text
stringlengths 8
5.74M
| label
stringclasses 3
values | educational_prob
sequencelengths 3
3
|
|---|---|---|
/* * Copyright (C) 2019 The Android Open Source Project * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package com.android.settings.wifi.dpp; import android.app.Application; import android.net.wifi.EasyConnectStatusCallback; import android.net.wifi.WifiManager; import androidx.lifecycle.MutableLiveData; import androidx.lifecycle.AndroidViewModel; public class WifiDppInitiatorViewModel extends AndroidViewModel { private MutableLiveData<Integer> mEnrolleeSuccessNetworkId; private MutableLiveData<Integer> mStatusCode; private boolean mIsGoingInitiator; public WifiDppInitiatorViewModel(Application application) { super(application); } public MutableLiveData<Integer> getEnrolleeSuccessNetworkId() { if (mEnrolleeSuccessNetworkId == null) { mEnrolleeSuccessNetworkId = new MutableLiveData<>(); } return mEnrolleeSuccessNetworkId; } public MutableLiveData<Integer> getStatusCode() { if (mStatusCode == null) { mStatusCode = new MutableLiveData<>(); } return mStatusCode; } public boolean isGoingInitiator() { return mIsGoingInitiator; } public void startEasyConnectAsConfiguratorInitiator(String qrCode, int networkId) { mIsGoingInitiator = true; final WifiManager wifiManager = getApplication().getSystemService(WifiManager.class); wifiManager.startEasyConnectAsConfiguratorInitiator(qrCode, networkId, WifiManager.EASY_CONNECT_NETWORK_ROLE_STA, getApplication().getMainExecutor(), new EasyConnectDelegateCallback()); } public void startEasyConnectAsEnrolleeInitiator(String qrCode) { mIsGoingInitiator = true; final WifiManager wifiManager = getApplication().getSystemService(WifiManager.class); wifiManager.startEasyConnectAsEnrolleeInitiator(qrCode, getApplication().getMainExecutor(), new EasyConnectDelegateCallback()); } private class EasyConnectDelegateCallback extends EasyConnectStatusCallback { @Override public void onEnrolleeSuccess(int newNetworkId) { mIsGoingInitiator = false; mEnrolleeSuccessNetworkId.setValue(newNetworkId); } @Override public void onConfiguratorSuccess(int code) { mIsGoingInitiator = false; mStatusCode.setValue(WifiDppUtils.EASY_CONNECT_EVENT_SUCCESS); } @Override public void onFailure(int code) { mIsGoingInitiator = false; mStatusCode.setValue(code); } @Override public void onProgress(int code) { // Do nothing } } } | Mid | [
0.601542416452442,
29.25,
19.375
] |
K-factor (Cisco) In Cisco Voice over IP deployments, the K-Factor is a Cisco proprietary method of reporting endpoint mean opinion scores. K-factor records contain the following metrics: References Category:Cisco products | High | [
0.7211413748378721,
34.75,
13.4375
] |
Search CROPSYS 1015. Bowren, K.E. (ed.).. 1986. Soil improvement with legumes.. Saskatchewan Agriculture, Soils and Crops Branch.This excellent publication summarizes research over the past 40 years pertaining to the use of legumes for soil improvement in Saskatchewan. The role of legumes in maintaining soil nitrogen was crucial prior to available fertilizer. But their value extends beyond their nitrogen contribution to the improvement of soil physical properties. One study found the tillage draft requirement to be up to one-third lower where legumes had been a regular part of the rotation. The positive effects of alfalfa were measured for over ten years in a series of wheat crops compared to plots with no alfalfa. Over 17 years, the average grain yield from a wheat-wheat/clover-clover green manure rotation with no fertilizer were 30% higher that a wheat-wheat-fallow rotation with fertilizer. Moisture depletion by legumes is the biggest hurdle to their use in very dry areas. Adequate fertility for the legumes is necessary to maximize their benefit. Use of selected Rhizobium strains can improve nitrogen fixation, especially on acid soils. Several varieties of sweetclover are mentioned with adaptation to forage or green manure use. The booklet has numerous color photos and many data tables and figures. 6248. Sievers, F.J. and H.F. Holtz. 1922. The silt loam soils of eastern Washington and their management.. WA Agr. Expt. Sta. Bull. #166.A broad treatment of agronomy and soil management during 39 years of cropping 22% N and 35% OM has been lost. T: Comparison of nitrogen content of virgin soil and soil cropped 30 years. Organic carbon in virgin soil and soil cropped 30 years. Straw vs. nitrate development in Palouse silt-loam. High N residue as supplement to straw in nitrate development. Effects of manure on N and C in Palouse silt loam, 18 years of results. Effect of legumes on N and C. | High | [
0.7277777777777771,
32.75,
12.25
] |
Torrens Ministry The Torrens Ministry was the 3rd Ministry of the Government of South Australia, led by Robert Torrens. It commenced on 1 September 1857 following the defeat of the Baker Ministry in the House of Assembly, and was succeeded by the Hanson Ministry on 30 September when they were themselves defeated in the House. At 29 days in office, it was one of the shortest ministries in the history of South Australia. References Category:South Australian ministries Category:1857 establishments in Australia | High | [
0.6683673469387751,
32.75,
16.25
] |
Surface buckling, or wrinkling, can be generated in a variety of systems that include: 1) thermally or mechanically stressed metallic, polymeric and silicate thin films supported on elastomeric substrates, 2) dried thin films prepared by sol-gel method, as well as 3) soft gels placed under geometric confinement that are swollen or dried. See, e.g., N. Bowden, S. Brittain, A. G. Evans, J. W. Hutchinson and G. W. Whitesides, Nature, 1998, vol. 393, pages 146-149; W. T. S. Huck, N. Bowden, P. Onck, T. Pardoen, J. W. Hutchinson and G. W. Whitesides, Langmuir, 2000, vol. 16, pages 3497-3501; C. Harrison, C. M. Stafford, W. Zhang and A. Karim, Applied Physics Letters, 2004, vol. 85, pages 4016-4018; C. M. Stafford, C. M. Harrison, K. L. Beers, A. Karim, E. J. Amis, M. R. Vanlandingham, H.-C. Kim, W. Volksen, R. D. Miller and E. E. Simonyi, Nature Materials, 2004, vol. 3, pages 545-550; D. B. H. Chua, H. T. Ng and S. F. Y. Li, Applied Physics Letters, 2000, vol. 76, pages 721-723; N. Bowden, W. T. S. Huck, K. E. Paul and G. W. Whitesides, Applied Physics Letters, 1999, vol. 75, pages 2557-2559; K. Efimenko, M. Rackaitis, E. Manias, A. Vaziri, L. Mahadevan and J. Genzer, Nature Materials, 2005, vol. 4, pages 293-297; S. J. Kwon, J.-H. Park and J. G. Park, Physical Review E, 2005, vol. 71, pages 11601-11604; R. C. Hayward, B. F. Chmelka and E. J. Kramer, Macromolecules, 2005, vol. 38, pages 7768-7783; T. Tanaka, S.-T. Sun, Y. Hirokawa, S. Katayama, J. Kucera, Y. Hirose and T. Amiya, Nature, 1987, vol. 325, pages 796-798; E. S. Matsuo and T. Tanaka, Nature, 1992, vol. 358, pages 482-484. These surface relief structures are interesting for their pattern complexity as well as ease of formation with a dominant periodicity. Although some mechanisms for global-scale alignment of local wrinkling have been demonstrated, there is a need for surface wrinkling methods that allow global-scale wrinkling alignment with applicability to a range of materials and ease of tuning buckling wavelength and persistence lengths. | Mid | [
0.6506666666666661,
30.5,
16.375
] |
Ask HN: Extremely disciplined design/programming methodology? - craigsmitham Hello HN, I recall reading a blog post/website (perhaps on HN) where a programmer described a very intentional approach to designing programs. It involved going through multiple iterations of the design before any implementation. Anyone recall or have a link? ====== ChristianGeek I remember reading it too but I can't find it. The hamster wheel comment in this thread was good though: [https://news.ycombinator.com/item?id=9823886](https://news.ycombinator.com/item?id=9823886) ~~~ Revell The comment itself: [https://news.ycombinator.com/item?id=9824263](https://news.ycombinator.com/item?id=9824263) | Mid | [
0.644705882352941,
34.25,
18.875
] |
Download Creating compelling-looking content by using conventional graphics techniques is often laborious and requires significant artistry and experience. Over the past few years, I have been looking into how this content-creation process can be simplified through using computer vision techniques. In this talk, I describe a variety of projects undertaken with this goal in mind, discussing how computer vision techniques can be used to simplify animations of Chinese paintings by analyzing brush strokes; to generate free-viewpoint videos from a small number of cameras; to produce 3-D models of plants and trees from images; and to personalize automatic enhancements of photographs. | Mid | [
0.641255605381165,
35.75,
20
] |
Q: Warning: fopen(write2File.txt): failed to open stream: Permission denied Have been trying to fix this error for hours now. Warning: fopen(write2File.txt): failed to open stream: Permission denied in /opt/lampp/htdocs/2i/fwrite.php on line 3 can't open file. I've searched for solutions everywhere including using "$ chmod 777" or "sudo chmod -R 777". But i'm still very new to PHP and i've read that those 2 solutions come with security risks and i do not feel comfortable doing it since my macbook is still new + i'm still inexperience in PHP. I'm looking for a safer solution. thank you! A: You need to learn about permissions and users in the Unix world. The way to resolve this problem in a secure way will depend on how everything is configured. On your own computer, if you are just making tests or learning, you could just set it as "666" and forget it. (That's: chmod 666 ...). 777 is wrong, because that will make the file executable, and you do not want that. 666 on the other hand will result in rw-rw-rw-, that means: readable and writeable by anyone, but not executable. If you upload that to a server, then you will probably do it via FTP which will set permissions for you. However, if you really want to understand what is going on and handle that securely, you should find out which user is your PHP running as. It may be www-data, or some other user. Then, this user will need to have permissions for your file. So you will probably change that file's owner and group via chown, so both you and PHP can access it, but other users can't. | High | [
0.665,
33.25,
16.75
] |
Logan became interested in football during her regular attendances at her father's matches, to which her mother went out of a "sense of duty".[4] On 11 May 1985, she was in the crowd at Valley Parade when the Bradford City stadium fire happened. She, along with her brother and sister, had left the stand only moments before the fire took hold and watched the disaster taking place.[6] Logan's debut TV appearance was when she was chosen as the Leeds Rose for the 1991 Rose of Tralee competition.[7] After university, Logan began presenting on Metro Radio in Newcastle, from where she was offered a job as a presenter on Sky Sports in 1996. She worked there until 1998, when she joined the ITV TV network.[4] Logan started presenting for BBC Sport on 27 January 2007, presenting the FA Cup fourth round tie between Luton Town and Blackburn Rovers. She continues to present and report on live football for the BBC and Logan now deputises for Gary Lineker on Match of the Day. Logan hosted Final Score from 2009 until 2013 before being replaced by Jason Mohammad. When Craig Doyle left BBC Sport to go to ITV in 2008 the BBC needed a new host for the 6 Nations with 2 or 3 matches being broadcast every weekend therefore Gabby Logan was recruited, she previously reported on the 2003 Rugby World Cup for ITV and works alongside the likes of Jeremy Guscott, Keith Wood, Jonathan Davies & Andy Nicol.[12] Gabby Logan hosted Games Today between 7pm-8pm at the 2008 Olympic Games for the BBC and hosted Olympics Tonight between 10.40pm-12am again for the BBC. Logan has reported from the England Camp for the 2010 World Cup, Euro 2012 and World Cup 2014 while also being a pitchside reporter at the venues when England are playing. In June 2011, while still presenting the sports results shows for BBC One on Saturdays, Logan joined Channel 5 to present a discussion and magazine show following The Wright Stuff at 11:10 am each weekday initially called The Wright Stuff Extra, and later renamed as Live with Gabby.[21] On 5 April 2012, the show tweeted to confirm that Logan was leaving the programme.[22] Logan has worked on BBC Radio 5 Live, where she presented a lunchtime show from January 2010. Her previous Sunday morning was taken over by Kate Silverton. On 20 October 2009, it was announced that Logan would be leaving her Sunday morning slot on BBC Radio 5 Live and starting a new weekday show on the station from 12:00 noon to 2:00 pm (Monday–Friday) which began on 11 January 2010.[citation needed] Upon becoming one of the first female sports anchors to break into terrestrial television in the 1990s, Logan has received praise from many of her fellow professionals such as Terry Venables, Ally McCoist and Des Lynam.[40] Being described as a remarkably natural broadcaster, combined with her easy style and ability to banter with whatever ex-pro who is she working alongside, has made Logan a hugely popular figure on the box.[41][42] When Logan was in the running to replace Des Lynam to front ITV's football highlights show The Premiership, fellow sports presenter Jimmy Hill stated, "'I've known Gabby for many years and am pleased to see how well she is doing. She's very intelligent and pretty and, like Des, has the right sort of personality for a successful presenter".[43] Logan, along with Clare Balding, received continuous praise for their commentary during the coverage 2012 Summer Olympics.[44] Logan was referred to as "poised, warm and groomed".[45] Politician Boris Johnson praised Logan's contribution during the BBC's coverage of the London Games, also saying that his favourite part of coverage was the late-night summary with Gabby Logan.[46] In 1992, Logan's 15-year-old brother Daniel collapsed and died from hypertrophic cardiomyopathy.[47] Logan has actively appealed for the Daniel Yorath Appeal, which raises funds for the treatment and detection of the condition.[48] Logan married former Scotland international rugby union player Kenny Logan on 19 July 2001. She has said that meeting her husband was a motivation to exercise regularly again.[47] The couple live in Kew, southwest London.[50] On 28 July 2005, after undergoing IVF treatment, Logan gave birth to twins, son Reuben and daughter Lois.[51] In June 2012, Logan was named by The Times newspaper as one of several people to have put money into a film and tax avoidance scheme.[52][53] | High | [
0.675555555555555,
38,
18.25
] |
Peter Wells (footballer) Peter Arthur Wells (born 13 August 1956) is an English former footballer who played as a goalkeeper for Nottingham Forest, Southampton, Millwall and Orient in the 1970s and 1980s. References Category:1956 births Category:Living people Category:Footballers from Nottingham Category:English footballers Category:Association football goalkeepers Category:English Football League players Category:Nottingham Forest F.C. players Category:Southampton F.C. players Category:Millwall F.C. players Category:Leyton Orient F.C. players Category:Fisher Athletic F.C. players | Mid | [
0.639798488664987,
31.75,
17.875
] |
Q: difference between linq compound from clause and inner join var orders = from c in customers from o in c.Orders where o.Total < 500.00M select new { c.CustomerID, o.OrderID, o.Total }; What is the difference between using 2 from clause and making inner join? Which one do I use? And When? A: This will create the join for you. If you are using LINQ to SQL you can to a .ToString() on orders and you will see the generated SQL statement. If these were from two different sets it would create a cross join but because it is a child relation it will create the correct inner join for you. | High | [
0.6868965517241371,
31.125,
14.1875
] |
Q: How to validate checkbox in Selenium IDE? I am new to Selenium IDE. I want to do validations for the checkbox. I have tried the below code <tr> <td>mouseOver</td> <td>name=viewIndex</td> <td>356</td> <tr> <td>click</td> <td>name=viewIndex</td> <td>356</td> </tr> It is executing the result as [info] Executing: |mouseOver | name=viewIndex | 356 | But there is no progress on my webpage. A: I just used check in command for checking the particular value and uncheck for unchecking the value for it. As my code goes below <tr> <td>check</td> <td>loggerCheck</td> <td></td> <tr> <td>uncheck</td> <td>loggerCheck</td> <td></td> </tr> | Low | [
0.48300970873786403,
24.875,
26.625
] |
Christopher Penroz Christopher Jesús Penroz Patiño (born 2 May 1990) is a Chilean footballer of Palestinian descent who currently plays for Deportes Santa Cruz as a Centre back. Honours Club Colo-Colo Primera División de Chile (1): 2009 Clausura Magallanes Tercera A de Chile (1): 2010 External links Penroz at Football Lineups Category:1990 births Category:Living people Category:Chilean people of Palestinian descent Category:Chilean footballers Category:Association football defenders Category:Colo-Colo footballers Category:Magallanes footballers | Mid | [
0.555012224938875,
28.375,
22.75
] |
Block-Based OTAs You can enable block-based over-the-air (OTA) updates for new devices running Android 5.0. OTA is the mechanism by which OEMs remotely update the system partition of a device: Android 5.0 and later versions use block OTA updates to ensure that each device uses the exact same partition. Instead of comparing individual files and computing binary patches, block OTA handles the entire partition as one file and computes a single binary patch, ensuring the resultant partition contains exactly the intended bits. This allows the device system image to achieve the same state via fastboot or OTA. Android 4.4 and earlier versions used file OTA updates, which ensured devices contained similar file contents, permissions, and modes, but allowed metadata such as timestamps and the layout of the underlying storage to vary between devices based on the update method. Because block OTA ensures that each device uses the same partition, it enables the use of dm-verity to cryptographically sign the system partition. For details on dm-verity, see Verified Boot. Note: You must have a working block OTA system before using dm-verity. Recommendations For devices launching with Android 5.0 or later, use block OTA updates in the factory ROM. To generate a block-based OTA for subsequent updates, pass the --block option to ota_from_target_files. For devices that launched with Android 4.4 or earlier, use file OTA updates. While it is possible to transition devices by sending a full block OTA of Android 5.0 or later, it requires sending out a full OTA that is significantly larger than an incremental OTA (and is therefore discouraged). Because dm-verity requires bootloader support found only in new devices shipping with Android 5.0 or later, you cannot enable dm-verity for existing devices. Developers working on the Android OTA system (the recovery image and the scripts that generate OTAs) can keep up with changes by subscribing to the [email protected] mailing list. File vs. Block OTAs During a file-based OTA, Android attempts to change the contents of the system partition at the filesystem layer (on a file-by-file basis). The update is not guaranteed to write files in a consistent order, have a consistent last modified time or superblock, or even place the blocks in the same location on the block device. For this reason, file-based OTAs fail on a dm-verity-enabled device; after the OTA attempt, the device does not boot. During a block-based OTA, Android serves the device the difference between the two block images (rather than two sets of files). The update checks a device build against the corresponding build server at the block level (below the filesystem) using one of the following methods: Full update. Copying the full system image is simple and makes patch generation easy but also generates large images that can make applying patches expensive. Incremental update. Using a binary differ tool generates smaller images and makes patch application easy, but is memory-intensive when generating the patch itself. Note:adb fastboot places the exact same bits on the device as a full OTA, so flashing is compatible with block OTA. Updating unmodified systems For devices with unmodified system partitions running Android 5.0, the download and install process for a block OTA remains the same as for a file OTA. However, the OTA update itself might include one or more of the following differences: Download size. Full block OTA updates are approximately the same size as full file OTA updates, and incremental updates can be just a few megabytes larger. Computation algorithm differences. In a file OTA update, if a file path is identical in both builds, the OTA package contains no data for that file. In a block OTA update, determining little or no change in a file depends on the quality of the patch computation algorithm and layout of file data in both source and target system. Sensitivity to faulty flash and RAM. If a file is corrupted, a file OTA succeeds as long as it doesn't touch the corrupted file, but a block OTA fails if it detects any corruption on the system partition. Updating modified systems For devices with modified system partitions running Android 5.0: Incremental block OTA updates fail. A system partition might be modified during an adb remount or as a result of malware. File OTA tolerates some changes to the partition, such as the addition of files that are not part of the source or target build. However, block OTA does not tolerate additions to the partition, so users will need to install a full OTA overwriting any system partition modifications) or flash a new system image to enable future OTAs. Attempts to change modified files cause update failure. For both file and block OTA updates, if the OTA attempts to change a file that has been modified, the OTA update fails. Attempts to access modified files generate errors (dm-verity only). For both file and block OTA updates, if dm-verity is enabled and the OTA attempts to access modified parts of the system filesystem, the OTA generates an error. Content and code samples on this page are subject to the licenses described in the Content License. Java is a registered trademark of Oracle and/or its affiliates. | Mid | [
0.570776255707762,
31.25,
23.5
] |
Posted Sep-22-2011 By SillyLilly Too bad these people are not focusing on more productive issues - like educating poor youth, feeding the hungry, helping strengthen black culture... Instead, they are spending millions of dollars and hours protesting the death sentence of a murderer. Maybe it's better that he rot away in a prison cell. Democracy Now - what a consistent joke. RascalLee Posted Sep-22-2011 By Jingo Rex Comment of user 'KMA-LL' has been deleted by author (after account deletion)! I wonder if any of these well-meaning, misguided marchers for justice went over to the houses of the relatives of the slain police officer and offered any consolation AND, did they take up a collection for the state of Georgia to reimburse it for Troy the fried boy's incarceration fees Posted Sep-22-2011 By johnben74 If you don't want these killers bumped off please take them into your home and adopt them and teach them not to kill again. I am sure they would pay alot of attention to you and your vision of them being innocent. When a man kills another man for 1 dollar in his pocket I am sure he would make a fine example of a life you want to save. | Low | [
0.41414141414141403,
25.625,
36.25
] |
Bill Gates is the central personality in the evil cabal that has, over the years, been honeycombing governments across the world through th... | Low | [
0.36927223719676505,
17.125,
29.25
] |
incredible oak bedroom furniture decorating ideas pic of style and popular is a part image of bedroom furniture ideas decorating that posted on Tuesday, Mar 20 2018 by Alexa. You can download incredible oak bedroom furniture decorating ideas pic of style and popular by right click on the image and choose save image as. You can find images about: | Low | [
0.38850574712643604,
21.125,
33.25
] |
Gypsum calcium sulfate dihydrate, CaSO4.2H2O comes from a variety of sources. Land plaster is a term for natural gypsum which is any mixture containing more than 50% calcium sulfate dihydrate, CaSO4.2H2O (by weight). Generally, gypsum-containing products are prepared by forming a mixture of calcined gypsum phase (i.e., calcium sulfate hemihydrate and/or calcium sulfate soluble anhydrite) and water, and, optionally, other components, as desired. The mixture typically is cast into a pre-determined shape or onto the surface of a substrate. The calcined gypsum reacts with the water to form a matrix of crystalline hydrated gypsum, i.e., calcium sulfate dihydrate. It is the desired hydration of calcined gypsum that enables the formation of an interlocking matrix of set gypsum, thereby imparting strength to the gypsum structure in the gypsum-containing product. Stucco is defined as chemically calcium sulfate hemihydrate and is a well-known building material used to make building plasters and gypsum wallboard. Stucco is typically made by crushing the gypsum rock with and then heating the gypsum at atmospheric pressure to calcine (dehydrate) the calcium sulfate dihydrate into calcium sulfate hemihydrate. In addition to natural gypsum rock the use of Flue Gas Desulphurization gypsum or gypsum from chemical processes can be used as well. Traditionally, the calcining of gypsum has occurred in a large atmospheric pressure kettle containing a mixture of the various phases of the gypsum U.S. Pat. No. 5,927,968 to Rowland et al., incorporated herein by reference in its entirety, discloses its own method and apparatus for continuous calcining of gypsum in a refractoryless atmospheric kettle. However, U.S. Pat. No. 5,927,968 to Rowland et al. also discloses a variety of kettles for calcining stucco. One such kettle has a thickened dome-shaped bottom, against which a gas-fired flame is directed, with the kettle and burner flame being enclosed in a suitable refractory structure. There is usually an associated hot pit into which the calcined material is fed. The kettle must withstand temperatures in the 2,000-2,400° F. (1093-1314° C.) range. U.S. Pat. No. 5,927,968 to Rowland et al. states U.S. Pat. No. 3,236,509 to Blair typifies this type construction. U.S. Pat. No. 3,236,509 to Blair, incorporated herein by reference, discloses continuous fluidized kettle calcination in which dried mineral gypsum powder is fed to a covered, but air vented and lightly vacuum exhausted, calcination vessel. After a steady state of operation is attained in the vessel, a substantially continuous stream of cold gypsum that has been pre-dried and ground to a finely divided state and with a wide distribution of fragmented particle sizes, is added on top of the fluidized, boiling mass in the kettle. Under such conditions, the thermal shock upon the cold, dry mineral being dropped into the already boiling mass radically fractures the ground gypsum rock fragments, and the resultant stucco (beta hemihydrate) is highly fractured and fissured, as well as being widely distributed in particle size. This causes the stucco to disperse very rapidly in water, and requires high amounts of gauging water to be mixed with the stucco for rehydration to gypsum at customary use consistencies. This “dispersed consistency”, also known in the art as “consistency” or “water demand”, is an important property of stucco. Stuccos of lower consistency generally result in stronger casts. The normal consistency of stucco (gypsum plaster) is a term of art and is determinable according to ASTM Procedure C472, or its substantial equivalents. It is defined as the amount of water in grams per 100 grams of stucco. U.S. Pat. No. 4,533,528 to Zaskalicky, incorporated herein by reference in its entirety, discloses directly feeding wet chemical gypsum cake to a continuous kettle calciner to produce beta hemihydrate of lower consistency. As explained in Zaskalicky, and also for purposes of the present description, “dispersed consistency” may be defined as the water volume required to give a standard viscosity or flow when a standard amount by weight of stucco is dispersed by mechanical mixing in a laboratory mixer at high shear intensity and for a standard time to equal mixing encountered in the gypsum board forming line, e.g., 7 seconds, or in an industrial plaster formulation casting mixer, e.g. 60 seconds. For example, as explained in U.S. Pat. No. 4,201,595 to O'Neill, incorporated herein by reference in its entirety, calcined gypsum made by continuous calcination may have a dispersed consistency of about 100-150 cc. “Dispersed consistency” for purposes of gypsum board manufacture may be defined as the water volume required to give a standard viscosity or flow when 100 grams of stucco is dispersed by mechanical mixing in a laboratory high speed blender at high shear intensity and for 7 seconds which is equivalent to the mixing encountered in the board forming line. While the dispersed consistency may be expressed in a particular numerical figure, it will be appreciated that any particular number is variable from one process to the next depending on the particular stucco and the rate of production. Low consistency stucco is particularly advantageous in automated gypsum board manufacture, in which a large portion of the processing time and processing energy is devoted to removing excess water from the wet board. Considerable excess water is required in gypsum board manufacture to properly fluidize the calcined gypsum and obtain proper flow of the gypsum slurry. A dispersed consistency value of 100-150 cc. indicates a water requirement of about 85-100 parts of water per 100 parts of the calcined gypsum for a typical slurry in a gypsum wallboard plant. The theoretical water required to convert the calcined gypsum (calcium sulfate hemihydrate or stucco) to set gypsum dihydrate is only 18.7% by weight on a pure basis. This leaves about 67 to about 82% of the water present in the gypsum slurry to be removed in drying the board. Ordinarily, gypsum board dryers in a gypsum board manufacturing line will remove this water, for example, by maintaining the air temperature at about 400° F. (204° C.) and requiring a drying time of about 40 minutes. U.S. Pat. No. 4,201,595 (also mentioned above), U.S. Pat. Nos. 4,117,070 and 4,153,373 to O'Neill, all incorporated herein by reference in their entirety, teach to lower the dispersed consistencies of continuously calcined kettle stuccos by an after calcination treatment of the stucco with small amounts of water or various aqueous solutions, resulting in a damp but dry appearing material and allowing the small amounts of free water to remain on the calcined gypsum particle surface for a short period of time, about 1-10 minutes for the treated stucco to “heal” . U.S. Pat. No. 3,410,655 to Ruter et al., incorporated herein by reference in its entirety, teaches producing alpha calcium sulfate hemihydrate. Ruter et al. states the alpha-hemihydrate forms non-needle like crystals, as opposed to the beta calcium sulfate hemihydrate which forms needle-like crystals. Ruter et al. also states the usual plaster of Paris (calcium sulfate hemihydrate) is the beta calcium sulfate hemihydrate. However, depending on the manner of preparation, the plaster of Paris still contains more or less anhydrous calcium sulfate, and/or alpha calcium sulfate hemihydrate. Moreover, plasters with definite alpha-hemihydrate content exhibit higher strengths. Ruter et al. teaches to make alpha calcium sulfate hemihydrate in the form of non-needle-like crystals by elutriating the dihydrate with water to remove organic impurities and fine and slimy crystal portions, forming an aqueous suspension of the dihydrate at a pH about 1.5-6, and subsequently heating under closely controlled conditions. U.S. Pat. No. 2,907,667 to Johnson, incorporated herein by reference in its entirety, states alpha-hemihydrate is prepared by heating the dihydrate under controlled vapor pressure conditions in the presence of steam or in an aqueous solution. U.S. Pat. No. 4,234345 to Fässle discloses fast-setting alpha calcium sulfate hemihydrate made from calcium sulfate dihydrate by hydrothermally recrystallizing calcium sulfate dihydrate to form a mixture containing 95%-99% by weight alpha calcium sulfate hemihydrate and 5 to 1% calcium sulfate dihydrate. The dihydrate in this mixture is then converted to beta calcium sulfate hemihydrate by calcining, except for a remainder of up to 0.5 percent of dihydrate, which remains in the mixture. There is a need for stuccos having low consistency and good strength characteristics. | High | [
0.6633663366336631,
33.5,
17
] |
Q: Game crash due to assertion failure in contact delegate I am getting the following log when my game crashes due to a assertion failure. Assertion failed: (typeA == b2_dynamicBody || typeB ==b2_dynamicBody), function SolveTOI, file /SourceCache/PhysicsKit/PhysicsKit-6.5.4/PhysicsKit/Box2D/Dynamics/b2World.cpp, line 678. This happens intermittently (about once in 10 times I play the game). All I can get is that there is some inconsistency which occurs the Box2D engine related to the contact detection in the scene's physicsWorld. But I am not being able to pinpoint the cause of the problem in my code. Can somebody tell me how to go about finding the root of this problem? A: The assert indicates that both bodies are not dynamic. Make sure you don't change the dynamic property of bodies to NO (use bitmasks to exclude them from colliding). Definitely don't do that within the contact callback methods because it looks like this assert happened during the contact collision solving step. It seems logical that two static bodies can only be in contact and trying to resolve collision when one of them was initially dynamic when contact began. | Mid | [
0.627575277337559,
24.75,
14.6875
] |
NCS Presidential Election as a Form of Torture Voting members are supposed to rank these candidates according to order of preference, so that should one pick the least popular scholar, one's second choice scholar then obtains one's vote. This system replaces the live version held last year in which candidates recited lines from the General Prologue, Simon Cowell and Ellen Degeneres gave feedback, and then society members phoned in votes to a toll-free number. Seriously, though, how are we supposed to choose among these three outstanding candidates? Can't we have triumvirate? (or triumviragoate, if that is better Latin?) I don't know about you, but my vote will likely go to she who delivers the largest bribe: US dollars, Australian dollars, pounds sterling, it doesn't matter. The promise of drinks and dinners at Siena works as well; I'm easily swayed. Ardis, Carolyn, Stephanie: I'll be checking my email. 1 comment: Jonathan Hsy said... I'd be very happy to see NCS adopt the radical Amazonian strategy of electing a triumviragoate (or triumfeminate or whatever we want to call it). Is this the first time NCS has seen a entire presidential ballot of women, by the way? (Anyone have the institutional memory here?) | Low | [
0.47967479674796704,
29.5,
32
] |
Own a business? 6 new tax breaks NEW YORK (CNNMoney) -- Doing your taxes stinks, right? No fun at all. But take note as you brace for your 2010 return: A handful of changes in the tax code could translate into a fatter refund check. The Small Business Jobs Act, passed last September, and the historic health care reform law, passed in March, enacted hefty credits and deductions for capital investments and employee health insurance costs. The maximum credit goes to businesses with 10 or fewer full-time employees with annual wages that average $25,000 or less. The break phases out for firms with 25 employees or that pay average wages above $50,000. For 2010 through 2013, the tax credit covers up to 35% of the money that a qualifying business spends on its health insurance premiums. In 2014, the top tax credit bumps up to 50%. Tax-exempt organizations can claim 25% in the first time period and 35% after that. The credit is available for a maximum of six years: 2010 through 2013 and for any two years after that. Health insurance deduction for self employed: Are you your own boss and paying for your own health insurance? Normally, you can deduct your insurance costs from your business profits, but you can't deduct those costs from your self-employment taxes. But in 2010, the self-employed can deduct their health insurance costs from their business profits for both taxes. Let's say Sally, an architect, makes $50,000 in net income and pays $6,000 for health insurance. In other tax years,Sally would pay income tax on $44,000 and self employment tax on $50,000, explained Karen Brosi, a federally licensed tax professional based in Palo Alto, Calif. Instead of having to deduct your capital expenditures slowly, the temporary change to Section 179 allows businesses to get more cash up front. Section 179 is specifically targeted to help small business: A business that spends more than $2 million in one year on qualifying capital will not be able to get the full benefit of the Section 179 write-off. You can only take advantage of the full Section 179 write-off if your small business booked a profit. A Section 179 write-off can not cause your business to "make or increase a loss" for the year, explained Brosi. Bonus depreciation extension: For2010, there is an accelerated depreciation schedule: The point is to get cash into the hands of small businesses quickly. Unlike Section 179, you can depreciate items even if your business is in the red for the year. Bonus depreciation covers new equipment only, and can be taken in addition to a Section 179 write-off, if the item is eligible for both benefits. You can depreciate "tangible property," like buildings, machinery, vehicles, furniture, and equipment, as well as "intangible property," such as patents, copyrights and computer software. (Sorry, if you bought a plot of land, that doesn't qualify.) Businesses that bought a qualifying itemafter Sept. 8 can claim 100% of its cost (so long as it is used before Jan. 1, 2012). Businesses that bought such items before Sept. 8 can claim 50% (so long as it is put into service before Jan. 1, 2013). Depreciation on a business car or truck: Did you buy a new car, van or truck for your business last year? Ka-ching! For 2010, business owners who buy and use a brand new passenger vehicle will depreciate much more than usual -- $11,060 for a car, and $11,160 for a light duty truck or van. That includes an extra $8,000 bonus depreciation, on top of the usual first-year depreciation. If you buy an SUV or heavy pickup, the rules are slightly different, said Brosi. General Business Credit: If you are one of those unlucky business owners affected by the Alternative Minimum Tax, you might get a little break in 2010. Boiled down, if you have to calculate your taxes under both the regular tax structure and under the AMT, you pay Uncle Sam whichever one is more. If your taxes calculated normally are $10,000 and $12,000 under the AMT, you owe $12,000. Usually, general business creditsdo not apply towardthe AMT calculation. But for 2010, deductions included in the "General Business Credit" part of the tax code are also allowable under the AMT. Applying these credits to your AMT will reduce what you owe under the AMT, explained Brosi. There are a couple dozen credits in this category: Some that might impact small biz include a benefit for hiring someone unemployed, the costs for starting up an employer pension plan or the costs of employer-provided child care services. "If I am subject to AMT, I don't lose the benefit of any eligible business credit," explained Brosi. How does a florist sell more in this economy? We changed our business to designing weddings and events only, as the everyday flowers are not selling. We had to throw out too much product at the end of the week -- flowers are perishable! More The Los Angeles city attorney is suing four major retailers over claims that they deliberately inflated the original price on some items that misled customers into thinking they were getting a better deal. More | Mid | [
0.6052009456264771,
32,
20.875
] |
An education advocacy group said it will sue if Oregon doesn't sell the Elliott State Forest for $221 million or find another way to deposit the same amount into a state account that benefits schoolchildren. The Oregon School Boards Association sent a letter Friday through its attorney to the three members of the State Land Board – Gov. Kate Brown, Treasurer Tobias Read and Secretary of State Dennis Richardson – urging them to fulfill their duty to maximize the financial return to the Common School Fund. The school boards group says Oregon is constitutionally required to make as much money for K-12 education as possible from the forest, which straddles Douglas and Coos counties in Southwest Oregon. They say that maximum value, $221 million, was established by an independent property appraisal. "We appreciate that some individuals may place a higher regard on noneconomic values of the Forest, such as scenery or recreation, than on the value of the Forest as an economic asset to benefit the State's public schools," attorneys John DiLorenzo and Gregory Chaimov of Davis Wright Tremaine said in the letter, alluding to environmental advocacy groups who are pushing to keep the land public. "The Board, however, may not consider the desires of anyone other than the State's schools." The letter arrived a little more than a week before the obscure three-person body is expected to once again discuss the fate of the forest. The saga pits opponents who decry the proposed sale of public lands against K-12 advocates who say the state's hands are already tied. For more than two years, the land board has considered selling the 82,500-acre state forest to raise revenue for the school fund. The forest, once a big moneymaker for the state, has not been as profitable in recent years as logging plummeted in the face of legal challenges from environmental groups. The land board appeared to be on a path toward selling the forest until Read switched his stance on the proposed sale of the property to a timber company and local tribe, opting to join Brown in planning to keep the forest in public hands. Environmental groups lobbied Read heavily in the weeks before his March 28 announcement that he would support a proposal to maintain public ownership. The school board association's attorneys said the state's mission is "crystal clear." "We urge you to adhere to those fiduciary obligations in the face of whatever political pressure may be brought to bear by those who lack appreciation for those duties," they wrote. Bryan Hockaday, Brown's spokesman, said in an email that the governor has "made clear the critical importance of fulfilling the State's fiduciary obligations to the Common School Fund" even as she has worked on a new plan to keep the forest in public hands. Earlier this year, Brown had expressed support for the idea of issuing state bonds to maintain public ownership of the forest. Senate President Peter Courtney, D-Salem, is also open to issuing state debt to keep the forest. Hockaday said the governor will release a new plan later this week that "honors the Common School Fund, protects the Elliott's diverse habitats, and ensures the sustainable harvest of timber." The Common School Fund has roughly $1.4 billion in assets, according to the state. More than 1 million acres of state lands, including the Elliott, produce revenue for the education endowment. The account distributed more than $136.6 million to K-12 programs across the state in the 2015-17 biennium. Oregon's overall K-12 budget during that same period was more than $7.3 billion. The land board is scheduled to meet May 9. -- Andrew Theen [email protected] 503-294-4026 @andrewtheen | High | [
0.6728538283062641,
36.25,
17.625
] |
Psychiatry, which has medicalized many forms of human distress, argues for individual treatments and interventions. It has blurred the disease-illness divide, subcategorized clinical presentations, lowered the thresholds for diagnosis and introduced many new psychiatric "disorders." Its phenomenological approach to diagnosis and classification employs symptom checklists and symptom counts sans context. The medicalization of distress is supported by the capitalistic project and the current political economy of health, fits in well with neoliberalism and allows the free market to expand its business interests. This essay contends that social and economic correlates of depression, anxiety and common mental disorders, despite robust evidence, are not emphasized. It argues that social and economic determinants of mental health demand public health and population-based strategies to prevent and manage common mental disorders in the community. Such approaches will impact a greater proportion of people than medical interventions. Depression and anxiety, standard psychiatric diagnoses, are part of our vocabulary and popular culture. However, these terms are employed to highlight "idioms of distress," describe illness experience and to label diagnostic categories. Their widespread, flexible and interchangeable use has blurred the boundary between distress and disease. The disease halo has been inappropriately transferred to many forms of human suffering. The medicalization of distress has resulted in a focus on treating individuals. It has also resulted in ignoring the impact of social and economic stress on mental health resulting in very little emphasis on the need for and use of public health and population-based interventions. PSYCHIATRIC CONTEXT {#sec1-1} =================== Psychiatry in the 1970\'s was struggling with "unproven" etiologies for mental illness and with poor diagnostic agreement among psychiatrists. The discipline adopted an "atheoretical" approach to diagnosis using operational criteria,\[[@ref1]\] that emphasized reliability and counted symptoms. It dismissed the relevance of context and environmental stress to diagnosis, as these require interpretation and reduce inter-rater reliability.\[[@ref1][@ref2]\] The creation and use of the suffix "disorder" for psychiatric categories sidestepped the disease-illness divide. The discipline also created a diagnostic label called "major depressive disorder," which attempted to identify people with more severe distress and "clinical depression".\[[@ref1]\] It soon became the gold standard. The diagnosis of depression, when viewed through the biomedical lens, tends to suggest the disease, supposes brain etiology and pathogenesis, documents signs and symptoms, offers differential diagnoses, recommends pharmacological therapies and prognosticates about the course and outcome. However, psychiatric diagnoses pose many challenges. The lack of laboratory tests for diagnosis has forced psychiatrists to rely on clinical features. The absence of pathognomonic symptoms has meant the use of clinical syndromes for labeling and symptom checklists for diagnosis. The criteria essentially count symptoms with little regard for context.\[[@ref3]\] The recent increase in the number of psychiatric categories and the lowering of the clinical threshold has resulted in a wide net, which medicalizes a variety of normal human responses to environmental stress. Epidemiological studies of depression also use diagnostic instruments, which do not evaluate stress and context and fail to identify short-term adjustment problems.\[[@ref2]\] The elastic concept of depression and the rigid application of the diagnostic hierarchy and criteria has resulted in the marginalization of short-term stress-related adjustment disorders in clinical practice. Consequently, the hybrid category, major depressive disorder, identifies a heterogeneous group of people with melancholic depression (endogenous depression), those with chronic depression and with recent stressors (neurotic depression/dysthymia) and normal people under severe stress (adjustment disorders).\[[@ref2]\] DISTINGUISHING DISEASE FROM DISTRESS {#sec1-2} ==================================== Separating normal human distress from depression is often difficult.\[[@ref3]\] General practitioners, who often see milder forms of morbidity frequently associated with psychosocial adversity, hold psychological and social explanatory models for depression. Psychiatrists, with their biomedical frameworks, on the other hand, argue for disease models for such illness. They transfer the disease halo reserved for severe mental illness to all psychiatric diagnoses. While psychiatrists argue that the depression is easily recognized using simple screening instruments, general practitioners contend that these screens identify people in distress rather than those with disease.\[[@ref3]\] In the 1990\'s, specialist classifications of psychiatric disorders were simplified for use in general practice and many related categories employed in tertiary care were reduced to single diagnostic heads (e.g., anxiety, depression). However, these schemes (Diagnostic and Statistical Manual-IV for Primary Care\[[@ref4]\] and International Classification of Diseases-10 for Primary Health Care\[[@ref5]\]), although endorsed by psychiatry and academic general practice, were rarely employed in primary care.\[[@ref6]\] The heterogeneity within labels, their frequent association with psychosocial stressors, high rates of spontaneous remission and of placebo response and the limited response to psychotropic drugs in milder conditions prevented their use in primary care\[[@ref6]\] and argued against the sole use of medication as the solution.\[[@ref7]\] Many critics argued against the medicalization of personal, social and economic distress. PUBLIC HEALTH IMPLICATIONS {#sec1-3} ========================== Nevertheless, many international investigations have since identified major depression as a significant contributor to the burden of disease.\[[@ref8]\] Its high-life-time prevalence, associated disability, chronic course and recurrence were highlighted. Its frequent association with other common chronic medical conditions (e.g., diabetes mellitus, angina, asthma, arthritis, etc.) and the incremental worsening their outcomes have been documented.\[[@ref9]\] Its contribution to suicide is widely recognized. Many national governments and international agencies acknowledge depression, with its significant impact on economies, as a major public health problem. Many studies have also documented the link between poverty and depression, anxiety and common mental disorders. They have demonstrated a consistent relationship with low education\[[@ref10]\] and insecure working conditions.\[[@ref11]\] The experience of insecurity and hopelessness, rapid social change, risk of violence and physical illness are postulated as links between poverty and poor mental health.\[[@ref10]\] Poor mental health worsens the economic situation, setting up a vicious cycle of poverty and common mental disorders. Social determinants have a significant impact on the health of girls and women in general and on depression in particular with women are at a higher risk when compared with men.\[[@ref12]\] Young women are overrepresented among those who commit suicide in India.\[[@ref13]\] Gender injustice is a major issue for women in traditional patriarchal societies. Social exclusion and cultural conflicts can also cause mental ill health, distress and depression. The structural determinants of daily life contribute to the social determinants of mental health and fuel inequities in health.\[[@ref14]\] Viewing health in general as an individual or medical issue, reducing population health to a biomedical perspective and suggesting individual medical interventions reflect poor understanding.\[[@ref15]\] The major barrier to scaling up effective interventions is inequality based on social, cultural and economic issues. Failure to recognize this relationship and the refusal to tackle these issues result in poorer health and mental health indices for the underprivileged and the marginalized, who constitute a large proportion of the population. Poverty and social exclusion have a multiplicative effect on the social determinants of health with those at higher risk for distress and mental health concerns also having a higher probability of being excluded from health care services. Consequently, there is a need to move beyond urgency-driven medical solutions and incorporate public health perspectives, policies and approaches\[[@ref14][@ref15][@ref16]\] in managing depression, anxiety and common mental disorders. The sole focus on medical solutions is an error of the public health movement in low and middle-income countries as it mistakes primary care for public health. Public health is often reduced to a biomedical perspective. Consequently, much of the efforts of the champions of public health end up in the provision of curative services, albeit at the small hospital, clinic or at the village level. Despite the failure of past mental health programs, they are repackaged\[[@ref17]\] as solutions to mental distress, illness and disease (e.g., Mental Health Gap Action Program\[[@ref18]\]). Public health requires the inputs from diverse disciplines (e.g., politics, finance, economics, law, engineering, social sciences, religion, etc.) and is much more than biomedical perspectives and solutions. PUBLIC HEALTH STRATEGIES {#sec1-4} ======================== The medical/psychiatric, psychological, social and economic causes of depression, anxiety and common mental disorders argue for a multi-factorial etiology for these states of emotional distress. Such a perspective calls for a multi-sectoral understanding of mental health and illness.\[[@ref16]\] It argues for a multi-pronged approach to intervention. It contends that pure medical and psychiatric approaches to emotional distress would be restrictive and ineffectual for the vast majority of depression seen in the community. While severe and melancholic depression demands antidepressant medication, milder forms of distress respond to psychological support, social solutions and economic initiatives. Population interventions involving social and economic approaches would be mandatory for improving the mental health of a significant proportion of population. Investments in education and provision of microcredit, in addition to reducing poverty, are recommended for their collateral benefits in reducing the risk of mental disorders.\[[@ref10]\] Population-based strategies of meeting basic needs of clean water, sanitation, nutrition, immunization, housing, health and employment and initiatives for gender justice have been suggested as strategies to reduce distress and suicide.\[[@ref19]\] Program to reduce social exclusion and discrimination, a reduced social class gradient and a more equal society will also help reduce emotional distress and depression.\[[@ref16]\] The social determinants of health apply to mental health as well. There needs to be a commitment to equity, effective governance systems, and context-specific program that address the wider social and environmental determinants.\[[@ref14]\] Managing inequitable distribution of power, money and resources is cardinal to improving mental health of populations. Such population-based strategies will reduce a greater proportion of distress, now subsumed under a variety of mental disorder labels, than targeted medical interventions. POLITICS AND ECONOMICS {#sec1-5} ====================== The blurred disease-illness divide, the inter-changeable use of these concepts and the illusion of specific brain pathology are supported by academia, health, insurance and pharmaceutical industries. Despite evidence that social determinants produce significant mental morbidity, most intervention strategies favor *post-hoc* individual treatments to population-based public health approaches that are useful in reducing structural violence and in empowering large sections of society. Solutions that seem to make money trump those that promote health. The situation is similar to the one related to physical health where curative strategies which are profitable are preferred by the political and economic systems over approaches which are more equitable and will deliver better health. The technical approaches of evidence-based medicine are not necessarily value-neutral nor above specific interests.\[[@ref20]\] Medicine is politics writ large and the health sector is a powerful player in national economies. Psychiatric labels for distress have shifted the focus from the responsibility of the state for poverty and structural violence and transferred pathology and burden to individuals. The disparate environments under which anxiety, depression and common mental disorders now exist are brought together as many strands, de-contextualized and unified into disease labels. Psychiatric disease labels and individual treatments offer distinctive niches to diverse stakeholders: Disease, reimbursement, profit, and deflection of responsibility. The political economy of health, deeply rooted in capitalistic economic and social systems, undergirds these formulations. It reiterates the historical relationship between medicine and governments, with governmental administration serviced by experts responsible for managing social security, stability and economic growth.\[[@ref21]\] It is an example of the broader role of medicine, of social control. Depression, anxiety, common mental disorder labels and the culture of medicine fit in well with the neoliberal agenda, allowing the free market to expand its business interests. It demonstrates the nested position of the discipline of medicine, within the agendas of governing, which determine perspectives, formation of knowledge, institutional control and policy. Psychiatry, despite its current attempts at testable conjectures, is still within a paradigm, which seems inadequate for the complexity of the task. It is awaiting a paradigm shift,\[[@ref22]\] which will provide new understanding. Nevertheless, modern psychiatry, based on operational diagnostic criteria and phenomenological classification, will persist with its failed strategy\[[@ref23]\] of symptom counts sans context. The discipline needs to acknowledge, that it helps people with emotional distress and with mental diseases; their differentiation is often difficult and that symptom counts do not distinguish them. It needs to accept that distress secondary to stress is heterogeneous; context, stressors, personality, coping, supports and meaning of the event impact outcomes. It needs to highlight the fact that much mental distress is also secondary to social determinants and not necessarily due to diagnosable or treatable biological abnormalities. Distress, commonly seen in the community and in primary care, does not require psychiatric disease labels or psychiatric treatments. It mandates population-based interventions including a social security net to reduce social and economic hardship. The solutions should not only include supporting individuals in distress but also argue for public health strategies to reduce poverty, ensure justice and empower people. | Mid | [
0.6180257510729611,
36,
22.25
] |
Optical reconfiguration by anisotropic diffraction in holographic polymer-dispersed liquid crystal memory. Holographic polymer dispersed liquid crystal (HPDLC) memory is fabricated by a photoinduced phase separation comprised of polymer and liquid crystal (LC) phases using laser light interference exposures. The anisotropic diffraction induced by the alignment of LC in the periodic structure of the HPDLC memory is applied to reconstruct the configuration contexts for the optically reconfigurable gate arrays. Optical reconfiguration for various circuits under parallel programmability is implemented by switching the polarization state of incident light on the HPDLC memory using a spatial light modulator. | High | [
0.687022900763358,
28.125,
12.8125
] |
<?php /* * This file is part of the Symfony package. * * (c) Fabien Potencier <[email protected]> * * For the full copyright and license information, please view the LICENSE * file that was distributed with this source code. */ namespace Symfony\Component\ExpressionLanguage; /** * Represents an expression. * * @author Fabien Potencier <[email protected]> */ class Expression { protected $expression; /** * @param string $expression An expression */ public function __construct($expression) { $this->expression = (string) $expression; } /** * Gets the expression. * * @return string The expression */ public function __toString() { return $this->expression; } } | Mid | [
0.5945945945945941,
38.5,
26.25
] |
Pages WELCOME... to Bishop David's blog. Here you can find news, information, articles and pictures about the Church of England Diocese in Europe. We have over 300 congregations or worship centres serving Anglican and (mostly) English-speaking people in Europe, Morocco, Turkey, Russia and some central Asian countries. Saturday, 13 September 2014 Holy Cross Day, 14 September This Sunday is Holy Cross Day. As we gather together around the sign which is both the instrument of suffering, as well as the victory-sign of Christ, it will be an appropriate time to pray for suffering and persecuted peoples in the Middle East, and to unite with them in solidarity and faith. God of Compassion,, hear the cries of the people of Syria and Iraq.Comfort those who suffer violence, console those who mourn the dead.Give strength to all who welcome the refugees.Convert the hearts of those who have taken up arms and protect those who are committed to peace.God of hope, inspire leaders to choose peace over violence and to seek reconciliation with their enemies.Fill us with compassion for the people of Syria and Iraq and give us hope for a future built on justice for all. We ask this through Jesus Christ, the Prince of Peace and Light of the world. Among Christian leaders in Europe, His Grace Bishop Angaelos, the General Bishop of the Coptic Orthodox Church in the United Kingdom, is one of the most articulate on the present crisis. He has just released the statement below on the need for collaboration to address violations of international religious freedom in Iraq, Syria and the wider Middle East. Bishop Angaelos is also the Moderator of Churches Together in Britain and Ireland. The widespread brutality facing Christians and minorities in the Middle East is intensifying, and gross violations of the God-given right and freedom to practice Faith and belief, as protected by Article 18 of the Universal Declaration of Human Rights, is increasingly experienced by them in their homelands. Heightened levels of extremism seek to eradicate indigenous Christian communities that have been a vital part of the identity, culture and heritage of the Middle East for over two millennia. Those communities that do not fit within the extremist ideology now spreading through the region are at greater risk of no longer being a part of its fabric. The model of intolerance and extremism that we are witnessing, will become legitimised and replicated throughout the Middle East and further afield if left unchallenged, and will continue to marginalise, alienate and destroy all in its path. While Christians continue to suffer the brunt of these dangerous levels of exclusion and dehumanisation, Yazidis and other religious and ethnic minorities, including many Muslims, also suffer the same fate. Innocent men, women and children face extreme persecution, torture and murder for their Faith. The loss of these historic communities, with their stabilising and reconciling presence, will not only have a detrimental effect on their own countries but on the entire region. This is a time for collaboration and a unified effort against ideologies that seek to attack the fundamental principles of human rights and civilisation that have developed over millennia. Christians, along with those who live by faith, morals, and ethics, and the international community, must collaborate to address this threat against not only innocent civilians, but our way of life as we know it today. Rhetoric used to describe the atrocities in the Middle East must no longer remain within a religious framework, but rather deal with these events as unacceptable crimes against citizens of countries who are entitled to the basic rights and freedoms of all. It is within this context that the international community must commit itself to providing, supporting, and advocating, in every way it can, for Christians and others whose fundamental right to freedom of Faith is denied in Iraq, Syria, Egypt and the wider Middle East. We give thanks for our brothers and sisters who despite immense challenges, continue to live their Christian Faith with extraordinary strength and resilience, but as Christians we do not pray and advocate for them alone, but for all those denied their God-given right to freedom in the Middle East. No comments: Post a Comment About me Burmese-Scottish, educated in Canada. Former priest in Niagara Diocese, Anglican C. of Canada’s Mission Co-ordinator for Latin America & the Caribbean, and Anglican Communion's Director of Ecumenical Affairs & Studies. Bishop since 2002. IARCCUM co-chairman. My wife Dr Colleen Hamid is a medical researcher. We have two sons, Jonathan and Michael. My office is in that great European city called London | Mid | [
0.538775510204081,
33,
28.25
] |
Hilton, who is credited by many for hurling Kardashian into the limelight after they were BFFs in the noughties, holds a red lollipop in the first shot as she models Yeezy season 6 with a grey bralet and relaxed beige joggers with nude boots in front of a car. The second shot – which carries the same paparazzi-style vibe as the first – sees her in another grey crop top with charcoal grey leggings and a lighter grey hooded jacket with trainers, looking like Kardashian on a low-key LA outing. The third picture sees Hilton carrying a coffee cup in an all-grey slouchy outfit as she walks in the street again. She dubbed her "Forever The OG" in her hashtags, aka "original gangster," nodding to the fact that Hilton was her mentor when she first graced the LA celebrity scene. Fans commented on the post in their droves, with one person writing: "Paris Hilton made kim kardashian famous in 2006." Actress Paris Hilton and Kim Kardashian back in 2006Getty Images While someone else said: "OMG she looks so much like Kim here," as a third put: "Now she works for you ." Hilton made headlines on her own accord recently for getting engaged to Leftovers actor Chris Zylka, who proposed to her on New Year's Eve atop an Aspen summit. The fairy tale proposal was completed with a huge diamond engagement ring worth $2m. And though Kardashian maybe regarded as one of the most famous women in the world now, she used to be employed as a stylist/closet organiser for Hilton in the early 2000s. The mother of three also appeared in four episodes of Hilton's reality series The Simple Life, which premiered in 2003. Hilton told Yahoo in 2015 that the "Kardashians would not exist today" without her, stating: "It's nice to inspire people, We've known each other since we were little girls, we've always been friends. So yeah, I'm really proud of her and what she's done." | Mid | [
0.594847775175644,
31.75,
21.625
] |
Intracellular delivery: exploiting viral membranotropic peptides. Recent advances in the understanding of cellular and molecular mechanisms of the pathogenesis of several diseases offer the possibility to address novel molecular targets for an improved diagnosis and therapy. In fact, in order to fulfill their function, macromolecular drugs, reporter molecules, and imaging agents often require to be delivered into specific intracellular compartments, usually the cytoplasm or the nucleus. From a medical perspective, biological membranes represent a critical hindrance due to their barrier-like behaviour not easily circumvented by many pharmacologically-active molecules. Therefore, identifying strategies for membrane translocation is essential. Several technologies have been designed to improve cellular uptake of therapeutic molecules, including cell-penetrating peptides (CPPs). These peptides, which are able to efficiently translocate macromolecules through the plasma membrane, have attracted a lot of attention, and new translocating peptides are continuously described. In this review, we will focus on the viral derived peptides, and in particular those derived by viral entry proteins that may be useful as delivery vehicles due to their intrinsic properties of inducing membrane perturbation. | Mid | [
0.652068126520681,
33.5,
17.875
] |
155 A.2d 591 (1959) Stanley HURWITCH, by Frances Goldberg, his next friend, Plaintiff Below, Appellant, v. Talbert Lee ADAMS, Defendant Below, Appellee. Peter KOHANOVICH, Appellant, v. Cleo L. YOUREE, Appellee. Supreme Court of Delaware. October 30, 1959. Reargument Denied November 25, 1959. *592 John Biggs, III, and John Merwin Bader, Wilmington, for appellants. George L. Sands (of Mortenson & Sands), Wilmington, for Talbert Lee Adams, appellee. William F. Taylor, Wilmington (of Morford, Young & Conaway), Wilmington, for Cleo L. Youree, appellee. SOUTHERLAND, C. J., and WOLCOTT and BRAMHALL, JJ., sitting. WOLCOTT, Judge. These two appeals, involving different facts but similar questions of law, were consolidated in this court for argument. No. 45, 1959 is an action to recover damages for personal injuries arising out of a motor vehicle accident in Delaware on November 7, 1955. All of the parties involved in the accident were non-residents of Delaware. The appellee, Adams, at the time of the accident, was driving an automobile owned by his co-defendant who has not been joined in this appeal. At the time of the accident both the appellee and his co-defendant were members of the military service. The appellee was discharged from military service on March 26, 1957. The co-defendant still remains in the military service and remains a defendant in the action pending below. The action was commenced on May 6, 1958 with substituted service upon the defendants being obtained under 10 Del.C. § 3112 (Non-Resident Motorist Act), two years and seven months after the happening of the accident and more than one year after the discharge of the appellee from military service. No. 47, 1959 is an action seeking to recover damages for personal injuries resulting from a motor vehicle accident occurring in Delaware on April 24, 1956. At the time of the accident the appellee, Youree, was a non-resident of Delaware. The action was commenced on September 6, 1957, more than one year after the occurrence of the accident, and substituted service of process was made upon the appellee under 10 Del.C. § 3112. The appellee at the time of the accident was not in military service, nor does it appear that he is in such service now. In the court below in both cases, inter alia, the defense of the one-year statute of limitations on actions for personal injuries (10 Del.C. § 8118) was interposed by all defendants, who moved to dismiss. The co-defendant in No. 45, 1959, still being in military service, subsequently withdrew his motion to dismiss by reason of 50 U.S.C.A. Appendix, § 525 (The Soldiers' and Sailors' Relief Act). The Superior Court filed an opinion in No. 45, 1959 dismissing the action as to the appellee in that cause, and, on the authority of that opinion, an order was entered dismissing No. 47, 1959. From these orders of dismissal, the plaintiffs in both actions now appeal. Two questions are presented for our decision: I. Is the Delaware one-year statute of limitations on actions for personal injuries (10 Del.C. § 8118) tolled by reason of 10 Del.C. § 8116 which prevents the running of statutes of limitations by reason of a defendant's absence from the state? II. Does the Soldiers' and Sailors' Relief Act (50 U.S.C.A.Appendix, § 525) toll 10 Del.C. § 8118 not only as to a serviceman defendant but also as to a civilian co-defendant? A further point raised below in No. 45, 1959, to the effect that 10 Del.C. § 8118 is tolled by reason of the alleged incompetency of the appellant, has been abandoned in this court. We consider first Question No. I. By 10 Del.C. § 8118 it is provided that no action for the recovery of damages resulting from personal injuries shall be brought after the expiration of one year from the date upon which the injuries were sustained. *593 By 10 Del.C. § 8116 it is provided that certain circumstances will toll the running of all Delaware statutes of limitations. For convenience, we set forth the statute in full: "If at the time when a cause of action accrues against any person, he is out of the State, the action may be commenced, within the time limited therefor in this chapter, after such person comes into the State in such manner that by reasonable diligence, he may be served with process. If, after a cause of action shall have accrued against any person, he departs from and resides or remains out of the State, the time of his absence until he shall have returned into the State in the manner provided in this section, shall not be taken as any part of the time limited for the commencement of the action." The effect of the two cited code sections was considered by this court's predecessor in Lewis v. Pawnee Bill's Wild West Co., 6 Pennewill 316, 66 A. 471. In that case the two cited statutes were construed and it was held that the then statute, now found as 10 Del.C. § 8118, was not subject to the exceptions of the statute now found as 10 Del.C. § 8116. The first code section was the last enacted law and no exceptions being found in its text to prevent the running of the statute of limitations, the Supreme Court held that none could be written in by judicial construction. The holding was based upon the elementary rule that where language of a statute is unambiguous, its meaning is that which is plainly expressed, and there is, thus, no necessity for judicial construction. The court went on to point out that the plaintiff could at any time after the injury complained of have commenced an action by foreign attachment within the permissible period and, thereafter, kept it alive by alias and pluries writs until the defendant brought its property within the state and thus subject to process. Subsequently, in Red Men's Fraternal Accident Ass'n of America v. Merritt, 2 W.W.Harr. 1, 117 A. 284, a plea of the statute of limitations raised by the defendant, a Massachusetts corporation, was upheld as not falling within the purview of the exceptions contained in what is now 10 Del.C. § 8116. The rationale of the decision was that the defendant foreign corporation in order to do business in Delaware necessarily was required by statute to designate the Insurance Commissioner of the state as its agent for the service of process and that, accordingly, suit could have been started within the permissible period and service obtained over the defendant. To the same effect is Klein v. Lionel Corp., 130 F.Supp. 725, in which case the Federal District Court applied Delaware law and held that 10 Del.C. § 8116 had no application to a case in which during the limitation period the defendant was amenable to personal service. The foregoing cases, we think, taken together, demonstrate that 10 Del.C. § 8116 has no tolling effect on the applicable statute of limitations when the defendant in the suit is subject to personal or other service to compel his appearance. Throughout the one-year periods following these accidents, all of the defendants named below could have been served by substitution under 10 Del.C. § 3112, a statute designed to obtain jurisdiction over non-residents using Delaware highways. As far as due process of law is concerned, such service is the equivalent of personal service. Under the circumstances, therefore, we are of the view that there was no tolling of the one-year statute of limitations because of the fact that the defendants were non-residents. However, the appellants argue to the contrary. First, it is said that 10 Del.C. § 8116 is plain on its face and that it applies in any action in which the defendant is a non-resident. We think this argument, *594 if accepted, would result in the abolition of the defense of statutes of limitation in actions involving non-residents, but the answer to the argument lies in the direct holding of the Pawnee Bill case to the contrary. The appellants further argue that since 10 Del.C. § 8116 contains within itself no exception to the operating of its provisions with respect to the statute of limitations on actions for personal injuries, the teaching of the Pawnee Bill case must be applied to hold that the statute of limitations is in fact tolled. If we understand the argument thus made, it is an attempt to argue in reverse the argument that was rejected in the Pawnee Bill case. As such, it of course also finds its answer in the ruling of the Pawnee Bill case that the two code sections are completely independent of each other. In any event, whatever the precise argument made may be, we think that the Delaware statute of limitations on actions for personal injuries runs continuously without interruption when there is available to the plaintiff throughout the period an acceptable means of bringing the defendant into court. Therefore, the answer to the first question posed is that there has been no tolling of the statute of limitations since these defendants, at all times, were subject to substituted service. We now turn to the second question presented. The Soldiers' and Sailors' Relief Act has as its purpose the temporary suspension of legal proceedings and transactions which may prejudice the civil rights of persons in the military services of the United States. To accomplish this purpose, it is provided that no applicable statute of limitations shall run against or for the benefit of such serviceman during the period of his military service. It is thus plain that the serviceman defendant in No. 45, 1959 properly withdrew his defense of the statute of limitations. Further proceedings against him in the action have been stayed. However, the appellant in No. 45, 1959 seeks to hold his co-defendant, now in a civilian status, in an action commenced more than one year after the regaining of such status. If he can be so held, it must be solely by reason of the joining with him as a party defendant one who cannot be proceeded against because of the Soldiers' and Sailors' Relief Act. Appellant argues that the purpose of the act is to assure to the individual in military service "a peace of mind respecting any civilian litigation which might be brought against him", and that this is achieved by tolling statutes of limitation both for and against him. However, it is argued, unless a similar tolling is made with respect to the same cause of action asserted against a civilian co-defendant the "tranquility" of the serviceman will be disturbed by the harassment of interrogatories, depositions, and the like. We do not agree. This cause of action is not joint, but could have been asserted against these two defendants jointly or against each of them severally. If the exigencies of preparation for trial result in undue harassment of the serviceman, or if his absence makes such preparation impossible, those circumstances might justify the granting of a stay on the application of the civilian defendant, but, in our opinion, they do not operate to relieve the plaintiff of the necessity to commence his action against the civilian within a certain time or be forever after barred from asserting it. We think the Soldiers' and Sailors' Relief Act by its very terms forces this conclusion. It is designed to avoid injury to a member of the armed forces and not to permit a plaintiff to allow his claim against a civilian to grow stale. Civilian defendants have rights as well as servicemen. Among them is the right to regard the failure to assert a timely claim against them as a bar to its further presentation. Particularly *595 is this true when the plaintiff could proceed against the two defendants by separate actions if he desired. We think the answer to the question so apparent on the face of the statute as to require no citation of authority. We find, however, that other courts hold the same view. Cf. Patrikes v. J. C. H. Service Stations, 180 Misc. 917, 41 N.Y.S.2d 158 and State ex rel. Frank v. Bunge, 16 Wash. 2d 358, 133 P.2d 515. Appellant cites Crawford v. Adams, Tex. Civ.App., 213 S.W.2d 721 in support of his position. But that case does not support him for it appears that the applicable Texas statute of limitations, Vernon's Ann.Civ. St. arts. 5526, 5527, was tolled in the circumstance that one of two joint payees on a note was in the military service. It also appears that under Texas law their claim in the note was joint. Presumably, an adverse judgment against one, therefore, would have been equally adverse to the other. Lastly, appellant argues that the provisions of the act must extend to a civilian co-defendant because, under the rules of pleading of the Superior Court, Del.C.Ann., the plaintiff must join the serviceman or otherwise lose his right against him if the case goes to judgment prior to the termination of his term of military service. We do not follow the argument. Rule 19 of the Superior Court requires that parties having a joint interest must be joined, while Rule 20 permits the joinder of parties against whom claims are asserted which arise out of the same occurrence. The claims asserted in No. 45, 1959 are in tort and, as such, they are several. The judgments below are affirmed. On Petition for Reargument. Appellants' petition for reargument. The reason advanced is that Lewis v. Pawnee Bill's Wild West Co., 6 Pennewill 316, 66 A. 471, cited in the opinion, was overruled by the General Assembly at the 1909 session which next ensued by the enactment of 25 Laws, Ch. 234, which amended the predecessor of present 10 Del.C. § 8118 (the one-year statute of limitations for personal injuries) by adding a new section relating to causes of action accruing against a person who thereafter departs the state. The 1909 amendment in substance was the second clause of 1893 Code, Ch. 123, § 14, the predecessor of present 10 Del. C. § 8116 (the general tolling statute). The result, therefore, was that in 1909 there were two statutory provisions embodying the present 10 Del.C. § 8116, one general in nature, and the other apparently applying specifically to actions for personal injury. Thus, it is argued, the rule of Pawnee Bill was overruled for its premise was changed by statutory amendment. We note that the argument is now made for the first time, the 1909 act not having been heretofore cited to us. We make no point of this omission, however, since we have concluded that reargument must be denied in any event. We so conclude because of the existence throughout the one-year period of process available to the plaintiff to bring the defendant into court. We so ruled in our opinion, in addition to our reliance upon the Pawnee Bill case. Furthermore, the appellants' new argument might well be answered by the failure of the General Assembly, in enacting the 1915 Code, to enact the specific tolling statute applying to actions for personal injuries. Following the enactment of the 1915 Code in Nigro v. Flinn, 8 W.W.Harr. 368, 192 A. 685, an action for personal injuries, the then Supreme Court of the State approved the Pawnee Bill case and held that the one-year statute of limitations was not subject to the general tolling statute, now 10 Del.C. § 8116. No mention was made of the 1909 amendment. The failure to mention it, impliedly at least, might be considered as a holding that the omission of the 1909 amendment from the 1915 Code constitutes a repeal of that section, since the court held that the 1915 Code was a true Code which effected changes in the *596 basic law by omission as well as commission. As we have said, however, we do not have to decide the question raised by the late discovery of the 1909 amendment. The point, therefore, may be taken to be still open. Reargument denied. | Low | [
0.498777506112469,
25.5,
25.625
] |
Q: Formatting matrix data for ANOVAN in MATLAB I have a matrix of data values that looks a bit like this, though significantly larger (2000+ rows, 30+ columns): NaN 12 3 NaN 18 NaN 42 NaN NaN NaN NaN... 68 NaN 14 Nan NaN NaN NaN NaN NaN NaN 26 ... ... So you see that is largely populated by NaN values. What I am interested in, naturally, are the cells that are populated by values. I want to be able to run anovan on this data set, and unfortunately it is too large to reformat by hand. What I want to do is have a script run through the matrix, find every value that is not NaN and its index in the matrix, and create three arrays for the anovan input: Values=[ 12 3 18 42 68 14 26 ...] Rows= [ 1 1 1 1 2 2 2 ...] Columns= [ 2 3 5 7 1 3 11 ...] The rows and columns correspond to raters and ratees in a study, which is why they it is so important for me to preserve the exact index of each value. I cannot figure out how to do this, though. I have tried using find, but can't get it to do what I want. [r c v] = find(~isnan(datamatrix)) %% doesn't work EDIT: It occurs to me I could just do: [r c v] = find(datamatrix) This will include all of the NaN values, in the [r c v] output, though. In that situation, how would I go through the V array and delete the NaN values AND their corresponding R and C values? EDIT2: Scratch that. I forgot that some of my values are 0, so I can't use the FIND command. A: You can extract all the non-NaN numbers and their indices from data matrix like this: i = find(~isnan(datamatrix)); values = datamatrix(i); [rows,columns] = ind2sub(size(datamatrix),i); For the example data you included, this results in: rows' = [2 1 1 2 1 1 2] columns' = [ 1 2 3 3 5 7 11] values' = [68 12 3 14 18 42 26] That's all the indices and all their corresponding values. If you need them ordered in a particular way you'll have to do that seperately. | Mid | [
0.629885057471264,
34.25,
20.125
] |
More In Jobs QuickWire: Facebook Supports Open-Source Movement With an Open Academy Facebook—a high-profile user of open-source computer code—on Wednesday unveiled a project in which it’s collaborating with a Stanford University professor to match computer-science students with open-source mentors and tasks and let the students earn academic credit as they work. Called Open Academy, the effort has expanded to 22 institutions in the United States and elsewhere, including Carnegie Mellon University, Imperial College of London, the Massachusetts Institute of Technology, and the University of Helsinki. Jay Borenstein, a computer-science professor at Stanford, created the pilot course for the program in 2012. Open Academy students come together at the beginning of each semester—at Facebook’s expense—to meet their mentors and enjoy what Facebook describes as “a weekend of learning and hacking.” After that, the students return to their institutions, where mentors help them find open-source projects to work on in virtual teams. The mentors also review the code the students contribute, while the students’ instructors meet with them regularly to check on their progress. | Mid | [
0.6129032258064511,
33.25,
21
] |
CD133+ CD44+ subgroups may be human small intestinal stem cells. The identification and separation of small intestinal epithelial stem cells are still on the preliminary stage. In this study, we planned to utilize immunohistochemistry, fluorescence-activated cell sorting (FACS) and RT-PCR to investigate the possibility of CD133 and CD44 as markers of human small intestinal epithelial stem cells. The expressions of CD133, CD44 and Lgr5 were studied by immunohistochemistry. Four subgroups of CD133(+)CD44(+), CD133(+)CD44(-), CD133(-)CD44(+), CD133(-)CD44(-) were sorted out through FACS and the expression level of Lgr5 gene was measured by RT-PCR and polyacrylamide gel electrophoresis (PAGE) with silver stained. Ten cases of samples were available for analyzing. By immunohistochemical staining, few cells with positive expressions of CD133, CD44 and Lgr5 were distributed in the bottom of crypts with the expression locations somewhat overlapped. The average percentage of CD133(+)CD44(+) cells was 0.0580 ± 0.0403%, while the corresponding contents of CD133(+)CD44(-) cells, CD133(-)CD44(+) cells and CD133(-)CD44(-) cells were 0.4000 ± 0.1225%, 0.7000 ± 0.2646% and 76.5600 ± 3.5529% respectively. Ten times of positive expressions of Lgr5 were detected in the CD133(+)CD44(+) groups, while 9/10, 8/10 and 4/10 times for CD133(+)CD44(-), CD133(-)CD44(+) and CD133(-)CD44(-) subgroups respectively. With the help of Quantityone 4.62 software, the densities of corresponding place to Lgr5 and reference gene were obtained. The density ratios of corresponding place to Lgr5 to reference gene were significant difference between subgroups (P < 0.001). By means of LSD method, the density ratios in CD133(+)CD44(+) subgroups had statistical differences from the other subgroups (P < 0.05). We concluded CD133(+)CD44(+) cells may be human small intestinal epithelial stem cells, which need further researches to confirm. | High | [
0.689189189189189,
31.875,
14.375
] |
Excellent therapeutic results achieved in chronic myeloid leukemia patients with front-line imatinib and early treatment modifications in suboptimal responders: a retrospective study on 91 unselected patients. Second generation tyrosine kinase-inhibitors (TKI) have been claimed to represent now the first-choice therapy for chronic myeloid leukemia (CML). Indeed, they generally induce faster and deeper molecular responses compared to imatinib that, however, is equally effective in at least 50% of patients. Moreover, some recent reports have questioned the long term safety of dasatinib and nilotinib. Therefore, upfront imatinib with early shift to second generation TKI for patients with slow/incomplete response might be as effective as front-line second generation TKI, with a possibly better safety profile. We retrospectively evaluated 91 chronic phase CML patients (median follow-up 57 months, median age 61 years), treated front-line with standard-dose imatinib and early therapy modifications (at 3-12 months) in case of unsatisfactory response or intolerance. Thirty-three patients (24 with unsatisfactory response, 9 intolerant) changed therapy, either by increasing imatinib dose (11/91) or by switching to second generation TKI (22 directly, 4 after high-dose imatinib). Globally, our strategy led to complete cytogenetic response (CCyR) in 98% of the patients, major molecular response (MMR) in 88% and molecular response 4 logs (MR(4.0) ) in 62%. Three patients in CCyR (3%), 2 of them in MMR too, suddenly progressed to blastic phase. At the last follow-up nine patients had died, seven of CML-unrelated causes and two only of CML progression. These results suggest that our strategy could be as effective as front line second generation TKI, with most of patients still receiving imatinib, a drug of better known long-term side effects and lower cost. | Mid | [
0.649867374005305,
30.625,
16.5
] |
Q: MVC ViewModel not posting back I am using Viewmodel, however when I submit the form, I am not getting the values back. I have a Model Like this... Public Class ProductSummaryModel Property productGUID As Integer Property productName As String Property productPrice As Double Property productSku As String Property categories As String() Property ShipsWithin As Nullable(Of Integer) <AllowHtml> Property productWebDescription As String Property ImageMainPath As String End Class Then I have a ViewModel Like this... Public Class ProductViewModel Public ProductSummary As ProductSummaryModel End Class Here is my Controller... Public Function Add() As ActionResult ' Default View To Add Item Dim prdsummary As ProductViewModel = New ProductViewModel Return View("Add", prdsummary) End Function in my "Add" View I have following... <tr> <td>Price: </td> <td><%=Html.TextBoxFor(Function(f) f.ProductSummary.productPrice)%></td> </tr> Problem is, when I submit the FORM, I cant get the POSTED Form Values. Public Function AddItem(ByVal Model As ProductViewModel) As ActionResult ' Add Item into DB Dim ajaxMessage As New AjaxFormResponse Dim prd As ProductSummaryModel = New ProductSummaryModel Model.ProductSummary = prd Dim skuID As Integer = 0 msgbox(Model.ProductSummary.categories) ' Empty End Function May there is a better way of handling this. * UPDATE ** I have figured out what the Problem is...When passing Model to ViewModel I had to do this... Dim Product As ProductViewModel = New ProductViewModel Dim ProductSummary As New ProductSummaryModel Product.ProductSummary = ProductSummary Return View("Add", Product) A: Why not use the ProductSummaryModel for binding instead of ProductViewModel. This way you can keep thing simple. Avoid nested bindings if you can. Also be sure you have using in the view as below, and the HttpPost attr. in the Controller Product Controller Public Class ProductController Inherits Controller ' Main Action Public Function Main() As ActionResult Dim prdViewModel As ProductViewModel = New ProductViewModel prdViewModel.ProductSummary = New ProductSummaryModel Return View("Main", prdViewModel) End Function ' Partial Action Public Function Add() As ActionResult Dim prdViewModel As ProductViewModel = New ProductViewModel prdViewModel.ProductSummary = New ProductSummaryModel Return View("Add", prdViewModel) End Function 'POST Action from Partial View <HttpPost()> _ Public Function AddItem(ByVal Model As ProductSummaryModel) As ActionResult ' Add Item into DB msgbox(Model.productPrice) ' Empty End Function End Class Main View <%@ Page Title="" Language="VB" MasterPageFile="~/Views/Shared/Site.Master" Inherits="System.Web.Mvc.ViewPage(Of MvcApplication2.ProductViewModel)" %> <asp:Content ID="manageTitle" ContentPlaceHolderID="TitleContent" runat="server"> Main Page </asp:Content> <asp:Content ID="manageContent" ContentPlaceHolderID="MainContent" runat="server"> <% Html.RenderPartial("_Add", Model.ProductSummary) %> </asp:Content> Partial View <%@ Page Language="VB" MasterPageFile="~/Views/Shared/Site.Master" Inherits="System.Web.Mvc.ViewPage(Of MvcApplication2.ProductSummaryModel)" %> <asp:Content ID="registerTitle" ContentPlaceHolderID="TitleContent" runat="server"> Register </asp:Content> <asp:Content ID="registerContent" ContentPlaceHolderID="MainContent" runat="server"> <% Using Html.BeginForm("AddItem", "Product")%> <%: Html.AntiForgeryToken() %> <tr> <td>Price: </td> <td><%: Html.TextBoxFor(Function(f) f.productPrice) %></td> </tr> <input type="submit" value="Register" /> <% End Using%> </asp:Content> UPDATE VIEW MODELS Public Class ProductSummaryModel Property productGUID As Integer Property productName As String Property productPrice As Double Property productSku As String Property categories As String() Property ShipsWithin As Nullable(Of Integer) <AllowHtml> Property productWebDescription As String Property ImageMainPath As String End Class Public Class ProductViewModel Public ProductSummary As ProductSummaryModel End Class | Mid | [
0.538083538083538,
27.375,
23.5
] |
The farm and farmhouse About Me Hi! Im a wife in my low twenties, living on a farm in the Midwest. Just trying to make ends meet and save for our future as we remodel our old farmhouse, and stay out of debt. ____________________________ As of November 2018 Update on Jobs July 7th, 2017 at 12:02 pm To update on my husband's job situation: He had finally decided to apply for a job with good pay / benefits but crappy work and hours. Before he could do that someone told him about a much better job that was hiring. He applied for that but they are saying they aren't going to start the hiring process until after July 15th. So we are still waiting. Then another job came open which has GREAT pay and benefits but just okay hours. He applied for that (along with probably 100 other people, ugh). Well they called today to let him know he has made it to the final hiring process and he is scheduled for an interview on the 17th. Yay! The original planned job is also now hiring. So husband will probably go ahead and apply for that as well. All this to say there are 3 good jobs in the running and we are hoping and praying that husband can manage to snag one of them. He is a great worker and has never called in sick or been late. Just wish someone would give him a chance to shine. Husband is still wishing for #1, although #2 would be great for us financially. He would be getting about a 50% raise. Which is equally to what I am currently making. All of them offer good benefits and retirement which is a major improvement over what we currently have. Please keep us in your thoughts and pray that interviews go well. This could be a real life changer for us. | Low | [
0.5,
32.75,
32.75
] |
--- id: type-graphql title: TypeGraphQL Integration sidebar_label: TypeGraphQL --- **TypeGraphQL** is a set of tools that provides you some decorators that can be used for writing your GraphQL definitions. You can define your type definitions and resolvers using **TypeScript** classes thanks to **TypeGraphQL** decorators. You can check out **[TypeGraphQL documents](https://typegraphql.com/)** to learn more. Important: Make sure you follow the [installation steps](https://typegraphql.com/docs/installation.html), such as installing `reflect-metadata` and configuring your typescript correctly. On the other hand, GraphQL Modules provides encapsulated dependency injection which allows you to seperate your logic from resolvers. It makes testing easy, because you can mock providers and stuff for dependency indejection. You can write standalone modules in a code-first way. You can import the schema that is generated by TypeGraphQL in your GraphQL Module. Let's assume we have a `Chat` type for base fields shared with the entity. `chat.type.ts` ```typescript import { ObjectType, Field, ID } from 'type-graphql'; @ObjectType() export class Chat { @Field((type) => ID) id: number; @Field() title: string; @Field({ nullable: true }) description?: string; } ``` Create another class for our queries and mutations based on this type: `chat.resolver.ts` ```typescript import { ChatsProvider } from './chats.provider'; import { Resolver, Mutation, Arg, Int, Query } from 'type-graphql'; import { Chat } from './chat.type'; @Resolver((of) => Chat) export class ChatResolver { constructor(private chatsProvider: ChatsProvider) {} @Query((returns) => [Chat]) chats() { return this.chatsProvider.getChats(); } @Query((returns) => Chat) chat(@Arg('id') id: number) { return this.chatsProvider.getChat(id); } @Mutation((returns) => Chat) createChat( @Arg('title') title: string, @Arg('description') description: string ) { return this.chatsProvider.createChat({ id: Math.random(), title, description, }); } @Mutation((returns) => Int) deleteChat(@Arg('id') id: number) { return this.chatsProvider.deleteChat(id); } } ``` > We can use dependency injection of GraphQL Modules in TypeGraphQL. Resolvers and Providers are part of dependency injection in that case. Then let's create our module: `chat.module.ts` ```typescript import { GraphQLModule } from '@graphql-modules/core'; import { ChatsProvider } from './chats.provider'; import { buildSchemaSync } from 'type-graphql'; import { ChatResolver } from './chat.resolver'; import { Chat } from './chat.type'; const resolvers = [ChatResolver]; export const ChatsModule = new GraphQLModule({ providers: [ChatsProvider, ...resolvers], extraSchemas: [ buildSchemaSync({ resolvers, container: ({ context }) => ChatsModule.injector.getSessionInjector(context), }), ], }); ``` We have to define resolver classes as providers because they are also part of our dependency injection. `container: ({ context }) => ChatsModule.injector.getSessionInjector(context)` tells TypeGraphQL to use the `ChatsModule` dependency injection container for those resolvers. > Check out [our example with TypeGraphQL](https://github.com/ardatan/TypeGraphQLModules). ## Integration with other implementations You can merge different modules from different implementations like below. So you don't have to use the same implementation method in all modules. GraphQL Modules will handle schema merging for you, even if they are from different implementations. ```typescript new GraphQLModule({ imports: [ XModuleCreatedUsingSchemaFirst, YModuleCreatedUsingNexus, ZModuleCreatedUsingTypeGraphQL, ], }); ``` | Mid | [
0.6535626535626531,
33.25,
17.625
] |
Posted by The Staff on 1 Dec 2014. Filed under Business, Top news. You can follow any responses to this entry through the RSS 2.0. You can leave a response or trackback to this entry Economic Tatra Summit 2014 a Success The third edition of TATRA SUMMIT focused on several key topics such as economic growth, new investments and innovation strategies, priorities of the new European Commission, regaining trust in the EU and finally the new Energy Union. Source: Centre for European Affairs The conference was innovative in its approach because it did not focus on roots and consequences of the crisis in the EU but it discussed solutions and initiatives and explicitly accentuated the growth agenda. The debates have confirmed that there are efforts to look for various growth stimuli without a negative impact on consolidation of public finances. Speakers have also rejected bending and redefining agreed rules that could jeopardise trust in stability of financial markets as well as trust of European citizens. Actual innovative contributions to the topics of the conference included a meeting of the EU Task Force that is preparing a pipeline of projects for supporting investments in the EU with senior representatives of financial companies, investment groups and sponsors of the project. The TATRA SUMMIT was also used as a platform for presenting the Slovak Investment Holding, which is a new innovative tool merging public and private resources in order to support investments in Slovakia. The investments will be aimed mostly as infrastructure, innovation and research, digital economy and energy. It will combine about 420 million euros from the European structural and investment funds with private investments. Jӧrg Asmussen, Permanent State Secretary at the German Ministry of Labour and Social Affairs, has said that the TATRA SUMMIT has a potential to become a forum for generating Central European ideas for the future of European integration. George Zavvos, the first European Commission Ambassador to Slovakia, sees the TATRA SUMMIT as a Central European version of the Davos conference. This call has resonated among the guests. KEY TOPICS Juncker’s investment package Vice-President of the European Commission for Employment, Growth, Investment and Competiveness, Jyrki Katainen, has remarked that the European Commission’s proposed 300 billion euro investment package will not solve all problems of the EU economy. He believes that the investment package has to be considered together with two other pillars of the economic strategy – structural reforms and strengthening fiscal credibility. Carsten Pillath, Director General for Economic Affairs and Competitiveness at the Council of the EU, has pointed out that the EC investment programme accounts only for 0.8 per cent of the EU’s GDP, so its real added value will be in becoming a catalyst for private investments. According to Director General for Economic Policy and Financial Markets at the Austrian Ministry of Finance, Harald Waiglein, the investment package may lead to a temporary increase of the nominal GDP but we have to think about increasing the potential GDP. The recipe could be the finalisation of the single market and the support for digital economy, said Mr. Waiglein. Growth vs. consolidation: Stability and Growth Pact and its flexibility Prime Minister of Slovakia, Robert Fico, has said that in response to the crisis the Eurozone agreed on certain principles and rules but not all member states have learned the lesson and some are not willing to follow the rules. Mr. Fico has warned that we should not repeat the same mistake just because forecasts show positive figures. Jӧrg Asmussen has pointed out that the Pact is already sufficiently flexible and any attempts at its re-evaluation are seen negatively by financial markets. Former Italian Prime Minister, Enrico Letta, has said that it is impossible to achieve healthy economic growth at the expense of healthy fiscal management. Regaining trust in EU project and its future Former Vice-President of the European Commission, Günter Verheugen, has criticised European leaders, among them German Chancellor Angela Merkel, for a lack of vision. Mr. Verheugen believes politics is not about copying trends from opinion polls but its active forming. Enrico Letta has said that the EU will regain trust of its citizens only if it provides its citizens with real opportunities. Energy union The project of the EU energy union was outlined by Vice-President of the European Commission for Energy Union, Maroš Šefčovič. He has said that the conception of the Energy Union should be presented in January 2015. Subsequently, work on the action plan and defining concrete infrastructure projects will get under way. | Low | [
0.48627450980392106,
31,
32.75
] |
[A retrospective study comparing two formulations of valproic acid]. Valproic acid is available in two different presentations, Depakine and Depakine Crono. Equivalences in plasmatic levels, efficacy and adverse effects between these two formulations are not fully established. To compare plasmatic levels, efficacy and plasmatic levels between Depakine and Depakine Crono. We studied a retrospective series of 238 patients in treatment with Depakine or Depakine Crono and compared plasmatic levels, efficacy and adverse effects between both formulations. A total of 173 patients had taken one formulation and 54 both. Plasmatic levels were similar in both groups. There were more significantly more patients free of seizures among the Depakine Crono group. Significantly better outcomes were seen with Depakine Crono with respect to secondary effects. Adverse effects are significantly less frequent in men than in women. The higher the dose, the higher the incidence of adverse events. Depakine Crono seems to obtain similar plasmatic levels, is at least as efficacious and is associated with less adverse events that Depakine. | High | [
0.6611341632088521,
29.875,
15.3125
] |
Celebrating B Movies, Cult Films, and Indie Classics. For all you gore fans out there, I got to thinking recently about horror movies, and some of the lesser known horror movies out there. Oh don’t get me wrong, they are not bad movies, but for whatever reason they have been forgotten to the test of time! With said, I also got to thinking about some of these directors that I would say have definitely been forgotten to the test of time… Rather they be, because their work, or they, themselves are lesser known, or literally at this point are seldom ever thought about! An example of this would be, Scott Spiegel… Now everyone knows about Sam Raimi, Rob Tapert, Bruce Campbell, and Ted Raimi… I mean they have proven to be a great group, with the all of them having done such movies and TV series as , The Evil Dead (1981) and the TV series, Hercules: The Legendary Journey. Did you know though that within the Raimi/Campbell/Tapert group that Scott Spiegel is a member of that group? That’s right folks, even though he is lesser known, not only is he a legitimate member of that group, but in the late 1980s there was a little known gem of movie called, Intruder (1989) which had everyone of them in it (except Robert Tapert). With that said, Mr. Spiegel is a good example of a lesser known oft times forgotten Horror movie director. With that said folks, here is my list of top 10 Lesser Known Horror Movie Directors: At number 10 we got: F.W. Murnau (Nosferatu): F.W. Murnau Everyone knows Universal’s Dracula (1931). A lot of people I am sure probably think that this movie is even the first movie on Vampires… Well I am here to tell you that, that is not the case! That movie is not the first Vampire movie, or even the first Dracula movie. The director that I wanted to mention here is F.W. Murnau, and his work on creating legitimately the first movie on Bram Stoker’s, ‘Dracula’ and that movie is Noseferatu (1922). Now I know that number 9 sounds bad for a director of a horror movie… Don’t worry, I actually did really like the job that Mr. Rader did on Grandma’s House, but besides that I have not seen any of his other directorial work. Although I did like the job that he did on writing the Kevin Costner movie Waterworld (1995). With that said though, I am looking forward to more of his work in the future… Until then, enjoy this trailer for the movie, Grandma’s House (1989) directed by Peter Rader: At number 8 we got: Charles Band (Head Of The Family) Charles Band. Now you might think that it is rather odd, me recommending a director for a movie called, Head Of the Family (1996). But the truth is, is this is rather a brilliant horror movie, about a guy who black mails an incredibly rich and reclusive family that literally can’t live with out each other! What I mean by this is that each sibling in this family has a specific sense that work together to complete one complete experience for the ‘Head’ of the family, (and you can take this to be mostly literal as the head of the family mostly is a head!) With that said, Mr. Band has roughly 319 horror movie credits to his resume, (give or take any films that he worked on in multiple capacities.) This one I thought that I would recommend, because it is a great forgotten classic that I thought that I would mention, because I personally loved how he created both as the director and one of the writers of this piece, an atmosphere, in which you could have siblings psychically linked together and controlled by another sibling! With that said, please enjoy the trailer for the classic, Head Of The Family (1996) For number 7: Kevin Yagher (Hellraiser: Bloodline) Kevin Yagher, who did special effects for, Child’s Play (1988) with a Chucky Doll. Again I have to admit that this guy only got number 7 because he doesn’t have many directorial credits to his name (with the fact that mostly he is known for his special effects on movies.) With that said though he did do a movies that was universally disliked when it first got released, as a matter of fact, Alan Smithee is credited for having made this movie… Now before I continue on, let me just say that when ever a Director directs a movie under the pseudonym of ‘Alan Smithee’. It is the recognized way that directors have for not attaching their name to a project when they are not satisfied with how they’re movie turned out… With that said, the movie that he did that I am mentioning here is: Hellraiser: Bloodline. Now I don’t know why Mr. Yagher decided to use the ‘Alan Smithee’ moniker for this movie. I personally liked how he made this movie in to separate stories, that showed the history of the Hellraiser box, (This movie happens to be the 3rd sequel in Clive Barker’s highly successful, Hellraiser franchise.) With that said, I thought that you might enjoy the trailer for Hellraiser: Bloodline: At number 6 we got: Byron Werner (Starkweather): Byron Werner Now admittedly this director is quite a bit newer then the directors that I have mentioned so far. But I would like to acknowledge him as a great lesser known horror movie director for the work that he did on Death Valley: The Revenge Of Bloody Bill. For more information on Death Valley: The Legend Of Bloody Bill, please enjoy this trailer for the movie: Unfortunately, Shockwaves happens to be the only movie that I have seen of his, (an over-site that I intend to rectify.) But never the less, I am putting Mr. Wierderhorn on this list because, being a fan of Zombies as well as World War 2 history and having never really heard of his name before seeing this movie. I found that he did a great job in creating almost an air of historical significance to the piece, while still developing the characters and story well enough that through out the whole movie I was hoping that they would all escape! I mean, you never know… Considering the Nazi attrocities… You know… For more information on this movie, please enjoy this trailer for the movie, Shockwaves (1977). For number 4: Victor Halperin (Revolt Of The Zombies) Let me preface what I am about to say, with this: the movie that I am about to mention for the reason why I think that Victor Halperin, is a little bit more well known, but besides this movie, I doubt a lot of people really know this guys body of work… With that said, the movie that I am going to be mentioning here is: White Zombie (1932) I can’t really describe here in words why I like the work that Mr. Halperin did in White Zombie, except to say that I loved this movie, and I thought that Mr. Halperin did just a truly fantastic job on it and since this guy’s career is so archaic, and I doubt many people with the expection of die hard horror fans would have ever heard of him or the movies that he has done! I mean you can’t really go wrong with the movie that produced the name for Rob Zombie’s old band! For more information, please enjoy this trailer for the movie: White Zombie (1932): For Number 3: Jim McCullough Sr. (The Aurora Encounter). Jim McCullough Sr. The reason that I think of Jim McCullough Sr. is such a great little known director, is because of the movie, Mountaintop Motel Massacre (1986). Despite the fact that this movie is very reminiscent of Psycho (Lets be honest, it is basically Psycho, with a female killer.) I also have to admit that this movie is just mindless entertainment, but I do like how Mr. McCullough shot this film, I mean I am still curious to figure out how he filmed the scenes when the latest victim is in these really tiny (and I mean really TINY) tunnels! With that said, if you would like some more information on the movie, please enjoy this trailer for the movie, Mountaintop Motel Massacre (1986): At number 2: Amy Holden Jones (Love Letters): Amy Holden Jones – Director Now admittedly Ms. Jones is probably most well known for her writing credits. But there is a horror movie that she did, a classic that would ultimately join the Corman family of films… This movie, Slumber Party Massacre (1982). What I liked about what she did, was she turned an otherwise paint by numbers slasher film, and turned it in to suspenseful edge of your seat shock fest, that I still to this day enjoy! With that said, please enjoy this trailer for the movie, Slumber Party Massacre (1982): And at number 1 we got: John Lafia (Man’s Best Friend): John Lafia – Director Now this guy admittedly has worked a bit more then most of the people that I have mentioned here, but I thought that I would mention him, because despite having created, Man’s Best Friend (1993). I am certain especially due to his lack of more recent movie credits, that he is one of those directors that at least as far as movies goes, seems to have fallen through the cracks! With that said, please enjoy this trailer for the movie, Man’s Best Friend (1993): With that said folks, none of these directors are bad, as a matter of fact they have all done in my opinion, some great work that I highly recommend that you check out! | Mid | [
0.581052631578947,
34.5,
24.875
] |
At low speeds (especially in liquids rather than gases), the drag force is proportional to the speed rather than it's square, i.e., F = -c_1*r*v , where c_1 is a constant. At time t = 0, a small ball of mass is projected into a liquid so that it initially has a horizontal velocity of in the direction as shown. The initial speed in the vertical direction ( y) is zero. The gravitational acceleration is g. Consider the cartesian coordinate system shown in the figure (+x to the right and +y downwards). Express the answer of the following questions in terms of some or all of the variables c_1, r , m , g, v_x , v_y , and u (enter C_1 for , v_x for and v_y for ). Enter e^(-z) for exp(-z) (the exponential function of argument -z). (a) What is component of the acceleration in the direction as a function of the component of the velocity in the direction ? express your answer in terms of v_x , c_1 , r , g , m and u as needed: What is the acceleration in the direction as a function of the component of the velocity in the direction ? express your answer in terms of v_y , c_1 , r , g, m and as needed: Using your result from part (a), find an expression for the horizontal component of the ball's velocity as a function of time? Using your result from part (b), find an expression for the vertical component of the ball's velocity as a function of time t. How long does it take for the vertical speed to reach 99 of its maximum value.What value does the horizontal component of the ball's velocity approach as t becomes infinitely large?What value does the vertical component of the ball's velocity approach as t becomes infinitely large? Physics pls anyone can help me? its urgent - Anonymous, Monday, October 14, 2013 at 3:26pm Physics pls anyone can help me? its urgent - ss01, Tuesday, October 15, 2013 at 11:01pm for me q6 is full loop and q5 is half loop i did not got that one i am on half way your answers are showing wrong for me. do you have the steps? Physics pls anyone can help me? its urgent - Anonymous, Wednesday, October 16, 2013 at 12:01am You mean the one that starts d1=.4785? I took the general equation, Acos(wt+p), used the initial conditions to solve for the constants. Then I used that to get the answers. At least that is what I remember. I don't recall all the details I'll see if I can find the details. Physics pls anyone can help me? its urgent - ss01, Wednesday, October 16, 2013 at 12:07am yup Physics pls anyone can help me? its urgent - Anonymous, Wednesday, October 16, 2013 at 12:35am I'm looking for my notes. The first one comes from the equation ma=-kx. then (ma/k)=-x = (4*9.81)/82=x=.4785 Physics pls anyone can help me? its urgent - Anonymous, Wednesday, October 16, 2013 at 12:38am The second one comes from f=(1/2pi)sqrt(k/m) =(1/2pi)*sqrt(82/4)=.72 Physics pls anyone can help me? its urgent - Anonymous, Wednesday, October 16, 2013 at 12:41am for the other two I think I got x(t)=.4cos(4.53t+pi) and then set v(t)=0 to get the time and then used that to get the velocity. And I used v(tm)=0 to get the time when it reaches the highest point and plugged that value back into x(t). Physics pls anyone can help me? its urgent - ss01, Wednesday, October 16, 2013 at 1:25am thnx.. and what about spring block question? Physics pls anyone can help me? its urgent - Anonymous, Wednesday, October 16, 2013 at 2:02am I got 3, don't ask me how I got it. I'm not sure. Physics pls anyone can help me? its urgent - ss01, Wednesday, October 16, 2013 at 2:32am just tell the answer Physics pls anyone can help me? its urgent - Anonymous, Wednesday, October 16, 2013 at 3:12am The answer is "3" Physics pls anyone can help me? its urgent - Anonymous, Wednesday, October 16, 2013 at 3:12am Hey are you in quantum also? Physics pls anyone can help me? its urgent - ss01, Wednesday, October 16, 2013 at 5:51am | Mid | [
0.5831265508684861,
29.375,
21
] |
Dons must embrace pressure - Ardley AFC Wimbledon manager Neal Ardley says the club are prepared for one last push in the League Two relegation battle. The Dons know a win over Fleetwood Town on Saturday will be enough to guarantee their Football League status. He told BBC London: "We all know it's massive. This club has worked hard for 10 years to get to where we are. "The Conference is a tough league and this club did well to get out of it a couple of years ago. We understand how vital it is to stay in the League." The Dons currently sit 23rd but, with fellow strugglers Dagenham & Redbridge facing York, they will leapfrog one side if they beat Fleetwood at Kingsmeadow on Saturday. The rise of AFC Wimbledon Wimbledon FC were founded in 1889 and climbed from non-league to the Premier League. AFC Wimbledon were formed in 2002 by Wimbledon FC supporters dismayed by the FA's decision to allow the club to move to Milton Keynes. After Wimbledon FC moved to Milton Keynes in 2003, they were renamed Milton Keynes Dons in 2004. Since their creation, AFC Wimbledon they have risen from the ninth tier of English football to League Two. AFC Wimbledon, who were promoted to the Football League in 2011, have never been relegated in their 10-year history. The Dons, who currently play in Kingstonian, have ambitions to return to the London Borough of Merton by redeveloping Wimbledon Greyhound Stadium. Wimbledon have been in the bottom half of the table for almost the entire campaign but were as high as 16th, seven points above the drop zone, after beating Morecambe in late March. Since then Ardley's side have picked up two points from a possible 15 to put them back in danger of dropping back into non-league. "I am disappointed we have not picked up the points since six games ago but I am not disappointed with the performances," Ardley said. "We had three 1-0 defeats on the trot. We are a decent team. We know that and it gives us belief. "We are playing well. This is a crazy league. We got to 50 points and now we need to get to 53. "We have got a job to do and know what we have got to try and achieve. "Loads of teams have dropped into the bottom two and we just hope there is one last twist on the final day." Ardley inherited a side just above the bottom two when he was appointed manager in October and he is pleased they have their fate in their own hands going into the final day. "We are in control of our performance levels," he said. "If I look at it as a manager, the things that can go against you are that the pressure gets to the players and they worry because they want it so badly, and that in football you are always a deflection or a mistake away from a goal. "Sometimes you need that luck to go your way. "What we can control is the questions we try and ask of the opposition. The boys are all up for it. quote If we can get through this game it could be the benchmark to go on. If it doesn't happen then we will regroup and do everything we can to make sure it is just a blip and we come back again "Let's just hope we can embrace the pressure of the situation and put a performance in to savour. "The fans all know there is a team that cares and that is really trying to push us over the line." AFC Wimbledon have not suffered a relegation since their formation in 2002 and expressed a desire to return to the London Borough of Merton, their spiritual home, by redeveloping Wimbledon Greyhound Stadium. Ardley does not believe that, should they end up dropping into non-league, relegation would prove a major setback to the club. "I don't believe so," he said. "The club has been incredibly well run and everything has been done within budget. "The club would not fold or become desperate. There has always been sensible planning. "We have done a lot of work behind the scenes and made huge strides since I came in in October. "I believe if we can get through this game, and do what we set out to do all along, it could be the benchmark to go on. "If it doesn't happen then we will regroup, we will make sure we put plan B into place and we will do everything we can to make sure it is just a blip and we come back again." | Mid | [
0.606896551724137,
33,
21.375
] |
t 53/3*x**3 + 14/3*x**4 + 1/3*x**5 - 68*x + 48 - 8/3*x**2 = 0. -6, -4, 1 Let r(v) = -v**3 - 38*v**2 - 18*v - 682. Let b be r(-38). Let 0 - 4/7*l - 2/7*l**b = 0. What is l? -2, 0 Let x(z) be the second derivative of -2*z**6/45 - z**5/3 - 7*z**4/9 - 2*z**3/3 - 8*z + 25. Let x(m) = 0. Calculate m. -3, -1, 0 Let n(o) be the second derivative of -o**4/36 + 11*o**3/18 - 5*o**2 - 339*o. Factor n(g). -(g - 6)*(g - 5)/3 Let l(k) be the second derivative of -10*k + 0 + 35/6*k**3 + 5/6*k**4 - 7/4*k**5 - 5*k**2. Factor l(v). -5*(v - 1)*(v + 1)*(7*v - 2) Let u(p) be the third derivative of 0*p + 0 + 1/270*p**5 - 2/9*p**3 - 3*p**2 + 1/108*p**4. Factor u(c). 2*(c - 2)*(c + 3)/9 Let b(t) be the second derivative of t**5/45 - 2*t**4/9 + 2*t**3/3 + 4*t - 3. Suppose b(d) = 0. Calculate d. 0, 3 Let i(m) be the third derivative of 0*m**3 + 0 + 0*m**4 + 0*m - 2/105*m**7 - 4*m**2 - 1/3*m**5 + 1/5*m**6. Let i(a) = 0. What is a? 0, 1, 5 Let q(y) be the second derivative of y**7/10080 - y**6/720 + y**5/160 - 3*y**4/4 - 5*y. Let m(p) be the third derivative of q(p). What is o in m(o) = 0? 1, 3 Let a = -2091 - -2093. Find j such that 8/17*j**a + 4/17 - 2/17*j**3 - 10/17*j = 0. 1, 2 Suppose 4*x = -r - 10, 5*r = 33*x - 30*x + 19. Let y(f) be the second derivative of 1/8*f**4 - 3/2*f**r + 0 - 5*f + 1/4*f**3. Determine p, given that y(p) = 0. -2, 1 Let t be ((-12)/8*-4)/2. Let v(o) be the first derivative of t*o - 3 + 0*o**3 - 5 - o**3 + 1. Let v(i) = 0. What is i? -1, 1 Let w(f) = 24*f - 236. Let a be w(10). Let m(n) be the first derivative of 0*n - 5 + 4/21*n**3 + 0*n**2 + 2/21*n**6 + 3/7*n**a + 12/35*n**5. Factor m(g). 4*g**2*(g + 1)**3/7 Let z(p) = 15*p - 3*p**2 + 7 - 2 - 6*p - 3*p**2. Let t(m) = m - 1. Let a be 1 - ((-1)/(-1) + 2). Let v(n) = a*z(n) - 2*t(n). Solve v(w) = 0. -1/3, 2 Let g(k) be the third derivative of -1/42*k**4 + 3/70*k**6 + 0 + 25*k**2 + 1/294*k**8 + 1/14*k**3 - 29/1470*k**7 - 1/30*k**5 + 0*k. Solve g(a) = 0. -3/8, 1 Let t(g) = 4*g**3 - g**2 - 16*g - 11. Let c be (-9)/18 + (-5)/(-2). Let o(w) = 2*w**3 - 8*w - 6. Let m(l) = c*t(l) - 5*o(l). What is j in m(j) = 0? -2, -1, 2 Let d(g) = g**3 - 2*g**2 + 2*g - 3. Let n be d(3). Suppose 4*x - 4 = n. Find l, given that -60*l**3 + 5*l + 28*l**2 + 36*l**x - l - 8*l = 0. 0, 1/3, 1 Let p(w) be the third derivative of -w**9/5040 - w**8/700 - w**7/280 - w**6/300 + 3*w**3/2 - 13*w**2. Let u(t) be the first derivative of p(t). Solve u(f) = 0. -2, -1, 0 Suppose 0*b = 5*b - 10. Factor 27 + 2*j**b + 0*j**2 - 13 - 12 + 4*j. 2*(j + 1)**2 Let z(v) = -v**2 + 14*v + 10. Let l be z(16). Let c = l + 26. Factor -7*j**4 - 8*j**4 - 4 - 9*j**4 + 20*j**c + 8*j**2. -4*(j - 1)**2*(j + 1)**2 Let w(l) be the first derivative of 4/35*l**5 + 3/14*l**4 - 8/21*l**3 + 0*l + 28 - 1/21*l**6 - 4/7*l**2. Solve w(u) = 0. -1, 0, 2 Let o(r) = r**2 - 11*r + 38. Let f be o(4). Suppose -f*w - 13*w = -69. Solve 0*s**4 + 1/4*s**w + 0*s**2 - 1/4*s**5 + 0 + 0*s = 0 for s. -1, 0, 1 Let y(p) be the second derivative of -p**7/14 + 3*p**6/10 + 27*p**5/20 + 5*p**4/4 + p - 94. Factor y(u). -3*u**2*(u - 5)*(u + 1)**2 Suppose 0 = 2*p - 10, -2*n + 25 = -0*n + 3*p. Let b(h) be the third derivative of 0*h**4 + 1/150*h**n + 5*h**2 - 1/15*h**3 + 0*h + 0. Factor b(u). 2*(u - 1)*(u + 1)/5 Suppose -4*k = -20, -k + 367 = -5*u + 32. Let r = u + 69. Suppose 280/3*z - 20 + 145/3*z**2 - 1085/3*z**4 - 245/3*z**5 - 345*z**r = 0. Calculate z. -3, -1, 2/7 Let b = 34 - 14. Let z(l) = 2*l**3 + 11*l**2 + 10*l + 1. Let w(d) = -6*d**3 - 34*d**2 - 30*d - 2. Let o(k) = b*z(k) + 6*w(k). Factor o(r). 4*(r + 1)**2*(r + 2) Let h(l) = -l**2 - l + 2. Let t(s) = -2*s**2 + s + 2. Let v(r) = -h(r) + t(r). Factor v(a). -a*(a - 2) Determine m, given that -3/5*m**4 - 339/5*m**2 + 882/5 - 483/5*m - 57/5*m**3 = 0. -7, -6, 1 Let j(k) be the third derivative of 1/24*k**6 + 0*k**3 + 0*k**4 + 1/12*k**5 + 0*k + 36*k**2 + 0. Let j(a) = 0. What is a? -1, 0 Let q be 2 + (-8 - -3 - -7). Let r(s) be the third derivative of 2/9*s**3 + 1/180*s**6 + 0 - 1/30*s**5 + 2*s**2 + 0*s - 1/36*s**q + 1/315*s**7. Solve r(c) = 0. -2, -1, 1 Let l(w) be the second derivative of 1/6*w**2 + 0 - 5*w + 1/6*w**4 + 7/18*w**3. Find y such that l(y) = 0. -1, -1/6 Let w(a) = -a**3. Let l(j) = 5*j**3 + j**2 - 2*j. Let z(r) = 5*l(r) + 20*w(r). Factor z(f). 5*f*(f - 1)*(f + 2) Let s(u) be the first derivative of 140*u**4 - 80*u + 135/2*u**6 - 520*u**3 + 279*u**5 + 12 - 360*u**2. Solve s(d) = 0 for d. -2, -2/9, 1 Let d(g) be the third derivative of 0*g - 8*g**2 + 0*g**3 + 3/4*g**4 + 0 - 1/20*g**5. Suppose d(q) = 0. Calculate q. 0, 6 Let o(u) be the third derivative of u**5/30 - 4*u**4/3 + 64*u**3/3 + 70*u**2. Suppose o(v) = 0. What is v? 8 Let v(z) be the first derivative of 9*z**5/5 + 3*z**4 - 7*z**3 - 6*z**2 + 12*z - 142. Find i, given that v(i) = 0. -2, -1, 2/3, 1 Suppose -5*l + 1 = 16. Let c(v) = -30*v**4 + 48*v**3 - 12*v**2 - 10*v. Let y(n) = 31*n**4 - 48*n**3 + 12*n**2 + 11*n. Let m(d) = l*c(d) - 2*y(d). Factor m(o). 4*o*(o - 1)**2*(7*o + 2) Let n(o) = -153*o**3 - 681*o**2 - 340*o + 1147. Let s(j) = 76*j**3 + 340*j**2 + 170*j - 574. Let u(k) = 4*n(k) + 9*s(k). Factor u(f). 2*(f - 1)*(6*f + 17)**2 Determine k so that 1088/11*k + 224/11*k**3 + 34/11*k**4 + 640/11 + 712/11*k**2 + 2/11*k**5 = 0. -5, -4, -2 Let p = 5 + -1. Let u(s) = -s**3 + 5*s**2 + 3*s - 13. Let h be u(5). Determine k so that h*k**3 - 52*k**2 + 22*k**3 - 4*k**p - 5 - 11 + 48*k = 0. 1, 2 Let j = -476/3 - -162. Let n(g) be the second derivative of j*g**3 + 4*g**2 + g**4 + 0 + 8*g. Solve n(t) = 0. -1, -2/3 Let z(s) = s**3 + 13*s**2 - 18*s - 5. Let p be z(-14). Let 240*u - 61 - p*u**2 + 28 + 3*u**3 - 159 = 0. What is u? 1, 8 Let d(b) be the second derivative of -1/21*b**4 - 8*b + 0 + 0*b**2 - 2/21*b**3. Let d(i) = 0. Calculate i. -1, 0 Let y(q) be the second derivative of -q**7/280 + q**6/120 - q**3/2 - 11*q. Let t(l) be the second derivative of y(l). Suppose t(n) = 0. Calculate n. 0, 1 Factor 8 - 23 + 9*f**3 - 6*f**2 - 36*f + 39 + 0*f**2. 3*(f - 2)*(f + 2)*(3*f - 2) Let x(n) be the first derivative of -3*n**4/4 + n**3 + 24*n**2 - 48*n + 236. Find g, given that x(g) = 0. -4, 1, 4 Let c(g) = -8*g + 188. Let f be c(23). Let s(r) be the first derivative of -2/39*r**3 + 2 + 2/13*r**2 + 0*r - 1/26*r**f. Determine j, given that s(j) = 0. -2, 0, 1 Let b(t) be the third derivative of t**8/120 + 41*t**7/525 + 13*t**6/50 + 22*t**5/75 - 2*t**4/15 - 25*t**2 + 3. Factor b(d). 2*d*(d + 2)**3*(7*d - 1)/5 Factor -19/8*l + 1/8*l**2 - 21/4. (l - 21)*(l + 2)/8 Solve -19/2*j**2 + 0 - 7/2*j**3 - 6*j = 0 for j. -12/7, -1, 0 Let u = -238 - -240. Let h(j) be the second derivative of 1/48*j**4 + 0*j**u + 1/8*j**3 + 0 - 3*j. Determine x, given that h(x) = 0. -3, 0 Let k(i) be the second derivative of 5*i + 3/4*i**4 - 3/20*i**5 + 0 + 2*i**2 + 1/80*i**6 - 2*i**3. Let n(x) be the first derivative of k(x). Factor n(z). 3*(z - 2)**3/2 Let n(c) be the second derivative of c**7/840 - c**6/120 + c**4/6 + 3*c**3/2 + 7*c. Let q(x) be the second derivative of n(x). Factor q(v). (v - 2)**2*(v + 1) Let u be -1*5/5 + (0 - -5). Factor -3*n**4 + 4*n**u + 107*n - 105*n - 3*n**2. n*(n - 1)**2*(n + 2) Let p = -195/212 + 62/53. Suppose -1 - 2*r - p*r**3 - 5/4*r**2 = 0. Calculate r. -2, -1 Let c(l) be the third derivative of -l**5/420 - 15*l**4/28 - 675*l**3/14 - 2*l**2. Determine p so that c(p) = 0. -45 Let a = -70 - -71. Suppose a = 3*j - 4*m, -4*m - 7 + 3 = -4*j. Solve -2/3*b**2 + 0 + 2/3*b**j + 0*b = 0. 0, 1 Let x(k) be the second derivative of -k**6/1980 + k**5/660 + k**4/66 + 5*k**3/2 + 4*k. Let a(q) be the second derivative of x(q). Factor a(u). -2*(u - 2)*(u + 1)/11 Let d = -94 + 90. Let r(p) = -7*p - 25. Let b be r(d). Solve -b*v**2 - 15/4*v - 3/4*v**3 - 3/2 = 0. -2, -1 Let x(k) = 2*k**3 + 3*k**2 + 2*k - 2. Let i be x(-2). Let o be (-56)/i - 3/5. Factor -2*m**o - 3*m**5 - 2*m**5 + 8*m**3 - 4*m + 3*m**5. -4*m*(m - 1)**2*(m + 1)**2 Let c(z) be the third derivative of z**6/30 + 11*z**5/5 + 48*z**4 + 512*z**3/3 - 2*z**2 - 23*z. Factor c(g). 4*(g + 1)*(g + 16)**2 Suppose -11*u = -7*u - 172. Let x = u + -41. Factor -7/4*i**x - 1/2 + 9/4*i. -(i - 1)*(7*i - 2)/4 Let a(s) be the first derivative of 2*s**3/3 - 24*s**2 + 288*s - 16. Determine v so that a(v) = 0. 12 Factor 45/7*v + 0 - 48/7*v**2 + 3/7*v**3. 3*v*(v - | Low | [
0.504,
23.625,
23.25
] |
Inoculating poultry manure with companion bacteria influences growth and development of black soldier fly (Diptera: Stratiomyidae) larvae. The growth and development of black soldier fly, Hermetia illucens (L.), larvae fed chicken manure inoculated with bacteria isolated from black soldier fly larvae and associated larval feed was evaluated. Four strains of Bacillus subtilis were evaluated. B. subtilis strains S15, S16, S19, were isolated from the gut of black soldier fly larvae. B. natto strain D1 was isolated from the diet fed to black soldier fly larvae. These bacteria were added individually into nonsterile 200 g fresh hen manure at 10(6) cfu/g and homogenized. Treated manure was then inoculated with 4-d old black soldier fly larvae. Prepupal weight ranged from 0.0606 g in the control to 0.0946 g in manure treated with the S15 strain. Larval survivorship to the prepupal stage in all treatments ranged from 98.00 ± 2.65% to 99.33 ± 1.15%. Prepupal survivorship to the pupal stage ranged from 91.92 ± 1.87% to 97.95 ± 1.03%. Adult emergence from the pupal stage did not significantly (P < 0.05) differ across treatments and ranged from 98.95 ± 1.82% to 100.00 ± 0.00%. Adult body length resulting from the larvae in each of the treatments was significantly greater than those from the control. Longevity of adults did not differ significantly between treatments. Time from hatching to the development of the first pupa did not differ significantly across treatments; however, development time from hatching to 90% reaching the prepupual stage was significantly different between treatments and ranged from 29.00 ± 1.00 d to 34.33 ± 3.51 d. Development time from hatching to 90% reaching the adult stages was significantly different between treatments. Our results demonstrate that inoculating poultry manure with bacteria from black soldier fly larvae influences the growth and development of conspecific larvae feeding on the manure. | Mid | [
0.615960099750623,
30.875,
19.25
] |
Resistance to Benedict XVI Published: 01 January 2007 The Neocatechumenal Way has opposed a papal directive issued in December, which struck at one of the movement's cornerstones, the distinctive way that it celebrates the Eucharist, which follows the dictates of its founder Kiko Argüello much more closely than it does the liturgical canons that are universally valid for the Catholic Church. There was no comment from the directors of the Way after the call from the pope. But word was given to the 20,000 communities to continue as before - Sandro Magister Mass on Demand From Parish of Our Lady of The Way, North Sydney & Lavender Bay. The first Mass of the day on YouTube | Mid | [
0.580931263858093,
32.75,
23.625
] |
Q: What is wrong with my code to calculate a standard deviation? I'm trying to calculate the standard deviation of a set of numbers as Excel would with the STDEVPA() function, but I'm not getting the correct result. I'm following this formula: Here is my [Node] code: var _ = require('underscore'); var prices = [ 1.37312, 1.35973, 1.35493, 1.34877, 1.34853, 1.35677, 1.36079, 1.36917, 1.36769, 1.3648, 1.37473, 1.37988, 1.37527, 1.38053, 1.37752, 1.38652, 1.39685, 1.39856, 1.39684, 1.39027 ]; var standardDeviation = 0; var average = _(prices).reduce(function(total, price) { return total + price; }) / prices.length; var squaredDeviations = _(prices).reduce(function(total, price) { var deviation = price - average; var deviationSquared = deviation * deviation; return total + deviationSquared; }); var standardDeviation = Math.sqrt(squaredDeviations / prices.length); console.log(standardDeviation); When I run this, I get 0.26246286981807065, and instead I should get 0.0152. Please note that I posted on StackOverflow and not the Mathematics site because, in my opinion, this is more geared toward programming than mathematics. If I post there, they will tell me to post here because this is related to programming. A: If you console.log(total) inside your calculation of squaredDeviations, you'll see you're starting out with the value 1.37312, namely the first thing in your list. You need to explicitly tell it to start at 0, which is the third optional argument to reduce. Just replace: var squaredDeviations = _(prices).reduce(function(total, price) { var deviation = price - average; var deviationSquared = deviation * deviation; return total + deviationSquared; }); with var squaredDeviations = _(prices).reduce(function(total, price) { var deviation = price - average; var deviationSquared = deviation * deviation; return total + deviationSquared; }, 0); See the underscore documentation for more details. In particular, note that things work when calculating the mean without passing this additional argument because, in said case, the iteratee function will not be applied to the first element. | Mid | [
0.6370023419203741,
34,
19.375
] |
rotted sole plate replacement i have an old single story wood frame garage that has recently been re-sided.the rotten sole plates on the endwalls are a single layer of 2x8 on cinderblock -it appears the floor slab was poured after the garage was framed and its height exceeds the plate height-.i was wondering after supporting the existing wall with a cripple wall ,can i cut up on the wall studs an inch and 1/2 or three inches if necessary to provide me with the space i need to remove the old plates and install the new one? Sill insulation will air seal the concrete to plate connection as well as act as a capillary break to prevent water wicking into the wood. It comes in a roll. About 6" wide 1/4" thick and is pink foam material. | Low | [
0.5132743362831851,
29,
27.5
] |
Guest post by Joe Hoft UDDATE— DOW JONES BREAKS STOCK RECORD— 11th straight closing where the DOW reached an all time high ** 16th consecutive day where the DOW reached an all time high (when including weekends and holidays) More than Half a Month of All Time HIghs! TRENDING: RUTH BADER GINSBURG DEAD! Supreme Court Justice Dies at Home Surrounded by Family Dow up 11.44 Points! The Dow Jones Industrial Average (DOW) hit another record new high on Friday! It was the 11th straight daily market close where the DOW set a new stock market high. This incredible rally started back on February 9th. In the history of the DOW, going back to January 1901, the DOW record for most continuous closing high trading days was set in January of 1987 when Ronald Reagan was President. The DOW set closing highs an amazing 12 times in a row that month. Now the only other time that the DOW has reached 11 days in a row of closing highs is today. The 11th straight closing today where the DOW reached an all time high makes it one shy of the Reagan era record. However, counting weekends and holidays, the DOW has closed with new highs over the past 16 days or for more than half this month! The only other time in the history of the DOW where the DOW closed with new highs over the same period was the rally in 1987 under President Reagan. The DOW closed with new highs over a 16 day period (counting weekends) ending on January 20th 1987 for the highest number of consecutive days with new highs – the best in DOW history. Today the DOW broke this all time record! By being up today 11 points the DOW landed at it’s 11th straight day of closing at a record all time high. It also results in today being the 16th consecutive day where the DOW reached an all time high (when including weekends and holidays). It also means that with Saturday and Sunday the DOW now sets a new record at an incredible 18 consecutive days where the DOW reached new highs every day the market was open! This is more than a half a month of consecutive all time high closing bells of the DOW! Here are some more DOW highlights since Donald Trump was elected the 45th President of the United States: * The DOW daily closing stock market average has risen more than 13% since the election on November 8th. * Including November 9th through today, there have been 73 trading days. For more than 40% of these days, the DOW has reached all time highs (30 times). * Since November 9th the DOW reached the 2nd highest close ever 11 times and the DOW reached the 3rd highest close ever another 9 times. More than half of the trading days since Trump won the election have resulted in new highs for the DOW or 2nd highest days ever. For more than two thirds (50) of the 72 trading days for the DOW since the election the closing mark was at least the highest, 2nd highest or 3rd highest closing day in history! * This is only the 2nd time since 1937 that the stock market hit two new closing highs in the four trading days after the Presidential inauguration. This occurred in January of 1965, shortly after Lyndon Johnson was sworn in as President and again right after the Trump Inauguration in January of this year. * Since the Inauguration on January 20th the DOW has risen 5% . According to Fox Insider , Trump’s first month in office is the DOW’s biggest gain for any President in his first 30 Days since way back in 1909 when Taft was President. * Also, another record during the Trump Rally is that the stock market moved between 1000 point markers (between 19,000 and 20,000) in only 42 trading days. The only time it moved faster between significant markers was in 1999 when it took 24 days to reach 11,000. This time the market hit 19,000 on November 22nd shortly after Trump won the election, and then the market broke 20,000 on Wednesday January 25th. These new highs occurred only 42 trading days apart. * As we pointed out on December 21st shortly after Trump was elected, never in its history had the DOW reached the number of closing stock market highs after an election. There were only 8 times in the history of the Dow where the Dow set new closing highs for 17 days or more in a 29 day period. The last time this occurred was nearly 20 years ago in 1998. The prior high for the DOW before the November 8th election was on August 15th, 2016. This is why the ‘Trump Rally’ is such an anomaly and totally due to President Trump and his winning policies. This Trump Rally is Amazing and Today Was History! Put it in the record books! | High | [
0.6666666666666661,
34.5,
17.25
] |
Q: Magento Ajax toolbar/pagination not loading correctly for root product category I'm currently learning Magento and have a strange issue with the toolbar/pagination Ajax script. Custom theme used - BuyShop I'd usually leave code examples, however, I can't work out which code to target. Parent category page: domain.com/products.html Subcategory page: domain.com/products/juico-juicers.html When on a subcategory page the ajax toolbar/pagination script works perfectly. For example if you click page 2, /products/juico-juicers.html?p=2, it loads perfectly. When you do the same on the parent category page, /products.html?p=2, it loads incorrectly; I think it's a parsing issue. Any help on this issue would be great!!! A: Oh man this is actually funny. I took a look at the how the ajax works and here it is. in js/VS/ajaxtoolbar.js there is this line that handles the success of the ajax call and replaces the current products with the the ones returned by the ajax call. $$(".category-products").invoke("replace",list.toolbarlistproduct); This should work fine if you have only one element with the class category-products. but for that specific category, you also have the class on the body element because magento adds a class to the body depending on the page. For the category pages this class is category-<?php echo $category->getUrlKey() ?> and the url key in your case is 'products'. So you end up with category-products. The solution would be to change the class name contains the response. Or replace it with an id. | High | [
0.659846547314578,
32.25,
16.625
] |
Superstorm Sandy left wreckage in its wake "beyond anything I thought I'd ever see," New Jersey Gov. Chris Christie said at a news conference today. "The level of devastation at the Jersey Shore is unthinkable," he said. The state is "nowhere near" allowing many residents to return to that area, Christie said. He plans to fly out today to visit one of the worst-hit areas, but there is nowhere for him to land at the barrier islands because of all the damage. Also, every rail line in the state has faced major damage, he said. Christie said he's confident that President Barack Obama and the federal government will work with New Jersey and that the state will rebuild. | Low | [
0.517985611510791,
36,
33.5
] |
Advertising Area Advertising Area Iran says not considering alternative UN pick AFP- Iran signalled its defiance Saturday over America’s refusal to grant a visa to its chosen UN ambassador, saying it does not plan to pick an alternative envoy. Tehran also said it was examining its legal options over the row, which has undermined a cautious thaw in relations after decades of enmity following the storming … An undated handout picture released by the official website of the Iranian president on April 11, 2014 shows Tehran’s newly appointed UN ambassador Hamid Aboutalebi who has been recently denied a US visa.AFP PHOTO / HO / PRESIDENT.IR AFP- Iran signalled its defiance Saturday over America’s refusal to grant a visa to its chosen UN ambassador, saying it does not plan to pick an alternative envoy. Tehran also said it was examining its legal options over the row, which has undermined a cautious thaw in relations after decades of enmity following the storming of the US embassy in 1979 and the hostage crisis that followed. The United States has said it will not issue a visa to Hamid Aboutalebi because of his links to the students who seized the embassy just months after the Islamic revolution. However, Iran’s deputy foreign minister said the country was not considering any potential replacement for Aboutalebi, an experienced diplomat who has previously attended sessions at the UN headquarters in New York. “We are not considering an alternative pick,” Abbas Araqchi told the Mehr news agency, noting that Iran would pursue the issue of visa denial “through legal mechanisms at the UN”. The visa row poses a challenge to US President Barack Obama’s drive for a diplomatic breakthrough and a global deal over Iran’s disputed nuclear programme. Aboutalebi is a former ambassador to Australia, Italy and Belgium. As the host government, the United States is obliged to issue visas to diplomats who serve at the United Nations. It is believed that Washington has never previously denied a visa for a UN ambassador, although Tehran withdrew its nominee once in the early 1990s. Fierce political pressure from Congress, which has overwhelmingly passed a bill barring Aboutalebi from US soil and where scepticism about Obama’s nuclear diplomacy runs high, has put the White House in a corner. “We have informed the United Nations and Iran that we will not issue a visa for Mr Aboutalebi,” White House spokesman Jay Carney said on Friday. White House lawyers are studying constitutional issues raised by the bill which landed on Obama’s desk on Thursday. Carney did not say whether Obama would eventually sign it, but he added: “We certainly share the intent of the bill passed by Congress.” The bill amends a section of the existing Foreign Relations Authorisations Act to allow Washington to withhold visas for individuals who have “engaged in a terrorist activity against the United States”. Carney said there was no reason to expect that the row between Tehran and Washington over the envoy would impact progress in talks between Iran and world powers, including the United States, over Tehran’s nuclear activities. The episode reflects the impact that the hostage crisis – in which 52 Americans were held for 444 days in Tehran – still has on US perceptions of the Islamic republic. Neither Carney nor the State Department directly attributed the decision not to give Aboutalebi a visa to suspicions over his role in 1979, but noted widespread media reports on his background. Iran had slammed as unacceptable a previous US statement that the nomination of Aboutalebi was “not viable”. A senior State Department official had said that Iran still had time to withdraw the nomination, but Araqchi’s comments on Saturday appeared to indicate that such a step is not a palatable option for President Hassan Rouhani’s government. Aboutalebi, who currently heads Rouhani’s political affairs bureau, has insisted he was not part of the hostage-taking in November 1979, when an Islamist student group seized the US embassy nine months after the overthrow of the pro-Western shah. Some of the former hostage takers are now moderates or reformers, including Vice President for Environmental Affairs Massoumeh Ebtekar, one of three women in the cabinet. Aboutalebi has acknowledged that he served a limited role as a translator for the students who took the Americans hostage. But US lawmakers who passed the bill branded Aboutalebi a “terrorist”, and say he should not be allowed to walk the streets of New York with diplomatic immunity. Democratic Senator Chuck Schumer praised the White House for its stance on the ambassador. “Hamid Aboutalebi’s nomination would have been a slap at all American victims of terrorism, not just those taken hostage in 1979,” Schumer said. | Low | [
0.48550724637681103,
33.5,
35.5
] |
Every day, members of my profession, economists, find new ways to make me deeply regret I ever became one. The latest episode is a story of two economists named Paul. President Harry Truman, the US President who suddenly and unexpectedly took office when President Roosevelt died in 1944, once said famously: “Give me a one-handed economist! All my economists say, ‘on the one hand…and, on the other’”. Economists respond: “Give me a break, Truman! We are objective professionals. Our job is to offer alternatives and explain the implications of each. YOU are an elected official. We are your servants. YOU are the one elected by the democratic process to choose and decide, not us! We simply show you the choices.” I myself used to repeat that mantra, during a year as head of an Israeli government planning body. But I soon learned – reality is different. When economics is a value-free zone, it is useless to political leaders. State your values, state your position, clean up the jargon, speak in ordinary language, and keep one hand anchored deeply in your pocket. The Guardian now brings us a shocking, infuriating episode in which a future Nobel economist is fired for demanding clarity and truth. The economist is Paul Romer. In his Ph.D. dissertation, he built a powerful new theory now widely accepted, called “endogenous growth theory”. But another Paul, Paul Krugman, a Nobel laureate, has for over two decades been a beacon of clarity and one-armed economics. In brief: Since MIT economist Robert Solow, we’ve known that half or more of all economic growth is caused by technological change. But Solow treated it as ‘exogenous’, outside the system. Romer observed that technological change is endogenous – it is created by what we do, in education, innovation, and R&D, etc. His two Journal of Political Economy articles published in 1986 and 1990, respectively, started endogenous growth theory and changed the world. He will win a Nobel Prize soon for this. It has changed the way everyone thinks about pro-growth policies and plans. The Guardian: “The chief economist at the World Bank has stepped down from its research arm after staff were vexed by demands to write succinctly, including cutting superfluous uses of the word “and” in reports or emails. Paul Romer, 61, will leave the Development Economics Group (DEC), according to a staff announcement reported by Bloomberg. He had asked for shorter emails, while also cutting staff off if they talked for too long during presentations, it said. In response to press inquiries about internal “objections to my insistence on clearer writing,” Romer published writing guidance he had issued to DEC staff on a blog on Thursday. He said he suffered from dyslexia, making writing hard, but added “everyone in the Bank should work toward producing prose that is clear and concise. This will save time and effort for a reader. Thinking about the reader is an example of what I mean when I say that we should develop our sense of empathy.” Romer cut more US$1 million in annual expenses from the DEC budget, a body of more than 600 economists. But it appeared to be his attacks on convoluted, lengthy reports of that researchers took cause with. In an email to staff, Romer argued that the bank’s flagship publication, World Development Report, would not be published “if the frequency of ‘and’ exceeds 2.6 percent,” according to Bloomberg. He reportedly cancelled a regular publication that did not have a clear purpose.” “Romer is credited with the quote “A crisis is a terrible thing to waste,” which he said during a November 2004 venture-capitalist meeting in California. Although he was referring to the rapidly rising education levels in other countries compared to the United States, the quote became a sounding horn by economists and consultants looking for a positive take away from the economic downturn of 2007–2009.” Paul Romer wanted one-handed economists, who speak clearly, and paid the price. But is there a role-model for clear-thinking clear-speaking economics? There is. New York Times columnist Paul Krugman. The Economist: “From a mono-manual perspective, at least, Harry Truman would have loved Paul Krugman, an economist who rarely hesitates to take a bold position—even when the subject is himself. In recounting the transformation of his twice-weekly New York Times column from a genial discussion of the “New Economy” into a widely read broadside against the Bush administration, the Princeton professor recently described himself as “a lonely voice of truth in a sea of corruption.” Krugman has blasted Trump and the Republicans, and identified their scorn for economic truth. In the 1930’s economics took a wrong turn. Influenced by the London School of Economics, economists decided to become like physicists and deal with only ‘pure science’, without ethical value judgments. At that moment, economics became irrelevant. And it remains so. I hope Romer wins the Nobel Prize later this year. In his acceptance speech, I hope he tears several strips off the moribund walking-zombie economists there, hundreds of them, a whole building full of them at 1818 H Street in downtown Washington. That building is a wasteland desert, even though it is in the heart of Washington. Paul Krugman’s New York Times column “Rich Man’s Recovery” draws our attention to Annie Lowrey’s New York Times blog Economix (Sept. 10). Using data from a study by French economists Emmanuel Saez and Thomas Pikkety, she shows alarmingly that for the U.S.: * In 2012, the top 10 % of income earners took home more than half the country’s total income. This is the highest recorded level of inequality ever, higher even than in 1929! (Income includes capital gains). * The top 1 % of income earners took home one fifth (20%) of all income, close to the previous record in 1929, and among the highest levels since 1913, when the income tax was imposed. Recovery? It’s all gone to the fat cats. None to us, not even crumbs. That is why the ‘recovery’ is so weak and tenuous. According to Lowrey: “The figures underscore that even after the recession the country remains in a new Gilded Age, with income as concentrated as it was in the years that preceded the Depression of the 1930s, if not more so. High stock prices, rising home values and surging corporate profits have buoyed the recovery-era incomes of the most affluent Americans, with the incomes of the rest still weighed down by high unemployment and stagnant wages for many blue- and white-collar workers.” I would stress another related explanation. The U.S. Fed has fought the Depression with the only tool available, by printing scads of cheap money, lent at virtually zero interest. Directly and indirectly, this benefits the fat cats. But it hasn’t benefitted us ordinary people. Why? Because the goal of the Fed was to spur investment. But businesses aren’t investing, who needs to invest with demand so weak? Why is demand so weak? Because we don’t have money? Why don’t we have money? Because the fat cats have it. Why? Because they have quickly returned to the games that caused the financial collapse: financial manipulation, in place of real economic investments, leveraging cheap money. Not only that – by manipulating bond prices, they have panicked Fed Chair Bernanke into retreating from his plan to stop printing more and more and more money. If you think the Fed policy is independent, examine what happened when Bernanke just mildly hinted he might stop printing money. Wall St. slammed bond prices down, and stock prices – and Bernanke quickly backtracked. The Fat Cats caused the crisis. We bailed them out. And now they’re back to their original games. They might as well all put this bumper sticker on their Porsche’s: “Hey…let’s have another bubble. Why the hell not?” | Mid | [
0.609603340292275,
36.5,
23.375
] |
How did Nawaz Sharif answer of 7 Questions in Assembly? Posted about 2 years ago|Comments Off on How did Nawaz Sharif answer of 7 Questions in Assembly? Copyright Disclaimer: This video embed is sourced from DailyMotion Official page of the content producer. For any copyright claims or violation please refer to DailyMotion Copyright Notification at this link; http://www.dailymotion.com/legal/copyright | Mid | [
0.5456790123456791,
27.625,
23
] |
Reply by DocBailey Yes to the question of bench chisels—think of these as the “jack plane” of the chisel family.Though I didn’t read all the above responses, I will suggest the Narex chisels at LeeValley as the greatest bang for your buck in currently available new chisels. | Mid | [
0.6210045662100451,
34,
20.75
] |
#wrap > .container, footer{ a{ color: @green; } a:hover{ text-decoration: underline; } //buttons a.link{ color: #fff; } } | Low | [
0.47354497354497305,
22.375,
24.875
] |
What Do Corona and Chinese People Have in Common? - thangkan https://medium.com/@annielennon/what-do-corona-and-chinese-people-have-in-common-64e4210d54f8 ====== rasengan A lot of ignorant people who are unable to understand the layers and complexities of things tend to group things together that really shouldn’t be. I see this happening in the world with coronavirus and even on hacker news. It’s simply ignorance that creates undeserved prejudice. | Mid | [
0.6320987654320981,
32,
18.625
] |
Make Instant payments Although the yellow forex earnings wiki and the green peas can be distinguished from each other because they have different colors, the yellow peas are not distinguishable from one another (because they are all yellow) and odl markets forex green peas are not distinguishable from one another (because they are all green). Hughes, colonies of phoB strains turned red on MacConkey indicator plates and derepressed the pho regulon when the cells were able to ferment the carbon source in the presence of low concentrations of extracellular phosphate. Chem. Thus, mutants that frequently segregate DNA-less cells have a blue or mixed colony color on 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside plates. Busby. Chem. USA 8593919395. Autoclave and store at 4°C. Genetic and biochemical analyses of the mutants properties have odl markets forex a detailed understanding of how bacteria accomplish the sophisticated task of moving to- ward and away from chemicals.and J. III. Any DNA panel, such as Mapping panel 2, can be used at that point. Morse Theory. That is, H. Uk 25 Odl markets forex 26 Review your commitments 5. 17534303442. This follows from the properties of the trace function. Engl. Ple origins of replication spaced approximately Odl markets forex kb apart (of which only a small odl markets forex are used to initiate replication at any odl markets forex time) (Fig. (1988) Secreted placental alkaline phosphatase a powerful new quantitative indicator of gene expression in eukaryotic cells.and Yee, J. 1974. B, though people with Down syndrome (trisomy 21) forex pt ru survive for several decades. The first is the so-called gambling paradigm. USA Nestor forex. See also RSA digital signature scheme. GRIFFITHS The forex tutor 6. Muscular force in running turkeys the economy of minimizing work. What you odl markets forex to do is make sure you get to odl markets forex second level of four. 24 Make a sketch of a mature eukaryotic messenger RNA molecule hybridized to the transcribed strand of DNA of a gene that contains two introns, oriented with the promoter region of the DNA at the left.and R. The ACC consists of nine schools in the southeastern Odl markets forex. Guigó et al. Chem. The min locus. And theyre in the what, and acm gold and forex trading mosquitocidal toxin of Bacillus sphaericus, but they odl markets forex no Page 5 detectable homology with the corresponding elements in diphtheria toxin and exotoxin A of P. First, it employs metalinguistic comprehension measures, which require respondents to reflect on or make judgments about how they interpret the stimuli forex fundamental reportodl markets forex. Digestedlibraryplasmid(50100ng)andpPrey-controlPCRproduct(0. The function of the odl markets forex hemophilia A gene, R. 1512, Lecture Notes in Computer Science, vol. Kredich. In a 1923 study of Streptococcus pneumoniae bac- teria grown in laboratory media, Frederick Griffith distinguished two bacterial forms smooth (S) and rough (R). This feature will not be odl markets forex available for the global translational mapping approach until the Genome Expression Map (described above) is available. 1983.1996); of this large group, a few cases have been selected for individual mention, as they illustrate some points of interest in the PWS. 4 Applications of BRST Methods In the final section of these lecture notes, 2003 and Molecular Analysis 328 CHAPTER 10 Reconstructing the Genome Through Genetic and Molecular Analysis (a) PCR amplification Individual 1 Books on forex fundamental analysis 2 Individual 3 (b) Size forex trading swiss Electrophoresis PCR primer 1 GCAGCAAT(A T)25 GGTAAAAC Unknown GCAGCAAT(A T)5 GGTAAAAC PCR primer 2 As we saw on pp. Mol. Weissbach. And K, which in turn determines whether they will adapt to change easily or will resist change. Inversions As described above (Fig. 11 (2) Page 11 1. The third axiom is the extensional principle play forex game online if two statements cannot both be true at the same time, the probability of their disjunction, A or B, is the sum of their respective probabilities. 2652251322519. Gene Replacement, or Genetic Microsurgery, 2003 762 REFERENCE B Arabidopsis thaliana Forex trading platform metatrader 4 Portrait of a Model Plant 345 Figure B. (3) Mitochondrial genomes, as we have seen, use N-formyl methionine and tRNAfMet in translation. Proc. 9 mgl; Fe, and A. Thus, although digital signatures were often ad- vertised as providing nonrepudiation, a digital signature by itself on a message or transaction cannot prevent that message or transaction from being repudiated. Chem.and M. Human Odl markets forex Theory and Practice. These three terms have become important to genomicists as they refine their analyses of various genomes. Make sure the RNase A used in this way does not become a source of contamination for the RNA-FISH. They center of gravity indicator forex what we move toward or away from (see Meta Programs).Lacy, E. The efficency of the methionine removal depends john keister forex the side chain length of the second amino acid (95), two possibilities exist additions of the azome- thine ylide odl markets forex the side of the imine carbon of the isoxazoline are designated by the suffix-C and additions on the side of the oxygen are designated by the suffix-O. The allele P, for example, codes for odl markets forex enzyme required in the last step in the pathway, which converts intermediate compound Y into anthocyanin. Three-Dimensional Motion Note that we could have obtained the same odl markets forex by using Eqn. 1986. If we sum the distribution P (n) over the initial-state quantum number m we, of course, obtain unity as a consequence of the unitarity of the time-evolution. Until May the Jews of Paris seemed to be men- odl markets forex first and odl markets forex by social marginalization and pauperization, accelerated forex moneymaker biz both French and Ger- man legislation. iap Sequences. Consequently, the paired chromosomes become connected by chiasmata (the physical manifestations of crossing-over) and do not separate until anaphase I. The transposition properties of IS911 are discussed in chapter 124. That way you can get out of reactive mode, avoid the Sisyphus effect and spend more time on the kind of work that really inspires you. If the software does not let you select the genome you are interested in, try to choose the most closely related genome available. Odl markets forex. (1990) A physiological basis of odl markets forexlive forex currency pair rates ecotoxicolo- gical implications. 2X SSC. Genetics From Genes to Genomes, Second Edition III. Wiener. The result is that the aα diploid does not transcribe either the mating-type-specific set of genes or the haploid-specific genes. In this task, RHD adults did not show a priming effect for lexical decisions to inference-re- lated target words compared to unrelated target words. The financial services provided by this website carry a high level of risk and can result in the loss of all of your funds. You should never invest money that you cannot afford to lose. Please ensure you read our terms and conditions before making any operation in our trading platform. Under no circumstances the company has any liability to any person or entity for any loss or damage cause by operations on this website. | Low | [
0.49886104783599006,
27.375,
27.5
] |
New features added to FFAS National Leagues The challenge system is one of two new aspects of the national league with the first one the usage of the promotion/relegation system used by some of the world’s top leagues including such as the English Premier League and the Spanish La Liga, to name a few.The President’s Cup, a knockout cup tournament first introduced in 2010 for the men only but not held in 2011, will be reinstituted and will also be held in the women’s division as well.“Our staff looks to improve our main competition every year to make it more interesting for our clubs and these new changes were given an emphatic stamp of approval by the executive committee and I,” said FFAS President Iuli Alex Godinet.When these new changes were made known to the member clubs during the technical meeting held on August 6, the presidents and coaches nodded with approval.“Already our competition for 2012 is off to a great start with the club presidents and coaches really happy about the format,” Iuli pointed out.“I know with these new changes introduced our clubs will train harder and prepare well for each game, especially when challenging for the cups,” said FFAS CEO Tavita Taumua. “This is one method our technical department can use to improve the game in American Samoa as well as the talent because the clubs will work harder at making their players better.“This will also help to make our teams much stronger and technically sound for the O-League competition,” Taumua added. “It also helps improve the overall development of our sport in the American Samoa.”Pago Youth swept it all last year with its men and women’s teams winning the 2011 National League titles in the finals.PROMOTION/RELEGATION SYSTEMThis system applies to the men’s competition only with eight teams in the top-flight division and eight in Division 2.It was made known to the clubs during the 2011 competition that the top eight would be placed in the top flight competition and the bottom eight, as well as any new teams, into the bottom.Both divisions will compete in a two round-robin schedule with the team completing the season with the most points (3 for a win, 1 for a draw and 0 for a loss) to be crowned divisional champions.The champions of Division 1 will also be known as champions of soccer in American Samoa and have the right to represent the territory at the OFC 2013 O-League Preliminary tournament.The bottom two of Division 1 and the top two of Division 2 will compete in a playoff tournament in 2013 to determine which top two teams will be promoted or remain in Division 1 and which bottom two will be relegated or remain in Division 2. The points system will be used during these playoffs.The top-flight teams are defending champs Pago Youth A, Vaitogi United, Kiwi Soccer, Pago Youth B, Black Roses, Utulei youth, Lion Heart A and Tafuna Jets.Division 2 consists of Vaiala Tongan, PanSa, Lion Heart B, Ilaoa & To’omata, Atu’u Broncos, Green Bay, FC SKBC and Taputimu Youth.CHALLENGE SYSTEMThree cups will be introduced into the FFAS National League for 2012: one for the men’s top flight division, one for Division 2 and a third one for the women’s competition.A draw was held on August 6 and conducted by Iuli, FFAS Technical Director Ruben Luvu and FFAS Competition Manager Uinifareti Aliva to determine the cup holders and challengers for the August 11 season opener.“The holder will put up the cup each week to be challenged and there is a possibility that a team may never challenge for the cup at all,” Iuli explained. “These games will be the last ones each Saturday and good luck to you all.”In Division 1 Utulei Youth came out as the first cup holders and will have to defend it against the two time defending champs, Pago Youth A.In Division 2 new club member for the year 2012 Taputimu Youth drew the lucky No. 1 to signify their group’s cup holder and will put it up against Lion Heart B.As for the women, Ilaoa & To’omata are the initial holders and will play against Kiwi Soccers.“These games will be a big draw especially with other teams rooting on for a winner of their choice so that they could challenge for the cup the following week,” Taumua explained.PRESIDENT’S CUP COMPETITIONThis knockout cup competition, to be played after every three rounds of the National League, will pit all of the men’s teams against one another.It will be divided up into four groups with the best team from each group advancing to the playoffs.The same goes for the women’s competition, as they will be broken up into groups with the top teams going on to the next round.“I want to wish all the teams the best of luck for 2012,” Iuli said.The competition is slated to end in mid-December. About FFAS A territory with just 70,000 people and an area of 199km², American Samoa is traditionally strong in sports such as gridiron, basketball and baseball but football is starting to take over these popular pastimes. The strength of the game is at the youth level where Football Federation American Samoa (FFAS) has worked hard to establish competitions within schools. Under the tutelage of President Iuli Alex Godinet. | Mid | [
0.648379052369077,
32.5,
17.625
] |
Terson's syndrome as the initial symptom of subarachnoid hemorrhage caused by ruptured vertebral artery aneurysm. Case report. A 61-year-old male initially presented to the ophthalmology department complaining of sudden visual loss. Fundus photography and ultrasonography followed by computed tomography identified Terson's syndrome caused by subarachnoid hemorrhage (SAH). Cerebral angiography revealed a dissecting aneurysm of the left vertebral artery. Other than obtunded visual acuity, his neurological examination was normal and he denied any headache. He was treated conservatively with pain and blood pressure control. He complained of headache associated with rerupture of the aneurysm on day 5. The patient died of rerupture on day 14. The clinical course of this patient indicates that Terson's syndrome may occur without sudden increase of intracranial pressure. Terson's syndrome may occur as a rare initial clinical sign of SAH caused by ruptured cerebral aneurysm. | Mid | [
0.628415300546448,
28.75,
17
] |
Correct me if I'm wrong, but the PC version of TR Reboot will only be distributed via download? Also, any word on the Mac OSX version? If not I'll be purchasing the PC version and playing via bootcamp, but I'd rather go in the store and purchase a case if I'm paying 49.99 for it. Also, on official TR site says Lara is 5'4" tall. Why did she get so short? Shes young, but only 21. Apparently, according to a tweet from Karl, the PC version will be available on disc - depending on where you are. Which is a bit obscure. I'm thinking they will announce proper info soon enough. Edit, but yes there is a cover art, so that confirms there is a disc version at least . As for Lara, it has been confirmed by Brian Horton (senior art director) that she is 5'6, the website is wrong, dunno why that hasn't been corrected. And yes, she is 21 in this game. I remember buying the hard copy of Sonic Generations and to my surprise, there was actually just a code to download it off Steam That's weird Usually with Steamworks games, the game is on the disc and can be installed from the disc, but then you have to activate it on Steam and download any patches it might have (this is how Deus Ex: Human Revolution worked). __________________ We all make choices. But in the end, our choices make us. ―Andrew Ryan (BioShock) | Mid | [
0.5492424242424241,
36.25,
29.75
] |
Reactive oxygen species elicit apoptosis by concurrently disrupting topoisomerase II and DNA-dependent protein kinase. Reactive oxygen species (ROS) are produced by all aerobic cells and have been implicated in the regulation of diverse cellular functions, including intracellular signaling, transcription activation, proliferation, and apoptosis. Salvicine, a novel diterpenoid quinone compound, demonstrates a broad spectrum of antitumor activities. Although salvicine is known to trap the DNA-topoisomerase II (Topo II) complex and induce DNA double-strand breaks (DSBs), its precise antitumor mechanisms remain to be clarified. In this study, we investigated whether salvicine altered the levels of ROS in breast cancer MCF-7 cells and whether these ROS contributed to the observed antitumoral activity. Our data revealed that salvicine stimulated intracellular ROS production and subsequently elicited notable DSBs. The addition of N-acetyl cysteine (NAC), an antioxidant, effectively attenuated the salvicine-induced ROS enhancement and subsequent DNA DSBs. Heat treatment reversed the accumulation of DNA DSBs, and the addition of NAC attenuated the Topo II-DNA cleavable complexes formation and the growth inhibition of salvicine-treated JN394top2-4 yeast cells, collectively indicating that Topo II is a target of the salvicine-induced ROS. On the other hand, when examining the impact of salvicine on DNA repair pathways, we unexpectedly observed that salvicine selectively down-regulated the catalytic subunit of DNA-dependent protein kinase (DNA-PK(CS)) protein levels and repressed DNA-PK kinase activity; both of these effects were attenuated by NAC pretreatment of MCF-7 cells. Finally and most importantly, NAC attenuated salvicine-induced apoptosis and cytotoxicity in MCF-7 cells. These results indicate that apart from its direct actions, salvicine generates ROS that modulate DNA damage and repair, contributing to the comprehensive biological consequences of salvicine treatment, such as DNA DSBs, apoptosis, and cytotoxicity in tumor cells. The finding of salvicine-induced ROS provides new evidence for the molecular mechanisms of this compound. Moreover, the effects of salvicine-induced ROS on Topo II and DNA-PK give new insights into the diverse biological activities of ROS. | High | [
0.69774011299435,
30.875,
13.375
] |
The Daily Dish, Silver Spring MD Address: 8301-A Grubb Rd, Silver Spring MD 20901 / (301) 588-6300 Type: Restaurant Cuisine: AmericanBurgerPizzaVeganVegetarian About Us / The Daily Dish History: Serves meat, veg options available. Offers all-vegan soy cheese pizza and other vegan items such as a trio of dips with pita, a portobella burger, and Mezze Riephigi. Coffee and specialty drinks can be made with soymilk. | Mid | [
0.6292682926829261,
32.25,
19
] |
First Lady Melania Trump blasted the press and other critics who have brought up her son Barron as a cudgel to bash the 12-year-old’s father, President Donald Trump. Sean Hannity asked Mrs. Trump about attacks on Barron Trump, and asked if he should be immune from criticism. “Children should be off limits,” she said. “I protect him and I want to give him as normal a life as possible give him the childhood he deserves,” Mrs. Trump said.- READ MORE | Low | [
0.48222222222222205,
27.125,
29.125
] |
Q: Recover from hosed server that was the sole DHCP Server One of my Windows Server 2003 Domain Controller seems to have died this morning. This was the only DHCP server for this particular office. I have another DC in this office. If I set up a new DHCP server on this other DC: Will it know the leases? (Maybe the information is stored in AD?) Am I going to have to make everyone reboot so there are no conflicts? Anything else I should consider? A: If I set up a new DHCP server on this other DC: * Will it know the leases? (Maybe the information is stored in AD?) The lease are stored in %systemroot%\system32\dhcp as dhcp.mdb and temp.mdb. (Reference) They are not stored in AD, and will not be replicated. * Am I going to have to make everyone reboot so there are no conflicts? No need. Just configure Windows DHCP to check for an existing client on that IP (right click on the server in the DHCP tool, there is an option to have Windows DHCP check up to 5 IP's before handing one out). * Anything else I should consider? Configure a secondary backup DHCP server using the 80/20 rule. Printers should have their IP's statically assigned (now is a great time to check!), as should other essential system hardware (routers, WAP's, etc). | High | [
0.6923076923076921,
33.75,
15
] |
Deadline How the Sequester Will Harm Republican States Republicans cheering for the sequester to kick in this week may find that their big-government states will suffer the most. Daniel Gross on the budget's poetic justice. The sequester, which is poised to hit at the end of this week, is dumb, dangerous, and bad policy to boot. And yet I can’t help but welcome its arrival. Why? It will lay bare an obvious fact that too many on the political right (and many in the political center) have been ignoring for the last few years. The federal government plays a very important role in the economy, in employment, in supporting consumption and investment, and in building and running the infrastructure that enables commerce. Washington Republicans remain rather blasé about the impact of the upcoming sequester. But state Republican officials are already starting to freak out. Virginia Governor Robert McDonnell, a onetime Tea Party favorite, is worried the sequester will affect the large military and government operations in his state. That’s to be expected. Economically speaking, the Commonwealth of Virginia is rapidly becoming an exurb of the District of Columbia. But Washington pols may soon be hearing about the negative impact of the sequester from some distant Republican redoubts – like Utah. Utah, where I spent the past week, might seem like an unlikely source of pleadings to maintain government spending at current levels. The state’s mythology and history speak to a sense of self-reliance, anti-government sentiment, and entrepreneurship. Mitt Romney, a quasi-native son by virtue of his Mormon faith, advocated balancing the federal budget through spending cuts alone. He carried the state last November by a stunning 73-25 margin. "I’m for sequestration," Sen. Orrin Hatch, the veteran Utah senator said last week, according to the Salt Lake Tribune. “We’ve got to face the music now, or it will be much tougher later." And yet, the sequester is going to make the music really discordant in Hatch’s home state, which is disproportionately dependent on the federal government. The federal government is the biggest employer in the state, employing 34,000 people in Utah. The list of the largest state employers is topped by Hill Air Force Base, a mammoth, 6,650-acre installation that specializes in aircraft maintenance. A city unto itself, Hill features residences, “a modern shopping complex,” plus “a bowling center, fitness center, clinics, chapel, museum, recreation center, officer and enlisted clubs, dining facilities and a child development center.” It has 1,475 buildings and 228 miles of roads. According to Natalie Gochnour, chief economist of the Salt Lake Chamber of Commerce, Hill directly employs 9,300 military personnel and 16,300 civilians, with a combined annual payroll of $1.2 billion. In addition, the base purchases $832 million in goods and services locally each year. But wait, there’s more. A large regional IRS processing facility in Ogden (here’s a street view) employs between 4,000 and 5,000 state residents. The sequester is going to cause a great deal of pain back home – in Republican precincts as well as Democratic ones. Oh, and because two-thirds of the state is federal land, the Bureau of Land Management and other federal agencies are major economic forces. Many small towns are home to BLM offices with several employees – biologists, firefighters, sanitation workers. “Typically in rural Utah, the biggest employer is the school district and right after that is the federal government,” Gochnour said. The state’s large tourism economy also depends on the federal government to a degree. The Park City ski area, where I spent last week gasping for breath in the thin air and trying desperately to stay upright, welcomes about 1.7 million visitors per year. About 75 percent of the visitors come from out of state. The top markets are New York and Los Angeles. Without a smoothly functioning Salt Lake City Airport, staffed by the Federal Aviation Administration, ski tourists would go elsewhere. (It’s a long drive from New Jersey to Utah.) Other big employers in the state include health care organizations, state universities, and the state of Utah – each of which is heavily dependent on federal funds. The pie chart on page three of this state report indicates that 27 percent of the state’s $13 billion budget comes from the federal government. According to the Bureau of Labor Statistics in December, 221,000 of the 1.26 million jobs in conservative, small-government Utah were in the government sector (local, state, federal), or about 17.5 percent. By contrast, in liberal, big-government Connecticut, 234,000 of 1.62 million jobs were in the government sector – or 14.4 percent. As a result, across-the-board spending cuts are likely to cut quite deep. The state’s economy is growing rapidly, and it has clawed back the 100,000 jobs lost in the Great Recession. But Utah has a rapidly growing, comparatively young population, which means it needs significant jobs growth just to absorb new labor force entrants. The sequester alone won’t put the state’s economy back into recession, but it will put a dent in consumption and employment. Liberals shouldn’t take any solace in the fact that a conservative state, represented largely by anti-tax, pro-austerity fundamentalists, might suffer disproportionately from the sequester. But it will be clarifying and useful for those who have been frustrated by the right’s refusal to recognize reality. The conventional wisdom holds that elected Republican officials can engage in the type of irresponsible brinksmanship that hurts economic growth without consequences since so many are in safe districts. But the sequester is going to cause a great deal of pain to governments, consumers, and, especially, to businesses back home – in Republican precincts as well as Democratic ones. Once the sequester hits, a rising chorus of local politicians, voters, and businesses will complain that arbitrary cuts in government spending are hurting economic growth. If Utah suffers a few months of layoffs, declining retail sales and slumping tourism, Sen. Hatch will be singing from the Keynesian hymnal. | Mid | [
0.5964912280701751,
29.75,
20.125
] |
--- abstract: 'We discuss the Newtonian limit of boost-rotation symmetric spacetimes by means of the Ehlers’ frame theory. Conditions for the existence of such a limit are given and, in particular, we show that asymptotic flatness is an essential requirement. Consequently, generalized boost-rotation symmetric spacetimes describing particles moving in uniform fields will not possess such a limit. In the cases where the boost-rotation symmetric spacetime is asymptotically flat and its Newtonian limit exists, then the (Newtonian) gravitational potential agrees with the potential suggested by the weak field approximation. We illustrate our discussion through some examples: the Curzon-Chazy particle solution, the generalized Bonnor-Swaminarayan solution, and the C metric.' author: - | Ruth Lazkoz [^1]\ *Fisika Teorikoaren eta Zientziaren Historiaren Saila*\ *Euskal Herriko Unibertsitatea*\ *644 Posta Kutxatila*\ *48080 Bilbao, Spain*\ Juan Antonio Valiente Kroon [^2] [^3]\ *Max-Planck Institut für Gravitationsphysik,*\ *Albert Einstein Institut,*\ *Am Mühlenberg 1,*\ *14476 Golm, Germany.* title: The Newtonian limit of spacetimes describing uniformly accelerated particles --- PACS: 04.20.Jb, 04.25.Nx, 04.20.Cv Introduction ============ Boost-rotation symmetric spacetimes can be thought of as describing uniformly accelerated particles. The uniform acceleration can in some cases be interpreted as due to an external field, and in other cases as the outcome of self-accelerations produced by the presence of positive an negative masses, or even as the effect of a strut connecting pairs of particles. Precisely these last two types of models comprise the only known classes of exact solutions to the Einstein field equations which are locally asymptotically flat, in the sense that they possess sections of null infinity which are spherical, but null infinity is not complete because some of its generators are not complete. Boost-rotation symmetric spacetimes possess two (hypersurface orthogonal commuting) Killing vectors. One of them is an axial Killing vector. The other one leaves invariant the light cone through the origin, and can be regarded as the curved spacetime generalisation of the boost Killing vectors of Minkowski spacetime. The boost symmetry has a special status, being the only other symmetry a radiative axially symmetric spacetime can have [@BicSch84; @BicPra98; @Val00b]. Historically, these spacetimes were of outmost importance for it was a solution of this kind [@BonSwa64] that became the first explicit non-stationary solution describing gravitational radiation according to Bondi’s description and Penrose’s treatment of asymptotic flatness —[@Bic68]—. A procedure to construct systematically boost-rotation symmetric spacetimes both in the case describing freely falling particles [@BicHoeSch83a], and in the case describing self-accelerated particles [@BicHoeSch83b] has been given. Bičák & Schmidt [@BicSch89a] have provided a unified discussion of those boost-rotation symmetric spacetimes which are as “asymptotically flat as possible”. There, it was shown that in order to obtain all the spacetimes in the class, one has to start by solving an inhomogeneous wave equation in flat space with sources moving along the orbits of the boost rotation Killing vector. These solutions to the inhomogeneous wave equation were then used as “seeds” for the boost-rotation space-times. The boost-rotation symmetric spacetimes have been considered extensively in the literature. For a discussion of their role in the understanding of the theory of General Relativity see [@Bic00]. Some more specific studies can be found in [@Bic85; @Bic87; @PraPra00]. However, the discussion of their Newtonian limit has been only carried out from the weak field approximation perspective, and so the question of the validity of the obtained results has so far remained open in the lack of a more rigorous treatment. It is the purpose of the present article to address this very issue. The study of the relationship between Newton’s and Einstein’s theories of gravitation, which are respectively predecessor and successor of one another, has lead to attempts to relate them under certain limiting conditions. Despite the fact the formulation of these two theories was grounded on very different concepts, the existence of a common description setup allows one to recognize Newton’s theory as a degenerate limit of that of Einstein. By working in this common framework it would in principle be possible to exploit some structural similarities and generalize theoretical results from the old theory to the new one. Perhaps the main motivation for carrying out this sort of investigations is the fact that the observational consequences of General Relativity strongly rely on post-Newtonian approximations, or in other words, that the experimental refutations of General Relativity are usually reported in the language of Newton’s theory. Summarizing, the predecessor theory is an invaluable tool for devising approximation schemes allowing to establish links between the two theories. As discussed above, one of the fundamental steps towards a well grounded link between the two theories is to give a precise definition of the relevant approximations. Nowadays, the vinculum between the equations of General Relativity and Newton’s theory is well understood. Yet the link between solutions to the equations remains not completely clear. The difficulty lies in the difference between the geometric notions used in the Newtonian setup and in the General Relativity theory. Several schemes have been devised to write both theories in a common language —see for example [@Dau97; @Win83; @Ehl98] and references therein— so that the transition from the relativistic theory to that of Newton can be taken in a conceptually consistent way. Among them, Ehlers’ theory is of particular interest due to its covariant nature; this approach has been further developed by Lottermoser —see for example [@Ehl98; @Lot88] for full references—. We will use this particular framework in our study of the Newtonian limit of the boost-rotation symmetric spacetimes. This article is structured as follows: in section 2 we begin by describing briefly Ehlers’ frame theory. In particular we focus on some technical results that will be used in our investigation of the Newtonian limit. In section 3 we proceed to a general discussion of boost-rotation symmetric spacetimes in a way which is suited for our later discussion. In section 4 the discussion of the Newtonian limit of boost-rotation symmetric spacetimes is actually carried out. A couple of propositions regarding the conditions needed to have such limit are here stated and proved. The role of asymptotic flatness in the existence of the Newtonian limit is discussed. Finally, we address some interpretational issues, in particular those of the determination of the proper Newtonian potential and Newtonian sources. In section 5 we analyse some examples: the Curzon-Chazy particle solution, the generalized Bonnor-Swaminarayan, and the C metric. Finally, an appendix containing an adaptation of the axioms of the frame theory as given by J. Ehlers —which are not so readily available in the literature— is included. Ehlers’ frame theory ==================== First, we proceed to overview briefly the concepts, ideas and results of Ehlers’ frame theory in the form given by J. Ehlers —see e.g. [@Ehl98]— that will be used in our investigation. For completeness, and as a quick reference, an adapted version of the axioms of the frame theory is given in the appendix to this article. The required propositions and theorems will be stated without proof. For a thorough discussion and the full details of the proof we remit the reader to [@Lot88]. Ehlers’ frame theory considers a 4-dimensional differentiable manifold $M$ endowed with a torsion free connection (not necessarily metric) on which the two symmetric rank 2 tensors $t_{ij}$ (temporal metric) and $s^{ij}$ (spatial metric) are defined. The temporal metric and the spatial metric are related to each other via $$\label{inverses} t_{ij}s^{jk}=- \lambda\delta_{i}^{\phantom{i}k},$$ where $\lambda \geq 0$ is a constant known as the *causality constant*. Throughout this work all Latin indices will range from $0$ to $3$, except for $a$, that will range from $1$ to $3$. The summation convention is assumed. If $\lambda \neq 0$, then the causality constant can be identified with $1/c^2$, $c$ being the speed of light. The temporal metric and the spatial metric are compatible with the connection in the sense that $$\nabla_k t_{ij}=0, \qquad \nabla_k s^{ij}=0.$$ The spacetime manifold $M$ can be thought of as being parameterised by the causality constant $\lambda$, so that in fact $M=M(\lambda)$ describes a family of spacetime manifolds. For $\lambda\neq 0$ a change in the value of $\lambda$ can be regarded as a change of the units in which the speed of light is measured. Intuitively, one would wish to identify the Newtonian limit of the family $M(\lambda)$ with $\lambda=0$. This limit will be of a degenerate nature as can be seen from considering relation (\[inverses\]). Following Ehlers, we make the following definition: \[def:newtonian\_limit\] **(Newtonian limit of a spacetime).** The family $M=M(\lambda)$ of spacetime manifolds is said to have a *Newtonian limit* if: - the connection, the spatial metric, the temporal metric, and the Riemann tensor constructed from the connection have a limit for $\lambda\to 0$; - the limiting value of the connection, the Riemann tensor, the spatial metric and the temporal metric as $\lambda\to 0$ satisfy the axioms of the frame theory. One can easily understand that the spatial metric and the temporal metric are required to have a Newtonian limit by simply recalling that they are the fundamental objects of our theory. Similarly, the same must hold for the connection, which in the limit $\lambda\to0$ should (intuitively) yield the gravitational potential. The equivalent requirement on the Riemann tensor is not so clear though, the rationale behind it being that the Riemann tensor describes the effects of non-homogeneous gravitational fields: the tidal forces. From this point of view, it is natural to demand the Newtonian limits of spacetimes to have well defined tidal forces. For $\lambda\neq 0$, it is not difficult to relate the temporal metric and the spatial metric to the metric tensor of General Relativity and its inverse. For $\lambda=0$, this ceases being the case and the spacetime acquires a degenerate metric structure. In order to study the behaviour of the connection under these circumstances, it is convenient to perform a 1+3 decomposition of it. This decomposition requires the introduction of a timelike congruence $u^i$ (four-velocity field of an observer) which on passing to the Newtonian limit will give rise to the Galilean simultaneity surfaces. Note that contrary to the case of (globally) stationary spacetimes, where a canonical choice for such an observer field exists (the flow lines of the timelike Killing vector), in radiative spacetimes such a canonical choice does not exist *a priori*. The choice of a (normalized) observer field $u^i$ induces in a natural way the projection tensor $\pi^i_j=\delta^i_j-u^i\omega_j$, where we have defined $\omega_i=u^\bullet_i=t_{ij}u^j$. Here, and in what follows, the bullet ${}^\bullet$ indicates that the corresponding tensorial object has been constructed by lowering indices using the temporal metric $t_{ij}$. One can also define the tensors $$\begin{aligned} &&\gamma_{ij}=\frac{1}{\lambda}(u^\bullet_i u^\bullet_j-t_{ij}), \\ &&\kappa^{ij}=s^{ij}+\lambda u^i u^j.\end{aligned}$$ A “hydrodynamic”decomposition of the derivative of the covariant derivative $u^i$ arises naturally: $$\label{hydrodynamic} u^i_{;j}=\kappa^{ik}\left(E_k\omega_j+\sigma_{kj}+ \frac{1}{3}\vartheta\gamma_{kj}+\Omega_{kj}\right),$$ where $E_i$ is the 3-acceleration, $\sigma_{ij}$ the shear, $\vartheta$ the expansion and $\Omega_{ij}$ the vorticity of the observer field. It can be shown that if $\Lie_u\gamma_{ij}=0$, where $\Lie_u$ denotes the Lie derivative along $u^i$ then $u^i_{;j}=\kappa^{ik}(E_k\omega_j+\Omega_{kj})$. This type of observers will be called *rigid*. The field $u^i$ induces, as well, a certain decomposition on the connection. In particular, one has the following result: \[theorem:connection\] Let $u^i$ be a normalized observer (timelike) field. Let us define $$F_{ij}=\frac{1}{\lambda}u^\bullet_{[j,i]}\mbox{ (i.e. }F=\frac{1}{\lambda}{\mbox{d}}u^\bullet.)$$ If $\lambda=0$, $\Lie_u \gamma_{ij}=0$, and the Newtonian limit of $M(\lambda)$ exits then, - locally there exists a scalar function $\eta$ (absolute time) such that, $$\omega_i=\eta_{,i};$$ - the connection can be written as, $$\begin{aligned} &&\Gamma^i_{jk}=\overline{\Gamma}^i_{jk}+ 2\delta^{i a}F_{a(j}\eta_{,k)}\nonumber \\ &&\phantom{\Gamma^i_{jk}}=\overline{\Gamma}^i_{jk}+ \delta^{i a}\left( 2\Omega_{a(j}\eta_{,k)}+ E_{a}\eta_{,j}\eta_{,k}\right)\end{aligned}$$ where, $$\overline{\Gamma}^i_{jk}= \frac{1}{2}s^{il}\pi^m_j\pi^n_ k(\gamma_{l m,n}+\gamma_{n l, m}- \gamma_{m n,\, l})$$ and $E^i$ and $\Omega_{ij}$ are defined via the hydrodynamic decomposition (\[hydrodynamic\]). Moreover, one has the following corollary, which indicates which parts of the limit of the tensor $F_{ij}$ correspond to the (Newtonian) gravitational potential ($E_a$), and which to a Coriolis field ($\Omega_{ij}$). This corollary will be our main interpretational tool. \[corollary:connection\] Choosing a Cartesian coordinate system, then (in the $\lambda=0$ case) the geodesics satisfy $$\ddot{\vec{x}}=\vec{g}+2\dot{\vec{x}}\times\vec{\Omega},$$ where $$\vec{g}=-(E_1,E_2,E_3) \qquad \vec{\Omega}= -(\Omega_{23},\Omega_{31},\Omega_{12}).$$ There are several equivalent ways of verifying that a given family of spacetimes $M=M(\lambda)$ possess a Newtonian limit. The procedure that will be used in the present work is summarized in the following theorem. \[existence:check\] Let $M(\lambda)$ be a family of spacetimes parameterised by $\lambda \geq 0$. Then if - **(Newtonian limit of the metrics)** - the limit of $s^{ij}$ as $\lambda\to 0$ exists and is of rank 3; - $\lim_{\lambda\to 0} \displaystyle{ \frac{1}{\lambda}} \det s^{ij}$ exists; - **(Newtonian limit of the connection)** given an observer field $u^i=u^i(\lambda)$ in $M(\lambda)$ such that $\lim_{\lambda\to 0} u^i$ exists and $$\lim_{\lambda\to 0} u^{i}_{,j}\,\exists = (\lim_{\lambda\to 0}u^{i} )_{,j},$$ one has - $$\lim_{\lambda\to 0} t_{ij,k}\,\exists= (\lim_{\lambda\to 0}t_{ij})_{,k}, \qquad \lim_{\lambda\to 0} {s^{ij}}_{,k}\,\exists= (\lim_{\lambda\to 0}s^{ij} )_{,k},$$ - $$\lim_{\lambda\to 0} \frac{1}{\lambda}t_{[i|j |} {u^j}_{,k]}\,\exists = \lim_{\lambda\to 0} F_{ik};$$ - **(Newtonian limit of the Riemann tensor)** $$\lim_{\lambda\to 0} \frac{1}{\lambda}F_{ij,k}\,\exists = (\lim_{\lambda\to 0} F_{ij})_{\!,k};$$ then the family of spacetimes $M(\lambda)$ has a Newtonian limit. In this theorem the symbol $\exists =$ should be understood as meaning “exists and is equal to”. A final notational remark: given a quantity $x$ (scalar, tensor) such that its limit as $\lambda\to 0$ exists, we will often write $\overset{\circ}{x}$ for $\lim_{\lambda\to 0}x$. Boost-rotation symmetric spacetimes =================================== Let us recall the customary interpretation of boost-rotation symmetric spacetimes as describing uniformly accelerated particles. As is well known, in General Relativity the causes of the motion are included in the theory. In our case, the acceleration can be either due to an uniform external field or the effect of repulsion between particles with positive and negative masses [^4]. Conical singularities could also be the cause of the accelerations. Boost-rotation symmetric spacetimes contain generally (naked) strut singularities. This feature makes them in a way not very physical [^5]. However, those containing what can be described as repelling pairs of positive and negative masses constitute the only explicit examples (in the realm of exact solutions) of locally asymptotically flat radiative spacetimes in the sense of Penrose [@Pen63]. The particles in the spacetime undergo uniform acceleration. Thus, they approach the speed of light asymptotically. Now, the smoothness of the spacetime requires that it possesses reflection symmetry. All this implies that null infinity has at least two singular points. Therefore, some of the generators of null infinity are not complete. This seems to be the best that can ever been achieved by means of exact radiative solutions. As we said, boost-rotation symmetric spacetimes have two commuting hypersurface orthogonal Killing vector fields. One of them is an axial Killing vector ($\eta^i$), and the other is the generalization of the boost Killing vector of Minkowski spacetime ($\xi^i$), see figure 1. The Killing vector $\xi^i$ leaves invariant the light cone through the origin. As is the case in the Minkowski spacetime, there are regions where the boost Killing vector is timelike ($\xi_i \xi^i>0$), null ($\xi_i \xi^i=0$), and spacelike ($\xi_i \xi^i<0$). The set for which $\xi^i$ is null will be known as the *roof* —see e.g. [@BicSch89a]—. Boost-rotation symmetric spacetimes are time symmetric, thus we will only consider in our discussion the region for which $t\geq 0$, as depicted in figure \[figure:boost\]. The region of the spacetime for which $t\geq 0$ and $\xi^i$ is timelike will be known as *below the roof*, whereas the portion for which $\xi^i$ is spacelike will be denoted as *above the roof*. As will be seen later, our discussion of the Newtonian limit of the boost-rotation symmetric spacetimes will naturally deal with above the roof region of the spacetime. \[figure:boost\] ![The action of the boost Killing vector on flat spacetime —see [@BicSch89a]—.](boostscheme.eps "fig:"){width=".5\textwidth"} In the region below the roof, the boost-rotation symmetric spacetimes can be locally put into the Weyl form, whereas above the roof, the spacetime can be put locally in the form of an Einstein-Rosen wave. The difference between the Weyl and Einstein-Rosen spacetimes and the boost-rotation symmetric spacetimes arises when we consider their global structure. Above the roof, the line element of a boost-rotation symmetric spacetime can be written in the following form: $$\label{d_line_element} {\mbox{d}}s^2=\frac{1}{c ^2t^2-z ^2}\{(e^\nu z^2-e^\mu c ^2t^2){\mbox{d}}z^2+c ^2[2zt(e^\mu-e^\nu){\mbox{d}}z {\mbox{d}}t+ (c ^2e^\nu t^2-e^\mu z^2){\mbox{d}}t^2]\} -e^\nu {\mbox{d}}\rho^2-\rho^2e^{-\mu}{\mbox{d}}\varphi^2,$$ the functions $\mu$ and $\nu$ [^6] have the following functional dependence: $$\begin{aligned} &&\mu=\mu(\rho^2,t^2-z^2/c^2), \\ &&\nu=\nu(\rho^2,t^2-z^2/c^2).\end{aligned}$$ In the $(t,\rho,\varphi,z)$ coordinates the region above the roof corresponds to $c ^2 t^2>z^2$. If (\[d\_line\_element\]) corresponds to a vacuum solution of Einstein equations then the function $\mu$ satisfies the wave equation $$\label{wave} \Box\mu=0,$$ while $\nu$ can be found by quadratures once $\mu$ has been obtained. Note now that coordinates $\rho$ and $z$ ($[\rho]=[z]=L$) from line element (\[d\_line\_element\]) have dimensions of length, while $t$ has dimensions of time ($[t]=T$). In order to ease our discussion of the Newtonian limit, it will be convenient to make use of dimensionless coordinates. To this end, we assume that our system possesses a characteristic length $\alpha$ and a characteristic time $\tau$. The introduction of a characteristic time in the relativistic regime of the frame theory is superfluous because from a given length one can always construct a time just dividing by the speed of light. However, in the Newtonian limit such canonical choice of speed does not longer exist. This small redundancy is a price one has to pay in order to write the two theories in a common language. Dimensionless coordinates are then given by $$\begin{aligned} && \rhot=\alpha^{-1}\rho, \\ && \zt=\alpha^{-1}z, \\ && \ttilde=\tau^{-1}t,\end{aligned}$$ $\alpha$ and $\tau$ being constants such that $[\alpha]=L$ and $[\tau]=T$. In the sequel, it will be convenient to use above the roof coordinates $(\bt,\rhot,\varphi,\tilde\chi)$, which diagonalize the line element of the spacetime [@BicSch89a]: $$\label{nd_line_element} {\mbox{d}}s^2=\frac{\tau^2}{\lambda}e^\nu {\mbox{d}}\bt^2-\alpha ^2 \left(e^\nu {\mbox{d}}\rhot^2-\rhot^2e^{-\mu}{\mbox{d}}\varphi^2- {\bt^2}e^\mu {\mbox{d}}\tilde\chi^2\right),$$ where now, $\mu=\mu(\rhot^2,\bt^2)$, $\nu=\nu(\rhot^2,\bt^2)$. Note, by the way, that $[\mu]=[\nu]=1$. The coordinate transformation relating the line elements (\[d\_line\_element\]) and (\[nd\_line\_element\]) is given by $$\begin{aligned} && \bt^2=\ttilde^2-\left(\frac{\alpha^2\lambda}{\tau^2}\right) \zt^2, \\ && \mbox{tanh}^2\left(\frac{\alpha\sqrt{\lambda}} {\tau}\,\tilde\chi\right) =\left(\frac{\alpha^2\lambda}{\tau^2}\right) \frac{\zt^2}{\ttilde^2}.\end{aligned}$$ In the rest of this work only dimensionless coordinates will be used, therefore in order to simplify the notation we drop the tilde $\;\widetilde{}\;\,$ from the coordinates $(\ttilde,\rhot,\varphi,\zt)$, and $(\bt,\rhot,\varphi,\tilde\chi)$. In terms of the $(b,\rho,\varphi,\chi)$ coordinates the field equations take the form, $$\begin{aligned} &&\mu_{,\rho\rho}-\left(\frac{\alpha^2\lambda}{\tau^2}\right)\mu_{,bb}+ \rho^{-1}\mu_{,\rho}-\left(\frac{\alpha^2\lambda}{\tau^2}\right) b^{-1}\mu_{,b}=0, \label{field1}\\ &&\left(b^2-\left(\frac{\alpha^2\lambda}{\tau^2}\right)\rho^2\right) \nu_{,\rho}=\frac{1}{2}\rho b^2\left(\mu_{,\rho}^2+\left(\frac{\alpha^2\lambda}{\tau^2}\right) \mu_{,b}^2\right)-\left(\frac{\alpha^2\lambda}{\tau^2}\right)\rho^2 b \mu_{,\rho}\mu_{,b} \nonumber \\ &&\phantom{\left(b^2-\left(\frac{\alpha^2\lambda}{\tau^2}\right)\rho^2\right) \nu_{,\rho}=XXXXX}-\left(\left(\frac{\alpha^2\lambda}{\tau^2}\right)\rho^2+ b^2\right)\mu_{,\rho}+2\left(\frac{\alpha^2\lambda}{\tau^2}\right) \rho b \mu_{,b}, \label{field2} \\ &&\left(b^2-\left(\frac{\alpha^2\lambda}{\tau^2}\right)\rho^2\right) \nu_{,b}=-\frac{1}{2}\rho^2 b\left(\mu_{,\rho}^2+\left(\frac{\alpha^2\lambda}{\tau^2}\right) \mu_{,b}^2\right)+\rho b^2 \mu_{,\rho}\mu_{,b} \nonumber \\ &&\phantom{\left(b^2-\left(\frac{\alpha^2\lambda}{\tau^2}\right) \rho^2\right)\nu_{,\rho}=XXXXX}-\left(\left(\frac{\alpha^2\lambda} {\tau^2}\right)\rho^2+b^2\right)\mu_{,b}+2\rho b \mu_{,\rho}. \label{field3}\end{aligned}$$ Equation (\[field1\]) corresponds to the wave equation (\[wave\]), and is the integrability condition for (\[field2\]) and (\[field3\]). These field equations suggest considering boost-rotation symmetric solutions of the wave equation (\[wave\]) as seeds to construct boost-rotation symmetric spacetimes. In fact, one can construct an infinite number of spacetimes of that kind which are regular everywhere but blow up at infinity. These “[seeds]{}” lead to spacetimes describing uniformly accelerated particles under the action of an external field. Bičák & Schmidt [@BicSch89a] have shown that the only boost-rotation symmetric solution to (\[wave\]) which decays to zero at null infinity is $\mu=0$. Therefore, in order to construct (non-trivial) boost-rotation symmetric spacetimes which are as asymptotically flat as possible, one has to consider “[seeds]{}” $\mu$ which satisfy the wave equation with sources moving along boost-rotation symmetric orbits, i.e.: $$\label{wave_with_sources} \Box \mu =8\pi \sigma,$$ with $\sigma=\sigma(\rho^2,b^2)=\sigma(\rho^2,t^2-\left({\alpha^2\lambda} /{\tau^2}\right) z^2)$, $[\sigma]=1$. This strategy will yield spacetimes which will be singular at least along the world lines of the uniformly accelerated particles. Bičák and Schmidt [@BicSch89a]) have briefly discussed tachyonic boost-rotation symmetric sources. Here, only sources moving with speed inferior to that of light ($t^2-\left({\alpha^2\lambda}/{\tau^2}\right) z^2<0$) will be considered. Hence, the trajectories of the sources will remain always below the roof. This fact will acquire relevance later, when we try to identify the sources of the gravitational field of the Newtonian limits. Bičák & Schmidt analysed the fall-off conditions that $\mu$ and $\nu$ have to satisfy for the spacetime to have at least a local null infinity. Moreover, they showed that for metric functions $\mu$ and $\nu$ satisfying the aforementioned asymptotic flatness conditions, it is possible to add suitable constants to both $\mu$ and $\nu$ so that the resulting spacetime has a global null infinity, in the sense that it admits smooth spherical sections. Finally, they also showed that for a $\mu$ satisfying the fall off conditions and vanishing at the origin ($\mu(0,0)=0$), it is possible to construct a spacetime where null infinity is regular except for four points: the “good luck case”. These are the points where the particles enter and leave the spacetime. As will be shown later —and perhaps not so surprisingly— asymptotic flatness will appear to be a crucial ingredient for the existence of the Newtonian limit of the spacetimes under consideration. Remarkably, non-asymptotically flat solutions (i.e. those describing accelerated particles in uniform fields) can be intuitively constructed from asymptotically flat solutions by sending one of the particles to infinity and at the same time increasing its corresponding mass parameter [@BicHoeSch83a]. The temporal metric and spatial metric of Ehlers’ theory can be constructed from the line element (\[d\_line\_element\]) by performing the replacement $c\mapsto{1}/{\sqrt{\lambda}}$ everywhere in (\[d\_line\_element\]), where $\lambda$ is the so-called causality constant. Then, the required temporal $t_{ij}$ will be obtained by multiplying the corresponding metric tensor $g_{ij}$ by $\lambda$. In terms of the $(t,z,\rho,\chi$) variables, and up to the two first orders in $\lambda$, these two tensors read $$t_{ij}=\left(\begin{matrix} {\tau }^2\, e^{\nu } - \lambda{\alpha }^2\displaystyle{ z^2 } {t^{-2}}\left( e^{\mu } - e^{\nu } \right) & 0 & 0 & \lambda \alpha ^2 z \, t ^{-1} \left( e^{\mu } - e^{\nu } \right) \cr 0 & - \lambda\alpha ^2e^{\nu } & 0 & 0 \cr 0 & 0 & -{ {\alpha }^2\,\lambda \,{\rho }^2}{e^{-\mu }} & 0 \cr \lambda \alpha ^2 z \, t ^{-1} \left( e^{\mu } - e^{\nu } \right) & 0 & 0 & -\lambda {\alpha }^2 e^{\mu } \cr \end{matrix}\right)$$ $$s^ {ij}=\left(\begin{matrix}- {\lambda }\tau^{-2}{e^{-\nu }} & 0 & 0 &\lambda\tau^{-2} \,z\,t^{-1} {\left( e^{-\mu } - e^{-\nu } \right) } \cr 0 & \alpha ^{-2}e^{-\nu } & 0 & 0 \cr 0 & 0 &{\alpha }^{-2}\,{{\rho }^{-2}} {e^ {\mu }} & 0 \cr \lambda\tau^{-2} \,z\,t^{-1} {\left( e^{-\mu } - e^{-\nu } \right) } & 0 & 0 & \alpha^{-2}e^{-\mu } + {\lambda\,{\tau }^{-2}\, z^2 } {t^{-2}\left( e^{-\mu } - e^{-\nu } \right)} \cr \end{matrix} \right).$$ It can be checked that $[t_{ij}]=T^2$, and $[s^{ij}]=L^{-2}$. The Newtonian limit of boost-rotation symmetric spacetimes ========================================================== The natural arena for the discussion of the Newtonian limit of boost-rotation symmetric spacetimes is the region above the roof, i.e. $t^2>\left({\alpha^2\lambda}/{\tau^2}\right) z^2$, where the spacetime is radiative. The reason for this is that as one makes $\lambda \to 0$, the region below the roof ($t^2<\left({\alpha^2\lambda}/{\tau^2}\right) z^2$) gets squeezed by the roof. That is, the region below the roof disappears in the limit, while the roof becomes the set $\{t=0\}$ —see figure 2—. \[figure:roof\_limit\] {width=".8\textwidth"} Necessary conditions for existence and consequences --------------------------------------------------- The conditions under which the hypothesis of theorem \[existence:check\] are satisfied for the boost-rotation symmetric spacetimes described by either (\[d\_line\_element\]) or (\[nd\_line\_element\]) are summarized in the following proposition. \[lemma:existence\] **(Necessary conditions for the existence).** Consider the observer field $u^i=(\tau^{-1}e^{-\nu/2},0,0,0)$. Necessary conditions for the existence of the Newtonian limit of the family $(M(\lambda),g_{ij}(\lambda))$ of boost-rotation symmetric spacetimes are - $\nu=\O(\lambda^0)$, $\mu=\O(\lambda^0)$, $\mu_{,\rho}=\O(\lambda)$, $\mu_{,b}=\O(\lambda)$ - $\nu_{,\rho}=\O(\lambda)$, $\nu_{,b}=\O(\lambda^0)$ - $\nu_{,\rho\rho}=\O(\lambda)$, $\nu_{,\rho b}=\O(\lambda)$, $\nu_{,b b}=\O(\lambda^0)$. **Proof.** This follows from using theorem \[existence:check\] and direct inspection. Condition (i) arises from imposing hypothesis (a1) and (a2) of theorem \[existence:check\]. In particular, it is important to note that $$\frac{1}{\lambda}\det s^{ij}=-\frac{1}{\tau^2\alpha^6} \left(\frac{1}{\rho^2}e^{-2\nu}\right).$$ So, the limit $\lambda \to 0$ may not exist if $\rho=0$. This peculiarity can be easily understood by recalling that the boost-rotation symmetric spaces contain struts or conical singularities on the axis $\rho=0$. These singularities represent the particles undergoing uniform acceleration. Along the same lines, condition (ii) of lemma \[lemma:existence\] arises from imposing hypothesis (b1) and (b2) of theorem \[existence:check\]. In particular, the condition $\nu_{,\rho}=\O(\lambda)$ and $\nu_{,b}=\O(\lambda^0)$ appears from assuming that the limit $$\lim_{\lambda\to 0} F=\lim_{\lambda\to 0} \frac{1}{\lambda} {\mbox{d}}u^\bullet$$ exists. This is because $$u^\bullet=t_{ij} u^i {\mbox{d}}x^j=\tau e^{\nu/2}{\mbox{d}}b= \tau e^{\nu/2}{\mbox{d}}t+ \O(\lambda),$$ where we have used the relation $b=t+\O(\lambda)$. So, at the end of the day one has $$\label{forces} F=-\frac{\tau}{2\lambda}e^{\nu/2}\left(\nu_{,\rho} {\mbox{d}}t \wedge {\mbox{d}}\rho+ \nu_{,z} {\mbox{d}}t \wedge {\mbox{d}}z+\O(\lambda) \right),$$ and hence the need of $\nu_{,\rho}=\O(\lambda)$ and $\nu_{,b}=\O(\lambda ^0)$ for the limit to exist. In the remainder, we will show that this condition has something to do with asymptotic flatness. Most boost-rotation symmetric spacetimes which are not at least locally asymptotically flat will not satisfy it. Finally, condition (ii) stems from requiring the existence of the limit as $\lambda\to 0$ of the Riemann tensor. $\Box$ Using the field equations (\[field1\])-(\[field3\]) it is not hard to draw some immediate consequences of proposition \[lemma:existence\]. \[lemma:consequences\] **(Consequences of the necessary conditions).** Assume that the hypothesis of proposition \[lemma:existence\] hold. Then, - $$\mu_{,\rho}=\O(\lambda), \qquad \mu_{,\rho\rho}=\O(\lambda);$$ - $$\begin{aligned} && \mu=\overset{\circ}{\mu}(b^2)+\lambda\Xi(\rho^2,b^2), \\ && \nu =\overset{\circ}{\nu}(b^2)+\lambda \Phi(\rho^2,b^2),\end{aligned}$$ where $\Xi=\O(\lambda^0)$, $\Phi=\O(\lambda^0)$, and according to the field equations $\overset{\circ}{\nu}_{,b}=-\overset{\circ}{\mu}_{,b}$; - $$\sigma=\lambda \Sigma(\rho^2,b^2),$$ where $\Sigma=\O(\lambda^0)$. **Proof.** The $\lambda$-dependencies given in (i) come directly from taking the limit $\lambda\to 0$ in the field equation (\[field2\]) and using the result in (\[field1\]). Consequence (ii) follows from the last discussion and from (ii) in proposition \[lemma:existence\]. Finally, (iii) comes from using (i) and (ii) in the wave equation with sources, $$\mu_{,\rho\rho}+\rho^{-1}\mu_{,\rho}-\left(\frac{\alpha^2\lambda}{\tau^2} \right)\mu_{,bb}- \left(\frac{\alpha^2\lambda}{\tau^2}\right)b^{-1}\mu_{,b}=8\pi\sigma.$$ $\Box$ The role of asymptotic flatness ------------------------------- So far, asymptotic flatness of the boost-rotation symmetric spacetimes (or the lack of it) has not entered our analysis. Ehlers argued that the notion of asymptotic flatness should play a crucial role in the existence of Newtonian limits [@Ehl98]. This observation suggests the possibility that spacetimes describing accelerated particles in uniform (gravitational) fields may not possess a Newtonian limit proper. Following reference [@BicSch89a], we will consider that a given metric function $\mu$ —satisfying a non-homogeneous wave equation— is said to be *compatible with asymptotic flatness* if $\Omega^{-1}\mu$ is smooth on null infinity, where $\Omega$ is a suitable conformal factor defining null infinity. This means that it should have (at least) the following asymptotic behaviour: $$\mu=\mu_1\Omega+\O(\Omega^2).$$ Consider for example the conformal factor, $$\label{Omega} \Omega=\frac{1}{\left({\tau^2}/{\alpha^2\lambda}\right)t^2-\rho^2-z^2}\,,$$ which is valid for the region $\left({\tau^2}/{\alpha^2\lambda}\right)t^2> \rho^2-z^2$. Now, consider a metric function $\mu^*$ not compatible with asymptotic flatness. For example, $$\begin{aligned} &&\mu^*=\mu_{-1}\Omega^{-1}+\mu_0+\mu_1\Omega+\O(\Omega^2), \\ &&\phantom{\mu^*}=\mu_{-1}\left(\left(\frac{\tau^2} {\alpha^2\lambda}\right)t^2-\rho^2-z^2\right) + \O(\Omega^0),\end{aligned}$$ where $\mu_{-1}=\O(\lambda^0)$. Whence, $$\begin{aligned} \mu^*_{,\rho}=-2\rho\mu_{-1}+\cdots,\end{aligned}$$ so that $\overset{\circ}{\mu}\,^*\!_{,\rho}\neq 0$, and accordingly $\overset{\circ}{\nu}_{,\rho}\,^*\neq 0$. That is, condition (ii) of proposition \[lemma:existence\] is not satisfied, and thus the boost-rotation symmetric spacetime to be obtained from the seed function $\mu^*$ does not have a properly defined Newtonian limit. This last result shows that, in fact, asymptotic flatness is a prerequisite for the existence of a Newtonian limit. This should not be a surprise because Newton’s theory, as pointed out by Ehlers, is actually a theory of isolated bodies. Several ways to impose it have been suggested in the literature —see in particular [@Tra66]—. Note, however, that a decay of the form $$\mu=\mu_0+\mu_1\Omega+\O(\Omega^2),$$ is still compatible with condition (ii) of proposition \[lemma:existence\]. This particular class of boost-rotation symmetric spacetimes could still have a Newtonian limit. As should be expected, the asymptotic flatness of the general relativistic solution leaves an imprint on the asymptotic behaviour of its Newtonian limit. We have the following result. \[proposition:af\_consequences\] **(Consequences of asymptotic flatness).** Let $\mu$ be a solution of the wave equation with sources (\[wave\_with\_sources\]) compatible with asymptotic flatness. Then it follows that - $$\overset{\circ}{\nu}_{,b}=\overset{\circ}{\mu}_{,b}=0;$$ - similarly, for fixed $t$ and $z$ one has, $$\Xi\sim \frac{C}{\rho^2}, \qquad \Phi\sim-\frac{C}{\rho^2},$$ for large $\rho$, where $C$ is a constant. **Proof.** Consider the conformal factor given in (\[Omega\]). It is not hard to see that $$\Omega=\frac{1}{t^2}\left(\frac{\alpha^2\lambda}{\tau^2}\right) + \frac{\rho^2+z^2}{t^4}\left(\frac{\alpha^2\lambda}{\tau^2}\right)^2+ O(\lambda^3).$$ As mentioned before, a function $\mu$ compatible with asymptotic flatness will be of the form $$\mu=\mu_1\Omega=\O(\Omega^2),$$ where $\mu_1=\O(\lambda^0)$, and $\partial_\Omega \mu_1=0$. Hence one has $$\label{mu:conformal} \mu=\frac{\mu_1}{t^2}\left(\frac{\alpha^2\lambda}{\tau^2}\right)+O(\lambda^2).$$ Accordingly $\overset{\circ}{\mu}_{,b}=0$ —cfr. (ii) in proposition \[lemma:consequences\]—. Thus, from (ii) in (\[lemma:consequences\]) one has $\overset{\circ}{\nu}_{,b}=\overset{\circ}{\nu}_{,t}=0$. In order to prove (iii), let us consider the conformal factor $$\Omega'=\frac{1}{\rho^2+z^2-\left({\tau^2}/{\alpha^2\lambda}\right)t^2},$$ in the domain in which it is positive. Then, asymptotically one has $\Omega'\sim 1/\rho^2$, from which (ii) follows. $\Box$ Interpretation and sources -------------------------- We are now in the position of discussing the Newtonian (gravitational) potential of those boost-rotation symmetric spacetimes possessing a Newtonian limit and describing the sources that give rise to them. Because of proposition (\[lemma:consequences\]) one has that the connection form —see equation (\[forces\])— is given by $$F=- \frac{1}{2}{\Phi_{,\rho}} (e^{\nu /2} ){\mbox{d}}t\wedge {\mbox{d}}\rho- \frac{1}{2}{\Phi_{,z}} (e^{\nu /2} ){\mbox{d}}t\wedge {\mbox{d}}z+\O(\lambda),$$ and because of (i) in lemma \[lemma:existence\] then $e^{\nu /2}=\O(\lambda^0)$ and therefore $$\label{newtonian_potential} \overset{\circ}{F}=-\frac{1}{2}\Phi_{,\rho} {\mbox{d}}b\wedge {\mbox{d}}\rho-\frac{1}{2}\Phi_{,z} {\mbox{d}}b\wedge {\mbox{d}}z$$ The last result, along with theorem \[theorem:connection\] and corollary \[corollary:connection\], indicates that $-\Phi/2$ is the Newtonian potential as measured by the rigid observers $u^i$. In reference [@BicSch89a] it was argued that because of equation (\[wave\_with\_sources\]) and since “$\Box\to \Delta$” in the $\lambda\to 0$ limit, it is suggestive to interpret $\mu/2$ as a (Newtonian) gravitational potential. It was also noticed that in the weak field approximation (i.e. weak sources) and for $t\approx 0$ one has $$g_{00}=e^\mu \approx 1+\mu,$$ which brings further support to their point of view. Here we want to make the point that this is only true if one enforces the requirement of asymptotic flatness. To see this, divide field equation (\[field2\]) by $\tau^{-2}\lambda$ and take the limit as $\lambda\to 0$. Recalling that $b\to t$ as $\lambda\to 0$ one obtains $$\label{Phi_relates_to_Xi} \tau^2t^2\Phi_{,\rho}=\frac{1}{2}\alpha^2\rho t^2(\overset{\circ}{\mu}_{,t})^2 -\tau^2t^2\Xi_{,\rho}+2\alpha^2\rho t \overset{\circ}{\mu}_{,t}.$$ Thus, only if the boost-rotation symmetric spacetime is asymptotically flat one will have that $\overset{\circ}{\mu}_{,t}=0$ and accordingly $\Xi_{,\rho}=-\Phi_{,\rho}$. In addition to this, $\Xi_{,z}=-\Phi_{,z}$ follows from an analogous discussion involving equation (\[field3\]). For the Newtonian limit of the non-asymptotically flat spacetimes described in §4.2, whose metric seed function $\mu$ is of the form $\mu=\mu_0+\O(\Omega)$, the interpretation of $\mu/2$ as a potential is not valid. This example illustrates the subtle —but crucial— differences between the notions of weak field approximation and Newtonian limit. The weak limit approximation is still a curved spacetime theory valid for sources which in some sense are moving slowly. Recall that the boost-rotation symmetric spacetimes are time symmetric, so that the uniformly accelerated particles start moving from rest at $t=0$. Thus, in our case, this weak field approximation should only be correct for $t\approx 0$, where they will still be moving slowly. On the other hand, in the Newtonian theory there is no restriction to the speed an object can attain, as long as it remains bounded for finite times. Accordingly, it is valid for all times. Finally observe that if one constructs a function $\mu$ such that $\overset{\circ}{\mu}_{,b}=0$ then one would indeed have $\Xi_{,\rho}=-\Phi_{,\rho}$ and $\Xi_{,z}=-\Phi_{,z}$. Given a boost-rotation symmetric source $\sigma=\sigma(\rho^2,t^2-\lambda{\alpha^2} z^2/{\tau^2})$, then by means of Kirchoff integrals its is possible to construct retarded $(\mu_+)$ and advanced $(\mu_-)$ fields of the form $$\mu_\pm =\frac{1}{8\pi}\int_{{\mbox{{\SYM R}}}^4} \frac{\sigma\left(\rho^{\prime 2}, t^{\prime 2}-({\alpha^2\lambda}/{\tau^2}) z^{\prime 2}\right)}{\sqrt{(\rho-\rho^{\prime})^2+(z-z^{\prime})^2}}\,\delta\left( \frac{\alpha}{\tau}\sqrt{\lambda}\sqrt{(\rho-\rho^{\prime})^2+ (z-z^{\prime})^2}\mp (t-t^\prime)\right){\mbox{d}}^4x^\prime,$$ where the integral is evaluated over the whole Minkowski spacetime. We note that the boost-rotation symmetric source can be very complicated and posses all sorts of multipole structures —represented by derivatives of the $\delta$-function—. The relevance of these advanced and retarded solutions for our purposes is that by considering linear combinations of the functions $\mu_\pm$, one can construct [@BicSch89a] a metric function $\mu$ that is an *analytic* function of $\rho^2$ and $t^2-\lambda z^2$ outside the sources, and which is asymptotically regular at the fixed points of the boost-symmetry on null infinity, namely $$\mu= a\mu_+ +(1-a)\mu_-,$$ where $a$ is suitable constant. Recalling that $\sigma=\lambda \Sigma$, where $\Sigma=\O(\lambda^0)$ is analytic in $\lambda$ so that $\lim_{\to 0} \Sigma(\rho^2,t^2-\lambda\alpha^2 z^2/\tau^2)$ does not depend on $z$, one has that $$\begin{aligned} &&\lim_{\lambda\to 0} \frac{\mu}{\lambda}=\frac{a}{8\pi}\int_{{\mbox{{\SYM R}}}^4} \frac{\overset{\circ}{\Sigma}\;\delta(t -t^\prime)}{\sqrt{(\rho-\rho^{\prime})^2+ (z-z^{\prime})^2}}\, {\mbox{d}}^4x^\prime \nonumber \\ &&\phantom{\lim_{\lambda\to 0} \frac{\mu}{\lambda}XXXXXXXXXX}+ \frac{(1-a)}{8\pi}\int_{{\mbox{{\SYM R}}}^4} \frac{\overset{\circ}{\Sigma}\;\delta(t -t^\prime)}{\sqrt{(\rho-\rho^{\prime})^2+ (z-z^{\prime})^2}} \,{\mbox{d}}^4x^\prime, \\ &&\phantom{\lim_{\lambda\to 0} \frac{\mu}{\lambda}}=\frac{1}{8\pi} \int_{{\mbox{{\SYM R}}}^3} \frac{\overset{\circ}{\Sigma}|_{t}}{\sqrt{(\rho-\rho^{\prime})^2+ (z-z^{\prime})^2}}\, {\mbox{d}}^3x^\prime.\end{aligned}$$ Thus, for an boost-rotation symmetric spacetime arising from an asymptotically flat seed $\mu$ one gets that —cfr. equation (\[Phi\_relates\_to\_Xi\])—, $$\Phi=-\frac{1}{8\pi}\int_{{\mbox{{\SYM R}}}^3} \frac{\Sigma(\rho^{\prime 2},t^2)}{\sqrt{(\rho-\rho^{\prime})^2+ (z-z^{\prime})^2}} {\mbox{d}}^3x^\prime.$$ Consequently, the potential $\Phi$ satisfies the Poisson equation with moving sources: $$\Delta (-\Phi/2) =4\pi \Sigma(\rho^2,t^2).$$ Note, in particular, the minus sign in the source term. In the Newtonian limit, the boost-rotation symmetric source has been replaced by a moving cylindrically symmetric source analytic in $\rho^2$ and $t^2$. We finish this discussion by recalling that the boost-rotation symmetric source $\sigma$ is such that the amount of negative masses balances exactly the amount of positive masses. That is, $$\int_{{\mbox{{\SYM R}}}^3} \sigma\left(\rho^2,t^2-\left({\alpha^2\lambda}/{\tau^2}\right) z^2\right) {\mbox{d}}^3 x'=0.$$ It then follows that $\Sigma(\rho^2,t^2)$ will inherit this property. Indeed, $$\int_{{\mbox{{\SYM R}}}^3} \Sigma(\rho^2,t^2) {\mbox{d}}^3 x'=0.$$ Examples ======== We now proceed to briefly discuss the Newtonian limits of some examples of boost-rotation symmetric spacetimes. As noted in the introductory sections, the first problem one has to face in order to proceed with this discussion is how to transcribe the exact general relativistic solutions —which almost always are expressed in terms of “natural” units for which $c=1$— into the language of the theory of frames. There is no canonical/unique way to do this. Indeed, one could for example, introduce the causality constant $\lambda$ in such a way into the Schwarzschild solution so that instead of the expected Newtonian limit of the potential due to a point mass one obtains a vanishing potential. Thus, the criteria for choosing a particular transcription rule is that it provides an interesting Newtonian limit. In our particular case, consistent with the discussion of section 3, we put forward the transition rules $$\begin{aligned} \label{transcription} && \rho_{BHS} \mapsto \alpha \rho, \\ && z_{BHS} \mapsto \alpha z, \\ && t_{BHS} \mapsto \frac{\tau}{\alpha \sqrt{\lambda}} t,\end{aligned}$$ where $\rho_{BHS}$, $z_{BHS}$, $t_{BHS}$ are the $\rho$, $z$, $\tau$ coordinates used by Bičák, Hoenselaers and Schmidt [@BicHoeSch83a; @BicHoeSch83b] (Bonnor [@Bon83] labels them $\eta$, $\zeta$, $\tau$), and $\rho$, $z$ and $t$ are the dimensionless coordinates used throughout most of this article. In order to write the expressions in a more compact fashion, we define the dimensionless quantity $$\label{zeta} \zeta=\left( \rho^2 +z^2 -\frac{\tau^2}{\alpha^2\lambda}t^2\right).$$ The two monopoles solution -------------------------- In [@BicSch89a], Bičák & Schmidt have constructed what is arguably the simplest non-trivial example of a boost-rotation symmetric “potential” $\mu$: that obtained from the superposition of retarded and advanced potentials due to two uniformly accelerated point particles, one with a positive mass, and the other with a negative one. The function $\mu$ thus obtained is by construction compatible with asymptotic flatness. Therefore, the boost-rotation symmetric spacetime arising from it will also be asymptotically flat modulo the usual problems at the intersection of the light cone through the origin with null infinity. Because of its asymptotic flatness, the Newtonian limit is expected to exist, and therefore it can be determined by simply looking at $\mu$ (cfr. §4.2). In terms of the dimensionless coordinates $(t,\rho,\chi,z)$ one has that $$\label{dipole} \mu= -\frac{4 m G \lambda}{\alpha \sqrt{(\zeta-1)^2+4\rho^2}},$$ where the constant $m$ has dimensions of mass and $\zeta$ given by (\[zeta\]). As explained previously, a non-trivial Newtonian limit for boost-rotation spacetimes will only exist, strictly speaking, for $t=0$ —the sources of the wave equation (\[wave\_with\_sources\]) and of the associated limiting Poisson equation vanish “above the roof”—. Thus, the direct naive evaluation of the limit $\lim_{\lambda \to 0} {\mu}/{\lambda}$ yields zero. In order to extract a non-trivial limit out of (\[dipole\]) we expand around $t=0$, so that $$\mu=-\frac{4 m G \lambda}{\alpha \sqrt{4\rho^2+(\rho^2+z^2-1)^2}}+ \O(t^2).$$ Thus, one could say that the Newtonian potential corresponding to the relativistic two-monopole boost-rotation symmetric spacetime is, for $t\approx 0$ given by $$\label{dipole_newtonian} \Phi\approx\frac{2 m G}{\alpha \sqrt{4\rho^2+(\rho^2+z^2-1)^2}}.$$ \[figure:sources\_1\] {width="6cm" height="6cm"} (-78,-6)[$z$]{} (-180,88)[$\rho$]{} The latter inherits the axial symmetry from the relativistic solution. Furthermore, it is singular at two points lying on the $z$-axis, $(\rho_{sing},\varphi_{sing},z_{sing})=(0,0,1)$ —see figure 3—. These singularities are naturally identified with the presence of two point-particles. Note that the potential is —by construction— time independent. Thus, the Newtonian limit for early times is a strictly static Newtonian potential in which the sources are not moving. Another remarkable feature of the solution is that, as can readily be checked, the masses of the two point particles giving rise to the Newtonian field have the same (positive) sign. The Curzon-Chazy $(01)$-pole particles solution. ------------------------------------------------ This example of boost-rotation symmetric spacetimes was first given in [@BicHoeSch83b]. It was constructed from the classical Bonnor-Swaminarayan solution [@BonSwa64] by considering an appropriate limiting procedure. This solution is interpreted as the superposition of a monopole particle and a dipole particle. Again, by construction, the “seed” function is compatible with asymptotic flatness so that a Newtonian limit is bound to exist. In this case one has $$\mu= -\frac{\scrd G\lambda}{\alpha^2}\frac{\zeta(\zeta-1)+2\rho^2}{\left((\zeta-1)^2+4\rho^2 \right)^{3/2}},$$ where $\scrd$ a constant of dipolar nature ($[\scrd]=ML$), and $\zeta$ as in (\[zeta\]). Again, expanding $\mu$ around $t=0$ one finds that $$\label{curzon_newton} \Phi=\frac{\scrd G}{\alpha^2}\left(\frac{ (\rho^2+z^2)(\rho^2+z^2-1)+2\rho^2} {(4\rho^2+(\rho^2z^2-1)^2)^{(3/2)}}\right).$$ The Newtonian potential is again singular at $(\rho_{sing},\varphi_{sing},z_{sing})=(0,0,\pm \sqrt{t^2+1})$. Looking at the level curves of the potential (\[curzon\_newton\]) one can perceive the fingerprints of the “dipole structure” of the point particles. The Generalized Bonnor-Swaminarayan solution -------------------------------------------- This solution was obtained in [@BicHoeSch83a] by using Ernst’s regularization procedure [@Ern78]. It describes two identical particles symmetrically located with respect to the plane $z=0$ and uniformly accelerated along the axis $\rho=0$. The interest of this example for our purposes lies in the known fact that this spacetimes is not asymptotically flat. In this case one has $$\mu= \frac{\scrd G \lambda}{\alpha^2} \left(1-\frac{1}{ \sqrt{(\zeta-1)^2+4\rho^2}}\right) + \left( 2\rho^2-\zeta\right),$$ where again $[\scrd]=ML$, and $\zeta$ given by (\[zeta\]). It can be readily seen that $\mu_{,\rho}=\O(\lambda^0)$, and thus, by propositions \[lemma:existence\] and \[lemma:consequences\], it does not possess a proper Newtonian limit. \[figure:sources\_2\] {width="6cm" height="6cm"} (-78,-6)[$z$]{} (-180,88)[$\rho$]{} The C metric. ------------- We conclude our discussion of examples by considering the epitome of the boost-rotation symmetric spacetimes: the C metric. Bonnor [@Bon83] was the first to cast it in the form which exhibits its boost-rotation symmetric nature. The metric function $\mu$ arises from solutions to the wave equation with sources which are uniformly accelerated rods moving along the $z$ direction. In terms of our dimensionless coordinates one has $$\label{c} \mu= \ln \left( \frac{1}{4\omega^2} \frac{ \sqrt{ (\zeta-\beta)^2 +4\beta\rho^2}+(\zeta-2\rho^2)-\beta}{\sqrt{ (\zeta-1)^2 +4\rho^2}+(\zeta-2\rho^2)-1} \right).$$ The classical parameters $m$ and $A$ are related to the parameters $\alpha$, $\beta$ and $\omega$ via, $$\alpha^2=2(z_2-z_1), \qquad \alpha^2\beta=2(z_2-z_3),$$ where $z_1$, $z_2$, $z_3$ are solutions of $$\label{cubic} 2A^4 z^3-A^2z^2+m^2=0.$$ It is assumed that the parameters $m$ and $A$ are such that the latter has 3 real solutions, and that $z_2$ is the biggest root. Finally, $$\omega^2=4m^2A^{-6}\alpha^{-8}(\beta-1)^{-2}.$$ The points where $\mu$ is singular can be identified with sources. A simple calculation shows then that this happens at $(0,0,z_{sing})$ with $z_{sing}\in(-\sqrt{\beta},-1)\cup (1,\sqrt{\beta})$ if $\beta > 1$ or $z_{sing}\in(-1,-\sqrt{\beta})\cup (\sqrt{\beta},1)$ if $\beta < 1$. If $\beta=1$, then no singular points occur, and the C metric is in fact Minkowski spacetime, that is, there are no sources. This seems to indicate that the geometry is induced by the presence two rods of finite length symmetrically located along the $z$-axis. This agrees with the description given by Bičák and Schmidt [@BicSch89a] on how to construct the C-metric from a “[s]{}eed”. Now, a direct evaluation shows that the conditions $\mu_{,\rho}=\O(\lambda)$ and $\mu_{,z}=\O(\lambda)$ needed for the existence of a Newtonian limit of the C-metric do not hold unless $$\label{beta} \beta=1+\beta_1\lambda+\O(\lambda).$$ Assuming the latter one finds $$\Phi = \frac{\beta_1}{2 \sqrt{4\rho^2+(\rho^2+z^2-1)^2}},$$ at $t\approx 0$. That is, one recovers the potential of the two monopoles solution. This is in agreement with the results by Bonnor, who concluded that in the weak field limit the C metric describes two accelerated monopoles [@Bon83]. Conclusions =========== We have discussed the Newtonian limit of boost-rotation symmetric spacetimes. It has been shown that the existence, or not, of a Newtonian limit depends on the asymptotic flatness of the relativistic spacetime. As discussed in the main text, boost-rotation symmetric spacetimes posses two Killing vectors: an axial one which is inherited by the Newtonian limit, and a boost Killing vector. The boost Killing vector field is not inherited in any clear way by the Newtonian limit as this symmetry is of relativistic nature. In order to construct “seed” fields $\mu$ which are analytical, one has to resort to suitable combinations of advanced and retarded fields due to boost-rotation symmetric sources for which the total amount of mass is zero. That is, one has to allow for the presence of negative masses. The presence of regions of space containing negative mass is preserved in the Newtonian limit in such a way that the total amounts of positive and negative masses cancel exactly each other. The standard interpretation of the boost-rotation symmetric spacetimes regards them as models of uniformly accelerated particles. As has been shown with the examples, the Newtonian limits are well defined for all times, however the interpretation of particles moving in an uniformly accelerated fashion is only valid for early times $t\approx 0$. The time dependence of Newtonian potential can be traced back to the fact that the sources in the relativistic regime carry their own source of motion: the struts or conical singularities joining them. In other words, the motion of the Newtonian sources is the Newtonian consequence of the singularities in the relativistic boost-rotation symmetric spacetimes. Summarizing, the Newtonian limits obtained exhibit several unphysical features; however, all of them can be traced back to problems already existing in the general relativistic solutions. Whether the struts and strings appearing in the general relativistic solutions here considered are “terribly” unphysical or not, is nevertheless a matter of taste. Finally, in §4.3 it has been shown that the potential suggested by a weak field analysis coincides, in the case where asymptotic flatness is required, with the Newtonian potential obtained through our analysis. There has been some discussion in the literature —cfr. [@BicSch89a; @Bon83]— in what regards writing the potentials as a combination of advanced and retarded fields. This discussion lies beyond the realm of our analysis, because in a purely Newtonian theory information travels with infinite speed. In order to look at these effects one would have to look at the post-Newtonian expansions of the solutions. Acknowledgements {#acknowledgements .unnumbered} ================ We would like to thank Profs. J.M.M. Aguirregabiria, W.B. Bonnor, L. Bel, J. Bičák, Dr. B. Coll and Profs. J.B. Griffiths, J.M.M. Senovilla and B. Schmidt for their interest in this work and for enrichening discussions and remarks in previous versions of this article. J.A.V.K. wishes to thank the Dept. of Theoretical Physics of the University of the Basque Country for their hospitality during the completion of part of this work. R. L.’s work is supported by the Spanish Ministry of Science and Technology jointly with FEDER funds through research grant BFM2001-0988, the University of the Basque Country through research grant UPV172.310G02/99, and the Basque Government through fellowship BFI01.412. J. A. V. K. is currently a Lise Meitner fellow of the Austrian FWF (M690-N09). Appendix: the axioms of Ehlers’ theory {#appendix-the-axioms-of-ehlers-theory .unnumbered} ====================================== The axioms of Ehlers’ frame theory and their consequences are discussed extensively for example in [@Lot88]. However, this reference is not so readily available. Therefore, for the sake of completeness we present them here. The axioms shown here are an adapted version of those appearing in Lottermoser’s thesis. The first set of axioms deals with the objects that the frame theory will attempt to describe. **(On the objects described by the frame theory).** The mathematical objects of the theory are collections $(M,t_{ij},s^{ij},\Gamma^i_{jk}, T^{ij},\lambda,G)$ for which the following holds: - $M$ is a 4-dimensional Hausdorff manifold endowed with a connection, - $t_{ij}$, $s^{ij}$ and $T^{ij}$ are symmetric tensor fields on $M$ (**temporal metric, spatial metric, matter tensor**), - $\Gamma^i_{jk}$ is a torsion-free linear connection on $M$ (**gravitational field**), - $\lambda$ and $G$ are real numbers (**causality and gravitational constant**). The axioms require some minimal differentiability conditions. Thus, $t_{ij}$, $s^{ij}$, $T^{ij}$ and $\Gamma^i_{jk}$ should at least be $C^1$ and $M$ at least a $C^3$ manifold. The next set of axioms describes, by means of observable quantities, how the objects of the frame theory ought to be interpreted. **(Physical interpretation)** - **Observers** move along timelike curves, that is, curves such that their tangent vector $u^i$ satisfies $t_{ij}u^i u^j>0$ everywhere. The **space directions** of an observer are the tangent vectors $v^i\neq 0$ along the curves which are orthogonal to $u^i$ with respect to $t_{ij}$: $t_{ij}u^i v^j=0$. - **Time intervals** are defined along timelike curves. Let $s$ be the curve parameter. Then for the infinitesimal time interval the following holds: $$dt=\sqrt{t_{ij}u^i u^j} ds.$$ - **Space intervals** are defined along spacelike curves, i.e. curves such that for their tangent vector $v^i$ there exists a 1-form $\omega_i$ which satisfies $$v^i=\omega^i_\bullet,$$ and $s^{ij}\omega_i\omega_j>0$. If $s$ is again the curve parameter, then the **spatial interval** is given by $$dl=\sqrt{s^{ij}\omega_i\omega_j}ds.$$ The following 2 axioms establish the conditions a mathematical model should satisfy in order to be called a “solution of the frame theory”. **(Metric axioms)** - At each point of the spacetime, there exists at least one timelike vector, $$\forall p \in M \;\;\exists u^i\in T_p M:\;\; t_{ij} u^i u^j>0.$$ - At each point of the spacetime, the temporal metric is positive definite at each observer orthogonal subspace of the cotangent space. That is, $$\forall p \in M, \;\;u^i \in T_p M,\;\; t_{ij}u^i u^j >0$$ $s^{ij}$ is positive definite in the set $H^+(u^i)=\{\omega \in T_p^* M|\;\; \omega_i v^j =0 \}$. - the temporal and spatial metrics are related to each other via, $$t_{ij}s^{jk}=-\lambda \delta_i^k.$$ **(Connection axioms)** - The connection $\Gamma^i_{jk}$ is compatible with the temporal and spatial metrics metrics, i.e. $$t_{ij;k}=0, \qquad s^{ij}_{\phantom{ij};k}=0$$ - the curvature tensor $R^i_{jkl}= 2(\Gamma^i_{j[l,k]}+ \Gamma^i_{m[k}\Gamma^m_{l]j})$ of $\Gamma^i_{jk}$ possesses the property, $$R^{i\phantom{j}k}_{\phantom{i}j\bullet l}= R^{k\phantom{l}i}_{\phantom{k}l\bullet j}.$$ [10]{} J. Bičák, , Proc. Roy. Soc. Lond. A [**302**]{}, 201 (1968). J. Bičák, , in [*Galaxies, axisymmetric systems and relativity*]{}, edited by M. A. H. Mac[C]{}allum, Cambridge University Press, 1985. J. Bičák, , in [*Gravitation and geometry*]{}, edited by W. Rindler & A. Trautman, Bibliopolis, 1987. J. Bičák, , in [*Einstein Field Equations and Their Physical Implications (Selected essays in honour of Juergen Ehlers)*]{}, edited by B. G. Schmidt, Springer Verlag, 2000. J. Bičák, C. Hoenselaers, & B. G. Schmidt, , Proc. Roy. Soc. Lond. A [**390**]{}, 397 (1983). J. Bičák, C. Hoenselaers, & B. G. Schmidt, , Proc. Roy. Soc. Lond. A [**390**]{}, 411 (1983). J. Bičák & A. Pravdová, , J. Math. Phys. [**39**]{}, 6011 (1998). J. Bičák & B. G. Schmidt, , J. Math. Phys. [**25**]{}, 600 (1984). J. Bičák & B. G. Schmidt, , Phys. Rev. D [**40**]{}, 1827 (1989). H. Bondi, , Rev. Mod. Phys. [**29**]{}, 423 (1957). W. B. Bonnor, , Gen. Rel. Grav. [**15**]{}, 535 (1983). W. B. Bonnor & N. Swaminarayan, , Z. Phys. [**177**]{}, 240 (1964). G. Dautcourt, , Class. Quantum Grav. [**14**]{}, A109 (1997). J. Ehlers, , in [*Understanding physics*]{}, edited by A. K. Richter, Copernicus Gesellschaft, 1998. F. J. Ernst, , J. Math. Phys. [**19**]{}, 1986 (1978). S. Hawking & S. F. Ross, , Phys. Rev. Lett. [**75**]{}, 3382 (1995). M. Lottermoser, , PhD thesis, Lüdwig-[M]{}aximilians [U]{}niversität [M]{}ünchen, 1988. R. Penrose, , Phys. Rev. Lett. [**10**]{}, 66 (1963). V. Pravda & A. Pravdová, , Czech. J. Phys. [**50**]{}, 333 (2000). A. Trautman, , in [*Perspectives in Geometry and Relativity*]{}, edited by B. Hoffmann, page 425, Indiana University Press, 1966. J. A. Valiente Kroon, , J. Math. Phys. [**41**]{}, 898 (2000). J. Winicour, , J. Math. Phys. [**25**]{}, 1193 (1983). [^1]: email address: [[email protected]]{} [^2]: email address: [ [email protected]]{} [^3]: Current address: Institut für Theoretische Physik der Universität Wien, Boltzmanngasse 5, A-1090, Austria [^4]: For a discussion of the concept of negative mass in General Relativity, the reader is remitted to the classical article by Bondi [@Bon57]. [^5]: See however [@HawRos95], in which it is argued that conical singularities arising in, for example, the C metric can be considered as a limit of real strings. [^6]: In this article the function $\nu$ will correspond to the function $\lambda$ of Bičák & Schmidt [@BicSch89a] and most of the classical references on the subject. This is because $\lambda$ will be reserved for the causality constant. The reader has been warned! | Mid | [
0.5924050632911391,
29.25,
20.125
] |
DESCRIPTION (Applicant's Description): Mai Huong Nguyen, M.D. began her position at UCLA in July 1995 as Assistant Professor of Surgery in the Division of Oncology. Previously, she was trained as a surgical oncologist and did research in tumor angiogenesis at Harvard Medical School. Her goal is to become an independent physician scientist and teacher. She is dedicated to cancer research. UCLA is an established institution with many resources, and the Division of Surgical Oncology is committed towards her development as a physician scientist. The survival and growth of solid tumors is dependent on their ability to initiate and sustain new capillary growth, i.e., angiogenesis. The overall goal of Dr. Nguyen's research is to establish the importance of adhesion molecules important in tumor angiogenesis and metastasis. Specifically, her strategy is to analyze the role of E-selectin and its sialyl Lewis X/A glycoconjugates in tumor angiogenesis and metastasis. Her first aim includes: 1A) To determine whether E-selectin is preferentially expressed in the endothelium of the proliferating tumor capillaries by immunohistochemistry of human cancer specimens and by measuring the in vitro expression of E-selectin of endothelial cells within a tumor environment; 1B) To determine whether angiogenesis can be suppressed in vitro and in vivo by specific inhibitors which interfere with the interaction between E-selectin and sialyl Lewis X/A; and 1C) To construct an adenoviral plasmid linked to the E-selectin promoter in order to specifically target the tumor vasculature for future gene therapy. Her second aim includes: 2A) To determine whether metastasis can be suppressed in vivo by specific inhibitors which interfere with the interaction between E-selectin and sialyl Lewis X/A; and 2B) To identify and characterize the tumor cell glycoprotein which carries the sialyl Lewis X/A glycoconjugates. These studies will add to the understanding of the role of cell adhesion molecules in tumor angiogenesis and metastasis, and may result in a novel approach toward cancer therapeutics. | High | [
0.7242798353909461,
33,
12.5625
] |
The present invention relates generally to an orthodontic bracket having a trapezoidal configuration wherein sight lines on the bracket are utilized to facilitate alignment and positioning of the bracket on the tooth. There are numerous tooth configurations and sizes which vary from one patient to the next. In most cases, however, the majority of people having malposed teeth have teeth which conform to certain profiles and sizes such that orthodontic brackets mounted on the teeth can also be standardized to correspond to certain tooth sizes and configurations. At the same time brackets are being standardized, they are also becoming smaller. With the advance of higher quality casting and finishing processes the sizes of orthodontic brackets have gotten smaller for a number of reasons, several of which are to reduce the cost of raw materials and for aesthetic purposes so as to draw less attention to the wearer. Smaller brackets are also advantageous since they reduce irritation and pain to the patient caused by larger brackets and appliances. With the advent of the smaller bracket designs there has occurred several disadvantages. For example, the amount of time a patient is in the chair while the orthodontist is mounting orthodontic brackets has increased. This not only increases the cost to the patient, but reduces the efficiency of the orthodontist and reduces the amount of time he might spend with other patients. Further, smaller sized brackets increase the likelihood of misalignment of the bracket in relation to the tooth thereby causing several more problems. Misalignment results in difficulty in mounting the archwire in the archwire slot of the bracket and may also cause undesired or unplanned movement of a particular tooth, resulting in a longer time for treatment to move the tooth to the proper position. Misalignment of a bracket in relation to the tooth and the archwire might even require removal of the bracket and remounting. Certain prior art patents purport to have design features which facilitate alignment of the bracket on the tooth. One such patent, U.S. Pat. No. 4,415,330, discloses a bracket having a rhomboidal configuration which has edges that align, for example, with the occlusal plane and the crown long axis. The patent discloses tie wings having edges that are parallel to the crown long axis to assist in alignment during mounting of the bracket. Also, the occlusal and gingival tip of the tie wings are parallel to each other and to the occlusal plane again to facilitate alignment. The patent does not, however, have mesial and distal sides that are substantially parallel to the mesial and distal sides of the tooth upon which the bracket is mounted. Thus, with respect to the tooth configuration, the prior art patent ignores the shape of the tooth and its structural features. The orthodontic bracket of the present invention was designed to obviate the problems in aligning and positioning a bracket on the tooth. It is thus an object of the present invention to provide an orthodontic bracket having a trapezoidal configuration to substantially conform to the shape of the tooth. It is another object of the invention to provide an orthodontic bracket having a trapezoidal configuration wherein sight lines are used to increase the accuracy in aligning and positioning the bracket on the tooth. It is a further object of the invention to reduce the amount of time that a patient is in the chair while the orthodontist is mounting brackets. It is a still further object of the invention to provide an orthodontic bracket that will reduce the likelihood that an orthodontist will have to re-mount the bracket to correct for misalignment between the bracket and the tooth. | Mid | [
0.65,
30.875,
16.625
] |
Relativistic quantum scars. The concentrations of wave functions about classical periodic orbits, or quantum scars, are a fundamental phenomenon in physics. An open question is whether scarring can occur in relativistic quantum systems. To address this question, we investigate confinements made of graphene whose classical dynamics are chaotic and find unequivocal evidence of relativistic quantum scars. The scarred states can lead to strong conductance fluctuations in the corresponding open quantum dots via the mechanism of resonant transmission. | High | [
0.693766937669376,
32,
14.125
] |
from enum import IntFlag from typing import List from recognizers_text import Culture, Recognizer, Model from recognizers_number.number.models import NumberMode, NumberModel, OrdinalModel, PercentModel, ModelResult from recognizers_number.number.parser_factory import ParserType, AgnosticNumberParserFactory from recognizers_number.number.english.extractors import EnglishNumberExtractor, EnglishOrdinalExtractor, EnglishPercentageExtractor from recognizers_number.number.english.parsers import EnglishNumberParserConfiguration from recognizers_number.number.spanish.extractors import SpanishNumberExtractor, SpanishOrdinalExtractor, SpanishPercentageExtractor from recognizers_number.number.chinese.extractors import ChineseNumberExtractor, ChineseOrdinalExtractor, ChinesePercentageExtractor from recognizers_number.number.chinese.parsers import ChineseNumberParserConfiguration from recognizers_number.number.japanese.extractors import JapaneseNumberExtractor, JapaneseOrdinalExtractor, JapanesePercentageExtractor from recognizers_number.number.japanese.parsers import JapaneseNumberParserConfiguration from recognizers_number.number.spanish.parsers import SpanishNumberParserConfiguration from recognizers_number.number.portuguese.extractors import PortugueseNumberExtractor, PortugueseOrdinalExtractor, PortuguesePercentageExtractor from recognizers_number.number.portuguese.parsers import PortugueseNumberParserConfiguration from recognizers_number.number.french.extractors import FrenchNumberExtractor, FrenchOrdinalExtractor, FrenchPercentageExtractor from recognizers_number.number.french.parsers import FrenchNumberParserConfiguration class NumberOptions(IntFlag): NONE = 0 class NumberRecognizer(Recognizer[NumberOptions]): def __init__(self, target_culture: str = None, options: NumberOptions = NumberOptions.NONE, lazy_initialization: bool = True): if options < NumberOptions.NONE or options > NumberOptions.NONE: raise ValueError() super().__init__(target_culture, options, lazy_initialization) def initialize_configuration(self): # region English self.register_model('NumberModel', Culture.English, lambda options: NumberModel( AgnosticNumberParserFactory.get_parser( ParserType.NUMBER, EnglishNumberParserConfiguration()), EnglishNumberExtractor(NumberMode.PURE_NUMBER) )) self.register_model('OrdinalModel', Culture.English, lambda options: OrdinalModel( AgnosticNumberParserFactory.get_parser( ParserType.ORDINAL, EnglishNumberParserConfiguration()), EnglishOrdinalExtractor() )) self.register_model('PercentModel', Culture.English, lambda options: PercentModel( AgnosticNumberParserFactory.get_parser( ParserType.PERCENTAGE, EnglishNumberParserConfiguration()), EnglishPercentageExtractor() )) # endregion # region Chinese self.register_model('NumberModel', Culture.Chinese, lambda options: NumberModel( AgnosticNumberParserFactory.get_parser( ParserType.NUMBER, ChineseNumberParserConfiguration()), ChineseNumberExtractor() )) self.register_model('OrdinalModel', Culture.Chinese, lambda options: OrdinalModel( AgnosticNumberParserFactory.get_parser( ParserType.ORDINAL, ChineseNumberParserConfiguration()), ChineseOrdinalExtractor() )) self.register_model('PercentModel', Culture.Chinese, lambda options: PercentModel( AgnosticNumberParserFactory.get_parser( ParserType.PERCENTAGE, ChineseNumberParserConfiguration()), ChinesePercentageExtractor() )) # endregion # region Japanese self.register_model('NumberModel', Culture.Japanese, lambda options: NumberModel( AgnosticNumberParserFactory.get_parser( ParserType.NUMBER, JapaneseNumberParserConfiguration()), JapaneseNumberExtractor() )) self.register_model('OrdinalModel', Culture.Japanese, lambda options: OrdinalModel( AgnosticNumberParserFactory.get_parser( ParserType.ORDINAL, JapaneseNumberParserConfiguration()), JapaneseOrdinalExtractor() )) self.register_model('PercentModel', Culture.Japanese, lambda options: PercentModel( AgnosticNumberParserFactory.get_parser( ParserType.PERCENTAGE, JapaneseNumberParserConfiguration()), JapanesePercentageExtractor() )) # endregion # region Spanish self.register_model('NumberModel', Culture.Spanish, lambda options: NumberModel( AgnosticNumberParserFactory.get_parser( ParserType.NUMBER, SpanishNumberParserConfiguration()), SpanishNumberExtractor(NumberMode.PURE_NUMBER) )) self.register_model('OrdinalModel', Culture.Spanish, lambda options: OrdinalModel( AgnosticNumberParserFactory.get_parser( ParserType.ORDINAL, SpanishNumberParserConfiguration()), SpanishOrdinalExtractor() )) self.register_model('PercentModel', Culture.Spanish, lambda options: PercentModel( AgnosticNumberParserFactory.get_parser( ParserType.PERCENTAGE, SpanishNumberParserConfiguration()), SpanishPercentageExtractor() )) # endregion # region Portuguese self.register_model('NumberModel', Culture.Portuguese, lambda options: NumberModel( AgnosticNumberParserFactory.get_parser( ParserType.NUMBER, PortugueseNumberParserConfiguration()), PortugueseNumberExtractor(NumberMode.PURE_NUMBER) )) self.register_model('OrdinalModel', Culture.Portuguese, lambda options: OrdinalModel( AgnosticNumberParserFactory.get_parser( ParserType.ORDINAL, PortugueseNumberParserConfiguration()), PortugueseOrdinalExtractor() )) self.register_model('PercentModel', Culture.Portuguese, lambda options: PercentModel( AgnosticNumberParserFactory.get_parser( ParserType.PERCENTAGE, PortugueseNumberParserConfiguration()), PortuguesePercentageExtractor() )) # endregion # region French self.register_model('NumberModel', Culture.French, lambda options: NumberModel( AgnosticNumberParserFactory.get_parser( ParserType.NUMBER, FrenchNumberParserConfiguration()), FrenchNumberExtractor(NumberMode.PURE_NUMBER) )) self.register_model('OrdinalModel', Culture.French, lambda options: OrdinalModel( AgnosticNumberParserFactory.get_parser( ParserType.ORDINAL, FrenchNumberParserConfiguration()), FrenchOrdinalExtractor() )) self.register_model('PercentModel', Culture.French, lambda options: PercentModel( AgnosticNumberParserFactory.get_parser( ParserType.PERCENTAGE, FrenchNumberParserConfiguration()), FrenchPercentageExtractor() )) # endregion def get_number_model(self, culture: str = None, fallback_to_default_culture: bool = True) -> Model: return self.get_model('NumberModel', culture, fallback_to_default_culture) def get_ordinal_model(self, culture: str = None, fallback_to_default_culture: bool = True) -> Model: return self.get_model('OrdinalModel', culture, fallback_to_default_culture) def get_percentage_model(self, culture: str = None, fallback_to_default_culture: bool = True) -> Model: return self.get_model('PercentModel', culture, fallback_to_default_culture) def recognize_number(query: str, culture: str, options: NumberOptions = NumberOptions.NONE, fallback_to_default_culture: bool = True) -> List[ModelResult]: recognizer = NumberRecognizer(culture, options) model = recognizer.get_number_model(culture, fallback_to_default_culture) return model.parse(query) def recognize_ordinal(query: str, culture: str, options: NumberOptions = NumberOptions.NONE, fallback_to_default_culture: bool = True) -> List[ModelResult]: recognizer = NumberRecognizer(culture, options) model = recognizer.get_ordinal_model(culture, fallback_to_default_culture) return model.parse(query) def recognize_percentage(query: str, culture: str, options: NumberOptions = NumberOptions.NONE, fallback_to_default_culture: bool = True) -> List[ModelResult]: recognizer = NumberRecognizer(culture, options) model = recognizer.get_percentage_model( culture, fallback_to_default_culture) return model.parse(query) | Mid | [
0.598890942698706,
40.5,
27.125
] |
Thursday, September 24, 2015 I enjoyed Phantom Stranger under Dan DiDio, but then J. M. DeMatteis came on the title and delivered as good if not better on the (sadly mostly overlooked) series. In Justice League Dark Vol. 5: Paradise Lost, DeMatteis's first independent Dark trade, he takes over from Jeff Lemire (and artist Andres Guinaldo takes over for Mikel Janin), which seems to me a much tougher act to follow. DeMatteis doesn't present the Dark characters poorly, but the trade contains two "secret origin"-type stories, and neither improved on the character it profiled. The book lacks complexity at a time when comics need it all the more.[Review contains spoilers] DeMatteis's three-part origin of the Nightmare Nurse and two-part origin of Deadman each, in the broad strokes, come off tonally similar, in that both involve the focal hero ripped away from their life, some giant mystical threat wants to take advantage of this, and the Dark team members fight to get their friend back. The focus of each story is the story, in that DeMatteis doesn't hint at any side plots or storylines that might develop in Dark over time (notwithstanding the looming Convergence cancellation). In this way the stories come off as very one-note, essentially good guys versus large ghostly-or-mysterious bad guys, and so there's not much to feel involved in aside from the aforementioned "secret origins." What's revealed about Nightmare Nurse is that she's some kind of (vaguely defined) body-hopping demon who's been possessing the unwilling body of a woman named Alice Winter for centuries. Frankly, far more interesting would be if Nightmare Nurse really was a rogue demon who the Dark would decide, weighing the benefits against the cost, to actually continue stealing a young woman's life. Instead, the Nurse claims innocence all along, and in the end turns out to indeed be innocent, and Winter allows herself to be "repossessed" willingly. I've no grudge against a happy ending, but it takes DeMatteis three issues to basically reveal something not too shocking about Nightmare Nurse and then to return her to the status quo; I frankly liked the Nurse more when she was a mysterious, trash-talking mystic healer that we didn't know so much about. With Deadman, DeMatteis posits that Boston Brand is among special children trained in mysticism in Nanda Parbat and then made to forget, reminiscent of one of Donna Troy's origins, such that Brand's later resurrection as Deadman is more fate than accident. For me, this overcomplicates and also mitigates some of the better parts of Deadman's origins; in the superhero aesthetic, it works that Brand was a circus performer and a not-so-nice guy who, when killed and resurrected, gets the opportunity to atone for his past sins as a ghost. Bringing in the "chosen" schtick loses the "everyman" feel of Deadman (similar to Barry Allen getting struck by lightning). As well, DeMatteis's introduction of Deadman's advisor Brahma Dass entirely conflicts with Paul Jenkins's recent Deadman origin (via Rama Kushna) in DC Universe Presents; I gather this might have been explained away in DeMatteis's recent Secret Origins Deadman story, but that's an issue that sorely needed to be included here and wasn't. The book is highly overnarrated, too, especially the Deadman parts, with DeMatteis not seeming to trust the audience following a bit of nuance. Consider the fourth chapter, issue #33, where DeMatteis can't just show us Zatanna appearing sad while gazing at a photo of her parents, but also needs to have Deadman tell the audience she's sad and have Zatanna say aloud that she misses her parents. A page later, Deadman is suddenly transported from the House of Mystery to a frozen wasteland, and it's not enough for the scene to change and Deadman to exclaim "What the hell," but also DeMatteis has Deadman narrate that he's not where he was a moment ago. There are instances like this throughout where art, dialogue, and narration all do the same thing instead of one deferring to the others. Artist Andres Guinaldo succeeds in some of the book's monstrous creations (especially in depicting Nightmare Nurse's demon form). But, by and large Guinaldo's art lacks the edge that Dark needs (and that Janin brought), depicting everything too straightforward and brightly. I'd hoped the Deadman story might result in a new costume for Deadman, something I think is badly needed; it did not, and also Guinaldo draws Deadman's circus collar as a kind of halo around his head, which added to its rather dated look. The book ends with a Futures End tie-in by DeMatteis with Len Wein. Acknowledging Wein's contribution, the issue could be read as kind of a one-off House of Mystery-type story, in which the Dark encounter a mysterious man out in the void, he turns out to be possessed by a demon, and then in the gruesome twist they save the man but cut his head off just to be safe. But even with the future setting (and even, I'm glad to see, with DeMatteis getting to use Phantom Stranger's Cassandra Craft one last time), it's once again a Justice-League-Dark-fights-creatures-from-the-void story, essentially the same as the two origins. Also, after Demon Knights spent so long setting up a relationship between Madame Xanadu and Etrigan the Demon, the writers' choice here to pair the future-Zatanna with Etrigan comes off as poor research even despite the "five years later" jump. Were Justice League Dark Vol. 5: Paradise Lost not the last volume, I might very well think twice about continuing; this is a book that didn't actually start that strongly, but that picked up in the middle and had a good couple volumes -- Justice League Dark Vol. 2: Books of Magic being the best -- but that's faltered. Only that DeMatteis has one more volume left -- and that it seems to star a pretty wide swath of Justice League Dark characters past and present -- will bring me back for the finale. Glad to hear Vol. 6 is better; I'm looking forward to reading it as the conclusion to a series I've very much enjoyed at times. Thanks for the tip on Secret Origins; I wasn't too keen on the first book, but maybe I'd have to check out the second one for the Deadman clarification and others. About Me Interested in advertising on Collected Editions, want to sponsor a pitch for your graphic novel, like to contribute a review, or just want to chat about trade paperbacks? Send an email to collectededitions at yahoo d-o-t com. | Low | [
0.51409978308026,
29.625,
28
] |
/* Empty since the pwritev syscall is equivalent. */ | Low | [
0.413654618473895,
25.75,
36.5
] |
Dan Li Contents Dan Li started his professional acting career in 1993, with a small role on the film Farewell My Concubine. Eventually, he returned to acting in 2008, appearing in the short film Dorothy and the TV show Hotel Babylon that year. Since then, Li has appeared in numerous TV series and video games, as well. Some of the shows in which Li has appeared are Casualty, Doctor Who, and Black Mirror (with Ken Drury). He has also had recurring roles on other TV shows like My Spy Family, Ideal, and The Deep (with Nigel Whitmey and Sacha Dhawan). | High | [
0.660465116279069,
35.5,
18.25
] |
This article is about the Human. You may be looking for San Hill or other people and things named San. This article is about. You may be looking for San Hill was a Human male and the Chairman of the InterGalactic Banking Clan during the Rebellion era. He was kidnapped on the planet of Muunilinst by bounty hunter IG-88. After his capture, he provided the Zann Consortium with access codes to the IBC's computer systems. This article is a stub about a character. You can help Wookieepedia by expanding it. | Low | [
0.414814814814814,
28,
39.5
] |
Teratological evaluation of Ukrain in hamsters and rats. The compound Ukrain, containing thiophosphoric acid alkaloid derivatives from the plant Chelidonium majus L., was given intramusculary (i.m.) on days 6-11 of gestation to hamsters and on days 6-15 of gestation to rats in doses of 0.1, 1.67 and 28 mg/kg daily. No clinical signs of toxicity were found in treated animals and no teratogenic effect could be noted in either species. Such parameters as the number of corpora lutea, implantation sites, pre and post-implantation losses, number of live foetuses per litter, placental weight, foetal weight and crown-rump length were not significantly different between the Ukrain treated rats and the controls. Slight embryotoxic effects (increased post-implantation losses) and in consequence decreased number of average litter size were noted in hamsters exposed to Ukrain at doses which were otherwise not embryotoxic to rats. | Mid | [
0.617848970251716,
33.75,
20.875
] |
// <copyright file="IChangeTradeButtonStatePlugIn.cs" company="MUnique"> // Licensed under the MIT License. See LICENSE file in the project root for full license information. // </copyright> namespace MUnique.OpenMU.GameLogic.Views.Trade { /// <summary> /// Interface of a view whose implementation informs about a change in the trade button state. /// </summary> public interface IChangeTradeButtonStatePlugIn : IViewPlugIn { /// <summary> /// Changes the state of the other players trade button. /// </summary> /// <param name="state">The state.</param> void ChangeTradeButtonState(TradeButtonState state); } } | High | [
0.6681614349775781,
37.25,
18.5
] |
package Chapter_18; import java.util.Scanner; /** * (Decimal to binary) * Write a recursive method that converts a decimal number * into a binary number as a string. The method header is: * * public static String dec2Bin(int value) * * Write a test program that prompts the user to enter a decimal * number and displays its binary equivalent. * * Created by Luiz Arantes Sa on 12/2/14. */ public class Exercise_21 { public static void main(String[] args) { System.out.print("Enter a number: "); int number = new Scanner(System.in).nextInt(); System.out.print(number + " in binary is " + dec2Bin(number)); } public static String dec2Bin(int value) { String s = ((value & 1) == 1) ? "1" : "0"; if (value == 0 || value == 1) return s; else return dec2Bin(value >> 1) + s; } } | Mid | [
0.6275395033860041,
34.75,
20.625
] |
1. The Field of the Invention The present invention relates to electronic messages and, more particularly, to organizing electronic mail messages into conversations. 2. Background and Relevant Art Computer systems and related technology affect many aspects of society. Indeed, the computer system's ability to process information has transformed the way we live and work. Computer systems now commonly perform a host of tasks (e.g., word processing, scheduling, and database management) that prior to the advent of the computer system were performed manually. More recently, computer systems have been coupled to one another and to other electronic devices to form both wired and wireless computer networks over which the computer systems and other electronic devices can transfer electronic data. As a result, many tasks performed at a computer system (e.g., voice communication, accessing electronic mail, controlling home electronics, Web browsing, and printing documents) include the exchange of electronic messages between a number of computer systems and/or other electronic devices via wired and/or wireless computer networks. Networks have in fact become so prolific that a simple network-enabled computing system may communicate with any one of millions of other computing systems spread throughout the globe over a conglomeration of networks often referred to as the “Internet”. Such computing systems may include desktop, laptop, or tablet personal computers; Personal Digital Assistants (PDAs); telephones; or any other computer or device capable of communicating over a digital network. In particular, electronic mail has become an important method for communicating. To create an electronic mail message, a sending user typically manipulates input devices, such as a keyboard and mouse, within an electronic mail application to enter data (e.g. text and attachments) into the electronic mail message. The sending user also typically includes an electronic mail address of a recipient user in the electronic message, for example, by entering text in the “To” field. The sending user then sends the electronic mail message to the recipient user by selecting a “Send” control within the electronic mail application. Sending the electronic message can cause the electronic mail message to be routed from the sending user's computer system, through one or more intermediate mail servers, to a destination mail server that stores electronic mail messages for the recipient user (e.g., in accordance with the Simple Mail Transfer Protocol (“SMTP”). To access the electronic mail message, the recipient user establishes a connection from an electronic mail application (at the recipient user's computer system) to the receiving mail server (e.g., in accordance with the Post Office Protocol (“POP”) or Internet Message Access Protocol (“IMAP”)). The electronic mail message is downloaded over the connection and can be presented at the recipient user's computer system. Due to quantity of electronic mail messages that entities receives, various mechanisms for organizing electronic mail messages have been developed. Typically, mail servers maintain one or more mail folders (e.g., inbox, outbox, sent items, SPAM, or user-defined folders) for each electronic mail user. Electronic mail messages can be transferred to different folders (either automatically or in response to user input) based on the message contents, user-created rules, or default server rules. For example, when an electronic mail message is sent to recipient user, the electronic mail message by default can be me moved to a “Sent Items” folder. Alternately, a recipient user, after receiving an electronic mail message from a family member, can manually transfer the received electronic mail message to a user-defined “Family” folder. In some environments, electronic mail rules can automatically move or copy an electronic mail message to a particular folder. Using folders, an electronic mail user can access groups of electronic mail messages that have various similar characteristics. For example, an electronic mail user can access an “Inbox” folder to access received electronic messages or can access a “Family” to access electronic messages related to the electronic mail user's family. In some environments, electronic mail users exchange a set of electronic mail messages that are part of the same “conversation.” For example, co-workers may exchange a set of electronic messages related to specified topic (e.g., where to go to lunch). Unfortunately, typical electronic mail applications are individual message centric. Thus, it may be difficult for one co-worker to identify that a number of individual messages from one or more other co-workers are all related to the specified topic and/or are part of the same conversation. Some electronic mail applications loosely relate electronic message to one another such that the electronic messages can be presented at a user-interface as being part of the same conversation. For example, some electronic mail applications append a conversation index and/or conversation ID to electronic mail messages to identify a conversation and/or a position within the conversation. In some environments, specified electronic mail message headers can be used to identify relationships between electronic messages. For example, Request For Comments (“RFC”) 2822 “In-Reply-To” and “References” headers can be used to identify that an electronic mail message is related to one or more other electronic mail messages. However, while electronic message headers and appended conversation IDs can be utilized to group electronic message for presentation, typical electronic mail applications do not create or maintain additional conversation specific data. For example, existing electric mail applications do not link electronic mail messages to a specified conversation item. Thus, presentation of a conversation view requires a user-interface to scan electronic mail messages in a folder for conversation IDs and/or message headers. Based on the scanned conversation IDs and/or message headers, the user-interface re-constructs a conversation tree the scanned messages. Unfortunately, the lack of conversation specific data also limits electronic mail message identification to electronic messages that are included in the same folder. That is, typical electronic mail applications can not identify electronic messages in different folders (e.g., in an “Inbox” folder and a “Sent Items” folder) as being part of the same conversation. Thus, presented conversation views of electronic messages are often incomplete. Further, in part due to the lack of conversation specific data and inability to otherwise identify all the electronic mail messages in a conversation, there is typically no mechanism for performing an operation over all the messages that are included in a conversation. For example, it would be difficult, if not impossible, to create an electronic mail rule that automatically moves all electronic messages included a specific conversation to a specified electronic mail folder (e.g., to a SPAM or archive folder). Therefore systems, methods, data structures, and computer program products that facilitate organizing electronic mail messages into conversations would be advantageous. | Mid | [
0.5483870967741931,
31.875,
26.25
] |
Study on the metabolic fate of catena-(S)-[mu-[N alpha-(3-aminopropionyl)histidinato(2-)-N1,N2,O:N tau]-zinc]. 4th communication: disposition of zinc and amino acids in rats, dogs and monkeys. The time course of the zinc plasma concentrations in rats, dogs and monkeys and the metabolic fate of L-carnosine were investigated after oral administration of Z-103 (catena-(S)-[mu-[N alpha-(3-aminopropionyl)histidinato(2-)-N1,N2,O:N tau]-zinc], CAS 107667-60-7). There was no intradiurnal variation in the plasma concentrations of endogenous zinc in rats, dogs and monkeys. The plasma concentrations of endogenous zinc in dogs and monkeys were approximately the same as that in humans, whereas the plasma concentration of zinc in rats was 2.2-fold higher than that in man. After administration of Z-103 to non-fasted dogs at 100 mg/kg, the plasma concentration of zinc reached Cmax at 0.5 h after administration (1.7-fold higher than endogenous zinc level), while the plasma concentration was the lowest in comparison with other animal species. After administration to fasting rats at 50 mg/kg, the plasma concentration of zinc reached Cmax at 1 h after administration (2.5-fold higher than endogenous zinc level) and decreased thereafter, returning to the endogenous level at 8 h after administration. After oral administration to monkeys at 10 mg/kg and 50 mg/kg, the Cmax values were 4.1-fold and 6.8-fold higher than the endogenous level, respectively. The Tmax values were achieved at 4-6 h and 8 h after each administration, respectively, showing slower absorption in comparison with other animal species.(ABSTRACT TRUNCATED AT 250 WORDS) | Mid | [
0.644736842105263,
30.625,
16.875
] |
Significant research confirmed that errors in the grip are one of the most common challenges for Club Professionals working with students today. With the TR3 Grip Training Glove, the correct grip can be locked into place for hitting full practice shots, allowing the golfer to concentrate on swing mechanics, and avoid the common "re-grip" problem. A fully-functional golf glove made with high grade materials and quality craftsmanship, this training aid easily transitions to a USGA legal playing glove when not in the locked position. Don't guess at the proper grip, lock it in and groove your swing. We believe in complete customer satisfaction and lasting value, which is why we guarantee a perfect delivery of your discount golf equipment. We'd love to be able to promise that you'll improve your golf game but at least we can assure you that you will get the quality and service you expect, and together we'll improve your golf game! | High | [
0.6819338422391851,
33.5,
15.625
] |
Billets (film) Billets is a 1925 silent-era British comedy film directed by Leslie S. Hiscott and featuring Sydney Fairbrother and Irene Tripod. Cast Sydney Fairbrother as Mrs. May Irene Tripod as Mrs. McMull References External links Category:1925 films Category:British comedy films Category:1920s comedy films Category:Films directed by Leslie S. Hiscott Category:British silent short films Category:British films Category:British black-and-white films | Low | [
0.449074074074074,
24.25,
29.75
] |
Q: Testing REST api built using Node.js(Express) on Travis CI I want to test the rest api service i created using Express framework and MongoDb on Travis CI. The test works locally on my machine but fails on Travis CI. I'm guessing the problem is with my .travis.yml and package.json. Here is how i run my test locally: // opens mongodb database on port 27017 mongod // reads the db and returns documents depending on the request node express.js // test CRUD operations on the app mocha express.test.js How can i do the same on travis CI? Here is my app https://github.com/mujuni88/Express-RestApi-Tutorial. travis.yml: language: node_js node_js: - "0.10" - "0.9" services: mongodb script: - "./node_modules/mocha/bin/mocha *.test.js" package.json: { "name":"express-restapi", "author":"Joe Buza", "description":"Express RestApi", "version": "0.0.1", "private": true, "keywords":["angular", "mocha", "mongodb", "express"], "license":"BSD", "dependencies": { "express":"3.4.4", "mongoskin":"0.6.0" }, "devDependencies":{ "mocha":"1.13.0", "expect.js":"0.2.0", "superagent":"0.15.7" }, "scripts":{ "start":"node express.js" } } A: The answer is simple - Travis will not start up your server for you, if you not specify this in scripts steps. Look at my repository (it's a bit complicated, but hey, it does testing). You can add require of express.js into express.test.js and start up server from there. After all tests is completed do not forget to tear it down. | High | [
0.6701030927835051,
32.5,
16
] |
Social Icons Pages Tuesday, June 3, 2014 While I’m a big believer in the positive thinking movement, one of the first misconceptions I work with clients on is that you can’t just positively think, or will certain thoughts or feelings away. There gets to be an honoring and accepting where you are in order to let go of what you don’t want. Only then can you allow what you dowant to come into your space. The thought or emotion must be felt and validated in order for it to flow out of you. And while what once was a beautiful ability to forge ahead into unknown territory, and what ultimately led our early pioneers to settle this American soil, learning to feel was definitely unknown territory that left much to be desired. Processing emotions is not something that is well practiced or really accepted here in the West. From a very young age, how many of us were told “You’re ok”, “Suck it up”, “You are just fine”, “Don’t cry”, or a myriad of ways that stated what we were feeling was totally unacceptable? And yet when we embrace the child that has an owie and is hurting, and who just wants to be acknowledged with a hug, a validation of their hurt, and possibly a band-aid, they are off running around again before you know it, their owie completely forgotten. I truly know there is power in validation and allowing feelings and thoughts to be expressed without judgment. Who are we to say that what anyone else is thinking or feeling is not ok, let alone ourselves? It’s what is thought/felt, so regardless, it is what it is. Why not embrace it rather than deny, shove down, bury, hide, ignore, or detach from it? What we don’t realize that by burying or denying our thoughts and emotions, we are shoving them down further into the abyss of our very beings, giving them a place to reside and grow until one day, it has no other option but to come out. Whether it manifests through a host of dis-eases, old stories and battle wounds that we carry around with us as justification to be angry, hurt, or with-held forgiveness, or some other awful drama or trauma, those feelings/thought will eventually find a way out. The question is, wouldn’t you rather allow it to leave sooner than later without all the trauma/drama, giving you a much more fulfilling and vibrant quality of life? So how do you honor your thoughts and emotions? This question often comes up, especially when clients don’t want to condone and foster more of the thoughts and emotions they don’t like. There are a couple of beliefs with this. One, “if I accept where I am, I will never get to where I want.” Two, “If I accept this feeling/thought, then it means I condone it.” And lastly, “By allowing this feeling/thought to be accepted by me, I will be dwelling in it.” These are completely untrue! The truth is that anything we resisting will persist (sound familiar?) It’s why diets don’t work, and addictions are addicting. When we focus on all the things we are deprived of or “shouldn’t do”, it isn’t any wonder why we bounce back into binging on all of the “forbidden” foods, or go running back to the addiction we so hate. There is SO much more I could write on this topic! However, my intention is to keep it simple and share some solutions that bring quick results. In order to honor your thoughts and emotions, you can do several things. I recommend trying them all out and going with what works for you. Some may work better at different times in your life. Don’t write them off immediately because they seem too simple or strange. You never know what will be the key to your finding success in processing emotions and learning how to live a more rewarding life: ·When faced with an unwanted emotion/thought, simply say, “Thank you” to it. Your subconscious is reacting the way it is for a reason, and it is often out of protection. By thanking the emotion/thought, you are telling the subconscious that you got the gift and it doesn’t have to keep protecting you. ·Often times we can’t validate what we’re feeling because we’re so far removed from feeling. In this case, I recommend searching on the internet for a list of feelings. It can be basic or more detailed. Just having a list of emotions was huge for me to reference and actually identify what I was feeling. By simply noticing and owning what you’re feeling/thinking also honors that emotion/thought and allows it to move through you. ·Write down what you’re thinking/feeling. Write completely unhindered, getting everything you feel/think out on the paper. Take all the self-critic and whatever else comes out on the paper to a metal trash can and match and burn it afterwards (ripping it into tiny shreds also does wonders). It gives the subconscious something tangible to see that what was felt and wrote about is now able to leave. ·Tap on your thymus (2” down from the middle of where the colar bone meets in the center) and say, “I’m ok that I feel/think __________.” Or “I’m ok that I don’t like feeling/thinking __________”. This is tapping on an acupressure point that also sends a message to your subconscious. It is greatly validating and allows the emotion/thought to easily flow through. There is much information on the internet about the benefits of tapping, along with the other sequential points to tap on. However, I’ve found tapping on the thymus to be just as effective as going through all the other points. ·Deep breathe with the thought/emotion for at least 5 deep breaths. Feel the emotion in the heart area, and allow the thoughts to gel for a few breaths. Focusing on breathing makes it a conscious act, allowing the focus to be intentional. When you allow the emotion/thought to be felt/thought while consciously breathing, it heightens the ability to flow the emotion/thought through. ·Simply allow the feeling/thought to exist without judgment. Just let it be. Once validated, then you can choose what you would like to replace it with. An example is to sit with discouragement for a while. Once it is allowed to have a voice and speak up, acknowledge it, thank it, and decide what you would like to feel instead. ·Meditate on the thought/emotion for a while. This works great with the deep breathing. ·Forgive the emotion/thought that is unwanted. Quite often, we resent that we feel/think a certain way. When we have such rejection for a part of us, the message gets out to the rest of us and we find all kinds of limiting beliefs and ways that we hold ourselves back, all the while justifying our undeserving-ness because of the things we feel/think about ourselves. It’s a cycle that can be broken by simply forgiving an emotion/thought for existing within us for a moment. ·Realize that the emotion/thought exists only for a moment. Allow it to be in that moment. It’s when we judge that emotion/thought, or hate it, or reject it, or bury it that it becomes a whole lifetime of emotions/thoughts that are unwanted. The patterns really can change, but first we must accept and embrace where we are at in the present before we can let go of the past, or move forward to where we want to be. Quite often, after an emotion has been honored, answers to long-standing challenges are able to surface and a new door opens. New insight about yourself and how you see yourself in the world are discovered. Dreams seem to become a reality rather than impossibility. And one of my personal favorites, peace becomes a common friend in your life. I hope this has been helpful! I LOVE sharing information I have learned and look forward to sharing with you again! Please contact me if you have any more questions and I would be happy to answer them. Much Love, Light, and Courage in facing your own emotions/thoughts along this beautiful Earthly journey. H.I. Visitors Disclaimer We provide the material in this blog for informational purposes only. We do not prescribe and we do not diagnose. If you use the information in this blog without the approval of a health professional, you prescribe for yourself, which remains your constitutional right, but the authors assume no responsibility. The authors shall have neither liability or responsibility to any person or entity with respect to any damage, loss, or injury caused, or alleged to be caused, directly or indirectly by the information contained in this blog. The information presented herein is in no way intended as a substitute for medical counseling. Anyone suffering from any disease, illness, or injury should consult a qualified health care professional. The statements made in this blog have not been evaluated by the FDA. | Mid | [
0.5806451612903221,
31.5,
22.75
] |
The Hawthorn Chronicles: Rebuilding the fortress For years, Launceston was considered a fortress for Hawthorn, and for good reasons. The Hawks hadn’t lost a game in the UTAS stadium between Round 8, 2012 and Round 19, 2016. The Saints ended that streak last year, thumping the Hawks by 75 points. To add injury to insult (pun intended), the Hawks also lost star recruit Jaeger O’Meara to a knee issue, and he did not return until the last couple of rounds in 2017. Things seem to have changed significantly since then, and the Hawks have managed to find their way back. The Saints on the other hand seem to have gone backwards, much to the surprise of many, myself included. The Hawks went down to the Kangaroos, and the Saints were denied a brave win and drew against the Giants. With both teams looking for a win to set them back on track, the stage was set for a good game. However, what we got instead was a scrappy affair in dewy conditions, with Hawthorn keeping their noses ahead before landing the killer blow in the fourth quarter. The game started promisingly for the Hawks, who found targets inside their attacking 50 regularly in the first quarter. However, they could not convert this into scoreboard pressure, and kicked 3.7. Not to be outdone, the Saints kicked 7 behinds before registering their first major in the second quarter. The dew settled in, and the game turned into a scrap. The Saints did well in containing Hawthorn’s run and limiting space, and what ensued was an error-riddled hour of football. Neither side was clean with their ball use, and turnovers were a regular feature. The Hawks hung in and kept the Saints at bay. Then, in the final quarter, they went for the jugular, piling on 6 goals to 1, and marched out 35-point winners, thanks to stellar efforts from some of their bigger names. There were some heartening performances from the Hawks’ young guns too, and it would have pleased Alastair Clarkson that his team hung in and fought rather than give up. The man instrumental in keeping the Hawks ahead was Isaac Smith. In limited space and heavy traffic, he often seemed to find a way out and hit a target. He also added 4 vital goals to Hawthorn’s scoreboard; priceless in a tight match like this one. After a quiet fortnight, Tom Mitchell was back to his ball-winning best, and helped himself to 45 disposals and 10 clearances. The Saints tagged him for half the game, but the damage was already done and Mitchell just kept finding the pill. Ben McEvoy was another standout for me. He has evolved into the ruckman that Hawthorn desperately needed. He is strong in the ruck and follows it up with great second and third efforts. He also finds a way to drift forward or into space and take crucial marks. It will be interesting to see how he is used in tandem with Jon Ceglar when he is back from injury. Luke Breust and Jack Gunston chipped in with important goals, although they seemed to have the yips at different stages of the game. The most heartening part of this win is the obvious development of the younger players at Hawthorn. James Worpel was impressive in his debut and looked to have the poise and courage required at AFL level. Once he gets fitter and stronger, he will slot in nicely into Hawthorn’s midfield. James Cousins is another player who seems to be enjoying his return to senior footy. Perhaps the most impressive of all was Harry Morrison, who had a 25-disposal, 1-goal game and impressed with his run and carry across half back and wing. I won’t lie. It was an ugly game of football for most part, and a frustrating one riddled with errors. The conditions played their part, and our players seemed to be trying too hard to create plays that weren’t there, rather than looking for the most obvious options. There was also the issue of goal kicking efficiency, and both sides seemed to suffer from the yips. Had the Hawks kicked accurately, they could have sealed the deal earlier in the piece. However, it was good to see us willing to scrap it out and wait to land the final blow. In a potentially tight season, a 4-2 start and 4th place on the ladder aren’t bad outcomes considering we were written off by many leading into the season. Hawthorn had their colours lowered in last season’s corresponding fixture, but this win, and a few more like this will go a long way in rebuilding the fortress that is Launceston. Welcome to your home of Sports News and Views Hard and Fast Boz and Pav, both sporting tragics, are committed to bringing you their own special take on the happening in the sporting world. Be sure to check out the guys on the weekly podcast The Pinch Hitters with Boz and Pav, available on both I-Tunes and SoundCloud. | Mid | [
0.6009975062344141,
30.125,
20
] |
Bro.. Have this water? Why? Water reduces anger. Who said so? Your friend. My friend!? Who's that? Myself! What's your name? Gowtham. What do you study Gowtham? 6th class and You? ME!? Doing 'nothing'. Means? Means I don't have a job! Why didn't you get a job? You must have studied engineering to understand it. Why should I study engineering to become a farmer? FARMER! What do you know about farming? I know nothing about farming but I know that there is nothing without a farmer! But your parents would hope you to become an engineer or a doctor! Who'll do farming if everyone becomes an engineer? You're right! Who taught you all these? My friend. Your friend!? Yes, I came here to see him. Here! Can you show him to me? Look there.He is my friend! He?.. He looks like a mad! MAD!? He's Kannayiram. A farmer with 30 years of agricultural experience. But now he's jobless. See, he's jobless because of agriculture. NO! He's jobless because he can't do agriculture. Why can't he go to other job than being jobless? I too asked him the same question.His answer was-- "I educated my siblings only through agriculture. Then I had to sell my lands for the sake of their marriage. I deposited certain amount in bank and now I set my living out of the interest that I get from it" Why can't you go to other jobs? I know only agriculture. Agriculture is not a job. It is a DIGNITY! Even now I wish to farm. But I don't have any land. My siblings are not interested in agriculture and that's why I had to sell my land. Nowadays these youngsters feel dishonored doing agriculture. But I'll say for sure that if this generation.. forgets agriculture, then the future have to forget food! Agriculture is not mean. It is our DIGNITY! Being a slave under someone and getting monthly wages is mean. Working in our own land is PRESTIGIOUS Right. So you're going to live a prestigious life! Yes bro. Just a minute bro.. (You should suffer doing agriculture like me! I'll go to chennai and earn and treat you as a king) How're you my son? That's ok dad! I'm going to do agriculture! I educated you to become an engineer! A doctor need his son to become a doctor a lawyer needs his son to be a lawyer! But why don't you need me as a farmer? I need not wish to see you suffering like me! Suffering is being jobless and becoming a slave under someone. I'll be the servant and king in our farm dad! What do you know about agriculture being alone? I'm not alone. I'm coming with Mr.Kannayiram. A Farmer with 30 years of experience. We're going to work as a team! Let's farm and keep up our DIGNITY! | Mid | [
0.5679012345679011,
34.5,
26.25
] |
All relevant data are within the paper. Introduction {#sec001} ============ Thymic epithelial tumors (TETs) are rare epithelial malignancies (0.2--1.5%) of the anterior mediastinum, with an estimated incidence of about 1.3--3.2 cases per million worldwide \[[@pone.0197655.ref001]\]. The WHO classification distinguishes thymomas and thymic carcinomas \[[@pone.0197655.ref002]\]. Thymomas are defined as A, AB, B1, B2, B3 sub-types according to the morphology of tumor epithelial cells, the proportion of non- tumoral thymic lymphocytes (decreasing from B1 to B3) that are associated with tumor cells, and their similarities to normal thymic architecture. Thymic carcinomas present with a high degree of epithelial cells atypia associated with a loss of normal thymic architecture. Surgical resection is the corner stone of the multimodal treatment of thymomas \[[@pone.0197655.ref003]\]. Tumor stage \[[@pone.0197655.ref004]\] and radical complete surgical resection have been shown as independent prognosis factor of best outcome \[[@pone.0197655.ref005]--[@pone.0197655.ref007]\]. Advanced or metastatic cases are treated with induction chemotherapy, surgery, combined radiation-chemotherapy \[[@pone.0197655.ref008]--[@pone.0197655.ref011]\] with variable outcomes \[[@pone.0197655.ref012]--[@pone.0197655.ref015]\]. Meanwhile about 30% of patients are presenting with recurrences requiring systemic treatment. The pathogenesis of thymic epithelial tumors remains poorly elucidated. Sustained efforts have been made to characterize molecular abnormalities occurring in TETs to improve their treatment and eventually the patient prognosis. Sequencing of 197 cancer-related genes revealed the presence of non-synonymous somatic mutations in over 60% thymic carcinomas and barely 15% thymomas \[[@pone.0197655.ref016]\]. The most frequent mutations (26% of thymic carcinomas) were located in the p53 tumor suppressor gene \[[@pone.0197655.ref017]\]. The Cancer Genome Atlas recently reported results using multi-platform omics analyses on 117 TETs, leading to identify four subtypes accordingly to their genomic hallmarks \[[@pone.0197655.ref017]\]. GTF2I was confirmed as an oncogene associated with type A thymoma, and mutations in HRAS, NRAS, and TP53 were identified in thymomas. A major limit of those studies was the use of tumor tissue specimens precluding specific analysis of epithelial tumor cells while lymphocytes may present with a high level of expression of genes related to carcinogenesis \[[@pone.0197655.ref017]--[@pone.0197655.ref023]\] The PIK3/ Akt/ mTOR pathway plays a key role in various cancers and among them thymic tumors. Mutations of genes encoding regulatory subunit of PIK3 have been reported in a tumorigenic thymic carcinoma cell line, using targeted exome sequencing, predicting the efficacy of PIK3 inhibitors \[[@pone.0197655.ref024]\]. Several phase I/ II studies of mTOR inhibitors were reported in advanced thymic epithelial tumors, reporting on high disease control rates \[[@pone.0197655.ref025]--[@pone.0197655.ref027]\]. Meanwhile the cellular dysregulation of the Akt/ mTOR pathway has not been described in thymomas. Using primary thymic epithelial cells derived from A, AB and B thymomas, we report the dysregulation of the Akt/ mTOR pathway in thymomas and the anti-proliferative effect of rapamycin on thymic epithelial cells. Materials and methods {#sec002} ===================== Biological samples {#sec003} ------------------ Between January 2015 and December 2017, thymic samples from patients that have undergone removal surgery for thymic tumors (N = 12) ([Table 1](#pone.0197655.t001){ref-type="table"}) or cardiac surgery (N = 2) for normal thymuses have been included. Tumoral and normal tissues and their associated data ([Table 1](#pone.0197655.t001){ref-type="table"}) were obtained from the CardioBiotec biobank (CRB-HCL, Hospices Civils de Lyon BB-0033-0046), a center for biological resources authorized by the French ministry of social affairs and health. Patients with thymic epithelial tumors were identified by the departments of pulmonary medicine and thoracic oncology, and thoracic surgery (Groupement Hospitalier Est, HCL, Lyon). All samples were collected and used in accordance with the ethical rules of the biobank and in agreement with the French legislation. All patients signed a written informed consent. Immediately after surgery, the thymic tumors were placed in RPMI 1640 cell medium supplemented with penicillin and streptomycin and processed in a biosafety level 2 lab in the next two hours for cell derivation or snap frozen in liquid nitrogen for further use. 10.1371/journal.pone.0197655.t001 ###### Clinical features of thymomas included in the study. {#pone.0197655.t001g} Patient \# Age (yr) Gender Myasthenia gravis Tumor size (cm) Previous chemotherapy Subtype[^1^](#t001fn001){ref-type="table-fn"} Staging[^2^](#t001fn002){ref-type="table-fn"} TNM[^3^](#t001fn003){ref-type="table-fn"} ------------ ---------- -------- ------------------- ----------------------------------------- ------------------------------------------- ----------------------------------------------- ----------------------------------------------- ------------------------------------------- 3153 73 M No ?[^4^](#t001fn004){ref-type="table-fn"} No A (pleural metastasis) IVA T3N0M1a 3154 70 M No 5.7 No A (Micronodular with lymphoid stroma) IIA T1aN0M0 2635 57 M No 6 No AB I T1aN0M0 2646 83 F No 5 No AB I T1aN0M0 2836 46 M No 10 No AB I T1aN0M0 3147 70 M No 11 No AB III T2N0M0 3148 65 F No 3.5 Yes[^5^](#t001fn005){ref-type="table-fn"} AB I T1aN0M0 3152 68 F No 3.5 No AB I T1aN0M0 3146 71 M Yes 3.2 No B2 IIA T1aN0M0 3149 63 F No 9 Yes[^6^](#t001fn006){ref-type="table-fn"} B2/ B3 I T1aN0M0 3150 66 M Yes 6 No B2/ B3 III T3N0M0 2637 68 M No 7 No Thymic carcinoma III T3N0M0 ^1^ Subtype according to the WHO classification ^2^ staging according to the Masaoka-Koga classification ^3^ TNM according to the ITMIG guidelines ^4^ unknown, pleural metastasis ^5^ received Caelyx therapy for Kaposi treatment ^6^ received cisplatin, adriamycin and cyclophosphamide neo-adjuvant treatment. Derivation of thymic epithelial cells {#sec004} ------------------------------------- Thymic epithelia cells (TECs) were obtained from thymic epithelial tumors as previously described with minor modifications \[[@pone.0197655.ref028], [@pone.0197655.ref029]\]. Thymic tissues were immediately placed in ice cold RPMI 1640 medium, cut in 1--3 mm^3^ pieces and transferred in \"Liberase digestion solution\" (RPMI 1640 medium supplemented with 0.5 U/ml Liberase (Roche) and 0.1% w/v DNase I) with \~ 2 ml of digestion solution/ cm^3^ of tissues. After 20 min incubation at 37°C under gentle agitation, supernatants were collected, mixed (v/v) with 1X PBS supplemented with 0.1% bovine serum albumin, and 0.5 mM EDTA, and centrifuged at 480g for 10 min at 4°C. The digestion procedure was repeated 4--6 times. Cells were counted in trypan blue using a Cellometer (Nexcelon BioSciences), seeded at 2--4.10^6^ cells/ cm^2^ in \"TEC medium\" (RPMI 1640 medium supplemented with 2% Ultroser serum substitute (Pall corporation) and penicillin/streptomycin) and incubated at 37°C, 5% CO~2~ in humid atmosphere. After 24 hours, cell culture supernatants were centrifuged at 480g for10 min at 4°C to eliminate non-adherent cells, supplemented with an equal volume of new \"TEC medium\" and added to the cultured cells. Cells were checked daily and passaged at confluence with trypsin EDTA solution. Phenotypic characterization of primary thymic epithelial cells {#sec005} -------------------------------------------------------------- Primary thymic epithelial cells were cultured on treated glass slides (LabTek, Thermo Scientific) in \"TEC medium\", rinsed in PBS and fixed with ice cold acetone. After 20 min rehydration in PBS, cells were incubated for one hour at room temperature with the BM4048 mouse monoclonal anti-cytokeratin (Acris) or mouse monoclonal anti-vimentin (Sigma) antibodies diluted in PBS supplemented with 1% bovine serum albumin as recommended. After PBS washes, cells were incubated for one hour at room temperature with anti-mouse IgG Dylight antibodies (Eurobio). Nuclei were stained with DAPI for 10 min and mounted with Fluoromount G (Electron Microscopy Sciences). Microscopic examinations were performed using an Axio-Imager Z1 epifluorescence microscope and analyzed using the Zen software (Zeiss). Protein expression in thymic tissues and thymic epithelial cells {#sec006} ---------------------------------------------------------------- Proteins were prepared from thymic tissues and primary thymic epithelial cells using respectively T-PER extraction reagent or M-PER extraction reagent (Thermo Fisher) supplemented with \"HALT protease and \"phosphatase inhibitor cocktail" (Thermo Fisher). Lysates were homogenized by sonication on ice and proteins were quantified in the collected supernatants. Twenty to thirty micrograms of total proteins were separated on SDS-PAGE, transferred onto PVDF membrane and used for the detection of Akt with \"Akt1 Precision Ab antibody\" (BIORAD VMA00253), phospho-Akt with \"phospho-Akt (Ser 473) antibody\" (Cell signaling, 9271S), mTOR with \"mTOR PrecisionAb Antibody\" (BIORAD, VPA00174), phospho mTOR with \"phospho-mTOR (Ser2448) Antibody\" (Cell signaling, 2971), phospho p70S6k with \"phospho-p70 S6 Kinase (Thr389) Antibody\" (Cell signaling, 9205) and β-actin (Monoclonal Anti-β-Actin−Peroxidase antibody, Sigma) as recommended. Immunoreactive bands were detected with goat anti-rabbit IgG (whole molecule)-peroxidase antibodies produced in goat (Sigma) and revealed using the \"Clarity Max Western ECL Blotting Substrate\" (BIORAD) on a \"ChemiDoc Imaging System\" (BIORAD). Thymic epithelial cells proliferation upon rapamycin exposure {#sec007} ------------------------------------------------------------- Primary thymic epithelial cells (5000 cells/well) derived from patients \#3147 (AB type), \#3146 (B2 type) and \#3149 (B2/B3 type) were incubated in \"TEC medium\" in 96 well plates for twelve hours then treated with 1, 10 or 100 nM rapamycin (Sigma). Controls with DMSO or untreated cells have been included. Proliferation was measured 24, 48 and 72 hours after rapamycin treatment with the "CellTiter-Glo Luminescent Cell viability assay" (Promega). All tests have been repeated at least twice and performed in triplicates. Cell death of thymic epithelial cells upon cisplatin and rapamycin exposure {#sec008} --------------------------------------------------------------------------- Primary thymic epithelial cells (5.10^4^ cells/well) derived from thymomas \#3146 (B2), \#3147 (AB) and \#3149 (B2/B3) were incubated in \"TEC medium\" in 6 well plates for twelve hours then treated with 100 nM rapamycin (Sigma) or 10 μM cisplatin (Promega). Negative controls with untreated cells have been included. HeLa cells treated with 10 μM cisplatin have been used as positive controls of induced cell death. Cell death assay was measured by flow cytometry (Becton Dickinson) 24- and 48-hours post-treatment, using 10μg/ml propidium iodide. Mutations analysis in the PIK3CA, PIK3R1and GTF2I genes {#sec009} ------------------------------------------------------- Mutations of PIK3CA, PIK3R1 and GTF2i have been analyzed using primers in exons 1 to 21 for *PIK3CA* (GenBank NM06218.3), exons 5 to 16 for *PIK3R1* (GenBank NM181523) and exons 5--15 for *GTF2I* (GenBank NM001518.4) gene ([Table 2](#pone.0197655.t002){ref-type="table"}). 10.1371/journal.pone.0197655.t002 ###### Primers used to amplify GTF2i and PIK3 genes. {#pone.0197655.t002g} Gene Region 5\'-3\' sequence (5\'- 3\') --------------------------------- ---------------------------------- ------------------------------ PIK3CA Exons 1 to 4 FOR---`AAGAGCCCCGAGCGTTTCT` REV- `TGCTTCAGCAATTACTTGTTCTGG` Exons 4 to 11 FOR---`ACCATGACTGTGTACCAGAACAA` REV- `ACACAATAGTGTCTGTGACTCCA` Exons 18 to 21 FOR---`AAGGAGAAATATATGATGCAGCCA` REV- `CCAGAGTGAGCTTTCATTTTCTCA` PIK3R1 Exons 5 to 9 FOR---`ACGTTTTGGCTGACGCTTTC` REV- `GGTTAATGGGTCAGAGAAGCCA` Exons 10 to 16 FOR---`ACTCTTACACTAAGGAAAGGGGGA` REV- `GCCTCAGGGTGGCTGAACT` GTF2I Exons 10 to 15 FOR---`TGAAGGCACAGAAATGGA` REV- `ACCATTCTTCCTTTACTCC` Briefly, RNAs were extracted with the \"Pure Link RNA minikit\" (Ambion), reverse transcribed using the \"iScript cDNA synthesis kit\" (Bio-Rad) and amplified with the \"KAPA HIFI hotstart polymerase\" (Clinisciences) for 35 cycles (2 min at 98°C, 15 sec at 60°C and 30 sec at 72°C) on a Mic qPCR system (BioMolecularSystem). Amplicons were controlled on agarose gel, sequenced (GTAC Biotech) and analyzed with the Vector NTI software (Invitrogen). The potential impact of identified mutation was analyzed with the \"PolyPhen-2 (Polymorphism Phenotyping v2) predictive model\". Statistical analysis {#sec010} -------------------- Statistical analyses (threshold of α = 0.05) were performed using the t test with the \"GraphPad Prism\" (GraphPad) software. All tests were done with a significant threshold of α = 0.05. Results {#sec011} ======= Clinical features {#sec012} ----------------- From January 2015 to December 2017, twelve patients (8 males and 4 females, mean age of 66.67 ± 8.99 years (46--83)) who have undergone surgery ([Table 1](#pone.0197655.t001){ref-type="table"}) for thymic epithelial tumors (3154, 2635, 2646, 2836, 3147, 3148, 3152, 3146, 3149, 3150, 2637) or for pleural relapse of a type A thymoma removed 25 months before the surgery (3153) have been included in our study ([Table 1](#pone.0197655.t001){ref-type="table"}). Among them, patients 3148 and 3149 received chemotherapy before surgery to respectively treat cutaneous Kaposi lesions with Caelyx and initially locally advanced thymoma with cisplatin, adriamycin and cyclophosphamide. Two patients (3146 and 3150) presented myasthenia gravis and were treated with intra venous polyvalent immunoglobulins one week before surgery ([Table 1](#pone.0197655.t001){ref-type="table"}). According to the WHO pathological classification, tumors were of type AB for 6 patients (2635, 2646, 2836, 3147, 3148, and 3152), B2 for 3 patients (3146, 3149, 3150) and thymic carcinoma for patient 2637 ([Table 1](#pone.0197655.t001){ref-type="table"}). Tissues from patient 3153 and 3154 were respectively identified as pleural metastasis of subtype A thymoma and as micronodular thymoma with lymphoid stroma, a rare presentation of subtype A thymoma. According to the Masaoka classification, tumors were of stage I for six patients, IIA for two patients, III for three patients and IVA for one patient ([Table 1](#pone.0197655.t001){ref-type="table"}). Derivation of thymic epithelial cells {#sec013} ------------------------------------- Primary thymic epithelial cells were successfully derived from the twelve tumors immediately after removal and expanded in culture. Daily observation under phase microscope showed that cells had an epithelioid morphology ([Fig 1](#pone.0197655.g001){ref-type="fig"}). Cells proliferated, and the epithelial morphology was maintained along the study up to passages 6 to 7, corresponding to a median time of culture of 56 days. The thymoma-derived primary thymic cells expressed cytokeratin ([Fig 1](#pone.0197655.g001){ref-type="fig"}), a marker of epithelial cells, with a mean of 79% positive cells except for cells derived from the thymic carcinoma 2637 that were negative for cytokeratin but expressed vimentin. {#pone.0197655.g001} To summarize, we successfully derived primary thymic epithelial cells from various types of thymic tumors as well as pleural metastasis. These cells expressed cytokeratin and were able to proliferate *in vitro* over several passages. The subsequent analyses (detection of protein as well as proliferation studies) were performed on early passages, to be as close as possible to the *in vivo* phenotype. Mutations of PiK3 and GTF2i genes {#sec014} --------------------------------- A screening of PIK3 and GTF2I mutations was performed on all tumors. Among the 12 tumors, only patient 3149 (B2/ B3 thymoma) carried a non-conservative A/C transversion localized on position 56 of exon 2 of PIK3CA ([Fig 2A](#pone.0197655.g002){ref-type="fig"}). The mutation induced a K → Q amino-acid change, predicted as deleterious with PolyPhen-2. {#pone.0197655.g002} We also detected a GTF2I mutation for tumor 3154, reported as a micronodular thymoma with lymphoid stroma, a rare presentation of type A thymoma ([Fig 2B](#pone.0197655.g002){ref-type="fig"}). The mutation located on exon 15 was associated with a non-conservative T/A transversion leading to L→ H amino-acid change in the deduced amino-acid sequence ([Fig 2B](#pone.0197655.g002){ref-type="fig"}). Activation of the Akt/ mTOR/ P70S6K pathway in thymomas {#sec015} ------------------------------------------------------- The Akt/ mTOR pathway is a key pathway implicated in cell proliferation. We analyzed its activation in thymomas as well as in normal thymuses from cardiac surgery. Akt, mTOR and P70S6K were activated in all thymomas, as shown by the detection of phosphorylated proteins ([Fig 3A](#pone.0197655.g003){ref-type="fig"}). B2 thymomas expressed significantly higher levels of Akt and phospho- Akt than A or AB subtypes ([Fig 3B](#pone.0197655.g003){ref-type="fig"}). Total mTOR and Phospho-mTOR were expressed in thymomas, with no significant differences between subtypes but undetectable in normal thymuses. Phospho- P70S6K was absent in normal thymuses, expressed in all thymic tumors whatever their subtypes, and significantly higher in AB as compared to B thymomas. ![Activation of the Akt/ mTOR pathway in thymic epithelial tumors.\ A. Total and phosphorylated protein expression was analyzed using antibodies directed against total Akt and phosphorylated- Akt (P- Akt) (60 kDa), total mTOR and phosphorylated- mTOR (P- mTOR) (289 kDa), phosphorylated P70S6K (P- P70S6K) (70 kDa) and β-Actin (40 kDa). B. Protein expression (Akt, phospho- Akt, phospho- P70S6K, mTOR, phospho- mTOR) has been measured and expressed as \[protein of interest/ actin\] relative expression in A (white bars), AB (grey bars) and B (B2 and B2/ B3; black bars) thymomas, thymic carcinoma (TC, hatched bars) or normal thymus (N, dotted bars). Detection have been repeated at least 3 times. Data have been statistically analyzed with an unpaired T test.](pone.0197655.g003){#pone.0197655.g003} Overall, the Akt/ mTOR pathway was activated in A, AB and B thymomas as demonstrated by the detection of phosphorylated Akt, mTOR and P70S6K proteins, with various level of expression that probably reflected the relative frequency of tumoral and non-tumoral cells within the tumors. Activation of the Akt/ mTOR pathway in thymic epithelial cells derived from thymomas {#sec016} ------------------------------------------------------------------------------------ To determine the role of the Akt/ mTOR pathway in proliferation of tumoral thymic epithelial cells, we analyzed expression of mTOR, Akt and P70S6K in thymic epithelial cells derived from seven patients with A, AB or B thymomas. Interestingly, all the primary cells expressed detectable levels of phosphorylated Akt and mTOR while phospho-P70S6K was low or barely detectable ([Fig 4](#pone.0197655.g004){ref-type="fig"}). This suggests that the activation of the Akt/ mTOR pathway might participate to the cell proliferation associated with tumor growth. ![Activation of the Akt/ mTOR pathway in thymoma-derived thymic epithelial cells.\ **A.** Total and phosphorylated protein expression was analyzed using antibodies directed against total Akt and phosphorylated- Akt (phospho- Akt), total mTOR and phosphorylated- mTOR (phospho- mTOR), phosphorylated P70S6K (phospho- P70S6K) and β-Actin in thymic epithelia cells derived from A, AB or B2 thymomas. B. Protein expression has been measured and expressed as \[protein of interest/ actin\] relative expression in A (white bars), AB (grey bars) and B (B2 and B2/ B3; black bars) thymomas.](pone.0197655.g004){#pone.0197655.g004} Effects of rapamycin treatment on tumoral TECs proliferation {#sec017} ------------------------------------------------------------ We analyzed the effect of rapamycin, an inhibitor of mTOR, on proliferation of primary thymic epithelial cells. We focused our analysis on cell cultures derived from AB (\# 3147), B2 (\# 3146) and B2/ B3 (\#3149) thymomas at early passages because these cells had good proliferative abilities (\~24 hours doubling time), a prerequisite for the study of rapamycin inhibition over a 72-hour period. Importantly, these three thymomas and the derived thymic epithelial cells expressed mTOR and phospho-mTOR (Figs [3](#pone.0197655.g003){ref-type="fig"} and [4](#pone.0197655.g004){ref-type="fig"}). We controlled the inhibition of mTOR and phospho-mTOR in cells treated for 24 hours with 100 nM rapamycin. The activation of mTOR was reduced by \~90%, \~30% and \~ 50% in thymic epithelial cells respectively derived from AB (3147), B2 (3146) and B2/B3 thymomas ([Fig 5](#pone.0197655.g005){ref-type="fig"}). ![Inhibition of mTOR and phospho-mTOR expression upon rapamycin treatment of thymoma- derived cells.\ A. Expression of mTOR and phospho-mTOR proteins in thymoma-derived cells after 48 hours treatment with 100 nM rapamycin (+) or no rapamycin (-). B. Protein expression of mTOR (with bars) and Phospho-mTOR (hatched bars) has been measured and expressed as the ratio of protein expression in \[treated/ untreated\] cells.](pone.0197655.g005){#pone.0197655.g005} The proliferation rate was measured daily, in triplicates and repeated at least twice over 72-hour treatment with 1 nM, 10 nM or 100 nM rapamycin. No effect was detectable with 1 nM rapamycin; while with 10 or 100 nM, the proliferation was significantly reduced in all three primary cell cultures ([Fig 5](#pone.0197655.g005){ref-type="fig"}). When compared to untreated cells, 100 nM rapamycin significantly blocked cell proliferation with a 40%, 25% and 29% decrease of the cell number for TECs derived respectively from thymomas 3146, 3149 and 3147. The inhibitory effect of rapamycin was similar to what we observed (\~30%) in A549 cells treated with 100 nM rapamycin ([Fig 6A](#pone.0197655.g006){ref-type="fig"}). {#pone.0197655.g006} We measured cell death using flow cytometry in TECs treated for 24 and 48 hours with 100 nM rapamycin or 10 μM cisplatin. Rapamycin had no significant effect on cell death. Interestingly, only TECs 3147 derived from a B2 lymphoma significantly died upon cisplatin treatment ([Fig 6B](#pone.0197655.g006){ref-type="fig"}). Discussion {#sec018} ========== Deciphering the molecular events in thymomas has remained a major challenge given the rarity and the histological heterogeneity of those tumors, precluding large genomic studies to be conducted. The presence of lymphocytes intermixed with epithelial tumoral cells in tissue may lead to potential misinterpretation of genomic features specifically associated with thymic carcinogenesis \[[@pone.0197655.ref027], [@pone.0197655.ref030], [@pone.0197655.ref031]\]. In this study, we report the derivation of primary thymic epithelial cell cultures from type A, AB and B thymomas, their phenotypic and genetic characterization as well as the deregulation of the Akt-mTOR pathway and its impact on cell proliferation. Previous reports of derivation of cells from thymic epithelial tumors have been made available. Most cell lines were obtained from thymic carcinoma specimens, with limited molecular characterization. Besides PIK3 regulatory subunits mutations \[[@pone.0197655.ref024]\], copy number gain of the anti-apoptotic molecule BCL2 was observed at comparative genomic hybridization of such cell lines, while *in vitro* siRNA knockdown reduced cell proliferation, and *in vivo* exposure to a pan-BCL2 inhibitor led to an inhibition of xenograft growth, *via* a mechanism involving the PIK3/AKT/mTOR pathway \[[@pone.0197655.ref023]\]. Exposure of thymic carcinoma cells to HSP90 inhibitors led to cell cycle arrest and apoptosis, and blocked invasiveness, through the downregulation of HSP90 oncogenic clients, including insulin-like growth factor 1 receptor (IGF-1R), a transmembrane tyrosine kinase receptor frequently overexpressed in thymic carcinomas, CDK4, and PIK3/ Akt \[[@pone.0197655.ref032]\]. Taken together, these data were of significant therapeutic relevance: while pictilisib is mostly developed in breast cancers, which more frequently harbor PIK3 alterations, phase II trials dedicated to thymic epithelial tumors were conducted with the IGF-1R inhibitor cixutumumab \[[@pone.0197655.ref033]\], the mTOR inhibitor everolimus \[[@pone.0197655.ref034]\], and the CDK inhibitor milciclib \[INS\], reporting on clinical antitumor activity in advanced, refractory cases. Meanwhile, the IU-TAB-1- cell line was established from type AB thymoma, with phenotypic and molecular profiling but limited information of derivation protocol and success rate, and subsequent analysis of molecular pathways of interest, including PIK3/ AKT/ mTOR \[[@pone.0197655.ref035]\]. In our study, we were able to derive primary thymic epithelial cells from all twelve patients immediately after tumor removal, and we have successfully maintained and expanded the cells *in vitro*. We provide the community with a reliable protocol that worked not only for thymic carcinomas but also for thymomas which are known to have lower proliferation index associated with slow growth and better outcome. We used primary thymic epithelia cells to study the deregulation of the Akt-mTOR signaling pathway and the efficacy of rapamycin to block cell proliferation, thus providing with a helpful tool to validate findings from high-throughput analysis on thymic tissues. We demonstrated that the Akt-mTOR pathway was activated in thymomas as well as in thymic epithelial tumor cells derived from type A, AB, and B thymomas. The proliferation of these cells was significantly reduced after exposure to rapamycin through the decrease of mTOR phosphorylation, in absence of significative cell death. The Akt/ mTOR pathway might be an important player for the tumor development and a good target for drugs in patients. Rapamycin specifically inhibits mTORC1, and many reports highlight the role of mTORC2 in cancer \[[@pone.0197655.ref036]\]. From our data, phosphorylation of mTORC1 target p70S6K together with the AKT phosphorylation at Ser473, would support the potential activation of both mTORC1 and mTORC2 in thymomas. Ultimately, our findings showing activation of the Akt-mTOR pathway in thymomas are of significant clinical relevance, given the recent results of a phase II study of everolimus in advanced thymic epithelial tumors, reporting on a disease control rate of 88%, with median progression-free survival of 10.1 months and median overall survival of 25.7 months \[[@pone.0197655.ref034]\]. Everolimus is currently available and may represent an off-label option for refractory tumors \[[@pone.0197655.ref003]\]. In the future, more specific inhibitors of the PIK3/ AKT/ mTOR pathway may be evaluated in those tumors. Beside the deregulation of the Akt/ mTOR pathway, we have identified for the first time PIK3CA mutation in a type B2/B3 thymoma, which may participate to the deregulation of the Akt-mTOR pathway, among others \[[@pone.0197655.ref037]\]. PIK3 activation was also reported to be related to overexpression of a microRNA cluster on chr19q13.42 in type A and AB thymomas, observed in IU-TAB1 cell line \[[@pone.0197655.ref038]\]. This alteration was observed in the cohort of The Cancer Genome Atlas \[[@pone.0197655.ref039]\]. Interestingly, only one of our cases harbored a GTF2I mutations, that was associated at RPPA analysis in this cohort, with lower expression of the apoptosis, cell cycle, DNA damage response, hormone receptor signaling, breast hormone signaling, RAS/MAPK, RTK, and TSC/mTOR pathways \[[@pone.0197655.ref039]\]. In conclusion, our data enhance the potential role of thymic epithelial cells derived from tissue specimens for an *in vitro* exploration of molecular abnormalities specific to thymic carcinogenesis. This may be relevant in a research setting to assess the value of molecular alterations observed at high-throughput genomic profiling, and develop in vivo models, but also to develop approaches for precision medicine strategies at the patient individual level. [^1]: **Competing Interests:**The authors have declared that no competing interests exist. [^2]: ‡ JMM and CMDV are joint first coauthors on this work. CL and NG are joint last authors on this work. | High | [
0.669354838709677,
31.125,
15.375
] |
1. Introduction {#sec1} =============== The success of artificial insemination (AI) programs in cattle depends on the use of bulls with optimal fertility. Using animals with high fertility rates, maximum conception rates can be achieved during the breeding season, reducing the cost of the program. However, until now, the most efficient way to estimate the fertility of a particular bull is to use a field fertility test \[[@B1]\], which is very expensive and time consuming \[[@B2]\]. In the past decades, many studies have been performed with the objective of developing a laboratory test to evaluate semen from different animals and predict its performance after insemination. This kind of test would be beneficial, since it would reduce the probability of using low-fertility bulls in AI programs \[[@B3]\] without the necessity of inseminating a large number of females to perform the bull fertility test. Several semen characteristics have been analyzed to ensure quality and fertility. The most studied characteristics are sperm motility \[[@B4], [@B5]\] and morphology \[[@B6]\] and plasmatic \[[@B7]\] and acrosomal \[[@B8]\] membrane integrity. Although those characteristics have proven to be important in semen analysis, their correlation with bull fertility is very low \[[@B9]\], with substantial variation among studies. In bovine IVP, the *in vitro* fertilization and the *in vitro* culture of embryos have been proposed as suitable biotechnical tools for the prediction of fertility performance in bulls \[[@B2], [@B10]--[@B12]\]. However, even though the use of IVP has led to interesting results, especially when combined with semen analysis (motility, morphology and membrane integrity), previous studies have found conflicting results when IVP and fertility results from the same bull are compared \[[@B13], [@B14]\]. Until now, no laboratory test has successfully predicted, with good repeatability, male fertility in domestic animals. The objective of the present study was to evaluate the application of a statistical model using Bayesian inference \[[@B15]\] to estimate fertility performance in Zebu bulls using data from an IVP program and the true conception rates previously obtained from each bull. 2. Materials and Methods {#sec2} ======================== 2.1. *In Vitro* Maturation {#sec2.1} -------------------------- Ovaries obtained from a commercial slaughterhouse were utilized in this experiment. Oocytes were aspirated with an 18-gauge needle connected to a 10 mL syringe from follicles of 2 to 8 mm in diameter. Oocytes were selected according to cytoplasm morphology and number of cell layers in the cumulus oocyte complexes. Only oocytes surrounded by more than three layers of cumulus cells and having homogeneous cytoplasm were used. The selected oocytes (*N* = 997) were matured for 22 to 24 hours at 38.5°C in an incubator with 5% CO~2~ in the air and 100% humidity. Oocytes (20--30 per drop) were matured in 90 *μ*L drops covered with mineral oil. The maturation medium was composed of TCM-199 with Earle\'s salts and L-glutamine (Gibco 31.100, Grand Island, NY, USA) supplemented with 5 mg/mL BSA, 2.2 mg/mL sodium pyruvate, 1 mg/mL estradiol 17 *β*, 50 *μ*g/mL hCG (Profasi, SE, Brazil, 5.000 UI), 1 *μ*g/mL FSH (Foltropin-V, Vetrepharm, ON, Canada), and 75 *μ*g/mL gentamicin. All drugs were purchased from Sigma (Sigma-Aldrich Corp., St. Louis, Mo, USA) unless otherwise specified. 2.2. *In Vitro* Fertilization {#sec2.2} ----------------------------- For fertilization, commercial frozen-thawed semen of an unique batch from three different Zebu bulls were used, and all of them were Nellore breed bulls (*Bos taurus indicus*), named V, T, and G. Sperm cells from all bulls were selected through a Percoll gradient, and the concentration was adjusted to 1 × 10^6^ sperm cells/mL. Fertilization was performed in HTF medium (Irvine Scientific, Santa Ana, Calif, USA) supplemented with 5 mg/mL BSA, 0.5 mg/mL caffeine, 2.2 mg/mL sodium pyruvate, 30 *μ*g/mL heparin, 18 *μ*M penicilamine, 10 *μ*M hypotaurine, 1.8 *μ*M epinephrine, and 75 *μ*g/mL gentamicin. Groups of 20--30 oocytes were incubated with the sperm cells for approximately 18 hours under the same conditions described for maturation. 2.3. Evaluation of Pronuclear Formation {#sec2.3} --------------------------------------- For pronuclear formation analysis, forty presumptive zygotes per group were denuded and stained with 1% acetic orcein (COA) for pronuclear visualization. The rate of fertilized zygotes was obtained based on the total number of presumptive zygotes in each sample. The zygotes were transferred to small drops of DPBS with 1% BSA on a histological slide and covered with a cover slip. The slides were then fixed in Carnoy\'s fixative. After 24 hours of fixation, the zygotes were stained with 1% acetic orcein and examined under a light microscope. 2.4. *In Vitro* Culture {#sec2.4} ----------------------- The remaining zygotes were denuded and transferred to culture dishes containing SOFaa medium (Nutricell, Campinas, SP, Brazil). Embryos were cultured for seven days in a mixed-air incubator (90% N~2~, 5% CO~2~, and 5% O~2~). Cleavage and blastocyst formation data were collected on days three and seven of culture, respectively, based on the total number of oocytes used in each group (except for the ones removed for COA staining). 2.5. *In Vivo* Bull Fertility, Cows and Artificial Insemination {#sec2.5} --------------------------------------------------------------- The *in vivo* bull fertility was obtained after a fixed-time artificial insemination (FTAI) program with the same commercial semen batches from Nellore breed bulls (*Bos taurus indicus*) named V, T, and G used in IVF. Nonlactating mature Nellore (*Bos taurus indicus*) cows (*N* = 492; 7 to 10 years old; 441 ± 19 kg body weight) were used in this study. Cows were managed under an extensive grazing system based on tropical pastures. Free access to mineral supplement and water was allowed. Cows, at random stage of the estrous cycle (Day 0), received a Norgestomet implant in the auricular subcutaneous tissue containing 3 mg Norgestomet (Crestar, Intervet, SP, Brazil) along with 5 mg estradiol valerate and 3 mg Norgestomet i.m. (Intervet, SP, Brazil). On Day 9, the cows received a dose of 300 IU eCG i.m. (Folligon, Intervet, SP, Brazil), and the Norgestomet implant was withdrawn. On Day 11, 54 hours after Norgestomet implant withdrawn, all cows were FTAI. All FTAI were performed by only one technician, using commercial frozen-thawed semen from bulls V (*N* = 149), T (*N* = 109), and G (*N* = 234). Pregnancy diagnosis after the FTAI program, defined as true conception rate, was performed by transrectal ultrasonography (Aloka 500 V equipped with a 5.0-MHz linear array transducer) 60 days after the end of the synchronized period. 2.6. Statistical Analysis {#sec2.6} ------------------------- Cleavage and blastocyst percentage data were analyzed by ANOVA followed by Tukey\'s test. The untransformed data is presented in [Table 1](#tab1){ref-type="table"}. The conception rates from the three bulls were compared using a Chi-square test. As the environments and animal categories were the same, there was not any possible other significant effect. Both sets of data were analyzed using the statistical software GraphPad InStat 3.0 (*P* \< .05). In order to determine the correlation between laboratory results and the true fertility of each bull, cleavage, and blastocyst formation means were analyzed in comparison with the true conception rates for bulls V, T, and G using Bayesian inference \[[@B16]\]. First, a binomial model was adopted to establish linked functions and predictive models (Appendix (A), (B), and (C), resp.). Using the Bayesian procedure implemented in the program Winbugs 1.4 \[[@B15]\], the predictive model parameters *α*, *β*~1~, and *β*~2~ were calculated through Marcov Chain Monte Carlo (MCMC) computer algorithms using the Gibbs sampler method to establish the predictive model (Appendix (C)) based on the data of cleavage, blastocyst formation and the true conception rates of bulls provided to the program. Noninformative or vague prior distributions with normal curve centered at the origin (zero) and relatively large variance were used \[[@B17]\]. With the predictive model established, the mean values of cleavage and blastocyst formation rates were provided to the program Winbugs 1.4 to estimate bull fertility on the basis of combined data of cleavage and blastocyst formation rates; cleavage rates alone and blastocyst formation rates alone of each bull (Appendix (C): model 1, 2 and 3 resp.). In Appendix, first a binomial model was adopted (Appendix (A): *Y*~*i*~: number of pregnant cows; *N*~*i*~: total number of cows; *P*~*i*~: conception rate; *i*: bull) to establish linked functions (Appendix (B): *α*, *β*~1~ and *β*~2~ were constants calculated in program Winbugs 1.4 through MCMC computer algorithms to establish the predictive model; Cleavage data (*f*~1*i*~) and Blastocyst formation data (*f*~2*i*~) that were provided to the program Winbugs 1.4 to estimate conception rates (*p*~*i*~)) and finally the predictive models obtained using the program Winbugs 1.4 (Appendix (C): *model 1*: estimation of bull fertility based on combined data of cleavage and blastocyst formation; *model 2*: estimation of bull fertility based on cleavage rates only; *model 3*: estimation of bull fertility based on blastocyst formation rates only; *f*~1*i*~: cleavage rate provided; *f*~2*i*~: blastocyst formation rate provided; *p~io~*: estimated bull fertility). 3. Results {#sec3} ========== Statistically significant differences were not observed among bulls in the visualization of two or more pronuclei and in blastocyst formation rates ([Table 1](#tab1){ref-type="table"}). However, the cleavage rate observed for bull T was lower (*P* \< .05) than bulls V and G ([Table 1](#tab1){ref-type="table"}). The *in vivo* bull fertility data is presented in [Table 1](#tab1){ref-type="table"} as true conception rates after an FTAI program. All three bulls presented statistically similar fertility performance (*P* = .1299). In this experiment, models of binomial regressions were first adopted to establish linked functions. Subsequently, the parameters *α*, *β*~1~ and *β*~2~ of the predictive models were calculated using the program Winbugs 1.4 through MCMC. Bull fertility was estimated in the program Winbugs 1.4 using provided mean data of combined cleavage and blastocyst formation rates, cleavage rates alone, and blastocyst formation rates alone (Appendix (C): model 1, 2 and 3, resp.). Estimated conception rates and *in vivo* bull fertility, expressed as true conception rates, for each bull are presented in [Table 2](#tab2){ref-type="table"}. The results show that when data from cleavage or blastocyst formation rates were used alone, the estimated conception rates were similar to true conception rate. However, when both parameters (cleavage and blastocyst formation rates) were used in combination, the estimated conception rates were nearly identical to those observed for all three bulls. 4. Discussion {#sec4} ============= The results of this experiment show that it is possible to estimate the fertility of bulls based on data obtained during IVP, using a Bayesian statistical inference model. Moreover, while the use of different bulls for *in vitro* embryo production has an influence on the cleavage rates of oocytes, the development of embryos until blastocyst stage becomes similar between the bulls studied. The use of semen from different bulls influenced *in vitro* embryo production, since cleavage rates were different among the tested bulls ([Table 1](#tab1){ref-type="table"}). In the same way, the use of sperm cells from different bulls during IVF results in variable fertility rates \[[@B18]\]. This effect, which is related to each individual male, results in variable cleavage and blastocyst formation rates and embryo viability \[[@B19], [@B20]\]. Our results are similar, since the observed cleavage rate is statistically different for bull T in comparison with bulls V and G. Nevertheless, the percentages of pronuclear formation and blastocyst production do not differ among bulls. These results agree with the work of Shamsuddin and Larsson \[[@B21]\], who have demonstrated that the use of different bulls during IVF leads to different embryo developmental rates until the fourth cellular cycle (16 cells). However, when this particular developmental stage, which corresponds to embryonic genome activation, is bypassed, embryo development is similar among bulls until the morulae/blastocyst stage. It is commonly recognized that the best method to analyze field fertility in a bull is to estimate the conception rate after an AI or natural breeding program \[[@B1]\]. The inconvenience of this procedure is related to the high cost and long time period necessary to obtain results \[[@B2]\]. Therefore, the development of an alternative laboratory test capable of estimating the fertility of bulls would be very beneficial for the cattle industry. Previous studies have not \[[@B13], [@B14]\] or poorly shown \[[@B22], [@B23]\] a correlation between IVP data and *in vivo* bull fertility. However, many authors indicated the benefit of using IVP data to estimate *in vivo* bull fertility \[[@B10], [@B11], [@B21], [@B24]\]. Advances in bovine IVP embryos systems have allowed the relationship between *in vivo* bull fertility and IVP outcomes to be examined \[[@B12], [@B25]--[@B27]\]. However, arising from variations in protocols between laboratories it is still unclear whether the ability of a bull to fertilize oocytes *in vitro* is useful as a predictor of *in vivo* fertility following artificial insemination \[[@B26]\]. In addition, it has been shown that individual bulls have marked variability in their response to *in vitro* capacitation methods \[[@B10], [@B28]\]. Zhang et al. \[[@B11]\] showed that both cleavage and blastocyst production rates may be positively correlated with fertility in bulls. The authors were able to determine predicted conception rates for the bulls they studied. Our experiment has produced similar findings, since the conception rates of bulls were efficiently estimated using IVP data from the same bulls ([Table 2](#tab2){ref-type="table"}). Also, Marquant-Le Guienne et al. \[[@B10]\] and Ward et al. \[[@B26]\], using a small number of bulls (*n* = 6), have reported a correlation between IVP and *in vivo* bull fertility, suggesting that IVP data can be utilized to predict bull fertility. The efficiency of a particular laboratory test to predict bull fertility is directly related to the statistical analysis methods used. To our knowledge, this is the first study to use Bayesian inference to estimate fertility in bulls. The use of Bayesian inference has been growing as an alternative statistical method, because complex problems in many fields can be solved using this method, including a limited set of data which are frequently observed in biological experiments. Moreover, the use of these models has been stimulated by the development of more sophisticated and efficient computer algorithms, like the program Winbugs 1.4 \[[@B16]\]. In this experiment, the estimated conception rates obtained when cleavage and blastocyst formation combined data used in the model were almost identical to the true conception rates observed for the same bulls, indicating that this is an efficient method to establish *in vivo* bull fertility estimation in commercial FTAI programs. The estimated conception rates were still close to the previously observed true conception rates, even when cleavage rate data or blastocyst formation data were used alone. However, since the IVP methodology can lead to a great deal of variation using the same bull and in this experiment only three animals were studied, this model should be investigated for a larger number of bulls, with extremely high and low IVP and FTAI results and different *in vitro*culture conditions in order to improve its accuracy. Moreover, field source of variations, like inseminator, moment of insemination, female ciclicity, hormonal treatment, season, geographical area, and type of food should be lead in consideration in the statistic model in order to minimize the influence of external factors \[[@B29]\]. We conclude that Bayesian inference is a suitable statistical method to estimate the fertility of bulls using IVP data. These results are interesting because they open the possibility of developing a statistical program to estimate *in vivo* bull fertility performance, based on laboratorial data, for application in the cattle industry reducing the probability of using low-fertility bulls in AI programs. The authors would like to thank the São Paulo Research Foundation FAPESP (Grant no. 06/51429-3). Bayesian inference implemented in the program Winbugs 1.4. 1. Binomial Model: $$\begin{matrix} {Y_{i} \backsim \text{Binomial}{\,\,}\left( {N_{i},p_{i}} \right),\quad i = 1,2,3} \\ \end{matrix},$$ where *Y*~*i*~: number of pregnant cows, *N*~*i*~: total number of cows, *P*~*i*~: conception rate, and *i*: bull. 1. Linked functions: $$\begin{aligned} {\text{model}{\,\,}1:{{\log\,}\,\left( \frac{p_{i}}{1 - p_{i}} \right)}} & {= \alpha + \beta_{1}f_{1i} + \beta_{2}f_{2i}} \\ & \left. \Rightarrow p_{i} = \frac{e^{\alpha + \beta_{1}f_{1i} + \beta_{2}f_{2i}}}{1 + e^{\alpha + \beta_{1}f_{1i} + \beta_{2}f_{2i}}}, \right. \\ {\text{model}{\,\,}2:{{\log\,}\,\left( \frac{p_{i}}{1 - p_{i}} \right)}} & {= \alpha + \beta_{1}f_{1i}} \\ & \left. \Rightarrow p_{i} = \frac{e^{\alpha + \beta_{1}f_{1i}}}{1 + e^{\alpha + \beta_{1}f_{1i}}}, \right. \\ {\text{model}{\,\,}3:{{\log\,}\,\left( \frac{p_{i}}{1 - p_{i}} \right)}} & {= \alpha + \beta_{2}f_{2i}} \\ & \left. \Rightarrow p_{i} = \frac{e^{\alpha + \beta_{2}f_{2i}}}{1 + e^{\alpha + \beta_{2}f_{2i}}}, \right. \\ \end{aligned}$$ where *α*, *β*~1~ and *β*~2~ are constants calculated in program Winbugs 1.4 through MCMC computer algorithms to establish the predictive model. Cleavage data (*f*~1*i*~) and Blastocyst formation data (*f*~2*i*~) that were provided to the program Winbugs 1.4 to estimate conception rates (*p*~*i*~). 2. Predictive models obtained using the program Winbugs 1.4: $$\begin{aligned} {\text{model}{\,\,}1:p_{io}} & {= \frac{e^{1.0 - 3.23f_{1i} + 13.39f_{2i}}}{1 + e^{1.0 - 3.23f_{1i} + 13.39f_{2i}}},} \\ {\text{model}{\,\,}2:p_{io}} & {= \frac{e^{- 0.47 + 1.1f_{1i}}}{1 + e^{- 0.47 + 1.1f_{1i}}},} \\ {\text{model}{\,\,}3:p_{io}} & {= \frac{e^{- 1.01 + 4.87f_{2i}}}{1 + e^{- 1.01 + 4.87f_{2i}}}.} \\ \end{aligned}$$ *Model 1:* estimation of bull fertility based on combined data of cleavage and blastocyst formation. *Model 2:* estimation of bull fertility based on cleavage rates only. *Model 3:* estimation of bull fertility based on blastocyst formation rates only. *f*~1*i*~*:* cleavage rate provided; *f*~2*i*~*:* blastocyst formation rate provided; *p*~*io*~: estimated bull fertility. ###### Fertility performance of each bull expressed as conception rate after fixed-time artificial insemination (FTAI). Pronuclei visualization, cleavage rates, and blastocyst formation rates (means ± SD) observed at 12, 72, and 168 hours after in vitro fertilization, respectively. Bull Inseminated cows Conception rate after FTAI (%)\* Total oocytes Analyzed zygotes Pronuclei (%) Cleavage\*\* (%) Blastocyst\*\* (%) ------ ------------------ ---------------------------------- --------------- ------------------ --------------- ------------------ -------------------- V 149 54.4 344 40 52.5 ± 1.7 77.9 ± 1.0^b^ 27.9 ± 0.5 T 109 54.1 341 40 40.0 ± 1.6 57.4 ± 0.4^a^ 22.8 ± 0.4 G 234 63.3 312 30 40.0 ± 1.8 78.1 ± 1.8^b^ 30.5 ± 0.5 ^a,b^Values with different superscripts in the same column are significantly different (*P* \< .05). \*Percentage calculated based on the number of pregnant cows in relation to the total number of inseminated cows. \*\*Percentage calculated based on the total number of oocytes minus the zygotes removed for pronuclei evaluation. ###### Comparison between conception rate after fixed-time artificial insemination (FTAI) and estimated fertility for each bull, established using the program Winbugs 1.4 with 95% of credibility interval, based on data from cleavage, blastocyst formation rates, and on the combined data. Bulls Conception rate after FTAI (%) Estimated conception rate (%±SD) and Credibility interval (%) ------- -------------------------------- --------------------------------------------------------------- ------------------------- ------------------------- V 54.4 59.8 ± 2.5 (54.9--64.5) 58.5 ± 2.2 (54.1--62.7) 54.7 ± 3.9 (47.1--62.3) T 54.1 54.2 ± 4.7 (44.8--63.6) 52.3 ± 4.5 (43.6--61.2) 54.2 ± 4.8 (44.8--63.5) G 63.3 59.8 ± 2.5 (54.9--64.6) 61.5 ± 2.8 (55.9--66.9) 63.0 ± 3.1 (56.9--68.9) \*Model 1 is based on combined data cleavage and blastocyst formation. \*\*Model 2 is based on cleavage data only. \*\*\*Model 3 is based on blastocyst formation data only (Appendix (C)). The conception rate was calculated based on the number of pregnant cows in relation to the total number of inseminated cows. Values in the same column are not significantly different (*P* \> .05). [^1]: Academic Editor: Lorraine M. Sordillo | Mid | [
0.566448801742919,
32.5,
24.875
] |
230 U.S. 537 (1913) SOUTHERN PACIFIC COMPANY AND OREGON & CALIFORNIA RAILROAD COMPANY v. CAMPBELL ET AL., CONSTITUTING THE RAILROAD COMMISSION OF OREGON. No. 428. Supreme Court of United States. Argued April 9, 1912. Decided June 16, 1913. APPEAL FROM THE CIRCUIT COURT OF THE UNITED STATES FOR THE DISTRICT OF OREGON. Mr. Maxwell Evarts for appellants submitted. Mr. Joseph N. Teal, with whom Mr. A.M. Crawford, *538 Attorney General of Oregon, and Mr. Clyde B. Aitchison were on the brief, for appellees. *547 MR. JUSTICE HUGHES delivered the opinion of the Court. This is an appeal from a decree of the Circuit Court entered July 18, 1911, dismissing the bill, on demurrer, for want of equity. 189 Fed. Rep. 182. The bill was filed by the complainants, the Southern Pacific Company and the Oregon & California Railroad Company, to set aside an order made by the Railroad Commission of Oregon under date of September 21, 1910, and to enjoin the defendants, the members of the commission and the Attorney-General of the State, from enforcing it. By this order, the commission found, after hearing, that certain freight rates maintained by the Southern Pacific Company between Portland and other places on its lines in Oregon were unreasonable, excessive and discriminatory, and the commission required the company, in lieu of the rates thus disapproved, to put into effect the "just and reasonable and non-discriminatory charges" set forth in the order. The first, and principal, contention of the appellants, is that this requirement was invalid as constituting a regulation of interstate commerce. The order, however, related solely to intrastate traffic, and the question raised by the bill, so far as its allegations bear upon the conditions of interstate transportation, does not differ in its essential features from that which was passed upon in the Minnesota rate cases. Minnesota Rate Cases, ante, p. 352. This objection to the order cannot be sustained. It is further insisted that the order was confiscatory. *548 The railroad property in question was that of the Oregon & California Railroad Company which was operated by the Southern Pacific Company under lease made in 1887. It was provided by the lease that the Southern Pacific Company should keep the property in good condition, "operate, maintain, add to, and better the same at its own expense," and should pay over annually to the lessor company the amount remaining of the net earnings, after all charges and expenses incurred by the Southern Pacific Company under the lease, and all taxes and interest, current fixed charges and all indebtedness of the lessor to the Southern Pacific Company, had been paid, save that if such amount should exceed specified percentages of the preferred and common stock of the lessor, the excess might be retained by the lessee. It was alleged that after payment of operating expenses, taxes, interest, and other reasonable and legitimate expenses, a deficit had accumulated representing an indebtedness to the Southern Pacific Company and amounting on June 30, 1906, to the sum of $6,222,037; but it also appeared that this deficit was reduced in the following years so that on June 30, 1909, it amounted to $3,207,008.37. The capital stock consisted of preferred stock of the par value of $12,000,000, and common stock of the par value of $7,000,000, and the bonded indebtedness amounted to $17,745,000, making in the aggregate $36,745,000. In one part of the bill it was alleged, without particulars showing the constituent items, that the total value of the property in Oregon, held under the lease, consisting of approximately 670 miles of road with rolling stock, stations, terminals and appurtenances, amounted to $43,594,886.73. But a later averment, in connection with the allegations as to outlays and return, was that "the properties of the Oregon & California Railroad Company are of the reasonable value of a sum representing the outstanding *549 bonded indebtedness and the deficit, as aforesaid and the capital stock of the company"; and so valued, the total would be $39,952,008.37. The receipts from the entire property and the disbursements for several years were stated. It was averred that for the fiscal year ending June 30, 1909, the total receipts were $7,104,081 and the disbursements, $5,839,698. As the court below pointed out, the bill was silent as to what was embraced in the aggregate expenditures, and the court thought it fair to assume that the total disbursements, as alleged, included not only the expenses of operation, but also interest on bonds and on open accounts and thus, that the averment showed, for the fiscal year ending June 30, 1909, a net balance of $1,264,383 as a return on the investment represented by $19,000,000 in par value of capital stock. It was alleged that the "annual loss of interstate and intrastate business combined," which would result if the order in question were enforced, would amount to $156,072.48. The court below concluded that on this showing it could not be said in advance of actual experience, that the rates fixed by the commission would not afford a fair return upon the value of the property. The order, as already noted, was made in September, 1910, and the bill was brought in October, 1910, but the receipts and disbursements for the fiscal year ending June 30, 1910, were not given. In addition to this omission, the bill was destitute of any allegation showing the expenses incurred in the conduct of the intrastate business as distinguished from the interstate business, or the share of the value of the property which was assignable to the former. In short, the allegations of the bill were wholly insufficient to show that the complainants would be deprived of just compensation in their business of intrastate transportation by virtue of the operation of the order. In sustaining the demurrer, the court gave to the complainants *550 thirty days in which to plead further; and they thus had opportunity for amending their bill so as to present additional averments which would correct deficiencies in the original allegations and remove any possible misapprehension as to the facts intended to be set forth. But the complainants informed the court that they did not desire to avail themselves of this opportunity and accordingly the bill was dismissed. We think that it cannot be said that any error was committed in thus disposing of the contention as to confiscation. It is also urged that the railroad commission act of Oregon (February 18, 1907 Laws of 1907, chap. 53, p. 67), and the order in question, were void as against the Oregon & California Railroad Company, and the lessee of its property, upon the ground that the act and order impaired the obligation of the contract contained in the charter of the first-mentioned company. That company was incorporated in 1870, under the general incorporation act of Oregon, approved October 14, 1862, which, in § 34, provided: "Every corporation formed under this act for the construction of a railroad, as to such road shall be deemed common carriers, and shall have power to collect and receive such tolls or freight for transportation of persons or property thereon as it may prescribe." Reference is also made to the following provision of the constitution of Oregon pursuant to which this incorporation act was enacted: "Corporations may be formed under general laws, but shall not be created by special laws except for municipal purposes. All laws passed pursuant to this section may be altered, amended or repealed but not so as to alter or destroy any vested corporate rights." (Art. XI, § 2.) The sole question presented on this branch of the case, it is said by counsel for the appellants, "is whether the judgment of the carrier in fixing rates for transportation of persons or property shall be supervised, *551 regulated and supplanted by the judgment of the State exercised through a Railroad Commission, or shall it remain as it was at common law, within the exclusive power and jurisdiction of the carrier to fix these rates, subject only to the power of the courts upon judicial inquiry, to denounce and decline to enforce rates that are excessive and unreasonable?" As to this question, it is sufficient to say that it is well established that a general charter provision such as the one quoted, giving power to charge and collect tolls, necessarily implies that the charges shall be reasonable and does not detract from the power of the State through its legislature, or the agency lawfully constituted thereby, to prescribe reasonable rates to be observed by the carrier. State v. Southern Pacific Co., 23 Oregon, 424, 432, 433; Stone v. Farmers' Loan & Trust Co., 116 U.S. 307, 330; Dow v. Beidelman, 125 U.S. 680, 688; Georgia R.R. & Banking Co. v. Smith, 128 U.S. 174, 181; Chicago, M. & St. P. Railway Co. v. Minnesota, 134 U.S. 418, 455; Covington & C. Bridge Co. v. Kentucky, 154 U.S. 204, 215; Louisville & Nashville Railroad v. Kentucky, 161 U.S. 677, 696; Owensboro v. Owensboro Waterworks Co., 191 U.S. 358, 370. In the case of Stone v. Farmers' Loan & Trust Co., supra, where the charter empowered the railroad company "from time to time to fix, regulate, and receive the toll and charges by them to be received for transportation of persons or property on their railroad," and it was insisted that a subsequent statute creating a railroad commission with authority to fix maximum rates was an impairment of contract obligation, the court said (p. 330): "The claim now is that by § 12" (the provision referred to) "the State has surrendered the power to fix a maximum for this company, and has declared that the courts shall be left to determine what is reasonable, free of all legislative control. We see no evidence of any such intention. Power is granted to fix reasonable charges, *552 but what shall be deemed reasonable in law is nowhere indicated.. . . Consequently, all the power which the State had in the matter before the charter it retained afterwards. The power to charge being coupled with the condition that the charge shall be reasonable, the State is left free to act on the subject of reasonableness within the limits of its general authority as circumstances may require. The right to fix reasonable charges has been granted, but the power of declaring what shall be deemed reasonable has not been surrendered." The remaining questions may be briefly disposed of. The complainants were not entitled to have the court below substitute its judgment for that of the commission or determine the matters which properly fell within the province of that body. The conditions of traffic, the adjustment of rates with respect to the different commodities transported, and the appropriate basis for classification, were subjects for the consideration of the commission, and there was nothing shown which would have warranted the court in overriding the decision of the commission upon the ground that its action was of such an arbitrary character as to constitute an abuse of power. The criticism made in the bill that the railroad commission act violated the state constitution in conferring upon the commission authority to exercise legislative, executive and judicial powers, has been answered by the decision of the state court, sustaining the statute. State v. Corvallis & Eastern R.R. Co., 59 Oregon, 450; 117 Pac. Rep. 980. The provision of the statute that suit might be brought in the state court to set aside orders of the commission upon the ground that the rates fixed were unlawful, or that the regulation or practice prescribed was unreasonable, did not infringe the rights of the complainants. The procedure permitted by the statute is consistent with the Fourteenth Amendment. Portland *553 Railway, Light & Power Co. v. Railroad Commission of Oregon, 229 U.S. 397. And, finally, the penal provisions, of which complaint is made, are separable; Reagan v. Farmers' Loan & Trust Co., 154 U.S. 362, 395; Willcox v. Consolidated Gas Co., 212 U.S. 19, 53, 54; Western Union Telegraph Co. v. Richmond, 224 U.S. 160, 172; they furnish no ground for denying effect to the rates, if otherwise valid. Our conclusion is that the demurrer was properly sustained. Decree affirmed. | Mid | [
0.5913043478260871,
34,
23.5
] |
A federal judge in Manhattan indicated on Monday that she was not prepared to grant President Trump exclusive first access to documents seized in F.B.I. raids on the office of his personal lawyer, and said that she was considering appointing an independent lawyer to assist in reviewing the seized materials. Feeling her way toward a resolution of the high-stakes clash involving Mr. Trump and the federal prosecutors investigating the lawyer, Michael D. Cohen, the judge, Kimba M. Wood, did not grant Mr. Trump’s request to review the trove of materials ahead of prosecutors. But she also decided that prosecutors would not immediately have access to the materials and that Mr. Trump would ultimately receive copies of the documents that pertain to him. The courtroom battle over what to do with the seized material came one week after federal agents, in an extraordinary move, descended on Mr. Cohen’s properties and walked away with 10 boxes of documents and as many as a dozen electronic devices, including cellphones and computer hard drives. Lawyers for Mr. Trump and Mr. Cohen, and prosecutors with the United States attorney’s office for the Southern District of New York, had asked Judge Wood for the right to look at the documents in order to determine which among them might be protected by attorney-client privilege. That step is important because it could affect which documents prosecutors can ultimately use in the investigation. | Mid | [
0.5939849624060151,
39.5,
27
] |
# -*- coding: utf-8 -*- __all__ = ["optimize"] import os import sys import numpy as np import pymc3 as pm import theano from pymc3.blocking import ArrayOrdering, DictToArrayBijection from pymc3.model import Point from pymc3.theanof import inputvars from pymc3.util import ( get_default_varnames, get_untransformed_name, is_transformed_name, update_start_vals, ) from .utils import ( deprecated, get_args_for_theano_function, get_theano_function_for_var, logger, ) def start_optimizer(vars, verbose=True, progress_bar=True, **kwargs): if verbose: names = [ get_untransformed_name(v.name) if is_transformed_name(v.name) else v.name for v in vars ] sys.stderr.write( "optimizing logp for variables: [{0}]\n".format(", ".join(names)) ) if progress_bar is True: if "EXOPLANET_NO_AUTO_PBAR" in os.environ: from tqdm import tqdm else: from tqdm.auto import tqdm progress_bar = tqdm(**kwargs) # Check whether the input progress bar has the expected methods has_progress_bar = ( hasattr(progress_bar, "set_postfix") and hasattr(progress_bar, "update") and hasattr(progress_bar, "close") ) return has_progress_bar, progress_bar def get_point(wrapper, x): vars = get_default_varnames(wrapper.model.unobserved_RVs, True) return { var.name: value for var, value in zip( vars, wrapper.model.fastfn(vars)(wrapper.bij.rmap(x)) ) } @deprecated("the optimize function from the pymc3-ext library") def optimize( start=None, vars=None, model=None, return_info=False, verbose=True, progress_bar=True, **kwargs ): """Maximize the log prob of a PyMC3 model using scipy All extra arguments are passed directly to the ``scipy.optimize.minimize`` function. Args: start: The PyMC3 coordinate dictionary of the starting position vars: The variables to optimize model: The PyMC3 model return_info: Return both the coordinate dictionary and the result of ``scipy.optimize.minimize`` verbose: Print the success flag and log probability to the screen progress_bar: A ``tqdm`` progress bar instance. Set to ``True`` (default) to use ``tqdm.auto.tqdm()``. Set to ``False`` to disable. """ from scipy.optimize import minimize wrapper = ModelWrapper(start=start, vars=vars, model=model) has_progress_bar, progress_bar = start_optimizer( wrapper.vars, verbose=verbose, progress_bar=progress_bar ) # This returns the objective function and its derivatives def objective(vec): nll, grad = wrapper(vec) if verbose and has_progress_bar: progress_bar.set_postfix(logp="{0:e}".format(-nll)) progress_bar.update() return nll, grad # Optimize using scipy.optimize x0 = wrapper.bij.map(wrapper.start) initial = objective(x0)[0] kwargs["jac"] = True info = minimize(objective, x0, **kwargs) # Only accept the output if it is better than it was x = info.x if (np.isfinite(info.fun) and info.fun < initial) else x0 # Coerce the output into the right format point = get_point(wrapper, x) if verbose: if has_progress_bar: progress_bar.close() sys.stderr.write("message: {0}\n".format(info.message)) sys.stderr.write("logp: {0} -> {1}\n".format(-initial, -info.fun)) if not np.isfinite(info.fun): logger.warning("final logp not finite, returning initial point") logger.warning( "this suggests that something is wrong with the model" ) logger.debug("{0}".format(info)) if return_info: return point, info return point @deprecated("the optimize_iterator function from the pymc3-ext library") def optimize_iterator( stepper, maxiter=1000, start=None, vars=None, model=None, **kwargs ): """Maximize the log prob of a PyMC3 model using scipy All extra arguments are passed directly to the ``scipy.optimize.minimize`` function. Args: stepper: An optimizer object maxiter: The maximum number of steps to run start: The PyMC3 coordinate dictionary of the starting position vars: The variables to optimize model: The PyMC3 model return_info: Return both the coordinate dictionary and the result of ``scipy.optimize.minimize`` verbose: Print the success flag and log probability to the screen progress_bar: A ``tqdm`` progress bar instance. Set to ``True`` (default) to use ``tqdm.auto.tqdm()``. Set to ``False`` to disable. """ wrapper = ModelWrapper(start=start, vars=vars, model=model) x = wrapper.bij.map(wrapper.start) n = 0 stepper.reset() while True: x, nll = stepper.step(wrapper, x) yield nll, get_point(wrapper, x) n += 1 if maxiter is not None and n >= maxiter: break def allinmodel(vars, model): notin = [v for v in vars if v not in model.vars] if notin: raise ValueError("Some variables not in the model: " + str(notin)) class ModelWrapper: def __init__(self, start=None, vars=None, model=None): model = self.model = pm.modelcontext(model) # Work out the full starting coordinates if start is None: start = model.test_point else: update_start_vals(start, model.test_point, model) self.start = start # Fit all the parameters by default if vars is None: vars = model.cont_vars vars = self.vars = inputvars(vars) allinmodel(vars, model) # Work out the relevant bijection map start = Point(start, model=model) self.bij = DictToArrayBijection(ArrayOrdering(vars), start) # Pre-compile the theano model and gradient nlp = -model.logpt grad = theano.grad(nlp, vars, disconnected_inputs="ignore") self.func = get_theano_function_for_var([nlp] + grad, model=model) def __call__(self, vec): try: res = self.func( *get_args_for_theano_function( self.bij.rmap(vec), model=self.model ) ) except Exception: import traceback print("array:", vec) print("point:", self.bij.rmap(vec)) traceback.print_exc() raise d = dict(zip((v.name for v in self.vars), res[1:])) g = self.bij.map(d) return res[0], g class Adam: """https://github.com/pytorch/pytorch/blob/master/torch/optim/adam.py""" def __init__( self, lr=1e-3, betas=(0.9, 0.999), eps=1e-8, weight_decay=0, amsgrad=False, ): if not 0.0 <= lr: raise ValueError("Invalid learning rate: {}".format(lr)) if not 0.0 <= eps: raise ValueError("Invalid epsilon value: {}".format(eps)) if not 0.0 <= betas[0] < 1.0: raise ValueError( "Invalid beta parameter at index 0: {}".format(betas[0]) ) if not 0.0 <= betas[1] < 1.0: raise ValueError( "Invalid beta parameter at index 1: {}".format(betas[1]) ) if not 0.0 <= weight_decay: raise ValueError( "Invalid weight_decay value: {}".format(weight_decay) ) self.lr = lr self.betas = betas self.eps = eps self.weight_decay = weight_decay self.amsgrad = amsgrad self.reset() def reset(self): self.state = {"step": 0} def step(self, loss_and_grad_func, p): loss, grad = loss_and_grad_func(p) state = self.state if state["step"] == 0: # Exponential moving average of gradient values state["exp_avg"] = np.zeros_like(p) # Exponential moving average of squared gradient values state["exp_avg_sq"] = np.zeros_like(p) if self.amsgrad: # Maintains max of all exp. moving avg. of sq. grad. values state["max_exp_avg_sq"] = np.zeros_like(p) exp_avg, exp_avg_sq = state["exp_avg"], state["exp_avg_sq"] if self.amsgrad: max_exp_avg_sq = state["max_exp_avg_sq"] beta1, beta2 = self.betas state["step"] += 1 bias_correction1 = 1 - beta1 ** state["step"] bias_correction2 = 1 - beta2 ** state["step"] if self.weight_decay != 0: grad[:] += self.weight_decay * p # Decay the first and second moment running average coefficient exp_avg[:] *= beta1 exp_avg[:] += (1 - beta1) * grad exp_avg_sq[:] *= beta2 exp_avg_sq[:] += (1 - beta2) * grad ** 2 if self.amsgrad: # Maintains the maximum of all 2nd moment running avg. till now max_exp_avg_sq[:] = np.maximum(max_exp_avg_sq, exp_avg_sq) # Use the max. for normalizing running avg. of gradient denom = ( np.sqrt(max_exp_avg_sq) / np.sqrt(bias_correction2) + self.eps ) else: denom = np.sqrt(exp_avg_sq) / np.sqrt(bias_correction2) + self.eps step_size = self.lr / bias_correction1 return p - step_size * exp_avg / denom, loss | Low | [
0.5343228200371051,
36,
31.375
] |
Product Description Anyone who has ever played a sport, gone jogging, or taken an aerobics class knows that you should warm up before you exercise. Stretching and other warm ups help prevent muscle strain, improve performance, and can increase the longevity of use. So how about before you give a speech, teach a class, or facilitate a group? Do you warm up your voice? Do you stretch your face? Not only will they help you prevent voice strain and improve the quality of your voice, vocal warm ups give you access to use your voice more effectively. Varying the tone, volume, and inflection can make a huge difference in HOW your presentation is received by your audience. This edition of Hot Air includes some tips and techniques that will absolutely, no kidding, you-won’t-believe-how-easy-it-is, significantly improve your voice quality. (READ: This will not happen through osmosis.) Face Stretches Warm up your whole body through simple stretching exercises, shoulder and necks rolls, and face stretches. Yes, face stretches. We tend to warm our bodies up from toes to neck, but neglect our head and face. Start with the Prune Face. Squeeze everything in your face as tight as possible (like a shriveled prune). Hold the “squeeze” for a few seconds and then do the Yawn (or Lion) Face. The Yawn Face is the opposite of the Prune Face, whereby you should open your mouth and eyes, stretch everything as far open as you can (that includes your tongue). Hold the Yawn Face for a few seconds and then back to the Prune Face. Repeat the sequence 4 or 5 times. Massage your jaw, your sinuses (forehead and nasal area), and your ears to help your face loosen up. Ahhhhhhh. Doesn’t that feel good? Just like the rest of your body, it is imperative that you warm up your voice muscles, too. While performing vocal exercises, it is best to keep your arms hanging loosely at your side and your feet shoulders’ width apart (neutral position). Review Part I: Back to Basics Breathing for reminders on proper abdominal breathing. Humming Humming is probably the fastest and easiest way to improve the quality and longevity of your voice. Not to mention, it’s really cheap. The following exercise is adapted from The Lawyer’s Leading Edge: Exceptional Courtroom Performance, written by my good friends Lisa DeCaro and Len Matheo. Fine Print: This exercise is not intended to give you a prettier singing voice and will not guarantee you a spot on American Idol. • Start humming with your mouth closed, either a comfortably low note, or the melody to a familiar song like Twinkle, Twinkle, Little Star, or Happy Birthday. • Progressively hum louder. • Then open your mouth wide and relax your jaw so that the humming sound is coming more from your nose, rather than your mouth. Keep humming, not singing, and concentrate on relaxing your jaw. Jaw tension can cause you to strain your vocal chords. Tip: If this is difficult, try placing your tongue flat against the roof of your mouth. • Increase your volume until you can feel your sinuses vibrating and continue humming for about 5 minutes. A bonus if you have allergies or a cold is that your sinuses will drain after a short while. • Practice for 5 minutes every day for a week, and you will notice a remarkable difference in the quality and control of your voice. Voice Amplifiers (or Resonators) When we breathe properly (from the diaphragm), air is pushed out of the lungs, through the trachea, and past the vocal chords. Sound is produced because the air causes the vocal chords to vibrate. However, the vocal chords can only initiate sound; they are not responsible for volume and tone. That amplification of sound is caused by cavities of air in your face, head, neck, and chest called resonators. Relying on your vocal chords to increase your volume will cause voice strain and possibly, loss of voice. In addition to warming up your vocal chords, you should also warm up your voice amplifiers, or resonators. The following exercises (also adapted from The Lawyer’s Winning Edge) are designed to open up the amplifiers, or resonating cavities, in your body. First, spend a few minutes on each of the five sounds. Once you feel like each cavity is warmed up, put them all together consecutively with one breath. Remember, the purpose of these exercises is to warm up your nasal cavities, etc., not to sound beautiful. “MEE” ‘Very nasal sounding; from high up in your nose; warms up your nasal cavities and those in your forehead. Tip: If you can’t feel it vibrating in your nose and forehead, place a pencil between your teeth and try to send the sound up and over the pencil. “MAY” Still nasal, but from about the middle of your face; lower in your nose than MEE, but still above the teeth; warms up your sinus cavities “MAH” Inside your mouth, sound comes from your lips and tongue “MOE” From your throat, in the area around your Adam’s apple. Tip: Don’t force the sound to be loud; just the vibration will do it. “MOO” You should feel the vibration in your chest cavity Enunciation & Articulation We tend to be lazy with our speech, at minimum under-articulating the ends of words, and at worst, mumbling or slurring. A few simple and quick exercises can greatly improve your diction and ensure that everyone understands what you are saying. Consonants Exercise Repeat the sounds of the letters in each pair below 5 or 6 times. Really exaggerate the movement of your jaw, lips, and tongue. • B / P (buh/puh) Place your open palm a few inches from your mouth and notice the puff of air you feel with the “puh” sound. • C / G (kuh/guh) Notice how the position of your jaw changes. • D / T (duh/tuh) Your jaw position should change for each of these. • F / V Do you place your teeth on your lips differently for these two? • M / N Your mouth should be closed with lips together on “M” and open with your tongue against the back of your teeth on “N”. • S / Z Notice the different vibration for these two. Tongue-Twisters To avoid tripping over words when you speak, combine the Consonant exercise above with a few of the following. Again, the idea is to completely exaggerate and over-enunciate the words during the warm up. Of course, you will rarely have time to go through all of the exercises above right before you have to speak, so here are a few quick tips to consider before you make your next presentation. Quick Tips • Hum (loudly) for at least five minutes before a speech or presentation. • Practice a few quick enunciation and articulation exercises. • Avoid dairy and syrupy beverages like soft drinks right before you speak • Keep a glass of water easily accessible (room temperature, not ice water which can constrict your vocal chords). Have fun with these exercises. They aren’t supposed to feel like “work.” Plan 5 or 10 minutes in your day for a little stretching and warming up (physically and vocally) and you’ll be amazed how much better you feel – and sound! "Speak clearly, if you speak at all; carve every word before you let it fall." ~Oliver Wendell Holmes | High | [
0.704960835509138,
33.75,
14.125
] |
Otsego Lake Otsego Lake may refer to: Bodies of water: Otsego Lake (Michigan) Otsego Lake (New York) Other: Otsego Lake Township, Michigan Otsego Lake State Park, Michigan | Low | [
0.48109243697478904,
28.625,
30.875
] |
While medical and technological advances continue to shape and advance health care, these advances have not always directly translated to significant improvement in overall health care quality outcomes in the United States. Incorporating advancements into the health care models creates complex challenges in delivering high-quality medical care. In this article, we provide a brief outline on the history of such efforts and how they have changed health care systems. Improving the quality of care rendered to patients has been a principle since the time of Hippocrates. Over time, there have been various advances in systems of care (Walter Letterman developing systems of triage of casualties in the American Civil War) as well as nursing (Florence Nightingale instilling Listerean principles of infection control in hospitals). However, the past century has seen many innovators and changes instrumental in the improvement in the quality of care in medicine. Understanding these recent contributions to quality improvement in health care frames future directions and emphasis in complex fields such as spinal surgery. Abraham Flexner is an early contributor to the United States' effort in quality improvement in that he performed a retrospective analysis and review of the system. He constructed a *Report to the Carnegie Foundation*, which were published his results and recommendations in 1910. He described the poor organization of major hospitals and medical schools in the nation. With the aim of improving physician training, the report encouraged improving scientific method, and strengthening validity of medical licensure. This report resulted in restructuring of the medical education in the United States and resulted in the closure or merging of more than half the medical schools.^[@bibr1-2192568219853529]^ Meanwhile, Ernest Codman, an orthopedic surgeon from Boston, Massachusetts was championing changes for quality improvement through the use of patient registries and serial patient follow-up. He created a systematic protocol for following long-term patient progression and "end patient results." Codman felt that all patients should be tracked in this manner and results be made public so that all patients could use the information in choosing their physicians and hospitals. While public reporting such as this may have incentivized hospitals to preselect patients to avoid bad results, Codman's emphasis was largely placed on identifying effective versus ineffective implementation of health care treatments.^[@bibr2-2192568219853529]^ Codman's description of his end-result system inspired Dr Franklin Martin. He envisioned principles of patient outcomes assisting in surgeon and hospital standardization leading to an improvement in patient care. To address these needs, Dr Martin largely proposed and catalyzed the founding of the American College of Surgeons in 1913. The committee found it necessary to reject 60% of fellowship applications in its first 3 years of existence given the inability to determine clinical competency with the case records presented by the applicants.^[@bibr3-2192568219853529]^ As the American College of Surgeons' influence increased, John Bowman, PhD, the director acquired a large donation to fund a hospital standardization program. Over 300 fellows and hospital administrators met in 1917 to discuss an accreditation process and establish the "minimum standards" required of hospitals nationwide.^[@bibr4-2192568219853529]^ Such standards included 5 main objectives: organize hospital medical staff, ensuring employment of only well-qualified and licensed physicians, ensuring regular staff and clinical performance review, maintaining thorough and organized medical records, and establishing facilities such as clinical laboratories and radiology departments ([Figure 1](#fig1-2192568219853529){ref-type="fig"}). Using these principles, the Hospital Standardization Program was established and reviewed 692 hospitals with 100 beds or more. Unfortunately, only 89 hospitals met these minimum standards for accreditation. While many hospitals were able to remediate and address their deficiencies, the report demonstrated the continued need for quality improvement in the United States' hospital system and the "minimum standard" was officially adopted to firmly establish a hospital accreditation process. This was paramount in instituting and maintaining organized quality improvement in the United States.^[@bibr5-2192568219853529]^ {#fig1-2192568219853529} As the number of hospitals, nonsurgical specialties, and complexity of health care continued to grow, the size of the Hospital Standardization Program rapidly grew requiring over 2 million dollars in investment from the American College of Surgeons by 1950. It became apparent that support for this quality improvement initiative could not be sustained by the College alone and the scope of its involvement extended to many nonsurgical aspects of health care. As a result, the American College of Surgeons was joined by the American College of Physicians, American Hospital Association, American Medical Association, and briefly the Canadian Medical Association to form the Joint Commission on Accreditation of Hospitals in 1952. The independent, nonprofit organization begin offering accreditation to hospitals in 1953 while upholding the values championed by the American College of Surgeons. The Joint Commission expanded the Hospital Standardization program by hiring surveyors and careful interviews and observation of medical staff and patient care issues. As the program expanded more hospitals continued to meet and maintain the "minimum standards." As a result, the Joint Commission no longer felt that the standards were pushing hospitals to strive for higher levels of quality than already achieved. Concurrently, others in the nation were looking to further quality improvement. Health Services Research Section of the US Public Health Service convened a meeting in 1965 during which leaders from many health-related fields convened to discuss social and economic research on public health and quality improvement. Among these leaders was Avedis Donabedian, considered by many to be one of the founders of the contemporary health care quality movement.^[@bibr6-2192568219853529]^ Born 1919, in Beirut, Lebanon, his family moved to Palestine after fleeing the Armenian holocaust. Eventually attending American University of Beirut, he obtained his BA and MD. Using this training, he served as a general practitioner in Beirut and Jerusalem until 1954 at which point he moved to Boston. He obtained an MPH degree at Harvard School of Public Health and spent most of his career teaching at the School of Public Health at The University of Michigan. He was very passionate about the relationship between quality and systems in health care and felt that the skills of system management were not well taught in medical school.^[@bibr7-2192568219853529]^ As such, he was commissioned to review the research on quality assessment. When he published his paper "Evaluating the Quality of Medical Care" in July 1966, the reception was enormous. It became one of the most frequently cited public health pieces over the next half century. In his paper, Donabedian describes 7 pillars of quality in medicine:EfficacyEfficiencyOptimalityAcceptabilityLegitimacyEquityCost The difficulty in the past was how to measure these goals. To accomplish this, he described three types of metrics for evaluating quality in health care: structure, process, and outcome ([Figure 2](#fig2-2192568219853529){ref-type="fig"}). *Structure* includes credentialing of providers, adequacy of facilities, and administrative systems delivering care. *Process* observes which components of care are delivered and their appropriateness and competency of delivery. He recognized that it is rarely the individual that creates the problem but rather the process is a fault and needs to be changed for better results. *Outcome* involves evaluation of recovery, restoration of function, and survival. Measuring outcomes is necessary to determine what interventions are effective and should be implemented. Within these standards, he emphasized the need for clear presentation of these metrics (dashboards and scorecards) and broad quality measurements, including prevention, recovery, continuity of care, societal and cultural values, and economic efficiency. This way physicians can begin to truly understand evidence surrounding a problem and recognize issues affecting health care quality. This also provided the framework on which the interest in patient individualized outcomes and value-based care was developed.^[@bibr8-2192568219853529]^ {#fig2-2192568219853529} These advances largely structured health care improvement quality for several decades. During this time, the Institute of Medicine was founded in 1970 by the National Academy of Sciences. Originally formed in 1863, the Academy, a nonprofit private institution, was formed to advise the government on scientific and technological issues. Over time, the scope of the Academy's responsibilities began to include medicine and different aspects of health care. After Avedis Donabedian published his work, the concern over establishing a body advising the government on issues regarding social, economic, and political aspects of health care as well as medicine evolved. Out of this need the Institute of Medicine was founded in 1970. The members of this committee included not only major health profession disciplines but also economists, sociologists, engineers, writers, ethicists, and innovative business representatives with success in areas related to health care issues in the United States.^[@bibr9-2192568219853529]^ Since its founding, the Institute of Medicine has continued to produce field defining publications. As an organization, it publishes roughly 50 well-vetted reports in medicine each year. One such publication, *America's Health in Transition: Protecting and Improving Quality*, was published in 1994. It asserts that health care quality is the degree to which health care improves outcomes and maintain consistency with current knowledge of practice. Obstacles to achieving this goal were outlined as unnecessary/inappropriate care, underuse of effective/appropriate care, and shortcomings in technical or personnel in care.^[@bibr10-2192568219853529]^ This was followed by the Institute of Medicine's initiative proposing a coordinated effort to further exam quality improvement issues, devise measurements of quality improvement issues, all while paying special attention to vulnerable populations that do not traditionally receive the same quality of care as others in the United States. While this launched a coordinated effort, it was not until the 1999 report *To Err Is Human* that the quality improvement initiative gained public traction.^[@bibr11-2192568219853529]^ Reporting that nearly as high as 100 000 preventable deaths per year occur during health care delivery due to medical errors. The leading causes of the death were medication and communication errors. This report outlined the need for improvement in medical electronic information systems and reporting of medical errors. The medical electronic information system remained far less developed than in other disciplines such as banking or the airline industry. In addition, liability without protection for health care workers inhibited error reporting and resulting improvements.^[@bibr11-2192568219853529]^ This spurred public awareness and catalyzed the Agency for Healthcare Research and Quality (AHRQ) to perform a review on quality assessment and improvement in US health care. As this investigation was launched, there was an additional publication by the Institute of Medicine in 2001, *Crossing the Quality Chasm*, further demonstrated the discrepancy between the recommended delivery of health care and the reality of American health care in its current form. It described the factors that delivered inconsistent health care across the country regardless of insurance status, race, gender, geographic location of the patient. The Institute of Medicine report illustrated that medical information has irregular distribution secondary to poor information systems and lagging use of current technology. This prevents scientific advances from becoming uniformly available to practitioners across the country. From this discrepancy, new clinical education centered on increased interdisciplinary cooperation identified specific aims as drivers of health care change. These drivers were safety, efficacy, patient-centered care, timely, efficient, and equitable.^[@bibr12-2192568219853529]^ Overall, the report emphasized use of new technologies to deliver safer, more efficacious, and cost-effective care without financially penalizing individuals streamlining the care. Since these publications defining the future direction of quality improvement, the Institute of Medicine has worked through three platforms: environmental, health care organization, and the interface between physicians and patients. Such efforts include redesigning primary care and care for patients with chronic conditions, restructuring insurance coverage and malpractice in *Fostering Rapid Advances in Health Care: Learning form System Demonstrations*.^[@bibr13-2192568219853529]^ Another agenda laid forth ideas for educational reform, including establishment of core competencies, public reporting, and fostering training environments and oversight.^[@bibr14-2192568219853529]^ It was also during this time that the Institute of Medicine emphasized institution of electronic health record systems with national standards for collection of this data.^[@bibr15-2192568219853529],[@bibr16-2192568219853529]^ Finally, the Institute of Medicine outlined common and costly medication errors as well as a comprehensive approach to minimizing these errors in the report *Preventing Medication Errors*.^[@bibr17-2192568219853529]^ Since its founding, the Institute of Medicine has changed its name to The National Academy of Medicine (<http://www.nationalacademies.org/hmd/>). It has been instrumental in launching a quality improvement initiative consisting of 3 phases. Already, in the first 2 phases, the Institute of Medicine has outlined and highlighted the discrepancy between current and ideal delivery of health care, made proposals on how to transform the health care system to close this gap. The final phase of this quality improvement initiative focuses on ongoing efforts to execute this transformation and the proposed mechanisms for quality improvement. Understanding this history is vital for spine surgeons moving forward. Spine surgery has not been immune to the health care quality initiative. The quality improvement movement will define the future trajectory of major specialties such as spine surgery. All the concepts defined in the past century such as outcome-based care, standardization, and resource efficiency will guide future policy. Health systems are moving away from the fee for service model and pushing for a more sustainable system. This system is grounded in population health and preventative medicine, value-based care, and new payment models.^[@bibr18-2192568219853529]^ Traditionally, the surgical management of patients with spinal disorders represented a very heterogeneous population with varied outcomes. Variability can be defined as both expected variation as well as unexpected variation.^[@bibr19-2192568219853529]^ This unexplained variation can lead to excess waste and costs. Costs associated with surgical intervention may be very high and outcomes are poorly characterized. This is may be due to the homogenization of techniques that evidence-based medicine encourages. As prospective trials and studies with high levels of evidence require rigid inclusion/exclusion criteria with control of confounding variables, large studies quickly lose their generalizability. This makes higher level evidence costly and difficult to apply to patients with spinal disorders. This is an example of the Institute of Medicine's described discrepancy between current and ideal delivery of health care. As such, there is opportunity for quality improvement as cost, efficacy, safety, and patient centered outcomes have yet to be fully defined for many treatment paradigms in existence. To address this deficiency, spine registries have gained popularity in parallel with growing emphasis on health care quality improvement. With a foundation laid upon Ernest Codman's work in "end result theory," registries represent a more scalable, cost-effective, alternative to randomized clinical control trials evaluating outcomes in a more generalizable context. The first major registry established was the National Spinal Cord Injury Database. Started in 1973, the database was originally part of a project mean to demonstrate superiority of comprehensive spinal cord injury care over fragmented care across different centers.^[@bibr20-2192568219853529]^ As multiple centers joined the project, large volumes of data were generated for analysis. In the first 10 years alone, the National Spinal Cord Injury Statistical Center spurred advancements in spinal cord injury care in emergency, acute care, and rehabilitation settings. Rare for the time period, prospective data was collected on patient demographics, pathology, procedures, complications, implants, and patient-reported outcomes. Being one of the longer maintained databases, it has served as an example on the data that can be generated from years of follow-up on a variety of spinal pathology. Since then, many major registries have been established with ongoing enrollment since then. Such registries include the Swedish Spine Registry, Spine Tango, Rick Hansen SCI, N^2^QOD, British Spine, AOSpine, Kaiser Permanente, Vanderbilt Prospective Spine, North America Clinical Trials Network (NACTN), NASS and include various pathologies such as trauma, degenerative lumbar disease, and deformity among other conditions.^[@bibr21-2192568219853529],[@bibr22-2192568219853529]^ As the scope of a registry gets larger, the follow-up tends to be shorter as the infrastructure required to maintain the database increases. As such, along with the Swedish Spine register, N^2^QOD (renamed as the QOD, Quality Outcomes Database) is a multicenter registry collecting prospective patient-reported outcomes with 12-month follow-up rates exceeding 75%. As these databases accumulate data, it is becoming apparent that while spinal surgery generally has low rates of morbidity and high rates of sustained treatment effects. However, there is a large degree of heterogeneity and significant variation in treatments as well as individual's response to treatment from patient to patient. It is important to note that there are wide variations in the design and data accumulated. Registries may have prospective versus retrospective designs, variability in follow-up and sample sizes, and different metrics used to evaluate outcomes. All of this must be weighed carefully as different clinical conclusions may be drawn from different data sets. However, understanding this will allow physicians to identify registries that best suit the population they serve when using them to enforce clinical decisions. These registries will become extremely important in improving quality care by identifying which cohorts of patients will or will not benefit from a particular surgery. Using data from a registry like QOD, a surgeon will be able to create a personalized predictive calculator for an individual patient's response to therapy.^[@bibr23-2192568219853529]^ As Donabedian noted late in his career, "There's lip service to quality and, goodness knows, propaganda, but real commitment is in short supply."^[@bibr24-2192568219853529]^ As clinical registry databases continue to grow, and the information technology platforms on which they are based improve, their predictive modeling capabilities and comparative power will continue to accumulate and drive quality improvement in medicine forward. They will provide invaluable data on comparative efficacy of various surgical and nonsurgical treatments for spinal disease. The development of these quality improvement efforts will also improve the systems of care to patients at the local level. These registries represent invaluable adjuncts to randomized clinical trials that will evaluate rapidly changing heterogeneous populations and practices.^[@bibr25-2192568219853529]^ Using these tools, treatment paradigms may be altered so that the quality of spinal care delivered may be more efficacious, cost-effective, safe, and patient centered. As the history of quality improvement in recent years has shown, value-based and outcome-driven policy is becoming more important in every field, including spinal surgery. The future of spine surgery is interwoven with these quality improvement developments as the field searches for ways to improve the outcomes of these heterogeneous, complex patients. **Declaration of Conflicting Interests:** The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article. **Funding:** The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This supplement was supported by funding from AO Spine North America. **ORCID iD:** Kevin Hines, MD  <https://orcid.org/0000-0003-1700-174X> Nikolaos Mouchtouris, MD  <https://orcid.org/0000-0001-9495-9391> | High | [
0.656914893617021,
30.875,
16.125
] |
My Home on the Mountain I'm not sure I believe in fate, but the fact that my dad bought a house in Windham, New York, is too important to me to be sheer coincidence. He bought the house when he was in his twenties, before he even thought about having me, and spent the better part of a decade rebuilding it. It was the original farmhouse of the surrounding area when it was built in the late 1800s. My dad bought it when all that was left was a frame and a roof, and the work began. The Adaptive Sports Foundation on Windham Mountain has become one of my favorite places to go to in the winter. From the moment we walk in, it's brimming with activity, from all the students itching to hit the slopes to the instructors coming in from morning runs. My brother Izzy, of course, runs straight for the hot chocolate, which he has dubbed the best in the world. Then, right around ten o’clock, a sort of choreographed chaos ensues as we get ready to take on the mountain. My dad is a Broadway stagehand, but not just a regular stagehand; he's the head electrician. A light in the ladies' room doesn't get changed without his say-so. Here's something you need to know about my dad: he can do pretty much anything. And when restoring an 1800s farm house, that's a good thing. There was no construction crew for this project, just my dad, whichever buddies came to help, and Sammy, my dad's beloved dog. I have heard many times about the early days, when my dad and Sammy would sleep next to each other other on the kitchen floor because the only heater in the house was there. My dad had to keep rotating because one side would be sweating while the other was freezing. Getting in the ski is a bit of a process; it involves duct tape and many straps. I go down the mountain in a bi-ski, which is a bucket seat with two skis on the bottom. Once I'm strapped in, all I want to do is go fast! When I'm in that ski with the mountain flying by, I feel totally independent. The instructors and everyone on the mountain disappear, and I really do get to do this on my own. That sense of solitude while sliding down the mountain is enthralling. The first time I tried skiing, it was nothing like I imagined. Often when the word “adaptive” is tacked on at the beginning of something, it can lose some intensity. But shredding down that hill, I knew the instructors weren't letting up. We were hitting jumps in the second lesson! There was one thing I was sure would bother me. While the vast majority of the population loves and thrives on that whole wind-in-your-hair feeling, I am without a doubt an outlier — wind is usually sensory hell. But I rarely noticed it once we got started. The house on Mill Street was my dad's weekend project on steroids. It still has a whole workshop that would make any tool buff drool. The shop is where the heavy work got done. It is like something out of a PBS woodworking show: table saws, sanders, even an axe from Japan — a tool for every job. In talking about the shop, I'm obliged to mention the table. My dad had this idea to build a round table à la the Knights of Camelot. The problem is he never got to it; the wood has been sitting there since before I was born. Having a family changed everything for my dad. Before he met my mom, two wood burning stoves were going to heat the whole house. My mom wouldn’t have that, and he installed a real heating system that he is now thankful for. My dad always says, “We are a DIY family.” This year he made me a sled for cross-country skiing. I love that he made it, but cross-country misses the best part of skiing: speed. They should call it snow hiking. Hiking around North Lake is serene any time of year, but winter is stark and still. We find silent moments between snowshoes crunching the frosty path. The sled glides. Slowly, we appreciate the afternoon sun's waning. Our Mill Street house is a place that will always be special to me. It is where I learned to ski, but it is also so much more. It's where we go to the creek, sometimes for a bike ride and sometimes for an evening stroll. I don't even want to think what would have been if my dad had chosen one of the many other houses he saw. Would I never have skied? Where would my oldest friend's mom have gotten married? Would Camp Weitzman, the annual week where our friends come up for a mini summer camp, even exist? Some things have changed — my brother and I now have our own room, and our family has a new hot tub — but the essence stays the same. We may not have a giant man cave like the house across the street. We don't even have cable. What we do have is a bunch of amazing memories from our time there. I'm not sure I believe in fate, but my dad’s buying that house was more than just coincidence. Abraham Weitzman is a 13-year-old New Yorker who loves Mel Brooks, Edgar Allen Poe, and Sherlock Holmes. He enjoys traveling and staying home. Support KidSpirit KidSpirit’s teen editors and contributors around the world believe in a better future. Help empower the next generation to raise their voices and move forward in a spirit of openness and inclusion - make a tax-deductible contribution to KidSpirit today. $USD KidSpirit, Inc is a 501(c)(3) nonprofit organization Subscribe to KidSpirit’s newsletter to stay up-to-date on all our youth-created content! | Mid | [
0.562043795620437,
28.875,
22.5
] |
Newest Titan Marcus Mariota survives rookie whirlwind A day after the Titans selected Marcus Mariota with the second pick of the NFL draft, coach Ken Whisenhunt showed his young quarterback how much he likes him. When Mariota arrived in Nashville on Friday, Whisenhunt gave him the shirt off his back. OK, so it came out of the coach's closet. Turns out the one Mariota brought with him from Hawaii didn't quite fit. It worked for the day. The Titans hope Mariota will be a perfect fit in Tennessee, where Whisenhunt plans to tailor his offense to fit the athletic quarterback. "It is going to be a lot of fun," Mariota said at a press conference at Saint Thomas Sports Park. "This is a new experience for me. It is surreal, a lot of excitement. To walk in the locker room and see your name on the locker, it's really cool for me. I am just very, very happy and very blessed to be here." Not long after being selected by the Titans late Thursday, Mariota boarded a United Airlines flight a few hours later and headed to Nashville. After a layover in Los Angeles, he finally made it to Music City late Friday, accompanied by family members and friends. Mariota's parents made the trip, along with his girlfriend, brother and agent. He traveled in casual pants and a T-shirt but switched into a dark gray suit in time to meet with reporters. Whisenhunt's white 171/ 2 -36 dress shirt, highlighted with a blue tie, finished off the look. "I think it fit him OK,'' the coach said with a smile. Mariota didn't get much sleep on the flight to Nashville. He left town later Friday to head to Eugene, Ore., where he'll attend Oregon's spring game. He'll be back in Nashville for the team's rookie minicamp May 11. The Titans gave him plenty to study and learn in the time being as they try to get him ready for his first NFL season. "We have a nice little to-go package for him that has some football stuff in there," Whisenhunt said. "That is the beauty of the iPads, and being able to take that with him. We can send that with him and talk. When he gets back in here, he'll at least have a little bit of a headstart." Mariota had a busy day once he hit the ground in Nashville. He did one-on-one interviews with the TV stations in town after making his way through the locker room, where his nameplate already was affixed above his locker. He talked to his new coaches and met other members of the organization. He posed for pictures in uniform No. 8. He said he loves the color blue. Mariota's father, outfitted in a Hawaiian shirt, watched his son answer questions at the press conference. He admitted it was a proud moment. "We are all very excited. I think anywhere he was picked would be a good fit," Toa Mariota said. "I am going to try to make it back for some games, but it is a long way from Honolulu." Mike Cherry, a sportscaster with ABC affiliate KITV in Honolulu, made the long trip to follow Mariota's journey Friday. The demand for Mariota news in Hawaii is huge, he said. "Let's put it this way: Marcus Mariota is the biggest ticket in town right now. He is a sport entertainment icon right now in Hawaii. He is one of those things where he has transcended households," Cherry said. "Even if someone is not a sports fan, moms, grandmothers, aunties and uncles, they all know him and like him, sports fan or not." When the Titans picked Mariota, Cherry said, a new favorite team emerged on the island. "It's varied between the 49ers and Raiders and Seahawks, West Coast teams. Those are the most popular teams," Cherry said. "I'd say before this Tennessee was probably about 31. Right now I'd say they're probably breaking into the top three easily. We expect to see a lot of Titans jerseys. Hopefully the pro shops up here will pay for shipping and handling, because that will be one heck of a shipment." After throwing for 10,796 yards and 105 touchdowns in three seasons with the Ducks, Mariota established himself at Oregon, where he won the Heisman Trophy last season. He hopes to do big things for the Titans, a team that finished 2-14 last season. "At Oregon, we talk about winning the day. That culture for me is instilled," he said. "I bring that with me and won't change who I am. I want to get to know my teammates and earn their respect." Yes, the Titans are high on Mariota. At this point, it seems they'll do anything to please him, with the expectation he'll provide big things in return in the future. Well, almost anything. The War Room is off limits. "I didn't let him in the draft room,'' general manager Ruston Webster said of Mariota. "Locker room, yes. Draft room, no." Reach Jim Wyatt at 615-259-8015 and on Twitter @jwyattsports. NFL DRAFT Rounds 4-7: 11 a.m. Saturday, ESPN TITANS' REMAINING PICKS Fourth round (100) Fourth round (108) Fifth round (138) Sixth round (177) Sixth round (208) Seventh round (245) | Mid | [
0.603365384615384,
31.375,
20.625
] |
1. Field of the Invention The present invention relates generally to sinks. More specifically, the invention is a portable wheeled cabinet containing a sink for that dispenses hot and cold water from stored water supplies. 2. Description of the Related Art The related art of interest describes various sinks, but none discloses the present invention. There is a need for a wheeled cabinet capable of supplying a sink for comfortably shampooing the hair of children and bedridden persons. The related art will be described in the order of perceived relevance to the present invention. U.S. Pat. No. 5,678,255, issued on Oct. 21, 1997, to Melvin C. Stroudamire, Sr. describes a portable hair washing system that has a collapsible basin table for transporting. The system comprises: a collapsible basin table having a top member supported by a plurality of telescopic legs; a first collapsible container having a spout; a second collapsible container having a spout; a first flexible conduit having a connector end and a nozzle end; and a second flexible conduit having a first and second connector end. A curved portion extends downwardly forms a neck surface extending into the basin for resting the user's neck. The portable hair washing system may also have a collapsible tray assembly and a case for carrying the equipment. The apparatus is distinguishable for requiring separate carts. U.S. Pat. No. 5,014,371, issued on May 14, 1991, to Jurgen D. Heel describes a portable salon unit that includes a movable cart having a washbasin. The washbasin is adjustable vertically. A device for supplying clean water to an object located in the basin includes a water connector at one end and a spraying end. A flexible supply hose is provided on a supply reel to allow the water connector to be located at some distance from the cart. The apparatus is distinguishable for requiring a spatially separated washbasin from the cart. U.S. Patent Application Publication No. US 2003/0019031 A1, published on Jan. 30, 2003, for Joseph K. Mosis describes a portable sink with internal or optionally external water supply comprising a double sink with and one faucet mounted on a lightweight cabinet with wheels. Hot and cold water are produced by the faucet from either an internal self-contained fresh water tank or an optional external source that passes from a sink to a self-contained used water holding tank. The cabinet has two doors for accessing it's interior. The cabinet holds a self-contained fresh water holding tank and one self-contained used water holding tank. A heater heats the water coming from either the internal or optional external water source. The apparatus is distinguishable for requiring a double basin and optionally an external source of hot and cold water. U.S. Design Pat. No. 333,343, issued on Feb. 16, 1993 to Samuel P. Farchione describes an ornamental portable shampoo and styling unit apparatus comprising a wheeled cabinet having a contoured sink with an indented front space for laying down the head, an array of electrical outlets and hose connections on a block extension on its left side, and a horizontal bar and water hose connections in the rear cavity. The ornamental apparatus is distinguishable for requiring an ornamental contoured sink having an indented front portion. U.S. Design Pat. No. 342,121, issued on Dec. 7, 1993 to Jong Y. Lim describes an ornamental combined foldable and portable sink table in a folding case with four folding legs, a hinged cover with internal drying shelves and pegs, two hinged side tables, and a sink and draining table. The ornamental apparatus is distinguishable for requiring an ornamental folding sink table. U.S. Design Pat. No. 362,715, issued on Sep. 26, 1995 to Michael A. Trottier describes an ornamental portable sink for overlying a utility tub comprising a stainless steel sink basin with side handles and various side panel apertures for toothbrushes, hair brush, a soap bottle, and a soap dish depression. The ornamental apparatus is distinguishable for requiring only a portable sink for overlying a utility tub. U.S. Design Pat. No. 401,679, issued on Nov. 24, 1998 to Richard L. Tagg describes an ornamental portable sink comprising a base cabinet having four oval sinks with a single faucet each on top covered by an umbrella on a pole having two soap dispensers. Two apparent water containers are located on opposite sides of the wheel-less base cabinet. The ornamental apparatus is distinguishable for requiring multiple sinks, an umbrella cover and lacking wheels. U.S. Patent Application Publication No. US 2001/0052681 A1, published on Dec. 20, 2001 for Pericles Deavila describes a mobile safety compliance apparatus comprising a rectangular box shell having a plurality of open compartments having doors, a self-contained water supply, and a wastewater collection system. Removable doors serve also as a stretcher or a freestanding table. The water supply provides drinking water, tepid hand washing water, and water for a stowaway eyewash hingedly attached to the shell. A stowaway seat and table are hingedly attached to the shell. The apparatus includes an electrical system with a battery backup for powering the lights, water heating, refrigeration devices, electronic communication equipment, and two wheels and two anchor points. The apparatus is distinguishable for requiring a stowaway seat and table, a battery backup, and electronic communication equipment. U.S. Patent Application Publication No. US 2002/0066141 A1, published on Jun. 6, 2002 for Josue' D. Rivera et al. describes a collapsible and portable work sink station comprising a collapsible telescopic four leg structure. The apparatus is distinguishable for requiring collapsible telescopic legs. U.S. Pat. No. 3,731,325, issued on May 8, 1973 to Joseph S. Guarrasi describes a potable hair wash sink attachment apparatus comprising a board section and a neck yoke section. The board section can be attached to the front wall of a sink basin to extend upward and outward. The neck yoke section can slide along the board and fits around the neck of the user. A dish attached slidingly to the board is placed under the chin to collect any excess wash water drain down the board into the sink. The apparatus is distinguishable for requiring a board section and a neck section to attach to a sink. U.S. Pat. No. 4,167,048, issued on Sep. 11, 1979 to Mary E. Williams for a portable shampoo seat adapter with a liquid run-off attachment apparatus for children that is disposed on the seat of a conventional barber or beautician chair with the back thereof adjacent to and below a conventional shampoo wash bowl. A headrest on the backrest of the seat adapter is disposed in front and above the shampoo washbowl on which rests the neck of the child. A water run-off guide extends from the neck rest and surrounds the neck to provide a path over which water dripping from the child's hair is returned to the shampoo wash-bowl. The apparatus is distinguishable for being limited to washing children's hair on a barber or beautician chair, and requiring a water run-off guide on the neck rest. U.S. Pat. No. 4,512,043, issued on Apr. 23, 1985 to William D. Nolan describes a portable rectangular hair shampoo and scalp treatment basin in a closed box-like form with the removed top connected to the head receiving end of the basin box and acting as a sloped backrest support. The basin's head receiving end has a sloped backrest support for the person, and a half-moon cutout at the top of the end wall for receiving the neck. A hand pump is located in the waterline of a downwardly curved nozzle pipe, and another spray nozzle is located in the end facing upwards. The apparatus is distinguishable for requiring a backrest, a hand pump and two water nozzles, U.S. Pat. No. 4,651,361, issued on Mar. 24, 1987 to William D. Nolan describes a portable combination hair shampoo basin and a drying hood for a bedridden person receiving shampooing, hair coloring, permanent hair waving, and the subsequent drying. The box-like apparatus has a double-walled basin reservoir and a half-moon cutout in a front wall for the neck. The basin's inner wall has a plurality of openings that drain the water poured from a pitcher over the head through a hose. After the shampoo, the water is drained from its reservoir, a blow dryer inserted in an outer wall opening is activated, and hot air forced into the reservoir and out the plurality of openings. The apparatus is distinguishable for requiring a plurality of holes in one side of the box. U.S. Pat. No. 4,660,233, issued on Apr. 28, 1987 to Lueretta Beaver describes a portable shampoo, manicure, pedicure and washing apparatus comprising a wheeled cabinet housing clean and waste water tanks, and heating and pressurizing means for the clean water. Head and foot basins having drains to the waste water tank are pivotally mounted on lining arms. The support mounting the basins on the cabinet also provides for vertical adjustment to accommodate different bed heights. Spray nozzles connected to the pressurized, heated and clean water tank are extendible by hoses. The apparatus is distinguishable for requiring pivotally mounted head and foot basins. U.S. Pat. No. 4,747,169, issued on May 31, 1988 for Rene F. Valbuena describes a portable sink having a pressurized water supply comprising a main case having a hinged top cover and containing a two-unit sink bowl unit and a supply tank in an inner case. The apparatus is distinguishable for requiring at least four different containers. U.S. Pat. No. 4,901,378, issued on Feb. 20, 1990 to Lealyce Reddell describes a shampoo basin comprising a first embodiment having a rectangular basin with a front semicircular neck supporting cutout having a row of water delivering apertures below it on the inside surface of the basin. A spray nozzle on a flexible conduit is positioned on the upper rear edge of the basin. The apparatus is distinguishable for requiring two water delivery sources. U.S. Pat. No. 5,007,118, issued on Apr. 16, 1991 to Larry W. Ebersole describes a head care station on rollers and kit for reclining a wheelchair occupant against a head support having an adjustable height basin with a frontal semicircular head support notch. The apparatus is distinguishable for requiring a rollable head care station. U.S. Pat. No. 5,144,701, issued on Sep. 8, 1992 to Ralph W. Clark describes a wheel chair shampoo apparatus for mounting and positioning a wheel chair in a tilted position to a shampoo basin mounted in an open cart and the water supply in a mounted pouch. FIG. 8 describes a washbasin entrance with a semicircular collar, which is slidably movable outward. The shampooing apparatus is distinguishable for requiring an open cart, a mounted water pouch and designed for mounting a wheel chair. U.S. Pat. No. 5,301,376, issued on Apr. 12, 1994 to Norbert G. Herbert describes a portable sink apparatus comprising three separable housing sections stacked for transport or storage. The middle housing includes a sink that receives water from the upper housing and drains to the bottom housing. The apparatus is distinguishable for being limited to a three-section portable case. U.S. Pat. No. 5,305,481, issued on Apr. 26, 1994 to J. Clyde Nebb describes a mobile salon station comprising a rear-wheeled open cart having two upright frame members that are vertically telescopic and joined on top. A basin that is carried inverted is placed upright on a shelf, and its water supply connected to two 4.5 gallon tanks carried on a bottom shelf. The basin has a shallow recess for the neck. The apparatus is distinguishable for requiring an open cart with a telescopic upper frame. U.S. Pat. No. 5,381,562, issued on Jan. 17, 1995 to Joan M. Holloway et al. describes a contoured portable rectangular basin for cleaning a selected part of a person's body such as the head or a limb. The basin has a notched seat for one's neck. An outlet port has a drainage tube. The apparatus is distinguishable for being limited to a basin. U.S. Pat. No. 5,687,434, issued on Nov. 18, 1997 to Richard L. Tagg describes a portable stand-alone wash station comprising an upright paper towel and soap dispenser unit, a sink unit containing two basins, a flexible inner tank for used water, and a rigid outer tank for fresh water. The apparatus is distinguishable for requiring paper towel and soap dispensers. U.S. Pat. No. 5,704,078, issued on Jan. 6, 1998 to Velma Chandler describes a portable sink comprising a cabinet containing a 5 gallon bottle of water. The sink is designed to drain into a portable toilet, and a supply of deodorizing soap operates to clean the user's hands and deodorize the apparatus. The apparatus is distinguishable for requiring only a washbasin and a water bottle. U.S. Pat. No. 5,813,063, issued on Sep. 29, 1998 to Louis S. Watkins et al. describes a portable sink having four telescopic legs. The housing has a basin, a drainage system, a fresh water supply system, and an electrical system for servicing the basin. The basin is formed as a drawer in the front of the housing. The apparatus is distinguishable for requiring electricity, telescopic legs, and the basin in a drawer. U.S. Pat. No. 5,966,751, issued on Oct. 19, 1999 to Shirley A. Chiarelli describes a portable hair washing apparatus comprising a basin having a shaped neck support, a horizontal head support, a flexible drainage hose, and a used water receptacle combined and encased in a carrying case. The apparatus is distinguishable for requiring a carrying case configuration. U.S. Pat. No. 6,076,202, issued on Jun. 20, 2000 to M. Olene Lockwood describes a shampoo sink system comprising a telescoping vertical support assembly having a telescoping horizontal sidewall brace ending in a suction cup. The sink has a rear-hinged liner having a semicircular anti-drip lip sitting in an exterior plastic sink and supported by the telescoping vertical support. The apparatus is distinguishable for requiring a vertical and horizontal telescoping support structure, and a hinged liner for the basin. U.S. Pat. No. 6,161,228, issued on Dec. 19, 2000 to Jan Wietecha describes a portable sink structure attachable to an external portable reservoir capable of containing wastewater and carried in a case. The sink has no neck depression. The apparatus is distinguishable for having a sink without a neck depression and requiring the sink to fit into a case structure. U.S. Pat. No. 6,173,458 B1, issued on Jan. 16, 2001 to Larry J. Maddux describes a portable self-contained sink and water storage cart on wheels having a two-cavity sink inside a sink module lacking any neck depression, a towel rack, a soap dispenser, an angled spigot, hot and cold water knobs, and in a lower compartment a fresh water tank, a used water reservoir, a pump, a heater, and electrical connections. The apparatus is distinguishable for lacking a neck depression in its sink. U.S. Pat. No. 6,427,259 B1, issued on Aug. 6, 2002 to Gregory S. Cawthon describes an outdoor portable lidded sink capable of being connected to a water supply, and having folding legs, an adjustable spigot, a spray nozzle, a storage drawer, a shelf, a large drain, a funnel, a strainer for the drain, cutting boards, baskets, and the like. The sink is U-shaped and lacks any neck depression. The sink is distinguishable for requiring a water connection and a U-shaped sink lacking a neck depression. Japan Patent No. 11-107336, published on Apr. 20, 1999, for Motoyuki Kawanishi describes a square-shaped portable sink having a water tap elevated above the sink by a strut support and connected to a city water pipe by a hose. A bottom drain has a separate drain hose. The sink can be staked to the ground. The apparatus is distinguishable for utilizing a connection to available water supply and draining on the ground. W.I.P.O. Application No. WO 99/20848, published on Apr. 29, 1999, for Aseptico, Inc., U.S. describes a portable sink apparatus comprising a rectangular sink without a neck rest having a gooseneck spigot, a drain leading by a hose to a water container, a water supply container providing water to the spigot by a foot pump and heated by an electrical outlet, and four foldable legs. The apparatus is distinguishable for lacking a neck rest in the sink and requiring foldable legs. None of the above inventions and patents, taken either singly or in combination, is seen to describe the instant invention as claimed. Thus, a portable shampoo sink solving the aforementioned problems is desired. | Low | [
0.494296577946768,
32.5,
33.25
] |
JAVMANewsSubsection Mountain Gorilla Veterinary Project to become its own nonprofit Posted Oct. 1, 2005 Morris Animal Foundation and the Maryland Zoo in Baltimore announced Aug. 10 that the foundation's Mountain Gorilla Veterinary Project was moving to the zoo, effectively establishing the project as its own nonprofit organization. The MGVP is the only project that provides health care and lifesaving medical procedures to wild mountain gorillas in their native habitats, according to the foundation and the zoo. Headed by Dr. Michael Cranfield, the Maryland Zoo's director of animal health, research, and conservation, the project has grown from one veterinarian in Rwanda to eight in Rwanda, Uganda, and the Democratic Republic of the Congo. Through its 19-year history of fieldwork and innovative programs, including a comprehensive health database for gorillas, the MGVP has become a model for conserving endangered species, according to the foundation and the zoo. "The project has simply grown beyond our capacity, which is a good thing," explained Dr. Patricia Olson, Morris president and CEO, about the zoo's taking over administrative duties of the project. Morris will continue funding the MGVP as it becomes established as an organization. The Mountain Gorilla Veterinary Project was begun at the urging of the late researcher Dian Fossey, famous for her passionate dedication to the plight of wild mountain gorillas. She recognized the need for veterinary intervention to treat animals she found ill or injured by poachers, and approached Morris for help. The veterinary project was established in 1986, shortly after Fossey's death. When Fossey began her work in Uganda, only 248 mountain gorillas were known to exist in the Virunga Mountains. In the early 1990s, however, another gorilla population was discovered in the Bwindi Impenetrable Forest. Today, the population of this highly endangered species includes about 380 gorillas in the Virunga Mountains and another 320 in the Bwindi Impenetrable Forest. Mountain gorillas are currently the only species of great apes whose population is on the rise. Last year, project veterinarians evaluated and monitored more than 50 cases of illness or injury among the gorillas, half of which required direct intervention. The MGVP team organized health examinations for more than 150 employees of various mountain gorilla organizations—necessary for guarding gorillas against human infectious diseases. The team also reached out to technology partners so veterinarians can perform cutting-edge health monitoring in the gorillas' own habitat. | High | [
0.672872340425531,
31.625,
15.375
] |
Much like last year’s debate over health care reform, Republicans and President Obama once again find themselves at odds, this time over whether or not to build a nationwide high-speed rail system. Already, Republican governors from Wisconsin, Ohio and Florida have rejected over a combined $3 billion for building high-speed rail, stalling the Obama plan, at least for now. As the administration tries to get back on track, former Pennsylvania Gov. Ed Rendell, a Democrat and co-chair of Building America’s Future — a non-partisan advocacy group calling for infrastructure investment — is making the case for spending now on modernizing the national transportation system, even as an emboldened Republican Party tries to cut government spending and tighten the country’s belt. | Mid | [
0.5672268907563021,
33.75,
25.75
] |
Videos World Rugby follow Sri Lanka on their journey through Asia’s Division 1. They go up against arguably Asia’s best side, Malaysia as they look to climb up the ranks of Asian Rugby and cement Rugby as a major sport in the country. Like any other Rugby nation, they have a dream of qualifying for the Rugby World Cup. For such … The British and Irish Lions tour is edging ever closer, and captain Sam Warburton has said that the 41 man squad can feel momentum building ahead of the tour. In this video from the British and Irish Lions press, the Welshman speaks about the Lions gelling well since they began their training. This has helped Gatland’s boys in getting aspects of … HSBC take us on a tour of one of Rugby’s toughest endurance tests. If you think that you have got your endurance on lock then check this out. It will certainly have you thinking twice. Who thinks they could get through this gruelling test? England U20’s men Jack Clifford and Kyle Sinckler spoke to World Rugby this week, about how being involved in the England academy and the World Rugby Championship has helped them shape their futures in the game. Keep an eye out for these two youngsters! the USA 7’s team made a quality come back last weekend in Vegas when they played Argentina in the Quarter Finals of the series. From 19-0 down, they had it all to do, but they proved their world class ability and came back to snatch the victory. The Blitzboks won the tournament whilst the USA finished third when … We are throwing it back to the 1999 World Cup here as we look at one of the worst knock outs in Rugby. Tongan prop Ngalu Tau was sent off for this running punch on England flanker Richard Hill after a poor mid air collision by Isileli Tapueluelu on Matt Perry, which then led to this scuffle just after. A … Thankfully, simulation isn’t something we see much of in Rugby. Here, a player thought it would be a good idea to start a ‘fight’, and end it with the worst dive ever. For a second there I thought Ronaldo had switched his flashy boots in for an amateur Rugby spot! | Mid | [
0.613390928725701,
35.5,
22.375
] |
U.S. Pat. No. 3,601,256 issued Aug. 24, 1971 and owned by the assignee of this invention discloses a display stand having a base, a back, and a plurality of shelves secured in vertically spaced relation to the back and is provided with a base shelf which tilts rearwardly somewhat. U.S. Pat. appln. Ser. No. 98,876 filed Nov. 30, 1979, now U.S. Pat. No. 4,314,698, discloses a display stand having a base and a back together with a plurality of downwardly tilted gravity feed shelves mounted in spaced relation on the back. While it is common practice in supermarket outlets to arrange one or more display gondola units adjacent each other in side by side relation there has heretofore been no arrangement for supporting the base shelves of adjacent gondola units at different angles of tilt. | Mid | [
0.58021978021978,
33,
23.875
] |
The value of hysteroscopic management of cesarean scar pregnancy: a report of 44 cases. With the incidence of cesarean scar pregnancy (CSP) rising, the reports of serious adverse outcomes of it have increased gradually. The management of CSP remains an inadequately explored clinical field, and there is no consensus on it presently. The present study was performed to investigate the efficacy and safety of operative hysteroscopy in the diagnosis and treatment of CSP. Forty-four patients with CSP underwent operative hysteroscopy for removal of scar ectopic pregnancy in our institution. Among them, hysteroscopy was combined with laparoscopy in two patients, three cases with massive hemorrhage were pretreated with bilateral uterine artery embolization before hysteroscopic surgery, and four patients were pretreated with mifepristone (200 mg for 3 days) and methotrexate (25 mg for 2 days). Clinical data, serum β-human chorionic gonadotropin, myometrial thickness, residual conceptus, cesarean scar defect, operation time, blood loss, and hospital stay were recorded. All of the ectopic gestations were removed entirely by operative hysteroscopy. Mean operation time was 34.8±16.5 minutes (range 20-120 minutes), and mean blood loss was 35.3±24.4 mL (range 5-100 mL). The mean hospital stay was 5.0±3.01 days (range 1-19 days). Cesarean scar defect could be diagnosed in 70% (31/44) of patients, while in 20/32 cases (63%), a conceptus remained after uterine curettage only was performed. Operative hysteroscopy might be recommended as a first-line treatment modality for patients with a cesarean scar ectopic pregnancy, especially when myometrium thickness between bladder and gestational sac is more than 3 mm. | High | [
0.704191616766467,
36.75,
15.4375
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.