital for 3-month conventional follow-up in April 2013, abdominal sonogram revealed a liver cystic lesion with thin wall and smooth margin of 18 × 16 mm in the right liver lobe, and the lesion was interpreted as a simple liver cyst (Fig. ). Therefore, intense follow-up was suggested. Five months later, the cystic lesion enlarged to be 59 × 46 mm, with thick wall, but no signal of blood flow. Further CT presented a low density and heterogeneous lesion taking irregular wall and incomplete septa with strong contrast enhancement, indicating liver abscess (Fig. ). However, the patient was asymptomatic, with no fever, no right up abdominal pain, and no palpable mass by physical examination. On the contrary, laboratory findings were negative, liver function was normal, the white blood cell count, C-reactive protein, and cancer-related antigen including α-fetoprotein were within the normal limits. Afterward the patient was transferred to another hospital for abscess drainage, and fluid culture was negative, but fine-needle aspiration was not performed. After drainage, the mass shrank significantly to one-third of the original size. However, it returned to previous size by CT 2 months later. Thus, the liver lesion was suspected to be malignant. Work-up examination including chest CT, pelvic MRI, emission CT for bones, gastroscopy, colonoscopy, and brain MRI excluded other lesion that may account for another primary tumor or extra-hepatic distance metastases from NPC. In addition, nasopharynx MRI showed no evidence of local relapse. On November 21, 2013, surgical resection was administrated both for histologic diagnosis and treatment, and the surgical margin was negative. Histopathologic examination definitely confirmed that the metastasis originated from NPC, since the cells of the surgical segment were similar to primary NPC on the morphology and they were positive in Epstein–Barr virus (EBV) encoded RNAs (EBERs) (Fig. ). No adjuvant chemotherapy was done after resection of the liver metastasis.\nHowever, relapse-free survival time lasted only for 8 months. In July 2014, 2 small cystic lesions were found on abdominal CT scan again, which were extremely similar to simple cysts (Fig. ). Further contrast-enhanced ultrasonography provided no sign of “fast in and fast out,” that is, a characteristic appearance in malignant carcinoma. As a result of multidiscipline team discussion, “watch and wait” strategy was recommended. However, the number of hepatic lesions increased to 4, and the size of previous 2 cysts enlarged to be 3 cm within 3 months. The multidiscipline team members reached a consensus that the cystic lesions were metastases from NPC and suggested a palliative systematic chemotherapy. Then the patient received chemotherapy with paclitaxel and cisplatin for 6 cycles. During the first 3 cycles, partial lesions diminished in size, but stayed stable within the later 3 cycles. Nevertheless, the intraliver metastases exhibited significant progress soon after the chemotherapy. Subsequently, she underwent chemotherapy with gemcitabine plus targeted therapy with nimotuzumab, then single navelbine both for 3 cycles, but neither protocols showed notable effects on hepatic lesions. In addition, during the phase of chemotherapy with navelbine, the patient complained of chest pain, an irregular and fixed lump was found on her chest wall, approximately 3 cm in diameter. After local surgical resection was performed, the lump histologically was demonstrated to be an extra-hepatic metastasis from NPC. Considering the patient's good performance status score and grade A liver function according to the Child-pugh grading system, transcatheter hepatic artery chemoembolization (TACE) was administrated for 5 times from December 2015 to April 2016. After the TACE treatment, all the lesions were obviously decreased in size, with the largest metastasis decreasing from 64 × 53 to 33 × 32 cm (Fig. ). Meanwhile, carbohydrate antigen 125 (CA125) decreased from 125 to 60.8 U/mL, and squamous cell carcinoma antigen decreased from 2.8 to 0.9 ng/mL. Then 4 cycles of gemcitabine plus cisplatin were offered to consolidate the clinical effects. In the next 6 months, her liver metastases maintained stable, but lung metastases were noted. In October 2016, the CT showed the liver metastases progressed. At last, she died of liver failure in March 2017. |
A 10-month-old male infant with strong anxiety observed for one day was admitted to our department. Past medical history revealed surgery at the age of 8 months due to a Morgagni-Larrey hernia. In addition, the child was under the care of a cardiology outpatient clinic (ventricular septal defect type 2) and ENT outpatient clinic (bilateral sensorineural hearing loss). There were no abnormalities in complete blood counts and routine biochemical laboratory tests performed two and four months prior to hospitalization. The family history was insignificant. Physical examination revealed pale skin, postoperative scars, Mongolian spot in the sacral region, flat forehead, broad nasal bridge with a tendency to form epicanthal folds, single transverse palmar creases, persistent fetal pads, aphthous stomatitis, umbilical hernia and systolic murmur along the left border of the sternum. Preliminary results of laboratory tests showed agranulocytosis, monocytosis, anemia, and increase in C-reactive protein concentration. The results of laboratory tests are presented in . There were no abnormalities of abdominal organs based on abdominal radiographs and ultrasound examination, except for umbilical hernia.\nOn the second day of hospitalization, the tender and painful mass about 2 × 2.5 cm, without splashing in the right submandibular area was palpated. Ultrasound examination of this area revealed the features of a forming abscess. An laryngological consultation was performed and initially empiric antibiotic therapy with amoxicillin and clavulanic acid was used, but without improvement. On the seventh day of hospitalization under general anesthesia, a surgical incision and drainage of the abscess were performed. The pus culture indicated methicillin-sensitive Staphylococcus aureus (MSSA) infection. Due to agranulocytosis, immunological, genetic and hematological consultations were carried out to plan diagnostic tests to determine the cause of neutropenia. Epstein-Barr virus and cytomegalovirus infections were excluded. The lipid profile (total cholesterol and triglycerides), lactate and uric acid were within normal limits. The concentrations of elastase I and fat in the stool were normal; therefore exocrine pancreatic insufficiency was excluded. Urine organic acid analysis by gas chromatography-mass spectrometry (GC-MS) did not indicate inborn errors of metabolism. Immunophenotyping by flow cytometry was also performed and reference ranges for peripheral blood lymphocyte subsets were revealed. The immunoglobulin classes A, G, M, complement component 3 and complement 4 were within the normal range. Finally, anti-human neutrophil antigen-1 (HNA-1) antibodies were detected in serum using the granulocyte immunofluorescence test (GIFT), confirming an autoimmune neutropenia. Bone marrow biopsy was not performed due to parental disagreement. During hospitalization, the parents also refused to undergo genetic tests. After obtaining the culture result, antibiotic therapy was applied according to the antibiotic susceptibility testing. On the 14th day of hospitalization, the boy was discharged in good general condition with the recommendation of antibiotic prophylaxis (amoxicillin 20 mg/kg/24 h) until the follow-up visit at the immunological clinic. Our patient did not develop infectious diseases after starting prophylaxis with amoxicillin during 6 months of follow-up despite ANC < 500/µl. |
History
A 42-year-old male was brought to the emergency department (ED) in the evening via ambulance with initial complaints of dyspnea and diaphoresis. Prior to arrival to the ED, the patient had a syncopal episode in the ambulance. The patient had a significant cardiac history of hypertension, congestive heart failure with last ejection fraction of 10%, coronary artery disease, and refractory A-fib with rapid ventricular response. His CHA2DS2-VASc score was four. One month prior he underwent a cardiac ablation procedure at an outside hospital for his refractory A-fib. Once he regained consciousness, he denied any recent trauma, chest pain, headache, or focal neurologic deficits. Of note, he was evaluated at an outside hospital a day prior for similar symptoms with intermittent chest pain, but the workup there was not significant and he was released home.
Physical examination
Upon arrival to the ED, the patient was initially unresponsive, Glasgow coma scale (GCS) of 3, with right gaze deviation. Interestingly, within a few minutes, he regained consciousness and was alert and oriented. He was at 100% oxygenation on room air, but was noted to be tachycardic with heart rate in the 120s. The rest of his vital signs were stable. He was alert and oriented and his pupils were symmetric and reactive. Remaining cranial nerves were intact. Generalized weakness in his extremities was noted. Sensation to light touch and rectal tone were intact.
Hospital course
In the ED, the patient was placed on a cardiac monitor, oxygen, and intravenous (IV) access was established without difficulty. Electrocardiogram showed sinus tachycardia and initial chest radiograph did not show any significant abnormalities. However, in the ED, the patient became confused again and experienced acute bilateral vision loss with only intact light perception. An emergent head CT was performed which revealed small collections of intravascular air throughout, but was negative for any intracranial hemorrhage, midline shift, mass |
A 70-year-old African American male was seen in the emergency department for acute anxiety and paranoia. He reported that his son gave him melatonin to help him sleep, but he felt the medication was poisonous. He also reported that he was struggling with the death of his partner of 40 years and was feeling anxious. The patient was prescribed risperidone and lorazepam and was discharged shortly thereafter. Twenty-four hours later, he was seen again in the emergency department for worsening anxiety, psychosis, suicidal ideation, and command hallucinations. The patient's son reported that his father “had not slept in weeks.” The son reported progressive agitation, paranoia, and bizarre behavior. Due to the worsening psychosis, he was admitted to the medical floor for further work-up. He reported feeling as though people were watching him and that someone was going to harm him. When questioned about his reported suicidal ideation, he blamed that thought on his post-traumatic stress disorder; but would not elaborate on the event. The patient was given a one-to-one sitter due to his suicidal ideation.\nThis patient lives with his family of seven children. He has a history of prolonged incarceration. His past medical history is significant for hypertension and negative for seizure disorders. The patient had never been hospitalized for psychiatric issues prior to this visit. He denied past suicidal behavior and any history of physically or sexually aggressive behavior. The patient reported a history of excessive alcohol abuse for more than a year following the death of his partner. He reported that he stopped drinking “cold turkey” five months prior to this visit. The patient's family history is significant for a son with an anxiety disorder. He denied a history of physical or sexual abuse in the past.\nThe patient's mental status exam was significant for an anxious affect with referential and paranoid ideations. He denied any thought broadcasting, insertion, or withdrawal. He had some paranoid and persecutory delusions. Insight, judgment, and impulse control were poor.\nThe patient's initial physical exam revealed an inability to ambulate and overall weakness. Further neurological examination revealed mental disorientation with bilateral muscle wasting, sensory deficit, and hyporeflexive ankles. Additionally, the patient exhibited stance and gait abnormalities. A later eye exam revealed bilateral light-near dissociation with accommodation but no reaction to light. Otherwise, all other neurological components were intact and within normal limits.\nInitial routine testing was positive for the Treponema pallidum antibody, suggesting prior infection, but the distinction between treated and untreated syphilis cannot be made as the Treponemal-specific immunoglobulin G (IgG) may remain elevated throughout life. An RPR was then ordered to help distinguish between acute or chronic infection and a Treponema pallidum particle agglutination test was ordered to distinguish between syphilis infection and a false positive screening test. The RPR returned nonreactive but the Treponema pallidum particle agglutination returned reactive, indicating a prior infection of Treponema pallidum. The initial differential diagnosis workup included testing to exclude thiamine, folate and B12 deficiency, insomnia, hypocalcemia, hypothyroidism/hyperthyroidism, HIV encephalopathy, dementia, stroke, drug or alcohol intoxication, and normal pressure hydrocephalus.\nFurther labs showed white blood cell count, sodium, potassium, calcium, anion gap, creatinine, glomerular filtration rate, glucose, mean corpuscular volume, and thyroid stimulating hormone within normal limits. Urinalysis, toxicology screening, alcohol levels, and HIV antibody were also negative. Imaging included a head computed tomography (CT), which showed no abnormalities, a brain magnetic resonance imaging (MRI) that showed cortical atrophy, and an electroencephalogram within normal limits. |
A 25-year-old female was admitted with mandibular prognathism, class III malocclusion, and macrogenia (). The patient underwent MSSRO under general anesthesia. A side cutter was used for the surgery, which involved direct retraction of the mandibular foramen by performing horizontal osteotomy on the inside of the ramus, followed by sagittal splitting using a reciprocating saw and osteotome. The distal bone fragment was retracted by 9 mm, and fixation was performed to match the new occlusal surface. There were no specific findings during surgery and postoperative bleeding and swelling were not excessive. Immediately after surgery, there was no noticeable difference in the movement of the facial muscles, but by postoperative day (POD) 2, the patient had difficulty closing her right eye completely, weakness on wrinkling the forehead, and deviation to the left side when protruding her tongue. To record the progression of symptoms, photos were taken with the consent of the patient, and the clinical features including facial expression were recorded according to grade V in the House-Brackmann facial nerve grading system (HBFNGS) (, ). To determine the cause, X-ray imaging was performed; the results showed no direct pressure from retraction of the mandibular ramus or any other specific findings that would require additional surgery, such as mandibular condylar fracture. Thus, temporary FNP due to indirect pressure on the facial nerve from mild hematoma and edema was diagnosed (). Nerve conduction and blink reflex tests were performed and the patient was diagnosed with right FNP injury without the loss of nerve continuity (). To treat the FNP, drug therapy using steroids (prednisolone), anti-inflammatory agents, and nimodipine was administered, and concomitant physical therapy using transdermal nerve stimulation and electro-acupuncture therapies was performed. Prednisolone 15 mg three times a day (tid) was administered for 4 weeks, followed by 10 mg tid for 4 weeks, then 5 mg tid for an additional 2 weeks. Nimodipine 30 mg tid was administered for 4 weeks. Steroids, physical therapy, and nimodipine were administered; starting 2 weeks after treatment began, the patient recovered to HBFNGS grade III, and was able to close her right eye. Subsequently, she recovered to HBFNGS grade II by 8 weeks, and HBFNGS grade I by 10 weeks, with eventual complete recovery (, , ).\nTo compare the recovery speed with that reported in reference articles on post-MSSRO FNP occurred in 11 patients who received steroid administration and physical therapy, but not nimodipine, the present study analyzed the onset of FNP, HBFNGS at the time of initial diagnosis, HBFNGS after recovery, treatment method, and the time to recovery. In the reference articles, the time of onset varying from POD 1 to POD 6; in 9 of the 11 (81.8%), FNP appeared by POD 3. At the time of diagnosis, the severity was HBFNGS grade IV-V in all cases. The use of drug therapy except nimodipine, combined with physical therapy, showed no major difference, with an average recovery time of 16.32 weeks. The recovery time of 10 weeks in the present study was slightly faster () []. Moreover, there were no complications from nimodipine administration. |
66-year-old male with past medical history of mantle cell lymphoma status post chemotherapy in 2016 with maintenance Rituxan therapy which was completed 8 months before presentation, hypercholesterolemia, and hypothyroidism who presented to an urgent care clinic complaining of sharp, left-sided chest pain, and progressively worsening dyspnea on exertion over 1 week. 12-lead EKG demonstrated ST elevations in anterolateral and lateral leads. Due to concerns for Acute Coronary Syndrome, patient was given 324 mg aspirin. EMS was called to transport the patient to an Emergency Department (ED) for further evaluation with a STEMI alert activated. Upon further assessment in the ED, patient was chest pain free. He denied worsening of pain with inspiration and movement. On examination, the patient was comfortable without being dyspneic at rest. Labile blood pressures with tachycardia were noted on telemetry. He was taken up to cardiac catheterization lab and was started on therapeutic IV Heparin. On further examination, obtaining a thorough history, and review of systems, he was chest pain free and his symptoms were not consistent with acute coronary syndrome. Bedside echocardiogram demonstrated a large pericardial effusion. STAT Transthoracic echocardiogram confirmed a large pericardial effusion with pre-tamponade physiology (end-diastolic right atrial collapse). Meanwhile, patient was becoming increasingly dyspneic. CTA chest and abdomen showed no extravasation of contrast and no evidence of dissection. Cardiothoracic surgery physician performed an emergent pericardial window, which drained 350–400 ml of yellow murky pericardial fluid. The pericardium was noted to be thick with the myocardium being covered with a whitish rind. The patient became asymptomatic without any dyspnea and hemodynamically stable after the procedure. Pericardial fluid and blood cultures both grew Haemophilus influenzae. CT chest was obtained which ruled out pneumonia. He was treated with IV cefepime empirically and then narrowed down to IV ceftriaxone after the culture sensitivities revealed pan-sensitive nature of the organism. He was treated with IV ceftriaxone 2 g daily for 4 weeks from the day of negative blood cultures.\nFurther history was obtained from the patient by an Infectious Disease specialist, which revealed that over 2 months before his admission, the patient recalled eating ice cream from an ice cream truck in Philadelphia where he noted that hygiene of the ice cream machine was questionable. Due to upper respiratory infection symptoms, he visited his primary care physician who prescribed the patient doxycycline for 10 days duration for acute pansinusitis. Due to recurrent symptoms 6 weeks later, the patient was prescribed azithromycin (Z-pak) for recurrent pansinusitis. The patient saw an ENT-Otolaryngologist and was informed that he had a left ear infection, for which he was started on topical ear drops (name unknown). Temporal bone CT was performed that revealed findings suggestive of left otomastoiditis without bony destructive change, and also fluid and thickening in the right external auditory canal related to otitis externa. The patient stated that ENT-Otolaryngologist prescribed alternative ear drops (name unknown), but the patient had not started using the drops. |
A 69-year-old Japanese woman was referred to our department in August 2015, complaining of swelling in the right preauricular region. She had shown a mass lesion of the right lung on a chest x-ray and was referred to the university hospital. Fluorodeoxyglucose-positron emission tomography (FDG-PET) examination showed accumulation indicative of a pulmonary lesion and a temporomandibular joint lesion. The temporomandibular joint lesion had been enlarging but was otherwise asymptomatic. Her medical history included treatment for pulmonary tuberculosis at the age of 13 and surgery to remove breast cancer at the age of 53.\nOn examination, a tender mass in the right preauricular region was palpable. The chin of the mandible was deviated to the right side during mouth opening (mandibular maximum mouth opening, 41 mm). Facial nerve function and mandibular nerve were intact. There was no indication of cervical lymphadenopathy.\nA panoramic radiographic examination showed resorption of the right mandibular condyle to the ramus (Fig. ). Computed tomography (CT) showed destruction of the right mandibular condyle and a large mass lesion with enhanced margin in the masticator space; a cystic lesion was present inside the tumor mass. Three-dimensional CT was useful to understand the bone resorption findings of the mandibular condyle. There was no finding of metastatic cervical lymph node (Fig. ). T1-weighted magnetic resonance imaging showed an enhanced mass lesion in the right masticator space. Because some portions of the mass lesion showed high intensity in T2-weighted images, cystic lesions were suspected to exhibit changes of blood flow or retention of high-protein liquid. Tumor development was not observed in the articular disk of the temporomandibular joint (Fig. ). FDG-PET revealed abnormal FDG uptake in the right submandibular condyle and masticator space.\nA malignant tumor was suspected after analysis by various modalities. Therefore, we performed an incisional biopsy via preauricular incision. Histopathologically, the tumor was largely composed of proliferative, atypical, spindle-shaped cells. Some tumor cells showed increasing mitotic change and extreme atypia (Fig. ). The histopathological findings of biopsy suggested spindle-cell sarcoma. Tumor resection was performed with the patient under general anesthesia via a combined preauricular and transmandibular approach to the masticator space and infratemporal fossa.\nAfter preauricular temporomandibular incision, the superficial temporal fascia and temporal fascia were elevated. The facial nerve (temporal and zygomatic branches) was protected by the fascia (Fig. a).\nThe facial nerve trunk was identified, and its branch was traced according to the conventional method.\nA midline lip-splitting incision was connected to the submandibular incision and accessed the anterior mandibular ramus. The lip-split incision traversed to the periosteum of the mandible; the periosteum dissector was used to elevate the soft tissues of the mandible, and the lateral mandible was exposed. The branch of the facial nerve was traced continuously with the skin flap, and the masseter muscle and deep parotid gland were dissected on the tumor side (Fig. c). The mandible was resected to within ≥ 20 mm from the primary tumor on the anterior of the mandibular ramus. The masseter muscle was divided at the lower edge of the zygomatic arch; further, the temporal muscle was divided horizontally at the height of the zygomatic arch to reach the side of the temporal bone. Excision was performed on the temporal bone to the base of the pterygoid process, and an osteotomy was performed continuously from the maxilla to the pterygoid process. Osteotomy was performed via ultrasonic scalpel. Then, deep excision was performed on the skull base until the foramen ovale was reached. The mandibular branch (VIII) of the trigeminal nerve was resected at the foramen ovale, and bone wax was used to fill the foramen ovale when hemostasis was achieved. The tumor was excised in bulk with the surrounding tissue (Fig. d). Especially, the glenoid fossa was close to the primary tumor site; however, it was excised including the joint disc, and the glenoid and infratemporal fossa were excised, including the periosteum of the skull base. For that reason, the margin was considered complete, and we did not perform the histopathological evaluation intraoperatively.\nThe surgical defect was reconstructed with a free vascularized fibula with skin paddle (Fig. e). The occlusion was performed with intermaxillary wire fixation for 1 week postoperatively. There were no abnormal findings during the postoperative course with complete healing. Right-sided facial nerve dysfunction appeared immediately after surgery.\nThe resected specimen exhibited nearly identical histological findings as observed in the biopsy. Because it involved a periosteal reaction corresponding partially to Codman’s triangle, the tumor was thought to have derived from bone (Fig. ). Immunohistochemical analysis showed positive staining for vimentin, MIB-1 index (40–80%), desmin, α-smooth muscle actin, Bcl-2, neuron-specific enolase, and S-100; it showed negative staining for AE1/AE3, caldesmon, and CD34. Thus, the final diagnosis was osteosarcoma (fibroblastic). The resection margin was negative for tumor. After excision of the mandibular tumor, excision of lung cancer was performed under thoracoscopy by a respiratory surgeon in our hospital. Although we recommended adjuvant treatment after surgery, the patient refused this treatment.\nThere has been no evidence of local recurrence or distant metastasis through 30 months of follow-up. The chin of the mandible deviates to the right side during opening (maximum mouth opening, 40 mm). Centric occlusion has not changed. Facial nerve dysfunction gradually improved and became mild according to House-Brackmann Scale evaluation (Figs. and ). |
A 38-year-old male metalworker was presented to our care following a crushing trauma on his left hand in an industrial press machine. He was unable to describe the exact mechanism of the injury. On physical examination, there was severe swelling of the hand and wrist with palpable bony prominence on the dorsal aspect of the carpus, and a wound on the ulnar aspect of the palm, volar to the fourth metacarpal. The patient also referred paresthesias and decreased sensation to light touch in the median nerve distribution of the hand. Routine radiographs revealed dorsal dislocations of the carpometacarpal joints of the index, long and ring fingers with radial migration of the second and third metacarpal bases, scapho-trapezium joint dislocation and fracture-dislocation of the trapezoid (). A CT scan was performed to further characterize the injuries. Two days following the accident, the patient underwent surgery under regional brachial plexus block.\nOpen reduction and median nerve release were performed through a dorsal double incision, combined to a volar one.\nThe first longitudinal incision was made dorsal to the wrist, centered on third intermetacarpal space (over the 3/4 CMC joint), and was used to reduce and stabilize dislocations of the third and fourth metacarpals with multiple K-wires and dorsal capsulodesis.\nThen, an extended carpal tunnel incision was made and open carpal tunnel release and neurolysis of the median nerve were performed. The nerve sustained a blunt contusion from the neighbouring dislocated bones and was suffering due to increasing intracarpal tunnel pressure. The intraoperative features showed focal swelling and hyperemia of the nerve, without crushing or lesion in continuity of the axons. The trapezoid was extruded volarly and split into two fracture fragments; one of which was occupying the carpal tunnel and the other was migrated distally and ulnarly in the palm (). The first fragment maintained a connection with the volar ligaments.\nA second dorsal longitudinal wrist incision was made, centered on first intermetacarpal spaces. Hemi-trapezoid was recovered from the palm, reduced and fixed with a 1.2-mm OsteoMed mini screw (). Afterwards, the trapezoid was relocated, trapeziometacarpal and scaphotrapezial joints were reduced and stabilized with K-wires and avulsed dorsal ligaments were repaired. Intraoperative radiographs revealed successful reduction (). The wrist was immobilized in a volar splint for four weeks, at which time the pins were removed and an intensive rehabilitation program was initiated. The patient returned to work after four months. Two years following the operation, he has a painless wrist with a good functional outcome. Functionally, the range of motion compared with the uninjured hand was complete in palmar flexion, radial and ulnar deviation, pronation and supination. The exception was noted with the dorsiflexion where 50° was achieved compared to 70° in the uninjured hand. Opposition of the thumb to the small finger was good; a Kapandji score of 8 was registered (). The Disabilities of the Arm, Shoulder and Hand (DASH) score was 1.7 and DASH work module was 0.0. Grip strength of both extremities, as measured by the Jamar dynamometry (level 3) and Pinch tests, resulted in an average of 43 kg vs 46.6 kg and 11 kg vs 9 kg for the injured and uninjured hands, respectively. The patient had no signs of any median nerve dysfunction and normal 2-p discrimination in the median nerve distribution. Radiographs at two-years follow-up showed good alignment and no evidence of avascular necrosis or arthritis (). This study is performed in accordance with the Ethical Standards of the 1964 Declaration of Helsinki. The patient gave written, informed consent to report data from this case. |
A 19-year-old female patient visited our clinic with complaints of a painless mass in the inferior eye lid of the right eye (OD). Best-corrected visual acuity was measured 10/10 with a Snellen card in both eyes. On palpation, a firm, irregular, non-reducible mass of ∼3 cm was noted in the inferior orbital rim of the OD (Fig. a). The mass was inseparable from the inferior orbital rim. Additionally, there was diplopia on the downward gaze and ophthalmoparesis in the OD. Fundus examination of both eyes was normal. The patient's history and general physical examination were unremarkable. A complete blood cell count and serum laboratory values were normal. Magnetic resonance imaging (MRI) revealed an extraconal solid mass measuring 3 × 3 cm in the region of the right inferior temporal orbital wall (Fig. b). The paranasal sinuses were normal. No definite intracranial extension was seen.\nAnterior transconjunctival orbitotomy was performed for excisional biopsy and the removal of the tumor with its periosteum due to the erosion of the inferior orbital wall. The resected tumor was 3 × 3 × 3 cm and the tumor had caused lytic lesions on the inferior orbital wall. The tumor tissues resected in the surgery were fixed in 10% formalin, embedded in paraffin and then processed for light microscopy. The tissue sections were stained with hematoxylin and eosin (H&E), and examined immunohistochemically. After the surgery, the patient's diplopia with right and inferior ophthalmoparesis disappeared. At postoperative week 3, while we were waiting for the pathological diagnosis of the resected tumor, the patient visited our clinic with complaints of anesthesia and fullness on her right cheek. There was paresthesia in the region where the right infraorbital nerve innerved. Control MRI revealed a mass that invaded the anterolateral wall of the right maxillary sinus (Fig. a and b). In the meantime, tumor cells were positive in the membranous pattern for CD99 immunostaining and Periodic acid—Schiff (PAS) (Fig. a–c).\nAccording to the results of further metastatic evaluation including PET–computed tomography and Technetium-99 whole-body bone scintigraphy, we did not detect any other tumor regions. In consequence of these examinations, we considered this tumor as primary orbital ES. We referred the patient to our oncology department. A chemotherapy treatment protocol of six cycles with Vincristine, Doxorubicin, Cyclophosphamide and Mesna was organized by the oncology clinic. In the control examination after the first cycle, it was observed that the complaints of anesthesia and parasthesia recovered. |
A 43-year old male weighing 53kg, without any comorbidity presented to the hospital with gradually increasing breathlessness of 3 months duration, one episode of haemoptysis, and oedema of legs. Examination revealed a baseline heart rate of 106/min and blood pressure was 114/70 mmHg, grossly reduced breath sounds on left lung fields and a grade 3/6 ejection systolic murmur. Chest X-ray showed heterogeneous opacity in left lower lung fields [ (Panel A)]. Transthoracic echocardiography revealed asymmetric hypertrophy of interventricular septum (IVS) (19 mm) and IVS to posterior wall thickness ratio of 1.3 with mid-cavitary gradient of 60 mmHg. There was also mitral inflow variation of more than 25%, tricuspid inflow variation of 40%, expiratory flow reversal of hepatic veins and inferior vena cava plethora consistent with CP. Computed tomographic scan showed pleural and pericardial calcification [ (Panel B)]. A catheterisation study demonstrated normal coronaries and confirmed presence of pericardial calcification []; however myocardial biopsy for confirmation of HCM was not taken. The patient was already on anti-tubercular treatment (ATT) for previous 2 months and sputum examination was negative for acid-fast bacillus. The patient was started on tablet metoprolol 25 mg twice daily in view of the HCM.\nAs the patient refused any surgical intervention for HCM, he was scheduled for decortication and pericardiectomy in single session surgery via anterolateral thoracotomy. ATT and beta blockers were continued up to the day of surgery. In the operation theatre standard monitoring were applied. Defibrillation pads were applied in anteroposterior position. The patient was premedicated with IV fentanyl 50 µg and midazolam 1 mg. Arterial and central venous lines were placed in the right radial artery and right internal jugular vein, respectively. Thoracic epidural anaesthesia was avoided because of the potential adverse effects of sympathetic block and vasodilation on an HCM patient. The patient was induced with fentanyl 200 µg, midazolam 3 mg and thiopentone 150 mg in incremental doses and tracheal intubation with a 37 Fr left sided double lumen tube was facilitated with rocuronium. The patient was ventilated with low tidal volume (5 ml/kg) and higher rate (16–20) to minimise compromise of venous return. Anaesthesia was maintained with 50% O2 in air with titrated doses of sevoflurane, vecuronium and fentanyl infusion to maintain heart rate of 75–85/min and blood pressure within 20% of baseline. Thoracotomy was performed and one lung ventilation(OLV) was initiated. During OLV pulmonary gas exchange was well-maintained and there were no significant changes in airway mechanics. An episode of paroxysmal supraventricular tachycardia which occurred during pericardial dissection resolved spontaneously when stimulation was stopped. Intraoperatively there was one episode of hypotension associated with blood loss. This was treated with phenylephrine (50 µg) and blood transfusion. Total blood loss during surgery was approximately 1L and patient was transfused one unit of packed cells and a total of 1.5 L of crystalloids. Urine output was normal during surgery.\nFor postoperative analgesia intercostal block was administered under vision by the surgeon before closure of chest. The patient was ventilated post operatively as the hospital protocol mandates elective ventilation in all pericardiectomy patients. In the intensive care unit analgesia was maintained with fentanyl infusion 1.5 µg/kg/h. The patient was weaned and extubated after 12 hours. Rest of the patient's hospital stay was uneventful. Post-operative Echocardiography showed HCM gradient of 45 mmHg and absence of CP features. The patient was discharged with the advice to continue β blockers and follow up for HCM. |
A previously healthy 20-year-old man was admitted to our emergency department after being stabbed by a young female during a violent fight between the two. The patient presented with massive bleeding from a wound in the epigastrium. Abdominal ultrasonography revealed an abundance of free fluid in Morrison’s pouch and the perisplenic space. Hand compression of the wound and aggressive fluid therapy were performed simultaneously. With only a slight hemodynamic improvement, an emergency laparotomy in the emergency room (ER) was immediately initiated.\nLaparotomy was conducted through an abdominal midline incision, and there was massive hematoma in the abdominal cavity. The stab wound was identified on the surface of the left liver, where the bleeding was profuse and continuous (Fig. a). The skin incision was extended into an inverted L-shape to adequately expose the whole liver. Since clamping of the hepatoduodenal ligament using the Pringle’s maneuver did not reduce bleeding, a deep liver laceration involving a hepatic vein or IVC injury was suspected. Neither hand compression nor gauze packing controlled the bleeding, and therefore, a left hepatectomy was performed to adequately expose the injured vessels. The left hepatic vein was ligated and divided, the left hepatic hilar plate was divided using a stapler, and the left hepatectomy was completed. However, the laceration of the liver parenchyma reached deeper into the resection surface, and persistent bleeding continued from the laceration (Fig. b). Suturing of the lacerated liver parenchyma was attempted. However, bleeding was still unable to be controlled (Fig. c). Fortunately, temporal hemostasis was achieved by gauze packing probably because hemostasis from the injured peripheral left hepatic vein was obtained and gauze compression close to the bleeding point was effective. The initial procedure was terminated as a damage control surgery, with consideration for the patient’s coagulopathy and physiological instability due to the massive blood transfusion required during the procedure. In total, 28 units of red blood cells, 32 units of fresh frozen plasma, and 30 units of platelet concentrate were transfused. The operative time was 97 min. The blood loss was approximately 2000 g. In the resected specimen of the left liver, there was a laceration penetrated from the liver surface to the resection surface (Fig. d). Postoperative course after the damage control surgery was favorable. There was no sign of re-bleeding in the abdomen and his vital signs were stable. Since IVC injury was implied considering the massive bleeding from the laceration, we made an arrangement of surgeons, anesthesiologists, and blood transfusion to fully prepare a second-look surgery.\nThe second-look surgery was then performed on the third operative day in the operating room. Upon opening the wound, there was no remarkable bleeding. However, severe bleeding was observed after gauze packing was removed from the resection surface of the liver. Intraoperative ultrasonography confirmed free fluid anterior to the retrohepatic IVC, suggesting IVC injury and pooling of a hematoma (Fig. a). TVE was planned for vascular isolation. The infrahepatic IVC was taped superior to the left renal vein (Fig. b), and the suprahepatic IVC was exposed. TVE was applied, and the lacerated site was observed (Fig. c). Evidently, the laceration reached and penetrated the retrohepatic IVC. To repair the IVC, the slit of the posterior wall was sutured first (Fig. d). Subsequently, the anterior wall of the IVC was sutured together with liver parenchyma (Fig. e). Finally, the lacerated liver parenchyma was sutured and repaired for closure (Fig. f). Hemostasis was confirmed after the release of TVE. The duration of TVE was 27 min. The operative time was 161 min, and blood loss was 3721 g. In total, 22 units of red blood cells and 4 units of fresh frozen plasma were transfused.\nDuring the postoperative course, the patient developed minor bile leakage, which was relieved conservatively. The patient was discharged on postoperative day 35. The patient was successfully rehabilitated after discharge and returned work. |
A 12-year-old boy, born to nonconsanguineous parents, was diagnosed to have situs inversus, levocardia, and tricuspid valve atresia with severe pulmonary stenosis in his early infancy. He had undergone bidirectional Glenn procedure at 2 years of age. Later his father had recurrent superficial vein thrombosis and was diagnosed to have FVL mutation (by real-time polymerase chain reaction). The child was subsequently screened and found to be heterozygous for FVL (by real-time polymerase chain reaction). But the boy did not have any history suggestive of thrombotic episodes. When a Fontan procedure was planned, haematologist opinion was obtained and he was screened for other prothrombotic conditions with protein C, protein S, prothrombin mutation, antithrombin III, anticardiolipin, and lupus anticoagulant studies. He was negative for all these tests. Diagnostic cardiac catheterization was done and the hemodynamics were found suitable for Fontan. The mean pulmonary artery pressure was 10 mm Hg. One collateral was embolized with a coil. Heparin was used in the routine dose (2500 units) during catheterization and there were no complications after the procedure. Subsequently he underwent extracardiac Fontan surgery using 18 mm PTFE graft without fenestration. The following strategies were followed to prevent thrombosis during the Fontan procedure. (1) Heparin infusion was started preoperatively and continued postoperatively for 2 days so as to maintain an APTT of 1.5-2 times the control. (2) Central venous catheter was removed early. (3) Warfarin was added on the first postoperative day. (4) He was ambulated early to prevent venous thrombosis. (5) Heparin infusion was changed to subcutaneous low molecular weight heparin at a dose of 0.1 mg/kg q12h and continued for 7 days postoperatively till his INR was consistently above 2.0. His postoperative recovery was uneventful with only two days of right pleural drainage. There were no thromboembolic events and the Fontan circuit was functioning well at the time of discharge. He was discharged on oral anticoagulants and was advised to maintain a higher INR of 2.0–2.5. |
A previously healthy 22-year-old man presented to our emergency department in Abu Dhabi, United Arab Emirates in December. This patient was diagnosed with mild COVID-19 illness, sore throat and loss of sense of smell as well as positive COVID-19 PCR, 0n 26 October 2020. Following full recovery by resolution of symptoms and reverting to negative PCR, he received the first dose of inactivated SARS-CoV-2 vaccine on November 6. Following the first dose of vaccine, he remained asymptomatic and well. He received the second dose on 6 December 2020. A few hours later the patient started to experience headache and fatigue. The day after, he started to develop fever, sore throat and abdominal pain. The illness progressed over the following 4 days when he presented to the emergency department with high-grade fever, myalgia, nausea, vomiting and diarrhoea, and a faint erythematous non-itchy rash over his torso that he noticed earlier that day. The patient reported a dry irritant cough but no shortness of breath or chest discomfort. He had no urinary symptoms and no pain or swelling of his joints.\nThe patient had no history of recent travel, no sick contacts, no animal exposure and no consumption of raw dairy products. He was not on any chronic medications and had no known allergies. He reported taking ibuprofen and one dose of an antibiotic over the prior few days for symptomatic relief. He was a non-smoker and did not use recreational drugs.\nIn the emergency department the patient was noted to have a temperature of 39°C, systolic blood pressure of 110 mm Hg and tachycardia, 140 beats per minute. Physical examination revealed dry mucous membranes with congested throat. Bilateral conjunctival injection and left conjunctival haemorrhage. There was a generalised erythematous maculopapular rash, mostly over the chest and back. His peripheral lymph nodes were not enlarged. There were no audible cardiac murmurs, his chest was clear to auscultation, abdomen examination was unremarkable. |
We present the case of a previously healthy 38-year-old Caucasian woman who presented to our hospital's emergency department with a six-day history of severe sharp and burning right heel and foot pain with inability to bear weight. She had no antecedent trauma or systemic symptoms. The pain was referred distally along the medial and lateral plantar aspect of her foot into the toes, with exacerbation at night and with ambulation.\nA physical examination revealed a warm localised swelling around her medial malleolus with no overlying erythema. Her ankle movements were normal but her subtalar joint movement was painful and restricted. A neurological examination confirmed altered sensation over the plantar surface of her foot and toes. Tinel's sign was also noted to be absent along the course of her posterior tibial nerve.\nOur patient's inflammatory markers were raised (white cell count at 12.2 × 109cells/L [neutrophils = 11.0] C-reactive protein at 194 and erythrocyte sedimentation rate at 59), while her autoimmune antibody titres and blood cultures were found to be normal. Initial plain radiographs were unremarkable (Figure ), while a magnetic resonance imaging (MRI) of her hindfoot demonstrated an increased calcaneal signal intensity on the T2/STIR-weighted images, with a tense effusion of the subtalar joint (Figure ). Bone scanning confirmed the presence of isolated increased uptake of radioisotope in the calcaneus on blood pool and delayed phases (Figure ).\nIn view of the radiological and clinical evidence available, early exploration of the tarsal tunnel was performed via a posteromedial approach. The operative findings were of widespread oedema adjacent to the medial wall of the calcaneus extending into the proximal end of the tarsal tunnel. The posterior tibial nerve itself was noted to be erythematous and swollen. Following decompression of the tarsal canal, a core needle bone biopsy of the body of the calcaneus was performed. Postoperatively, our patient's pain improved and her neurological symptoms resolved within 24 hours. Intraoperative bone biopsy microbiology grew Staphylococcus aureus sensitive to vancomycin. She was subsequently treated for 12 weeks with a combination of oral and intravenous antibiotics and made a full recovery with normal inflammatory markers at six months postoperatively. When she was followed up after four years, she was noted to have remained asymptomatic with no indication of recurrence of the disease. |
A 59-year-old female patient with a BMI of 26.9 kg/m2 and a significant past medical history of lung cancer and a motor vehicle accident over 10 years prior presented to the emergency department due to acute chronic back pain with worsening numbness and weakness in her lower extremities. She had multiple back operations including an L3-L5 laminectomy performed two months at another institution prior to presentation without resolution of symptoms. On examination, her lower extremities were intact except for bilateral 3/5 strength in her anterior tibialis and extensor hallucis longus. An initial computed tomography (CT) scan (Figure ) revealed a two-column burst fracture at L4 with 9mm retropulsed fracture fragments that resulted in severe, nearly complete, spinal canal stenosis. Two-column fracture also involved the L5 level with extension into the left L5 pedicle. There was associated significant bony resorption at L4 and L5. A magnetic resonance imaging (MRI) of the spine with and without contrast (Figure ) was obtained to further assess the ligamentous structures, spinal canal, and nerve roots. MRI was also obtained to evaluate for possible associated neoplastic or infectious etiologies. A multi-disciplinary approach to care, including vascular surgery, neuroradiology, and neurosurgery recommended a corpectomy with subsequent posterior stabilization. The corpectomy was performed through an anterior approach with a staged posterior L2-pelvis instrumentation five days later.\nA standard abdominal aortic exposure was performed by the vascular surgery team. Once the aorta, inferior vena cava, lumbar arteries, and veins were exposed; most of these small branches were ligated in continuity; which allowed for further easier exposure of the spine by carefully retracting both the aorta and inferior vena cava laterally in opposite directions. Through a small window between the aorta and the inferior vena cava, we were able to expose the anterior spine, which was significantly scarred and inflamed. We then proceeded with the identification of the L3-L4 disk space under fluoroscopy. Working between the aorta and the inferior vena cava, the L3-4 and L5-S1 discs were exonerated. Using small curettes and an M8 drill bit, we then performed the L4 and L5 corpectomy (Figure ). The retropulsed fracture fragments of L4-5 were meticulously dissected away from the dura until the thecal sac was decompressed. Once the endplates above and below our levels were prepared, we carefully placed a Stryker Capri Corpectomy cage (17x22mm) filled with Vivigen (DePuy Sytheses, Warsaw, IN, USA), with the capability to expand from 58-72mm and a variable degree between the L3 and S1 endplates. We placed the cage from cranial to caudal passing the cage underneath the vessels. Using intraoperative fluoroscopy, we then expanded the cage to 64mm. Subsequently, a 47-mm anterior plate was placed and secured with 20-mm screws at the L3 level (Figure -). The vascular team then proceeded to close the retroperitoneal space using a bovine pericardium sheath (Edwards Lifesciences Corp., Irvine, CA, USA) to prevent possible future fistula formation. The operation duration was 10 hours and 41 minutes with an estimated blood loss of 1300 ml. Five days later, the patient was taken back for a posterior fusion from L2 to the pelvis (Figure ). The patient tolerated both operations well. She was treated for multidrug-resistant Klebsiella pneumonia with vancomycin and ertapenem for six weeks. After 14 days, she was deemed stable for discharge to a rehabilitation facility. The patient had a two-month follow-up visit and she was progressing well recovering from her operations. |
Forty-five-year-old female patient attended our institution with intensely pruritic, persistent red raised lesions over forearms, legs, palms, and soles of 5 years duration. Fever and constitutional symptoms were conspicuously absent. She did not give a history of bronchial asthma, allergic disorders, or any other systemic diseases. No food item or drug was found to precipitate the lesions. With the diagnosis of erythema multiforme, she was treated at a nearby hospital with prednisolone 20 mg daily to which her skin lesions responded. Tapering the dose of prednisolone to 2.5 mg always brought out recurrences; hence, she was continued on 5 mg prednisolone for the past 5 years. One month before attending our outpatient department, the patient stopped prednisolone as per the advice of her clinician in an attempt to withdraw steroids which resulted in exacerbation of skin lesions. As no control could be achieved with antihistamines and emollients, she was referred to us.\nClinical examination revealed multiple, discrete, and confluent purpuric papules and plaques distributed over forehead [], neck, abdomen, and limbs. Some of the lesions showed an annular pattern. In addition, she had angioedema affecting lips []. Systemic examination revealed no abnormality.\nComplete hemogram, absolute eosinophil count, peripheral smear analysis, bleeding and clotting time, and prothrombin time with international normalized ratio, urine microscopy, and renal and liver function tests were within normal limits. Serology was negative for infections due to mycoplasma and herpes simplex, hepatitis A, B, and C, and human immunodeficiency viruses. Serology for antinuclear antibody profile and rheumatoid factor were negative. Chest radiography, electrocardiogram, and ultrasonogram of abdomen and pelvis were within normal limits. Biopsy was taken from a lesion on the right upper arm and was sent for histopathology analysis and immunofluorescence study. Histology revealed perivascular inflammatory infiltrate [] predominantly composed of eosinophils with fibrinoid necrosis of vessel walls and extravasation of erythrocytes [] conclusive of eosinophilic vasculitis. Immunofluorescence was negative for immunoglobulins G, A and M, and C3.\nSerum cryoglobulins and antineutrophil cytoplasmic antibodies were negative. Serum complement level (C1q, C3, and C4) and immunoglobulin profile were within normal limits. Stool microscopy for cysts and ova was negative. Radiography of paranasal sinuses, computerized tomogram of the thorax, and nerve conduction study (peripheral neuropathy can be a manifestation of idiopathic hypereosinophilic syndrome or Churg–Strauss vasculitis) returned normal results.\nSince a detailed evaluation ruled out any underlying systemic disease and since there was no systemic involvement, we arrived at a diagnosis of recurrent cutaneous eosinophilic vasculitis. She received prednisolone 30 mg/day orally. Her skin lesions resolved in 7–10 days. On tapering steroids, the patient remained symptom free up to a dose of 5 mg daily. Trying to reduce the dose to 2.5 mg precipitated a flare up; hence, she was advised to continue prednisolone at 5 mg/day. Now, after 4 months patient is well maintained on 5 mg prednisolone with no more recurrences. |
The patient was a 28-year-old, 57-kg, female with severe pulmonary hypertension secondary to Gerbode defect, a left to right shunt between the left ventricle and the right atrium . Although she recalled dyspnoea and fatigue as a child compared to her peers, she was not evaluated by a physician until age 18 years. Right heart catheterization 18 months prior to presentation showed suprasystemic pulmonary hypertension, with pulmonary artery pressure of 117/58 mmHg, mean pulmonary artery pressure of 82 mmHg, cardiac output via thermodilution method of 4.53 L/min, cardiac index via thermodilution method of 2.80 L/min, pulmonary vascular resistance of 16 Woods units, and transpulmonary gradient of 74 mmHg. It was decided she should pursue lung transplantation; however, during workup she developed a persistent dry cough. Computed tomography (CT) chest was notable for irregular pulmonary nodules. Repeat CT upon presentation showed progression to cavitary lesions, for which bronchoscopy was planned for investigation. At the time of presentation, medications included sildenafil 80 mg morning and night, and 60 mg afternoon; treprostinil 48 mcg via nebulizer every 4 h; and ambrisentan 10 mg daily. She required 3 L of oxygen at rest and 6 L with exertion. She was unable to lay in the supine position due to shortness of breath.\nBronchoalveolar lavage under moderate sedation provided by the pulmonologist without an anaesthesia team was planned for further evaluation of newly discovered cavitary lesions. In light of the severity of pulmonary hypertension, it was believed diagnostic discovery outweighed procedural risks. It was decided an anaesthesia team would allow safer administration of sedation for the bronchoscopy. Our main anaesthetic concern with administration of sedation was the avoidance of hypercarbia and hypoxaemia which could exacerbate her pulmonary hypertension. We decided the best approach was to topicalize the airway and provide sedation along with high-flow nasal oxygen which potentially could lessen her chances of developing hypoxia and hypercarbia. We hoped to avoid general anaesthesia which would be poorly tolerated given the extent of her pulmonary hypertension.\nOn arrival to the bronchoscopy suite, she had a pre-existing peripherally inserted central catheter and a midline in situ in the contralateral upper extremity. Non-invasive blood pressure monitoring was used to record blood pressure every 5 min. Three-lead electrocardiogram (EKG) and peripheral oxygen saturation monitoring were used continuously. The decision was made not to pursue invasive haemodynamic monitoring due to the short predicted length of procedure, and low level of sedation to be given. Airway was topicalized with 4% lidocaine, first via a nebulizer and subsequently with direct application using an atomizer, and finally direct application on vocal cords via bronchoscope. Dexmedetomidine was the sedative of choice to avoid suppression of spontaneous respiration. The patient was placed on OptiFlow intranasal delivery of oxygen at 70 L/min while in the sitting position. End-tidal CO2 (ETCO2) was not monitored due to the incompatibility with high-flow nasal oxygen. To avoid hypotension and bradycardia, a low-dose bolus of 0.5 μg/kg intravenous dexmedetomidine was given over 15 min. She also received a single dose of 0.5 mg intravenous midazolam for anxiolysis at induction followed later by an additional dose of 1.5 mg midazolam in divided doses. Dexmedetomidine continuous infusion ran at 0.7 mcg/kg/h following initial bolus. Despite adequate topicalization she continued to cough, thus 100 mcg intravenous fentanyl was given in four divided doses. Intravenous ondansetron (4 mg) was given prior to conclusion of the bronchoscopy.\nTotal time from induction to emergence was 23 min. Spontaneous respirations were preserved throughout, with respiratory rate constant at 18. Oxygen saturation was maintained above 96% for the entire procedure. Mean arterial pressure was maintained at 80–90 mmHg throughout. Heart rate ranged from 80 to 100 beats per minute, with an elevation to 120 upon insertion of bronchoscope. Throughout the procedure, the patient was responsive to verbal stimuli. Patient was transported from bronchoscopy suite to post-anaesthesia recovery unit, where she met all criteria for discharge to regular nursing floor. There were no complications noted post-operatively. She was very satisfied with the procedure and had minimal recall. |
A healthy 44-year-old man presented with pain, watering, and decreased vision in the right eye 4 hours after injury with a hypodermic needle in another clinic. His eye had been injured with a hypodermic needle during irrigation after removal of a corneal foreign body by an ophthalmologist; the needle loosened from the syringe and injured the right eye. On examination, his visual acuity in the right eye was counting fingers. The intraocular pressure was 15 mmHg in the right eye, and there was no evidence of a relative afferent pupil defect. Slit-lamp examination revealed a temporal penetrating corneal puncture and iris hole in the right eye (). The anterior chamber was deep and quiet, and the cornea and lens remained clear. However, pupil dilation using tropicamide eye drops revealed a breached anterior capsule and localized cataract (). The results of both dilated fundal examination and B-scan ultrasonography were normal. Cefepime was administered intravenously at 30 mg/kg twice daily, and 0.5% levofloxacin eye drops were instilled six times per day. The patient was prepared for cataract surgery.\nAfter 20 hours, the visual acuity in the affected eye had decreased to hand motion, and the eye had become painful; it was inflamed and had severe fibrin exudates in the anterior chamber, obscuring the pupil (). A 1-mm focus of hypopyon was present (). No fundus view was present. B-scan ultrasonography showed prominent vitritis with an attached retina. The patient was treated for endophthalmitis by immediate vitreous biopsy, irrigation of the anterior chamber, and intravitreal antibiotic therapy with vancomycin (1 mg/0.1 ml) and ceftazidime (2.25 mg in 0.1 ml) in the operating room. The previous doctor was contacted to obtain a first-hand account of the incident, and he confirmed that a needle had been dropped onto the patient’s eye while using a syringe to irrigate the eye with normal saline. The incident had occurred before use of the needle; it was therefore presumed to be sterile.\nFour hours later, the right eye had become painful, and the anterior chamber showed a redevelopment of a severe fibrinous reaction. Emergent vitrectomy combined with lensectomy was performed along with the administration of intravitreal antibiotics (vancomycin, 1 mg/0.1 ml; ceftazidime, 2.25 mg in 0.1 ml). Multiple patchy retinal hemorrhages were noted during the vitrectomy. Postoperatively, the patient was treated with intravenous ciprofloxacin at 750 mg twice daily, levofloxacin eye drops hourly, tobramycin eye drops hourly, and 1% atropine eye drops twice daily. Culture of the vitreous biopsy grew Pseudomonas aeruginosa, which was sensitive to ceftazidime.\nOn the sixth postoperative day, the best-corrected visual acuity improved to 20/200 and the intraocular pressure was 20 mmHg in the right eye. The anterior chamber was quiet (), and B-scan ultrasonography findings were normal. Fundus examination of the right eye showed a decrease in the patchy retinal hemorrhages. During the 2-month follow-up, the patient remained clinically stable and his best-corrected visual acuity improved to 40/200. |
A perimenopausal 52-year-old woman, gravida 3, para3, was admitted by our clinic in April 2012 with a one-month history of vaginal bleeding and progressive abdominal discomfort. She dose not have known medical history, medication, drinking alcohol problem, and family history of cancer. The patient's gynecologic examination and transvaginal ultrasound showed a mass in the right adnexa. Moreover, pelvic magnetic resonance imaging showed mass of about 7 cm in diameter in the right adnexal with coexisting cystic and solid densities. In the Doppler screening, there was a vascularization in solid component, and the value of the Resistance Index (RI) at Doppler scan was 0.71. Serum levels of cancer antigen are CA-125: 57 U/mL (<35). Colonoscopy was normal. Abdominal tomography and pelvic magnetic resonance imaging were negative for any metastasis. The patient underwent total abdominal hysterectomy with bilateral oophorectomy, omentectomy, pelvic lymph node dissection and debulking. Grossly an opened uniloculated cystic mass was received measuring 12 × 7.5 cm in size with 0.2 cm wall thickness. The cyst wall contained a mural nodule measuring 7 × 7 × 2 cm in size. Intraoperative pathology consultation revealed a malignant epithelial tumor consistent with squamous cell carcinoma arising in a mature cystic teratoma. According to the intraoperative pathology consultation, total abdominal hysterectomy, and bilateral salpingo-oophorectomy, omentectomy and pelvic lymph node dissection was made. In permanent sections the cyst wall showed features of a mature cystic teratoma that was composed of ectodermal elements. Sections from the mural nodule showed moderately differentiated squamous cell carcinoma arising from the surface epithelium. A final diagnosis of malignant transformation of moderately differentiated squamous cell carcinoma in a mature cystic teratoma with extensive necrosis was made (Figures and ). Omentum and the pelvic lymph nodes were free of tumor deposits. Ovarian surface was free of tumor and lymphovascular invasion was not identified. Consequently, tumor stage was determined as stage 1A. Two months after surgery six rounds carboplatin and paclitaxel were planned. Later the patient received second cycle treatment without any problem. |
A 75-year-old male arrived to the ED after having experienced increasing pain and abnormal swelling of his left leg. Further questioning revealed a previous history of an attack by a vaccinated male cat that included bites and scratches in the left calf, four days prior. The patient referred that the attack produced three superficial puncture wounds, involving the upper dermis, that received adequate wound management with bi-daily cleaning with saline irrigation and change of dressings. No antibiotic prophylaxis or analgesics were prescribed. Despite no signs of systemic infection or changes in skin color, texture or temperature, the sudden increase in pain and swelling at the wound region led the patient to seek further medical attention. Past medical history was relevant only for primary hypertension, diagnosed about 15 years earlier and without treatment for the previous five years, allergy to clindamycin, and an inguinal hernioplasty four years prior. No personal history of cancer or hemostasis disorders was reported.\nAt admission, his vital signs were within normal limits. Upon examination, unilateral pitting edema and weakened tibial pulses were found in his left leg. No changes in skin color or warmth suggestive of cellulitis were detected. Calf diameter was different between the two legs (>3 cm). No Homan’s sign, tachypnea or abnormal heart or lung sounds were found. The patient did not report chest pain or dyspnea. The modified Wells’ score for deep-vein thrombosis was three points.\nA compression venous ultrasound with Doppler imaging of the left leg revealed an echogenic non-compressible subvalvular thrombus on the middle portion of the popliteal vein. No other thrombi were detected (Figure ).\nThe diagnosis of DVT was made and laboratory tests were ordered to investigate potential causes: complete blood count (CBC), coagulation profile, prostate-specific antigen, comprehensive metabolic panel, HbA1c, fecal occult blood test, D-dimer, and urinalysis were all within reference parameters. No additional imaging studies were ordered.\nThe patient’s clinical history, exhaustive physical exam, and laboratory evaluations showed no signs of underlying malignancy, autoimmune disease or infection. As no clear cause was established, and complying with the patient’s request, outpatient management for DVT was initiated with subcutaneous enoxaparin (1 mg/kg) twice daily and the usual non-pharmacological recommendations. The patient was told to come for a follow-up sonogram 10 days after starting therapy and to discuss the transition to oral medication.\nThe succeeding ultrasound - performed 13 days after the initial diagnosis - showed an anechoic lumen with complete remission and normal venous valvular function (Figure ). As the initial parenteral therapy with low-molecular-weight heparin (LMWH) had been completed, treatment was changed to 15 mg rivaroxaban twice daily for 21 days and then 20 mg once daily for three to six months. Four months after the events here reported, the patient remains asymptomatic and is being treated with amlodipine 5 mg/losartan 100 mg QD and rivaroxaban 20 mg once daily. |
A 43-year-old lady without significant co-morbidity and no apparent cardiovascular risk factors presented to us for a second opinion following an emergent admission to her local hospital department with sudden onset central chest pain and ECG changes indicative of acute anterior myocardial infarction (AMI). After initial supportive medical therapy and improvement of her acute symptoms, investigations to further characterise the nature of her coronary disease were performed. CT coronary angiography showed the culprit lesion was likely to be an embolic occlusion of the distal left anterior descending (LAD) artery after the second diagonal branch, but incidentally made note of a soft tissue mass seen on the left coronary cusp of the aortic valve (AV) (Figure ). Further characterisation of this lesion by both trans-thoracic (TTE) (Figure ) and trans-oesophageal echo (TOE) showed appearances consistent with a papillary fibroelastoma (PFE) and she was admitted for surgery on the 24th October 2011. A minimal access 6 cm skin incision was made, and the chest entered via a limited upper sternotomy extending to the right 3rd intercostal space. Cannnulation was performed via the ascending aorta and right atrium (Figure ). Following transverse aortotomy, the aortic valve was inspected revealing a round mass at the very edge of the left coronary cusp. The lesion was excised, sparing the AV, and the valve tested confirming perfect competence prior to closure. Total cross clamp time was 16 minutes with an uneventful wean from bypass. Prior to decannulation, intra-operative TOE confirmed normal valve competence and good overall myocardial function. Total operative time was 52 minutes. The excised lesion measured 9 × 8 × 3 mm (Figure ). Histopathology demonstrated a fronded papillary lesion, with cores of collagen surrounded by elastic tissue covered with a layer of endocardial endothelium, typical of PFE (Figure ). The patient had an uneventful post-operative course and was discharged home 3 days after surgery. |
A 54-year-old female patient was referred to our tertiary care university hospital with a history of hospital admission for unstable angina global repolarization and surgical management of a Stage IIB breast malignancy. The episode of unstable angina was managed in a hospital conservatively. Clinical details and electrocardiographic abnormalities had previously led to a diagnosis of acquired coronary stenosis. In view of urgent breast cancer surgery, she chose referral to our hospital for simultaneous management of both conditions. The only current symptoms were dyspnea on climbing two flights of stairs and no orthopnea or paroxysmal nocturnal dyspnea or chest pain. Clinical examination of the cardiovascular system was remarkable for a pansystolic murmur suggestive of mitral regurgitation. The first TTE demonstrated a dilated left heart, mildly diminished global wall motion, a left ventricular ejection fraction of 40% (modified Simpson method), moderate to severe mitral regurgitation, and an estimated right ventricular systolic pressure of 45 + right atrial pressure mean. The tricuspid annular plane systolic excursion was noted to be 23 mm. The TTE also recorded that the LCA orifice was not visualized and the RCA was deemed exceptionally dilated and ecstatic raising suspicion of a diagnosis of ALCAPA.[] Stress perfusion with technetium-99m sestamibi showed a reversible perfusion deficit in the territory expected to be supplied by the LCA. A coronary angiogram, in finality, demonstrated the origin of the LCA from the pulmonary artery [Figures and ] and the dilated RCA. Major hematologic and biochemical screening was unremarkable, with a hemoglobin level of 11 g/dL. Consultation between cardiology, cardiac surgery, oncologic surgery, and anesthesia teams consensually agreed to accept the patient for a total mastectomy, with axillary clearance as a priority procedure. ALCAPA management was to be done as a second-stage procedure.\nOn the day of surgery, after standard preoperative fasting, the anesthesia team performed a focused cardiovascular ultrasound (FoCUS)[] in the holding area. The results of this examination concurred with the previous expert cardiology report noting well preserved right ventricular function (tricuspid annular plane systolic excursion of 24 mm), mild left ventricular dysfunction (left ventricular end diastolic dimensions of 63 mm), fractional shortening of 25%, fractional area change of 40%, and a wall motion score index (WMSI) of 2.[] The left ventricular end diastolic area on the parasternal short-axis view was assessed to be 14 cm2.\nIntravenous access and a radial arterial catheter were secured under local infiltration anesthesia. Ultrasound-guided paravertebral block was performed at the T4 vertebral level with 0.5% ropivacaine (0.3 mL/kg) in the sitting position. Standard monitors such as 5-lead electrocardiogram (ECG), pulse oximetry, and end-tidal carbon dioxide (ETCO2) and anesthetic gas were applied. Infective endocarditis prophylaxis was administered according to extant guidelines/anesthesia was induced with incremental doses of intravenous propofol. Intravenous Ringer lactate fluid boluses of 100 mL and 50 μg boluses of phenylephrine were used to treat >10% changes in mean arterial pressure from baseline. The decision to infuse fluid or inject vasopressor was based on repeated viewing of the left ventricle in the parasternal short axis window at the level of the papillary muscle; the left ventricular end diastolic area was attempted to be maintained within the normal limits of 14–18 cm2. Any change in global or regional ventricular function on a qualitative basis was also assessed. The stroke volume obtained from an apical five-chamber view was 47 mL, and the cardiac index was 2.3. If need be, this measurement could have been repeated to optimize systemic hemodynamics. Endotracheal intubation was facilitated with 0.1 mg/kg of vecuronium bromide and thereafter titrated to 1–2 responses on a train-of-four stimulation. Anesthesia was maintained with isoflurane (end-tidal anesthetic agent of 1–1.5%) in an air-oxygen mixture (fractional concentration of oxygen 45%) and mechanical ventilation was adjusted to achieve an ETCO2 of 35 mm Hg. An arterial blood gas sample was obtained after attainment of stable hemodynamics to establish the arterial to ETCO2 gradient which was then determined to be 5 mm Hg; in addition, this was also used to determine the arterial oxygen tension which was 120 mm Hg. Surgery lasted for 95 min; at the end of the procedure, neuromuscular block was duly reversed and the trachea extubated. Temperature monitoring and forced air warming were used to maintain a nasopharyngeal temperature of 36°C. In addition to routine limb lead II and precordial lead V5 visualization on surface ECG, real-time ST segment monitoring (with an alarm set at 2 mm below the patient's baseline and measured at J + 80 ms) was also commenced and monitored throughout the procedure on a Datex-Ohmeda S/5 monitor (GE Healthcare, Madison WI, USA). Invasive right heart catheters were not placed as we surmised that owing to the low-risk nature of breast surgery with minimal fluid shifts, hemodynamic perturbations would be limited to use of anesthesia medications and positive pressure ventilation. Hemodynamic parameters were unchanged (maximum deviations of 10% from baseline in the heart rate and mean arterial pressure) throughout the procedure and in the postoperative anesthesia care unit.\nAn intravenous infusion of morphine at the rate of 40 μg/kg/h was commenced with the analgesia protocol prescribing in addition to 4 g of intravenous paracetamol every 24 h. Boluses of fentanyl (2/μg/kg) were used if the numerical rating score for pain exceeded 4. Echo examination was repeated in the postoperative holding area which was unremarkable and not different from the preoperative examination in terms of either wall motion or overall ventricular function. A point-of-care cardiac troponin visual estimation kit (TROP T®, Roche Diagnostics, Basel Schweiz, cutoff 100/ng/mL) was measured on postoperative days (PODs) 0–2 to detect occult myocardial damage and screen for further quantitative troponin estimation. All of these results were negative. The patient was discharged from the postanesthesia care unit at 24 h and hospital on POD 3; recovery was unremarkable and she has since been referred to a center of her choice for surgical correction of her cardiac condition. |
In May 2016, a 67-year-old woman came primarily to our hospital for a consultation about painless mass of the left lower gingiva. Intra-oral examination showed a 46 × 25-mm tumor with induration on the left lower gingiva (Fig. ). A submucosal mass, independent of the gingival tumor, was palpable in the left buccal region. Several cervical lymph nodes on the left side were also palpable. Pathological examination of a biopsy sample taken from the gingival tumor revealed a well-differentiated squamous cell carcinoma.\nA computed tomography (CT) scan with contrast showed a large gingival tumor, with destruction of the adjacent mandibular bone, and four metastatic left-cervical lymph nodes that were markedly enlarged, non-homogeneously enhanced, and partially necrotic. These lymph nodes included two left submandibular and two left upper jugular nodes. CT imaging showed no metastases to the lungs. Magnetic resonance imaging (MRI) showed a large primary tumor on the left side, with its epicenter located in the lower gingiva. The tumor appeared to extend into the sublingual space medially and into the buccinator muscle laterally. A non-homogeneously enhanced mass was identified in the buccinator space along the facial vessels, anterior to the anterior edge of the masseter muscle, and lateral to the buccinator muscle (Fig. ). This mass lay on the cranial side of the primary tumor. The mandibular ramus and pterygoid region that are on the cranial side of BN were not invaded by primary tumor (Fig. ). Moreover, T1-weighted MRI showed a thin layer with high signal, indicative of fatty tissue, between this mass and the primary tumor, indicating that the mass was independent of the primary tumor. Based on its anatomic location, the mass appeared to be metastatic disease to BN. Greyscale sonogram showed some metastatic cervical lymph nodes on the left, and metastatic BN. These cervical lymph nodes were markedly enlarged, round in shape, heterogenous hypoechoic, and without an echogenic hilus. Metastatic BN was round in shape, hypoechoic, with well-defined borders, and without an echogenic hilus.\nThe tumor was diagnosed as a cT4aN2bM0 squamous cell carcinoma of the lower gingiva. The patient received neoadjuvant chemotherapy, consisting of docetaxel 60–70 mg/m2 and cisplatin 70 mg/m2 on day 1, and 5-fluorouracil 700 mg/m2/day 96 h continuous infusion. Gross examination after two cycles of chemotherapy showed marked shrinkage of the primary tumor. A slight reduction in BN size was observed. According to the Response Evaluation Criteria in Solid Tumors (RECIST) guidelines, version 1.1 [], this patient showed a partial response to treatment.\nThree weeks after the end of neoadjuvant chemotherapy, the patient underwent surgery, consisting of suprahyoid neck dissection (levels I–II) on the right side, classical radical neck dissection (levels I–V) on the left side, segmental mandibulectomy, and oromandibular reconstruction with a scapular osteocutaneous flap. The primary tumor and buccinator space including BN were dissected in continuity with neck dissection. Histopathological examination of the segmental mandibulectomy specimens showed that the alveolar bone and part of the bone trabeculae of the mandible had been resorbed and replaced by fibrous connective tissue. This tissue contained a few nests of squamous cell carcinoma, composed mainly of necrotic tissue with a small number of viable cancer cells and remnants of keratin pearls. The surgical margins were free from tumor. Metastatic disease was detected in five cervical lymph nodes, including one left submandibular aggregated-node, three left upper jugular nodes, and one left middle jugular node. No metastatic nodes revealed extra-nodal extension. Metastasis to BN was also present (Fig. ). These metastatic regions contained few viable cancer cells and consisted primarily of necrotic tissue.\nFollowing surgery, the patient was treated with adjuvant radiotherapy (50 Gy/25 fractions) with concurrent oral chemotherapy (S-1, 100 mg/day for 5 days per week for 5 weeks) []. Two years later, there has been no evidence of tumor recurrence or metastasis. |
A 28-year-old woman, gravida 3 para 1, had a medical termination of a miscarriage at seven weeks, with no dilation and curettage, in 2008. In 2015, a baby was delivered by caesarean section in the breech position, weighing 3900 g. She had no significant past medical history, and her antenatal care had been uneventful. On August 9, 2018, at 19:15, she was admitted to our hospital due to a pregnancy of 9+ months and irregular contractions for 4+ hours. Periodic uterine contractions occurred every 6–8 min. The patient was not accompanied by abdominal pain or vaginal bleeding and had intermittent term after contractions. Clinical examination showed that her body temperature was 36.7 °C, blood pressure was 102/65 mmHg, pulse rate was 100 bpm, and oxygen saturation was 100%. Blood tests showed mild leucocytosis (16.61 × 109/L), normal platelet count, normal coagulation test, and haemoglobin of 102 g/L. Vaginal examination showed the cervix was tightly closed; no vaginal bleeding or fluid was found. The ultrasonography indicated that the foetal head was located above the uterine cavity, the foetal size was consistent with the gestational age, the placental position was normal, and the scar thickness of the previous caesarean section was approximately 0.2 cm. Uterine contractions declined after admission. During admission, the patient was clinically and biochemically stable, and daily cardiotocograms showed a reassuring foetal heart rate pattern. Because of the patient’s progressive anaemia (blood tests revealed a slow decline in haemoglobin to 93 g/L, 87 g/L) and sudden increasing abdominal pain, ultrasound was used but did not show ruptured abdominal fluid. An urgent laparotomy was performed and revealed a massive haemoperitoneum caused by the rupture of the uterine posterior wall. A haemoperitoneum with approximately 1 liter of blood was recovered. The lower uterine segment was intact and not ruptured. A boy with a body weight of 2900 g was delivered. Apgar scores were 9 at 1 min and 10 at 5 min. The amniotic fluid was clear, the placental was completely delivered, and no placental abruption occurred. The patient’s uterus was closed in two layers. After removing the blood and clots, a 12 cm-long tear in the posterior wall and active bleeding from the uterine rupture were found. Uterine tissue adhered to the bowel (see Fig. ). After separation of the adhesions between the bowel and the uterine wall, two layer of uninterrupted stitches restored the uterine integrity, and interrupted stitches closed the mesentery defect (see Fig. ). It was suspected that future conceptions would be dangerous, so bilateral tubal ligation was performed at the same time, under the permission of the patient and the patient’s family member. Our patient’s uterine and pelvis showed no abnormalities and, particularly, no evidence of endometriosis. Inspection of her liver showed no rupture. The placenta was sent for pathological examination. Syntocinon (oxytocin) (Ma an Mountain Company, China, SFDA approval number: H34020474) was administered intravenously. The operation was uncomplicated, and the estimated total blood loss was 2500 ml. Ten units of blood and 400 ml of blood plasma were transfused. The patient’s postoperative course was regular, and she was discharged 6 days later. |
A six-year-old boy presented with a one month history of abdominal distension and facial puffiness. There was a brief episode of low-grade fever with constitutional symptoms two weeks prior to the current illness. Physical examination revealed jugular venous distention, prominent hepatomegaly, and ascites. His ECG was normal, while the chest X-ray showed cardiomegaly with right atrial enlargement and normal pulmonary vascularity.\nTransthoracic echocardiography revealed a large solid mass of inhomogeneous echo texture filling the entire right ventricle including the outflow tract, leaving a residual lumen of only a few millimeters [Figures and ]. This mass was indistinguishable from the myocardium, and delimited by the tricuspid and pulmonary valves. The right atrium was enlarged and left-sided cardiac chambers were compressed. There was a small pericardial effusion. Systemic evaluation did not show any evidence of extracardiac disease. A provisional diagnosis of rhabdomyosarcoma was considered. Cardiac MRI did not add to this diagnosis. The mass was not biopsied as an urgent palliative resection was planned in view of the obstructive symptoms. Considering the extent of the tumor, it was approached through an atriotomy as well as through the pulmonary artery. The tumor was entirely intracavitary, its extent being as suggested by the echocardiographic appearance. The entire mass was resected and a Glenn shunt was performed. The foramen ovale was left patent. The immediate postoperative period was uneventful. However, on the first postoperative day, the patient expired, likely due to an air embolism.\nHistology and histochemistry of the operative specimen revealed a malignant small round cell tumor [] with abundant intracytoplasmic glycogen. Immunocytochemistry was positive for vimentin and MIC2 (CD99), suggesting a primitive neuroectodermal tumor (PNET) []. Negativity for smooth muscle actin, desmin, and myogenin ruled out the commoner possibility of a rhabdomyosarcoma. The other two malignant small round cell cardiac tumors ( please delete the intervening commas) cell cardiac tumors viz. lymphoblastic lymphoma and neuroblastoma were ruled out by virtue of negativity for leucocyte common antigen, chromogranin and synaptophysin. Thus, a final diagnosis of a PNET of the myocardium was made. |
A 59-year-old woman presented with persistent pain in the thoracic spine after low energy trauma 6 weeks ago. X-ray imaging showed vertebra compression fracture of Th9 with kyphosis of 20°. The patient had a history of three strokes, 15 and 13 years ago, with residual paralysis on the right side. She did not report of new neurological disability after trauma: no new motor dysfunction, no long tract signs, neither bladder nor bowel dysfunction. There was no history of malignancy in her family. MRI studies revealed a solid mass of 16x14x12 cm in the inferior posterior mediastinum on the left side with infiltration of Th9 and Th10 vertebral body and spinal canal infiltration with myelon compression (Figure 1 , Figure 2 ). Staging procedure including total spine MRI, abdominal and chest computed tomography (CT), cranial CT, and PET CT did not show distant metastasis. The interdisciplinary tumor board decided to perform a transthoracic needle aspiration biopsy first. The histopathological examination could not define a clear diagnosis. Therefore an open biopsy was performed. This result was not clear, too. At last, pleomorphic rhabdomyosarcoma or liposarcoma with rhabdomyogenic dedifferentiation were discussed. The proliferation index Ki67 was 70%, meaning high-grade sarcoma. Trimodality treatment was proposed: surgery with “en-bloc” resection followed by adjuvant multidrug chemotherapy and radiation beam therapy. The day after biopsy, the patient suddenly developed an ascending sensory spinal cord injury. We decided for a two-stage surgery, starting with immediate posterior decompression and stabilization: We performed a posterior decompression with complete resection of the posterior parts of the Th9 and Th10 vertebra with spinal canal clearance. Long segment stabilization was performed three levels above and three levels below (Figure 3 ). After a few days of recovery the anterior procedure followed (Figure 4 ). Via thoracolumbophrenotomy an “en bloc” resection including TH9 and Th10 vertebral body as well as 2 level cage reconstruction of the anterior column was performed (Figure 5 , Figure 6 ). The patient recovered quite well after surgery: no problems of wound healing, no new neurological deficits, sensory deficit improved. Adjuvant chemotherapy started 4 weeks after surgery with the first of 3 cycles in a 21 days period. Unfortunately chemotherapy had to be reduced and later stopped due to major side effects. A radiation beam therapy with total radiation dose of 60 Gy followed. The patient did well at 3 month and 6 month follow-up, showing no new neurological deficits, less pain. MR imaging after 6 month did not show local recurrence and PET CT did show no proof of relapse. |
A male patient aged 5-year-and-1-month was referred for genetic evaluation of development and speech delay, intellectual disabilities at the genetic counselling clinic in Shenzhen Maternal and Child Healthcare Hospital. The parents described that an affected brother also presented the same clinical phenotype but was not available for the clinical examination. The chromosome karyotype and chromosomal microarray analysis (CMA) in the proband were normal. The mother was pregnant again and pursued genetic counseling. The proband was subject to comprehensive neurological testing including the Gesell Developmental index. Molecular genetic tests and biochemical and neurochemical analysis were performed on the proband. The present study was approved by the hospital’s Institutional Review Board and written informed consent was obtained from their parents.\nThe proband was the second boy of healthy nonconsanguineous parents (pedigree in Fig. ). He was born at 39 weeks of gestation from an uneventful pregnancy and delivered by Caesarean section (weight, 3600 g; length, 50 cm; head circumference, 36 cm). He showed head control at 12 months, ability to sit by himself at 15 months, and walking with aid at 20 months. His verbal language was nearly absent and he made no visual contact. He suffered from seizures from 6 months old. He had no craniofacial dysmorphism. Gastrointestinal problems such as chronic constipation or nausea were noted in the proband. The physical examination on the proband showed 95 cm height, weight 18.2 kg and developmental and language delay. The proband also had an electroencephalogram (EEG) test, which showed sharp and slow waves in sleep during 24-h EEG monitoring. A brain stem auditory-evoked potential (BAEP) test showed mild abnormality. The proband had a Children’s Autism Rating Scale (CARS) score of 33, which indicated mildly autistic characteristics. The Gesell developmental scale test was used to evaluate the proband. Both the development age (DA) and developmental quotient (DQ) data showed extremely low grades which suggested severe development delay (adaptability, DA = 14.23mo., DQ = 23; gross motor, DA = 26.37mo., DQ = 43; fine movement DA = 15.87mo., DQ = 26; vocabulary DA = 13.07mo., DQ = 21; personal-social skill DA = 13.3mo., DQ = 22). The test results are depicted in Additional file : Figure S1A. The affected brother of the proband (II:1) was not available for the physical examination. The parental description of the clinical phenotype of the brother was mostly the same as the proband. The parents were physically healthy and indicated no significant past medical, surgical or family history.\nDNA samples were provided from the index patient and other family members, which were extracted as previously described []. The present study used the TruSight One Sequencing Panel and NextSeq 500/550 Mid Output v2 kit (300 cycles) with high depth of coverage for 4813 target genes (approximately 62000 target exons) that are associated with clinically relevant phenotypes. An average sequencing depth of 136.88x was achieved and 98.25% of targeted variants were covered at least to a 10x depth, and 97.04% of targeted variants were covered at least by 20x. The total detected variants numbered 24594, which included 21,733 SNPs, 1,182 insertions and 1,679 deletions respectively. The data were analyzed on the TGex (Translational Genomics Expert) platform featuring with the VarElect scoring system []. A missense mutation, c.1181C > A (p.Thr394Lys), in the SLC6A8 gene was called with high probability as a candidate mutation.\nSanger sequencing was performed to confirm the SLC6A8 gene c.1181C > A mutation (forward primer 5’ ACGGAACTTGTCAGATTGT3’, and reverse primer 5’CAACAGCATGAAGAAGAACA3’). The father (I:1) was wildtype and the mother (I:2) was heterozygous for the c.1181C > A variation. The affected brother (II:1) and the proband (II:2) both carried the hemizygous variation of c.1181C > A. The pregnant mother had an amniocentesis at 22 weeks and Sanger sequencing targeting the SLC6A8 gene c.1181C > A was performed. The result showed a wild-type allele (II:3) and the mother gave birth to a healthy baby girl (Fig. ). In silico variant prediction analysis methods, including SIFT, PolyPhen2, PROVEAN, and Mutation Taster demonstrated this variant had probably damaging or diseasing-causing effects.\nBiochemical screening was performed with blood and urine samples from the proband and his mother. The creatine/creatinine (Cr:Crn) ratio was determined by liquid chromatography-mass spectrometry with deuterated internal standards in two urine samples taken on different days. A urine creatine test of the proband showed significantly elevated levels of creatine (0.805 mg/ml, normal control 0.160 ± 0.177 mg/ml) (Additional file : Figure S1B), and the creatine/creatinine ratio was significantly elevated compared to controls. Proton magnetic resonance spectroscopy (MRS, Magnetom Skyra 3.0-T, Siemens Healthcare GmbH, Erlangen, Germany), examination using a 3.0-T system at the brain left parietal lobe, right parietal lobe and genu of corpus callosum all showed marked reduction of the brain creatine peak (Fig. left part). Brain MRI showed a thin corpus callosum in the proband (Fig. right part). The MRS and MRI examination of the mother (I:2) showed normal results (Additional file : Figure S1C). |
The patient is a 69-year-old woman. She was infected with pneumonia at the age of three and had a high fever for a long period. After the fever abated, she became aware of hearing loss. Because she lived in a mountain village, she rarely visited medical facilities. Since then, she had never worn a hearing aid, had gone to a school for the deaf from elementary school to high school, and communicated with people in sign language. Her husband also used sign language, so she had not used oral communication from elementary school to the present. In 2011, family stress triggered the onset of tinnitus. Because around the same time, she began suffering from sleep onset disorder (it took about one hour until sleep onset), nocturnal awakening, and palpitations, she went to a nearby psychosomatic medicine clinic. She received medication at the clinic but her tinnitus did not improve, so she was referred to our department in 2014.\nVarious questionnaires were given at her consultation. The result of THI (Tinnitus Handicap Inventory) [], which is used to evaluate the severity of tinnitus, was a high of 94, which indicates the most severe form of tinnitus. Also, an SDS (Self-rating Depression Scale) [] score, which is used to measure depression tendency, was as high as 61, showing that she had a tendency toward depression. The STAI (State-Trait Anxiety Inventory) [], which is used to measure anxiety tendency, returned a State Anxiety (STAIs) score of 69 and a Trait Anxiety (STAIt) score of 67, indicating that she had an extremely high anxiety tendency. As one of the personal features of her tinnitus, she had no concept of the “loudness of tinnitus” because she had been deaf since childhood.\nIn imaging tests, there were no abnormal findings except for a slight enlargement of the inner ear canals observed by temporal bone CT scan. Head MRI showed no abnormal findings within the skull or in the internal auditory canals.\nFor treatment, we started oral administration of a serotonin reuptake inhibitor (SSRI) (paroxetine hydrochloride, Paxil®, 12.5 mg, started as one tablet a day, increased to three tablets a day) and a sleep-inducing agent (suvorexant, Belsomra®, 15 mg, one tablet a day). One and a half months later, the sleep onset disorder and nocturnal awakening improved, but early morning arousal persisted. Then, a benzodiazepine anxiolytic was added (etizolam, Depas®, 0.5 mg, one tablet a day). At four months after the initial visit, THI was 84, SDS 43, STAIs 50, and STAIt 48, which showed that her psychological condition had improved, although the tinnitus distress level did not change.\nAt this time, there was no improvement in perceived palpitations, and “pulsatile tinnitus” that seemed to synchronize with the heartbeat became the chief complaint concerning tinnitus, which led us to suspect that she had autonomic disorders. Six months after the initial visit, she started to receive psychotherapy (autogenic training). After the start of the treatment, we treated the patient with psychotherapy once a month, which continued until the 7th therapy session was completed. At the end of psychotherapy, our test results showed THI at 60, SDS 45, STAIs 32, and STAIt 43, showing a further improvement trend. The THI score was still high at 60, but the subjective tinnitus distress became “not so annoying,” and the “echoing tinnitus” that was the cause of the patient’s discomfort at the time of the initial visit disappeared. Only the pulsatile tinnitus, which seemed to be related to palpitations, remained.\nOne year and seven months after the initial visit, palpitations and pulsatile tinnitus, as well as anxiety and insomnia, were aggravated due to work stress. She restarted psychotherapy. At the same time, SSRIs were replaced by noradrenergic and specific serotonergic antidepressants (NaSSAs) (mirtazapine, Reflex®, 15 mg, started as one tablet a day, increased to two tablets a day). As a result, improvement of the palpitations and insomnia gradually occurred, and two years and one month after the initial visit, our test results showed THI at 40, SDS 47, STAIs 40, and STAIt 46.\nBy three years after the initial visit, the symptoms had stabilized and the anxiolytic drug was discontinued, but oral administration of the NaSSA and sleep induction drugs continued. The subjective tinnitus and palpitations at the time of sleep almost disappeared, and the sleep onset disorder and nocturnal awakening rarely occurred.\nNow 4.5 years have passed and she is taking only a low dose NaSSA (mirtazapine, Reflex®, 15 mg, 0.5 Tablets a day). The latest test results were THI 0, SDS 43, STAIt 47, and STAIs 50, indicating that the tinnitus distress had disappeared completely. |
A 62-year-old Caucasian man with end-stage renal disease presented to our hospital because of a four-day history of fever, diarrhea and the need for emergency dialysis due to hyperkalemia. Our patient had been treated with hemodialysis for one year. Over the last month, a temporary non-tunneled catheter had been used for vascular access because of arteriovenous graft thrombosis. However, he had missed the two last dialysis sessions. His prior medical history included diabetes mellitus type 2 and systemic arterial hypertension. During the hemodialysis procedure, our patient experienced shock and respiratory insufficiency with a requirement for endotracheal intubation and mechanical ventilation. An electrocardiogram revealed ST-segment depression in leads V4 to V6, suggesting an episode of acute myocardial ischemia. An emergency coronary arteriography was performed and showed severe stenosis of the proximal circumflex and anterior inter-ventricular coronary branches. Percutaneous coronary intervention with successful stent implantation was performed in both arteries. Because of our patient’s poor hemodynamic condition, despite the use of vasopressor and inotropic drugs, an intra-aortic balloon counterpulsation was placed and our patient was admitted to our intensive care unit (ICU). A rise in cardiac troponin and creatine kinase (CK)-MB levels confirmed the diagnosis of myocardial infarction.\nBroad-spectrum intravenous antibiotics were initiated because of our patient’s previous history of fever and diarrhea. Peripheral blood cultures obtained at admission tested positive for methicillin-resistant Staphylococcus aureus (MRSA). Culture of the removed dialysis catheter tip also grew MRSA.\nOn the fifth day of our patient’s ICU stay, echocardiography showed relevant pericardial effusion with impaired right ventricular filling. Pericardial drainage was performed and 500mL of purulent fluid drained. Cultures again tested positive for MRSA. A transesophageal echocardiogram revealed no valvular vegetation.\nOn the seventh day after our patient’s admission, ocular opacity was observed. An aqueous humor sample was collected and a culture grown tested positive for MRSA, which allowed a diagnosis of endogenous bacterial endophthalmitis to be made. Neurological clinical examination revealed nuchal rigidity. A lumbar puncture was performed and cerebrospinal fluid culture grew MRSA, confirming the diagnosis of bacterial meningitis. Septic arthritis of the right knee was diagnosed based on a positive synovial fluid culture for MRSA. A computed tomography (CT) scan of the thorax showed multiple cavity nodules in both lungs, and sphenoid sinus tomography showed sphenoid sinusitis, probably of staphylococcal etiology.\nOn our patient’s 14th day in the ICU, a mitral regurgitation murmur was diagnosed. A second transesophageal echocardiography procedure showed a mobile image attached to the mitral valve leaflet with the appearance of vegetation, and an image compatible with ruptured anterior mitral chordae tendineae, resulting in severe mitral regurgitation. One day later, our patient experienced a refractory shock followed by cardiac arrest non-responsive to resuscitative efforts, and died.\nAn autopsy was performed and our patient’s heart was observed to have moderate enlargement. The pericardial surface was covered with greenish granular exudate and loose adhesions were present between the visceral and parietal layers of the pericardium. Concentric hypertrophy with mild dilatation of the left ventricle was observed. The subendocardial layer of the anterior, lateral and inferior walls of the left ventricle showed many yellowish areas with softened granular centers (Figure A). Complete rupture of the anterior papillary muscle was also found (Figure B), but the mitral valve leaflets did not present vegetation. The aortic, tricuspid and pulmonary valves were normal. Microscopic examination revealed acute purulent pericarditis and multiple subendocardial abscesses with Gram-positive cocci colonies within areas of healing necrotic myocardium, including the ruptured papillary muscle (Figure C). Histological evaluation of the coronary arteries showed an acute inflammatory process in the wall of the circumflex and anterior inter-ventricular branches, characterized by neutrophil infiltration and the presence of Gram-positive cocci (Figure D). Abscesses were also found in the lungs and spleen. Pulmonary edema was present. |
A 20-year-old African American man was admitted to a psychiatric facility for psychosis. On initial presentation, the patient had an antalgic gait, which he attributed to his history of dopa-responsive dystonia. His mood was depressed and his affect was restricted. He had disorganized thought process and was slow to recall. He endorsed auditory hallucinations, paranoid delusions, depressive symptoms, frequent night awakenings, and persecutory nightmares. Per the ambulance report, the patient was wandering the streets in a confused state, so bystanders called 911. The patient stated that he had been homeless for the past 3 weeks. During this 3-week period, he admitted to not being complaint with his medications. Urine toxicology screen was negative.\nPer medical records, he was diagnosed with dopa-responsive dystonia at age 11 after a 2.5-year history of progressive abnormal gait. He was initially misdiagnosed with tight heel cords at age 10 and treated with serial casting that resulted in good improvement on the right but marginal improvement on the left. His toe walking became more pronounced overtime accompanied by worsening left calf pain and stiffness, increasingly frequent falls, and new onset of intermittent torticollis. These symptoms worsened over the course of the day. He was eventually taken to an urban teaching hospital, where he was diagnosed with dopa-responsive dystonia based on clinical presentation and marked improvement on a levodopa trial. Magnetic resonance imaging of the brain and spine was unremarkable at the time.\nAt age 15, he was diagnosed with schizoaffective disorder bipolar type. His psychiatric history is also significant for multiple psychiatric hospitalizations, history of previous suicide attempts with medication overdose, and history of trauma. He also endorsed marijuana use since age 15 and daily tobacco use since age 18. He denies using any other illicit drugs. Per collateral information from his mother, his schizoaffective disorder has never been well controlled given the conflicting effects of his medications. She also mentioned that he was placed in individualized education programs as a child due to learning disabilities. His family history is significant for bipolar disorder on his maternal side. His family history on his paternal side is unknown. In addition to carbidopa-levodopa, his outpatient medications included sertraline, divalproex sodium, aripiprazole, and benztropine.\nOn hospital day 1, he was started on carbidopa-levodopa 25/100 mg tablet three times daily for dopa-responsive dystonia. On day 2 of his hospital course, sertraline 50 mg once daily, benztropine 2 mg twice daily, divalproex sodium 500 mg twice daily, and risperidone 0.5 mg twice daily were added to his medication regimen. We started him on a low-dose risperidone to avoid exacerbating his dopa-responsive dystonia symptoms. Physical exams were also performed daily to assess for dystonia and parkinsonian symptoms. His initial physical exam revealed an antalgic gait secondary to left lower extremity dystonia, which improved by hospital day 2 and resolved by hospital day 3. On hospital day 3, he became agitated and aggressive with staff members, which led to intramuscular administrations of haloperidol 10 mg, diphenhydramine 50 mg, and lorazepam 2 mg. He continued to endorse auditory hallucinations, so risperidone was increased to 0.5 mg in the morning and 1 mg at bedtime. His auditory hallucinations resolved and then returned on day 6. He reported hearing “good” voices and “bad” voices. He also continued to endorse depressive symptoms, multiple night awakenings, and persecutory nightmares. As a result, his risperidone dosage was increased to 1 mg twice daily. On hospital day 7, the patient reported hearing “mumbling” voices only and improvement in his sleep and depressive symptoms. On hospital day 8, his auditory hallucinations fully abated. By hospital day 10, he slept throughout the night, no longer had depressive symptoms, and had normal spontaneous speech. His thought process was linear, logical, and goal-oriented. His mood and affect was euthymic and full range. No psychotic symptoms were noted. The patient was compliant with his medications throughout the whole hospital course and his daily physical exams were negative for dystonia or parkinsonian symptoms since day 3 of his hospitalization. He was subsequently discharged on hospital day 14 with appropriate outpatient follow-up. |
The patient, a 53-year old Caucasian woman, initially noticed a lesion in her right eye. After a medical appointment at the ophthalmologic clinic at a regional hospital, a decision to remove the lesion was taken and an operation was carried out in August 2011. The pathology report showed a 13×11×7 mm malignant melanoma located in the conjunctiva with a minimal resection’s margin. The patient was re-operated one month later and the pathology report revealed a remnant of the melanoma with still a minimal resection’s margin. Therefore, the patient received cryotherapy. Four months after the first surgical procedure five new tumor lesions were detected in the same eye. Treatment with mitomycin eye drops was initiated, however enucleation of the right eye had to be carried out two months later to obtain local control. One month post enucleation, a CT scan of the chest and abdomen showed no metastases. However, yet two months later, positron emission tomography with 2-deoxy-2-[fluorine-18] fluoro-D-glucose integrated with computed tomography (18 F-FDG PET/CT also referred as PET/CT scan) revealed an orbital, a parotid gland and a suspected lung metastasis. Treatment with temozolomide was started and carried on for five months until progressive disease in all locations including the lung was noted in a new PET/CT scan. Shortly thereafter, the patient was included in a trial and received immunostimulatory gene therapy with the investigational drug AdCD40L in combination with low dose cyclophosphamide. Specifically, the patient received four weekly ultrasound-guided intratumoral injections in the parotid gland. Three days after the final injection, a CT-brain scan was performed due to left-sided leg weakness and revealed bleeding brain metastases. An MRI scan confirmed the presence of five brain metastases and the patient received whole brain radiotherapy (4 Gy × 5). A PET/CT scan at that time point showed progression in all lesions except the parotid compared with the most recent PET/CT scan (Fig. ).\nTissue from the primary tumor was tested for BRAF status, revealing the presence of the V600E mutation.\nOne month after the whole brain radiotherapy, vemurafenib treatment (standard dose: 960 mg po q 12 h) was initiated. The patient responded rapidly to the treatment; the metastases in the parotid gland and orbit were reduced in size within a week. After two weeks of therapy, the patient experienced maculopapular rash located on the head’s uppermost part, classified as grade 2 according to common terminology criteria for adverse events (CTCAE version 4.0), and the treatment was paused. One week later the rash was improved to grade 1 and the treatment was re-started at a lower dose (25 % reduction of the initial dose), whereafter no side effects were observed. After four weeks of vemurafenib treatment, the above-described clinically detectable metastases in the parotid gland and orbit had disappeared. At the next clinical examination, yet two months later, the patient’s general condition was considerably improved without clinical signs of disease progression. A PET/CT scan one month later, confirmed the reduction of tumor burden in all locations compared to the pretreatment examination (Fig. ). In particular, the parotid metastasis had only minor residual FDG-uptake and the size of and the FDG-uptake in the lung metastasis had decreased. However, at that time the orbital lesion had clinically reoccurred, measuring one centimeter in diameter indicating progressive disease. Based on this latter finding in combination with the worsened general condition of the patient, the treatment was assessed as no longer effective and was discontinued. The total duration of the BRAF therapy was four months. A new CT scan of the brain was planned in order to map the brain metastases and determine the possibility to repeat radiotherapy. However, the patient’s clinical condition quickly deteriorated. Therefore, she underwent the CT scan earlier than scheduled whereby more brain metastases, than had previously been detected, were diagnosed. The patient passed away the day after. The time schedule for the case is depicted in Fig. . The pathology report was eventually reviewed and it was ensured that the diagnosis indeed was CMM. |
A 71-year-old right-handed man was admitted to our hospital. When he came to the hospital, he was in a state of aphasic seizure with repeated spitting. He was diagnosed as an infarction of left middle cerebral artery territory with valvular heart disease 20 years ago. He was right side weakness (mRS score 1) with a sequelae of cerebral infarction. Aphasic seizure is the secondary event after he was diagnosed with cerebral infarction. He initially presented with an aphasic seizure for 5 years ago. He was treated with valproic acid, which was discontinued due to poor cooperation.\nOn neurological examination, he was an alert mentality. Speech was not fluent tangentially with improper comprehension. He made frequent paraphasic errors. He was not able to repeat a short phrase and name. Pupils were reactive, extraocular movements were conjugate. He had right side weakness (MRC grade 4) and right central type facial palsy due to previous cerebral infarction.\nAfter arriving to the hospital, he was found to have a left parietal cerebromalatic change due to cerebral infarction by non-contrast brain CT. There were no new lesions associated with symptoms in brain magnetic resonance imaging (MRI). Brain MRI on admission showed only cerebromalatic lesions in left temporoparietal lobe due to previous cerebral infarction (). His symptoms of apparent motor aphasia were thought to be a temporal lobe epilepsy due to post-stroke and he was started on fosphenytoin with loading dose. On the second day of admition, aphasia resolved.\nBut, as him aphasia improved, the patient reported a new auditory phenomenon after hearing a dialogue on television. He was not an aura preceding his symptoms. He stated that a dialogue rattled around in his head and repeated itself numerous times. Acoustic sensations preserved after the television was switched off. He could not stop the dialogue by manually occluding his external auditory meatus. He had never experienced auditory illusions or hallucinations in the past and had no history of psychiatric illness. The nature of his auditory perseveration (palinacousis) did not accompany with motor aphasia. He said the episode was bothersome and distracting symptoms.\nAt the time of symptoms, an electroencephalogram (EEG) revealed without definite epileptiform abnormalities (). Brain perfusion MRI showed decreased perfusion in old lesion with suspicious increased perfusion at overlying cortex due to seizure related hyperperfusion (). We concerned that the patients symptoms were focal sensory seizures, and prescribed antiepileptic drug with levetiracetam 250 mg twice a day continuous. After giving antiepileptic drug, he presented the perseverating acoustic phenomenon were reduced. By hospital day 4, palinacousis and motor aphasia had completely resolved. |
A 64-year-old woman was admitted to our hospital with a pulsatile mass swelling over the left cervical region and right hemiparesis after cough for 1 day. She had a history of fibromatosis, but no previous history of trauma, operation or inflammation in this region. On physical examination, a 5-cm large pulsatile swelling with blowing bruit was found over the left cervical region and multiple fibromas were found in regions of face, neck, and trunk. Neurological examination revealed muscular strength of grade IV according to the ‘manual muscle test (MMT)' grading system and hypoesthesia of right limbs, including touch and pain sensation. Computed tomography angiography (CTA) and DSA revealed a left high-flow internal carotid-jugular fistula at the first cervical level and twisted left internal carotid artery (ICA) (Figures ). Blood flow from the vertebrobasilar artery and right ICA via the circle of Willis supplied the left anterior cerebral artery and middle cerebral artery and drained backwards into the petrosal segment of left ICA (Figures ).\nWe chose embolization of both the fistula and parental artery, because no appropriate covered stent could be used to pack the fistula in the condition of reservation of left ICA. The purpose of first endovascular treatment was to isolate the fistula, by blocking both the backward blood flow from right ICA and the forward blood flow from left ICA. A Headway-21 stent catheter was selectively inserted into the distal part of fistula in the segment of carotid cavernous sinus, meanwhile an Echelon-10 microcatheter was placed in the distal part of stent catheter. One LVIS 5.5*30 mm stent, with its characteristic relatively compact mesh, was used to cover the distal part of fistula to avoid coils being pushed into internal jugular vein and heart (Figure ). However, the 3.5 cm fistula could not be covered by the LVIS stent. Therefore, 10 coils were additionally used one by one, to block the fistula from the distal to proximal part through an Echelon-10 microcatheter (Figure ). When considering the fast-backward blood flow from the right ICA after embolization, we could not guarantee the safety of blocking by Onyx. We chose one detachable balloon to block the ICA near the proximal part of fistula to stop the forward blood flow, and the backward blood flow would be stopped in the second treatment (Figures ).\nThe blowing bruit was reduced significantly after the first treatment, but became worse after 2 months later. The patient was admitted to our hospital again, and DSA revealed residual blood flow in the fistula from the left ICA and premature balloon deflation (Figures ). It was fortunate that LVIS stent blocked the balloon into the internal jugular vein. An additional 13 coils were used to pack the fistula with double-microcatheter techniques, under the multi-angle DSA projection, to avoid the coil protruding into the internal jugular vein (Figures ). Afterwards, two detachable balloons were used to block the proximal part of left ICA again (Figure ). DSA revealed the forward blood flow disappeared, the low-flow backward blood from right ICA still supplied the fistula, and a normal ipsilateral jugular vein (Figure ). Because the fistula was mostly blocked, and the low-flow backward blood may promote the formation of thrombosis in the distal part of fistula, we stopped the second endovascular treatment and planed a DSA examination to evaluate the effect of embolization and to determine further treatment. After this treatment, the patient did not feel the blowing bruit or any other discomfort.\nHowever, the patient complained of swelling and pain in the left occipitocervical region 2 days later. Physical examination revealed a large subcutaneous mass, with volatility and severe tenderness. Emergent CT revealed a subcutaneous hematoma in left occipitocervical region, without abnormalities in brain (Figures ). DSA in the hybrid operation room showed the coils in the fistula were stable without no forward blood flow in the proximal part of fistula. However, there was still a little backward blood flow through the right ICA and vertebrobasilar artery into right internal jugular vein, via the distal part of fistula. The lower part of fistula was not shown, because the blood drained into the right internal jugular vein through the sigmoid and transverse sinus reversely (Figures ). It was suggested that the occipitocervical subcutaneous hemorrhage was caused by poor ipsilateral jugular drainage, which was the result of the formation of thrombosis in fistula extending to the left internal jugular vein, thus blocking forward and backward reflow. We inserted an Echelon microcatheter through the left vertebrobasilar artery-posterior communicating artery, then selectively to petrosal segment of the left ICA, where 3 coils were put in, and then a 1.2 ml Onyx-18 was injected slowly. DSA examination after this procedure revealed that the backward blood flow distal to the fistula disappeared (Figures ). An open operation to remove the hematoma was preformed after the interventional operation. Multiple capillary hemorrhages were found from behind the sternocleidomastoid muscle after removing clots. The operation to stop bleeding was successful, and the postoperative course was uneventful. A 6-month follow-up DSA demonstrated a totally occluded fistula allowing the patient to engage in light manual labor with normal neurological functioning after the operation (Figures ). |
A 36 year old apparently healthy Hispanic female presented to the emergency department (ED) with a 4 days history of left upper extremity pain dull aching in nature and tenderness to palpation after a week of strenuous activity. Her background history was without any significant family history or risk factors. Physical examination revealed a moderately nourished, well-built female, not in acute distress except for marked pain in left extremity. No other abnormality was detected on physical examination.\nA complete blood count was done as part of a routine examination. Doppler studies of the four extremities was done in ED which showed left axillosubclavian acute DVT. Laboratory results are presented in Table and Table below. Secondary to the elevated D-Dimers patient underwent CT chest and pulmonary angiography to rule out pulmonary extension or pulmonary embolism (PE). The CT results confirmed the presence of left axillo-subclavian venous thrombosis; however, there was no evidence of PE.\nFuthermore, a CT chest was done and results showed there were no anatomical abnormalities obstructing thoracic outlet. It is possible that strenuous physical activity with temporary obstruction of the thoracic outlet while patient was training her upper body has triggered and likely temporary dehydration caused by extensive sweating during physical training further contributed to the thrombotic event.\nThe patient was started on strict precautions of left upper extremity immobilization, analgesics in the form of Tylenol 650 mg every 6 h for pain as well as cold compresses. Lovenox 90 mg subcutaneous twice daily (1 mg/kg BID) was started together with warfarin to keep INR 2–3. On the third day of hospitalization the therapeutic INR was reached and patient was discharged.\nAdditional workup to exclude hypercoagulable state in the form of antiphospholilpid antibody, factor V, Leyden, protein S and C and antithrombin III were within normal levels with no gross abnormality suggestive of thrombophilic state. Catheter-guided thrombolysis was considered with option to transfer patient to specialized center since this type of treatment was not available at the described facility. However patient was not willing to relocate and preferred to be treated at the same facility she was admitted to originally knowing that other type of treatment is available at the other center.\nTwo months after discharge, patient came for follow up. Doppler study showed that there were no blood clots in axillosubclavian vessels and all blood work was within normal limits including D-Dimers of 177 and the patient clinically asymptomatic. |
A 32-year-old unmarried woman presented to our hospital with a complaint of progressive distension of the abdomen and discomfort from the past 4–5 months. Her menstrual cycle was normal and attended menarche at the age of 13 years. There were no associated changes in bowel and bladder habits. She had no history of nausea, vomiting, weight loss, or anorexia. There was no significant medical, surgical, and family history. On per abdomen a 26 weeks lump was palpable []. Ultrasonography was done, and it showed a markedly enlarged uterus containing a 16 cm × 17 cm subserosal fibroid and 3 cm × 4 cm intramural fibroid. Bilateral ovaries were not visualized magnetic resonance imaging (MRI) suggestive of subserosal fundal myoma of 11.2 cm × 9.6 cm × 14.2 cm, 3 cm × 3 cm intramural fibroid in the lateral wall of the uterus and a small submucosal fibroid of dimension 1.1 cm × 0.9 cm × 0.8 cm. Endometrium showed an 8-mm thickness. Bilateral ovaries appear normal with multiple small follicles. After discussion with the patient, the laparoscopic route of myomectomy was chosen. A veress needle was introduced supraumbilicaly and pneumoperitoneum was created. The abdominal pressure was raised to 12mm HG. For telescope, Ten-millimeter port was created and under vision two 5mm accessory port was created on the right and left quadrant. The intraoperative finding was suggestive of a giant myoma arising from the uterine fundus and occupying the entire abdomen []. It was a big challenge to manipulate such a giant myoma. Twenty units of vasopressin was diluted in 200 ml saline and was injected into the myometrium until the blanching was achieved. On the highest point of the largest myoma transverse incision was given with the help of harmonic and after that dissection done in between the cleavage plain to identify the myoma. Myoma was stabilized with the help of myoma screw and enucleation accomplished by standard traction and countertraction without disturbing endometrial cavity. To achieve hemostasis, bipolar cautery was used. The defect was closed in two layers with the help of Covidien V-Loc 180 Barbed Sutures USP 0. Similarly, lateral wall fibroid was enucleated and sutured. The morcellator was used to remove the myoma, and for that, the left 5-mm port was converted to 10 mm. The overall time taken for surgery was 130 min. The intraoperative blood loss was minimal. The weight of the specimen retrieved was 2000 g []. The intra- and postoperative periods were uneventful. The final histopathological report was suggestive of uterine leiomyoma. The patient was discharged on the 2nd postoperative day. The patient is doing well 2 months post follow-up. |
In this study, the patient was a 49-year-old American Society of Anesthesiology class I Asian woman who was scheduled for internal fixation of her femoral bone traumatic fracture. Her medical history was not remarkable.\nOn the physical examination, her back was slightly scoliotic, and vertebral interspaces seemed narrow. Anesthesia team planned for epidural anesthesia in accordance with its advantages and patient's desire. An arrow epidural catheterization set with a 17- gauge epidural Tuohy needle, and a 19-gauge wire reinforced flex tip catheter was used for epidural anesthesia. As the patient was not comfortable in sitting flexed position, we initially tried paramedian approach in lateral decubitus position to access her epidural space.\nHowever, when we failed to guide the needle beyond bony structures after 2 times of paramedian attempts, we tried midline approach at L4-L5 interspace, which was successful. A test dose was negative for intrathecal or intravascular placement. Then, the catheter was inserted without any difficulty and threaded about 4 cm beyond needle tip into the epidural space. After injecting 20 ml lidocaine 1.5% into the catheter, the surgery proceeded uneventfully. Postoperative pain was controlled with a continuous epidural infusion of preservative-free bupivacaine 0.1%.\nOn the second postoperative day, an anesthesiology resident attempted to remove the catheter while the patient was in sitting position. Due to resistance to dragging, the resident reported the problem and was instructed to try steady and gentle traction in the patient's diverse positions especially the same position as when the catheter had been initially inserted. But, the catheter appeared difficult to be removed in sitting or lateral lying positions (either flexed or extended back). While making effects to dismiss the catheter, the patient did not complain of any pain or paresthesia.\nNext, we paved the same way while injecting the saline into the catheter, and then we repeated the task 10 min after administering 5 mg intravenous diazepam, but both were unsuccessful. We took anterioposterior and lateral X-rays to monitor the catheter and the tip []. Because the tip was not clear in plain X-ray studies, we did not insert a guide wire into the catheter.\nTo come up with a solution, a surgery consultation was conducted, and the patient was informed about the alternatives. Having consented, she was scheduled for an exploring surgery. In the operating room, we induced anesthesia and intubated the patient by thiopental and cisatracurium followed by prone positioning with chest and iliac rolls. Before getting ready for the operation, the surgeon tried to remove the catheter in the prone position, but this time the entrapped catheter was removed easily and intact without any resistance. There was no knot on the catheter, but we observed an angulation point, almost 5 cm before the tip. That point resembled a pressure point on the catheter caused by an entrapment |
A 52-year-old Nigerian man of the Yoruba ethnic group, presented with severe breathlessness on exertion, paroxysmal nocturnal dyspnoea and bilateral pedal swelling of six weeks duration, having been referred from a private hospital. He was recently diagnosed hypertensive during consultation at the referring hospital, few weeks prior to presentation. He had smoked for 13 pack years and also consumed alcohol heavily (≥60 g/day) for thirty years. There was no history of food or drug allergy and no family history of atopy.\nPhysical examination revealed an acutely ill looking middle aged man. He was not pale. There was no periorbital or facial swelling. There was no significant peripheral lymphadenopathy. The main findings were in the cardiovascular system examination. The pulse was 106 beats per minute, regular and normal volume; the blood pressure was 145/100 mmHg supine. The apex beat was at the 6th intercostals space, immediately lateral to the mid-clavicular line. Heart sounds SI, S2 and S3 gallop rhythm were heard. Chest examination showed few basal crepitations bilaterally. Fundoscopy revealed a grade 2 hypertensive retinopathy. All other systems were essentially normal. A clinical assessment of Hypertensive Heart Disease in failure was made. Although an in-patient management was offered, the patient however decline. He was managed on an out-patient basis; he was placed on lisinopril 5 mg daily, frusemide 40 mg daily, aspirin 150 mg daily and digoxin 0.25 mg daily.\nThe patient re-presented at the medical emergency unit of the hospital two days later with swollen lips and lower face of 10 hours duration. There was associated difficulty in swallowing but no stridor or hoarseness of his voice. There was no swelling of any other part of the body. He had neither skin rashes nor pruritus. There was no previous history of similar episode of swollen lips. Other aspects of his medical history did not show any abnormality and were not significant as to the likely cause of his disease state. Physical examination revealed a middle aged man with swollen lips and lower part of the face. The pharynx was also oedematous. He was not dyspnoeic.\nThe breath sounds were vesicular and there were no rales. The pulse rate was 94 beats per minute and respiratory rate was 20 breaths per minute respectively. His blood pressure was 140/90 mmHg. All other body system examination were essentially normal. A clinical assessment of lisinopril induced angioedema was made. The lisinopril was immediately discontinued. He was treated with intravenous hydrocortisone 200 mg stat and followed up with tabs prednisolone 10 mg tds and tabs chlorpheniramine 4 mg tds. He was seen at the outpatient unit two days later having recovered fully. The Naranjo probability scale indicated that this adverse drug event was probable. |
A 49-year-old woman presented at the emergency department with chest discomfort, dizziness, fatigue, and pallor. She was treated solely with duloxetine for depression and anxiety. Three years earlier, she had presented with HF, elevated troponin levels, and a normal coronary angiogram and was diagnosed as having takotsubo cardiomyopathy.\nAt arrival, she was alternating between a sinus rhythm of 80 beats per minute (bpm) and a monomorphic ventricular tachycardia (VT) of 170 bpm with hemodynamic compromise but no syncope. The ECG revealed VT of suspected right ventricular apical origin (Fig. ). Troponin T was 221 μg/mL at admission. The recurring VT was treated with metoprolol and a bolus of 300 mg of intravenous (IV) amiodarone and the rhythm converted into sinus rhythm. An echocardiogram showed apical and septal hypokinesia, minimal mitral insufficiency, and a left ventricular systolic ejection fraction (EF) estimated at 35%. Two hours after admission to the hospital, the VT returned, but could be aborted after another bolus of IV amiodarone followed by a potassium and magnesium infusion.\nThe patient was transferred for an angiogram to exclude coronary artery disease as the culprit for the arrhythmia. The angiogram was normal and recurrent VT every hour required repeated boluses and continuous administration (1200 mg during 24 h) of IV amiodarone. HF medications, including metoprolol and enalapril, were initiated. A cardiac magnetic resonance (CMR) tomography scan showed signs of inflammation and edema, dilation of the left and right ventricles, with EF 29% and 27%, respectively (Figs , , , ). Cardiac sarcoidosis was suspected based on patchy areas of late gadolinium enhancement and 30 mg prednisolone daily was started. Despite supranormal dosages of amiodarone, VT recurred and the treatment strategy needed to be changed. The ES did not cease (up to 40 min of VT) even by the third day, and lidocaine (100 mg bolus followed by continuous infusion of 2 mg/min) was administered despite the patient's depressed biventricular function. The recurrent VT became worse, however, and a higher heart rate (190 bpm) complicated the situation. She was referred to the thoracic intensive care unit at a tertiary center.\nHer pharmacological regimen was revised: antiarrhythmic therapy was switched back to IV amiodarone, lidocaine was discontinued, and spironolactone was added to treat her underlying HF. Midazolam and dexmedetomidine were used for sedation to decrease sympathetic tone. Notably, the patient's C-reactive protein increased to 190 mg/L from 3.7 mg/L 3 days earlier; her sedation rate was at 90 mm/h in the absence of focal symptoms of infection, and cefotaxime and doxycycline were given. VT may cause hemodynamic instability, so the patient was sedated with propofol and intubated. Over the next 24 h, she was cardioverted several times. After several cardioversions in the following days, the situation stabilized, and amiodarone was changed to an oral regimen.\nBlood and urine cultures were negative. Viral and bacterial serology was negative, except for elevated IgM for Borrelia burgdorferi deemed not indicative of current infection. ANCA and serum angiotensin-converting enzyme levels were normal. Interestingly, there was a family history of rheumatic disease; two aunts and her father had rheumatoid arthritis; it had also been suspected that her father had microscopic polyangiitis, a condition confirmed in the patient's daughter. The unspecific marker ANA was elevated, but without clinical signs of systemic lupus erythematosus. Corticosteroids were discontinued after a positron emission tomography–computer tomography (PET-CT) showed receding inflammation and no signs of sarcoidosis. After 18 days, C-reactive protein levels were close to normal and VT was infrequent, so ablation was deemed unnecessary. Furthermore, the VT had several ECG morphologies, suggesting complex ablation procedure, which was a reason to postpone ablation and wait until the inflammation had receded. Endomyocardial biopsy (EMB) was not performed. After 25 days, she experienced another VT, was sedated with propofol, and reverted to sinus rhythm before cardioversion could be performed. The following day, an implantable cardioverter defibrillator (ICD) with a single lead was implanted as her QRS < 120 msec. After a total of 30 days in the hospital, she was discharged, and at her three-month follow-up, no VT was seen on device interrogation and amiodarone was discontinued after another month. |
A 74-year-old female patient visited our hospital for the evaluation of a palpable abdominal mass. The patient had undergone successful endovascular aneurysm repair (EVAR) for an infrarenal abdominal aortic aneurysm (AAA) and a right common iliac artery (CIA) aneurysm 6 years ago, and had been lost to follow-up since 3 months after the procedure.\nIn computed tomographic angiography (CTA) before the EVAR procedure, the patient had an aortic aneurysm; the maximal diameters of the infrarenal AAA and the right CIA aneurysm were 50 mm and 36 mm, respectively. Even though the aorta was tortuous with a proximal angle of 75°, the proximal aortic diameter of 26 mm and proximal neck length of 33 mm seemed anatomically suitable for an EVAR procedure (). At that time, EVAR using the SEAL stent graft (S&G Biotech, Seongnam, Korea) was performed under general anesthesia. A bifurcated proximal graft measuring 30 mm in diameter was used as the main body; on the right side, the right internal iliac artery was covered with a limb extension using a 12-mm stent graft, and on the left side, a 20-mm bell bottom-shaped endograft was placed before the iliac bifurcation. After the surgery, no endoleak was observed on the CTA images either immediately or 2 months postoperatively. The patient did not visit the hospital again until 6 years later, when she presented with a palpable abdominal mass.\nIn the initial CTA images obtained during the more recent admission, type Ia and Ib endoleaks were observed, and a type III endoleak was also suspected (). The maximal diameters of the aneurysms were 61 mm for the AAA; 41 mm for the right CIA; and 35 mm for the left CIA. This time, the patient underwent surgery rather than an endovascular intervention, and an aorto-bi-iliac bypass using a transperitoneal approach was performed. After cross-clamping the aneurysm proximally at the stented aorta and distally at the bi-iliac artery, the SEAL stent graft was removed, with a portion of the bare metal stent proximal to the cross-clamp left un-removed. Then, the aorto-bi-iliac artery was replaced using a prosthetic vascular graft, with the residual bare metal stent included in the proximal anastomosis. The surgical findings showed that the main body of the stent graft had been in contact with the aortic wall in the kinked area as shown in the CTA image, and there were 2 holes with erosions of 2 mm (). The patient was discharged on postoperative day 26, and has remained well, without any complications, over 8 months of postoperative follow-up (). |
A 79-year-old male with a medical history of cholelithiasis, for which he underwent cholecystectomy 11 years ago, hyperlipidemia, essential hypertension, and paroxysmal atrial fibrillation was admitted for mild acute pancreatitis. His presentation included severe epigastric pain radiating to the back, lipase of 1840 u/L, and no organ failure. He denied fever, chills, or body aches. The patient denied alcohol consumption and reported to have quit smoking 41 years ago. Liver chemistries, serum bilirubin, serum triglycerides, and immunoglobulin subclasses were within normal limits (). Abdominal CT scan demonstrated peripancreatic haziness consistent with noncomplicated acute pancreatitis (). Home medications included atorvastatin for several years and the addition of 160 mg fenofibrate six months prior to admission. These medications were held upon admission but resumed at discharge. Full medication lists on admission and at discharge are shown in (). The patient was managed with fluid resuscitation and pain control. The patient recovered well and was able to tolerate regular diet without any pain or nausea. The patient was discharged in a stable condition after three hospital admission days, and lipase level at the day of discharge was 307 u/l.\nThree days later, the patient returned with similar symptoms. Lipase levels were >30,000 u/l (), and magnetic resonance cholangiopancreatography showed acute interstitial edematous pancreatitis (). The patient was treated conservatively with intravenous fluid resuscitation, pain control, and nothing per mouth until his symptoms resolved. Four days after his second admission, the patient recovered well and was discharged home in a stable condition. Fenofibrate and atorvastatin were discontinued ().\nTwo months later, the patient remained asymptomatic and returned for further workup to rule out an alternative cause to fenofibrate-induced pancreatitis. Endoscopic ultrasound (EUS) was done, which showed a 12 mm x 20 mm pancreatic head mass without pancreatic duct stenosis, strictures, or dilation. There were no common bile duct abnormalities. Fine needle aspiration was performed, and cytology was negative for malignant cells. Endoscopic retrograde cholangiopancreatography (ERCP) was performed to place a prophylactic pancreatic duct stent. Cholangiogram revealed a normal biliary system without dilation or strictures. The biliary tree was swept, and nothing was found. A prophylactic pancreatic duct stent was placed and a prophylactic sphincterotomy was performed. No recurrence of pancreatitis has occurred as of 6-month follow-up.\nGiven the course of the patient's illnesses in relation to fenofibrate usage, the timespan of drug initiation, and the fact that he had been taking atorvastatin for many years without previous signs or symptoms of acute pancreatitis, we hypothesize that his recurrent disease is probably due to the use of fenofibrate. |
A 54-year-old female with a history of untreated multiple sclerosis and substance abuse presented with sudden onset nausea, vomiting, and abdominal pain. On examination, she was noted to be cachectic with a body mass index of 15 kg/m2. Abdominal examination revealed high-pitched bowel sounds and a distended, diffusely tender abdomen. Her serum potassium was 3.2 mmol/L, and she had total serum protein of 4.6 g/dL and albumin of 2.4 g/dL indicating poor nutritional status. She was found to have SBO as barium swallow (Figure ) and computed tomography (CT) scan (Figure ) of abdomen and pelvis revealed a distended stomach and first half of the duodenum with abrupt narrowing of the third part. She underwent nasogastric tube decompression with drainage of approximately seven liters of bilious fluid. The patient was aggressively treated with intravenous fluids along with appropriate repletion of the electrolytes. She subsequently underwent esophagogastroduodenoscopy (EGD) (Figure ), which showed a dilated stomach and proximal portion of duodenum concerning for SMA syndrome. Nasojejunal tube was placed during the endoscopy for enteral nutrition. Total parenteral nutrition (TPN) was started two weeks after the admission as the patient was unable to tolerate enteric feeds and had no improvement in her symptoms. She subsequently required surgical intervention due to the lack of clinical improvement despite the medical management and nutritional support. During the diagnostic laparoscopy, she was found to have a massively dilated stomach and duodenum up to the third portion consistent with SMA syndrome. Several clinical clues supported the diagnosis of SBO due to SMA syndrome. These included the presence of multiple risk factors such as significant weight loss and cachexia in the setting of poor oral intake and underlying neurological disorder. In addition to the presence of obstructive symptoms seen in SMA, laboratory findings indicated poor nutritional status and imaging studies (i.e., barium study and CT scan) demonstrated SMA as the etiology. Subsequently, a duodenojejunostomy was performed. Following this procedure, the patient reported improvement in her symptoms, and was able to tolerate oral feeds without significant nausea, vomiting, or postprandial abdominal pain. |
A 57-year-old Hispanic woman was admitted with nausea, vomiting and weakness of 1 week duration. She described herself to be in good health but had not seen a doctor for 15 years. Her history was only significant for pregnancies and visits to the emergency room for epistaxis 3 years prior to admission and after a fall 6 years prior to admission. She used no routine home medications and she had no known drug allergies. She has 3 children in good health. She denied smoking and the use of alcohol or illicit drugs. Her father died from malignancy, type unknown. Physical examination on admission was normal except for pallor. Initial laboratory findings are presented in table .\nThe patient was started on hemodialysis on admission and was transfused with 2 units of packed red blood cells for severe anemia. Urinalysis was positive for microscopic hematuria, and the patient had positive urine M spike with faint κ light chain on serum immunofixation (table ). Renal biopsy on day 4 of admission was consistent with chronic sclerosing pauci-immune glomerulonephritis (fig. ). Neither immunofluorescence nor electron microscopy showed evidence of an immune-mediated glomerulonephritis. ‘Burnt-out’ pauci-immune crescentic glomerulonephritis was therefore diagnosed.\nFurther investigations to evaluate myeloma showed a negative bone survey and bone scan. Initial bone marrow biopsy showed monoclonal plasmacytosis (12%) consistent with plasma cell myeloma. There was no evidence of increased blasts, monoclonal B-cell or aberrant T-cell process. The patient was eventually discharged home with hematology/oncology follow-up and remains on outpatient hemodialysis. She was started on high-dose dexamethasone a few days after discharge and bortezomib 1.3 mg/m2 twice weekly after hemodialysis approximately 1 month after discharge.\nShe was readmitted 3 months later with fever and symptoms of upper respiratory tract infection and was treated with antibiotics. The immunological investigations were repeated because of the rarity of multiple myeloma presenting with pauci-immune crescentic glomerulonephritis. These studies again demonstrated low IgG, IgA and IgM. However, repeat serum protein electrophoresis showed no M spike, and serum immunofixation showed a polyclonal pattern. Repeat free κ/λ ratio was now 10.25. Bone marrow aspirate Congo red stain was negative for amyloid deposits. C-ANCA and P-ANCA were again both negative. Spot urine protein was 834 mg/dl, the urine creatinine concentration was 24 mg/dl, the urine albumin concentration was 35 mg/dl and the urine protein/creatinine ratio was 35. The urine protein electrophoretic pattern was consistent with mixed glomerular and tubular proteinuria. A repeat bone survey showed mild generalized osteopenia, but it revealed no focal lesions. A follow-up bone marrow biopsy after 4 months of bortezomib and dexamethasone therapy showed a normocellular marrow without increased plasma cells. She continues to require hemodialysis despite reduction of the free light chain burden and disappearance of monoclonal plasma cells in the bone marrow. |
The second case involves a 30-year-old Deaf, Hispanic male who presented to the Emergency Department after his mother reported that the he was behaving oddly and not taking his risperidone. Per reports, the patient was talking to his mother about going places in a UFO and exhibiting disorganized and illogical behaviors. He was subsequently placed under a Baker Act by the emergency room physician who documented that the patient was exhibiting auditory hallucinations. Initially an interpreter was brought to the hospital prior to his admission. Per the ASL-interpreter, the patient stated that he felt “fine and not crazy” and that all of these events are happening because his mother does not “understanding Deaf culture.” He also conveyed that he did not like to take his meds because they interfered with him being able to drink alcohol and caused drowsiness.\nUpon initial psychiatric interview an interpreter was not present as the hospital only agreed to set periods of time for the interpreter. As an effort to communicate, questions were prepared for the patient to answer via written responses. highlights a portion of the questions and answers that were constructed. From the responses he maintained bizarre delusions but denied current SI, HI, or AVH. When the ASL-interpreter arrived, the patient appeared jovial and yearned to express himself. The interpreter stated she had difficulties reading his rapid signing at first and had to have him slow down several times. However she did note that this was a common occurrence when addressing Deaf individuals.\nWith the interpreter's assistance, the patient was answering questions logically with a linear thought process. He reported that he had been diagnosed with schizophrenia as a teenager after having several interpersonal issues with his mother. She is Spanish speaking only and he stated that she has never fully understood how to communicate effectively with him. He had been taking risperidone for several years but was tired of continuing with the medication due to the side effects of drowsiness and weight gain, which he was never able to fully discuss with his psychiatrist. Patient reported he was in an ASL school and learning a career in massage therapy. After meeting a girlfriend there he began to develop a sense of independence that he reported his mother disapproved of. This caused an altercation that he reports his mother misinterpreted which precipitated his admission.\nThe patient continued to express that he was abducted by aliens as a child and could understand their language, but besides this he expressed no other psychotic processes. He was observed for two days without medications and remained calm/cooperative but was unable to participate in most activities due to limitations of the interpreter availability. After a family session was completed the patient was discharged home with plans to follow up with his community psychiatrist. The patients' diagnosis was changed to delusional disorder upon his discharge. |
A 50-year-old male who had a past medical history of HIV with unknown cluster of differentiation 4 (CD4) lymphocyte count and not compliant with his medications was brought in by emergency medical services (EMS) after he was found in his room covered in feces and looking disheveled. They brought him to Brookdale University Hospital and Medical Center emergency room. His initial vital signs showed a temperature of 100 ºF, blood pressure of 143/91 mmHg, heart rate of 105 beats per minute, respiratory rate of 20 per minute. He was noticed to have disseminated, vesicular-pustular rash all over his body at different stages of healing and crusted skin eruption on his anterior neck and submandibular area (Figures -).\nPatient’s neurological exam revealed that he was alert and oriented to self only, had a right-sided upper and lower facial droop. The patient also had impaired hearing on the right side. The muscle strength was 5/5 throughout. The patient had normal reflexes and the sensation was intact. The remainder of his physical exam did not show any other abnormal findings. Computerized tomography of the head without contrast showed no acute intracranial pathology. Subsequently, the patient had a lumbar puncture done in the emergency room which revealed a cloudy cerebrospinal fluid (CSF) with a white blood cell count of 849 cells/uL with lymphocyte predominance (72%), glucose of 39 mg/dl and protein of 364 mg/dl. Serum electrolytes, liver enzymes, and coagulation profile were all within normal limits. CSF sample was sent for a varicella-zoster polymerase chain reaction (PCR) test as well. His chest X-ray was clear without any infiltrates. His initial laboratory investigations are summarized in Table .\nA presumptive diagnosis of disseminated VZV with encephalitis was made according to the patient's skin lesions and CSF analysis. Therefore, he was started on intravenous acyclovir at 10 mg/kg every eight hours and admitted to the general medical floor under contact and airborne precautions. Patient’s varicella zoster PCR from the CSF sample came back positive. Patient mental status improved rapidly within 48 hours of treatment and he became alert and fully oriented. On eye exam, the patient had diplopia with right gaze, and it was determined that he had a right sixth cranial nerve palsy. He had deficits in right sided cranial nerves VI, VII, and VIII evident by impaired right eye abduction, right sided facial weakness, as well as impaired hearing. This constellation of findings is likely secondary to Ramsay Hunt syndrome with multiple cranial nerve involvement. Intravenous acyclovir was continued, and the patient started taking prednisone 50 mg orally for five days for the treatment of Ramsay Hunt syndrome. He was also found to have otitis externa and was prescribed ciprofloxacin with dexamethasone otic drops. Magnetic resonance imaging of the brain without contrast found nonspecific white matter lesions in the high left frontal lobe measuring approximately 8 mm but otherwise no mass, hemorrhage, or acute infarct (Figure ).\nThe patient’s mental status came back to his baseline on day three. The patient’s rash had crusted on day six hence the isolation precautions were discontinued. He started ambulating without any difficulty and facial paralysis resolved by day eight. He was safely discharged home after nine days of hospital stay with oral acyclovir 400 mg tablets three times daily for 21 days and prednisone 50 mg tablets daily for three days. |
A 68-year-old female patient presented with a severe case of peri-implantitis of the fixture in position 23 (). The patient is a non-smoker and has a good health condition. In this case it was necessary to approach the lesion with open-flap debridement. A relief incision was made in zone 22 and another in zone 24 in order to open a flap. The implant was surrounded by chronically inflamed tissue and showed a severe three-dimensional bone loss around the fixture, in particular of the vestibular alveolar bone (). This was probably caused by problems on the implant-abutment connection since the abutment was not perfectly engaged. The first step of the procedure was to debride the exposed implant using diamond burs to smooth and polish the surface (). In this case, a Teflon curette was also used to further polish and finish the surface. After this important step, a wash of 10 vol. hydrogen peroxide (3%) was applied, followed by a rinse with a physiological solution to remove all traces of debris and a hydrogen peroxide solution. HYBENX® was applied on the implant surface for 30 s () and then rinsed properly with physiological solution (). Post-operative instructions are to use a 0.2% Chlorhexidine rinse twice daily for two weeks, 800 mg of Ibuprofen for pain at the time of need, and 1gr of Amoxicillin twice daily for a week. The patient did not complain of any particular post-operative pain in the days after the treatment. After 3 months, it was not necessary to repeat the application of HYBENX® because there were no signs of inflammation (). The patient was followed for up to one year after treatment and a repeat treatment was not necessary as there was still an improvement in the condition of the mucosa and alveolar bone around the implant. Bone regeneration is also visible on the intraoral X-ray (). |
A 19-year-old female with acute developed abdominal pain of 7 hours duration was referred to our hospital from a local clinic. Abdominal contrast-enhanced computed tomography (CT) that was performed at the local clinic revealed jejunojejunal intussusception owing to a solitary polyp (). She had no specific past medical, surgical, or familial history. Her vital signs were stable. On examination, the abdomen was mildly distended, but rigidity and rebound tenderness were not clearly elicited. All laboratory findings were within the normal range. There was no evidence of definite bowel obstruction in the plain abdominal X-ray taken in our emergency department. Abdominal ultrasonography (US) was performed to evaluate the current status of intussusception. There was still long segmental small bowel intussusception with a target sign at the left periumbilical area (). We decided to perform an emergent operation.\nWe used a 12 mm supraumbilical port for the camera. 5 mm ports were placed in the right mid- and lower quadrants of the abdomen (). A jejunojejunal intussusception was found to be approximately 20 cm distal to the ligament of Treitz. The intussusceptional segment was approximately 50 cm in length. The involved bowel was dilated, but there was no evidence of bowel ischemia or perforation. Laparoscopic intracorporeal reduction with blunt graspers was performed cautiously. We palpated the remaining small bowels to the terminal ileum using laparoscopic instruments, showing no other masses or abnormalities. Afterwards, a 5 cm extension of the vertical incision was made along the supraumbilical port site, through which the small bowel was exteriorized. The large solitary luminal protruding polyp was located in the jejunum (). Approximately 10 cm of jejunum including the polyp was resected. An end-to-end anastomosis was created by the hand-sewn method. The anastomosed jejunum was placed back into the peritoneal cavity. The extensional incision site was closed. A drain was inserted near the anastomosis site in the pelvic cavity. The total operation time was 137 minutes.\nThe pathologic report indicated a solitary hamartomatous polyp, measuring 6 cm in maximum diameter (). Microscopically, the polyp showed cystic dilation and hyperplastic glands with inflammatory stroma, which were consistent with a juvenile polyp (). Since the anastomotic bowel was dilated and edematous during the operation, we advanced the patient's diet slowly. The patient was discharged on the seventh postoperative day (POD) without complications. Three weeks after the operation, the patient underwent gastroduodenoscopy, colonoscopy, and small bowel series with double-contrast barium. These examinations revealed no specific findings. |
A 68-year-old female with a history of hypertension and diabetes presented to the emergency department (ED) with complaints of left visual field hallucinations. The symptoms had begun four days ago. She reported, “if I look to my left, I see my dog, but I know he is not there.” The patient also reported seeing her deceased mother only in her left visual field. She stated that if she looked to her right, she no longer saw the hallucinations. She denied any motor or tactile sensory deficits. Patient’s neurologic baseline otherwise was awake, alert and oriented with no focal motor or sensory deficits. The patient did report right upper lid droop since her elective bilateral blepharoplasty one month ago.\nExam revealed an afebrile patient with a normal heart rate at 66 bpm, elevated blood pressure of 197/99 mmHg and oxygen saturation of 97% on room air. Visual acuity showed OD: 20/40, OS: 20/60. The patient was an overall well appearing female, awake and alert in no acute distress. Her exam was unremarkable other than pertinent findings in the eye and neurologic exam. Eye exam showed bilateral pupils equal, round and reactive to light. Extraocular movement was intact however mild right-sided ptosis was noted, reportedly chronic per patient secondary to recent blepharoplasty. Patient’s neurologic exam revealed an awake, alert and oriented patient to person, place, time and purpose with structured, linear mentation. All cranial nerves were intact and no dysmetria was noted. No sensory deficits or motor deficits were found on examination in all four extremities. The patient was noted to have visual field loss in the left peripheral field.\nEvaluation in the ED included a complete blood count, coagulation studies, troponin and alcohol level which were within normal limits. Both glucose and potassium were minimally elevated. Patient’s chest X-ray demonstrated no active disease and electrocardiogram showed a normal sinus rhythm with no arrhythmias or signs of ischemia. Evaluation also included neuroimaging (Figure ).\nComputed tomography (CT) of the brain/head demonstrated mild underlying volume loss, right posterior infarction, which was not present previously, either sub-acute or old. CT showed no evidence of intracranial hemorrhage, other obvious acute event or vascular calcification. As noted in the exam, the patient did have a slight left-sided visual field loss that she previously had not noticed. However, upon questioning she did note that over the past month when changing lanes to the left while driving she noticed she had to turn her head further to the left to see her blind spot but disregarded this at the time.\nOur patient's case was discussed with a consulting neurologist at a tertiary center where the patient was ultimately transferred for further evaluation of her new and persistent symptoms. MRI was performed upon admission at the tertiary center (Figure ) and showed an acute infarct in the right medial posterior occipital lobe in the right posterior cerebral artery territory. The patient's discharge diagnosis was a right occipital infarct and Charles Bonnet syndrome upon discharge from the tertiary center. Unfortunately, patient follow-up and progression of disease is unknown. |
A 58-year-old man was admitted to a local hospital because of fever, dyspnea, and cough with expectoration. His chest radiograph showed bilateral consolidation of the lungs, which was suggestive of pneumonia; therefore, he was started on antibiotic treatment. Since his oxygen saturation continued to decrease, he was intubated and kept on a ventilator. After a week of hospitalization, oxygen saturation still could not be maintained with mechanical ventilation. He was then transferred to Hallym University Sacred Heart Hospital for veno-venous extracorporeal membrane oxygenation (ECMO) treatment. We performed a respiratory viral panel test, which led to the diagnosis of acute respiratory distress syndrome (ARDS) due to influenza A pneumonia. After a few weeks of treatment with awake veno-venous ECMO, the levels of inflammatory markers normalized, and his general condition improved. However, he could not be weaned from ECMO due to post-infectious pulmonary sequelae. A chest computed tomography scan on the 67th day after admission showed extensive ground glass opacities and diffuse bronchiectasis in both lungs (). Bilateral lung transplantation was performed on the 84th day of hospital stay. In the operation, an arterial cannula was inserted into the ascending aorta and 2 cannulas of veno-venous ECMO were connected and used as a venous cannula to convert the setup to central veno-arterial ECMO. The ischemic time of the right donor lung was 3 hours and that of the left donor lung was 4 hours and 56 minutes. After anastomosis finished, weaning from ECMO was attempted, but the patient’s blood pressure was not maintained even with sufficient inotropes and fluids due to decreased heart function. Eventually, a single arterial cannula was inserted into the femoral artery to change central veno-arterial ECMO into peripheral ECMO, and the operation was completed. Induction therapy with methylprednisolone (500 mg) was administered intravenously. An immunosuppressive regimen consisting of tacrolimus (target therapeutic range, 5–14 μg/mL) and mycophenolate mofetil (1,000 mg/day) was started after transplantation. Due to bleeding owing to coagulopathy after surgery, he was re-operated on days 1 and 2 after transplantation. Thereafter, sedatives were stopped, and we waited for the patient to regain consciousness. However, even 3 days after the second operation for bleeding control, he was unresponsive and showed no movement of the upper and lower extremities except for spontaneous pupil and eye movement. Deep tendon reflexes of the patient’s limbs were absent, and a nerve conduction study was performed to investigate the cause. The results were suggestive of sensory-motor polyneuropathy (motor-dominant demyelinating neuropathy) (). Cerebrospinal fluid testing was not performed due to the patient’s poor general condition and bleeding tendency. No electrolyte abnormalities or other causes were found. Guillain-Barré syndrome (GBS) was diagnosed based on its typical clinical manifestations. We started intravenous immunoglobulin therapy (IVIG) and plasmapheresis, which are the conventional treatments for GBS. Bronchoscopic toileting was performed regularly for effective lung care. As the treatment progressed, mild recovery of facial muscles was seen, but the patient died 24 days after surgery due to progression of ARDS and sepsis.\nThe patient’s spouse provided written informed consent for the publication of his clinical details and images. |
A 32-year-old female with a history of hyperthyroidism status after radiation resulting in hypothyroidism and no history of seizures presented with an acute onset of behavioral changes and witnessed seizure activity. Family history is remarkable for thyroid disease in multiple relatives, but negative for seizure or psychiatric disorders. Behavioral changes included uncontrolled laughter, screaming, signs of agitation, spitting on the floor, complete lack of appetite, and speaking in a British accent. A further history revealed that the patient is of Caucasian descent, was born in Germany, moved to the United States when she was a baby, and has no ties to Britain.\nShe had two seizures both involving tongue biting and postictal confusion with combative behavior. Her workups for seizures, including but not limited to head CT, urine drug screen, and electrolyte levels, were all within normal limits. She, as well as her family, refused MRI and subsequently was discharged on levetiracetam for new onset seizures. On the fourth day of illness (DOI), the patient was admitted to a local community hospital with continued behavioral changes, where an MRI and lumbar puncture (LP) were found to be unremarkable, with a WBC count of 1 cell per mm3. Other CSF parameters include a RBC count of 10 cells per mm3, glucose of 53 mg per dL, and protein of 26 mg per dL. She was subsequently transferred to our hospital care on the fourteenth day of illness because of persisting and worsening behavioral changes. Upon revisiting the initially unremarkable impression of the MRI, abnormal T2 flair hyperintensity in the mesial temporal lobes was noted, with left lobe hyperintensity greater than that of the right lobe (). These features raised suspicion for limbic encephalitis.\nTiters for serum anti-NMDAR and paraneoplastic antibody panel were sent on clinical suspicion. Video EEG () showed frequent focal onset electrographic seizures from the left frontocentral and left frontotemporal region. Some of these electroclinical seizures showed delta brushes (). With strong clinical suspicion for an anti-NMDAR or paraneoplastic antibody related encephalitis, before even receiving antibody titer results, the patient was started on five-day IV steroids on the fourteenth DOI, and IVIG course started on the fifteenth DOI.\nAt this point, multiple differential diagnoses were being considered including autoimmune encephalitides. During hospital admission, the patient continued to remain afebrile. Repeat LP showed lymphocytic pleocytosis, with a quantitative value of 54 cells per mm3 with 98% lymphocytes, after which she was started on empiric acyclovir until HSV PCR was later confirmed to be negative. All other CSF findings were insignificant, with a normal protein level of 16.8 mg per dL, no RBCs, and an elevated glucose level of 95 mg per dL. She continued to have seizures requiring Lacosamide followed by an addition of Lamotrigine. On the fifth day of IVIG course and twentieth DOI, NMDAR antibody was found to be positive in the serum. CT of the chest, abdomen, and pelvis showed no evidence for neoplasms and a transvaginal ultrasound was negative for ovarian teratoma. CSF was positive for NMDAR antibody with a titer of 1:64. After completion of IV steroids and IVIG, there was no significant clinical improvement. She was started on rituximab on DOI 27 for a total of 4 weeks given weekly, with subsequent clinical improvement in addition to no clinical seizures on EEG and resolution of her new onset British accent.\nThe patient continued to have subclinical focal seizures, catatonia, and orofacial dyskinesias with subsequent gradual improvement in her behavior at discharge. When seen for follow-up as an outpatient, she still was found to have some residual memory and cognitive processing deficits. The patient continues to follow up in the hospital for rituximab infusions which is controlling her anti-NMDAR encephalitis and she has now returned back to baseline health. |
A 14-year-old 3.5 kg female spayed strictly indoor domestic shorthair cat was admitted to the Small animal clinic, Veterinary faculty Ljubljana, Slovenia, for evaluation of a facial skin lesion of approximately two weeks duration. The history and general physical examination were unremarkable, except for a small superficial autotraumatic skin lesion in the right mandibular region (ventrally at the level of the right mandibular canine tooth). A brief dermatologic examination of the cat revealed no other abnormalities of the skin or coat and no evidence of ectoparasites. The right rostral mandible appeared swollen. On a brief oral examination, several missing teeth, a severely mobile right mandibular canine tooth and moderate generalized plaque, calculus and gingivitis affecting the remaining of the teeth were noted.\nInformed consent was obtained from the client to perform a detailed oral and dental examination under general anesthesia with dental radiographs and biopsy, as indicated. A basic preanesthetic bloodwork panel was within normal limits (Table ). The three-view thoracic radiographs were unremarkable and other diagnostic imaging procedures (e.g., CT scan) were declined by the owner. The detailed oral and dental examination revealed swelling and palpable instability of the rostral mandibles with severe mobility of all of the mandibular incisor teeth and the right mandibular canine tooth. No excessive probing depth, gingival recession or any other soft tissue lesions were diagnosed for any of the teeth (Fig. ). Several teeth were missing, gingivitis was present on all of the remaining teeth and tooth resorption of various stages was diagnosed at several of the remaining teeth. The dental radiographs of the rostral mandibles are presented in Fig. . The mandibular lymph nodes were palpably within normal limits.\nBased on the clinical and radiographic features, an aggressive process, such as osteomyelitis or cancer, was suspected, and a biopsy was recommended. The oral cavity was rinsed with a 0.12% chlorhexidine solution, and left and right inferior alveolar nerve blocks were performed with 0.2 ml of 2.5 mg/ml levobupivacaine prior to performing a professional dental cleaning. A full-thickness triangular flap was created to remove the remnants of the right mandibular canine tooth and to obtain soft tissue and bony samples for histopathology (Fig. ). The flap was sutured back in place with 5–0 resorbable monofilament suture material, and other dental treatments were postponed pending the biopsy results. The cat was discharged from the hospital with oral meloxicam (0.1 mg/kg/day), which was to be administered once daily until the re-check examination.\nThe incisional biopsies that were collected for histopathology were fixed in 10% buffered formalin, embedded in paraffin, sliced into 4 μm sections and stained with hematoxylin and eosin stain. Samples containing a large amount of bony tissue were decalcified with OSTEOMOLL® (Merck Millipore) before further processing.\nThe histopathological examination of the biopsies revealed an infiltrative lesion, composed of islands and cords of oval to polyhedral cells, which exhibited marked anisocytosis and had lightly eosinophilic, nongranulated cytoplasm and round to oval nuclei with moderate anisokaryosis and one to two prominent nucleoli. The mitotic index was 20 mitotic figures per 10 high power fields. Some of the neoplastic cells were binucleated or trinucleated. Foci of dyskeratotic neoplastic cells were evident, but true keratinization was not present. There was a moderate amount of fibrous stroma, which was multifocally infiltrated with lymphocytes. The neoplastic cells infiltratively grew into the surrounding bony tissue, but no blood or lymph vessel invasion was noted (Fig. ).\nAdditionally, immunohistochemistry was conducted on formalin-fixed, paraffin-embedded tissue sections to confirm the epithelial origin of the neoplastic cells. Mouse monoclonal antibody raised against human cytokeratin (clone MNF116; Dako, Glostrup, Denmark), which was diluted 1:100, was used for the immunolabelling. The antigen retrieval was performed by microwave treatment at medium power (550 W) for 20 min in a 0.1 M citrate buffer (pH 6.0). The remaining immunohistochemical procedure was performed using a previously described protocol []. Sections of normal feline skin were used as a positive control, and sections not treated with primary antibodies served as a negative control. Immunohistochemically, a moderate to marked positive cytoplasmic reaction for cytokeratin was observed in almost all of the neoplastic cells (Fig. ).\nA two-week re-check examination revealed progression of clinical signs with a more pronounced mandibular swelling. Soft tissue proliferation at the biopsy site and hemorrhagic oral discharge were present at this time. The client declined further procedures and elected palliative pain medications. Five months after the initial presentation, the client elected humane euthanasia of the animal due to the rapid deterioration of its health. An extensive oral lesion was found on necropsy (Fig. ) and the mandibular lymph nodes were mildly to moderately enlarged. No other tumors were detected elsewhere in the body. Histopathology revealed multiple islands of carcinomatous cells bilaterally in the mandibular lymph nodes, but no other primary tumor or metastases were discovered. |
A fit and healthy 12-year-old white boy (height 150cm, weight 40kg) underwent elective removal of a 2×2cm benign skin lesion from his anterior abdominal wall. He had no past medical history and was not on any medications. His physical examination preoperatively was normal. Surgery was scheduled for the late afternoon. He was fasted for 6h for solids and 2h for clear fluids. The World Health Organization surgical checklist for safety in the operating room [] was complied with intraoperatively, which included the prohibition of jewellery and other constrictive clothing items worn during surgery. After establishing intravenous access with a 22-guage cannula in a vein in the cubital fossa of his left arm, anaesthesia was induced with propofol (140mg) and fentanyl (50ug). A size 3 classic laryngeal mask was inserted for airway management, and spontaneous ventilation was maintained with 1 minimum alveolar concentration sevoflurane in a 50% oxygen to air mixture. Five millilitres of a local anaesthesia solution (lignocaine 2% with 1:200,000 adrenalin) was injected into the surgical area for local anaesthesia and postoperative analgesia. During surgery both of his arms were positioned by his side in a neutral position, supported by foam padding on the operating table to minimise pressure. The abdominal lesion was removed uneventfully and the procedure took 22min. Continuous electrocardiography, pulse saturation monitoring, and intermittent blood pressure measurements every 3min were normal. After uneventful emergence from anaesthesia, the laryngeal mask was removed, and he was transferred to the postoperative recovery unit for a 30-min observation period. He was haemodynamically stable, with normal arousal to voice and command. He required no further analgesia and was transferred to the ward at 1830 hours. On the ward his observations remained stable. After a light meal and when completely conversant and cooperative, he was discharged home under parental supervision.\nHe presented with his parents to the emergency department the following morning complaining of severe pain, paraesthesia and weakness of the right hand. A clinical examination revealed a circumferential wristwatch pressure imprint over his anterior and posterior distal right forearm (Figs. and ), as a result of sleeping with his wristwatch on. His hand was erythematous, swollen and painful to touch. There were complete sensory and motor deficits involving his right hand in a glove and stocking distribution from the wristwatch pressure imprint distally, including involvement of all five digits. A neurological examination showed inability to differentiate cooling and heat, sharp and dull, and there was a deficit in 2-point discrimination in the radial, median and ulnar nerve root distributions, most severe in the territory of the superficial cutaneous branch of the radial nerve. In addition there was complete motor deficit in the median, radial and ulnar nerve distributions.\nHe was admitted to the overnight short stay unit where his hand was elevated. A non-steroidal anti-inflammatory analgesic (ibuprofen 400mg) was prescribed 8 hourly for analgesia. Movement of his left hand was encouraged, and over the following 12h the oedema and erythema resolved completely, with complete return of motor function. After 18h, the sensory deficit had also completely recovered. In view of the rapid neurological recovery, quantitative nerve function assessments, for example nerve conduction studies, were not performed. He was discharged home and reviewed 24h later at the surgical out-patients clinic where his hand function examination remained normal. |
A 9-year-old girl presented at the Emergency Department for SCH following a distortion of the right arm occurred in horse fall. She was admitted 1 h after the event complaining of severe pain, swelling arm, and numbness of the fingers. At physical examination, the hand was hypothermic and pulses were not palpable. Vascular examination showed good capillary refill but no flow at arterial Doppler ultrasound scan was detected. An X-ray documented a Gartland IIIB fracture (). The patient underwent a closed reduction of the fracture and percutaneous pin fixation. At the end of the procedure, the arterial pulses did not reappear. To rule out any vascular injury, arterial Doppler ultrasound was performed demonstrating brachial artery interruption at the fracture level associated with an intramural hematoma; an external hematoma compressing the artery, that could have been drained cutting lacertus fibrosus, was not identified.\nWith a percutaneous right common femoral arterial approach, digital subtraction angiography (DSA) was performed, showing occlusion of the distal brachial artery, with recanalization of the ulnar and radial arteries immediately below the bifurcation (). The occlusion was crossed with two 0.014ʺ guide wires positioned in the ulnar and radial arteries, respectively, to protect the bifurcation. A 3 × 28 mm BVS (Absorb; Abbott Vascular, Lakeside Drive, Santa Clara, CA) was released in the distal brachial artery (), followed by remodeling with a non-compliant 2.5 × 20 mm balloon catheter to solve residual in-stent stenosis (). The final angiography confirmed correct positioning and patency of the stent with restoration of distal flow (). The stenotic part was interpreted as a spasm of the artery and we decided to not treat it. At the postoperative ultrasound scan, the stenotic part was not detected anymore. A regular sphygmic pulse appeared on radial and ulnar arteries.\nThe arm was maintained with a 130° posterior splint for 40 days after surgery, to avoid complete flexion of right arm. After 40 days, cast and pins were removed. The child was submitted to physiotherapy for 3 months after the accident, avoiding rapid movement of the right arm to protect the stent. After hematological consultation, a dual antiplatelet therapy (aspirin 100 mg/die and clopidogrel 75 mg/die) was administrated for 24 months and a single antiplatelet therapy (only aspirin) for further 12 months. A Doppler ultrasound scan performed 46 months after the procedure showed regular patency of the brachial artery ().\nPatient and her parents provided written informed consent for information and images to be published as case report. |
A 27-year-old woman presented at the Accident and Emergency Department after a motor vehicle accident. She was reluctant to move her neck in any direction due to pain but was neurologically intact. She also complained multiple facial lacerations, epistaxis, and cerebrospinal fluid rhinorrhea. Plain radiography showed a fracture through the base of the odontoid process (). Computed tomography (CT) scans confirmed the posterior oblique fracture but showed that the displacement was minimal. Magnetic resonance imaging showed an intact transverse ligament. The patient was also diagnosed with left frontal epidural hemorrhage and multiple facial bone fractures involving the frontal sinus, nasal bone, and left zygomaticomaxillary bone.\nAfter undergoing plastic surgery for the multiple facial bone fractures, the patient underwent anterior odontoid fixation surgery conducted by the senior surgeon using a single 4.5×40-mm cannulated lag screw(Synthes PA, USA) 8 days post injury. Postoperatively she was neurologically intact and radiographic imaging showed good alignment of the odontoid process.\nA week later, the patient complained of a sore throat and dysphagia. Erythematous neck swelling was visible on the surgical wound. A neck CT showed significant fluid collection with rim enhancement in the right lateral neck and retropharyngeal area at the level of C5-6 (). Ultra-sonography-guided aspiration of pus was done twice. The pus was cultured and a methicillin resistant Staphylococcus aureus was isolated. The patient was placed on intravenous vancomycin 1 g two times a day for a month. Thereafter, she recovered completely, as indicated by clinical and radiographic examinations ().\nRadiographic imaging for anterior odontoid fixation was performed on discharge and 3, 6 and 12months postoperatively: it consisted of plain radiographs of the cervical spine in the anteroposterior and lateral projections with flexion and extension views and fine-cut CT scans with sagittal reconstruction. Radiographic union at the fracture site was obtained 3 months after surgery. A trabeculation across the fracture site and absence of movement was demonstrated by flexionextension lateral radiographs. The screw placement was considered to be excellent. There was no evidence of instrumental failure until 12 months after surgery ().\nNearly 3 years after surgery, the patient presented at a local ENT clinic with a 2-month history of dysphagia and the sense of a foreign body in the throat. These symptoms started after the patient had suffered from severe paroxysmal coughing due to influenza for a month. Laryngoscopy identified the head of the odontoid screw. Plain radiography showed that the head of the screw had migrated into the pharyngeal soft tissue (). Flexion and extension radiographs did not detect motion at the fracture and indicated maintenance of the postoperative alignment. CT scans confirmed fusion of the odontoid fracture.\nThe patient was prepared for possible combined spine and otolaryngology intervention. The plan was to first attempt screw removal using forceps during suspension laryngoscopy, and if that failed, a neurosurgical anterior approach would be undertaken. Fiber-optic endotracheal intubation was performed while the patient was conscious. After induction of general anesthesia, a suspension laryngoscopy showed the screw head was surrounded by granulation tissue in the vallecular fossa. The screw was found to be movable and was easily removed by using small forceps under laryngomicroscopy (). A suture was not necessary. Flexion and extension films of the cervical spine showed no abnormal movement. The dysphagia and neck pain resolved shortly after the removal of the screw, and the patient was discharged the day after surgery. |
A 74 year-old Caucasian female never-smoker initially presented with a pleural effusion and was diagnosed with invasive adenocarcinoma following a pleural biopsy. The pleural biopsy performed revealed dense fibrous tissue with invasive adenocarcinoma with mucin production and associated psammomatous calcifications. The patient was initially treated with carboplatin, paclitaxel, and bevacizumab with good response, and she continued on maintenance bevacizumab for four years after diagnosis. Subsequently treatment was switched to pemetrexed but had to be stopped due to secondary fatigue and failure to thrive. Molecular (EGFR/ALK) testing was carried out on tissue procured from the initial right pleural biopsy. Using this sample with 35 % viable tumor tissue, the patient was found to be both EGFR wild-type and ALK-negative by FISH.\nChest computed tomography (CT) scan showed that the patient had marginal progression of her right pleural rind along with slow progressive growth of right chest wall nodule. She also received palliative radiation to her right chest nodule at this time. In year six, a re-biopsy was carried out on the chest wall skin, and the results indicated the presence of a well differentiated adenocarcinoma, with mucinous features. Immunohistochemistry stains were positive for nuclear thyroid transcription factor-1 and negative for estrogen receptor and progesterone receptor, which were consistent with a lung primary tumor. The tissue obtained was analyzed by NGS to identify potential actionable mutations. NGS testing results (Foundation Medicine, Inc., MA) indicated that the tumor was ALK-rearrangement positive for EIF2AK3-ALK fusion, and the patient received crizotinib treatment for 19 months. The patient responded well to crizotinib in the first 12 months of treatment (Fig. ), with significant interval decrease in the pleural based tumor, mediastinal lymphadenopathy, and subcutaneous metastatic deposits. Continued decreases in the size of nodules associated with the right pleural-based tumor, mediastinal lymphadenopathy and subcutaneous metastatic deposits was seen, followed by stable disease until 16 months into treatment, when CT showed disease progression. This manifested as an increase in right diaphragmatic pleural-based masses, an increase in right lateral chest wall tumor, and an increase in subcarinal lymphadenopathy (from prior study). 18 months after the start of crizotinib treatment, another CT scan showed a significant response (this was the last CT scan while on crizotinib treatment), with significant interval decrease in size of diaphragmatic pleural-based masses and minimal interval decrease in pleural thickening as described above. Despite the patient’s overall pronounced response to crizotinib, the treatment was eventually discontinued due to disease progression and gastrointestinal adverse events of Grade 3 nausea and vomiting.\nTreatment with orally administered ceritinib at a starting dose of 450 mg/day was initiated two months after crizotinib treatment ended. This ceritinib dose was administered with food; meals were generally relatively bland and small in size (taken three times a day), and red meat and spice-free. Ceritinib treatment is being well tolerated, and no gastrointestinal adverse events (nausea, vomiting, or related bowel problems) have been reported to date. Proactive treatment regimens have been reported as effective in the management of gastrointestinal AEs in patients taking ceritinib [], but regimens of this type were not required for this patient, who was treated with ceritinib 450 mg/day with food, and are not currently considered necessary for her future treatment. Overall, the patient has reported suffering from minimal side effects with the exception of some bloating and rhinorrhea. The patient has also shown a good response to ceritinib, as demonstrated by CT scans (Fig. ), and treatment is currently ongoing. There was no central nervous system (CNS) involvement. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.