text
stringlengths 746
31k
|
|---|
A 20-year-old female presented to our center with a telangiectatic osteosarcoma of the humerus. There was no history of malignancies within the family.\nMRI examination and open biopsy were performed by the previous physician. At the time the results were thought to be malignant lymphoma. After several diagnostic trials, the patient visited our center to seek advice about her telangiectatic osteosarcoma (A).\nWe observed a circumferential mass on the distal part of the right arm with a slight deformity of the arm, with marked venous engorgmnt and distal edema. The mass was warm and solid on palpation. Function of the right hand was still preserved. From the laboratory findings, there were marked elevation of the alkaline phosphatase and lactate dehydrogenase. From humerus X-ray, there was mixed lesions along the humerus with pathological fracture on the midshaft (A). T2-weighted MRI showed iso-hyperintense and expansile lesions along the humerus (A). For the metastatic workup, chest X-ray showed no coin lesions or metastatic characteristics. Patient also had a PET scan and the result was unremarkable. From the Clinico Pathological Conference (CPC) forum, it was concluded that the diagnosis was osteosarcoma of the right humerus stage IIB according to the Enneking classification.\nPatient took neoadjuvant chemotherapy regimen with Doxorubicin and Cisplatin for three cycles from January to March 2016. At the end of the third cycles, clinical and radiological evaluations were performed. Clinically the mass was not getting bigger compared to before chemotherapy (B). From x-ray, the mixed lesions became more marked compared to the previous x-ray (B). MRI showed that the mass was slightly became larger compared to the previous MRI with no involvement of neurovascular bundle (B).\nSix months after the initial complaint, the surgery was performed. We used extensive deltopectoral approach with anterolateral extension through the proximal part and curved backward to complete the posterior distal humerus and elbow approach. This approach was used because of the previous biopsy tract was in the posterior aspect of the distal humerus. The vascularity, rotator cuff tendons, biceps and triceps muscle, and majority of the nerves (musculocutaneous, radial, median, and ulnar nerves) were spared during the total resection of the humerus. Axillary nerve was sacrificed during the tumor resection. To reconstruct the humerus, both long shoulder hemiarthroplasty and total elbow prostheses were used. These two prostheses were joined using two long one-third tubular plate that worked as the long stem augmentation. Extension cerclage wire was used to make the implant as one unit (A). Finally, the stem was augmented with a bone cement from proximal through the distal. Prolene mesh then was sheathed to the bone cement, and then the preserved rotator cuff tendons and biceps and triceps muscle were sutured back with the Ethibond sutures (B). The resected tumor and humerus were then sent to the lab for histopathologic analysis (C).\nFrom the post-operative x-ray, the modified prosthesis sat well on the shoulder and elbow joint (). Function of the hand was excellent post-operatively. Patient also could immediately flex her elbow. Post-operative histopathological examination showed telangiectatic osteosarcoma with HUVOS IV (). After the wound healed without complication, patient underwent adjuvant chemotherapy. Two months after the surgery, patient could start writing with her right hand without marked difficulties. Further follow up of three years post-operatively, patient already came back to work and were able to perform daily activities without difficulties. Patient’s shoulder abduction and elbow flexion was shown on the pictures (). The MSTS functional score for the upper limb scored 83% which was excellent. There were no post-operative complications and the immunohistochemical workup used to rule out lymphoma (CD20, CD15, CD 30, and CK) would be planned. |
A 17 years old, right handed woman presented with a 7 months history of progressive right wrist pain which was not relieved by conservative treatment. There was no history of trauma. Examination revealed a painful swelling over the radial aspect of the right wrist (). Movements were slightly restricted by pain. Extension of the hand was reduced to 15°, flexion to 20°.\nHand X-ray revealed the demineralization of a giant scaphoid (). T1 weight led coronal MR images before and after administration of gadolinium showed an intraosseous mass, with partial erosion of the scaphoid; coupled to homogeneous low signal intensity on the T1 weighted image and high signal intensity on the T2 weighted with heterogeneous signal (, ).\nA biopsy was then performed showing, macroscopically, a cavity containing a spongy bone and a reddish soft fabric. Microscopy revealed a proliferation of well differentiated osteoblasts, numerous giant cells and a moderately developed conjonctivo-vascular fabric. The diagnosis of osteoblastoma was then retained.\nSynovectomy of the extensors; associated to the excision of the posterior capsule and the mass was performed; allowing for complete exposure of the carpus. In view of the aggressiveness of the lesion, complete excision of the proximal carpal row was performed (including the pisiform), followed by a thorough synovectomy and removal of the yellowish soft tissue mass infiltrations. As the capsulectomy-carpectomy had rendered the wrist completely unstable, a tendon transfer using the extensor carpi radialis brevis was performed to provide stability. The wrist was finally immobilized in a short arm plaster cast for six weeks.\nHistologic examination of the scaphoid showed a lesion consisting mainly of a benign osteoblastic proliferation. A large osteoblastic nidus was seen, formed by irregular trabeculae of osteoid that were encircled by numerous osteoblasts with dystrophic nuclei. A large number of osteoclasts were also present. There were no suspected signs of malignancy, especially osteosarcoma. The final diagnosis of osteoblastoma was retained.\nOne week postoperatively, the patient was practically pain-free. After removal of the plaster a rehabilitation program was started. Three months postoperatively her progress was already very satisfactory; the wrist was completely pain-free and stable. The range of movement was: dorsiflexion 25°, palmar flexion 20°, ulnar deviation 15°, radial deviation 10°, with full supination and pronation. The treatment continued with further physiotherapy and intermittent splinting. Due to the possibilities of recurrence the patient was advised on the need of a long-term follow-up. |
A 45-year-old woman with a history of open Fobi-Capella RYGBP was diagnosed with primary biliary cirrhosis and listed for LT. Bariatric surgery was carried out seven years before, followed by an emergency reintervention for obstruction of the jejunojejunostomy. Hepatopathy was diagnosed at 41 years of age. The patient presented Ig G antibodies for cytomegalovirus and a negative viral DNA detection by quantitative PCR. There were no other relevant comorbidities.\nShe was admitted to the emergency department with melena and hematochezia. Physical examination revealed hypotension, paleness, icterus and a pain-free abdomen without ascites. Her Model for End-Stage Liver Disease score was 33. The patient did not smoke, consume alcohol to excess or use nonsteroidal anti-inflammatory drugs, acetylsalicylic acid, or proton pump inhibitors. The Helicobacter pylori (HP) status was unknown, nor it was investigated. The patient was clinically managed with intravenous crystalloids, blood borne products transfusion, PPI and ciprofloxacin. The upper endoscopy was negative and the abdominal Doppler ultrasound showed signs of portal hypertension with patent hepatic vessels. Six days after admission, deceased donor LT was carried out without perioperative complications.\nThe postoperative immunosuppression regimen consisted of prednisone, tacrolimus and mycophenolate sodium. The prophylactic antibiotics consisted of amikacin and ampicillin until postoperative day (POD) 2 and ivermectin on PODs 2 and 3; sulfamethoxazole was introduced on POD 8. Acetylsalicylic acid and prophylactic low molecular weight heparin were suspended from POD 3 to POD 7 because of anemization without signs of bleeding. Low molecular weight heparin was reintroduced at therapeutic dose because of the thrombosis of a branch of the right portal vein. On POD 7 hepatic biopsy was performed due to elevation in liver enzymes. Moderate acute cellular rejection was diagnosed and treated with pulse therapy of methylprednisolone. Proton pump inhibitors were administered throughout the hospitalization. On POD 14 the patient developed an acute abdomen. An abdominal computed tomography scan with intravenous contrast showed a pneumoperitoneum with foci of free air next to the stomach and free abdominal fluid in small quantity ().\nAn emergency laparotomy was performed and a perforated ulcer of the body of the excluded stomach was found and repaired by simple closure. The ulcer was not resected for pathological examination. On POD 16 routine quantitative PCR for cytomegalovirus DNA was positive (41UI/ml 1,62 log (UI/ml)), but did not require antiviral therapy nor reduction in the immunosuppressive regimen. Prophylactic unfractioned heparin was administered from POD 16. Culture of the abdominal liquid collected intraoperatively showed positive for extended spectrum beta-lactamase producing Klebsiella pneumoniae and Enterococus faecium. Antibiotic treatment consisted of vancomycin, meropenem and fluconazol. The patient was discharged on POD 26 with immunosuppressors, sulfamethoxazole, proton pump inhibitors and prophylactic low molecular weight heparin, the latter being discontinued ten days after this.\nDuring follow-up, PCR for cytomegalovirus DNA showed negative results six weeks after discharge. Proton pump inhibitors were continued on double dose. Seven months after discharge, the patient underwent a double-balloon enteroscopy exploration of the excluded stomach - the second reported after a PU perforation in the gastric remnant. Because of the enteroenterostomies created after the RYGBP, it was impossible to reach the excluded stomach. Pathological examination of biopsies from the gastric pouch and the alimentary limb was negative for inflammatory alterations, cytomegalovirus or HP. Three years after transplantation, the patient remains well undergoing routine outpatient evaluation. |
A 62-year-old Caucasian male with a past medical history of hypertension and diabetes, presented with bilateral eye protrusion since 1 week. He had been experiencing double vision and throbbing frontal headaches for the past 2 weeks. Physical examination was remarkable only for bilateral exophthalmos [], without any palpable lymphadenopathy. Magnetic resonance imaging (MRI) of the orbit revealed 3.8 × 3.0 × 1.5 cm enhancing orbital mass involving the lateral and superolateral aspect of the peripheral right orbit as well as an irregular 1.1 × 1.1 × 2.4 cm mass along the inferior aspect of left orbit []. Also noted were abnormal signal enhancements within the lesser sphenoid wing and the anterior body of the mandible on the right. Given this constellation of findings, there was suspicion for lymphoma or other metastatic disease.\nBiopsy of right eye mass was done that revealed extensive soft tissue involvement by two separate lymphomatous populations [ and ], comprising small and large neoplastic lymphocytes. The large cells were positive for CD20 B cells with co-expression of CD10 BCL6 and MUM-1. By corresponding flow cytometry, they were found to be kappa chain restricted. These features were consistent with high grade large B cell lymphoma. The small lymphoma cells were CD20+ B cells with co-expression of BCL2 and aberrant CD43 and partial CD5. Flow cytometry revealed lambda restriction. These morphological and phenotypic features were consistent with MALT lymphoma. B cell immunoglobulin gene rearrangement by polymerase chain reaction (PCR) was done to detect clonality. Peaks migrating at 318, 255, and 274 bases were present on B-cell immunoglobulin heavy chain (IgH). In addition, there were peaks present migrating at 195 and 273 bases on B-cell immunoglobulin kappa light chain (IgK). The intensities of these peaks were consistent with clonal neoplasm. Gene rearrangement studies were also done on the different aberrant lymphocyte population with diagnosis of MALT lymphoma. Those areas also shared common peaks at 318 and 255 bases in IgH as well as 273 bases in IgK light chain.\nMetastatic work-up with computed tomography (CT) scans and positron emission tomography (PET) scan was negative. He was started on Rituximab and cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP). By the time of his 1-month follow-up, the orbital swelling had disappeared []. His lymphoma is currently under remission. Repeat PET is negative for any metastatic disease, and only residual disease is present in the orbit. |
The patient was a 53-year-old woman who was being worked up for an upcoming hysterectomy when a nodule was noted in the thyroid by a preoperative clearance X-ray. Additionally, several small nodules were noted in the lung, mostly in the lung bases bilaterally. A CT scan was subsequently performed, which confirmed the lung nodules and also showed a 3.4 cm hypoenhancing mass in the left lobe of the thyroid with right sided tracheal displacement. The thyroid mass was biopsied by fine needle aspiration and revealed a papillary thyroid carcinoma (PTC), which was BRAF V600E mutation negative. Approximately 5-6 years prior to her death, she underwent a total thyroidectomy for definitive surgical management as well as radioactive iodine ablation (251 mCi of iodine 131) with no uptake noted in the lung lesions. Surgical pathology at that time revealed a 4.3 cm PTC with oncocytic features, focally severe nuclear atypia, and tumor giant cells. These findings raise the possibility of focal anaplastic transformation at the time of initial resection. Additionally, giant cells have also been reported in cases of anaplastic thyroid transformation []. Of note, no extrathyroidal extension was seen at time of resection, margins were negative, and there was no lymph node metastases; however, venous/lymphatic invasion were present. The patient's lung nodules, at that time, were not biopsied and on numerous occasions she was lost to follow-up. Approximately 15 months after thyroidectomy, the patient was noted to have a nonstimulated thyroglobulin level of 134 ng/mL (reference < 0.4). Then three months later a new thyroglobulin level was obtained and was 821 ng/mL (reference < 0.4); however, a radioiodine scan was negative. A PET scan showed findings consistent with intensely metabolically active metastatic disease. This included uptake in the right fossa of Rosenmuller on the left thyroid bed, lymph node masses in the mediastinum, and bilateral hilar and bulky precarinal lymphadenopathy. Numerous intensely avid pleural and parenchymal lung nodules were noted to have increased in size and number compared to the previous CT scan. The lung nodules were biopsied and revealed papillary thyroid carcinoma with psammomatous calcifications and PAX8, TTF-1, and thyroglobulin immunostaining were reported as positive. She also developed an associated malignant pleural effusion, which also was consistent with papillary thyroid carcinoma. The patient was started on sorafenib and 5 months later the medication was changed (to sunitinib) due to progression of disease. Medications were stopped after approximately 10 months due to side effects (significant bone pain). She was admitted to the hospital on numerous occasions after treatment for respiratory symptoms. Her most recent admission occurred 12 days prior to her death for increased shortness of breath and dry cough. During this admission she was found to have a right lower lobe infiltrate and a right pleural effusion with an associated marked increase in her WBC count, which was considered to be of an infectious etiology and was treated with antibiotics. Her thyroglobulin level was noted to be 165 ng/mL (reference < 0.4) at that time. She was transferred to the medical intensive care unit the day before her death due to altered mental status and worsening symptoms where she ultimately died. |
A 61-year-old female with medical history of hypertension, diabetes mellitus type 2, and chronic kidney disease stage V was transferred to our institution from an outside hospital for further evaluation and definitive management of a migrated intracardiac stent.\nShe initially presented to the outside facility with progressive dyspnea on exertion, orthopnea, and bilateral lower extremity edema. She was initially diagnosed with acute heart failure and pneumonia and treated with diuretics and antibiotics. Subsequently, a transthoracic echocardiogram was performed, which revealed a foreign body within the right ventricle. On transfer to our facility, a transesophageal echocardiogram revealed a long stent straddling the tricuspid valve from the right atrium with the other end lodged in the trabeculation of the right ventricle with severe tricuspid regurgitation ().\nOn further investigation, we learned that the patient had undergone peripheral endovascular intervention for May-Thurner syndrome with placement of a self-expanding Nitinol Protege (14 mm × 60 mm) stent to the left iliac vein 6 months prior to presentation.\nA percutaneous endovascular approach with a 35- mm Medtronic-Covidien Amplatzer Gooseneck Snare was initially attempted to retrieve the migrated stent. However, the snared proximal segment fractured, leaving behind 2 stent fragments. After ensuring there was no myocardial perforation or pericardial effusion with intracardiac ultrasound, the patient was referred for surgical extraction via median sternotomy with use of cardiopulmonary bypass.\nDuring the operative procedure, the stent was found to be densely adherent to the tricuspid leaflets and the subvalvular apparatus, with majority of the primary chords to the anterior and posterior leaflets ruptured (). After successful extraction of the stent and native tricuspid valve, she underwent valve replacement with a 29-mm Carpentier-Edwards bioprosthetic valve. Her postoperative course was complicated by hemopericardium secondary to anticoagulation resulting in cardiac tamponade that was drained percutaneously, and small thromboembolic cerebellar stroke from atrial fibrillation. She was discharged to an inpatient rehabilitation facility and did well on 8-month follow-up. |
62-year-old woman with medical history significant for aortic stenosis and chronic atrial fibrillation presented to the emergency department with fatigue and progressively worsening shortness of breath with minimal exertion. She was asymptomatic at rest and denied chest pain, orthopnea, paroxysmal nocturnal dyspnea, leg swelling, presyncope, or syncope. She was incidentally found to have a systolic murmur during her pregnancy 20 years prior to this presentation. Notably, she had been offered aortic valve replacement in the past but declined.\nVital signs were normal with blood pressure of 110/60 mmHg, pulse rate of 79/min, temperature of 97.2°F, and respiratory rate of 16 breaths/min with normal oxygen saturation of 100% on ambient air. Physical examination was significant for irregularly irregular heart rhythm, and ejection systolic murmur was loudest in the aortic area with radiation to the carotids. Her lungs were clear to auscultation, and no pedal edema was noted. Electrocardiogram revealed atrial fibrillation with voltage criteria for left ventricular hypertrophy. Her most recent transthoracic echocardiogram revealed a thickened calcified aortic valve with decreased excursion with 4.6 m/s velocity suggesting a peak of 86 mmHg and mean of 36 mmHg suggestive of severe aortic stenosis. No other significant valvular abnormalities noted. Cardiac catheterization revealed widely patent coronary arteries.\nBased on the presence of worsening symptoms and the risk of sudden cardiac death, the decision was made to proceed with surgical aortic valve replacement. Given her history of chronic atrial fibrillation, she was also planned for left atrial appendage exclusion and Cox Maze IV procedure simultaneously with the aortic valve replacement. Intraoperative transesophageal echocardiogram revealed quadricuspid aortic valves confirmed during surgical exploration (). The native stenotic quadricuspid aortic valve leaflets were excised, and a 21 mm Saint Jude Medical Trifecta valve was implanted. The left atrial appendage was excised, and Cox Maze IV procedure was performed. Postoperatively, she remained in junctional rhythm and underwent uneventful placement of the dual chamber pacemaker on postoperative day 3. She recovered without further complications and was discharged on the eight postoperative day. |
A 27-year-old man underwent surgical intervention for right radial styloid fracture 6 years ago. Several months after the operation, the patient complained of intense and severe burning pain (visual analog scale: 8/10), edema, reduced strength, cold allodynia, and hyperalgesia in the right forearm. He was diagnosed with CRPS type I by a pain management specialist. He underwent a series of right stellate ganglion blocks, which provided minimal pain relief only for the duration of the local anesthetics. The patient was given various medications such as carbamazepine, pregabalin, gabapentin, oxycodone, and fentanyl to manage the pain, but none of medicines provided complete pain relief. Furthermore, treatment by a physical therapist and pain psychologist was also not effective. After struggling with CRPS for 6 years, he was referred to our pain management clinic for SCS insertion. This case report was approved by the Veterans Health Service medical center institutional review board (ID: 2018-09-014). The patient provided written informed consent to have his case details and accompanying images to be published.\nThe results of preoperative laboratory tests, chest radiography, and electrocardiogram were normal. A percutaneous lead trial was performed with a Vectris lead (8-lead array, Medtronics, Minneapolis, MN, USA). The electrode lead was inserted into the cervical epidural space by using the loss of resistance technique. The upper tip of the electrode was positioned to reach the top of the C3 body under continuous fluoroscopy. The lead of spinal neurostimulator was located at the midline of the C3 body (). In the testing of electrodes, complete coverage for the right arm was achieved with the stimulation of the second and third lead. After completing the first stimulation trial, the patient’s pain intensity improved from 8 to 4 on the visual analog scale. In addition to the pain relief, he could touch cold water without allodynia.\nOn postoperative day (POD) 1, his right arm pain aggravated and paresthesia from spinal cord stimulation was now experienced in the left instead of right arm. We tried stimulation of various electrodes to relieve the patient of his left-arm paresthesia, but to no avail. On cervical radiography, it was difficult to find the change in the lead location.\nAt POD 3, a second SCS trial was planned to relocate the lead. The permanent SCS lead was located to the right side of the C3 body to ensure right arm stimulation. The permanent lead was connected to an external pulse generator using an extension cable. After the second stimulation trial, the paresthesia from spinal cord stimulation was only achieved at the right arm of the patient from the stimulation of the second and third lead. At POD 4, he complained of minor inability to focus on nearby objects, but there was no specific problem observed in any physical and neurological examination. Further evaluation for myopia was postponed after SCS implantation. The effectiveness for pain relief between the first and second trial was similar.\nOn POD 6, a surgery for permanent implantation was performed under local anesthesia ( and ). The extension cable was removed, and a permanent lead was connected with implantable pulse generator (IPG, RestoreSensor SureScan MRI, Medtronics) buried under the skin of the right subclavicular area.\nOn POD 7, the patient developed right-sided meiosis and ptosis (). There was no other neurological abnormality such as mental change, headache, motor weakness, or sensory abnormality. He was hemodynamically stable. His pupil size was 3 mm (right) and 5 mm (left) with normal light reflexes. He was diagnosed with Horner’s syndrome based on his clinical examination findings.\nBased on the location of the stimulation lead (C3), the stimulation of superior cervical ganglion was suspected to be the cause of Horner’s syndrome. The stimulation lead was moved from the second and third to the third and fourth leads, respectively (). After stimulation lead change, Horner’s syndrome disappeared in 24 hours (). No further invasive evaluation was required. His final SCS program was 0.5–1 V for voltage, 130 Hz for frequency, and 330 µs for pulse width. |
A 4-year-old girl was admitted to our hospital for history of intermittent fever and nonproductive cough of 1-month duration. The mother reported a history of choking with seeds 3 weeks before the onset of symptoms. She had no other associated symptoms. The family history was relevant for leukemia from the paternal side. On physical examination, the patient was active, not in distress with diminished breath sounds along the left lung. The rest of physical examination was unremarkable. A chest radiograph showed complete collapse of the left lung (). Laboratory investigations showed a white blood cell count of 23000/mm3 with 73% of polymorphonuclear cells and 17% lymphocytes, hemoglobin 10 g/dL, hematocrit 30.5%, and platelets 543,000/mm3. CRP was 8.5 mg/dL (negative < 0.3). The purified protein derivative (PPD) test was negative.\nRigid bronchoscopy revealed a small part of seed surrounded by a grayish-white polypoid mass adherent to the bronchial wall and completely obstructing the orifice of the left main stem bronchus. Removal of the foreign body and excision of the surrounded polypoid mass were performed. The chest X-ray done after bronchoscopy showed almost complete expansion of the left lung (). However, five days later, the patient started to develop high grade fever with persistence of cough. Repeat chest radiograph showed again complete collapse of the left lung. CT scan of the chest with IV contrast revealed complete obliteration of the mid left main stem bronchus by an ill-defined hypodense/enhancing lesion, causing obstructive changes in the left lung with near complete collapse and mediastinal shift to the left with air bronchogram at the base. There were small scattered lymph nodes, subcarinal and left superior mediastinal (13 × 18 mm). The right lung was clear with no pleural or pericardial effusions.\nThe biopsy specimen taken during bronchoscopy revealed a mixture of tubules and solid areas. The tumor cells were large with round normochromic, often clear central nuclei. They vary from bland clear columnar mucinous, goblet cells to cuboidal expressing CKAE1/3, CK7 diffusely, and CEA focally. Anti-Ki67 was expressed in 10% of the nuclei. P63, CK5/6, CD34, and HMB-45 were absent. Consequently, the diagnosis of low-grade mucoepidermoid carcinoma was confirmed. Complete resection of the mass with bronchotomy and end-to-end anastomosis was undertaken through left posterolateral thoracotomy incision. The regional bronchopulmonary lymph nodes were also removed. The lung expanded after the anastomosis. Intraoperative frozen section analysis revealed tumor-free margins. No metastasis to lymph nodes was observed. Fluorescence in situ hybridization (FISH) confirmed the presence of MAML2 rearrangement. The postoperative course was uneventful. The patient was discharged home 8 days after surgery. Repeat bronchoscopy was performed 2 months after surgery and showed no recurrence of the tumor. Follow-up bronchoscopy after 6 months showed no recurrence. |
A 3-month-old male was seen in our pediatric oncology department because of a growing parotid gland mass. The mass was congenital and was followed by the pediatric oncology team with a prediagnosis of hemangioma. The patient’s magnetic resonance imaging (MRI) scan showed an infantile hemangioma in the proliferative phase filling the parapharyngeal space ().\nThe child then received propranolol therapy, but despite this treatment the mass continued to grow, and the child was referred to our department at the age of 10 months. The otorhinolaryngological examination revealed an 8×7-cm mass filling the left parotid region, with normal facial nerve motor functions (). Histopathological diagnosis of the mass was provided by an incisional biopsy as sialolipoma.\nWe planned to perform total excision of the mass with a transparotid approach. The facial nerve was monitored intra-operatively, and surgery was performed under magnification using surgical loops. A standard modified Blair incision was used, flaps were raised (), then the facial nerve was identified in a standard fashion using a tragal pointer and posterior belly of the digastric muscle as landmarks.\nThe main trunk of the facial nerve was found to be unusually elongated before pes anserinus. A soft lobular mass was encountered. A tumor involving the superficial parotid lobe was first dissected, then the deep lobe of the parotid gland and portion of the tumor filling the parapharyngeal space were gently dissected under the facial nerve (). A Jackson-Pratt drain was inserted into the wound after the excision of the tumor.\nOn macroscopic examination, the mass was found to be a lipomatous specimen, 9×8×4 cm in size. The cut surface was consistent with the appearance of a lipoma. Histopathologic examination confirmed the diagnosis of a sialolipoma. The lesion was composed of mature adipose tissue mixed with acinar, ductal structures of a normal salivary gland ().\nThe postoperative period was uneventful. The patient’s facial nerve motor functions were well preserved, and he was discharged on the third postoperative day. The patient is still followed, and has no signs of recurrence in his 24th postoperative month. |
Patient 2, a 40-year-old male, was referred to an outside hospital due to severe headaches and vomiting lasting 7 days. Physical examinations showed no obvious abnormality. MRI showed a lesion at the right parieto-occipital lobes (). Gross tumor resection was executed on December 26, 2014. The postoperative histopathology of the tumor was diagnosed as glioblastoma multiforme (WHO grade IV; ). Immunohistochemistry examination revealed the following: MGMT (−), Ki-67 30% (+) and P53 (+). RT was rejected by the patient after surgery, and only TMZ (200 mg/m2 on days 1–5, repeated every 28 days) chemotherapy was executed. After six cycles of TMZ chemotherapy, the patient developed left limb weakness, dizziness and headaches. MRI showed tumor recurrence at the primary location (). Resection was performed again on July 3, 2015, and the result of the postoperative histopathology remained the same. The patient was referred to our hospital as a result of severe headaches again at 43 days postsurgery. MRI showed a recurring nodular enhanced lesion in the front edge of the operative cavity (). This was considered as the second tumor recurrence. IMRT of 60 Gy in 28 fractions combined with concomitant TMZ (75 mg/m2/day for 40 days) was executed 52 days after reoperation. The headaches gradually subsided during the treatment. MRI after the combined therapy procedure showed that the nodular lesion shrunk and the edema also subsided. However, the patient’s headaches and left limb weakness reappeared at 3 weeks after the treatment. MRI showed that the previous lesion and periphery edema had obviously increased again (). Through consultation with a multidisciplinary team, the patient was clinically diagnosed with a third tumor progression. Bevacizumab targeted therapy was recommended; however, the patient refused this recommendation due to financial reasons. He decided to accept apatinib therapy on November 3, 2015, and signed the informed consent. Thus, apatinib 500 mg daily was administered to this patient. The symptoms of headaches and limb weakness were gradually relieved after medication. MRI at 4 weeks of medication showed partial response of the recurrent lesion and periphery edema (). The patient had grade 3 hand–foot skin toxicity and grade 2 stomatitis during the medication. Therefore, the dosage of apatinib was halved (250 mg daily) in order for him to continue and the toxic reactions subsided to some extent after symptomatic treatment. MRI after 12 weeks of medication still revealed partial response of the lesion, and the half dosage of apatinib was continued in maintenance therapy. Thereafter, MRI was performed every 3 months and indicated no disease progression. The patient had a progression-free survival of 12 months until a new lesion in the contralateral parietal lobe was found. He is still alive with clear consciousness, although he has developed severe bilateral limb weakness. |
A 28-year old woman was free climbing with her boyfriend near Gunnison, Colorado. Both were wearing a helmet and a harness for safety. The girl had 20 years of experience of rock climbing, being taught early tricks by her father at the age of 8 years. The ascent consisted of three pitches of 90-100 feet (ca. 30 m) each. The climbing distance was defined by the climbing rope which had been fixed at a defined length. The girl took the lead on the third pitch, to a total height of 300 feet (ca. 90 m). After securing the anchor at that height, the rope - which was lacking a security knot - slid through her harness. She then fell a total of 300 feet, with a first impact at 200 feet onto a flat rock surface, and a further fall for about 100 feet. Based on this falling height, the velocity at the time of impact is estimated around 75-80 mph. Her boyfriend witnessed the entire fall, climbed back down and provided first aid at the scene. The patient was awake and moaning, but not responsive to verbal or painful stimuli. She was intubated at the scene and transported to a local level IV trauma center, where she was resuscitated and transfused with 4 units of packed red blood cells (PRBC). Due to ongoing hypotension and transfusion requirements, a decision was made for transfer to our regional level 1 trauma center. On arrival, the patient was intubated and sedated. She was hypotensive, with systolic pressures in the 80s. She was successfully resuscitated with crystalloids and blood products, using a standardized institutional massive transfusion protocol with point-of-care thrombelastography-guided resuscitation [,]. The patient was managed according to the ATLS guidelines for initial assessment and management, and by our institutional "damage control" protocols, including the initial spanning external fixation of femur shaft fractures [,] and a proactive "spine damage control" approach [].\nThe patient sustained the following combination of injuries:\n• Blunt chest trauma with sternal fracture, bilateral hemo-/pneumothoraces, bilateral pulmonary contusions, right 1 and 2 rib fractures, left 9-11 rib fractures.\n• Blunt abdominal trauma with grade 3 liver laceration, grade 2 splenic laceration, and a devascularized right kidney.\n• Mild traumatic brain injury.\n• Rotationally unstable flexion/distraction injury at T6 (AO/OTA type 52-C2.1) with traumatic spinal cord transsection and complete paraplegia ASIA grade A below T6.\n• Unstable L1 burst/split fracture (AO/OTA type 53-A3.2).\n• Unstable pelvic ring injury with bilateral SI-joint disruption, bilateral L5 transverse process fractures, bilateral pubic rami fractures, and left-side transalar/transforaminal Denis type 2 sacral fracture (Young-Burgess type LC-3, AO/OTA type 61-B3.3).\n• Right femur shaft fracture (AO/OTA type 42-A3.2).\n• Right type IIIA open talar body fracture (AO/OTA type 81-C3) and associated posterior facet calcaneus fracture (AO/OTA type 82-C2)\n• Left comminuted joint-depression type calcaneus fracture (AO/OTA type 82-C3).\nThe injury pattern of bilateral lower extremity fractures and of the pelvic ring injury are shown in Figure .\nThe chest trauma was managed by placement of bilateral chest tubes. The patient responded well to initial resuscitation and remained normotensive and well oxygenated, with a blood pressure of 115/80 mmHg, heart rate of 82/min, and 100% SO2 on 0.6 FiO2. She was taken to the operating room for "damage control orthopaedics" (DCO) procedure with unilateral spanning external fixation of the right femur fracture, surgical debridement of the open talar fracture with primary wound closure, and spanning external fixation of the right ankle in a delta-frame. The contralateral comminuted calcaneus fracture was placed in a well padded bulky Jones splint. The patient was then transferred to the surgical intensive care unit (SICU) for further resuscitation. The physiological response to resuscitation during the first 72 hours is depicted in Figure .\nAn MRI of her C-/T-/ and L-spine was obtained the next morning which documented a traumatic spinal cord transsection at the level of the rotationally unstable T6 flexion/distraction injury (Figure ). She was taken the same day for preliminary spinal fixation as a "spine damage control" procedure []. This included a posterior spinal fusion from T4-T8 with laminectomy and spinal canal decompression at T6, as well as posterior spinal fusion T12-L2. The patient tolerated the procedure well and was brought back to the SICU in stable conditions. She was mobilized with physical and occupational therapy on day 1, and placed on low molecular weight heparin for DVT prophylaxis. The intraabdominal injuries were managed non-operatively.\nOn day 2, she was taken back to the operating room for stabilization of the pelvic ring injury using bilateral "triangular osteosynthesis" with lumbo-pelvic fixation from L4 to the ilium, and placement of bilateral 7.3 mm cannulated sacro-iliac screws through a safe surgical corridor []. On day 3, an IVC filter was placed due to the high risk constellation for a thromboembolic complication.\nThe patient recovered well from her injuries and from the "damage control" procedures. She was extubated on hospital day 4, and was successfully weaned to room air (Figure ). She remained fully awake and alert, with a GCS of 15. She had a normal neurological function to bilateral upper extremities, but lack of sensory function below T6, and complete paraplegia to bilateral lower extremities. On day 5, she was taken back to the operating room for locked intramedullary nail fixation of the right femur shaft fracture (Figure ), removal of the spanning external fixator, and cannulated lag screw fixation of her right talar body fracture.\nThe patient had an excellent recovery and was mobilized into a wheelchair with physical and occupational therapy. On day 13, she was taken back to the operating room for completion 360° fusion T5-T7 and T12-L2, with anterior corpectomy of T6 and L1 vertebral bodies, anterior spinal canal completion decompression, and placement of two titanium expandable cages and bone grafting (Figure ). This procedure was performed through less-invasive left-side posterolateral approaches, including a transthoracic approach to T6 and a retroperitoneal approach to L1 (Figure ). This less invasive technique was shown to be well tolerated by patients and allow early functional rehabilitation without restrictions [-].\nThe patient had an uneventful further recovery. All surgical wounds healed well, and there were no postoperative complications. At that time, X-rays of her multiple orthopaedic injuries were obtained, which showed early signs of uneventful fracture healing (Figure ). She was transferred to our neurorehabilitation unit on hospital day 18. The patient remained flaccid below the level of lesion related to the T6 ASIA grade A complete spinal cord injury. She remained in spinal shock until approximately 6 weeks after trauma. She also showed some general processing and impaired short term memory deficits related to her mild traumatic brain injury. Nerve conduction studies confirmed the notion from MRI imaging, in that there was no secondary neurologic conus injury due to the L1 burst fracture which may have further complicated her bowel and bladder management. The applied spinal and pelvic fixation techniques facilitated her mobilization without adjunctive truncal bracing. The initial efforts for self-care and mobilization, however, were complicated by orthostatic hypotension, nausea and anxiety felt to be multi-factorial in etiology. The weight bearing precautions to the lower extremities were discontinued around 9 weeks post injury, based on progressive callus formation seen on follow-up X-rays (Figure ). The patient quickly progressed to independent transfers. Her cognitive processing improved to essentially normal. The IVC filter was removed prior to discharge. She was transferred to her local community regional spinal cord rehabilitation center out-of-state at 2½ months after injury in excellent conditions, for completion of her neurorehabilitation program. |
A 60-year-old male experienced one month of escalating bifrontal headaches refractory to analgesics and antibiotics prescribed for presumed sinusitis. The headaches increased during sneezing, bending over, or bedrest and improved when he was sitting or standing. There was no history of trauma. His prior medical history was notable for hypertension and hyperlipidemia. There was no family history of coagulopathy or thrombophilia. He was married, employed, used 0.5 packs of tobacco (7.5 packs/years), consumed alcohol socially, and did not use any illicit drugs. His vital signs were notable for sinus bradycardia with a heart rate of 39 and elevated BP of 184/86 mmHg. He had no other significant findings on physical examination; detailed neurologic examination was unremarkable. Routine admission laboratory studies were within normal limits. Coagulation studies including platelet function assays were normal.\nNoncontrasted head CT demonstrated a 19 mm left isodense SDH with 10 mm of midline shift []. The collection was more prominent in the frontal region. A CT angiogram was obtained prior to surgery, and no source of bleeding was identified. He underwent a mini-craniotomy; and repeat CT imaging after the procedure [] demonstrated excellent hematoma evacuation and brain reexpansion.\nA scheduled follow up head CT obtained on postoperative day 27 was notable for recurrent SDH with a frontal predilection \n[]. The appearance and location were similar to the initial presentation. He was readmitted to the hospital and underwent SDH drainage via burr hole. On subsequent imaging with MRI, MR angiography, and MR venography, a filling defect was visible in the distal left transverse sinus and no flow was observed in the distal left sigmoid sinus or internal jugular vein. These findings were confirmed on CT venography.\nPatient underwent cerebral angiography on postoperative day 7 after SDH evacuation []. Left carotid injection was notable for a prominent left vein of Labbe with delayed wash-out, a filling defect in the left transverse sinus, and retrograde flow in the left transverse sinus with subsequent drainage into the right transverse sinus. Transvenous catheterization confirmed retrograde drainage of the left transverse sinus and venous stasis in the left vein of Labbe. Manometric readings in the left sigmoid sinus and both transverse sinuses were elevated (18-25 mmHg range). Thrombectomy with the Penumbra device and venoplasty with 7 × 20 mm balloon were performed; 10 mg of systemic abciximab was administered. Follow up venography demonstrated improved flow in the left vein of Labbe, restored normal direction of flow in the sinuses with normalized pressure (11 mmHg) in the left transverse sinus. Daily aspirin (325 mg) was initiated on the day of this intervention; patient was discharged home without neurologic deficits. A follow-up CT venogram at 6 weeks demonstrated patent venous sinuses and no recurrence of his SDH. His 3 month clinical outcome was excellent (modified Rankin score 0). |
An 11-year-old boy was admitted for biopsy of a skin rash and an enlarged axillary lymph node. No family history of autoimmune disease or autoinflammatory disorder was evident, and he had received no blood transfusion or stem cell transplantation. The patient had suffered from recurrent fever since infancy. At one-month old, the patient presented with fever without source, maculopapular rashes, and poor weight gain. Laboratory examinations revealed elevated levels of liver enzymes and C-reactive protein (CRP). Despite a careful examination, however, neither infection nor neoplasm was detected. There was also no evidence of biliary disorder. As the patient was well fed and his general condition was not much affected, he was followed closely as an outpatient, without therapy. Liver biopsy at seven-month old demonstrates features of chronic active hepatitis, with lymphocyte and plasma cell infiltration in Glisson's capsule yet without fibrosis and with a diffuse hepatocyte ballooning pattern.\nPrimary immunodeficiencies including phagocyte disorders, antibody deficiencies, complement deficiencies, and combined T- and B-cell immunodeficiencies [] were refuted through further examinations. Liver markers gradually normalized by age 3, whereas CRP levels remained elevated, and skin rash and fever without source relapsed occasionally. This long-standing fever and elevation of CRP levels without infection or neoplasm were considered possible indicators of autoimmune disease. However, as laboratory findings supporting the diagnosis of autoimmune disease such as positive antinuclear antibody test were not obtained, a definite diagnosis could not be established. At age 4, petechiae developed on the trunk, associated with thrombocytopenia and positive anti-dsDNA autoantibodies. Intravenous pulse steroid therapy was administered and this ameliorated both the clinical and laboratory findings. Petechiae and purpura disappeared and remittent fever resolved. Platelet count increased within normal range and CRP turned negative. The elevation of anti-dsDNA autoantibodies diminished within normal limits at this time. Nevertheless, CRP level rose again soon afterwards. Low-dose oral prednisone (5 mg/day) was commenced, but high-dose prednisone was frequently required when high fever developed. Frequent exacerbations and remissions of erythematous rash were observed all the while. At age 7, investigations for short stature revealed growth hormone (GH) deficiency, and GH replacement therapy was started but showed little effect. At age 9, an extensive differential diagnosis was considered for primary immunodeficiencies, especially infantile onset autoinflammatory disorders [, ] with clinical manifestations even if only slightly consistent with those observed in the patient. This involved genetic testing for conditions including cryopyrin-associated periodic syndrome (C1AS1), familial Mediterranean fever (MEFV), tumor necrosis factor receptor-associated periodic syndrome (TNFRSF1A), and hyper-IgD syndrome (MVK). However, none of these genetic defects was identified. Innate immunity deficiencies were excluded as clinical symptoms of this patient were not consistent with those of defects of innate immunity currently known. The similarity of the patient's clinical course and laboratory findings to those of cGVHD suggested the stable long-term persistence of allogenic cells, that is, mMc. Throughout the course, we observed that persistent fever and elevated CRP often resolved, contrary to expectations, when the patient had symptoms of an upper respiratory tract infection. For a definitive diagnosis, a biopsy of the skin and lymph node lesions was planned.\nOn admission, the patient exhibited markedly short stature (−5.5 SD) unresponsive to GH treatment, hepatosplenomegaly, generalized superficial lymphadenopathy, and urticaria-like rashes. No arthropathy was observed. Laboratory findings revealed anemia (Hb 8.2 g/dL), elevated levels of inflammation markers such as CRP, ESR (79 mm/h), and SAA (563 μg/dL), and hypergammaglobulinemia (IgG 3721 mg/dL). Serum complement levels were normal. Serum levels of IL-6 and B-cell activating factor (BAFF) were elevated at 21.4 pg/L and 3314 pg/mL, respectively. Viral infections such as Epstein-Barr virus, cytomegalovirus, and parvovirus B19 were not identified. Ophthalmologic examination was unremarkable. Thoracoabdominal CT scan showed hepatosplenomegaly and mild systemic lymphadenopathy. Gallium scintigraphy revealed no abnormal accumulation. Bone marrow examination revealed no abnormality. Histological examination of the skin revealed nonspecific inflammation. The perivascular and periappendicular mononuclear infiltration was observed in dermis. That of lymph node showed no increase of plasma cells but of histiocytes and dendritic cells. Epstein-Barr virus DNA and human herpes virus type 8 DNA were not detected.\nHLA typing using nested polymerase chain reaction (PCR) with sequence-specific primer typing revealed noninherited maternal antigens below measurable limits (<0.01%) in circulating lymphocytes. On the other hand, female cells were demonstrated in the patient's skin and lymph nodes by fluorescence in situ hybridization labeling for the X and Y chromosomes (). The percentage of female cells, presumed maternal, was 0.2% of all nuclei examined in the skin and 0.3% of those in the lymph node. Since elevated IL-6 was thought to be important in the pathogenesis, tocilizumab therapy was started. After the first tocilizumab infusion, IL-6 level rose further to 2230 pg/L as expected. Fever resolved, and the levels of CRP and BAFF normalized shortly thereafter. IL-6 level decreased but remained elevated (approximately 200 pg/L). The patient's height did not increase significantly, and the skin lesions persisted after more than 100 infusions. |
The case is about a male infant weighing 3562 grams at 39 4/7 weeks gestation, appropriate for gestational age, delivered vaginally after 11 hours of spontaneous rupture of membrane to an 18-year-old Hispanic primipara woman. Pregnancy history was uneventful; prenatal labs were all negative, except for positive group B streptococcus rapid test; and herpes simplex virus (HSV) IGG antibody . No active herpes genital lesions were present atthe time of infant’s delivery. The mother received adequate treatment for group B streptococcus prior to the delivery of the infant. Amniotic fluid was reported to be moderately meconium stained, and the infant had perinatal asphyxia at birth with Apgar scores of 21, 65, and 910 at 1, 5, and 10 minutes, respectively. The infant was oral and endotracheal suctioned, given positive pressure ventilation, and later orally intubated and placed on mechanical ventilation. Admission diagnosis included severe respiratory distress from meconium aspiration syndrome, perinatal; depression; and suspected neonatal sepsis. Management included intubation, placement on ventilator support, surfactant meconium lavage, surfactant replacement therapy, antibiotics for neonatal sepsis prophylaxis (with ampicillin and gentamicin), and placement of umbilical venous and arterial catheters.\nA size 5-Fr UVC was placed at admission without complication, and the initial position was confirmed to be in the ductus venosus at the level of thoracic vertebrae-T9 (). The infant’s initial blood workup for sepsis remained negative. Respiratory status was improving on the ventilator, with hypoxia and respiratory acidosis resolving, and the infant was weaned to minimal settings, in preparation for extubation by day of life 7.\nOn day of life 6, liver enlargement was noted on a routine abdominal X-ray. Liver enzymes were mildly elevated, and the infant was febrile, but otherwise hemodynamically stable. A presumptive diagnosis of disseminated neonatal HSV infection was entertained, due to past history of HSV in the mother prior to pregnancy, and IGG HSV positive in this pregnancy.The infant was started on Acyclovir, pending HSV polymerase chain reaction results, and blood culture and blood cell parameters were repeated. Antibiotics coverage with Ampicillin and Gentamicin started at birth were continued.\nOn the morning of day of life 7 with the infant on minimal settings on ventilator, the infant’s endotracheal tube was removed and extubated to nasal cannula. Within 6 hours, the infant failed extubation due to upper airway edema from 7 days of being intubated. Also later, failure of extubation was attributed to worsening respiratory status due to progressively increased abdominal girth.\nOn the evening of day of life 7, moderately high liver enzyme was noted on blood chemistry. Also, abdomen with chest X-ray showed paucity of bowel gas and UVC tip at T10 (). UVC had migrated into the liver, with insidious onset of abdominal distension, ascites, liver enlargement, markedly elevated liver enzymes, obstructive uropathy, and progressive worsening of respiratory status.\nBy early hours of day of life 8, abdominal girth had increased by 5 cm over the previous 6 hours, from 36 cm to 41 cm, and there was an increase in liver size, by clinical assessment and radiologically (-). X-ray of chest and abdomen revealed small lung volume, compressed by gasless abdomen, huge liver, marked abdominal distension, and ascites ( and ). Liver enzymes markedly increased from the previous 24 hours, aspartate transaminase from 173 U/L to 929 U/L; alanine transaminase from 82 U/L to 380 U/L (both 5 to 8 times increase from previous); total/D bilirubin 4.1/1.5 g/dL, from previous day’s total bilirubin of 2.7 g/dL; lactate dehydrogenase 1861 IU/L (see ). Abdominal ultrasound and computed tomography done on day of life 8 () confirmed ascites, huge liver with an echogenic mass within it, mild left hydroureter/hydronephrosis and obstructive uropathy, and intrahepatic biliary duct dilatation. TPN extravasation via UVC was suspected, UVC infusion stopped, and UVC was removed. TPN infusate at time of diagnosis had an osmolarity concentration of 1008 mOsm/L.\nA peripheral intravenous (IV) access was obtained and dextrose with electrolytes started. Pediatric surgeon was consulted, and performed exploratory laparatomy, clot removal, ascites drainage and Penrose drain placement in the Peritoneal cavity . Paracentesis confirmed TPN extravasation (peritoneal fluid described as milky and yellow and peritoneal fluid analysis chemistry showed protein 1213 mg/dL; triglyceride 591 mg/dL; glucose 539 mg/dL).\nOn day of life 10, HSV polymerase chain reaction was reported negative, and IV acyclovir was discontinued; repeat blood culture done on day of life 6 was also negative, and so IV ampicillin and gentamicin were also discontinued by day of life 11, when blood culture was final.\nThe infant’s clinical status improved significantly by day of life 10, within 48 to 96 hours of surgically draining the ascites and removal of peritoneal blood clots via exploratory laparotomy. A Penrose drain was placed in the peritoneal cavity, and removed 5 days later, when drainage ceased. The infant required and received two 20 mL/kg of packedredblood cell transfusion during the immediate 24 hours post operation for anemia due to liver laceration and hemorrhage. . Elevated liver enzymes dropped dramatically till normal, hematuria resolved, and Penrose drain was removed by the fifth day postoperative, which was on day of life 13. No sign of disseminated intravascular coagulopathy was noted. Enteric nutrition was started on fourth day postoperative, day of life 12, and attained full enteric feedings 7 days later, on day of life 19. The infant was extubated to room air on day of life 19, and started on nipple feeding, breast and bottle, Similac Advance, all per oral by day of life 25. Clinically and biochemically the liver laceration, liver mass, obstructive uropathy, and ascites resolved, as evident by normal liver and renal function tests at time of home discharge. Abdominal ultrasound done on day of life 27 was normal, except for small residual liver mass, which the pediatrician followed at outpatient. The infant remained in stable clinical condition and was discharge home on day of life 28. |
We describe a case of a 36-year-old black African woman with two previous live births by cesarean section and two previous miscarriages who was referred in her fifth pregnancy after 6 weeks of amenorrhea. Her serum quantitative β-human chorionic gonadotropin (bHCG) was 16,124 mIU/ml. However, an intrauterine or extrauterine pregnancy could not be located on a transabdominal ultrasound scan.\nA copper intrauterine contraceptive device had been removed 2 months prior to her last menstrual period. She reported using one cycle of clomiphene 50 mg with the hope of achieving a twin pregnancy.\nShe had delivered twice by cesarean section for failure to progress. Her last two pregnancies had been first-trimester miscarriages; one was managed expectantly, and the other was surgically evacuated, though the actual procedure was unknown to the patient. She did not have any chronic medical illness and was not receiving any medication prior to this presentation. She stayed in a city suburb that was well serviced. She was a school principal in her second marriage with no children in the current relationship. She did not smoke or drink alcohol.\nOn examination, she had a normal blood pressure of 113/70 mmHg and a pulse rate of 98 beats/min. Her body temperature was 37.5 °C. On examination, her cardiorespiratory and neurological systems were normal. Her abdomen was soft and not tender. The result of her pelvic examination was normal. TVUS showed a gestational sac of 13 mm with irregular margins and a visible yolk sac located on the anterior isthmic portion of the uterus, raising suspicion of a cesarean section scar ectopic pregnancy. She declined a Doppler ultrasound evaluation scheduled for the next day. She was scheduled to have serial bHCG evaluations every 48 h.\nA repeat serum quantitative bHCG done 48 h after the initial test revealed a level of 21,521 mIU/ml, a 33% rise. She defaulted follow-up until 1 week later, when she presented with pelvic pain of increasing intensity for 5 days. An urgent transvaginal scan was performed. A fetal pole with active cardiac activity (crown-rump length 0.9 cm) in a gestational sac was located in the anterior low myometrium. The sac traversed the full width of the anterior myometrium, with the posterior margin of the sac abutting the anterior margin of endometrium and the anterior margin of the sac extending to a subserosal location in a fairly exophytic fashion. There was evidence of trophoblastic circulation on Doppler examination. There was no endometrial fluid or free pelvic fluid (Fig. ).\nShe was immediately admitted for a diagnostic laparoscopy/hysteroscopy and possible excision of the scar pregnancy if confirmed. A preoperative complete blood count showed hemoglobin 13.4 g/dl, white blood cells 7.2 × 103/μl, and platelet count 243 × 103/μl. The patient’s kidney function was normal with sodium 135 mmol/L, potassium 4.9 mmol/L, urea 3.5 mmol/L, and creatinine 65 μmol/L. The patient’s liver function test results were also normal. She had a negative result in a blood test for human immunodeficiency virus. Urinalysis did not show abnormalities. The patient’s random blood sugar was 5.6 mmol at admission. At laparoscopy, the bladder was adherent high on the anterior uterine wall, and the ectopic pregnancy was not visualized (Fig. ). At hysteroscopy, there were extensive adhesions within the lower endometrial cavity, which obscured visibility. There was no active intracavitary bleeding ruling out a threatened or inevitable miscarriage. We could not visualize any obvious bulge in the cervical canal suggestive of a cervical ectopic pregnancy. Because of the uncertainty of the location of the pregnancy due to adhesions, excision was postponed. Postoperatively, the patient became unstable with low blood pressure, systolic pressure range of 82 to 95 mmHg and diastolic pressure range of 40 to 55 mmHg, and a pulse rate range of 64 to 73 beats/min, but without active vaginal bleeding or use of medications inducing persistent hypotension. Anesthesia had been induced with etomidate 16 mg and suxamethonium 100 mg, and maintenance was initiated with isoflurane 0.8–1.5%. Intra- and perioperative analgesia was induced with fentanyl 200 mg intravenously (IV), indomethacin 100 mg rectally, and paracetamol 1 g IV. Antibiotic prophylaxis was with ceftriaxone 1 g IV and metronidazole 500 mg IV. This prompted us to order an urgent MRI scan to map the location of the pregnancy in the immediate postoperative period. MRI confirmed the TVUS findings of a cesarean section ectopic scar extending to the serosa (Fig. ).\nAn emergency laparotomy was then performed on the same day. The abdomen was entered through a Pfannenstiel incision along the old skin scar. A transverse incision was made in the upper uterine segment just above the adherent bladder. The products of conception were removed with forceps, and the gap in the anterior myometrium at the old scar was seen and felt. There was massive bleeding from the implantation site. Twenty milliliters of vasopressin (20 U diluted in 100 ml) in normal saline was administered into the bleeding myometrium edges. The edges were apposed in layers with VICRYL suture (Ethicon, Somerville, NJ, USA) to repair the defect. Estimated blood loss was 2000 ml. The patient was transfused with 1 U of packed cells intraoperatively. She was continued on the same intravenous antibiotics and analgesia that had been commenced after the laparoscopy. Her hemoglobin count on day 1 postoperatively was 8 g/dl, and she declined any further transfusion. Oral iron and folic acid supplementation was commenced.\nThe patient’s postoperative recovery was uneventful, and she was discharged on day 4 after surgery. Histology confirmed the presence of decidua and chorionic villi. The patient wanted a child because she was in a new relationship, but she was no longer sure of her future fertility plans after the ectopic pregnancy. A levonorgestrel implant was inserted 2 weeks postoperatively. The patient last attended physical review at 6 weeks, and she was well with no problems related to the surgery at a telephone review at 3 months postoperatively. |
A 61-year-old right-hand dominant gentleman was referred to our clinic with sudden deterioration bilateral shoulder pain and loss of function. He was a retired ambulance driver with long-standing and established bilateral massive rotator cuff tear and arthropathy (worse on the left). Clinically, he had very limited and painful, active movements bilaterally (30° of abduction and forward flexion, no external rotation and internal rotation to sacrum). He had minimal supraspinatus and infraspinatus power and markedly weakened subscapularis. He was tender over both scapular spines, with significant site mobility and pain on the left side.\nShoulder radiographs, computed tomography (CT) and magnetic resonance imaging (MRI) revealed chronic bilateral massive rotator cuff tears with significant retraction of the supraspinatus and infraspinatus associated with fatty infiltration. There was associated superior migration of the humeral head on both sides with the loss of acromio-humeral space. Bilateral stress fractures of the spine of scapula were noted with the left side being significantly displaced with no evidence of healing []. Dual energy X-ray absorptiometry scan revealed early osteopenia without osteoporosis. The patient had a history of chronic obstructive pulmonary disease (COPD) and suffered from noninsulin-dependent diabetic mellitus.\nAlthough, he initially had severe pain in both shoulders, symptoms in his right shoulder reduced with conservative treatment after 2 months, with diminishing pain and functional improvement. This was further confirmed with X-rays and CT scans showing callus formation and progression to union []. However, his left side remained symptomatic with pain, abnormal mobility at the fracture site, and no radiological evidence of healing []. The patient underwent a successful open reduction and internal fixation of the left scapular spine with 3.5 mm limited contact dynamic compression plate (Synthes) and iliac crest bone grafting. Postoperatively the arm was immobilized in a polysling allowing rotational movements and pendulum exercises for 4 weeks. This was followed by active assisted forward flexion and abduction to 90° for further 2 weeks and a full range of movement exercises as tolerated by the patient after 6 weeks. The fracture progressed to union uneventfully with significant improvement in symptoms and function in his left shoulder []. As the patient's symptoms improved, he refused further treatment and arthroplasty for his cuff tear arthropathy as his level of symptoms were manageable.\nAt the final follow-up at 2 years, the patient was asymptomatic with regards to the scapular spine fractures with reasonably good function []. He was able to drive and managed his activities of daily living well. His Oxford Shoulder Score (OSS)[] was 30 for both shoulders and disabilities of the arm, shoulder and hand (DASH)[] score was 30.8 at the final follow-up. |
A 15-year-old male presented with cough, mucopurulent expectoration, and dyspnea since 3 months. There was history of exacerbation of cough after swallowing. This finding of swallow–cough sequence has been referred to as Ono's sign.[] A chest radiograph revealed complete opacification of the right hemithorax with volume loss suggesting complete collapse of the right lung with mediastinal shift to the right []. A plain and intravenous contrast-enhanced CT study with oral contrast swallow was performed on a 128-slice MDCT scanner (Siemens Somatom Definition AS, Erlangen, Germany). The study revealed complete collapse of the right lung with irregular dilated ectatic bronchi in the right lower lobe []. There was stenosis and diffuse narrowing of the right mainstem bronchus with nodularity of the mucosa seen best on the virtual bronchoscopy []. The right main pulomanary artery (MPA) was narrow in caliber. There was a resultant significant shift of the mediastinum and heart to the right. An air-filled tract was noted extending from one of the right lower lobar bronchi toward the posterior mediastinum with ill-defined soft tissue around it. The possibility of an esophagobronchial fistula was suspected, and we did a CT oral contrast swallow study to detect it. Oral contrast swallow study performed with the patient in right decubitus position using diluted non-ionic iodinated contrast medium (1:20 dilution of iohexol with normal saline). It depicted the site and the fistula tract between the right lateral wall of the esophagus and one of the ectactic bronchi in the right lower lobe of the lung. Thick MIP images and VRT processing demonstrated the fistula site and tract [Figures and ]. Right adrenal gland calcification was also noted. These imaging findings led us to conclude that these changes were most likely the sequelae of chronic tuberculosis. The patient underwent an open right pneumonectomy with repair of the fistula. Histology of the lung specimen revealed distorted bronchioles with diffuse and focal dense infiltration by mononuclear cells and giant cells. Lymph nodes with prominent germinal centers were also seen. |
A 55-year-old woman presented three days after a sudden onset of right-sided chest pain, pleuritic and positional in nature, associated with an acute onset of shortness of breath. She had gone to her primary care physician, who performed a chest X-ray and urged her to come to the hospital. Upon presentation at the emergency department, her oxygen saturation was above 95% on room air, and she was not in any respiratory distress, but her exam was significant for decreased breath sound on the right. A chest X-ray confirmed a large right-sided pneumothorax with small pleural effusion. A chest tube was inserted on the right side for the resolution of the pneumothorax, and subsequent computed tomography (CT) scan of the chest revealed bilateral diffuse bullous disease of the lung with multiple cysts (Figure -). The patient underwent video-assisted thoracoscopic surgery for right thoracoscopic wedge resection of a lung bleb and talc pleurodesis. Gross examination of the specimen revealed several dilated air-like spaces ranging from 0.2 cm to 0.4 cm in size. The hospital course was complicated by postsurgical pneumonia, but she recovered fully and was discharged to home with only minimal symptoms of dyspnea on exertion. Upon further investigations, she was found to have multiple small lesions of angiomyolipoma on the right kidney with diffuse retroperitoneal lymphadenopathy. One of the lymph nodes was biopsied, and pathology revealed predominantly spindle cells positive for HHF35 and smooth muscle actin, consistent with the diagnosis of leiomyoma. At the eight-month follow-up at the pulmonology clinic, her pulmonary function test (PFT) showed normal vital capacity and forced expiratory volume in one second (FEV1), but moderately reduced diffusion capacity, which may also be related to LAM. At her 12-month and 24-month follow-up visits, her PFT results showed improvements in peak flow and diffusion capacity, and the patient continues to report no symptoms other than minimal dyspnea on exertion. |
A 54-year-old white man, who worked as a consultant and spent long hours in front of a screen, presented with a 2-week history of headache. He had hypertension controlled with an angiotensin II receptor blocker. His BMI was 28 kg/m2. He described his headache as heaviness in the occipital area, associated with a foggy sensation and noise sensitivity. He denied any vision changes, weakness or focal neurological symptoms. There was no history of head trauma or strenuous exercise, or of smoking or use of recreational drugs. There was no use of aspirin or any other NSAID for pain control. There was no personal or family history of coagulopathy. The patient reported that the headache had started 12 days after he started using continuous positive airway pressure (CPAP) at night for obstructive sleep apnoea (OSA).\nThe physical examination, including vital signs and a full neurological investigation, was normal.\nIn view of the new onset headache in a patient over 50 years of age, an MRI of the brain without contrast was requested. It showed bilateral subdural collections: a 0.7 cm left chronic subdural haematoma (SDH), and a 1.4 cm right sub-acute/acute haematoma, with effacement of the peri-mesencephalic and suprasellar cisterns (). Investigations for blood coagulation disorders were all negative. A CT scan on day 7 showed stable haematomas, and on day 20 showed persistence of the SDH with a slight decrease in the thickness of the left collection. On day 30, a full spine MRI with contrast ruled out cerebrospinal fluid (CSF) leak.\nSince the patient was stable, he was discharged on prednisone (0.5 mg/kg) for 2 weeks with close clinical monitoring. His symptoms resolved gradually within 10 days. A brain CT performed 4 months after cessation of CPAP use showed complete resolution of the haematomas (), while a brain MRI carried out 30 months later showed no new lesions (). The patient refused to use CPAP again. |
A 64-year-old man who had no symptoms was diagnosed with thoracic superficial esophageal cancer that was detected by screening upper endoscopy. He had a history of hypertension. He had also been found to have a vascular abnormality (DAA) as an adult and was observed in an asymptomatic state.\nPhysical examinations showed no unusual findings, and the laboratory examination data, including tumor markers, such as squamous cell carcinoma-related antigen and carcinoembryonic antigen, were all within normal ranges. Chest X-ray demonstrated a widening in the upper mediastinal silhouette, reflecting the superior right aortic arch. An endoscopic examination revealed superficial esophageal cancer located in the left side of the wall in the upper thoracic esophagus and the invasion of the submucosa (Fig. ). A histological examination of biopsy specimens confirmed the presence of squamous cell carcinoma. Enhanced computed tomography showed a swollen lymph node in the right upper mediastinum, which was diagnosed as metastatic (Fig. ). No distant metastasis was detected. Computed tomography also confirmed the DAA. The right aortic arch was dominant, and the descending aorta was located at the right side of the post-mediastinum, as is common in cases of DAA (Fig. ). The patient was therefore diagnosed with upper thoracic esophageal cancer of cT1bN1M0 Stage IIB (UICC-TNM 7th) and a DAA.\nHe underwent neoadjuvant chemotherapy prior to sub-total esophagectomy with three-field lymphadenectomy. The neoadjuvant chemotherapy regimen was 2 courses of 5-FU (800 mg/m2) and cisplatin (80 mg/m2) every 3 weeks.\nWe planned to perform radical subtotal esophagectomy with three-field lymph node dissection after neoadjuvant chemotherapy. We first planned to perform cervical procedure in a supine position before the thoracic procedure in order to identify the bilateral inferior laryngeal nerves and avoid causing them injury or inducing palsy. We also planned to perform upper mediastinal lymph node dissection during this preceding procedure because the DAA was expected to interfere with upper mediastinal dissection attempted via either side of a transthoracic approach. We then planned to perform lymph node dissection via a left-thoracoscopic approach below the left aortic arch, as we worried that the right-sided descending aorta might interfere with a right-thoracic approach (Fig. ). The laparoscopic procedure was planned to be performed via an abdominal procedure in a supine position. Reconstruction would use the gastric tube pulled up via the retrosternal route with cervical esophago-gastric anastomosis.\nIn the preceding cervical procedure performed in a supine position, we identified the bilateral inferior laryngeal nerves, which were thought to be recurrent at each side of the aortic arch (Fig. ). After upper mediastinal dissection was performed, the left thoracoscopic procedure in a prone position was performed for middle and lower mediastinal lymph node dissection below the left aortic arch. We first confirmed that the right-sided aortic arch and descending aorta would interfere with the usual right thoracic approach (Fig. a). Upper mediastinum dissection was also deemed impossible via a bilateral thoracic approach because of the bilateral aortic arches and subclavian arteries, as expected preoperatively (Fig. a, b). Postmediastinal reconstruction also seemed impossible. The port position for the left thoracoscopic procedure was set symmetrically to our normal right thoracoscopic procedure for middle to lower mediastinal dissection, as shown in Fig. . No major anatomical findings other than those noted preoperatively were observed during the left thoracoscopic procedure. We were unable to identify where the thoracic duct ascended because of the preservation of the thoracic duct. We were also unable to confirm the details concerning both recurrent laryngeal nerves around each aortic arch.\nThe abdominal procedure in a supine position was performed laparoscopically with the simultaneous cervical procedure for bilateral supraclavicular lymph node dissection. Reconstruction was performed with cervical esophago-gastric tube anastomosis. The gastric tube was pulled up through a retrosternal route as planned. Three-field lymph node dissection and complete resection (R0) were achieved. The operative time was 8 h 9 min, and the total bleeding was 70 ml. No vocal cord palsy was observed on flexible laryngoscopy after the operation.\nThe patient’s postoperative course included minor leakage that was cured conservatively after 2 weeks, and he was discharged at postoperative day 29. The pathological diagnosis was ypT1bN0M0 Stage IA (UICC-TNM 7th edition). The patient was followed for 2 years with no signs of cancer recurrence. |
A 21-year-old man presented with acute vision loss immediately following his own finger gouging of his right eye while accidentally falling down during jogging. Visual acuity was counting fingers at 1 meter in the right eye and 20/20 in the left. The left eye was normal. A relative afferent pupillary defect was noted in the right eye. Intraocular pressure was 12 mmHg. Slit-lamp examination revealed a subconjunctival hemorrhage affecting the temporal aspect of the right eye. The cornea and lens were intact and clear. Dilated fundus examination revealed peripapillary subretinal hemorrhages and vitreous hemorrhage most prominently in the inferior vitreous cavity. Mild peripapillary edema and choroidal folds were observed. Fluorescein angiography revealed the masking of fluorescence due to intravitreal hemorrhage around the optic disc []. The patient was treated with a 20-day course of tapering systemic steroid (prednisolone, 64 mg, peroral). Subsequently, vitreous hemorrhage settled and partial ONA at the lower half of the optic disc was recognized 20 days after the injury [].\nMagnetic resonance imaging (MRI) of the orbits showed intact optic nerve bilaterally. But focal contrast enhancement was observed at the right optic nerve.\nFor structural evaluation, optical coherence tomography (OCT; Stratus OCT, Carl Zeiss Meditec, Dublin, CA) was performed after one month from the injury. Cross-sectional vertical scan from inferior to superior quadrant of the optic disc with OCT signal strength 7 revealed deep cavity at the inferior-temporal half [Fig. and ]. Circumpapillary scan showed thin inferior retinal nerve fiber layer (RNFL) with a thickness of 96 microns with respect to OCT normative database in the thickness profile graph and quadrant analysis []. RNFL thickness of the fellow eye was 133 microns for the inferior quadrant, 81 microns for the temporal quadrant, 150 microns for the superior quadrant, and 94 microns for the nasal quadrant. The analysis with the comparison to the normative dataset showed a borderline thin RNFL at the 7:00 position in the clock hour analysis and at the inferior quadrant []. Circumpapillary RNFL measurement at 75 days after trauma revealed an abnormally thin RNFL at the 6:00 and 7:00 positions in the clock hour analysis. Quadrant analysis was also apparently abnormal in the inferior part with the thickness of 81 microns [].\nVisual field test and electrophysiological tests were performed for functional evaluation. Humphrey visual field testing revealed a superior altitudinal visual field defect [Fig. and ]. Monocular pattern visual evoked potentials (PVEP) testing to five different check sizes (2’, 1’, 30°, 15°, 7°) showed even unrecordable P100 peaks to all checks in the right eye. Transient pattern electroretinogram (PERG) testing showed reduced P50 peak amplitude in the right eye [Fig. and ].\nVision acuity was 20/200 at the last visit. Fundus photo and angiography revealed inferiorly partial ONA, peripapillary atrophy, and choroidal folds at the macula. |
This is a 49-year-old male with hypertension and chronic kidney disease. He presented to the Emergency Department on the 28th of March 2017 with right-sided weakness and inability to speak. He was found to have recent acute/early subacute infarct along left middle cerebral artery territory.\nOn 6th of April 2017, the patient was transferred to Qatar Rehabilitation Institute to be enrolled in an active rehabilitation program. Upon assessment, he was found to have global aphasia, dense right-sided weakness, maximally assisted in bed mobility and transfer, and totally assisted in activities of daily life.\nDuring his hospital stay, he had episodes of elevated liver enzymes and the suspected medications (atorvastatin 40 mg orally daily and escitalopram 20 mg orally daily) were suspended with continuous monitoring of the liver enzymes. Liver enzymes started to decrease within few days after the suspension but did not reach the baseline. A week after suspending escitalopram, he was started on (oxybutynin 5 mg orally twice daily) for overactive bladder. Within a week of starting oxybutynin, liver enzymes increased again ( and ). A thorough medication review was done by the assigned clinical pharmacist and none of his medications was known to result in high liver enzymes. After discussing this with the physician, oxybutynin was the only suspected medication to be responsible of this elevation in liver enzymes as it was the newest medication added to his therapy, and hence, it was suspended.\nTo rule out inflammatory, autoimmune, or any other underlying causes, the gastroenterology team was consulted to evaluate the case. Their primary assessment was “drug-induced hepatitis.” Their recommendations were to stop any suspected hepatotoxic medication and to do further investigations. These included full workup of hepatitis, hepatitis A virus immunoglobulin M, hepatitis C virus antibody, hepatitis E virus immunoglobulin M, antinuclear antibody, anti-smooth muscle antibody, antimitochondrial antibody, anti-liver kidney antibodies, and celiac profile – immunoglobulin A, anti-tissue transglutaminase antibodies, ceruloplasmin, and α-1 antitrypsin. All the required tests were negative and the ultrasound of the abdomen showed normal findings. Within a week of discontinuing oxybutynin, both ALT and AST were decreased to values lower than 3 times the baseline.\nAs the patient was lost to follow-up, consent for publication of this case was not possible. However, the case details have been sufficiently anonymized and approval for publication has been obtained from the organization’s medical research center. |
A 34-year-old female patient, gravida two para zero, presented to the labor and delivery unit at Johnson City Medical Center, Johnson City, Tennessee for induction of labor at term. Her medical history was significant for a history of a first-trimester spontaneous abortion managed expectantly, herpes simplex-1, and cervical intraepithelial neoplasia 1. Her prenatal course was complicated by the White's classification A1 gestational diabetes, rubella non-immune status, and a urinary tract infection. The estimated fetal weight at 38 weeks and six days of gestation was 3,680 grams or eight pounds and two ounces, which is at the 73rd percentile for gestational age. Fetal abdominal circumference was at the 91st percentile, while head circumference was only at the 34th percentile.\nAt 39 weeks and two days of gestation, the patient was admitted for elective induction of labor. Laboratory evaluation at admission was significant for hemoglobin and hematocrit of 11.4 g/dL and 34.3%, respectively. Induction required cervical ripening with dinoprostone, misoprostol, mechanical dilation, oxytocin, and artificial rupture of membranes. The second stage of labor was complicated by vacuum assistance secondary to maternal exhaustion and resulted in an uncomplicated delivery of a vigorous infant. The infant was born appropriate weight for gestational age. Active management of the third stage of labor was initiated with oxytocin and downward traction on the umbilical cord.\nAfter thirty minutes of delivery, the placenta failed to deliver and we made the diagnosis of retained placenta. The placenta was manually extracted under transabdominal ultrasound guidance with epidural and intravenous analgesia. After the extraction, an inspection of the placenta showed a thinning in a single area. Re-exploration of the uterine cavity under ultrasound guidance revealed a 2/3-cm placental remnant and a small blood clot, which were extracted manually. The third stage of labor lasted approximately 57 minutes. The total estimated blood loss was 700 ml. The patient had a second-degree perineal laceration, which contributed to total blood loss. After delivery, we palpated the fundus and found it to be firm. We administered broad-spectrum antibiotics as there was a concern about contamination during extraction secondary to semi-sterile conditions of a vaginal delivery.\nThe entire placenta, including non-intact pieces, was sent to pathology for examination (Figure ). Histologic sections demonstrated decreased- to-focally-absent decidualized myometrium, supporting the clinical impression of placenta accreta.\nIn the immediate postpartum period, the patient received one unit of packed red blood cells for symptomatic anemia (hemoglobin and hematocrit: 6.7 g/dL and 22.3%, respectively). She was discharged on postpartum day two. Three days following delivery, the patient was evaluated in our outpatient clinic. She reported appropriate lochia. She received close postpartum follow-up with four postpartum visits within the first six weeks postpartum and one telephone call. She was asked about lochia at each visit. She breastfed without difficulties. The postpartum course was remarkable only for a urinary tract infection, which responded to antibiotics with a negative follow-up urine culture. At the time of preparation of this case report, the patient was still breastfeeding and had not had a return of menses. |
A 30-year-old female came to the emergency department of our institute with difficulty in swallowing since one day. The patient was not even able to have water. An assessment of the nervous system was made because neuromuscular disorders may present with dysphagia as an initial symptom. Proper history revealed that the patient was a known case of rheumatoid arthritis and was taking routine anti-inflammatory drugs. The prior day, the patient was advised to take ayurvedic tablets by relatives for immediate relief. The tablet was about I cm in diameter and was spherical in shape. The moment the patient took the first tablet with water, she started having discomfort in the throat. She took more water but was not relieved. She visited local doctors and was referred to our institute.\nOn arrival she had drooling of saliva; the oxygen saturation was between 70%-80% and the patient was not able to take anything orally since 12-14 hours. While performing an indirect laryngoscopy, we found pooling of saliva in both pyriform fossae. Taking history into account rigid oesophagoscopy under general anaesthesia was planned. All routine blood tests were in normal limits. The X-ray of the neck lateral view revealed a radiopaque spherical shadow at the lower level of cricopharynx, which was a surprise to us, as routinely tablets are not radiopaque. There was also a slight prevertebral widening in front of C6 and C7 ().\nTo understand what we were going to encounter, the patient’s husband was asked to provide another ayurvedic pill of the same kind. The tablet’s colour was black, it was spherical, stony hard and its approximate size was of 1 cm. Not knowing the contents of the pill, it was decided that it should be removed immediately because a long-standing tablet may cause erosion/obstruction of the wall of the oesophagus. The patient was shifted to operation theatre for rigid hypopharyngoscopy under general anaesthesia. On rigid hypopharyngoscopy, the tablet was visualised in lower border of the cricopharynx. The surrounding area was extremely congested and oedematous. With the help of a foreign body removal forceps, the tablet was grasped but some part of it broke, which made the removal action easier. The rest of the tablet affected the wall of the cricopharynx and was eventually removed (). On gross appearance, the pill’s colour was black; it was hard in consistency and of approximately 1.25 cm in size.\nThe postoperative X-ray of the neck confirmed the complete removal of the contents ().\nAs there was an erosion of the wall of the oesophagus, the patient was kept nil orally along with routine intravenous antibiotics and steroids. After two days, liquids were started, followed by semisolids and a normal diet. The patient was discharged on the 4th day postoperatively, being totally relieved of symptoms. |
A 38-year-old female patient without any relevant past medical history or family history was brought to the emergency department by the emergency medical service (EMS); she was found to be unresponsive, and the downtime was estimated around 30 minutes. The patient had been suffering from flu-like symptoms, diarrhea, and vomiting for one week before hospitalization. She took an unknown amount of loperamide for diarrhea. As per her husband, he found two empty bottles of loperamide that he suspected his wife has consumed over approximately 48 hours.\nSince the patient was unresponsive, her husband started cardiopulmonary resuscitation (CPR) until the EMS arrived at the scene; the initial rhythm reported by the EMS was VF (Figure ). Two shocks were delivered via defibrillation mode with continuous CPR as per advanced cardiac life support (ACLS) protocol following which return of spontaneous circulation (ROSC) was successfully achieved.\nThe patient was admitted to ICU where admission workup showed a prolonged QTc of more than 600 mSec on her electrocardiogram (EKG) and elevated troponins (Figure ). CT-angiography was performed showing no evidence of pulmonary embolism. Urine drug screen done did not demonstrate any illicit drug use. The patient was started on an amiodarone drip, despite which she had bouts of sustained ventricular tachycardia and another episode of VF for which she received a shock via defibrillator. Emergent cardiac catheterization revealed non-obstructive coronaries. Bedside echocardiography showed an ejection fraction of 45%-50%. She was then switched to a lidocaine drip, given her persisting episodes of ventricular tachycardia persisted despite being on amiodarone. A multidisciplinary team discussion with cardiology, critical care physician, an internist was held following which lidocaine was discontinued and VF was traced back to loperamide under the setting of electrolyte abnormalities. Meticulous electrolyte repletion to maintain potassium of 4 and magnesium of 2.5 was done as that could have potentially been aggravating factors in her prolonged QTc.\nWith optimal electrolytes, the patient’s condition stabilized with no further episodes of ventricular tachycardia. A repeat EKG showed that QTc had shortened to less than 500 msec within 24 hours. For secondary prevention, the patient received an implantable cardioverter (ICD).\nAfter extubation, the patient was found to have a hypoxic brain injury, a long term sequelae likely from the cardiac arrest-induced brain hypoxia. Over day 9 of the hospital course, her neurological status had started to gradually improve, and she was transferred to a neurology rehabilitation institution. |
A 1 year 3 months old male child was diagnosed to have double outlet right ventricle with a remote ventricular septal defect and severe pulmonary stenosis. In addition, there was an obstructive cor-triatriatum. The child had cyanosis along with restricted physical activities for age. Auscultation revealed normal heart sounds and a grade 3/6 ejection murmur in the left parasternal area. On cardiac catheterization, mean PA pressure was on the higher side (18 mm Hg) but with normal trans-pulmonary gradient (3 mm Hg). The child underwent right BDG with cor-membrane resection along with atrial septectomy. He did very well on the initial few check-ups but then was lost to follow-up for nearly a year. On return, he was noted to be deeply cyanosed (Spo2- 65%) with exertional dyspnea. Transthoracic echocardiography showed good flow across right BDG anastomosis into both branch PAs. Interestingly, there was a large venous communication from the proximal bend of the left innominate vein with antegrade flow toward the heart (Fig. a). The draining chamber of this venous communication was not very clear on echocardiography. We reviewed the angiograms prior to BDG, but there was no evidence of any left SVC. The child was thus taken up for cardiac catheterization for further assessment.\nAngiogram done from right jugular access with a catheter in the innominate vein revealed a large tortuous venous communication draining into the posterior margin of the roof of the left atrium. The venous channel had two distinct folds lower down resembling a collateral vessel. We measured a maximum dimension of 15 mm in its initial straight portion and dimensions of 17-18 mm at the tortuous lower end (Fig. b). We obtained the pressure in the venous communication, innominate vein, SVC, and in the branch pulmonary arteries. Mean pressure everywhere in the circuit was 11 mm Hg. Using a 18 × 40 mm Tyshak II balloon (NuMED Inc., Hopkinton, NY, USA) the venous channel was completely occluded for 15 min (Fig. c). This led to a substantial improvement in saturation (Spo2- 86%) without any significant rise in the Glenn pressures (11-12 mm Hg). It was hence decided to block this communication. A 24-mm Lifetech Cera Vascular plug (Lifetech Scientific, Shenzhen, China) was successfully deployed from the femoral venous route using a 9 Fr Mullins delivery sheath (Cook Medical, Bloomington, IN, USA). Angiogram after final positioning of device showed complete occlusion of the venous channel (Fig. d) with good flow into both branch PAs (Fig. e). The child was started on oral warfarin for the initial 6 months to keep the international normalized ratio (INR) above 1.5. Oral aspirin prophylaxis was continued indefinitely. The improvement in saturation was sustained during follow-up, and the child had successful Fontan completion after 2 years. |
A 38-year-old man presented with a 5-year history of intermittent left upper abdominal pain that was sometime precipitated by food and usually resolved spontaneously. There was no change in the bowel habit and no rectal bleeding. There was no past history of any other medical or surgical problems.\nAbdominal and anorectal examination, routine blood tests, x-ray abdomen, ultrasonography of abdomen, upper gastrointestinal endoscopy/ colonoscopy did not reveal any abnormality. A abdominal CT scan with oral and intravenous contrast showed an encapsulated sac–like mass of small-bowel loops with no dilatation in the left upper abdomen crossing the midline and indenting the posterior wall of the stomach [Figures and ]. A diagnosis of left paraduodenal hernia was made and the patient taken up for diagnostic laparoscopy.\nThe surgeon as well as the camera person stood on the right side of the patient. The laparoscope was inserted through a 10-mm supra-umbilical port. A 5-mm epigastric port was placed just below the xiphisternum as the left-hand working port, a 5-mm port in the right midclavicular line was used as the right-hand working port and a fourth port in the left midclavicular line below the subcostal margin was used by the assistant for traction. Intra-operatively it was observed that most of the small-bowel loops were lying within a large hernial sac []. The anterior wall of the hernial sac was formed by the left mesocolon. As the neck of the sac was narrow, small bowel could not be reduced. The sac was opened with an ultrasonic shears and the bowel was freed up []. There was no evidence of volvulus or bowel ischaemia. The neck of the sac was excised [], and the fluid inside the sac was sampled. The patient was allowed oral fluids on postoperative day 1 and progressed to diet. He was discharged on day 3. He remains well at a follow up of six months. |
A 29-year-old man (Han Chinese, Hoklo) with a diagnosis of MJD and CAG repeat numbers of 14 and 70 in the MJD1 gene had been confined to a wheelchair for three years. He had a history of left humeral bone fracture as a result of an accidental fall one year earlier. Three months prior to his stay in the hospital, he began to have severe regional pain in his feet. His pain was spontaneous, continuing, and excruciating in the areas mentioned above. He described it as like "originating deeply from the bone" and denied any burning or lancinating sensation. Moderate hair loss, focal edema, cutaneous thermal change with hypersensitivity to cold temperatures, and intermittent sweating in both feet were observed. Yet there was no light-touch allodynia, fever, chill, or local tenderness. He could hardly do anything except moan in bed in the daytime and yell and kick almost every night.\nPlain film of both feet revealed normal alignment and no bone lesions. A nerve conduction study and electromyography revealed merely mild sensorimotor polyneuropathy. Quantitative sensory testing (QST) was conducted for his severely depressed mood. During his stay in the hospital, we used the visual analogue scale (VAS) (0 for no pain and 10 for maximal pain) to measure his pain intensity []. Initially, his pain was minimally relieved, from 10 to 8 on the VAS, by common analgesics, including acetaminophen, diclofenac, and tramadol. On day four, gabapentin was added at a daily dose of 1200 mg (400 mg every eight hours) (Figure ). With an increasing daily dosage of gabapentin from 1200 to 2000 mg (500 mg every six hours), his pain was gradually resolved from 8 to 4 on the VAS (Figure ) by day 10. The abnormal cutaneous thermal change and edema also disappeared. As his pain diminished significantly, we observed a remarkable improvement in his quality of life: he slept better, was more mobile, and had more daily activity. Finally, he could move around again by wheelchair. |
An 18-year-old male patient, reported to Department of Oral and Maxillofacial Surgery, Trivandrum, Kerala, India, in May 2011, with the complaint of reddish swelling over left side of the upper lip with occasional bleeding while brushing since last 3-4 years. Patient noticed swelling over the left side of upper lip region 3-4 years back. Patient had repeated episodes of bleeding while brushing teeth or on mechanical trauma to the lesion. Patient visited private hospital, where he was kept on vitamin tablets and no other medications as history suggested by patient. The swelling was initially small papular which increased slowly to a size of 2×1 cm approximately in greatest dimension in last 2 years, after that there was no further change in swelling. At the time of reporting patient was having complaint of occasional bleeding from the lesion. Past medical and family history was non-contributory. Local examination revealed reddish multiple papular lesion over left side of buccal mucosa extending from 1cm behind the left corner of mouth in relation to 24, 25 of size approximately 2×1 cm []. There was no ulceration. On palpation the lesion was soft in consistency, non-tender, with smooth borders and was pulsatile in nature. There was no obvious increase in temperature of lesion. No obvious feeder vessel was identified. No obvious bleeding was identified on palpation of lesion. There was no associated lymphadenopathy. Provisional diagnosis of hemangioma left buccal mucosa was made. To rule out intracranial and bony involvement CT head and orthopantomogram (OPG) was taken, subsequently no abnormalities has been detected [Figures and ]. Excisional biopsy carried out under local anesthesia in proper aseptic conditions. Intraoperatively no obvious feeder vessel was identified. Mild to moderate bleeding was encountered and was managed by cauterization. Wide complete excision was done and surgical site was closed primarily. Gross specimen was soft in consistency and reddish in color and approximately of size 1.5×1 cm []. Specimen was sent for histopathological examination. Hematoxyline and eosine stain section shows hyperplastic stratified squamous epithelium which is extensively proliferating in to underlying moderately collagenous connective tissue stroma. There are numerous endothelail line vascular spaces through the stroma and extending in to submucosa. Intermixed with large vascular channels dilated lumphatic vessels also seen. Endothelial cells proliferation and forming vascular channels were also evident. There is minimal inflammatory infiltrate []. Histopathologically diagnosis of hemangiolymphangioma was made. Patient is on continuous follow-up no recurrence was noted till date. |
A 19-year-old woman presented with a lump in her right breast. She had macrocephaly and milimetric papules on the tongue giving a cobble stone appearance. The breast ultrasonography (US) showed more than twenty circumscribed, oval masses in each breast. An US-guided core biopsy was performed for the palpable masses which were confirmed as juvenile fibroadenomas. After the biopsy, a breast US was done as follow-up every 6 or 12 months for 3 years. During the surveillance period, core biopsies were performed six times, followed by US-guided vacuum-assisted core needle excisions or surgical excisions of lesions with increased sizes. Pathologic results were fibroadenoma, tubular adenoma or atypical ductal hyperplasia (ADH) involving fibroadenoma.\nAt the age of 19 years, the patient underwent a neck US for a palpable mass in the left neck. Several indeterminate nodules were revealed in both thyroid glands. A follow-up US revealed that some of those nodules increased in size. The patient underwent a total thyroidectomy and the pathologic result revealed an invasive follicular carcinoma in the left thyroid and follicular adenoma in the right thyroid (). At the age of 21 years, she visited the hospital due to a swelling of her left cheek. Head and neck CT scan revealed a vascular mass in the left parotid gland extended into the left forehead. An external carotid angiography confirmed the diagnosis of an AVM with feeder vessel arising from the left internal maxillary artery (). A partial embolization decreased the blood flow through the AVM, alleviating the patient's symptom. She was referred to genetic counseling under the suggestion of a Cowden syndrome and the PTEN DNA sequencing test of her blood sample revealed a frameshift mutation, c.301dupA (p.I101NfsX6).\nAt the age of 22 years, the patient presented with a mass with increased size and increased vascularity in the left breast. An US-guided vacuum-assisted core needle excision revealed a ductal carcinoma in situ (DCIS) of non-comedo type and a low grade involving fibroadenoma (). The contrast-enhanced breast MRI for the preoperative evaluation demonstrated multiple, well-circumscribed, enhancing masses in both breasts (). All masses showed high or intermediate signal intensity on T2-weighted images (). Several masses showed an early rapid enhancement with washout kinetic pattern on time-signal intensity curve evaluation, which tends to be associated with malignancy (). A bilateral prophylactic mastectomy with immediate breast reconstruction was performed in view of multiple bilateral breast masses with suspicious kinetic features on breast MRI and a high risk for breast cancer of Cowden syndrome. The surgical histopathology revealed ADH involving tubular adenoma without residual carcinoma in the left breast and multiple tubular adenomas, fibroadenomas and intraductal papillomas in both breasts. The patient had no family history of breast cancer or Cowden syndrome. |
A 61-year-old male with a past medical history of hypertension, hyperlipidemia, chronic obstructive pulmonary disease, valvular cardiomyopathy, substance abuse, and coronary artery disease presented to the emergency department with progressively worsening shortness of breath. The patient had associated weakness and fatigue in the days leading up to his hospital admission. The patient's cardiac enzymes were also elevated. Cardiac catheterization was significant for 50% stenosis of the proximal and mid-left anterior descending artery. Transthoracic echocardiography (TEE) showed severe aortic valve stenosis with moderate insufficiency and an ejection fraction of 32%. Subsequently, he was scheduled for a minimally invasive aortic valve replacement with a 27 mm·St. Jude Trifecta stented pericardial bioprosthesis under general endotracheal anesthesia. Standard monitors were used including cerebral oximetry. Intraoperative TEE showed a significant atherosclerotic burden with grade 3 atheroma in the ascending aorta and grade 5 atheroma in the descending aorta and aortic arch [] (). In the distal aortic arch, there was a large complex atheroma with a mobile component. The aortic valve was unicuspid, heavily calcified, and severely stenosed. Prior to initiating cardiopulmonary bypass, the aorta was palpated, and areas of calcification were noted. With good visualization of the discrete large complex atheroma using TEE, it was felt that modifying the cardiopulmonary bypass approach or using epiaortic ultrasound would yield no further potential benefit. A purse-string suture was placed in an area that was free of calcium. A 17-French Bio-Medicus aortic cannula was meticulously placed using the Seldinger technique and TEE guidance to direct placement of the tip away from the mobile atheroma that was visualized in the aortic arch. First described in 2006 for aortic cannulation, the Seldinger method is helpful when cannulating a patient with thoracoabdominal aortic disease, including a calcified ascending aorta or complicated aortic dissection []. A retrograde coronary sinus perfusion cannula was then placed. Aortic root venting and cardioplegia catheters were placed. The aorta was cross-clamped in the area with least disease as determined by manual palpation and TEE guidance. The aortic valve replacement was completed with no complications. The postoperative TEE showed that the previously described aortic arch atheroma remained intact. The patient tolerated the operation well and had no perioperative stroke events or other complications. He was discharged home in stable condition five days postoperatively. |
A 17-yr-old Caucasian female presented to the Department of Clinical Genomics at Mayo Clinic for an evaluation of a history of motor and speech delay, scoliosis, and recurrent rash. The patient's neonatal and perinatal history was unremarkable with the exception of mild bilateral hip clicks noted at birth. History of gross motor and speech delay was noted with the patient walking and pronouncing her first words at 18 mo. A reevaluation of the patient's speech comprehension at Mayo Clinic at age 14 showed weaknesses in attention processes. The patient also met the criteria for attention deficit hyperactivity disorder (ADHD)-inattentive subtype based on the Conners Parent Rating Scale-Revised (T = 82), the Conners ADHD Index (T = 74), and the BASC Parent Report (T = 74). As such, it was thought that the patient's speech and learning difficulties were due to inattentiveness and ADHD rather than cognitive impairment. Also reported was decreased muscle tone, daytime enuresis, and rashes that were refractory to treatment. The patient displayed distinctive craniofacial features (A) not noted in the parents or siblings (; D). Skeletal findings were significant for short stature, bilateral cervical ribs at C7 resulting in 13 pairs of matched ribs, and progressive scoliosis (B). At age 12, the patient underwent a posterior spinal fusion with instrumentation and bone grafting to correct a left thoracolumbar curve of 70°. She had several dental anomalies with narrow palate, frequent cavities, class III malocclusion, missing permanent teeth (Nos. 7 and 10), and impacted molars (Nos. 17 and 32) (C).\nThe family history was remarkable (D) with dry skin noted in the proband's mother and absent upper lateral incisor on one side reported in the paternal grandmother. Neither the proband nor the mother was noted to have asthma, though the proband was noted to have more frequent and prolonged respiratory illnesses in comparison with her siblings. Other laboratory testing performed on the patient, including biochemical testing, echocardiogram, abdominal ultrasound, and electroencephalogram, were unremarkable. Previous genetic testing included a microarray-based comparative genomic hybridization that was reported normal. |
A male patient aged 5-year-and-1-month was referred for genetic evaluation of development and speech delay, intellectual disabilities at the genetic counselling clinic in Shenzhen Maternal and Child Healthcare Hospital. The parents described that an affected brother also presented the same clinical phenotype but was not available for the clinical examination. The chromosome karyotype and chromosomal microarray analysis (CMA) in the proband were normal. The mother was pregnant again and pursued genetic counseling. The proband was subject to comprehensive neurological testing including the Gesell Developmental index. Molecular genetic tests and biochemical and neurochemical analysis were performed on the proband. The present study was approved by the hospital’s Institutional Review Board and written informed consent was obtained from their parents.\nThe proband was the second boy of healthy nonconsanguineous parents (pedigree in Fig. ). He was born at 39 weeks of gestation from an uneventful pregnancy and delivered by Caesarean section (weight, 3600 g; length, 50 cm; head circumference, 36 cm). He showed head control at 12 months, ability to sit by himself at 15 months, and walking with aid at 20 months. His verbal language was nearly absent and he made no visual contact. He suffered from seizures from 6 months old. He had no craniofacial dysmorphism. Gastrointestinal problems such as chronic constipation or nausea were noted in the proband. The physical examination on the proband showed 95 cm height, weight 18.2 kg and developmental and language delay. The proband also had an electroencephalogram (EEG) test, which showed sharp and slow waves in sleep during 24-h EEG monitoring. A brain stem auditory-evoked potential (BAEP) test showed mild abnormality. The proband had a Children’s Autism Rating Scale (CARS) score of 33, which indicated mildly autistic characteristics. The Gesell developmental scale test was used to evaluate the proband. Both the development age (DA) and developmental quotient (DQ) data showed extremely low grades which suggested severe development delay (adaptability, DA = 14.23mo., DQ = 23; gross motor, DA = 26.37mo., DQ = 43; fine movement DA = 15.87mo., DQ = 26; vocabulary DA = 13.07mo., DQ = 21; personal-social skill DA = 13.3mo., DQ = 22). The test results are depicted in Additional file : Figure S1A. The affected brother of the proband (II:1) was not available for the physical examination. The parental description of the clinical phenotype of the brother was mostly the same as the proband. The parents were physically healthy and indicated no significant past medical, surgical or family history.\nDNA samples were provided from the index patient and other family members, which were extracted as previously described []. The present study used the TruSight One Sequencing Panel and NextSeq 500/550 Mid Output v2 kit (300 cycles) with high depth of coverage for 4813 target genes (approximately 62000 target exons) that are associated with clinically relevant phenotypes. An average sequencing depth of 136.88x was achieved and 98.25% of targeted variants were covered at least to a 10x depth, and 97.04% of targeted variants were covered at least by 20x. The total detected variants numbered 24594, which included 21,733 SNPs, 1,182 insertions and 1,679 deletions respectively. The data were analyzed on the TGex (Translational Genomics Expert) platform featuring with the VarElect scoring system []. A missense mutation, c.1181C > A (p.Thr394Lys), in the SLC6A8 gene was called with high probability as a candidate mutation.\nSanger sequencing was performed to confirm the SLC6A8 gene c.1181C > A mutation (forward primer 5’ ACGGAACTTGTCAGATTGT3’, and reverse primer 5’CAACAGCATGAAGAAGAACA3’). The father (I:1) was wildtype and the mother (I:2) was heterozygous for the c.1181C > A variation. The affected brother (II:1) and the proband (II:2) both carried the hemizygous variation of c.1181C > A. The pregnant mother had an amniocentesis at 22 weeks and Sanger sequencing targeting the SLC6A8 gene c.1181C > A was performed. The result showed a wild-type allele (II:3) and the mother gave birth to a healthy baby girl (Fig. ). In silico variant prediction analysis methods, including SIFT, PolyPhen2, PROVEAN, and Mutation Taster demonstrated this variant had probably damaging or diseasing-causing effects.\nBiochemical screening was performed with blood and urine samples from the proband and his mother. The creatine/creatinine (Cr:Crn) ratio was determined by liquid chromatography-mass spectrometry with deuterated internal standards in two urine samples taken on different days. A urine creatine test of the proband showed significantly elevated levels of creatine (0.805 mg/ml, normal control 0.160 ± 0.177 mg/ml) (Additional file : Figure S1B), and the creatine/creatinine ratio was significantly elevated compared to controls. Proton magnetic resonance spectroscopy (MRS, Magnetom Skyra 3.0-T, Siemens Healthcare GmbH, Erlangen, Germany), examination using a 3.0-T system at the brain left parietal lobe, right parietal lobe and genu of corpus callosum all showed marked reduction of the brain creatine peak (Fig. left part). Brain MRI showed a thin corpus callosum in the proband (Fig. right part). The MRS and MRI examination of the mother (I:2) showed normal results (Additional file : Figure S1C). |
A 21-year-old primigavida with 29.3 weeks of gestation was admitted in our institute for termination of pregnancy, as her routine anomalous ultrasonogram (USG) done at a primary center revealed defective development of spine, atrial septal defect (ASD), aplasia of the right kidney, and encephalocele. The mother's routine blood and biochemical investigations were within normal limits. She was not a known diabetic or hypertensive and had a history of nonconsanguineous marriage. She gave a history of iron and folic acid tablets supplementation. A repeat USG done at our institute confirmed the above-mentioned anomalies. In view of multiple nonviable anomalies, with the informed consent of the parents, the pregnancy was terminated and abortus was sent for pathological examination.\nAt autopsy it was a fetus of ambiguous genitalia, weighed 900 g. The head was enlarged, severely retroflexed, and there was no neck. Head was seen directly resting on the chest and mandibular skin in continuous with chest skin surface. The ears were low set [] and the vertebral column was short and irregular. There was an omphalocele with partly covered membrane containing liver, bladder, and intestine as contents. Lower limbs showed bilateral clubfoot. There was overgrowth of upper limbs compared with lower limbs []. Posteriorly the skin of the scalp was thick and extended up to lumbar region [] Radiograph of the abortus revealed hyperextension of the neck with occiput touching the cervicodorsal vertebra with soft tissue continuation on the dorsal aspect of the neck. Cervical and thoracic vertebra showed defective block vertebra with thoracolumbar lordosis suggestive of iniencephaly []. Autopsy of the fetus revealed two lobes in the right lung with hypoplasia of both the lungs []. Cardia showed ASD [Figure and ]. There was an accessory spleen in the greater omentum []. Both the testes were seen in the inguinal canal. On opening the cranial cavity, there was defect in the development of occipital bone, which was covered by duramater inside and thin membrane outside. The foramen magnum was enlarged and measured 5 cm at its longest axis. Posterior fossa was small and hypoplastic cerebellar vermis [Figure –]. Cerebrum and spinal cord were normal. Umbilical cord showed single umbilical artery. Considering these features a pathological diagnosis of iniencephaly clausus was made. |
A 67-year-old Caucasian man presented to the emergency room because of a 4 days’ history of abdominal pain, with one episode of vomiting.\nThe patient’s past medical history was significant for colonic diverticulosis and an episode of gastrointestinal bleeding one year before. The event had been investigated by two different gastroscopies, a colonoscopy and a MDCT, which produced inconclusive results. Ten months later he was newly admitted because of abdominal pain and fever at 38.0 C°, with valid urination and defecation. A CT of the abdomen was performed, which confirmed the colonic diverticulosis and revealed the presence of multiple diverticula of the small intestine, fat stranding, signs of inflammation as well as a small amount of free liquid in the abdomen. The patient was hence diagnosed with jejunal diverticulitis and managed conservatively with intra-venous antibiotics, with an apparent complete recovery.\nHe re-presented to the emergency department two months later with acute abdominal pain. The pain was described as severe and constant, localized mainly in the lower abdomen with clinical signs of peritonitis. No change in bowel habits nor urinary symptoms were complained. His vital signs were stable, with a temperature of 37.2 C°; he appeared fully oriented and not in any acute distress. Laboratory examination reported a hemoglobin of 121 g/dL, a WBC count of 12.2 × 10E9/L and a CRP of 249 mg/L. Other laboratory data were within normal limit. An abdominal and pelvic contrast-enhanced computed tomography, with administration of oral contrast, was performed. Jejunum and ileum showed several diverticula as well as an inflammatory thick-walled mass involving different loops of the intestine. In addition, free fluid in the abdomen and a small amount of subdiaphragmatic air were reported (, ). On the basis of these findings, the diagnosis of perforated diverticulitis was hereby proposed.\nThe patient underwent a diagnostic laparoscopy which revealed plenty of purulent yellowish liquid collected in the right abdomen and a conglomerate of intestinal inflamed loops. We hence decided to convert immediately the procedure to laparotomy. Large multiple diverticula were found covering a section of small intestine approximately 2.5 m long, without signs of obvious macro perforation. Among the middle distal tract of the jejunum and the middle distal tract of ileum, strong adhesions were identified (). The involved segments of jejunum and ileum were connected by an intestinal loop free of signs of diverticulosis (). There were no signs of bowel ischemia. Adhesiolisis was partially carried out, however, because of difficulties associated with the procedure, we opt to perform a double enterectomy, removing only those segments involved in the intestinal conglomerate and deeply affected by the pathology. Roughly 25 cm of ileum and 80 cm of jejunum were resected. Bowel continuity was restored with an ileo-ileal and a jejuno-jejunal anastomosis. Almost 700 cl of pus were drained and the peritoneal cavity was washed with 10 L of saline solution. The postoperative recovery was uneventful and the patient was discharged 8 days later. There were no signs of malignancy in the resected intestine. |
A 41-year-old man with no remarkable medical history was referred to our department with a two-month history of difficulty on swallowing and appetite loss. A barium study and endoscopic examination showed type 4 advanced gastric cancer in the lesser curvature of the upper body of the stomach. On admission, the tumor markers, such as carcinoembryonic antigen(CEA) and gastrointestinal cancer antigen 19-9 were within normal limits. He underwent total gastrectomy (D2 dissection) with splenectomy and distal pancreatectomy for advanced gastric cancer in the greater curvature of the corpus. Histological examination of the resected specimen revealed tubular adenocarcinoma of the moderately differentiated type with partial signet-ring cell carcinoma. The depth of tumor invasion was confirmed as exposed-serosal (se). There was mild lymphatic invasion (ly1), no venous invasion (v0), and lymph node metastasis (n2). The patient received adjuvant chemotherapy with oral 5-fluorouracil for 1 year, and was followed up for 5 years on an outpatient basis without any sign of recurrence.\nAt the age of 61 years, 20 years after initial surgery, he was referred to our hospital with constipation, abdominal distention and lower abdominal pain. Abdominal computed tomography (CT) showed thickening of the intestinal wall, moderately accumulated ascites, and left hydronephrosis. Upper gastrointestinal fiberscope could demonstrate neither recurrent tumor nor another primary tumor. Radiographic contrast enema and colonoscopy could not evaluate the patient adequately because of extrinsic compression of the sigmoid colon. Tumor markers such as carcinoembryonic antigen, gastrointestinal cancer antigen 19-9, and alpha-fetoprotein were within normal limits. In contrast, cancer-related antigen 72-4 was elevated slightly. Laparotomy was performed because small-bowel obstruction could not be relieved by conservative therapy. At laparotomy, multiple white nodules (~10 mm) were observed within the mesentery proper (Figure and ). Stenosis caused by these nodules was recognized in the descending and sigmoid colon. In addition, we checked other organs which contain remnant pancreas head, small intestine, colon and other intra-abdominal organs, and operative findings could not demonstrated primary other cancer. We diagnosed peritoneal dissemination from an unknown primary lesion, and diverting ileostomy with partial ileal resection was performed.\nHistological examination for these white nodules revealed tubular adenocarcinoma with signet-ring cell carcinoma, which was similar to the pathological findings of the gastric tumor 20 years earlier (Figure and ). Immunohistochemical staining using antibody to pancytokeratin (pan-CK; 1:50; NovoCastro, Newcastle, UK) showed that cancer cells were expressed in recurrent specimens (Figure ). The immunohistochemical staining for cytokeratin-7 (CK-7; 1:50; DAKO, Glostrup, Denmark) was not expressed both in primary and disseminated cancer cells (Figure and ). In addition, immnohistochemical staining for CK-20 (1:25; DAKO, Glostrup, Denmark) was also not expressed both in primary and disseminated 6cancer cells (Figure and ). The intensity of staining for Ki-67 (1:50; Zymed, San Francisco, CA, USA) and PCNA (1:100; DAKO, Glostrup, Denmark) was decreased in recurrent cancer cells in comparison to primary cancer specimens (Figure ). On the other hand, staining for p53 (1:100; DAKO) was more positive and diffuse in recurrent than primary cancer cells (Figure and ).\nSystemic reevaluation, including total colonoscopy and systemic computed tomography, could not confirm another primary tumor as the cause of the recurrence, therefore, peritoneal recurrence of gastric cancer more than 20 years after primary surgery was diagnosed. Follow-up systemic computed tomography at 1 year after the second operation could not showed primary other lesion responsible for peritoneal dissemination. The patient's general condition after secondary surgery took a gradual turn for the worse, despite 5-fluorouracil-based systemic chemotherapy, and he died at 62 years of age, 21 years and 7 months after initial gastrectomy. |
A 21-year-old woman with history of repeated chest pain was admitted to our hospital. She had been initially diagnosed mediastinal abscess due to rupture of esophageal diverticulum at another facility. Blood examination showed leucocytosis (12430/mm3), but normal level of C-reactive protein. Chest x-ray photograph revealed no sign of mediastinal mass and pleural effusion. The bilateral lung fields were apparently normal. The chest vertebral bodies and intervertebral disc spaces have unremarkable changes. An upper gastrointestinal endoscopy showed the esophageal diverticulum lined columnar epithelium at left side of middle thoracic esophagus (Figure ). Chest computed tomography showed a meditational mass at caudal side of tracheal carina at the left side of middle thoracic esophagus, and maximum diameter of approximately 3 cm. The mass lesion have thin wall and contained partially air density part and solid portion (Figure ). The patient was diagnosed as having a mediastinal abscess due to perforation of esophageal diverticulum from these findings.\nSurgery was carried out via right thoracoscopic approach. The double lumen endotracheal tube was used for deflates the right lung. The arch of azygos vein was ligated and cutted. The middle thoracic esophagus was isolated from pericardium and carina at ventral side (Figure ). The fibrous change due to repeated inflammation of adjacent structures was noted. Bilateral vegal nerve identified and preserved. The operation was proceeding with the aid of endoscope in the esophagus, checked for investigation the air insufflation intraoperatively. After secured the middle thoracic esophagus, the lesion was resected using linea stapler (Figure ).\nResected specimen showed 3.5 × 3.5 cm cystic tumor with solid portion (Figure ). Pathologically, the resected specimen was composed of cystic part and solid portion. The cystic part of the lesion lined by squamous epithelium, columner or simple cuboid epithelium complicated with actinomycetic granule. The cyst covered by smooth muscle layer (Figure ). The solid portion consisted of admixture of glands of fundic types. In addition, multiple solid foci of pancreatic tissue were scattered (Figure ). This lesion was diagnosed as esophageal duplication cyst from these findings. Post operative course was satisfactory, and the patient was discharged from our hospital at 12 days postoperatively. She was symtoms-free at 9 months from operation. |
A 74-year-old woman was referred to upper gastrointestinal endoscopy due to weight loss of 10 kg in 6 months, epigastric discomfort, nausea, and episodes of vomiting. She had a previous history of a tachy-brady syndrome resulting in pacemaker implantation two years before and received metoprolol treatment.\nUpper endoscopy showed large areas of intramucosal hemorrhage, mainly in the corpus and cardia of the stomach, whereas in the duodenal bulb, there was a polypoid lesion (). A biopsy was taken from a small area with modest signs of intramucosal hemorrhage resulted in a profuse bleeding that was stopped with endoscopic clips. Biopsy collection from the polypoid lesion in the duodenum was apparently uncomplicated. In the evening, after the endoscopy, the patient had one episode of red hematemesis, but endoscopy the next day did not reveal the bleeding site, and Hb was 13.8 g/dL. Histological examination of the biopsies from the stomach showed amyloid deposits, and the lesion in the duodenal bulb was ectopic gastric mucosa with amyloid deposits ().\nSubsequent diagnostic examinations revealed monoclonal component at serum electrophoresis quantified as immunoglobulin G (IgG) λ 6.4 g/L. Bone marrow biopsy showed a slight increase in plasma cells positive for light chain λ as a sign of monoclonal plasma cell expansion (). These bone marrow changes did not fulfill criteria for multiple myeloma and were considered compatible with monoclonal gammopathy of unknown significance (MGUS). Further workup demonstrated considerable myocardial thickening by echocardiography with a reduced short axis contraction compatible with amyloid deposition. High troponin T (60 ng/L) and NT-proBNP (15000 ng/L) values were found, indicating stage III cardiac involvement, which has a dismal prognosis. Additionally, the patient had neuropathic pain, neurographic signs of axonal, and demyelinating sensorimotor polyneuropathy, also assumed to be caused by amyloid deposition. The diagnosis was hence AL amyloidosis with gastroduodenal, cardiac, and neuropathic involvements. The patient started treatment with dexamethasone, melphalan, and bortezomib which has been shown to induce a very high rate of deep biochemical response in multiple myeloma with improved survival []. Amyloidosis has previously been considered as a condition not amenable to treatment, but it is important to know that combinations of either melphalan or bortezomib with dexamethasone can induce organ responses in about 30–50% of patients with amyloidosis []. After treatment started, the nausea and epigastric discomfort improved and a reduction in biochemical markers such as troponin T, NT-proBNP, and M-component was observed. |
A 55-year-old man presented with the chief complaint of dysphagia. A suspected right level IV lymph node metastasis and a neoplastic lesion located in the inferior pole of the thyroid to the mediastinum were observed. Because the boundary between the inferior pole of the thyroid gland and the tumor was unclear, and a calcified lesion was observed in the tumor, thyroid cancer was suspected.\nWe performed fine needle biopsy on the caudal thyroid tumor and right level IV lymph node, created cell blocks at the time of cytodiagnosis, and performed thyroglobulin, thyroid transcription factor-1 (TTF-1) and Hecter Battifora mesothelial epitope-1 (HBME-1) immunostaining. However, the results of immunostaining were negative, and based on the results of the cytodiagnosis, poorly differentiated squamous cell carcinoma was suspected. A generalized examination consisting of contrast-enhanced computed tomography (CT), FDG-positron emission tomography (PET), and endoscopy did not reveal a clear primary site in the head and neck region, and in addition to the mediastinal tumor, a right level IV cervical lymph node metastasis, pulmonary metastases, and bone metastases were observed (Fig. ).\nThe results of the biopsy performed on the level IV lymph node metastasis to determine the tissue type revealed a metastasis of a squamous cell carcinoma. Based on this, we diagnosed occult primary squamous cell carcinoma and initiated treatment. Chemotherapy consisting of cetuximab, cisplatin, and fluorouracil was initiated 1 month following the initial presentation. The result was stable disease. We administered an additional course of chemotherapy consisting of cetuximab, cisplatin, and fluorouracil, but the result was progressive disease, and edema of his cervical and facial regions and tracheal stenosis worsened.\nEndotracheal fiber examination showed tracheal invasion of the tumor, and CT revealed mediastinal tumor infiltration of the large vessels of the chest (left common carotid artery, brachiocephalic artery, and brachiocephalic vein) and thrombosis of the bilateral internal jugular veins (Fig. ).\nBecause the airway was becoming blocked, we performed a tracheotomy and placed a long intubation tube just above the tracheal bifurcation. A mediastinal tumor biopsy was also simultaneously performed. After performing airway management, we administered palliative irradiation (16 Gy/2 Fr) but no efficacy was noted. Biopsy results revealed papillary thyroid carcinoma and partially anaplastic transformation (Fig. ).\nThe anaplastic thyroid carcinoma was stage IVC, and the tracheal stenosis progressed to the region just above the bifurcation of the trachea because of the infiltrated tumor. Therefore, we thought that suffocation would be unavoidable in the near future (Fig. ).\nBecause there are no conventional treatments that are believed to be effective for anaplastic carcinoma, we initiated the administration of lenvatinib (full dose, 24 mg) after having obtained consent from the patient and his family members and having performed a heart evaluation and screening for brain metastases. |
A 42-year-old G2P1001 presented for a routine growth ultrasound at 36 wk 5 d. The fetus was found to have a vein of Galen malformation, which had not been identified during the 20-wk anatomy scan (Figure ). A review of her medical history was significant for a prior uncomplicated full-term vaginal delivery. Her living child is alive and well, meeting all appropriate milestones. The patient denied any significant family history for congenital anomalies or social history for toxic environmental or occupational exposures. Prenatal care was otherwise uneventful. Fetal MRI confirmed the diagnosis of VOGM, demonstrating a persistent median prosencephalic vein, which measured up to 22 mm in the transverse dimension and 74 mm in length (Figure and C). There was a network of feeding vessels (greater on the right as compared to the left) in the region of the medial temporal lobe, midbrain, and thalami, which likely represented feeder vessels emanating from the posterior cerebral arteries. Torcula and bilateral transverse sinuses were also enlarged. The lateral ventricles and cortical sulci were appropriate for the patient's gestational age. The infratentorial brain appeared normal, with no mass effect or midline shift.\nA fetal echocardiogram showed cardiomegaly with preserved biventricular systolic function. The superior vena cava (SVC) was moderately dilated. The right atrium was severely dilated whereas the left atrium was only mildly dilated and there was an aneurysmal patent foramen ovale (PFO) with right to left shunting. The right ventricle (RV) was moderately dilated with qualitatively good RV systolic function. There was marked reversal of flow in the distal aortic arch, apparently draining predominantly to the brachiocephalic artery.\nOver the next 2 d, repeat sonographic evaluation demonstrated new polyhydramnios and abnormal Doppler studies. The fetus developed an abnormal fetal heart rate tracing with areas of minimal variability and non-reactivity. At this point, because of the massive VOGM causing a steal phenomenon, evidence of heart failure, worsening doppler studies, and fetal monitoring showing fetal compromise, the decision was made to proceed with delivery and to achieve optimization of management in the neonate. An elective uncomplicated primary cesarean section was performed because of fetal cardiac failure and breech presentation. The neonate had Apgar scores of 4 at 1 min and 8 at 5 min. Cord blood gas studies showed a pH of 7.30 and base deficit of -2.2.\nPhysical examination revealed a weight of 2675 g (25th centile), length 47 cm (30th centile), head circumference 33 cm (40th centile). No visible anomalies were noted at birth. The pertinent physical findings were cranial bruit and a grade 2/6 soft systolic heart murmur at the left sternal border.\nChest radiography immediately after birth showed cardiomegaly. An echocardiogram performed at 1 h of life showed pulmonary hypertension, patent foramen ovale, dilated superior vena cava and reversal of flow in the descending aorta. Neurosonogram showed a large midline venous structure. MRI and magnetic resonance (MR) angiography showed VGOM and the vessels feeding the aneurysm (Figures and ). The feeding arteries are from bilateral middle cerebral arteries, bilateral anterior cerebral arteries and posterior cerebral arteries.\nOver the first few days, the infant gradually became tachypneic and had a hyperdynamic precordium. Medical treatment of cardiac failure (furosemide, digoxin, and milrinone) was begun on the second day of life. Since the patient showed signs of cardiac decompensation despite the cardiac failure therapy, embolization with N-butyl cyanoacrylate (NBCA) was performed via the umbilical artery catheter at 7 d of age. The patient was intubated and placed on a conventional ventilator at 10 d of age. Trans-femoral embolizations were performed on the 10th, 12th and 14th day of life, and finally trans-axillary artery embolization was performed at 19 d of age. A repeat neurosonogram done on the 19th day of life showed intraventricular hemorrhage and mild post hemorrhagic hydrocephalus, which however, did not require any intervention. The patient was extubated on the 20th day of life, MRI and MR angiography performed on the following day showed that the dilatation of the Vein of Galen had decreased markedly (Figure ). The infant was discharged at 53 d of age. When seen at 6 mo of age in the follow-up clinic, the patient was developing normally. |
Patient 2 is a 28 year-old-male who first presented to our outpatient clinic at the age of 16 years. He was born on term as the second of dizygotic twins through planned caesarean section. Pregnancy was normal and there were no reports of perinatal complications. At about 6 months of life a delay in motor development compared to his twin brother and axial hypotonia with poor head control were noticed as well as leg spasticity. Speech development was also delayed. At 8 months, he would sit in a “W” position. This sitting position was maintained for several years. At 2 years of age he would stand up independently. Ambulation was achieved in a crouched position with marked difficulty. Milestones such as unsupported sitting, standing with normal posture or walking were never reached. At the age of 2, he began having sudden attacks with flexion of the arms, extension of the legs and reclination of the head and/or the trunk. These attacks would occur up to 30 times a day, mainly during drowsiness or sleep, and would interrupt sleep. They were triggered by quick changes of muscle tone (active or passive) and had a duration of less than 1 min. There were no prodromal signs, no loss of consciousness, enuresis or encopresis. Family history was negative for neurological conditions, especially regarding the dizygotic twin brother as well as a 2 year older brother.\nPrior to referral to our outpatient clinic, a broad clinical and genetic work-up had been performed: cerebral MRI, extensive metabolic screening and repetitive EEGs had shown normal results. Sensory- and motor-evoked potentials of the lower limbs were indicative of a central defect. Genetic testing was negative for spinocerebellar ataxias, generalized dystonia and Pantothenate kinase-associated neurodegeneration. The nocturnal attacks described above were misdiagnosed as sleep-related hypermotor epilepsy and treatment was initiated with antiepileptic medication. A detailed list is summarized in Table .\nClinical exam at the first visit showed a 16-year-old young man sitting in a wheel-chair with head support. He had narrow eyes, a long thin face and oromandibular dystonia (involuntary jaw opening) as well as perioral myoclonic jerks and tongue dyskinesia. Execution of voluntary facial movements was impaired (e.g. unable to close his eyes when asked or show a sad face). Speech was effortful and dysarthric. Cervical dystonia was intermittent and predominantly phasic. He had spastic tetraparesis more pronounced on the right side with normal deep tendon reflexes but positive pyramidal signs on both feet. All limbs were preferably held in a flexed position, dystonia was induced by action. Myoclonus was present at rest and also triggered by voluntary movement. Ambulation was possible for a few steps in a crouched position. Fine motor skills were significantly impaired. He had to be fed, needed help to wash himself and to dress. A systematic neuropsychological exam was normal. He completed secondary school and was trained to work in counselling for social inclusion.\nBefore DBS surgery, the patient took 4.5 mg clonazepam and 25 mg diphenhydramin at night. At the age of 20 years, he underwent neurosurgery with implantation of bilateral pallidal electrodes (Medtronic 3389–28) and a Medtronic Activa PC IPG. After the implantation, he reported on reduction of the nocturnal hyperkinetic episodes by 90%. The benzodiazepines were slowly reduced to 0.5 mg/night over the following months. He reported a general subjective improvement of the hyperkinetic disorder of about 50%. Retrospective assessment of videos revealed only a slight reduction in AIMS and no effect on BFMDRS (see Table for details). Almost complete cessation of nocturnal hyperkinetic attacks persisted over the entire follow-up period. In addition to improved sleep, no specific improvements in activities of daily living were reported after DBS. There were six episodes with severe worsening of dystonic features and/or nocturnal attacks that led to admission through the emergency service of our hospital. Three times (3 months, 6 years and 6 and a half years after surgery), a technical defect was detected and either both connecting cables or connecting cables and leads were replaced. Three times (4, 7 and 8 years after surgery), worsening of the movement disorder was due to battery exemption and improved after replacement. The pathological ADCY5 mutation was first detected 8 years after DBS implantation. |
A 3-month-old male was seen in our pediatric oncology department because of a growing parotid gland mass. The mass was congenital and was followed by the pediatric oncology team with a prediagnosis of hemangioma. The patient’s magnetic resonance imaging (MRI) scan showed an infantile hemangioma in the proliferative phase filling the parapharyngeal space ().\nThe child then received propranolol therapy, but despite this treatment the mass continued to grow, and the child was referred to our department at the age of 10 months. The otorhinolaryngological examination revealed an 8×7-cm mass filling the left parotid region, with normal facial nerve motor functions (). Histopathological diagnosis of the mass was provided by an incisional biopsy as sialolipoma.\nWe planned to perform total excision of the mass with a transparotid approach. The facial nerve was monitored intra-operatively, and surgery was performed under magnification using surgical loops. A standard modified Blair incision was used, flaps were raised (), then the facial nerve was identified in a standard fashion using a tragal pointer and posterior belly of the digastric muscle as landmarks.\nThe main trunk of the facial nerve was found to be unusually elongated before pes anserinus. A soft lobular mass was encountered. A tumor involving the superficial parotid lobe was first dissected, then the deep lobe of the parotid gland and portion of the tumor filling the parapharyngeal space were gently dissected under the facial nerve (). A Jackson-Pratt drain was inserted into the wound after the excision of the tumor.\nOn macroscopic examination, the mass was found to be a lipomatous specimen, 9×8×4 cm in size. The cut surface was consistent with the appearance of a lipoma. Histopathologic examination confirmed the diagnosis of a sialolipoma. The lesion was composed of mature adipose tissue mixed with acinar, ductal structures of a normal salivary gland ().\nThe postoperative period was uneventful. The patient’s facial nerve motor functions were well preserved, and he was discharged on the third postoperative day. The patient is still followed, and has no signs of recurrence in his 24th postoperative month. |
A 49-year-old female was diagnosed with a 7×6×4 cm posterior mediastinal mass on the right side of the 8th, 9th, and 10th thoracic vertebrae. She was asymptomatic. The mass was found incidentally by a routine check-up chest X-ray image (). Tumor excision was performed through a right posterolateral thoracotomy, and no evaluation of the resection margin was conducted. Histological examination indicated increased cellularity, mild cellular atypism, and low mitotic activity, which was consistent with a benign peripheral nerve sheath tumor. On the basis of these findings, the tumor was diagnosed as a schwannoma. The possibility of recurrence was not considered, and no long-term follow-up surveillance was performed.\nThirteen years later, she was referred to our hospital with an asymptomatic right posterior mediastinal mass. Similar to the previous occurrence, a cellular schwannoma was detected by a screening computed tomogram. The images revealed a 5.6×4.6×2.5 cm lobulated mass at the level of the 9th, 10th, and 11th thoracic vertebrae with the possibility of involvement in the 11th right neural foramen. To determine the correlation between the mass and the spinal nerve, we performed magnetic resonance imaging. The soft-tissue mass originated from the 11th intercostal nerve, extending to the right neural foramen of the 11th and 12th thoracic vertebrae. Due to its heterogeneous signal intensity, the tumor was thought to be a benign neurogenic tumor ().\nThrough the previous incision, a right posterolateral thoracotomy was conducted. We found two solid round masses at the paravertebral area of the 10th, 11th, and 12th thoracic spinal bodies. With the exception of the apex area, pleural adhesion was minimal. A neurosurgeon examined the lesion and confirmed that there was no severe extension of the tumor through the vertebral foramen. The two connected masses along with the 11th intercostal nerve were resected with sufficient margins. An intraoperative frozen biopsy confirmed no involvement of the tumor at the resection margin. Three days later, the patient was discharged without complications.\nA gross examination of the specimen showed two well-encapsulated, round masses measuring 4×5 cm each. A cross-section showed thin-walled, firm, slightly yellow solid tumors with a cystic change. The two tumors were connected by a fibrous capsule (). Microscopic examination revealed a markedly increased cellularity and fascicles of spindle cells occasionally associated with a herringbone or storiform pattern. Compact and hypercellular fascicles that recapitulated the Antoni A areas were identified. An immunohistochemical study demonstrated diffuse and strong positivity for the S-100 protein (). On the basis of these findings, the tumors were diagnosed as cellular schwannoma.\nBecause we could not find the remaining pathologic specimen or microscopic images from the earlier tumor occurrence, a direct comparison between the two tumors could not be performed. However, the pathologic description of the first tumor was consistent with cellular schwannoma. Further, the slight difference between the two lesions may be attributed to the larger size and upward extension of the first tumor. Therefore, we made a clinical diagnosis that the tumors were most likely recurred cellular schwannomas caused by an incomplete resection performed 13 years earlier. |
Diabetic male, 57 year old presented to us with history of pain in left ear for the last 8 days. 48–72 hrs after the onset of otalgia, patient developed facial weakness on left side along with vesicular eruptions on left conchae and in left external auditory meatus. After another 24–48 hrs patient had similar episode on right side. On the day of reporting to us patient was having bilateral facial weakness, impaired taste sensation, dryness of eyes along with decreased hearing on both sides but there was no history of vertigo or any ear discharge. There was history of stressful life events in past 6 months before the onset of rash.\nOn examination, there was bilateral lower motor neuron facial palsy which was complete. Bell's phenomenon was present on both sides Fig-. There were adherent crusts and scabs in left conchae and external auditory meatus. While vesicular eruptions were present in right external auditory meatus. Tuning fork tests were showing bilateral sensorineural hearing loss.\nThe patient was admitted and investigated. His postprandial blood sugar was 339 mg%, HbAIc was 7%. Pure tone audiometery was showing mild to moderate bilateral sensorineural hearing loss, stapedial reflexes were absent on both sides on tympanometery. There was impaired taste sensation from anterior two third of tongue. ELISA and Western Blot tests for HIV infection were negative. Liver function tests, tumor markers, thyroid hormones; serum ACE levels were all with in normal limits. Lumbar puncture revealed normal pressure. Glucose, protein and white blood cell count were all with in normal limits in CSF. Plain X-ray views of mastoid, internal auditory meatus and chest were normal. Computerized tomography of brain stem, cerebellopontine angle, temporal bone and skull base were normal. A smear from floor of vesicle stained with Giemsa stain showed degenerating cells with multiple nuclei. This favoured the clinical diagnosis of herpes zoster oticus. This diagnosis was confirmed by detection of IgM antibodies to Varicella-Zoster virus by ELISA test.\nDiabetes of this patient was controlled with insulin. Intravenous acyclovir was given in dose of 10 mg/kg every 8 hr for 7 days. Glucocorticoids were avoided in this patient due to diabetes, but NSAIDS were given. After 2 weeks of treatment and diabetes control, pure tone audiometery showed improvement in hearing by 10 db in all frequencies. 8 weeks later in the follow up, patient was able to close his eyes completely Fig-. and facial nerve functions on both sides recovered; recovery was more on right side. |
A 20-year-old female presented to our center with a telangiectatic osteosarcoma of the humerus. There was no history of malignancies within the family.\nMRI examination and open biopsy were performed by the previous physician. At the time the results were thought to be malignant lymphoma. After several diagnostic trials, the patient visited our center to seek advice about her telangiectatic osteosarcoma (A).\nWe observed a circumferential mass on the distal part of the right arm with a slight deformity of the arm, with marked venous engorgmnt and distal edema. The mass was warm and solid on palpation. Function of the right hand was still preserved. From the laboratory findings, there were marked elevation of the alkaline phosphatase and lactate dehydrogenase. From humerus X-ray, there was mixed lesions along the humerus with pathological fracture on the midshaft (A). T2-weighted MRI showed iso-hyperintense and expansile lesions along the humerus (A). For the metastatic workup, chest X-ray showed no coin lesions or metastatic characteristics. Patient also had a PET scan and the result was unremarkable. From the Clinico Pathological Conference (CPC) forum, it was concluded that the diagnosis was osteosarcoma of the right humerus stage IIB according to the Enneking classification.\nPatient took neoadjuvant chemotherapy regimen with Doxorubicin and Cisplatin for three cycles from January to March 2016. At the end of the third cycles, clinical and radiological evaluations were performed. Clinically the mass was not getting bigger compared to before chemotherapy (B). From x-ray, the mixed lesions became more marked compared to the previous x-ray (B). MRI showed that the mass was slightly became larger compared to the previous MRI with no involvement of neurovascular bundle (B).\nSix months after the initial complaint, the surgery was performed. We used extensive deltopectoral approach with anterolateral extension through the proximal part and curved backward to complete the posterior distal humerus and elbow approach. This approach was used because of the previous biopsy tract was in the posterior aspect of the distal humerus. The vascularity, rotator cuff tendons, biceps and triceps muscle, and majority of the nerves (musculocutaneous, radial, median, and ulnar nerves) were spared during the total resection of the humerus. Axillary nerve was sacrificed during the tumor resection. To reconstruct the humerus, both long shoulder hemiarthroplasty and total elbow prostheses were used. These two prostheses were joined using two long one-third tubular plate that worked as the long stem augmentation. Extension cerclage wire was used to make the implant as one unit (A). Finally, the stem was augmented with a bone cement from proximal through the distal. Prolene mesh then was sheathed to the bone cement, and then the preserved rotator cuff tendons and biceps and triceps muscle were sutured back with the Ethibond sutures (B). The resected tumor and humerus were then sent to the lab for histopathologic analysis (C).\nFrom the post-operative x-ray, the modified prosthesis sat well on the shoulder and elbow joint (). Function of the hand was excellent post-operatively. Patient also could immediately flex her elbow. Post-operative histopathological examination showed telangiectatic osteosarcoma with HUVOS IV (). After the wound healed without complication, patient underwent adjuvant chemotherapy. Two months after the surgery, patient could start writing with her right hand without marked difficulties. Further follow up of three years post-operatively, patient already came back to work and were able to perform daily activities without difficulties. Patient’s shoulder abduction and elbow flexion was shown on the pictures (). The MSTS functional score for the upper limb scored 83% which was excellent. There were no post-operative complications and the immunohistochemical workup used to rule out lymphoma (CD20, CD15, CD 30, and CK) would be planned. |
A 20-year-old girl was admitted to our hospital with painless swelling in the proximal right humerus of 6 weeks' duration.\nPhysical examination revealed a healthy well-developed girl with a tender, palpable, firm mass arising from the proximal shaft of the right humerus. A conventional radiographic image showed an ill-defined, aggressive, osteolytic lesion associated with a partial cortical defect in the proximal shaft of right humerus (Figure ). There was no evidence of osteoid or chondroid matrix within the lesion.\nMagnetic resonance imaging (MRI) showed an irregularly shaped extraosseous mass extending around the right humerus through the destroyed bone and invading the biceps brachii (Figure ). The lesion had similar signal intensity to muscle on T1-weighted images and a heterogeneous increase in signal intensity on T2-weighted sequences. A CT-guided biopsy was performed, and the specimen demonstrated atypical cells and reactive new bone. Bone scintigraphy with 740 MBq 99mTc-HMDP showed no abnormal accumulation other than in the proximal right humerus.\nOne week after preoperative chemotherapy, which included cisplatin and adriamycin, a total tumor excision-alcoholization-replantation (EAR), internal fixation and bone cement implantation were performed. With the patient under general anesthesia; the anteriomedial approach to the humerus which included the pathway of CT-guided biopsy was used. After detachment of the biceps and triceps brachii, the tumor was found to involve the anteriomedial portion of the proximal humerus and part of the biceps brachii. The site of cortical destruction was not related to the attachment of any tendon or ligament. The whole tumor was detached from the bone and resected. (Figure ) The humerus was sawed completed through 3 cm distal from the distal end of tumor and a fast frozen biopsy was excised from the periosteum at this site and the proximal end of the tumor with no tumor cells found. The proximal end of the humerus was slivered and the medullary canal was scraped. To destroy all tumor cells that might be remaining in the bone, we put the proximal humerus into 95% ethanol for 30 min. Similar to Pezzillo's method, [] we then implanted bone cement into the medullary canal and fixed the humerus with a Limited contact dynamic compressive plate (LC-DCP, SYNTHES, Switzerland) (Figure ).\nRoutine histopathological studies with hematoxylin-eosin (HE), and immunohistochemical investigations with S-100 and HMB-45 were performed. Histological studies with HE showed fibrous septa divided into well-defined nests and polygonal and fusiform cells with clear cytoplasm (Figure ). Immunohistochemical studies demonstrated strong positive cytoplasmic staining with S-100 and scattered positivity with HMB-45 (Figure ). With the tumor displaying these morphological and immunoenzymatic features, the neoplasm was diagnosed as clear cell sarcoma\nAfter the operation, the patient undertook routine chemotherapy consisting of cisplatin, adriamycin and methotrexate for 2 years. She has been followed up every month and the humerus was found to be completely reconstructed one year after treatment. (Figure ) |
A 44-year-old Japanese man presented to the Maxillofacial Surgery Clinic at the Tokyo Medical and Dental University, Tokyo, Japan, with reports of a hard mass and dull pain in the left mandible. His medical history was generally unremarkable, though his mandible had been accidentally smashed against his young son’s head at the age of 40. No fracture was detected at the time, and no treatment was received.\nClinical examination revealed slight swelling in the left lower molar region and swelling of the left mandible. There was no disturbance of sensitivity in the left lower lip or chin, and he could move his lips normally. Radiographic examination showed large, irregular, multilocular radiolucency of the left area of mandible extending to the premolar and molar area, with no evidence of any impacted tooth (Fig. ). A computed tomography (CT) image revealed a 45 × 30 × 30 mm multilocular cystic mass in the mandible (Fig. ). An axial CT image showed thinning or partly resorption site of the buccal cortical plate. The coronal section images of the CT scan showed the mass lesion displacing the mandibular canal downward, near the inferior border. The roots of the adjacent teeth were resorbed, changing their shapes (Fig. ). The location of the teeth was not changed.\nThe initial clinical impression was an ameloblastoma, myxoma, keratocystic odontogenic tumor or another tumor type lesion.\nThe lesion was removed surgically with the buccal cortical bone and buccal mucosa in contact with the mass of the tumor. The mass fully excised intraorally under general anesthesia, and the inferior alveolar nerve in contact with the mass was preserved.\nThe resected specimen of the primary tumor was a soft, fragile, yellowish-white mass. Microscopically, tumor tissues were composed of plexiform or cord-like nests of tumor cells with round to oval nuclei and eosinophilic cytoplasm in a matrix with prominent myxoid change (Fig. ). On the other hand, the component of solid sheets of tumor cells was limited (Fig. ). In some areas, tumor cells surrounded small blood vessels (Fig. ). Moreover, tumor cells manifested a uniform cell morphology, poor dysplasia, and inconspicuous mitosis.\nImmunohistochemical staining was positive for vimentin (Fig. ), muscle-specific actin/HHF35 (Fig. ), and Calponin (Fig. ), a protein responsible for binding the actin-binding protein. A hairline-shaped area of positive staining for type IV collagen surrounding the tumor cells was also observed (Fig. ). VEGF and D2–40 was also focally positive in tumor cells. In contrast, staining for alpha-SMA, cytokeratin (AE1/AE3), cytokeratin (CAM5.2), CK19, CD34, CD68, p63, S-100, Factor VIII, and desmin, CD56, chromogranin A, synaptophysin was all negative in the tumor cells. Moreover, CD31 was also negative, but we observed many blood cells intervened between tumor nests. The Ki-67 labeling index was almost 1%. No necrosis or tumor invasion into the neurovascular channel was observed. The primary tumor was diagnosed as a glomus tumor based on these findings.\nThe patient remained symptom-free and manifested no signs of recurrence. However, a recurrent tumor was detected in a panoramic radiograph during an 8-year follow-up. The panoramic radiographs taken earlier, after excision of the primary tumor, showed normal healing process, bone regrowth, and increased radiopacity. The follow-up panoramic radiograph 8 years later depicted the recurrence as a radiolucent expansion in the lower area of the mandible. A CT exam showed an expanding lesion exiting the lower site of the mandible and a thinning buccal cortical bone in contact with the tumor (Fig. , ). In magnetic resonance imaging (MRI), the recurrent lesion showed a lower or compatible signal intensity compared to the muscle in T1-weighted images and a low-to-high inhomogeneous signal intensity in T2-weighted images. The apparent diffusion coefficient in the glomus tumor area was 2.0 × 10− 3 mm2/sec, suggesting a low cellular density (Fig. -).\nThe recurrent tumor mass and related teeth were removed under general anesthesia, and the bone surface was shaved. The recurrent tumor had the same microscopic, morphologic, and immunohistochemical features as the primary tumor (Fig. ). The tumor invaded the medullary cavity of the mandible, involving spongiosa and resorbing compressively the cortex bone around tumor.\nThe patient has no symptoms of recurrence as of this writing, 2 years after the second operation, and will be followed for the long term to promptly detect any signs of new tumor growth.\nThe patient is satisfied that the glomus tumor was regulated without resecting the mandibular region. He is pleased that there was no functional deterioration that he was worried about before treatment and there was no aesthetic damage.\nTimeline of patient diagnosis and treatment.\n1. 4 years before the first visit, the patient had been smashed against his young son’s head.\n2. At first visit, the symptom was slight swelling of the left mandible. There was no disturbance of sensitivity. The examinations were performed with X-lay and CT.\n3. First surgery was performed and started clinical follow-up after the surgery.\n4. 8 years later from first surgery, the recurrence was found by panoramic radiograph. The examinations were performed with CT and MR.\n5. Second surgery was performed, and it was passed 2 years with no recurrence from second surgery. |
A 20-year-old female was referred with an OCD of the right talus. Her symptoms had started after a supination trauma of the ankle. She had been treated twice in the referring hospital. During both procedures, the defect was excised and curetted through anterior arthroscopic surgery. The last procedure was 1 year and 2 months before her presentation.\nAt presentation, the patient’s predominant symptom was pain deep in the ankle joint during and after activity. She used to play korfball at competitive level but had stopped due to the pain. Korfball is a mixed gender team ball game, similar to mixed netball and basketball, and is very popular in the Netherlands.\nAt physical examination, leg alignment was neutral, the range of motion was normal and symmetric, and both ankle joints were stable. There was no recognizable tenderness on palpation.\nRadiographs of the right ankle revealed a large cystic osteochondral defect of the medial talar dome (Fig. ). A computed tomography scan confirmed the osteochondral defect, measuring 17 × 8 × 8 mm, accompanied by some small subchondral cysts and a loose fragment. After informed consent was obtained, the patient was scheduled for surgery.\nA curved skin incision was made over the medial malleolus. After two screw holes were predrilled in the medial malleolus, a medial malleolar osteotomy was made at an angle of 30 degrees relative to the long tibial axis [], exposing the osteochondral defect (Fig. a).\nThe defect was debrided. Utilizing a drill guide, a guide pin was placed into the center of the defect, perpendicular to the curvature of the medial talar dome. The cannulated screw was inserted. A contact probe was used to determine the radius of curvature; an offset size of 0.5 × 3.5 mm was measured. A matching reamer prepared the site for placement of the articular component. A trial articular component allowed for final verification of proper fit (Fig. b). The selected articular component was placed on the screw (Fig. c). It was impacted, thereby engaging the taper interlock (Fig. d). The osteotomy was fixated with two 3.5-mm lag screws, and the wound was closed.\nThe postoperative management was initiated with a plaster cast for 1 week and continued with a functional brace (Walker, Össur, Son en Breugel, the Netherlands) for 5 weeks. After this 6-week period, radiographs of the operated ankle confirmed consolidation of the malleolar osteotomy. Physical therapy was prescribed to advance to full weight bearing in 1 month.\nThe patient recovered well from surgery. Initially, there was a small area of numbness about the scar but this had resolved at 3 months follow-up. The patient was able to play korfball at the preinjury level after 1 year and continued to play at this level at 2 years follow-up. The sagittal range of motion arc remained slightly reduced: 15° of dorsiflexion to 45° of plantar flexion compared to 20° of dorsiflexion to 45° of plantar flexion in the left ankle.\nUsing numeric rating scales, the patient preoperatively rated the pain as 0 when at rest, 8 when walking, and 10 when running. These numbers improved to 0, 0, and 1 at final follow-up, respectively. The Foot and Ankle Outcome Score [] improved from preoperatively to final follow-up on four of five subscales; the subscale “other symptoms” decreased due to subjective inability to fully straighten and bend the ankle. The American Orthopaedic Foot and Ankle Society ankle-hindfoot score [] improved from 74 preoperatively to 90 at 1 and 2 years.\nRadiographs were obtained at all follow-up visits. The implant remained in position, and there were no signs of osteolysis or progressive degenerative changes in the ankle joint (Fig. ). |
A 66-year-old male visited Yizheng People’s Hospital (Yangzhou, China) due to a nodule on the left side of the forehead, which was accompanied by orbital pain and occasional headaches that had been apparent for 4 months. The patient was administered several courses of antibiotics, however, these did not relieve the symptoms. One month prior to the patient being admitted to the Northern Jiangsu People’s Hospital (Yangzhou, Jiangsu, China) the headaches became continuous and extremely severe in the left side of the forehead over the frontal sinus region. The patient was consequently transferred to the Department of Neurosurgery in December 2012. A physical examination revealed a giant, solid and low mobility ~4×6-cm subcutaneous nodule on the left side of the forehead (). The patient could not open the right eye fully due to the nodule. Computed tomography (CT) and MRI of the head showed a large uneven soft-tissue mass measuring 54×76 mm in the left frontal sinus, with intracranial extension into areas that included the frontal lobe, the anterior wall of the ethmoid sinus and the orbit. The signal of the mass was hypointense on T1-weighted MRI images and hyperintense on T2-weighted images. The lesion showed uniform homogenous enhancement following gadolinium-contrast injection (). The patient had no family history of sinus cancer, was not taking any medication, did not smoke and did not drink alcohol. The erosion of the frontal bone gave rise to the suspicion of malignant disease or a metastatic tumor.\nA frontal craniotomy was performed with the aim of removing the tumor in December 2012. Subsequent to opening a skin flap, the tumor was found to invade through the frontal bone and to extend to the left frontal lobe (). The extra-cranial lesion was resected en bloc as widely as possible and the erosion of the frontal bone was extended by resection into the normal bones and dura, to remove a section 7×8 cm in diameter (). During the surgical procedure, the intra-cranial lesions invading the left frontal lobe, ethmoid sinus, superior sagittal sinus and the wall of the orbit were radically resected. The lesion in the ethmoid sinus was coagulated by electrocauterization subsequent to an extended resection. The frontal base was opened to the ethmoid sinus and sphenoid sinus for drainage to the nasal cavity. The defect of the dura was patched using a Neuro-Patch (DuraMax; Beijing TianXinFu Medical Appliance Co., Ltd., Beijing, China). The forehead and frontal skull base were reconstructed with a rectus abdominis myocutaneous free flap.\nHistopathological examination of a biopsy revealed a proliferation of large round cells with abundant cytoplasm (). The result of the histopathological examination was a diagnosis of SCC. Given that primary carcinomas of the frontal sinus are rare, the patient underwent further investigations, including chest and abdominal CT scans and a pelvic ultrasound. The results showed that there were no other primary lesions in the other organs. The histological, radiological and investigational results were all diagnostic of a primary carcinoma of the frontal sinus. Four weeks after the surgical procedure, radiotherapy (50 Gy in 15 fractions) was performed. Six months after the surgery, the repeat MRI examinations did not find evidence of recurrence or metastatic lesions. |
A 28-year-old female patient suffered from postprandial lower chest pain and heartburn for more than one year. Her past medical history and family history were unremarkable. She lost 4 kilograms and did not experience dysphagia or regurgitation. Three months before her visit to our hospital, the pain had become more severe. The upper gastrointestinal endoscopy (UGIE) performed at another hospital showed a lower esophageal ulcer, which was located just above the gastroesophageal junction, hiatal hernia, and antral-predominant gastritis (Figures and ). The H. pylori antibody test was positive, and the histological result of esophageal ulcer was benign. The patient received H. pylori eradication therapy followed by a regimen of proton pump inhibitor (PPI) at a standard dose in combination with antacid for more than 8 weeks. However, her pain did not resolve and she sought for medical consultation in our hospital.\nWe managed the patient as a case of refractory GERD. At first, the patient was treated with rabeprazole 20 mg bid in combination with alginate-antacid at bedtime for 2 weeks. The pain improved but was still intolerable and badly affected her sleep quality. The regimen was switched to rabeprazole 20 mg bid in combination with amitriptyline 12.5 mg at bedtime, which resulted in a complete clinical response and was continued for 10 weeks. The dose of rabeprazole was then tapered to 20 mg qd aiming to stop completely before UGIE was performed to document the efficacy of treatment. However, the pain recurred badly after about a week. The patient requested us return to double-dose rabeprazole, which again relieved the pain.\nThe second UGIE performed when the patient was still on PPI showed that the lower esophageal ulcer had completely healed (Figures and ). There was a protrusion at the cardia, which was only identified when air was minimum insufflated, suspected of a submucosal lesion. Endoscopic ultrasound (EUS) and CT scan were performed which surprisingly showed a giant submucosal tumor at the fourth layer of the lower esophagus and the cardia (Figures and ). EUS-FNA was performed, and the histological examination confirmed that this lesion was a leiomyoma ().\nThe patient was performed laparoscopic transhiatal surgery to enucleate the esophageal leiomyoma. In addition, hiatal hernia was repaired with laparoscopic Nissen fundoplication (). As the tumor is too large, it was cut into pieces to facilitate its removal. The solid straightened tumor was approximately 8 cm × 3 cm in size (). The patient made an uneventful postoperative recovery. During the first two weeks, she had experienced dysphagia and regurgitation, which have resolved completely.\nFour months after her surgery, UGIE was performed again which showed good results of fundoplication surgery (Figures and ). The patient sometimes had epigastric pain which could be completely controlled with intermittent rabeprazole therapy at a standard dose. |
A 40-year-old Japanese man presented at an Ear, Nose and Throat clinic with left-side hearing loss and tinnitus without otalgia or vertigo that had been present in the prior 10 days. A tumor was identified at the opening of his left ear canal, and he was referred to our hospital. The tumor was smoothly covered by the skin, and it was not mobile. It obstructed his ear canal so that the tympanic membrane was hidden from view (Figure ). The pure tone audiogram showed mild conductive hearing loss with an air-bone gap of 20 to 45dB. Computed tomography showed a homogeneous mass from the posterior wall of his left ear canal without infiltration into the other structures. In the ear canal, the area between the tumor and the tympanic membrane was isodense (Figure ).\nConsidering these noninvasive findings, this tumor was suspected to be benign. Surgical treatment under general anesthesia was performed two months after the start of symptoms. The tumor was resected en bloc via a postaural and endaural approach with a margin including cartilage and skin. A significant amount of hyperkeratotic substances were present behind the tumor, apparently retained debris. The tympanic membrane was preserved without appreciable change. A full-thickness retroauricular skin flap and fascia temporalis were used to cover the cutaneous defect of the ear canal.The tumor size was 18×12×12mm. It was well circumscribed and its cut surface was whitish (Figure a). Microscopically, the tumor showed a mixture of epithelial cells with formed ducts and myxomatous stroma with spindle cells. It had a cartilage component. The pathological diagnosis was PA (Figure b). The tumor was sharply marginated, but its capsule was not formed sufficiently, so that it invaded the surrounding fat tissue in some places. The margin of the excision was clear. Approximately two years after the tumor removal, there was no stenosis of the ear canal or recurrence of the tumor. |
The individual was a 24-year-old African American male inpatient at a state psychiatric facility. His psychiatric diagnoses included unspecified schizophrenia and psychosis as well as alcohol, cannabis, and nicotine use disorders. His somatic diagnoses included benign ethnic neutropenia and constipation. During the time of this report, his psychiatric medications included haloperidol decanoate 300 mg IM every 28 days in the deltoid and quetiapine 800 mg PO at 9 pm for the past 1.5 years. His somatic medications included polyethylene glycol, docusate, and benztropine. During a previous admission, the patient received daily PO haloperidol (maximum 40 mg/d) but did not receive decanoate. He had no known food or drug allergies. Both haloperidol decanoate and quetiapine were continued at these doses throughout the duration of this case report.\nAs part of the hospital's routine vital sign monitoring, monthly temperatures were recorded for the patient from hospital day (HD) 1-263. With the local onset of the COVID-19 pandemic, daily temperatures were recorded starting on HD 263. Because of the increased frequency in temperature monitoring, a pattern began to emerge in which the patient's temperature was noted to be elevated shortly after receiving his haloperidol decanoate injections (). Upon questioning, the patient reported feeling feverish after injections since the beginning of haloperidol decanoate therapy, but no fevers were recorded due to the infrequency of temperature monitoring prior to the COVID-19 pandemic. He also reported that there was usual injection site pain, swelling, and a “knot” feeling that resolved within a few days. During the time of the fever, muscle rigidity or mental status changes were not observed. Out of the 11 haloperidol injections after initiation of daily temperature monitoring, a temperature of greater than or equal to 100.0°F occurred after 7 injections, each within 2 or 3 days. After each of these occurrences, he received 1 to 2 doses of acetaminophen, and the temperature returned to baseline until the next injection. No other doses of acetaminophen were utilized until the administration of the last 2 recorded haloperidol decanoate doses (HD 520 and 548). At this point, ibuprofen and acetaminophen were given prior to the injection and for the 3 days following as a preventative measure. This was effective against fever and the other adverse reactions he previously experienced, including the knot and swelling at the injection site. Unfortunately, no haloperidol levels were drawn, preventing further evaluation of why this may have occurred.\nAdditionally, the patient was started on clozapine on HD 387, reaching a maximum dose of 200 mg/d and discontinued on HD 503 due to no significant improvement in behaviors or delusions since initiation. During this time, weekly CBC counts were drawn to monitor absolute neutrophil count as a routine part of clozapine therapy at initiation. Thus, WBC counts are available during this time period, allowing analysis during haloperidol decanoate therapy (). By tracking WBC levels, another pattern emerged of elevated counts within 5 days of medication administration with a subsequent decrease that trends slightly higher than the previous month's baseline. It is important to note that this patient had benign ethnic neutropenia, which accounts for his baseline low WBC.\nAside from fever and injection site reactions, there were generally no other somatic complaints besides 1 headache on HD 354. The patient tested negative for COVID-19 multiple times as well as negative for a COVID-19 serology test on HD 551. He tested negative for influenza A/B on HD 497. Additionally, C-reactive protein levels were found to be elevated twice (HD 355 and 363), but no additional levels are available after a normal level obtained on HD 378. Creatine phosphokinase levels were not obtained due to an absence of muscle rigidity.\nOne consideration was that this adverse reaction could be occurring with any intramuscular injection because this trend was not observed when he was receiving only oral haloperidol. However, the patient received his first COVID-19 vaccination on HD 565, denied any adverse reactions, did not develop a fever postvaccination, and no acetaminophen or ibuprofen was given. |
An 8 years old male child, weighing 20 kg with diagnosis of moyamoya disease with Duchenne muscular dystrophy was scheduled for an EDAMS procedure. Magnetic resonance imaging showed right middle cerebral artery territory infarct with small foci of infarct in left frontal and high fronto-parietal white matter. There were also signs of left middle cerebral artery territory infarct and near total occlusion of right sphenoid internal carotid artery with multiple collateral vessels suggestive of moyamoya disease. The child had progressively increasing bilateral lower limb weakness and was diagnosed to have Duchenne muscular dystrophy at the age of 5 years. Patient was dysphasic and had right sided hemiparesis with right sided facial nerve palsy. Cardiovascular and respiratory systems were normal. Airway examination revealed a large tongue with Mallampati Grade 3 score. Prior to induction of anaesthesia, all the vaporizers were dismounted from the anaesthesia machine, fresh soda lime was filled into the soda lime canisters and the breathing circuits were changed. Then the anaesthesia machine was flushed at a fresh gas flow of 10 l/min for 30 min prior to remove any residual anaesthetic gases residue from prior use. It was ensured that there was absolutely no inhalational anaesthetic inside the anaesthesia machine and circuit as shown by gas monitoring. After attaching the routine monitors, child was induced with 40 mcg fentanyl and 40 mg propofol. Rocuronium 20 mg was given to facilitate endotracheal intubation. Intraoperative monitoring included electrocardiography (ECG), non-invasive blood pressure, invasive blood pressure, pulse oximetry, capnography, temperature and central venous pressure monitoring. Anaesthesia was maintained with 60% nitrous oxide-oxygen-propofol-fentanyl and rocuronium. Patient was given positive pressure ventilation and to maintain the ETCO2 between 32 and 34 mm Hg. Multiple episodes of haemodynamic fluctuations (systolic blood pressure variations from 90 mm Hg to 160 mm Hg and heart rate variations from 80 to 130 beats/min) were noticed during the dissection of subcutaneous tissue. These haemodynamic fluctuations were managed with adjustment of depth of anaesthesia and warning to the neurosurgeon. Apart from the haemodynamic variability, rest of the intraoperative period was unremarkable with no abnormality in cardiac rhythm, ETCO2, body temperature, serum electrolyte and urine output. The total duration of the procedure was 3 h. Propofol infusion was stopped 15 min prior to the end of surgery and muscle paralysis was reversed after surgery. Child was extubated when he was fully awake with good respiratory efforts.\nThe child was kept in the intensive care unit for 48 h where he made a successful recovery with no signs of rhabdomyolysis or hyperkalemia and shifted to ward for further care. He was discharged from the hospital on the 8th postoperative day. |
A 65-year-old man was admitted to our hospital for “discovering a nodule adjacent to the stoma in April that had enlarged for 1 wk, and then ruptured 1 d prior”.\nFour months ago, the patient accidentally found a small nodule on the right side of the colostomy that was approximately 0.5 cm in size without redness, swelling, or tenderness, and did not go to the doctor. Two months ago, the nodule enlarged, accompanied by redness, swelling, heat, and pain. After oral administration of cefdinir, he improved and did not take antibiotics regularly. One week ago, the patient had an enlarged nodule on the right side of the stoma, accompanied by a mass on the left side of the stoma that was approximately 4 cm × 3 cm in size, with redness, swelling, heat, pain, and a black mass of pus in the middle; intravenous infusion of cefoxitin did not alleviate symptoms. Three days ago, the nodule on the right side of the stoma ruptured, and a fistula of approximately 1.5 cm in size appeared, which caused a large amount of overflowing stool. A day ago, the mass on the left side of the fistula ruptured and released pus, so he went to our hospital.\nThirteen years ago, the patient underwent Hartmann surgery due to a sigmoid colon tumor with acute obstruction. Postoperative pathological diagnosis was stage II sigmoid colon adenocarcinoma (T4N0M0). Due to the patient's own reasons, he did not undergo regular treatment and not reverse the stoma in time. The patient was admitted to our hospital for paraostomy hernia and right inguinal hernia 3 years ago, and underwent tension-free inguinal repair and paraostomy hernia repair via an open operation. The abscess was cut for drainage 1 year ago due to a paraostomy abscess.\nThere was a 10-cm surgical scar (from the Hartmann surgical incision) on the right abdomen, a 15-cm surgical incision scar (paraostomy hernia repair incision) in the middle abdomen, and a 5-cm surgical scar on the right inguinal area. The colostomy port was located in the left lower abdomen. On the right side of the colostomy port, there was an abscess of approximately 5 cm × 5 cm in size. The skin was red, swollen, and hot. A middle ulcer was also found. The place where the mass overflowed with pus was located at the anterior upper pole of the iliac and was approximately 1.5 cm × 1.5 cm, at a depth of approximately about 2 cm, and there was pus outflow. On the left side of the stoma, there was a fistula of approximately 1.5 cm × 1.5 cm in size, located next to the belly button that had much stool overflow. A mass of approximately 5 cm × 3 cm was palpable in the left groin area, which was obvious when standing, soft in quality, and did not protrude into the scrotum.\nRoutine blood markers and tumor markers were normal, but Calcitonin original was 0.53.\nEnhanced computed tomography: The right sinus of the stoma was formed, which was the same as the intestinal cavity (orange arrow), and the parastomal hernia can be seen (Figure -). The left side of the stoma had a suspicious sinus formation (yellow arrow), with surrounding soft tissue swelling (Figure and ) and left inguinal hernia (white arrow). No tumor recurrence was seen (Figure ).\nColonoscopy: The proximal bowel (Figure and ) was not significantly abnormal; the distal bowel (Figure and ) was approximately 25 cm, and showed changes from disuse, with a large number of white mucus masses (The white mucus masses were formed by the absorption of water by intestinal fluid secreted by the colon).\nRetrograde transanal digestive tract radiography: Front view (Figure and ) and lateral view (Figure and ) showed that the distal bowel was approximately 25 cm, with no bowel stenosis and a smooth bowel mucosa. |
A 78-year-old male patient presented in April 2015 with suspected lung cancer. Chest CT examination revealed a pulmonary space-occupying lesion in the left upper lobe of the lung (Fig. ). Following fine needle biopsy, pathology confirmed the patient had lung adenocarcinoma and EGFR (Fig. ), ALK and ROS1 were negative (Fig. ). Due to the advanced age of the patient (78) together with a diagnosis of atrial fibrillation, EGFR-TKIs was recommended as the treatment of choice. From 23 October 2015, the patient commenced gefitinib 250 mg orally once a day until the disease progressed in July 2016 when CT scan of the chest indicated metastasis in the lung. The gefitinib, everolimus combined therapy was subsequently recommended because of disease progression. However, after a few months of combined treatment, everolimus had to be withdrawn because the patient experienced severe breathlessness, cough and mouth ulcers. At that time, the patient had been taking gefitinib for 16 months until drug resistance developed on 16 February 2017 (Fig. (a)).\nThe patient had second gene mutation testing at this time which indicated EGFR T790M mutation. Osimertinib 80 mg/day orally was subsequently recommended from March 2017. After only one month of treatment, chest CT scan revealed the disease had almost completely resolved (Fig. (b)). However, severe interstitial lung disease was also confirmed (Fig. (b)). The patient was found to have severe cough and difficulty in breathing at this time and the symptoms did not resolve, even after anti-infection and anti-cough treatments were administered. The patient attended our hospital for further treatment. After reviewing his treatment history and chest xray, we considered that he was suffering from severe drug-induced interstitial lung disease and advised him to cease taking the osimertinib immediately. Unfortunately, he still continued to take the osimertinib as he considered the medicine to be effective for his tumor, and refused to tell the doctor the truth until it was found that he was suffering from further dyspnea. After anti-infection and high dosage methylprednisolone (240 mg/day) and mechanical ventilation, the patient finally died of multiple organ failure after 2 weeks treatment for severe interstitial lung disease and resultant complications. |
An 11-year-old male Rwandan, a known patient of multiple hereditary exostoses (MHE), presented to our hospital with a 6-month history of unrelenting bone pain despite treatment with NSAIDs; he later developed (two weeks prior to admission) a dull persistent aching pain and swelling of his left lower thigh that was worse at night and unresponsive to morphine. His parents noticed that he had also lost weight and appetite. There was no history of trauma or a fall. He was diagnosed with MHE at age 3 and had been living a relatively normal life and attending school. None of his siblings or any other member of his family had MHE. His past surgical history was unremarkable. On general examination, he was well nourished, had mild pallor of the mucus membranes, no jaundice, lymphadenopathy, or skin rash. All the other parameters were normal. Examination of the musculoskeletal system revealed normal stature except for the curving deformity of the left leg. There were multiple palpable bony swellings bilaterally on the upper humeri and lower femurs. The lesion on the left distal femur was markedly enlarged and tender, with induration, reddening, and limited range of motion of his knee joint (). Repeat X-rays confirmed the presence of bony outgrowths (exostoses) on the medial and lateral aspects of the distal femurs bilaterally and left metaphyseal widening common in this condition as had been previously identified when he was diagnosed at age 3, and further investigations of the left distal femur swelling () with magnetic resonance imaging (MRI) revealed a distinct enhancing lesion in the distal aspect of the left thigh at the site of intense swelling and pain. MRI showed a lesion with hypointense signals on T1WI sequences and has heterogeneous signal intensities with moderate and heterogeneous enhancement on T1WI postcontrast study and on T2WI sequences; the lesion had heterogeneous signal intensities (Figures –). At surgery, there was a necrotic lesion, and excision biopsy at the site of the left distal femur exostosis was taken (Figures and ). Hematological evaluation was normal except for a mild leukocytosis. The results of the serum biochemical tests were also normal. We did not do genotyping for EXT-1 and EXT-2 due to lack of facilities.\nHistopathological examination revealed a characteristic fibrous cartilaginous cap with a broad base (1.293 mm thick), covering a layer of normal appearing marrow and bone below which was a tumor-forming osteoid, an osteoblastic tumor as evidenced by presence of numerous bone spicules of varying maturity. There was also marked cellular atypia, grossly pleomorphic osteoblasts in the marrow with frequent mitoses. These features were those of a high-grade osteoblastic osteosarcoma. In conclusion, histopathological revealed an osteochondroma with an underlying high-grade osteoblastic osteosarcoma involving the marrow cavity (Figures –).\nFor staging purposes, CT scans of the chest, abdomen, and pelvis were done to investigate any presence of metastatic lesions (Figures and ). There were no metastatic deposits in the lungs, abdomen, and pelvis, and this was confirmed with PET scan in India where the patient was referred for specialized bone tumor treatment including limb salvage therapy. He was reevaluated, and the diagnosis of MHE and osteoblastic osteosarcoma confirmed. Whole body PET scan showed metabolically active disease in the distal left femur 8.6 × 8.1 × 16 cms in dimension with features consistent with osteosarcoma, multiple hereditary exostoses with evidence of skip lesions, loco-regional lymph node involvement, and no distant metastases. Histopathological review confirmed the earlier diagnosis of osteochondroma with osteoblastic osteosarcoma. The conclusion was that the patient had clinically localized disease. The following treatment plan was proposed and instituted: initiation with neoadjuvant chemotherapy followed by limp salvaging surgery and finally adjuvant chemotherapy. He received doxorubicin 35.5 mgs/m2 per day (day 1 and day 2), cisplatin 60 mgs/m2 for 7 days (days 1 and 2), methotrexate 12 gms/m2 per day, etoposide 100 mgs/m2/day for 5 days, and ifosfamide 2.8 gms/m2/day for 5 days followed by Ifosfamide 3 gms/m2/day for 3 days and subsequently pegylated Interferon-α2b 0.5 mcg/kg - 1mcg/kg. He completed a total of six cycles of chemoimmunotherapy.\nOur patient is still alive and back at school with no evidence of disease after 11 months of treatment and follow-up and continues to be followed up by the oncologist. |
A 49-year-old man presented to an outpatient clinic with a saccular-shaped aneurysm at the distal infrarenal aorta. Two months prior, he had visited the emergency department of an outside hospital with a weeklong history of mid-abdominal and lower back pain with gross hematuria.\nAn abdominal computed tomography (CT) scan demonstrated a 3 × 3.5 cm saccular-shaped aneurysm at the infrarenal aorta 1 cm proximal to the aortic bifurcation with a 7 × 10 cm retroperitoneal hematoma surrounding the aneurysm; there was mild aneurysmal change of the left common iliac artery ().\nEVAR had been attempted at an outside hospital to treat the aortic pseudoaneurysm with contained rupture. A 20 mm diameter ×6 cm length SEAL device (S&G Biotech Inc., Seongnam, Korea) was deployed at the infrarenal aorta to exclude the rupture site. Then, a 12 mm diameter ×9 cm length SEAL stent graft (S&G Biotech Inc.) was deployed in the left iliac artery to treat the small aneurysmal dilatation of the left common iliac artery. On the final aortogram, there was no observable endoleak. The patient recovered uneventfully and was discharged from the hospital.\nOn a follow-up CT scan (), a small pseudoaneurysm was detected distal to the aortic stent graft, prompting referral to our facility. On physical examination, multiple cutaneous nodules and café au lait spots were observed on the skin of the chest and abdomen. On abdominal X-ray there was remarkable scoliosis and lateral spondylolisthesis at the level of L3-4. His past medical history was significant for treatment with anti-tuberculosis agents while in high school for the clinical diagnosis of spinal tuberculosis, without identification of the suspected microbe.\nOn admission to our hospital, the patient's vital signs were stable and there was no evidence of acute retroperitoneal hemorrhage. We decided to perform an open surgical repair of the recurrent aortic aneurysm based on the relatively young age of the patient and the uncertain aortic pathology due to his underlying NF-1. We removed the aortic and iliac stent grafts and reconstructed the aorta using a Dacron graft (Boston Scientific Inc., Natick, MA, USA). Intra-operatively, easy bleeding from the retroperitoneal periaortic tissue due to increased vascularity was observed. A 2 × 3 cm pseudoaneurysm was identified at the anterolateral aspect of the terminal abdominal aorta at the level of aortic bifurcation.\nOn histologic examination (), the aortic wall close to the rupture site demonstrated medial thinning and disruption of the aortic wall, as well as degeneration of elastic fibers in the aortic wall, adventitial fibrosis, and mild inflammatory infiltrations. Focal intimal hyperplasia, adventitial hemorrhage, and foreign-body granulomas were also found in the aortic wall specimen. Although some scattered S100 protein positive spindle cells were detected in the adventitia on immunohistochemical staining, definitive histologic evidence of neurofibroma invasion of the aortic wall was not identified.\nPrior to sudden onset abdominal distension and hypovolemic shock on the sixth postoperative day, the patient was hemodynamically stable following open surgical repair of the aortic aneurysm. Following his clinical deterioration, an abdominal CT scan demonstrated a large hemoperitoneum with active bleeding from a branch of the middle colic artery. The active bleeding was successfully treated with coil embolization of the middle colic artery branch proximally and distally using a microcatheter technique (). Intra-peritoneal blood was removed with 5 days of percutaneous drainage with a catheter at the pouch of Douglas. The patient recovered and was discharged without further complications. Cultures for bacteria, mycobacterium, and fungus from aortic wall and periaortic retroperitoneal soft tissue samples were negative. |
A 67-year-old man with a history of depression since age 50 presenting with symptoms of dysarthria and left hemiplegia was admitted to the stroke care unit. An MRI showed an infarct of the right corona radiata as well as infarcts in the caudate nucleus, lentiform nucleus, and right posterior temporal lobe () due to occlusion of the MCA. An MCA stem (M1) occlusion was observed on brain angiography. He showed improvements in blood flow to the MCA after treatment based on acute stroke treatment guidelines; after 30 days, he was transferred to a rehabilitation hospital. Three months after his stroke, he was crying for no reason several times a day and complained of loss of interest and a tendency to be pessimistic. An HRSD17 score of 18/50 suggested that the patient had developed mild to moderate depression and a PLACS score of 20/27 suggested moderate disability.\nA score of 28 on the Mini Mental State Examination (MMSE) did not suggest significant cognitive impairment. As a result, he was diagnosed with comorbid PSD and EI and was started on paroxetine 10 mg. Paroxetine was gradually increased to 40 mg over 12 weeks. The PLACS score decreased to 10/27 during the first 4 weeks and HRSD17 decreased to 13. However, PLACS and HRSD17 scores did not decrease over the next 8 weeks. The left hemiplegia did not improve, even 9 months after his stroke, and he subsequently received superficial temporal artery-to-middle cerebral artery bypass surgery after assessment by cerebral angiography. Administration of paroxetine 40 mg was continued.\nHe was transferred again to the rehabilitation hospital, where his clinical symptoms improved after surgery. His MMSE score did not decrease but his PLACS and HRSD17 scores did not decrease. In addition, unstable emotional thinking, pessimistic irritability, and aggressive behavior were observed. Therefore, with the informed consent of the patient and family, adjunctive therapy with low-dose aripiprazole 3 mg/day was started. Within 4 weeks, uncontrolled crying spells stopped. Aripiprazole was increased to 6 mg/day over 2 weeks, and after 2 more weeks, his depressive symptoms, irritability, and aggressive behavior were relieved, with a HRDS17 score of 7 and sustained clinical improvement in EI. No adverse effects from the aripiprazole were seen. His lower limb remained hemiplegic but the decreased motivation for rehabilitation was markedly improved. PSD and EI remained in remission (PLACS 0; HRDS17 4) after 2 months of adjunctive therapy with aripiprazole. |
A 51-year-old female with a past medical history of deep vein thrombosis (DVT), pulmonary embolism, and well controlled diabetes mellitus type 2 (hemoglobin A1c 6.1%) presented after several days of worsening chest pain, low-grade fevers, and chills. Several weeks prior to presentation patient had a central venous catheter placed for intravenous iron infusions to treat refractory iron-deficiency anemia. Three weeks prior to presentation, the patient had left tarsal tunnel release with no postoperative complications. Upon presentation, to the hospital for evaluation she was bradycardic with a pulse of 48 beats per minute, hypotensive with a blood pressure of 106/54 mmHg (as compared to her baseline hypertension), and febrile to 101.3°C. Given her history of DVT, a computed tomography (CT) angiogram was ordered that revealed no new pulmonary emboli but showed cavitary lung lesions suggestive of septic emboli. An electrocardiogram (ECG) demonstrated accelerated junctional escape rhythm with complete atrioventricular block (). Blood and urine cultures were obtained, and patient was initiated on empiric coverage for endocarditis with vancomycin, gentamicin, and micafungin.\nGiven CT evidence of septic emboli, fevers, and ECG findings of complete AV block, an initial transthoracic echocardiogram (TTE) was performed on day two of admission, followed by a transesophageal echocardiogram (TEE) on day three of admission. TEE confirmed initial TTE findings of aortic valve thickening on the left coronary cusp highly suggestive of vegetation () and associated severe aortic regurgitation. Furthermore, an echo density was noted at the aortic root with color flow transmission highly suggestive of an aortic root abscess with fistula (). There was moderate mitral valve regurgitation with normal left ventricular systolic function. A bicuspid aortic valve was also noted on the TEE. Gram-positive cocci were seen on Gram stain from blood cultures drawn on admission; therefore she was continued on vancomycin and gentamicin. The patient was referred for emergent cardiothoracic surgery with replacement of the aortic valve with a 19 mm freestyle tissue valve, incision and drainage and debridement of the subannular abscess, and reconstruction of the proximal anterior leaflet of the mitral valve and aortic annulus with pericardial patch placement which was performed at an outside hospital on day six of hospitalization. No pacemaker was placed at this time of surgery as the cardiothoracic surgeons felt that it would best be placed once her blood cultures were sterile. At the time of valve replacement a transfemoral pacer was placed.\nWithin 24 hours of hospitalization, blood cultures drawn on admission began growing what was initially identified as Gram-positive cocci. However, on day three of admission the Gram stain was reassessed and changed to Gram-negative rods identified as Ralstonia species. Repeat blood cultures on consecutive days up until the day of surgery grew persistent Ralstonia species, which was ultimately identified as Ralstonia pickettii. Surgical specimens from the aortic valve and annular abscess all had heavy growth of R. pickettii (surgical intervention on day 6). All postsurgical blood cultures remained negative (). She was initially on aggressive Gram-positive coverage initially with vancomycin and gentamicin; however this was quickly changed to levofloxacin once sensitivities returned. The Ralstonia species, later identified as pickettii, was sensitive to quinolones and trimethoprim-sulfamethoxazole only with intermediate sensitivity to piperacillin/tazobactam, imipenem, and cefepime and complete resistance to tobramycin amikacin and gentamycin. Her postoperative course was uneventful except for dental extractions done for extensive necrosis and caries. She was initiated on levofloxacin on day four of admission and completed a total of eight weeks of therapy postoperatively. Upon sterilization of blood cultures approximately one week after surgery, a dual-chamber pacemaker was implanted.\nUnfortunately, shortly after completion of the initial eight weeks of antibiotic therapy, the patient developed recurrent bacteremia with Ralstonia pickettii complicated by a periannular abscess around the new aortic valve prosthesis and a pseudoaneurysm of the ascending aorta. She was again emergently taken for repeat aortic root replacement with a 24 mm homograft and treated with aggressive antibiotic therapy with trimethoprim-sulfamethoxazole and levofloxacin (after repeat sensitivity testing). Unfortunately the patient rapidly succumbed to infection and died due to complications of persistent bacteremia.\nRalstonia species are aerobic Gram-negative, oxidase-positive, nonfermenting bacilli that have in recent years been identified as emerging opportunistic pathogens in immunocompromised hosts. Both environmental and hospital sources have been identified in human infection. Of the Ralstonia genus, Ralstonia pickettii formerly known as Burkholderia pickettii is regarded as the one with clinical importance []. It was first identified as Pseudomonas pickettii in 1973 [] and then reclassified in 1992 to the Burkholderia [] genus and finally in 1995 to a new genus Ralstonia [–], based upon cellular lipid and fatty acid composition, phenotypic analysis, and both DNA and 16s rRNA sequencing and hybridization. Disease associated with Ralstonia pickettii ranges from asymptomatic to septicemia and death. |
A 2-year-old boy felt down from a balcony (4 m) with direct head trauma and initial brief loss of consciousness. He presented with immediate vomiting and the appearance of a secondary stupor. His family transferred him to the hospital less than an hour after the trauma.\nOn arrival, clinical examination revealed an initial Glasgow Coma Scale (GCS) score of 13 with a large right frontoparietal cephalhematoma overlying the right upper eyelid. He presented with tetraparesis, absent tendon reflex, plantar Babinski cutaneous reflex indifferent bilaterally, the left pupil was intermediate and reactive, and eyelid occlusion by the hematoma made evaluation of the right pupil impossible.\nA selection of images from a noncontrast head CT scan was sent via Personal E-mail to a nonpediatric neurosurgeon after phone contact. Diagnosis was suspected with the characteristic biconvex chap and significant compression and with arguments for VEDH that they usually result from trauma in younger children even if in this case epidural hematoma does cross-cranial sutures. The consultant confirmed the diagnosis of epidural hematoma of the arch (Figures and ), associated with a fractured frontal paramedian extending down to the right orbital ceiling []. There was no associated cervical spine injury. The need for emergent surgical decompression [] was determined less than 15 minutes after the initial phone call to the neurosurgeon. Surgical technique was discussed via phone transmission and optimized with a scheme () using Microsoft PowerPoint showing skin incision, bilateral craniotomies, and dural tack up sutures crossing the midline.\nWe proceeded to the surgery and made a coronal incision following coronal suture, keeping the proposed approach. Raising the skin flap anteriorly exposed the fracture site. Two free bone flaps were performed, from each side of the median line, with Gigli saw and using the fracture line on the right side. The epidural clot was carefully removed. On the left side, this approach was suddenly accompanied with active bleeding probably from venous origin, controlled by tack-up sutures as planned by the scheme preoperatively. The flaps were repositioned with transosseous sutures after dural suspension device. During the postoperative course, the patient showed dramatic improvement and the child was discharged home shortly after repeat control CT Scan (). The child recovered ad integrum on neurological examination. The only complication was pulp necrosis of the fifth right toe secondary to hemodynamic instability requiring introduction of pressor drugs in postoperative course. |
A 72-year-old African American male patient with a history of alcohol abuse presented with acute encephalopathy and failure to thrive (FTT) with unintentional weight loss. His electrocardiogram showed new-onset AF. As part of his initial work up for FTT, he underwent computed tomography (CT) scan of the chest and abdomen with an incidental finding of congenital absence of the CS ostium resulting in retrograde cardiac venous blood flow through the PLSVC to the left innominate/brachiocephalic vein, into the (right) superior vena cava and back into the right atrium (). A large thrombus measuring 2.5 cm in its largest dimension and extending into the PLSVC was detected in the coronary sinus (). Transthoracic echocardiogram (TTE) confirmed the findings of CS thrombus with engorged cardiac veins (). Due to high operative risk, the patient was started on anticoagulation instead of thrombectomy and eventually discharged to a nursing facility. Six months following his initial diagnosis, he presented with right upper quadrant abdominal pain where he was found to have a large pericardial effusion on CT chest, abdomen, and pelvis. As the CT image was performed without contrast, the thrombus was not visualized, though CS dilatation was still observed. A repeat echocardiogram noted the dilated coronary sinus and persistent thrombus. The patient had features of cardiac tamponade requiring pericardiocentesis with fluid studies suggestive of an effusive-constrictive disease. He continued to decompensate and his family opted for comfort measures.\nPersistent superior left vena cava results as failure of obliteration of the left common cardinal vein during embryological development of the coronary venous system resulting in connection with the CS via the vein of Marshall. Dilation of the CS seen on routine TTE leads to suspicion for PLSVC. To confirm this finding on TTE, criteria include (i) the presence of CS dilatation on 2D echocardiography in the absence of right-sided elevated filling pressures, (ii) enhancement of the CS before the right atrium (RA) after contrast infusion into a left arm vein, and (iii) normal transit of contrast with RA opacification before the CS with contrast injection in the right arm vein. Other imaging modalities to rule out additional anomalous findings and delineate coronary anatomy include CT and magnetic resonance venography.\nWhile this congenital anomaly is usually asymptomatic, it is possible that our patient’s AF may have been due to the presence of a PLSVC. In a small study of five patients with symptomatic medication-resistant AF, catheter ablation of the PLSVC resulted in successful conversion and maintenance of sinus rhythm at 15-month follow-up. The presence of spontaneous CS thrombosis in our patient without any prior intervention is unique. In a histological analysis from necropsied hearts, a cuff of striated muscle from the ostium was seen in the wall of the CS that inserted distally in the left atrium. As such, it is plausible that in the setting of AF with an absent CS ostium and contraction, venous stasis led to formation of thrombus at the terminal end of the CS.\nTreatment for CS thrombosis may include thrombectomy to prevent embolization into the pulmonary circulation or alternatively medical management with anticoagulation alone. Despite significant clot burden with extension ascending into the PLSVC, our patient was considered a very poor surgical and interventional candidate. There are no current studies outlining anticoagulation choice for CS thrombosis. The patient was initially started on warfarin for CS thrombosis and new-onset AF. He was discharged to a nursing home where he was transitioned to rivaroxaban. We suspect this was for ease of administration and monitoring in the setting of normal kidney and liver function.\nConsent: The author/s confirm that written consent for submission and publication of this case report including image(s) and associated text has been obtained from the patient in line with COPE guidance.\nConflict of interest: none declared. |
A 22-year-old male patient was referred to the Department of Conservative Dentistry and Endodontics with a chief complaint of pain in his upper left back region of the mouth. Patient's medical and familial history was noncontributory and there was no sign of any systemic diseases or syndromes.\nAn intraoral examination revealed a Class I dentition with a well aligned upper and lower arch. In addition to the full complement of permanent teeth, there was an extra tooth present palatally between the maxillary left first and second molars []. This supernumerary tooth was diagnosed as a paramolar. The crown of this paramolar had two cusps and quite resembled a permanent premolar. The tooth was rotated, with its buccal surface face distally, whereas its mesial surface faced buccally. On clinical examination, caries was detected on the mesial surface of the paramolar []. Soft tissue examination revealed inflammation in the surrounding periodontium between the maxillary left first and second molars and paramolar.\nFollowing clinical examination, panoramic, periapical, and occlusal radiographs were taken. The palatally positioned paramolar made its clear visual assessment with the panoramic radiograph difficult. Periapical and occlusal radiographs revealed the presence of a supernumerary tooth with a single root [Figures and ].\nThe patient was informed of the existing condition and extraction of the paramolar was advised as maintenance of oral hygiene in this area was difficult and there was the possibility of food lodgement, recurrence of dental caries, and deterioration of the surrounding periodontal health. The patient was referred to the Department of Oral and Maxillofacial Surgery for extraction of his paramolar.\nThe extracted tooth was cleaned, disinfected, and analyzed. The tooth had a normal morphology. The length of the root was normal relative to its crown. The root apex was completely developed. Radiographic investigation revealed a Vertucci's Type I canal configuration. The actual size of the tooth was measured with a caliper. The mesiodistal and buccopalatal width of the crown was 6 and 10 mm, respectively. The length of the crown was 6.5 mm, whereas the length of the root was 12 mm. The morphometric measurements displayed that the paramolar had very close values relative to the maxillary premolar []. |
A 60-year-old male patient reported to the outpatient department of our institute, with the chief complaint of burning sensation in the mouth for the past 3 months. He had no abusive habits, and his past dental history and family history were noncontributory. The patient was not under any medications. He had initially visited a general practitioner, who had prescribed him multivitamin tablets. When the lesions did not subside, he consulted a general dentist, who had first treated him symptomatically, with topical anesthetic gel and mouthwash. Later, he was advised antifungal drugs by the same dentist. However, since there was no real improvement in his condition, he was referred to us, 3 months after his initial oral lesions. A thorough intraoral examination revealed numerous erosive lesions on the right and left buccal mucosae, gingiva, floor of the mouth, soft palate, and oropharynx []. Similar erosive lesions were also observed in the nasal mucosa. Few of these eroded areas showed tissue tags over them. However, no intact vesicles or bullae were noticed. A general examination to identify similar lesions elsewhere in the body turned out to be negative. Based on the history and clinical findings, a vesiculobullous lesion was suspected. Pemphigus, mucous membrane pemphigoid, bullous lichen planus, erythema multiforme, and chronic ulcerative stomatitis were considered under differential diagnosis.\nUnder local anesthesia, an incisional biopsy was performed from the edge of the eroded area in the buccal mucosa, taking care to include apparently unaffected mucosa also. Two samples were taken, and one was fixed in 10% neutral buffered formalin for routine histopathology. The other sample was immersed and transported in Michel's medium for direct immunofluorescence study.\nHistopathology revealed the presence of a parakeratotic stratified squamous epithelium that showed features of intraepithelial blister formation. Most areas showed suprabasilar clefting with only the basal layer of epithelium attached to the underlying connective tissue. Within these clefts, numerous round-to-ovoid epithelial cells with large hyperchromatic nuclei and minimal eosinophilic cytoplasm, suggestive of acantholytic (Tzanck) cells, were also evident [Figures and ]. The histopathological features were suggestive of pemphigus. Direct immunofluorescence revealed intercellular staining of the epithelium with IgG, in a typical fishnet pattern, which was diagnostic of pemphigus []. Therefore, on the basis of clinical, histopathological, and immunofluorescence findings, a final diagnosis of pemphigus was made.\nThe patient was initially prescribed tablet prednisolone 10 mg twice daily for 15 days. However, no marked response was noticed. In the meantime, the patient also started complaining of pruritus in the skin of the trunk region and he was referred to a dermatologist for review. The patient was admitted as an inpatient and was advised pulse steroid therapy. As part of the first phase of this treatment, he received 100 mg of dexamethasone in 500 ml of 5% dextrose on 3 consecutive days. Cyclophosphamide (500 mg) was also administered intravenously on day 2. In addition, the patient also received 50 mg of oral cyclophosphamide daily. The patient has been scheduled to receive this treatment once every month, until all lesions disappear. Between the monthly visits, the patient was advised to take tablet prednisolone (30 mg in the morning and 10 mg in the night), along with topical betamethasone for the skin lesions and triamcinolone gel for oral lesions. The patient has already undergone two courses of the first phase of the pulse steroid therapy and is scheduled to receive the third course shortly. His signs and symptoms have shown marked improvement, and the number of lesions has reduced considerably []. However, as a side effect of the pulse steroid therapy, the patient has developed hyperglycemia, for which he is under antidiabetic medications currently. |
A 48-year-old male patient was admitted to the hospital for hematemesis and melena. His past medical history included chronic alcohol abuse, intense smoking habit, chronic antral gastritis due to Helicobacter pylori that had not been eradicated, and longstanding epigastric pain treated with proton pump inhibitors.\nThe patient was lucid, but anemic, with a fine radial pulse of 120 beats per minute and a blood pressure of 60/40 mm Hg. The abdominal examination showed no elements suggesting peritoneal irritation.\nOn initial presentation, his hemoglobin level was 7.0 g/dL so the patient management began with the transfusion of two packed red cells and intravenous fluids and posteriorly a gastroscopy was performed revealing a posterior bulbar ulcer of 15 mm, with blood oozing. Hemostasis was achieved using 1/10,000 adrenaline. But the ulcer continued bleeding and, after assuring it was not safe to repeat the sclerosis, we decided to perform an urgent duodenotomy, suture of the penetrated ulcer in the posterior wall and Graham patch. Due to placement of the ulcer and the inflammation of the tissues around, the gastroduodenal artery was not ligated. The patient developed well and was discharged 6 days after. But he presented again to our hospital two days after with a history of persistent epigastric pain associated. He was afebrile and hemodynamically stable; moreover, physical examination revealed a palpable beating mass in the epigastrium.\nThe contrast-enhanced CT scan documented the presence of a large (8.3 × 7.5 cm) pseudoaneurysm of the gastroduodenal artery supplied by the superior mesenteric artery.\nSelective arterial embolization through a femoral approach was successfully performed to treat the pseudoaneurysm. We decided to occlude the gastroduodenal artery first to stop the backflow into the pseudoaneurysm and it was embolized with two 3 mm × 4 cm coils. Subsequently, the inferior pancreaticoduodenal artery was embolized with two 3 mm × 5 cm coils through the superior mesenteric artery. An angiographic control uncovered a marginal filling of the pseudoaneurysm and an additional embolization using the liquid embolic agent lipiodol/ethibloc mixture was performed. Angiographic control confirmed the complete exclusion of the pseudoaneurysm ().\nThe patient's hospital stay was uneventful and he could be discharged after 4 days without any signs of bleeding or intestinal ischemia. A contrast-enhanced follow-up CT scan (4 weeks after embolization) showed the pseudoaneurysm excluded completely and no changes in its size, which was still thrombosed by the coils. |
A 47-year-old male patient presented to the Division of Maxillofacial and Traumatology Surgery of the Federal University of Minas Gerais with a history of a knife attack 3 months previously. He complained of pain in the left temporomandibular joint and limited mouth opening. His current medical condition and medical history included rheumatoid arthritis and hepatitis during childhood. Upon physical examination, a scar was observed in the left preauricular region, and significant limitation of the buccal opening was noted, with an interincisal distance of 13 mm. An intraoral evaluation revealed no changes in the hard or soft tissues. Computed tomography revealed the presence of a large knife fragment in the infratemporal fossa. A perforation path was observed, extending from the pre-auricular region to the infratemporal fossa, passing through the zygomatic arch and the sigmoid notch of the mandible until the nasopharynx (). An upper left condylar fracture was also observed ().\nThe images suggested moderate proximity of the foreign body to the internal and external carotid arteries; therefore, DSA was requested, since it is selective for the internal and external carotid arteries bilaterally ( and ). DSA showed no extravasation of contrast, pseudoaneurysm, or arteriovenous fistula, suggesting that the small branches of the left external carotid artery had been transected. DSA also showed that the tip of the knife fragment had an intimate relationship with the right internal carotid artery (1.1 cm×1.9 cm×2.1 cm), but without any signs of extravasation. As a therapeutic plan, it was decided to surgically remove the knife, with conservative treatment of the condylar fracture. The procedure was performed jointly with the Head and Neck Surgery Service of the Federal University of Minas Gerais due the imminent risk of involvement of large vessels during the removal of the impacted blade. Under general anesthesia, extensive left pre-auricular surgical access was obtained, and after careful dissection of the facial tissues, the knife fragment was located and gently removed with the use of a needle holder ().\nDuring the procedure, no intense bleeding was observed, and there was no need for vessel ligation or replacement of blood products. The patient received tetanus antitoxin and prophylactic antibiotics in the perioperative period. In the immediate postoperative period, the patient experienced complete remission of pain symptoms and recovered normal mouth opening. At 3 years after surgery, he is receiving ambulatory follow-up, and has shown a good clinical course. |
A 35-year-old woman was scheduled to undergo surgery to close her tracheocutaneous fistula. The patient had previously undergone tracheostomy with an inverted U-shaped tracheal incision and mechanical ventilation for central neurogenic respiratory failure due to autoimmune limbic encephalitis when she was 30 years old. Although she recovered from her previous condition after 11 months of tracheal cannulation, she subsequently developed a tracheocutaneous fistula due to the prolonged course of healing and poor nutritional status. Laboratory analysis revealed that her white blood cell count was 2900/μL, serum total protein level was 5.3 g/dL, and serum albumin level was 3.0 g/dL. Neck sagittal computed tomography showed a tracheocutaneous fistula (Fig. a). Although repair of such fistulae is possible under local anesthesia, her surgery was performed under general anesthesia because the encephalitis had caused residual restlessness.\nThe skin incision was designed as a box around the fistula with two sequential straight incisions emanating from one corner (Fig. b). The length of each skin incision was 25 mm. Bilateral hinge flaps to close the fistula were created from the left and right sides of the tracheal defect, and superfluous skin from each hinge flap was trimmed (Fig. a). A single flap covering the skin defect was elevated from the lateral aspect of the right hinge flap to join with the corresponding sides of the defect (Fig. b). The hinge flaps were inversed to cover the tracheal lumen with skin epithelium and sutured tightly with the platysma muscle using absorbent strings (Fig. b). The elevated and rotated single flap covered the skin defect, and nonabsorbent suture was used to close the skin in a layer-by-layer fashion to avoid creating dead space (Figs. c and c). The operative time was 58 min, and a drainage tube was not placed. Her postoperative course was uneventful, and she had no recurrence of the tracheocutaneous fistula for 18 months.\nSeveral procedures to close tracheocutaneous fistulae have been previously reported [–]. However, no standard, easily performed procedure has been established worldwide. One advantage of the procedure described herein is that postoperative tracheal stenosis secondary to granulation is not likely to occur because the tracheal lumen is covered by inversed skin epithelium. The bilateral hinge flaps closing the tracheal defect can be lifted from not only the left and right sides but also from the upper and lower sides depending on the form of the defect. Moreover, the superfluous skin of each hinge flap can be trimmed to create appropriately sized flaps. Another advantage is that recurrence of the tracheocutaneous fistula after wound dehiscence is not likely to occur because the suture line of the skin cannot overlap with that of the subcutaneous tissue. Most patients can undergo this procedure with local anesthesia. This technique for closing tracheocutaneous fistulae after tracheostomy using two skin flaps is thus considered to be beneficial. |
A 45-year-old male who was a chronic alcohol user presented with high-grade fever, right upper quadrant abdominal pain, and abdominal distension for past 12 days. On abdominal examination, he had tender hepatomegaly and ascites. Ultrasound abdomen revealed ruptured liver abscess and ascites. He was started with intravenous metronidazole 800 mg TDS and piperacillin-tazobactam 2.25 gm QID on the day of admission and the abscess drained subsequently. With the given treatment and supportive care, he was improving clinically.\nOn the 12th day of admission, he developed one episode of generalized tonic-clonic seizures (GTCS) for 30 s and then he gained consciousness within 10 min. He was loaded with levetiracetam. Metabolic parameters like blood glucose and electrolytes were within the normal range. NCCT head was done to rule out new-onset infarct/intracranial hemorrhage or other gross organic pathology. The next day, he again developed two episodes of seizures following which he had poor responsiveness; hence he was intubated and mechanically ventilated as a result of airway protection.\nIn view of persistently altered sensorium (GCS–8/15) with multiple liver abscesses and chronic alcohol use, the possibility of hepatic encephalopathy was considered. However, his ultrasound imaging and metabolic parameters were not suggestive for chronic liver disease and hepatic encephalopathy. For further evaluation, we were able to perform MRI on day 29 of admission which showed symmetric areas of FLAIR hyperintensities and restricted diffusion seen in the dentate nuclei, dorsal Pons, and posterior limb of internal capsule and splenium of corpus callosum suggestive of metronidazole toxicity []. Subsequently, metronidazole was stopped on the same day. The total dose of metronidazole received by patient till first episode of seizure was 28.8 g. The total cumulative dose was 69.6 g. His further hospital stay was complicated by cardiac arrest due to hypoxia on next day of stopping metronidazole. He attained return of spontaneous circulation after 20 min of CPR. Following CPR, his sensorium further deteriorated (GCS–3/15) and did not improve further. Since he had cardiac arrest, clinical improvement with reversal of metronidazole toxicity was not seen. Repeat MRI was done after 1 month of previous MRI which showed marked reduction in FLAIR hyperintensities in the dentate nuclei, dorsal pons, and splenium of corpus callosum suggestive of partial resolution in changes due to metronidazole toxicity. However, there were new areas of symmetric FLAIR hyperintensities in basal ganglia and thalamus suggestive of new hypoxic-ischemic changes due to cardiac arrest []. The post-cardiac arrest was managed conservatively, in spite of good supportive care, he succumbed to ventilator-associated pneumonia. |
A 56 year old male presented with a non tender hard atrophic left testicle. The rest of the examination was normal. There had been no previous scrotal surgery or trauma.\nTumour markers including lactate dehydrogenase (LDH), human chorionic gonadotrophin (HCG), alpha fetoprotein (AFP) and prostate specific antigen (PSA) were normal. His total white cell count was normal. An ultrasound of the scrotum demonstrated a localised tumour of the testis. Chest x-ray was normal. A standard left radical orchidectomy was performed by the inguinal approach. The tumour appeared to be confined to the upper pole of the testis and was clinically described as T1 or T2. Macroscopic histological examination suggested no involvement of the tunica albuginea, epididymis or spermatic cord. Microscopic examination demonstrated infiltration of the testis by uniform ovoid cells with clear cytoplasm, vesicular nuclei and prominent nucleoli consistent with seminoma (Fig ). Tumour involved the tunica albuginea but did not extend through it. There was no vascular invasion. Surprisingly, seminoma cells were present beneath the epithelial lining of the vas deferans extending to the spermatic cord resection margin but nowhere else within the spermatic cord. (Fig ). The microscopic slides gave the appearance of sub epithelial spread of seminoma cells along the vas deferans. Other structures in the spermatic cord were not involved.\nA post operative CT scan demonstrated two separate masses. A 2.8 cm by 2.3 cm central abdominal mesenteric mass and a 7.6 cm by 5.4 cm irregular heterogeneous lobulated soft tissue mass within the pelvis arising from the prostate and extending into the mesorectal fascia. There were no enlarged retroperitoneal, pelvic, inguinal or thoracic lymph nodes. (Fig and ). The chest CT scan was normal. The patient has received chemotherapy and is currently under follow up according to standard EUA guidelines. There is no evidence of residual or recurrent disease. The CT scan performed after completion of the course of chemotherapy demonstrated complete resolution of the two metastatic masses. (Fig and ). |
A 37 year old female presented to her primary care physician with nonspecific abdominal pain. She underwent CT imaging that revealed bilateral ovarian masses and ascites. Preoperative CA125 was the only tumor marker examined and it was within normal limits. A presumptive diagnosis of ovarian cancer was made and she underwent exploratory laparotomy which revealed macroscopic peritoneal metastases to ovaries, omentum and pelvic peritoneum. At that time total abdominal hysterectomy, bilateral salpingoopherectomy, pelvic lymph node sampling, partial omentectomy, appendectomy and evacuation of mucinous ascites was performed. Final pathology revealed low grade mucinous adenocarcinoma in all specimens, arising from an appendiceal primary. The patient received no additional therapy and was followed clinically. She developed recurrent abdominal pain approximately 2 years later. Computed tomography (CT) scan revealed progressive nodularity in the mesentery and peritoneal surfaces consistent with recurrent disease. This was further evaluated with a laparoscopy, which revealed mucinous tumor implants along the anterior abdominal wall, right retroperitoneum, diaphragm, and remaining omentum (Figure ). At this time, the patient was referred to the University of Cincinnati for consideration of cytoreductive surgery and intraperitoneal hyperthermic chemoperfusion. The patient's past medical history was significant only for a seizure disorder which was managed by anticonvulsant medication and an implanted vagus nerve stimulator. Preoperative CA19-9 was elevated at 59, while CEA and CA-125 were normal. The patient was felt to be an appropriate candidate and underwent exploration. At surgery, extensive disease was noted over the peritoneal surfaces. A complete cytoreduction was achieved requiring, right colectomy, splenectomy, cholecystectomy, omentectomy, and perionectomies of the diaphragms, anterior abdominal wall, and pelvis. Tumor nodules were excised from the small bowel and large bowel mesentery. The cytoreductive portion of the operation was completed in approximately 210 minutes. Per our current practice protocol, a 90 minute perfusion was performed using an inflow temperature of 44°C, with peritoneal surface temperatures averaging 40.5–41.5°C. Intraperitoneal temperatures were measured via four temperature probes, one within the liver parenchyma, and three within separate quadrants of the peritoneum. Core temperature was recorded via the bladder and esophageal temperature probes. Per our standard protocol, the carrier solution was peritoneal dialysis fluid (2.5%). The patient's maximum recorded core body temperature during the procedure was 38.7°C and the maximum recorded liver temperature was 38.8°C. Mitomycin C was delivered using a total dose of 10 mg/L perfusate, delivered in divided doses of 7 mg/L at initiation and redosed after 45 minutes at 3 mg/L. A total dose of 45 mg was delivered in this patient. During the operation, the patient had no significant electrolyte abnormalities aside from the expected glucose elevation seen during the perfusion period. The maximum serum glucose was 355 mg/dL and the lowest serum sodium was 135. The operation was generally uneventful; no blood transfusions were required and the patient was transferred to the ICU in stable condition. Postoperatively, all serum electrolytes were normal and albumin was 3.4 mg/dl compared with 4.3 mg/dl, preoperatively. The patient was easily arousable and followed commands appropriately. However, approximately 4 hrs later, the patient complained of headache and right eye pain. Her headache was treated with analgesics, however 3 hours later, she was found to be tachypenic, bradycardic, and hypotensive, and was unresponsive with fixed, dilated pupils. She was emergently intubated and resuscitated. After approximately 15 minutes, she regained consciousness, and responded appropriately to commands. Her pupils returned to 3 mm and because reactive. Neurology was consulted and she was loaded with Dilantin due to her history of seizure disorder. An urgent CT scan was ordered. On route to the CT scanner, she once again became bradycardic and hypotensive with fixed, dilated pupils. The CT scan revealed diffuse cerebral edema (Figure ). ICP monitoring revealed pressures of 70–90 mmHg. Mannitol was used in an attempt to lower intracranial pressure without success. EEG was consistent with diffuse brain dysfunction. A brain death protocol revealed that she had suffered brain death and care was subsequently withdrawn. At autopsy, diffuse cerebral edema with tonsillar herniation was noted (Figure ). No pathologic findings were present to indicate the cause of the cerebral edema. The final pathology on all resected specimens reconfirmed the diagnosis of mucinous adenocarcinoma (Figure ). |
The patient was a 65-year-old woman who presented with a 1-month history of bloody stool. A digital colonoscopy with biopsies revealed adenocarcinoma in the sigmoid colon. The patient elected to undergo primary laparoscopic colon resection, and the procedure was reported to be uneventful. However, on the 6th postoperative day, the patient noticed a large amount of yellow fluid coming out of a left side abdominal drain. The fluid appeared to be urine. An abdominal ultrasonography showed a collection of fluid in the patient's pelvis. A contrasted computed tomography (CT) scan showed contrast extravasation in the pelvis and around the descending colon (). The patient had decreased serum protein and albumin; however, complete blood count, creatinine, liver functions, and urine analysis were normal. On the 8th postoperative day, the patient was taken to the operating room for a ureteroscopy. The ureteroscopy revealed that the left ureter was completely severed about 4 to 5 cm from the ureteral orifice (, transected distal end of the ureter). The bowels could be seen through the ureteroscope (, intraabdominal cavity with bowels seen through the distal end of the transected ureter). No other obvious injury was identified. With patience, persistence, and some difficulty, the severed upper end of the ureter was identified and entered (, the proximal end of the transected ureter). We estimated that there was a 3- to 4-cm gap between the two ends of the ureter. Two 0.035″ guidewires were first passed, followed by the placement of two 4.5F Double-J ureteral stents. After placing the Double-J stents, the abdominal drainage quickly subsided. An abdominal ultrasonography 6 days after tube placement showed complete resolution of the abdominal fluid collection. The abdominal drain was removed and the patient was discharged. At the 3-month follow-up, a repeat CT scan showed no hydronephrosis, no abdominal fluid collection, and no contrast extravasation. The patient, however, had an asymptomatic urinary tract infection from Klebsiella pneumoniae, which was treated and resolved. A follow-up ureteroscopy over a guidewire showed excellent healing and realignment of the disrupted ureter. The only obvious sign of the transacted ureter was that the mucosa was paler than normal. Because of this unconventional treatment, we decided to continue stenting the ureter with two fresh 4.5F Double-J stents for an additional 4 weeks. Stents were removed 4 months after the injury. Follow-up contrast-enhanced CT scans taken 8 and 14 months after the initial endoscopic treatment showed mild but unchanged residual dilation of the renal pelvis and ureter with good drainage. There were no other abnormalities. |
A previously well 44-year-old female presented with acute lower limb numbness and weakness of 1-day duration. Prior to this, she suffered from back pain for 2 weeks that gradually progressed to pain in both hips as well. There were no complaints of urinary or bowel incontinence. She did not experience any abdominal pain, distension, vomiting or constipation.\nOn examination, the patient had decreased sensation and power in the bilateral lower limbs and up-going plantar reflexes. Abdominal examination revealed no mass or distension. Bowel sounds were active. Anal tone was intact on digital rectal examination.\nMagnetic resonance imaging of her thoracic and lumbar spine with 10 ml intravenous Magnevist showed abnormal marrow replacement affecting the 11th thoracic vertebral body associated with enhancement causing compression of the spinal cord (Fig. ). The initial impression was spine metastases from unknown primary causing spinal cord compression. The patient underwent excision of thoracic spine tumour, decompression laminectomy and fixation the following day. A computed tomography (CT) scan of her thorax and abdomen with 80 ml intravenous Omnipaque 350 was performed 2 days after surgery to look for a primary malignancy. A 2-cm liver lesion (Fig. ) was detected along with an indeterminate 0.3-cm left pulmonary nodule and a single enlarged 1.3-cm para-aortic lymph node. The small and large bowels were normal (Fig. ). Immunohistology of the vertebral tumour revealed epidural Ewing sarcoma. Molecular testing detected presence of t(11;22)(q24;q12) translocation further confirming the diagnosis of Ewing sarcoma.\nThe patient was planned for chemotherapy but, 3 weeks after her spine surgery, she developed symptoms of intestinal obstruction with persistent vomiting, intermittent upper abdominal pain and distension. A repeat CT scan showed multiple new lytic lesions in the vertebrae, right iliac bone and right femur, increase in size and number of liver nodules (Fig. ) and para-aortic lymphadenopathy. It also showed new findings of small bowel dilatation secondary to an entero-enteric intussusception (Fig. ). An emergent laparotomy was performed and jejunal-jejunal intussusception was found (Fig. ) with a 5-cm tumour forming the lead point (Fig. ). There were no other lesions in the small bowel and colon. The affected segment of the small bowel was resected with primary anastomosis. Histopathological examination of the resected small bowel tumour confirmed metastatic Ewing sarcoma, morphologically similar to the spinal tumour (Figs. and ).The entire panel of immunochemical stains including CD99, synaptophysin, chromogranin, MNF-116, AE1/AE3, epithelial membrane antigen (EMA), CD34, HMB-45,desmin and S100 showed similar results in both the vertebral as well as the small bowel tumour (Figs. , , and ).\nThe patient made an uneventful recovery from surgery and was started on palliative chemotherapy. She eventually succumbed to progressive metastatic disease 16 months after her initial diagnosis.\nThe Ewing sarcoma family of tumors (ESFT) consists of Ewing sarcoma, peripheral primitive neuroectodermal tumor (PNET), extraosseous Ewing sarcoma (EES), and Askin’s tumor (Ewing sarcoma of the chest wall). ESFT tumours are of neural crest derivation that differentiate along a neuroendocrine lineage and are described as small round cell tumours. All ESFT tumours are characterized by a balanced chromosomal translocation between the 5ʹ half of the EWS gene (22q12) and the 3ʹ half of members of the ETS family of transcription factors, leading to the understanding that ESFT represents a single neoplastic entity [].\nEwing sarcoma predominantly affects children and young adults with a peak incidence between 10 and 20 years of age. About 30 % occur in adults over the age of 20 and fewer than 5 % occur in adults over the age of 40 []. Ewing sarcoma most often arises in the mid-shaft or diaphysis of the long bones of the extremities with the spine making up only 8 % of primary sites of Ewing sarcoma []. Our patient, being a 44-year-old female adult, did not fit the typical profile of an Ewing sarcoma patient and was initially treated as spinal metastases from a yet undetermined primary. It was only on histopathological examination of the spinal tumour that the diagnosis of Ewing sarcoma was reached.\nThe presence of metastasis is the single most important factor in determining survival in ESFT patients. Patients with metastatic disease at diagnosis have a dismal 5-year survival rate varying from 0–25 %, compared with 40–79 % for those with localized disease [, ]. Chemotherapy is essential in the treatment of Ewing sarcoma because although approximately 80 % of patients present with clinically localized disease, subclinical metastatic disease is presumed to be present in almost all patients due to a 80–90 % relapse rate noted in patients who underwent local therapy alone []. It is possible that our patient had occult metastases that continued to rapidly progress after excision of the primary tumour before commencement of systemic chemotherapy. Metastases are mostly found in the lungs (50 %), bone (25 %) and bone marrow (20 %) []. Only eight cases of primary Ewing sarcoma of the small bowel have been reported [–, , ], and metastasis of Ewing sarcoma to the small bowel is even rarer with Capitini reporting a case of a 26-year-old male with metastasis of left femur Ewing sarcoma to the small bowel and brain following allogenic stem cell transplantation.\nIntussusception is the invagination of a bowel loop with its mesenteric fold (intussusceptum) into the lumen of a contiguous portion of the bowel (intussuscipiens) as a result of peristalsis. Intussusception is rare in adults, accounting for 1–5 % of all cases of intestinal obstruction and 5 % of all intussusceptions []. Most cases of intussusception in adults are due to a pathologic lead point within the bowel and are malignant in over 50 % of cases [], thereby necessitating surgery and resection of the affected bowel segment. In the small intestine, an intussusception can be secondary to the presence of intra- or extra-luminal lesions which include inflammatory lesions, Meckel’s diverticulum, postoperative adhesions, lipoma, adenomatous polyps, lymphoma and metastases or iatrogenic (the presence of an intestinal tube, in patients with a gastrojejunostomy, etc.). Malignancy (adenocarcinoma) accounts for up to 30 % of cases of intussusception occurring in the small bowel []. In 2003, Boehm [] described a case of ileoileal intussusception in an 18-year-old male who presented with a protracted course of abdominal pain and vomiting for several weeks. The intussusception was eventually discovered on laparotomy and histopathology of the resected bowel revealed primary Ewing sarcoma. Our patient suffered from intussusception as well, although the cause was due to a large jejunal intraluminal metastasis from her primary spinal ES. No bowel mass was evident on her initial CT scan (Figs. and ), but her subsequent CT performed after development of intestinal obstructive symptoms showed not only new development of small bowel intussusception but also progression of metastatic disease (Figs. , and ). The resected jejunal metastatic tumour, possibly a result of haematogenous spread, displayed the same histomorphological and immunohistochemical characteristics as the vertebral primary tumour (Figs. , , , , and ). |
A 72-year-old male, smoker with a past medical history of arterial hypertension, high blood cholesterol and ischemic cardiomyopathy, had suffered a transient episode of slurred speech a week earlier that resolved within 4 hours.\nThe patient presented to the emergency department with gait instability and unclear speech. Physical examination of the patient revealed blood pressure 130/60 on the right arm and 150/75 on the left, weak pulse in both legs and no radial pulse in the arms. Neurological examination showed unclear speech and gait instability without other abnormalities. The National Institute of Health Stroke Scale (NIHSS) was 2. The Canadian scale was 10.\nElectrocardiogram revealed sinus rhythm. Computed tomography (CT) of the brain showed prior lacunar infarcts in both basal ganglia and a subacute lacunar infarction affecting left paramedian thalamus.\nTranscranial Doppler ultrasound was normal. Extracranial Duplex ultrasound showed diffuse cervical atheromatosis including non-relevant (< 50%) carotid plaques and indirect hemodynamic signs of bilateral subclavian artery (SA) stenosis (delayed increase in systolic flow with monophasic flow profile instead of a normal triphasic profile). Interestingly, both vertebral arteries (VA) also showed delayed systolic flow increase (Fig. ). A bilateral subclavian steal phenomenon was then suspected and arm compression test with a blood-pressure cuff was performed. The test was repeated on both arms; release of the pressure cuff led to reverse flow in the right VA and loss of diastolic flow in the left VA (Fig. ). The arm compression test was repeated because of the patient's neurological symptoms while we recorded basilar artery (BA) waveforms (Fig. ) by means of transcranial Doppler. The normal anterograde BA flow became retrograde following the causative ischemia test in either arm (Fig. ).\nThe suspected diagnosis was athero-embolic stroke affecting left thalamus due to proximal left subclavian atheromatosis. Additionally, the patient suffered bilateral subclavian steal phenomenon, mainly on the right side. The patient was admitted to the stroke unit. A CT angiography performed 24 hours later confirmed the data from the ultrasound study. It showed stenosis about 77% of the right subclavian artery and 50% of the left.\nStenting was performed on both subclavian arteries in the same procedure free of complications. Pharmacological double anti-aggregation treatment was established; acetylsalicylic acid 150 mg/d and clopidogrel 75 mg/d.\nAfter two months, the patient was asymptomatic. Cervical ultrasonography confirmed permeability of stents in the subclavian arteries and absence of steal phenomenon. |
A baby was born by emergency caesarean section due to foetal distress and meconium stained liquor, to a 27- year old primi gravid, Sinhalese female. The mother had fever during delivery and had been febrile 2 days prior to delivery. The baby had respiratory distress at birth and his umbilical cord was stained with meconium. The chest radiograph revealed evidence of meconium aspiration. The baby was given incubator care and was started on intravenous crystalline penicillin and gentamycin. Initially as the baby had features of meconium aspiration syndrome, he was kept off any fluids by mouth and was given intravenous 10% dextrose 60 ml/kg/day with Calcium Gluconate. The baby’s respiratory distress gradually resolved and he weaned off and sent to cot care on day 3. At this point the baby was commenced on expressed breast milk every 3 hours. He remained afebrile in first 4 days. On day 5 of life, he developed fever spikes (102°F). The baby’s C-reactive protein was normal. Serial full blood counts showed gradual decline in platelet counts and a >20% rise in the PCV. At this stage, total intravenous fluids were gradually increased to 150 ml /kg and continued at a rate of 150 ml/kg/day. The baby’s pulse rates, capillary refilling time, warmth of peripheries, urine output were closely monitored to detect any haemodymanic instablity. Breast feeding was started on day 5 of illness and was fully established by day 8 of illness. IV fluids were gradually reduced and omitted on day 8 of illness. The baby’s serial full blood counts are shown in Table . As sepsis or a viral infection was suspected the baby was given cefotaxime intravenously.\nAs the mother was febrile during delivery, possible perinatal dengue was suspected. The baby’s dengue NS1 antigen test was strongly positive on day 3 of fever and the dengue specific IgM antibodies were weakly positive. The PCR was negative. The mother was also tested at the same time and both dengue IgM and IgG were positive. The baby’s blood culture did not yield a bacterial growth and the blood picture showed evidence of viral infection. The liver enzymes were elevated. He was managed as having dengue haemorrhagic fever according to the 2011 WHO guidelines []. During the clinical course, he did not develop any evidence of haemorrhage or pleural effusions or ascites. He was discharged on Day 14 of life. |
A 42-year-old man with no previous medical history presented with mild dyspnea on exertion and abdominal distension that lasted for a week. Computed tomography (CT) revealed a huge homogeneous mass completely obstructing the right ventricle and extending into the pulmonary trunk (Fig. a, b). CT findings showed little evidence of blood clots and moderate amounts of pericardial effusion (Fig. b). The patient was admitted via the emergency room for further evaluation and scheduled for echocardiography the next day. However, he suddenly collapsed the next day while on his way to an echocardiography. Cardiopulmonary resuscitation (CPR) was performed immediately by medical staffs, but heart rhythm did not recover. Accordingly, an extracorporeal membrane oxygenation (ECMO) device was inserted percutaneously via the left femoral artery and right femoral vein and ECMO support was urgently initiated. Subsequently, a pericardial window was created at bedside, and about 350 cc of dark blood colored effusion was drained. Soon afterward, blood pressure stabilized but consciousness was not confirmed. But his light reflexes remained intact. Based on consideration of right ventricular outflow tract (RVOT) obstruction in the initial CT scan, we decided to remove the mass from the right ventricle immediately. Surgery was performed using a median-sternotomy approach. Initially, an arterial cannula was placed in the distal aspect of the ascending aorta, and the superior and inferior venae cavae were cannulated to establish cardiopulmonary bypass (CPB). After aortic cross-clamping, the pulmonary trunk and RVOT were incised. By intra-operative gross visualization, the tumor was located in the RVOT and protruded from endocardium of the right ventricle out of epicardium of the right ventricle (Fig. a) and also extended toward and was attached to the right leaflet of the pulmonary valve (Fig. b). The tumor was fragile and considered highly likely to be malignant and impossible to completely control, and thus, we planned chemotherapy after surgery. The main mass was resected to relieve the RVOT obstruction, and after the operation, the ECMO was removed from the operation room. However, the patient failed to regain consciousness and electroencephalography (EEG) and subsequent magnetic resonance imaging (MRI) indicated severe hypoxic brain damage. We assume CPR was unsuccessful because the mass completely blocked the RVOT. Pathology revealed the mass was an undifferentiated spindle cell sarcoma (Fig. a, b). |
A 47-year-old male patient from Gaza was referred to our hospital due to body weakness, dysphagia and dysarthria of 14 days duration.\nHe was in his usual state of health until two weeks before admission when he started to complain of proximal muscle weakness that was increasing in severity in addition to fatigue, difficulty in speech and chocking episodes mainly triggered by liquids.\nIn Gaza hospital the doctors performed a brain and whole spine MRI which showed no abnormality. Furthermore, a lumbar puncture was done with normal results.\nDue to a progressive deterioration of his symptoms, as his weakness was so severe he was almost became quadriplegic, his case was referred to our hospital.\nAn NG tube was introduced due to his severe dysphagia and he was reevaluated with a thorough physical examination that showed: mild respiratory distress with a respiratory rate of 19 breaths/min, vitiligo over his entire body, weak gag reflex and nasal speech. The lower limb weakness was 1/5 bilaterally and the upper limb weakness was 2/5 with intact sensation and hyporeflexia.\nAn electromyography (EMG) and nerve conduction studies were also performed and showed a decrement in the muscle action-potential which lead to the suspicion of myasthenia gravis. Thus a serum anti-Ach receptor antibodies titer was done with positive results leading to the confirmation of this suspicion.\nDuring the patients’ time of hospitalization and evaluation, it was discovered that his fasting cortisol levels and TSH levels were low (TSH was 0.35 mU/L) whereas the T3 and T4 were high.\nSince the patient was found to have findings of three autoimmune diseases, autoimmune polyglandular syndrome was considered.\nSix sessions of plasmapheresis were done. The patient was also prescribed prednisolone pyridostigmine, azathioprine, vitamin D and thyroxin.\nAfter we started his treatment, the patient's muscle power started to improve (after the third session of plasmapheresis we could notice the improvement).\nIn addition, physiotherapy was recommended and after six sessions he was able to walk alone again, the NG tube was removed and he was started on oral feeding with a semi-solid diet.\nHe was discharged later after a good response to treatment with a good prognosis. |
A 17-year-old uneducated girl from poor socio-economic background residing in an overcrowded locality came to our OPD with a complaint of a lump on the right side of the neck in the supraclavicular region. She first noticed the swelling 4 months ago, which gradually increased in size without any pain. The detailed family history revealed that her mother suffered a case of pulmonary tuberculosis and was on anti-tubercular treatment. The patient had only been involved in household work without any engagement with pets. She was on mixed diet with normal appetite without any history of weight loss or fever. Clinical examination of the lump revealed a uniform non-tender, cystic swelling of around 5-6 cm with slight fluctuation as well in the right supraclavicular region ().\nThere were no signs of erythema and echymosis. A presumptive diagnosis of tubercular cold abscess was made on the basis of her family history. Complete blood count was normal except for slight eosinophilia. Mantoux test was negative and chest radiograph was absolutely normal. Absolute eosinophil count was raised (850 cells/microlitre).\nUltrasonography of the neck showed a thick walled cystic lesion having internal septations and echoes with peripheral vascularity in the subcutaneous plane in the right supraclavicular region. Due to the USG findings, aspiration of the swelling was performed under aseptic conditions using an 18G needle. The aspirate in the syringe was clear watery fluid and was sent for cyto-chemical analysis. The fluid was reported to be acellular with some proteinaceous content. The swelling completely regressed after aspiration. Because of the clear fluid aspirate, the differential diagnosis of hydatid cyst was considered. Ultrasonography of the abdomen revealed no abnormality.\nOn the 5th post aspiration day, the patient presented with a tense and tender swelling in the same region. Again aspiration was done and pus came out in the syringe. Despite all our aseptic precautions, the swelling got infected during the first aspiration. Intravenous antibiotics were initiated and contrast enhanced computed tomography (CECT) of the neck and thorax was planned. CECT showed a heterogen- eously enhancing lesion at the level of the thoracic inlet just posterior to the lateral aspect of the right clavicle. Medially the lesion was abutting and causing erosion of the transverse process of T1 vertebra and the first rib ().\nPosteriorly the lesion was abutting the scapula and subscapularis muscle with maintained fat planes. Overall CECT showed an infected nodal mass or complex cystic lesion. Bilateral lung fields were clear on CT. Surgical excision of the cyst was planned under general anaesthesia using supraclavicular skin crease incision. Surgical exposure revealed a thick walled cystic mass with numerous small lymph nodes and areas of fibrosis around it. The entirety of the mass was excised and sent for histopathology (). Since we were keeping hydatid cyst as one of the our probable diagnosis, the wound was irrigated with hypertonic saline (20%) and betadine. Closure was done in three layers.\nHistopathology confirmed the diagnosis for hydatid cyst by showing the presence of three classical layers: the innermost germinal layer, middle laminar membrane, and outermost thick pericyst (). During the post-operative period, Albendazole 400mg/day was given for 2 months and the patient was regularly followed up without any signs of recurrence. |
Miss AB, a 20-year-old female, attended our outpatients’ department (OPD) on 16 August 2007 with complaints of lump lower abdomen for last two months []. She also complained of nausea and vomiting for the last few days. She had history of primary amenorrhea and poorly developed secondary sexual characteristics. There was no history of cyclic abdominal pain, hormonal intake, radiation exposure or any chemotherapy. There was no history of significant trauma and medical or surgical illness. There was no history of any major disease in the family. She is the second child of her mother being delivered vaginally at the age of 29 years. The mother reported that the pediatrician after examining the baby told the parents that the external genitalia of the baby were inadequately developed and advised the mother to return after one year if there was no adequate development. Over time they did not turn up and she started growing up as a female although with very poor development of her secondary sex characters. She has one brother and one sister. All of them attained puberty normally and are enjoying good health.\nOn general examination her condition was fair, height 146 cm and weight 42 kg. She had mild pallor. There was no cyanosis, clubbing, edema, obesity, acne, hirsutism, thyroid swelling or cushingoid features; her breast was small, underdeveloped with hypopigmented areola (Tanner Stage II). There was no axillary or pubic hair. Her systemic examination including chest and Cardiovascular system were within normal limits. Per abdomen examination revealed lump in lower abdomen, there was no visible swelling in the inguinal region. Her external genitalia were infantile. There were hypertrophied clitoris resembling like a micropenis. She had inadequately developed vulva with small vaginal pit [].\nHer blood group was A +ve, H aemoglobin percentage 7.5 g% and all other routine blood tests were within normal limits. Her S. AFP was 48815.2 IU/ml (normal range <7.22 IU/ml), serum beta hCG=1.24 mIU/ml (normal range <6.15 mIU/ml), serum prolactin and thyroid profile were within normal limits, serum testosterone level 924 ng/dl (normal range 300-1000 ng/dl), serum estradiol 31.18 pg/ml, serum calcium 7.6 mg% and Parathyroid hormone level 9.69 pg/ml. Karyotyping showed 46 xy pattern. A whole abdomen ultrasonography (USG) showed no uterus and ovaries. There was a lower abdominal mass approx 15 cm × 15 cm × 10 cm, probably neoplastic changes in an intra-abdominal testis, with mild ascites.\nA USG-guided fine needle aspiration cytology (FNAC) from the tumor mass reported the possibility of non-seminomatous germ cell tumor, possibly embryonal carcinoma. Smear from ascitic fluid was suggestive of metastatic adenocarcinoma. Computed tomography (CT) scan of brain revealed normal findings. PA view chest X-ray was normal.\nA diagnosis of Stage IIIC malignant germ cell tumor (embryonal carcinoma) of undescended (intra-abdominal) gonad was made. The tumor board of our Institute decided to go in for laparotomy following a few courses of neoadjuvant chemotherapy.\nShe received three cycles of neoadjuvant chemotherapy (Regime Bleomycin, Etoposide and Cisplatin). Post chemotherapy an assessment of the disease status was done by a CT scan whole abdomen, which revealed an oval-shaped residual solid mass arising from the left side of the pelvis and externally to the lower abdominal cavity; the size of the mass was 12 × 7.2 cm × 9.5 cm. No adjacent organ infiltration was noted. No ascitis, vascular or ureteric encasement was seen. No hepatic secondary or significant lymphadenopathy was noted. Serum AFP came down to 3.4 IU/ml and S. B. hCG: 3.24 mIU/ml. After proper counseling and written and informed consent, laparotomy was done on 10 December 2007 under general anesthesia. The findings were: left testis was enlarged, 15×10 cm, right testis was of normal size, no uterus/ovaries detected.\nAt laparotomy (L) orchidectomy with removal of tumor, (R) orchidectomy, omentectomy and appendisectomy was performed [Figures –]. Histopathological examination of the excised specimens: Left testis: embryonal cell carcinoma, Right testis– normal, omentum – metastatic deposit, appendix- chronic appendicitis. Her postoperative recovery was uneventful. She was discharged on 18– December 2007 and advised to attend the Gynecology OPD after three weeks at which her S AFP level was 2.3 IU/ml.\nPostoperatively she received two more cycles of adjuvant chemotherapy of the same regime.\nOn 25 February 2008 repeat total S. testosterone was 120 ng/dl and free testosterone 940 ng/dl.\nOver four months after operation she was doing well and her secondary sexual characters were developing (breast development Tanner Stage III) after taking hormonal supplementation advised by the endocrinologist. She is on regular follow-up, she attended our OPD for checkup on 20 October 2009 with no evidence of disease clinically, USG was within normal limits and normal S. AFP. |
A 40-year-old man was evaluated for bilateral hilar opacities on radiographs by a contrast-enhanced CT of chest. The patient had significant history of bilateral femoral vein thrombosis two years back for which the patient was hospitalized; the patient also had recurrent episodes of hemoptysis for last one and a half year for which he did not undergo any imaging and which was managed conservatively with antibiotics. The patient had also developed aphthous ulcers in the past year that lasted for two to three weeks. There was no evidence of genital ulcers, uveitis, or skin lesions either historically or on physical examination. Laboratory studies were remarkable for a raised ESR. ANA and RF were absent; coagulation studies were normal. CECT chest revealed large saccular aneurysms involving the segmental branches of lower lobe arteries bilaterally and right upper lobe artery []. The bronchial arteries were hypertrophied; eccentric, organized thrombi were seen in few aneurysms []. Pulmonary angiography was performed through the jugular vein as transfemoral cannulation was not possible because of bilateral femoral vein thrombosis which confirmed the presence of multiple pulmonary artery aneurysms. The final diagnosis of Hughes-Stovin syndrome was made. The possibility of incomplete Behcet was also considered as the patient did not fulfill the diagnostic criteria of the complete Behcet's syndrome. The patient was put on topical steroids (as mouth paint for oral ulcers), systemic steroids, and azathioprine (in view of pulmonary vasculitis and aneurysm formation); the steroids were subsequently tapered and withdrawn after 6 months (aspirin and anticoagulation were avoided in view of hemoptysis). More than one year of follow up has documented the resolution of oral ulcers without any fresh recurrence; there has been no fresh episode of deep venous thrombosis. The patient had two episodes of mild hemoptysis which was managed conservatively. There was no evidence of enlargement of the pulmonary artery aneurysms on follow-up CT scans. |
A 28-year old male patient reported to the clinic with a hard maxillary swelling in the left posterior quadrant. On clinical examination, the swelling was seen associated with the premolars and first molar in the left maxillary quadrant (). The swelling was bony hard in consistency and was approximately 2 cm in size, with normal stretched mucosa covering it on the palatal and vestibular areas. The examination of teeth revealed a missing canine. The premolars and molars were malaligned but did not show any mobility.\nOn examination with an orthopantomogram, a fully developed impacted canine was noted in the left antral floor area (). In the region of 21 and 22, a radiopaque mass was seen approximately 1.5 cm in diameter. Posterior to the radiopaque mass, a multilocular radiolucency was seen. A computed tomography (CT) scan revealed an impacted canine in association with a radiopaque mass. It extended posteriorly into a large well-defined multilocular radiolucent lesion with specks of radiopacity (). The swelling had caused palatal expansion and a notable expansion of the buccal aspect of the alveolar bone. Teeth 24 to 26 were involved in the lesion and showed considerable root resorption. Resorption of the lateral incisor was seen till the mid-half of the root extending into the odontome. The premolar and molar teeth showed resorption of roots till the middle 3rd of the root ().\nA provisional diagnosis of COC with an impacted canine and odontome was made for the first case and was treated with conservative surgical removal of 23, odontome, and the radiolucent lesion. The radiopaque and radiolucent lesional tissues were removed in toto and appeared to be well circumscribed. Gross examination revealed a soft cystic lesional mass along with maxillary canine ().\nOn histopathological examination, the hematoxylin and eosin- (H&E-) stained sections showed odontogenic cystic epithelium with tall columnar basal cells with polarized hyperchromatic nuclei. Suprabasal cells resembling the stellate reticulum-like cells and ghost cells were evident (). The connective tissue showed odontogenic epithelial islands, nests made of cuboidal cells with multiple areas of ghost cells (). The ghost cells showed calcification in a few sites. Varying amounts of mineralized dysplastic dentin and dentinoid were seen in association with odontogenic epithelial cells (). Reactive and residual bone was seen at the periphery of the lesion.\nThe decalcified H&E-stained sections of the hard mass showed dentin, cementum, and ectomesenchymal tissues similar to the dental papilla. All these tissues were arranged haphazardly representing a composite complex odontome (). A diagnosis of DGCT with odontome and impacted canine was given.\nFollow-up led to the disclosure of recurrence in the maxillary antral floor in the form of a solid tumor (DGCT) after 11 months, but the patient was asymptomatic.\nA CT scan was done revealing a lowering mass in the antrum showing radiolucent radiopacities (), and a provisional diagnosis of recurrent DCGT was made. The recurrent tumor was treated with surgical therapy. The patient has responded well with no history of recurrence for the last 2 years.\nThe recurrent lesion found after 11 months, showed on grossing, a predominantly solid tumor mass (Figures and 5(b)). Histopathological examination was in unison with the previous reports and findings. The only variation seen was large number of ghost cells forming islands and sheets and some were undergoing calcification (Figures and 6(b)). These islands were seen getting incorporated into the surrounding lamellar/trabecular bone at few sites. |
A male aged 35 years with a history of cyanosis from early childhood was referred for evaluation of low grade fever and worsening breathlessness on exertion. There was no history of a recent dental or surgical procedure. General physical examination revealed a moderately nourished individual with central cyanosis and grade IV clubbing. The jugular venous pulse was elevated. The pulse was regular with a rate of 100 beats per minute and a collapsing character. The blood pressure was 120/60 mmHg. On precordial examination the first heart sound was palpable. Auscultation revealed a loud first heart sound, single second heart sound and an apical opening snap. Additional findings included ejection systolic and early diastolic murmurs at the left sternal border and a mid-diastolic murmur with pre-systolic accentuation at the apex. The lungs were clear. Abdominal examination revealed a tender enlarged liver. There was no enlarged spleen. Pulse oximetry showed a room air oxygen saturation of 78%. Chest X-ray revealed enlarged heart, pulmonary oligemia and no evidence of pulmonary venous hypertension. Electrocardiogram revealed sinus rhythm, normal PR interval, right axis deviation, left atrial enlargement and right ventricular hypertrophy.\nAn echocardiogram revealed a large malaligned ventricular septal defect with 60% aortic override. The aortic valve was trileaflet with a vegetation on the right coronary cusp (Figure ). The mitral valve was thickened. Diastolic doming of the anterior leaflet, fixed posterior mitral leaflet with paradoxical motion and two well-formed papillary muscles were noted (Figure ). There was no aortic stenosis and grade II aortic regurgitation was noted in addition to severe infundibular and annular stenosis with confluent branch pulmonary arteries (Figure ). Non calcific severe mitral stenosis with commissural fusion and thickening of the sub-valvular apparatus was noted. The mitral valve area was 1.1 cm2. There was no mitral regurgitation. The peak and mean gradients across the valve were 36 and 21 mmHg respectively (Figure ) and the echocardiographic mitral valve score was 6/16. Blood cultures revealed Streptococcus viridans as the infecting organism. The serum antistreptolysin O titers were within reference range, C-reactive protein was positive and erythrocyte sedimentation rate was elevated.\nA final diagnosis of TF, subacute bacterial endocarditis of the aortic valve and severe mitral stenosis, probably of rheumatic etiology, was considered. Endocarditis with aortic regurgitation added to the hemodynamic burden and the patient succumbed to infective complications during the course of stabilization. |
We describe the case of a 42-year-old white man who was transferred to our facility due to worsening headache of 6 months evolution and new onset left facial and tongue numbness with dizziness. A head computed tomography indicated two areas suspicious for acute hemorrhage: one within the fourth ventricle and the other adjacent to the calvarium in his right cerebellum (Fig. ). His past medical history was significant for acute sinusitis and recent onset of hypertension. A physical examination at the time of presentation revealed blood pressure of 161/98 mmHg, ataxia, dysmetria, vertigo, and a positive Romberg’s test. Magnetic resonance imaging (MRI) was obtained with and without contrast.\nThe MRI showed two additional lesions: one in his left lateral cerebellar hemisphere and the other in his medial posterior left temporal lobe (Fig. ). All lesions exhibited significant signal dropout on gradient echo sequences. Heterogeneous enhancement was noted in the right cerebellar mass (Fig. ). The differential diagnosis included multiple cavernous malformations or hemorrhagic metastatic lesions.\nErythrocyte sedimentation rate, C-reactive protein, carbohydrate antigen 19-9, carcinoembryonic antigen, and a chest X-ray were ordered and found to be within normal limits. A computed tomography (CT) scan performed the next day showed increased hemorrhage size within the ventricular lesion and a new hemorrhagic hyperdensity within the left medial temporal location (Fig. ). The patient symptomatically improved over his 2-day hospital course with complete resolution of his dizziness and ataxia. He was discharged with orders for a repeat MRI after hemorrhage resolution and further testing. Surgical resection was delayed due to his presenting symptoms, uncertainty of etiology, and specific reports suggesting resection of CCMs after two bleeding incidents in eloquent brain regions or single hemorrhage in non-eloquent area accompanied by deteriorating neurological deficit [].\nThe patient was readmitted 1 week later with headache, nausea, worsening dizziness, new onset diplopia and elevated blood pressure. He was found to have a fourth cranial nerve palsy, mild decrease in the right nasolabial fold, hypophonia and continued left facial and tongue numbness. A CT scan displayed further hemorrhagic enlargement of the intraventricular and temporal lesions with development of hydrocephalus (Fig. ).\nThe patient underwent a suboccipital craniotomy and the right cerebellar lesion was resected first. The lesion demonstrated hemosiderin deposition with a gliotic margin. The telovelar approach was then used to access the fourth ventricle. The ventricular mass was well-circumscribed, pearly red and easily delineated from the ventral wall of the fourth ventricle. The mass was centrally debulked and the walls circumferentially collapsed. The gliotic margin adjacent to the brainstem was carefully delineated and gross total resection was achieved.\nImmediately after surgery, the patient developed new onset mild left third nerve palsy. MRI showed complete resection of fourth ventricular and right cerebellar masses (Fig. ). Pathology confirmed diagnosis of CCM. He was discharged on postoperative day six with improved cranial nerve functioning and resolution of ataxia but continued vertigo. Approximately 1 month after surgery, his course was complicated by culture-negative bacterial meningitis and development of pseudomeningocele that resolved with aspiration and proper antibiotics treatment. He demonstrated complete resolution of ocular cranial nerve dysfunction but exhibited mild horizontal nystagmus with rotational challenge that resolved by 6 months. |
A one-and-a-half-month-old boy of Caucasian origins was referred to our hospital for an assessment of his feet. He was born with talipes equinovarus, or clubfoot, on his right foot. Figure shows his right foot postoperatively, after the correction to his clubfoot. On his left foot he had developed pes cavus and he had curly toes on both feet (Figure ). He had also been treated for a left hip dislocation.\nThere is no information with regard to the pregnancy itself but the birth was troublesome because he was lying in a lateral position and had to be born with vacuum extraction.\nHe was born to nonconsanguineous parents and has an older sister who is healthy.\nIt was found necessary to operate on his right foot and the operation, which went as planned, took place when he was just three months old. It was noted that there was an eczematous rash corresponding to the medial-dorsal skin furrow, which was exactly where the intended incision was to be made. The eczema was described as exuding, with fluid slowly seeping out, but not as a complete epidermis lesion. He was subsequently prescribed peri-operative antibiotics (dicloxacillin) two times per day for the course of one week after the operation, and the eczema was not considered an issue for the success of the operation and healing process.\nTen days after the surgery he was admitted urgently to our hospital because the bandages were foul-smelling and he had failed to thrive for the previous two days. Necrosis was seen around the cicatrix and it was found necessary to revise the wound under general anesthesia. Afterward, he was monitored for a month every other day when he had his bandages changed and the wound healed well. He was fitted with a dynamic splint to support his right foot.\nA week after the last control, he was referred from his physiotherapist because of skin problems on his right foot. It was noted that he had a tendency to atopic dermatitis with dry skin and eczema on his cheeks, around the skin lines of his arms and several places on his legs. Furthermore, his skin was described as very delicate, with frequent superficial infections. He now had problems tolerating the splint. There were no general symptoms but it was obvious that his foot was itchy as he was seen constantly rubbing his foot against the mattress.\nThe eczema developed and spread to both feet between the toes, on the malleoli and on both crura; it was described as an infected asthmatic eczema with dry crusts. He was monitored regularly with regard to the eczema and the splint for the next two years and the skin problem gradually resolved itself. To the best of our knowledge, no allergy test was ever performed testing for allergy to the bandages.\nAt the age of two-and-a-half years old, it was noted for the first time that he had a certain type of skin pattern on his back (Figure ). It had been noted that he had developmental problems and was set back compared to his peers. He was not able to walk independently and his language was remarkably decreased and he was therefore referred to a pediatrician. It was suspected that he had a type of mosaicism but it was not possible to prove the genetic abnormality when skin biopsies were taken. Finally, when he was six years old the pediatrician at a special unit working with rare illnesses made the diagnosis of HI. The diagnosis was based on the criteria listed in Table : the clinical picture consisted of the characteristic depigmented skin pattern already noticed at the age of two and five, mental retardation, pes cavus, talipes equinovarus, clinodactyly, eczema, inverted cilia of the eye, strabismus and reduced hearing. He later developed a ventral hernia, which regressed, he got glomerulonephritis with proteinuria at the age of seven and, at the same time, it was discovered that there were missing testicles in both scrota. At the present time, he is 13 years old and has developed leg length discrepancy (Figure ), back pain and a syrinx corresponding to the conus as well as scoliosis (Figure ), for which he has recently had successful surgery.\nThe databases of biblioteket.dk, SveMed+, PubMed, Embase, Cochrane Library and Cinahl were searched using the following words, either by themselves or in different combinations: hypomelanosis, pigmentation disorders, hypopigmentation, hypomelanosis of Ito, hypopigmentation [Mesh: NoExp], hypopigmentation [Mesh: narrowed by major subject-skin diseases], dermatology, hip dysplasia, Ito syndrome, orthopedics, orthopedics [Mesh], incontinetia pigmenti.\nThis search led to the identification of 112 articles, of which the abstracts were reviewed and included based on the following criteria:\n– The articles’ main subject had to be HI.\n– Written in any of the following languages: English, Danish, Norwegian, Swedish, German and Italian.\nAfter this exclusion of irrelevant articles there were 34 articles left, which we read and from these we chose 10 articles as our main references. The articles were chosen based mainly on these criteria:\n– Patients having orthopedic symptoms.\n– Patients having dermatological symptoms.\n– Articles containing diagnostic criteria and treatment/follow-up suggestions.\nThe bibliographies of the 10 articles were reviewed in order to discover any other relevant studies.\nWhen constructing Table , we used 22 out of the 34 articles and included all case reports in order to obtain the highest number of patients when counting extracutaneous symptoms.\nSince HI is a very complex diagnosis to make because of the various combinations of nonspecific symptoms described in the literature, it would be advantageous to physicians to have some diagnostic criteria on which they could base the diagnosis.\nIt is crucial that the patient is born with or develops the characteristic depigmented skin pattern early in life. It should, however, be noted that it can be extremely difficult to see the pattern on fair-skinned individuals. In these cases, a Wood’s lamp can be of help (a diagnostic dermatologic tool with which ultraviolet light can be shone on the patient’s skin, any following fluorescence can then be observed) [].\nIn 1992, Ruiz-Maldonado et al. [] published a suggestion for diagnostic criteria. The criteria were composed based on a 20-year prospective protocol performed at a reference center for diagnostic and therapeutic problems of all pediatric specialties. Forty-one cases were included-at the time the largest collection of cases, and therefore based on vast clinical experience. The criteria were again recommended by Failla et al. in 1997 [] and there appears to be no better suggestions until now. The criteria can be seen in Table .\nFor the clinician, it is perhaps not so much the diagnostic criteria as it is the presumptive diagnosis that is more relevant. It is the appearance of the hypopigmentation either alone or in combination with a congenital malformation that should aid diagnosis. This should then lead to an investigation into whether or not the patient suffers from the syndrome. It will always be of utmost relevance to do a skin biopsy from both hypo- and normopigmented skin areas and test for chromosomal mosaicism. It should be remembered though that it is not in all cases possible to verify the diagnosis this way, but that does not mean that the patient does not have HI []. It is likely that the problems we are experiencing today with regard to the identification of the mosaicism are merely because of technological limitations and that, in the future, it will be a defining diagnostic criterion.\nAs the cutaneous and extracutaneous symptoms often reveal themselves early in life, the challenge of diagnosis will often fall on a pediatrician. Other specialities that might be involved in the diagnostic process will often be dermatologists and geneticists because of the cutaneous patterns and combination of syndrome-suspicious extracutaneous symptoms.\nBefore diagnosing a patient with HI, it is important to have ruled out other hypopigmentation disorders such as the fourth stage of incontinentia pigmenti of Bloch-Sulzberger syndrome, nevus depigmentosus, linear or whorled nevoid hypermelanosis, piebaldism and segmental vitiligo. It must also be kept in mind that certain skin fungi infections can leave a color pattern on the skin, which can be similar to the one of HI [,].\nIn order to clarify if any possible links between HI and any other extracutaneous symptoms exist, the literature was reviewed and case reports including 122 patients were collected, as depicted in Table [-,-].\nNumerous symptoms are related to the cutaneous manifestations and therefore it is difficult, or perhaps impossible, to reach any conclusions with regard to the linking of HI with any specific extracutaneous symptoms. However, some symptoms cannot be ignored based on the high prevalence, as seen in Figure . These symptoms include primarily mental and motor retardation (45 percent), cramps and seizures (34 percent), delayed motor and mental development (16 percent) and hypotonia (12 percent). It may be seen that there is a great similarity between Table and Table , although Table contains more specified symptoms. |
Our patient was 30 weeks and 3 days male infant born to a 23-year-old gravida 2 para 1 mother. He was delivered by Cesarean section, due to placental abruption following pPROM. Four days prior to delivery, the mother presented to the labor and delivery unit with premature rupture of membranes. She was initially given betamethasone for pulmonary maturation and intravenous magnesium sulfate for neuroprotection. For latency period prolongation and GBS prophylaxis, a course of intravenous ampicillin (2 g q 6 × 48 hours) and azithromycin (500 mg q 6 × 48 hours) followed by oral ampicillin and erythromycin was initiated. At the time of admission, a cervical culture was taken, which was positive for Group B Streptococcus.\nOn admission, the maternal leukocyte count was 12.3 k/µL. She was afebrile but mildly tachycardic with a heart rate of 110 beats per minute. Leading up to the Cesarean delivery, the mother complained of increasing abdominal pain and contractions accompanied by vaginal bleeding, which was clinically indicative of placental abruption. The mother remained afebrile, but the leukocyte count measured 4 days after admission increased to 21.9 k/µl. Fetal heart rate monitoring started to exhibit a Category 2 tracing, which in combination with the clinical suspicion of placental abruption, resulted in the mother being taken for emergency Cesarean section. The baby was delivered in breech position, with clear amniotic fluid. He was dried and stimulated with reciprocal response. Apgar scores were calculated to be nine in the first and nine in the fifth minute of life. Although quite premature and weighing 1588 g, he was appropriate for his gestational age. Oxygen through nasal continuous positive airway pressure (CPAP) was started along with administration of Ampicillin, Gentamycin, and Penicillin. Vital signs at that time were Temperature 99.7 F, Pulse 180 beats per minute, Respiratory Rate 48 breath per minute, Blood Pressure 72/26 mm Hg, 90 SaO2. The baby was admitted to the Neonatal ICU with the diagnosis of respiratory distress and in order to rule out sepsis. Postdelivery, the mother had an unremarkable post-operative course and remained afebrile.\nThe neonate's laboratories where done at admission and showed a leukocyte count of 3.4 k/µl and a CRP of 1.37(units). Two hours into the neonatal ICU stay, the baby was unable to tolerate the nasal CPAP and sustained oxygen desaturations accompanied by bradycardia. Vitals taken at that time were P148, RR 60, BP 46/24, and 87 SaO2. Oral intubation was conducted and vital signs stabilized. An arterial blood gas (ABG) was indicative of reparatory acidosis with values of pH 7.11, pCO2 81, HCO3 25.7. A chest X-ray was done and showed haziness in bilateral lung fields suggestive of respiratory distress syndrome (show X-ray). In response to the chest radiograph, paired with the clinical findings, surfactant was given, but no clinical improvement occurred.\nShortly afterward, the baby started to decompensate and required high ventilator settings. Blood pressures started to drop. The echocardiogram showed bidirectional shunting across the atrial septal defect and a PDA consistent with pulmonary hypertension. The patient was promptly started on dopamine, dobutamine, and norepinephrine. Blood pressures stabilized, but the baby did not respond to ventilation. The baby expired later in the night despite extreme measures including fluid resuscitation. Subsequently, the peripheral blood cultures came back positive for gram-negative bacillus, later identified as Escherichia Coli, and gram-positive cocci in clusters. The antibiotic sensitivities of the Escherichia Coli displayed resistance to ampicillin but sensitivity to cephalosporins. An autopsy was later conducted at the hospital and revealed gram-negative bacilli in multiple areas of the lungs with significant congestion, hemorrhage and focally hyaline material deposits in both lungs. Further pathological testing established that the gram-negative bacilli were morphologically consistent with the previously cultured E coli including the same antibiotic resistance pattern. In summary, the report supported that the cause of death for the patient was overwhelming sepsis and pneumoniae due to ampicillin-resistant E coli. |
A 39-year-old man was referred to the Department of Cardiology to evaluate recurrent syncope. The patient had the first syncopal episode during meals 5 months ago. At that time, he experienced dizziness and chest tightness, which was followed by a sudden loss of consciousness. He regained full consciousness after several seconds. No seizure-like movements or urinary incontinence occurred during that episode. Subsequently, he has experienced four more episodes of syncope.\nHe had a 2-year history of hypertension, which was treated with telmisartan, amlodipine, and carvedilol. Additionally, he was diagnosed with diabetes mellitus 1 week before he visited our hospital. His diabetes was controlled using oral hypoglycemic agents.\nOn admission, his blood pressure was 118/72 mm Hg, and his heart rate was 70 beats per minute. He was alert, and the results of other physical examinations including a cardiac examination were normal. The results of most of the hematological and biochemical tests were normal, but the hemoglobin A1c level was 8.2%. Chest radiographs did not show cardiomegaly or active lung lesions. An initial 12-lead electrocardiogram (ECG) and 24 hours ECG recording both showed a normal sinus rhythm. His echocardiogram did not show any significant heart abnormalities. A treadmill exercise test showed that the patient had good exercise capacity, and no abnormal findings were obtained. Subsequently, we performed the head-up tilt test. During this test, we made him drink a cold beverage (Chilsung cider). The patient felt sudden dizziness, and his ECG showed a transient complete atrioventricular (AV) block with no ventricular escape beats for 6.2 seconds (). The head-up tilt test was repeated the next day. During that test, the patient was given a cold beverage at 5, 15, and 16 minutes from the start of the test and immediately developed a complete AV block without ventricular escape beats at time points of 4.92, 5.2, and 5.56 seconds. He simultaneously experienced dizziness and chest tightness ().\nThe patient was diagnosed with swallow syncope and was advised to avoid cold beverages, particularly cold carbonated drinks. After he was discharged, the patient did not suffer from any dizziness or syncope. However, if syncope recurs after controlling cold beverage intake, a permanent pacemaker will be implanted. |
A 20-year-old lady presented with complaints of headache and vomiting from past one and half months; headache was increasing in severity and there was relief on vomiting. She had no history of blurring or diminution of vision or seizures. There was also no history of motor or sensory disturbances. On examination, no abnormality was detected. The patient underwent computed tomography (CT) scan of brain, which showed space occupying lesion in the right frontal lobe, measuring about 6×6 cm []. Fundus was normal. She underwent near total excision of the lesion. Postoperative period was uneventful. Histopathology of the specimen showed features suggestive of papillary carcinoma of choroids plexus. There was increased cell density, increased mitotic figures (greater than 5 per 10 high-power fields), nuclear pleomorphism, and necrosis. Diffuse invasion of the adjacent brain parenchyma was present []. On immunohistochemistry, it was positive for glial fibrillary acidic protein and negative for epithelial membrane antigen []. Since the diagnosis of papillary carcinoma of choroid plexus is very rare in adults, patient was worked up to rule out any primary disease elsewhere in the body. Thyroid scan, chest X-ray, and ultrasonography of abdomen and pelvis were normal. Stool for occult blood was negative. Complete blood count and peripheral smear was normal. Cerebrospinal fluid (CSF) was examined for the presence of malignant cells and it was found to be negative for malignant cells. The patient received radiation to whole brain on telecobalt unit, using German helmet technique, with two lateral portals. Initial dose was 4000 cGy/20 fractions (200 cGy/fraction). Later, she received boost to the primary tumor bed, using antero-lateral wedge pair technique, to a dose of 2000 cGy/10 fractions. Along with radiation, the patient also received four cycles of intrathecal methotrexate (12 mg), cytarabine (50 mg) and hydrocortisone (20 mg) weekly. The patient tolerated the treatment well; except for grade 2 vomiting, there was no other toxicity. |
28-year-old G5P3105 at 10 weeks, 2 days with a dichorionic diamniotic gestation presented to the Emergency Department with sharp and constant abdominal pain, localized to her left lower quadrant. Review of systems was otherwise negative. The patient's medical history was noncontributory, though her obstetrical history was significant for a prior set of twins (with spontaneous conception of both sets) and a history of four low transverse cesarean sections. On physical examination, the patient's vital signs showed blood pressure 97/61, which was stable for her per chart review. Heart rate, respiratory rate, and temperature were within normal limits. Her abdomen was tender to palpation throughout, but there was no distention, guarding, or rebound. FAST (Focused Assessment with Sonography in Trauma) scan by the Emergency Medicine physician was positive for intraperitoneal fluid. Sterile speculum exam was negative for blood and the cervix appeared closed. She had hemoglobin of 8.8 g/dL and hematocrit of 22.3%, which was decreased from 12.7 g/dL and 38.8% a month earlier. Based on physical exam and ultrasound there was a strong suspicion for internal bleeding, and three units of packed red blood cells were transfused to the patient and Gynecology was consulted.\nOn presentation to the Gynecology team, the patient's vital signs were stable and her pain was well controlled with narcotic medication. An ultrasound exam was performed demonstrating two intrauterine fetuses with cardiac activity and a small subchorionic hemorrhage behind the placenta of twin B. Previous ultrasound from an outside hospital did note that the fetuses are low within the uterus (). Due to the unilateral nature of the pain, the intraperitoneal fluid was suspected to be blood from a ruptured ovarian cyst which would hopefully resolve spontaneously. Initially we opted for conservative management in order to avoid surgical intervention during the first trimester of pregnancy, and she was admitted for observation and serial abdominal exams. By midafternoon, however, patient reported increased pain and lab work demonstrated significant decrease in hemoglobin. The decision was made to proceed with diagnostic laparoscopy for hemoperitoneum.\nPrior to going to the operating room, we confirmed fetal cardiac activity of both twins by transabdominal ultrasound. The patient was placed under general anesthesia and we proceeded with a diagnostic laparoscopy. Hemoperitoneum was noted and 900 mL of blood was evacuated. Inspection of both ovaries showed bilateral simple cysts, none appeared ruptured, and no active bleeding was noted. However, upon exploration of the anterior pelvis, a fetal part was found extruding through the lower anterior uterus. We immediately converted to a laparotomy and discovered that the uterus had ruptured along the hysterotomy scar, leaving a 5 cm defect in the anterior uterus. The exteriorized fetus was removed, but chorionic tissue remained attached to the endometrium. In an attempt to save the remaining fetus, the hysterotomy was repaired with a single layer of Vicryl suture in a running locking fashion with good hemostasis noted. Another two units of packed red blood cells were transfused to the patient intraoperatively and her vital signs remained stable. Upon finishing the operation, transvaginal ultrasound was performed and confirmed the remaining intrauterine fetus with visualized cardiac activity.\nThe patient remained stable in the postoperative period and as her fetus was previable it was decided she could be managed with outpatient monitoring. She was counseled extensively on risks of subsequent uterine rupture with maternal or fetal demise. In addition, patient was counseled on grave prognosis of remaining fetus due to uncertainty of how well the placenta would continue to function. Ultrasounds were initially done every 2 weeks and then with increasing frequency as pregnancy continued. Possible placenta accreta as well as evidence of subchorionic hemorrhage from the area of retained chorionic tissue was demonstrated by ultrasound. The placenta was located anteriorly and extended over the lower uterine segment and hysterotomy scar. As the patient approached viability, which is 23 weeks of gestational age at our institution, the Obstetrics Department had a discussion about delivery planning. Final plan agreed upon was to perform repeat cesarean section with any indication for delivery and to prepare for possible cesarean hysterectomy due to possible placenta accreta and/or retained placenta in the hysterotomy scar.\nThrough the remainder of her pregnancy, she experienced multiple episodes of vaginal bleeding, requiring admissions for prolonged monitoring at 16, 20, and 21 weeks of gestational age, at which time she was admitted until delivery. The patient received a course of betamethasone for improvement of fetal lung maturity, first dose given at 22 weeks, 6 days. At 23 weeks, 1 day the patient had acute worsening of abdominal pain with vaginal bleeding of large blood clots. Decision was made to proceed with emergent cesarean section. A classical uterine incision was performed and about 300 mL of blood preceded delivery of the fetus. The placenta was delivered with the fetus. A remaining piece of placenta was removed from the anterior lower uterine segment. Banjo curettage was performed to ensure all remaining products were removed and uterus remained hemostatic with appropriate tone, so a cesarean hysterectomy was not indicated. The uterine incision was closed and good hemostasis was noted. The postoperative period was complicated by acute blood loss anemia and she required another blood transfusion; however, she recovered well and was discharged home in good condition on postoperative day three.\nThe fetus was born weighing 423 grams. She had APGARs of 4 at one minute, 9 at five minutes, and 9 at ten minutes. Venous blood gas (arterial blood gas sample was inadequate) showed pH of 7.29, pCO2 of 58.0 mEq/L, and base excess of −0.4 mmol/L. The neonate had an exceptional NICU stay; she did not develop intraventricular hemorrhage or necrotizing enterocolitis, though she did have transient retinal and renal issues that resolved by the time of discharge. She was diagnosed with respiratory distress syndrome now being managed as an outpatient with Aldactazide. She was discharged home at 41 weeks, 3 days of adjusted gestational age, weighing 2145 grams. |
A 77-year-old man with a history of alcoholic dementia and intracerebral hemorrhage was referred by a nursing home to undergo an exchange of feeding tubes because his tube had suddenly loosened 3 days previously. He had undergone a PEG procedure 3 times and a simple exchange of PEG tubes twice. The first PEG procedure was performed 33 months earlier for enteral feeding. The second PEG procedure was performed 2 weeks after the first because the patient had forcibly pulled out the initial feeding tube. The second PEG procedure had to be newly done because the tract of the first PEG site was obstructed shortly. The site of the second PEG was close by the first PEG site. The patient's condition was stable for 27 months after the second PEG procedure was done. The third PEG procedure was performed 6 months prior to this consultation owing to buried-bumper syndrome. At that time, the patient presented with a loosened tube and abdominal pain. Because an upper endoscopy revealed that the feeding tube bumper was buried in the gastric wall (), the feeding tube was removed. The previous fistula tract required 4 days to close completely. Subsequently, a new gastrostomy was performed near the previous PEG site before discharge. The patient's condition had been stable for 6 months after the third PEG. Upon admission to our hospital, the patient's blood pressure was 90/60 mmHg and body temperature was 36.1℃. The blood test results were as follows: hemoglobin level, 3.7 g/dL; BUN level, 108.2 mg/dL; creatinine level, 5.5 mg/dL; estimated glomerular filtration rate, 10.7 mL/min/1.73 m2; and CRP, 229.99 mg/dL. An upper endoscopy revealed that the bumper of the feeding tube was deeply buried within the gastric wall, forming a hole (). A large space was observed when the scope was advanced into the hole, and brownish material was attached to the bumper (). These findings suggested gastric wall perforation resulting from a deeply buried bumper. The feeding tube was exchanged to seal the gastric wall opening, and the bumper of the tube was positioned in the gastric cavity. The patient was admitted to the intensive care unit. Because peritonitis and aspiration pneumonia caused a septic condition with acute kidney injury, medical therapies including hydration, blood transfusion, continuous renal replacement therapy, and broad-spectrum antibiotics were applied. In consideration of the patient's condition, medical treatment, including total parenteral nutrition, was continued rather than using a surgical option. The feeding tube was withdrawn when pus discharged from the gastrostomy site on the 10th day of hospitalization. The patient's condition improved for a while, and the external opening of the colocutaneous fistula was nearly closed 3 weeks after admission. According to his family's request to insert a feeding tube through the gastrostomy tract, an upper endoscopy was performed again. The gastric wall opening was still unhealed. When the scope was advanced into the opening, the lumen of the transverse colon and a bluish liver shadow were identified (). The diagnosis of a gastrocolocutaneous fistula was confirmed at that time. The patient died of multiple organ failure caused by pneumonia aggravation 1 week later. |
Our patient is a 67-year-old male with a history of hypertension, type 2 diabetes, and hyperlipidemia, who went through the Inova Movement Disorders Program due to a history of fluctuating, progressing uncontrollable movements of the left side of his body. He reports these movements had been present for around 10 years, worsening over time.\nAt baseline, he always felt that his left arm and leg were moving, at times exhibiting large amplitude movements which could knock things down or affect his walking, making him fall. He described it as abnormal, uncontrollable movements that made his arm ‘reach around or fling out’ His leg was also described to ‘dance on its own.’ While at baseline, these were present but minimal stress or anxiety would exacerbate the movements. There were no movement issues on his right side, nor any facial movements noted.\nHis exam showed episodic, mild with some interspersed moderate-amplitude quick movements of the left hand, forearm, proximal arm muscles, as well as movement of the left leg. These were not suppressible, brought out more by distraction or with anxiety, such as discussing an MRI scan as he was claustrophobic. He also demonstrated some lateralizing movements of the head to the left, but no facial or tongue movements. His right side showed no such signs, and his neurological exam was otherwise unremarkable.\nHe was sent for a CT scan of the head initially due to a fear of MRI scanners, and was found to have asymmetric calcification of the right caudate nucleus and anterior putamen (Figure ). The calcification spared the anterior limb of the internal capsule. Laboratory work for parenchymal calcification was then sent and was normal. The MRI of the brain with contrast demonstrated both hypointense gradient echo (GRE) signal in the right caudate nucleus and putamen, as well as an underlying DVA (Figures -).\nGiven the lateralizing of his deficits and correlation with opposite hemispheric parenchymal calcification, he was diagnosed with unilateral hyperkinetic movements as a product of putamen and caudate calcification from an underlying DVA. Consideration was made for focal hemorrhage, but presentation and imaging were not thought to reflect this pathology. He was then treated with 0.25 mg clonazepam 2x daily with significant improvement in his hyperkinetic movements. |
An 18-year-old male African descent patient was admitted complaining of pain in the right upper quadrant of the abdominal region for the last 3 months. The physical examination revealed a firm, solid mass with an irregular lower border and mild tenderness in the liver topography. Abdominal ultrasonography and computed tomography (CT) scans showed a solid mass in the right hepatic lobe, measuring 21 cm in its largest diameter, with possible colon and right kidney invasion, and vena cava compression (). Preoperative right hepatic artery embolization was performed. In follow-up CT, areas of partial necrosis and no tumor size regression were found. The patient underwent exploratory laparotomy. The right lobe of the liver was partially replaced by a yellow-purple-red solid tumor, which was in continuity with the right kidney and hepatic colon flexure. There were no signs of peritoneal disease and no evidence of metastasis in liver segments 1 to 3. A right extended hepatectomy with en bloc resection of the right kidney, gallbladder, and partial colectomy (hepatic colon flexure) with primary anastomosis was performed.\nThe surgical specimen consisted of a portion of the liver, of the gallbladder, a segment of the colon, and of the right kidney, previously fixed in formalin, measuring 30 cm × 25 cm × 13.5 cm, and weighing 4313 g. On cut surface, the hepatic parenchyma was replaced by a yellowish-gray, multilobulated, soft tumor, with yellow central areas, that measured 21 cm in its largest diameter. The lesion was adhered to the colon and kidney, but without clear signs of invasion. On hematoxylin-eosin staining, a neoplastic process composed of sheets or lobules of small round cells, with little cytoplasm, and darkly staining, round or oval nuclei, was identified (). The lesion also showed areas of necrosis, high mitotic index, and rare rosettes. The immunohistochemical study of lesion revealed positive expression for vimentin (Vim 3B4—) and CD99 (12E7—), and negative immunostaining for desmin (D33), cytokeratin (AE1/AE3), and neuroblastoma protein (NB84). The liver parenchyma adjacent to the tumor had a normal histologic appearance. The morphology of the hepatic lesion associated with the findings of the immunohistochemical study was consistent with PNET. One month after surgery, venous thrombosis extending from the iliac vessels to the right atrium and multiple metastatic implants in the lungs were identified in thoracic CT. The patient had a sudden death due to massive pulmonary thromboembolism. At this time, it was not possible to perform genetic studies to establish the lineage of the neoplasm. |
A 59-year-old female patient with a history of hypertension was diagnosed with a well-differentiated stage IIB SCC of the cervix according to the International Federation of Gynaecology and Obstetrics classification where she underwent a total abdominal hysterectomy and bilateral salpingo-oophorectomy followed by adjuvant chemoradiation. She received a weekly dose of cisplatinum along with external and internal beam radiotherapy. There was no evidence of locoregional recurrence during her follow-ups and serial Papanicolaou smears were negative.\nTwo years later, she was admitted to the emergency department (ED) for acute bowel obstruction, with generalized abdominal pains, worsen in the right iliac fossa (RIF) associated with vomiting of gastric content, and without passage of stools or flatus. On physical examination, her vital signs were stable. Abdominal examination revealed a slight tenderness in the RIF, exaggerated bowel sounds with a 4 cm × 4 cm hard mobile lump in the RIF. Digital rectal examination revealed an empty rectal bowel. All the lymph node areas were disease-free. In the ED, abdominal computerized tomography (CT) scan revealed an intraluminal-caecal mass, measuring 43 mm in diameter, rounded in shape, tissue density, homogeneous, discreetly enhanced by the contrast product with no distant metastatic spread ().\nGiven the evidence of acute bowel obstruction, an exploratory laparotomy was performed which revealed a single hard, mobile mass of the caecum of size 5 cm × 5 cm. An extended right hemicolectomy with resection of two nodules in the umbilical and right parietal peritoneum and manual end-to-end ileo-transverse anastomosis was performed (). The postoperative course was uneventful and the patient was discharged on day 3. Histopathological examination of the resected specimen concluded a triple secondary localization of SCC in the caecum and both the nodules of the umbilicus and parietal peritoneum ().\nFollowing discussion in a multidisciplinary team meeting, the patient was addressed for complementary adjuvant chemotherapy where she received a combined carboplatin 540 mg and Gemcitabine 700 mg without radiotherapy. An 11 months follow-up period has shown no signs of recurrence. |
A previously healthy 10-year-old Asian girl presented to the emergency department with headache, vomiting, and one week of mild nonproductive cough. Her headache started the evening prior to presentation, was gradual in onset and frontotemporal in location, and improved with acetaminophen but subsequently woke her from sleep. It was accompanied by two episodes of emesis. On presentation to the ED, the patient described her headache pain as 3 out of 10 in severity. She denied photophobia, had no further nausea, and denied abdominal pain. She reported that the headache worsened with standing and improved with lying down. Review of systems was significant only for pallor.\nThe patient was otherwise healthy with no prior medical issues and taking no regular medications. She was fully vaccinated and had no known allergies. Her family history was significant for frequent headaches in her mother and maternal aunt. She was living with her parents and brother and attending 4th grade.\nVital signs demonstrated blood pressure 111/56, pulse 104, temperature 37.1°C, respiratory rate 22, and oxygen saturation 100% on room air. Initial exam revealed a well-appearing female and was unremarkable including a normal fundoscopic exam and a normal complete neurologic exam.\nThe patient received ibuprofen and oral rehydration and her headache further improved. A presumptive diagnosis of migraine headache was made and was discharged with primary care follow-up the following day.\nTwo days after her initial emergency department visit, the patient returned to the ED with worsening headache, myalgia, subjective fever, and diffuse weakness. The patient's mother reported that the patient was unable to stand or walk and as a result her mother had been carrying her, including to and from the bathroom. The patient endorsed nausea but no further vomiting.\nVital signs demonstrated blood pressure 105/49, pulse 123, temperature 36.9°C, respiratory rate 30, and oxygenation saturation of 97% on room air. On exam, the patient was moderately ill appearing, lying in bed responding slowly to questions. Her lips were noted to be cracked and with some oozing blood. No oral lesions were noted in the mouth. Pupils were equal, round, and sluggishly reactive bilaterally. Neck was supple with no adenopathy noted. Cardiovascularly, she was noted to be tachycardic with a regular rhythm and II/VI flow murmur. Her respiratory exam was normal. Her abdominal exam was benign with no organomegaly. Neurologically the patient was noted to be slow to respond to questions and moving slowly but without focal deficits. She was, however, unable to walk without assistance. Skin exam revealed diffuse ecchymoses on the lower extremities bilaterally.\nLaboratory studies were ordered along with a rapid brain MRI, and pediatric neurology was consulted.\nLaboratory results were as follows: hemoglobin 2.6 g/dL, hematocrit 8.3%, platelets 10K/uL, and WBC 60.5K/uL with 83% blasts in the differential. CRP was 15.7 mg/L, and ESR was 125 mm/h. Electrolytes showed sodium 139 mmol/L, potassium 4.0 mmol/L, chloride 100 mmol/L, carbon dioxide 24 mmol/L, BUN 11mg/dL, creatinine 0.56 mg/dL, glucose 129, magnesium 2.5mg/dL, and phosphorus 3.6 mg/dL. LDH was 359 U/L, uric acid was 2.3mg/dL. PTT was 29.4 seconds, PT was 19.5 seconds, and INR was 1.7. Fibrinogen was 117 mg/dL and D-dimer was >10,000 ng/mL. Review of peripheral blood smear () demonstrated many primitive cells with round and lobated nuclei, numerous cytoplasmic granules with Auer rods readily identified, and some cells with multiple Auer rods.\nRapid MRI Brain () was obtained which demonstrated leptomeningeal enhancement in the supratentorial parenchyma suggestive of leptomeningeal carcinomatosis, a hemorrhagic lesion in the corpus callosum, multiple subdural hematomas with mild mass effect, and petechial hemorrhages throughout the brain.\nPediatric Oncology was consulted and treatment initiated emergently with ATRA, dexamethasone, allopurinol, cefepime, and blood products including packed red blood cells, platelets, and cryoprecipitate. The patient was subsequently admitted to the pediatric intensive care unit.\nIn the pediatric ICU the patient received several transfusions with platelets, cryoprecipitate, and fresh frozen plasma to manage DIC. She was continued on an induction course of chemotherapy including ATRA, dexamethasone, idarubicin, and arsenic trioxide. Molecular analysis of the peripheral blood was positive for PML-RARA, confirming the diagnosis of APL. After the coagulopathy improved and the patient stabilized, lumbar puncture was performed with administration of intrathecal chemotherapy. The cerebrospinal fluid was notable for the presence of leukemia cells, confirming the involvement of the central nervous system. The patient's encephalopathy gradually improved and she returned to her baseline mental status by day 7 of treatment. The patient was noted to have elevated opening pressure on lumbar punctures, which worsened over the course of induction, attributed to pseudotumor cerebri secondary to ATRA.\nUpon completion of the first 28 days of induction therapy, repeat lumbar puncture and bone marrow studies demonstrated no morphologic evidence of acute promyelocytic leukemia, consistent with remission. |
A 36-year-old man who denied previous systemic disease had a history of drug abuse with ketamine for 6 to 7 years (at a frequency of 2–3 times per week, by nasal inhalation, and hence the dosage could not be measured), and had then ceased use for approximately 4 years.\nHe had suffered from dysuria, bladder pain, and a mild burning sensation during urination, especially over the urethral meatus and the perineal region, for approximately 1 month prior to admission. He ignored these symptoms initially, but the burning pain worsened, with concomitant urinary frequency and urgency. He visited another hospital for help, at which routine urine analysis revealed pyuria. Under the impression of acute prostatitis, oral antibiotic treatment with ciprofloxacin was initiated during an outpatient visit; however, his symptoms remained, with no improvement. Two days before admission to our hospital, the symptoms worsened, with a newly-developed decreased voiding amount (approximately 50 mL per void) and urgency with urge incontinence, accompanied by painful hematuria and blood clot formation, especially at the first urine void of the morning. The patient then presented to our Emergency Department. Urine analysis showed pyuria, over 100 white blood cells (WBCs)/high-power field (HPF), and significant tenderness and swelling of the prostate was noted upon digital rectal examination, but no pus-like urethral discharge was seen. Under the impression of acute prostatitis, for which oral antibiotic treatment had failed, the patient was then advised to undergo hospital admission for advanced antibiotic treatment.\nAfter admission, we consulted an infectious disease specialist for evaluation, and antibiotic treatment with ceftriaxone was started immediately. A blood test revealed WBC 4870/μL without predominance of neutrophils or eosinophils. No marked elevation of serum C-reactive protein (CRP) (0.25 mg/dL) was noted. The patient's temperature after admission had remained within the normal range, and there were no accompanying signs or symptoms of toxicity. Several blood and urine cultures were performed, including tuberculosis, but all results were negative. The symptoms of pyuria (which remained over 100 WBCs/HPF), urgency, and painful hematuria persisted with no improvement after one week of intravenous antibiotic treatment. However, a sonogram performed upon admission revealed suspected bladder wall thickening. Due to the persistent symptoms that failed to respond to advanced intravenous antibiotic treatment for 1 week, abdominal computed tomography (CT) with contrast was then arranged. The CT scan showed asymmetrical wall thickening (thickness of up to 1.2 cm) of the anterior aspect of the urinary bladder with a mural nodule, and mucosal enhancement with perivesical fatty stranding (Fig. ). According to the above findings and the clinical symptoms, bladder cancer was highly suspected, and we discussed cystoscopy with bladder biopsy with the patient and his wife, which was then performed the next day. Prior to hydrodistension, the bladder mucosa presented with hypervascularity, but there was no tumor over the anterior wall of the bladder as seen on the CT scan. The bladder mucosa of the anterior wall was erythematous, with multiple hump-like changes, and several biopsies were performed. After hydrodistension at a pressure of 90 cm H2O for 8 minutes, the bladder capacity was approximately 150 mL, and bleeding over multiple aspects of the bladder was seen, with glomerulation and ulcerative changes (Fig. A and B). Pathologic analysis of the bladder biopsies showed erosive cystitis, characterized by denuded urothelial cells, with prominent infiltration by eosinophils, lymphocytes, neutrophils, and plasma cells over the mucosa and submucosal layer. In addition, hypervascularity and submucosal granulation formation with fibrosis were observed (Fig. A and B).\nAfter the operation, the bladder capacity increased a little, to approximately 70 to 80 mL per urination, but the urgency, frequency, nocturia, and hematuria still persisted. We also prescribed an anticholinergic agent, a beta-3 agonist and a nonsteroidal anti-inflammatory drug (NSAID), and the patient was then discharged. During 2 weeks of outpatient treatment, his symptoms did not improve with medication. Thus, we discontinued medical treatment and performed hyaluronic acid (HA) instillation, once a week for a total of 10 times. After the treatment, the symptoms of urgency, frequency and nocturia improved, and the bladder capacity increased to 350 mL per urination according to the patient's own voiding diary; in addition, no morning hematuria or hematuria after holding back urine occurred. After the patient's symptoms had improved, we arranged follow-up MRI of the bladder and cystoscopy; on the images, no thickening of the bladder wall nor nodules were observed (Fig. ). Cystoscopy showed marked improvement of the previously-noted erythematous bladder mucosa, and there was neither active bleeding nor glomerulation seen during the whole procedure. Bladder biopsy near the previous biopsy site was performed, and the final pathologic analysis showed decreased inflammatory cell infiltration, regeneration of the urothelium, and less vascularity (Fig. A and B).\nWritten informed consent to publish this case report was provided by the patient, and the consent procedure was approved by the Ethics Committee of Tri-Service General Hospital. |
A 59 year old diabetic male suffered polytrauma from a motor vehicle collision with the following injuries: open left distal humerus fracture, closed fracture of the left radius and ulna, closed fracture of the left femur, closed fracture of the left patella, closed fracture of the left tibia, closed fracture of the acetabulum, and closed dislocation of the sacrum. This case report will focus on the management of the distal humerus fracture, which at the time of injury was debrided, stabilized with an external fixator with placement of antibiotic beads. Two weeks after the injury, a TEA was performed using a Coonrad-Morrey implant.\nWithin the first 5 years there were several complications which were addressed with three additional procedures, which included heterotopic ossification with excision and radiation, polyethylene wear treated with polyethylene exchange, and triceps failure treated with reconstruction with achilles/calcaneus allograft.\nTwo and a half years after the triceps reconstruction, the patient presented to the hospital in septic shock reporting one year of swelling in his elbow. At that time, the patient underwent an irrigation and debridement (I&D). He was placed on IV antibiotics for six weeks followed by continued oral suppressive antibiotics.\nSix months later, the patient was referred to the senior author with clinical signs of periprosthetic joint infection (PJI) including increased swelling. The patient underwent an I&D with replacement of hinge pin and bushings, and the prosthesis was stable and well-fixed. The patient was placed on IV antibiotics for six weeks for cultures positive for methicillin-resistant Staphylococcus aureus (MRSA) and then transitioned to oral suppressive antibiotics.\nOne year later, the patient continued to show clinical signs consistent with PJI and a 2 stage revision was planned (). During explantation, cement was carefully removed from the intramedullary canals and joint space. Next, using a mixture of vancomycin and polymethylmethacrylate (PMMA) cement, three antibiotic cue balls were formed and allowed to cure. These were then placed into the pericapsular tissue sleeve and the extensor mechanism was closed over top (). Repeat I&D and exchange of antibiotic cement was performed several months later. The patient was still able to use the elbow with functional flexion and extension with no brace needed.\nOnce clinical and laboratory results demonstrated adequate improvement, the second stage revision was performed (). Upon exposure of the joint space, the cue ball arthroplasty beads were found to be encased in bony material and a soft tissue membrane. This heterotopic bone formation and synovium was resected back. Intraoperatively, the decision was made to place the ulnar component into the radius due to severe loss of ulnar bone stock. The radial head was resected. A canal finder and subsequent broaches were used in the radius. Although not needed in this case, one can consider using the instrumentation for the contralateral arm to aid in proper prosthesis placement in the context of the increased bow of the radius compared to the ulna. Of note, the patient’s preoperative forearm rotation was greatly reduced due to synostosis bridging the ulna and radius at the level of his previous plating. To maximize function of the extremity, the ulnar component was inserted with the radius in slight pronation. After curing of the cement, the extremity was found to have approximately 15 degrees of hyperextension as well as full flexion. The wound was thoroughly irrigated with an acetic acid irrigation compound designed to reduce biofilm. The residual tissue triceps mechanism reconstruction with achilles allograft was attenuated but still present with fibrous tissue surrounding it. This remaining triceps mechanism was closed with #1 PDS in a running locked fashion in the soft tissue and integrated with new bone tunnels in the proximal ulna. A deep drain was placed along with a subcutaneous drain to avoid any postoperative hematoma. Next, the subcutaneous tissues were closed with 2-0 vicryl and staples were used on the skin. A sterile dressing was applied. The patient was placed in an anteroposterior long-arm splint at 45 degrees of elbow flexion.\nPatient had a normal postoperative course. At 9 months, Mayo score was 90 and DASH score was 23.15. At the most recent followup, 2.5 years postoperatively, the patient has functional elbow range of motion with any signs of infection (Figure 4). |
An 11-year-old boy, otherwise healthy, presented to emergency department with an acute onset of upper abdominal pain experienced for one day. The pain was associated with few episodes of vomiting, fever and constipation. The patient was treated symptomatically in a nearby hospital and discharged. Three days later, he presented to our hospital with moderate abdominal pain in the right upper quadrant and the right flank areas. The pain was continuous, non-radiating and associated with mild dysuria and fever.\nOn clinical examination, the patient was mildly dehydrated. He had a body temperature of 38.8 degrees Celsius and his pulse was 112 beats/min. The right hypochondrium and right lumbar areas were tender, with minimal tenderness in the other quadrants. No guarding or rigidity was detected.\nOn initial work-up, the complete blood count showed leukocytosis-a white blood count of 18 x 109 cells/L. All other investigations were normal. Ultrasonography of the abdomen revealed a collection in the subhepatic area in relation to the right kidney enabling a provisional diagnosis of a perinephric abscess. After admission and initial management with intravenous (IV) fluids and antibiotics, the patient was advised a computed tomography (CT) scan of the abdomen with IV contrast. The CT scan revealed a well-defined tubular structure lateral to the colon in the right hypochondrium with fat stranding extending cranially from its base. A 4 x 3 x 2 cm collection was detected in Morison's pouch indenting the edge of the liver. There were free air pockets associated with the collection (Figures , ).\nA diagnosis of an abnormally located perforated appendix with localized collection was made, and the patient was subjected to laparotomy. During exploration, an abnormally high lying cecum was observed in the right hypochondrium; the ascending colon was absent and a redundant dilated transverse colon was seen. An early inflammatory mass involving the cecum, transverse colon, omentum and the duodenum was detected. Upon manipulation, a pocket of pus was detected and drained (approximately 20 ml). The cecum was mobilized by incising the lateral peritoneal reflection. The appendix was located immediately medial to the ileocecal junction craniocaudally with the tip trailing superiorly in Morison's pouch. The appendix was grossly inflamed with an unhealthy base (Figure ). The terminal ileum was abnormally retroperitoneal, winding around the cecum with the ileocecal junction on the anterolateral aspect. Appendectomy was performed and followed by proper lavage and placement of drain.\nThe patient had an uneventful recovery and was discharged home on the fifth postoperative day. The patient was seen in the outpatient clinic, and he was in his usual state of health. |
A 57-year-old male with a history of hypertension, ischemic heart disease, and cerebrovascular accident consulted in 2005 for a BCC measuring 10 cm in diameter, located at the center of the chest [], with an evolution of 15 years. Conventional tumor excision was performed with a 1-cm margin and closure of the defect by means of a double advancement flap. The histological study revealed infiltrative BCC with no vascular or perineural involvement [Figure –], and with surgical margins free of neoplasia.\nAfter initial loss to follow-up, the patient returned 8 years later due to a subcutaneous, apparently retractile, lesion in the left armpit [], with no palpable locoregional adenopathies. Ultrasound examination of the ganglionic chains revealed no suspicious adenopathies. Imaging tests (ultrasound and magnetic resonance) indicated the presence of a tumor in contact with the pectoralis major muscle. Staged micrographic surgery was then performed, with two interventions and the removal of part of the pectoralis major muscle in order to obtain tumor-free margins. Ten palpable lymphadenopathies detected during this procedure were also extracted. The anatomopathological study revealed infiltrative BCC in the extracted mass and a focus of basaloid cells without extracapsular involvement in one of the adenopathies (Bcl-2 and cytokeratin positive) [Figure and ]. In view of these findings, the oncology committee decided to closely monitor the patient's evolution.\nFourteen months later, another subcutaneous left axillary tumor was detected. Puncture aspiration revealed the presence of BCC cells. The extension study performed by computed tomography revealed no involvement elsewhere. Therefore, a surgical resection of the tumor mass was performed, together with scheduled axillary lymphadenectomy. The histological study revealed a lymph node that had been completely replaced by BCC metastasis with periganglionar extension and infiltration of the adjacent striated muscle. Analysis of the remaining four excised lymph nodes revealed no tumoral presence. The treatment was complemented with adjuvant radiotherapy (ten 5 Gy sessions, twice weekly).\nFollow-up was continued without incidents of note until 6 months later, when a small nonspecific subcentimetric nodule appeared in the lower lobe of the right lung. Given the difficulty of determining its nature by puncture, radiological follow-up was carried out, which after 6 months showed the nodule to have grown slightly []. The case was discussed in the local oncologic committee and the type of surgery that should be performed as the only treatment according to the common guidelines (surgery is preferable to chemotherapy if metastases are resectable) was decided.[] The patient was then referred to thoracic surgery, where a wedge-shaped resection was performed of the right lower lobe, together with lymph node mapping (of segments 7-9). The histological study of the pulmonary specimen revealed basaloid cells infiltrating the lung parenchyma [], but the study of the excised lymph nodes came out to be negative. At 13 years after the eradication of the primary BCC, the patient remained disease free and was periodically followed up till reporting. |
A 47-year-old G1P1 African American woman presented with a right groin mass. The mass was noticed around four months ago and has been intermittently painful. The patient stated that the mass has grown in size recently. She denied any associated gastrointestinal or urinary symptoms and denied any recent weight loss, fever, or chills. She had no past medical history, no history of uterine leiomyomas, and no long-term estrogen use. Her past surgical history was significant for a Cesarean section followed by an abdominoplasty and a laparoscopic appendectomy. On physical exam, the patient's groins were asymmetric in the standing position; a bulge was visible in the right inguinal area. Upon palpation, the mass was round and firm measuring around 4 cm. Tenderness was only elicited with deep palpation. The mass was only partially reducible with pressure and with the patient in the supine position. A working diagnosis of incarcerated right inguinal hernia was made and the patient was scheduled for an elective surgical repair. Blood workup was within normal limits and no imaging was obtained. Under general anesthesia, a transverse groin incision was made and the external oblique fascia opened. A 4 × 3 × 2 cm firm well-circumscribed egg-shaped mass adherent to the RL was encountered; no hernia sac was seen (). The mass was removed completely and sent for frozen section pathology, which revealed a spindle cell tumor with “cigar shaped” nuclei and “herringbone” pattern often seen in smooth muscle tumors. No evidence of perinuclear vacuolization, hypercellularity, or cytological atypia was found (). The findings were consistent with the diagnosis of leiomyoma. Immunohistochemical stain for desmin later confirmed the diagnosis ().\nFollowing complete excision of the round ligament and lesion, it was noted that the internal ring was vacant, as it no longer had anything to obturate it. Additionally, the floor of the inguinal canal was weakened from the dissection. Therefore, a formal hernia repair was performed which included closure of the ring and placement of a lightweight mesh patch. |
A 27-year-old Filipino male began to experience easy fatigability accompanied by dyspnea on exertion, orthopnea, paroxysmal nocturnal dyspnea 1-year prior to consultation. There was a progression of symptoms and patient eventually sought consult and was said to have valvular heart disease. He was advised further work up and referral to our institution. Past medical history and family history were unremarkable. Physical examination showed he had intact mentation and was coherent. Blood pressure was 100/70 with a regular heart rate of 73 beats/min. The patient did not have any elfin facies or other facial abnormalities. Cardiac findings showed a dynamic precordium, a displaced apex beat at the 6th intercostal space left midclavicular line, with LV heave. A harsh 3/6 systolic murmur is heard at the 2nd right intercostal space which also radiates to the carotid area. Electrolytes and renal function were normal. A diagnostic evaluation showed left ventricular hypertrophy by voltage criteria as well as an enlarged heart with left ventricular prominence on chest X-ray. Serum calcium and other blood chemistries were normal. Transthoracic echocardiogram revealed a supravalvar aortic membrane with severe obstruction. Peak systolic pressure gradient was 135 mmHg []. There was also concentric left ventricular hypertrophy with severe hypokinesia and depressed global systolic function (29% by Simpson's) and Doppler evidence of Grade III diastolic dysfunction. Preoperative transesophageal echo (TEE) showed a linear echogenic density just above the aortic valve confirming the finding of SVAS. The aortic valve cusps are also thickened and fused indicating the presence of a concomitant valvar aortic stenosis []. The patient eventually underwent aortic valve replacement, excision of the supravalvar membrane and aortic root dilatation with aortotomy and pericardial patch augmentation. There was a note of severe aortic stenosis with a fusion of the aortic valve cusps and calcification of the aortic annulus intraoperatively. Postoperative TEE revealed an effective orifice area of Effective orifice area of 1.59 cm2 by continuity equation, the mean gradient of 5.4 mmHg; peak instantaneous gradient of 10 mmHg. The patient was discharged improved and stable. Follow-up echocardiogram showed a normally functioning prosthetic valve with improvement of wall motion compared to previous study as well as improvement of ejection fraction from 29% to 50% with Grade II diastolic dysfunction. He is presently maintained on anticoagulation with good functional capacity. |
We present a case of a 26-year-old, otherwise healthy man who reported gradual progressive back pain for a period of 3 months. It radiated to the lower thighs and occasionally to the feet, with no report of lower limb weakness. The pain was worse upon movement of his legs, hips, and lower back. He had no history of chronic back pain or bladder or bowel dysfunction. He was working as a soldier in training. He denied any history of spinal injections or procedures. He did not use alcohol, tobacco, or any illicit drugs.\nUpon examination, he was clinically pale and in severe pain with visual analog scale score 10/10. His vital signs were normal, and there was no fever. There were no skin lesions or lymphadenopathy. Higher cognitive function, cranial nerves, muscle bulk, tone, power, and reflexes were normal. No fasciculations were seen, and the sphincter tone was normal. The sensory examination of the upper and lower limbs was normal in temperature and proprioception; however, he had severe allodynia on the lower back and lower limbs generally. He experienced severe pain on light touch of the lower truncal region, and however, the pain did not follow any dermatome pattern.\nA full blood count showed hemoglobin of 8.1 g/dL, mild leukocytosis, and an elevated erythrocyte sedimentation rate of 105 mm/h. Renal and liver function tests together with electrolytes were all found to be within the normal range.\nLumbar puncture results showed a clear cerebrospinal fluid (CSF) with an elevated protein of 945.0 mg/L and glucose of 31 mg/dL with no pleocytosis. GeneXpert polymerase chain reaction for Mycobacterium tuberculosis on CSF was negative. Cytology on the CSF revealed no abnormal cells. Both serum and CSF rapid plasma reagin for syphilis were negative. His serology for human immunodeficiency virus was negative. A chest X-ray was normal. MRI of the lumbar spine shows thickened, clumped, and displaced cauda equina nerve roots suggestive of a chronic inflammatory process (Fig. , ).\nBecause of the severity of the pain, analgesic treatment was escalated to morphine, and there was only mild relief from added pregabalin and amitriptyline. Because his CSF protein levels were higher than normal, he was initiated on intravenous methylprednisolone 1 g daily for 5 days then proceeded to oral prednisolone 60 mg for another 5 days with gradual tapering of the dose over 6 weeks. There was insufficient evidence to start him on anti-TB treatment. On the third day of the methylprednisolone, he showed significant clinical improvement, with reduced pain to visual analog scale 6/10, and could mobilize normally again. He was later discharged home with daily physical therapy and neurology clinic follow-up appointment. On follow-up in the clinic over 3 months, the pain had subsided and he reported no more complaints. Follow-up after 6 months, he reported no neurological complaints and was back to his normal work schedule training as a soldier. |
A 46-year-old female was referred to our unit following a computed tomography (CT) scan which demonstrated an abdominalpelvic retroperitoneal mass. The patient had came to emergency department complaining of a three-day history of a lump on the right lower limb preceded by fever and continuous right lower abdominal pain irradiated to the back for the previous 3 weeks. Past medical history was unremarkable except for insulin-dependent diabetes mellitus since 11 years of age. The patient had a 3-year history of IUD which had recently been removed. Physical examination demonstrated mild oedema of the right leg, with no abdominal abnormal findings. Doppler ultrasonography of the lower limbs was carried out and ruled deep venous thrombosis and superficial thrombophlebitis. The patient was discharged and she was investigated as an outpatient. Biochemical and haematological investigations demonstrated a raised CRP and ESR, normal white blood count, mild macrocytic anemia (Hb 7.9 g/dL, MCV 100 fL), and thrombocytosis (PLT 626.000/uL). The CT scan showed a retroperitoneal mass with abscess areas and necrosis extending from the lower pole of the right kidney to the lower pelvis. The mass appeared to involve the ascending colon, cecum, distal ileum, right Fallopian tube and ovary, and ureter anteriorly and the psoas muscle posteriorly (Figures and ). Right ureteric dilatation was evident. A colonoscopy was carried out to investigate the possibility of inflammatory bowel disease or a colonic perforated cancer. The endoscopic examination was normal except for the presence of nonspecific mucosal inflammation of the distal ileum. A US-guided fine needle aspiration biopsy of the mass was hence performed. The cytological specimen showed inflammatory cells, with no evidence of malignant cells. Tuberculous and nontuberculous mycobacterium DNA was also negative.\nThe patient was hence referred to surgery division in the suspect of malignant retroperitoneal mass.\nA right ureteric stent was placed and an explorative laparotomy was preformed. The intraoperative findings were compatible with a neoplastic mass originating from the retroperitoneum. Debulking of retroperitoneal, appendicectomy right hemicolectomy extended to the distal ileum, and right salpingo-oophorectomy were performed. The postoperative period was uneventful and the patient was discharged in postoperative day 9.\nPenicillin therapy was given for six months without any complication. She is well and has gained weight after one year.\nThe retroperitoneal mass measured 4.5 × 3.5 × 3 cm, surrounded adjacent organs and histologically showed inflammatory granulomatous tissue composed by granulocytes, fibroblasts, xanthomatous cells, and agglomeration of filaments and sulfur granules of Actinomyces, with positive reaction with periodic acid-Schiff and Grocott's dye. Abscess formation, necrosis were found (Figures , , and ). Similar inflammatory granulomatous process was present in the serosa of terminal ileum, appendix, cecum, ascending colon with extension to corresponding mesentery. Regional 22 lymph nodes were free of disease. Right tubo-ovarian abscess was present. The mucosa of all organs examined did not show actinomycosis but only congestion and slight aspecific inflammation. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.