text
stringlengths 8
5.74M
| label
stringclasses 3
values | educational_prob
sequencelengths 3
3
|
|---|---|---|
Category Archives: coup de foudre He looked at her body as she was walking down the street. Before he saw her face, he was amazed by that slim, tall female body, lightly wrapped in a flowing black dress. That youthful body which was approaching him, as if moved by the focused attraction generated by his own desire. He saw the evocative curves of her breasts, slightly exposed by the low neckline of her dress. He saw her narrow, undulating waist as she seemed to be gliding toward him, into his arms. He saw the slight sway of her hips and the gentle outline of her long legs rhythmically extending the fabric of her garment in an easy, fluid motion. He grasped this approaching feminine figure in an instant. The next instant his eyes were already transfixed by the beauty of her face. By those large brown eyes, those full lips, that flowing red hair parted in the middle caressing her fragile shoulders. She was stunning. This beauty, matched by so many girls he had seen walking down the city streets during the course of the week, never ceased to enthrall him. Every time he followed it with his eyes, entranced. Every time he felt that momentary sensation of distanced, almost abstract reverence for feminine beauty. For each one of its manifestations, each one of its accentuated features. He indiscriminately paid this silent homage to every pretty woman he saw. Quite often, he felt as if his body spoke a different language from his mind. Or at least, different imagistic patterns of thought invaded his body, moving it closer to its potential pleasures. While his intellect kept its distance from the woman he appreciated almost like a work of art, his body moved toward her with anticipation and excitement, on the verge of betraying its focused, pleasurable needs. Then, acting with a partly conscious coordination of body and mind, he would walk closer to the pretty woman to see her better, to catch her fragrance, and perhaps even to brush her dress lightly with his leg, as if unintentionally, while moving past her through the crowd. Once they had passed each other, he would quickly spin around and look at her, careful not to miss a single moment of seeing her departing body from behind, defenseless without eyes before his gaze. Once the danger of her own potential glance diminished, his mind and body could act as one. He would no longer revere her, he would want her. He would want to ravish her, to visually consume her right then and there, before she disappeared from his potent sight. Fortunately–for him, for her–he would be aware of the physical barriers separating his bodily thoughts from their possible actions. Other people would circulate within the space forever distancing him from her, thoughtlessly eclipsing the movements of her departing form. Then he would turn around full of vague regrets and tangible yearnings, without making a spectacle of his desire. Withdrawn into himself, he would attempt to take her with him: by thinking about her, by memorizing her features and the sensations caused by her fleeting presence, by unfolding the drama of his desire within the more permissive theater of fantasies and dreams. One time he saw a beautiful young woman with very short black hair. When he looked at her, instead of continuing to look straight ahead proud of the admiration she excited, she returned his gaze. She appeared to be as transfixed by his body as he was by hers. He felt slightly embarrassed by her boldness, caught as he was in his habitual voyeurism by the mirror of her reciprocating gaze. His desire momentarily withdrew when hers advanced. He was surprised. Women whom he didn’t know rarely came to life under his gaze. Most often, when he looked at them he felt protected from any real interaction, as if he were watching a movie. So when this short-haired woman, a stranger, looked at him in the same way that he looked at her, he felt as if his spectator cushion was jolted from under his seat. Momentarily, he lost his balance. He looked away from her with slight confusion. She walked passed him. Feeling more secure, he reoccupied his spectator position. Out of force of habit, he turned around to watch her disappear into the crowd like the hundreds of other beautiful women before her. Then the curtain of life would be drawn, and the encore would be played, with poignant differences, in his imagination. But this time his look froze as soon as it found her. She had also turned around and was looking back at him. He didn’t know how to react. He felt like he could no longer continue to pretend that he was a spectator watching her, the spectacle. The distinction between them, a man and a woman, had become more complex in this interplay of glances. Like him, she seemed confused by their situation. Perhaps she felt that she had been too bold but didn’t know how to withdraw herself from the slightly awkward situation she created. Or perhaps she did not wish to retract her steps. He couldn’t tell. It was possible that she was only considering how she could advance further. Toward him. These considerations filled him with a mixture of excitement and intimidation. He decided to ease the tension with a friendly gesture. He smiled at her. As if with some relief, she smiled back. He marveled: she was even prettier now, when she smiled. Her formerly inexpressive features came to life. They became bright and accessible, inviting closer contact; calling for the meeting of their two separate worlds: his and hers. Perhaps another world would eventually emerge. A world which was theirs. | Low | [
0.47967479674796704,
29.5,
32
] |
Glass Restoration Services Bakersfield, California Our glass restoration and glass protection services for architectural windows always saves a substantial amount of money when compared to glass replacement, and with less disruption to your tenants. Just about any stain or damage in the surface can be easily removed with our services. Call us for a free quote on our glass refinishing services. Our window glass restoration services in Bakersfield, California are just a phone call away. Commercial glass restoration and glass scratch removal services are an art form that we have perfected over the years. We have the knowledge, the correct tools, staff and the proper equipment to perform a wide variety of repairs to exterior window glass surfaces. We can effectively remove hard water stains, mineral staining, effectively remove stage 1 and 2 corrosion, light surface scratches, oxidation, erosion channels, mineral deposits, calcium stains, lime stains, efflorescence, soap scum, acidic graffiti, oils, everyday grime and buildup, etching, acid burns, acid rain and other flaws from architectural glass surfaces.Our commercial glass restoration services can be performed at the ground level, or we have the equipment and knowledge, to perform high rise glass restoration and glass stain removal services.After the restoration process, we suggest the installation of a silicone protective treatment to the glass in order to help protect the surface from future staining and corrosion. Window Glass Stain & Spot Removal Services Bakersfield, California Many commercial buildings develop glass stains due to exposure to the elements, high amounts of tap water from sprinkler system over-spray, minerals leaching from adjacent pre-cast surfaces and inferior product used to maintain a building. Removing mineral stains and etching from window glass in Bakersfield, California is our specialty. Architectural windows are subjected to severe conditions which may result in damage to the surface of the glass. This damage is unable to be removed with standard window cleaning procedures, and requires glass restoration in order to remove the glass stains and spots. Etched windows have a cloudy appearance that makes the windows look dirty from both the interior and the exterior of the building despite having your windows cleaned on a regular basis. After the damaging elements have corroded the surface of the glass, often referred to "stage 2 corrosion" the glass should be resurfaced to effectively remove the damage. A word of caution. Inexperienced glass cleaning companies often damage the surface of the glass while attempting to restore the glass. It is important to restore a sample window in order to ensure that the desired glass restoration results are being achieved. One should examine the test area in direct sunlight from a variety of angles in order to ensure that the glass is not burned or scratched prior to having the windows restored on the entire building. Glass Scratch Removal Services Bakersfield, California Commercial glass scratch removal saves a considerable amount of money when compared to glass replacement. Glass surfaces can be sanded and polished down to remove the damaged surface of the glass removing the scratch from the finish. If performed correctly you will never be able to tell the scratch was on the glass. When scrapers are used to remove paint or caulking from glass windows, they often get scratched. Improper glass restoration products, or improper use of glass restoration products can also inflict scratching to a glass surface creating a stainless steel look for glass. Scrapers used during the construction clean up process can also scratch glass. In our experience the majority of window scratches occur during the construction phase, and are usually not noticed until later. We can even remove deep scratches that other contractors are unable to remove. Glass scratch removal in Bakersfield, California is a highly specialized service that requires qualified management and technicians, the proper products, and extensive experience. Improper products and techniques can result in severely scratched or burned, and noticeably damaged glass. Industry standard techniques often use harsh, abrasive products in an attempt to remove stains from the highly polished glass surface. This causes severe scratches in the glass. Other industry standard techniques involve the use of harsh acids that can leave burns in the glass and surrounding architectural materials creating a hazed look. Our technique completely removes stains from the glass without leaving any scratches or burns and produces a highly reflective finish. If you need glass scratch removal services in Bakersfield, California, just give us a call. We have effectively completed glass scratch removal services for contractors and glaziers consisting of thousands of windows per job on high rise buildings. Our glass scratch removal services were appreciated by the contractor because we were able to remove the scratches for a fraction of the cost of replacement, and we were able to complete the project faster than if the contractor were to replace the glass. Hard Water Stain Removal Services Bakersfield, California Hard water stains are formed when high mineral content water comes in contact with the glass surfaces. When the water evaporates it leaves behind all the hard minerals within the water, and creates difficult to remove hard water stains on the glass surface. This can be caused by sprinkler systems, water erosion from adjacent stone surfaces such as precast and dust that blows through the air. The hard water stain is the most difficult stain to remove especially when the mineral source contains silica. The silica bonds to the surface of the glass easily since most architectural glass is comprised of about 70% silica. This stain is the most difficult to remove because the pure silica in the stain is much harder than the glass surface which the hard water stain resides on. Removing the hard water stain without completely refinishing the glass with a product such as the Glass ReSurfacer Final Polish is near impossible. If you need hard water stain removal services in Bakersfield, California just give us a call. We have performed hard water stain removal service for some of the most prestigious buildings in the area. We started performing hard water stain removal service almost 20 years ago, and have since perfected the art. Our experience allows us to provide hard water stain removal services for the right price, and deliver the expected results on time. Glass Stain & Scratch Protection Services Bakersfield, California We use high performance glass protective treatments and or glass protection that can be applied to architectural window glass surfaces that will help to prevent the further development of glass stains as well as glass scratching. One such product called Glass Defender MD will install a rubberized, silicone protective coating, that will last on the surface of the glass for many years to come - helping to prevent stains and scratches. When stains such as minerals come in contact with the glass surface they will reside on the protective coating instead of easily adhering to the microscopic cracks and crevices of the glass surface. As well, this rubberized coating will resist scratching much better than unprotected glass because the surface at a microscopic level is flexible. We always recommend applying a glass stain and scratch protective treatment to newly restored glass especially in Bakersfield, California. In 2002 glass restoration was performed on a property that was stained by sprinkler systems. As part of the procedure, a glass protective treatment was applied to the glass in order to prevent the stains from redeveloping. The property owners elected not to maintain the building, and the stains redeveloped. However, in 2006 when a new owner of the building called us to propose a solution to the problem at the building, we were able to easly remove the stains from the areas that were previously restored and treated. The picture to the right shows where the stains could be easily removed with a towel. Our glass protection process protects the glass from intense damage and yields easy cleaning for the future. For more information, we have included "Is Your Building Green" (PDF), a cost analysis from an actual building, demonstrating the savings possible when comparing new technologies with technologies typically used to maintain commercial properties. Glass polishing or glass refinishing is the process of installing a new surfaces on the glass removing all scratches stains or burns. Architectural glass can be polished by use of products such as the Glass ReSurfacer Final Polish to remove the top layer of scratched or stained glass, and reveal a new highly polished surface on the architectural window glass. Trust your architectural window glass surfaces to a professional company that is experienced not only restoring glass surfaces to new, but keeping them that way. We understand that image is everything. | Mid | [
0.569086651053864,
30.375,
23
] |
Q: Exposing only aggregate roots from a DBContext I am a new bie to DDD. In our DDD project ,we have a requirement that our DBContext should only expose AggregateRoots.. Assuming that our DbContext is as shown below public class ClassContext : DbContext { public DbSet<Class> Classes{ get; set; } public DbSet<Students> Students{ get; set; } } and Class is the aggregate root . Is the following implementation the right way public class ClassContext : DbContext { public DbSet<Class> Classes{ get; set; } private DbSet<Students> Students{ get; set; } } Any comment is appreciated A: It's certainly useful to think about aggregate roots in your application, but don't try to apply DDD concepts to an Entity Framework class model. An Entity Framework class model is not a domain model. It's a data access layer. Any considerations regarding including or hiding entities and/or navigation properties should be motivated by facilitating smooth data access and nothing more. It's highly unlikely that you're always going to read/create/update/delete students through classes only. That would make unnecessary clunky code. And who says that students will always be in a class? But maybe this isn't the best example of an aggregate. A Student doesn't have an identifying relationship with a Class, because next time he'll be in another class. It would be different with the classic Order-OrderLine relationship. I can imagine that in that case you might only expose a DbSet<Order>. So just expose the DbSet<Students> as public class. | Low | [
0.44742729306487605,
25,
30.875
] |
Prices shown in currencies other than USA Dollars are estimates based on current exchange rates. We will charge your credit card in USA Dollars on the day your order is shipped, and the conversion to your local currency will be done at the prevailing rate by your credit card issuer. Shipments outside the USA are declared as “bike parts” for customs purposes and will include the actual amount paid for merchandise and shipping. Jenson USA will not mark your parcel as a “gift”, declare a value lower than the actual price paid, or otherwise prepare false customs information. Inexpensive pedals that aren't too heavy and have good grip. I use Shimano M520's and these depending on what I'm doing and these have performed as expected whenever I've needed them. Great buy...Read complete review Inexpensive pedals that aren't too heavy and have good grip. I use Shimano M520's and these depending on what I'm doing and these have performed as expected whenever I've needed them. Great buy for 1/3 of the price of some popular name brands. Buy these and save your money for upgrading parts that NEED to be over-engineered. =) VS Most Liked Negative Review Just Fair The pedals do weigh 520 grams which I consider heavy but typical for this price range. The grip is good and they are sturdy but the bearings are very mediocre. I have not needed...Read complete review The pedals do weigh 520 grams which I consider heavy but typical for this price range. The grip is good and they are sturdy but the bearings are very mediocre. I have not needed to grease them yet but they have had little use as I just loan them out to people as I don't use platforms because I only feel safe with clipless. I much prefer the upper end of the Wellgo line like the B131 which costs more but you get a much lighter pedal with superior bearings. The loose bearings are fine if they would incorporate an adequate grease port, maybe with a zerk fitting. To be sure they are greased enough. Price was decent and overall quality above average. My shoes have yet to slide off of the pedals so I'm happy. Very disappointed. Having to grease the pedals before use is a real pain. The supplied applicator doesn't work well and there is not enough grease for both pedals. The pins are not all that grippy even after I replaced them with the longer "terror pins". They would barely stick to my 5.10 shoes. I would try something else if you are considering these for riding over roots and rocks. These were an upgrade from my factory pedals on my Rockhopper SL and perform flawlessly. I wear regular running shoes and they stick to these pedals! I highly recommend these to anyone that is looking for a high quality product and one that performs great. The pedals do weigh 520 grams which I consider heavy but typical for this price range. The grip is good and they are sturdy but the bearings are very mediocre. I have not needed to grease them yet but they have had little use as I just loan them out to people as I don't use platforms because I only feel safe with clipless. I much prefer the upper end of the Wellgo line like the B131 which costs more but you get a much lighter pedal with superior bearings. Platform pedals for a good price,your feet will stick to it like glue! got the white pedals to match my bike, only complaint is the ring on the spindle slides off. It's not a big concern because you just have to slide it back. Jenson USA ships worldwide, including APO/FPO addresses. For a quote, simply add the items you are interested in to your shopping cart and look for the "Shipping Options" box. You don't have to login or create an account to see shipping charges. Some manufacturers restrict where we can ship their products. If this item has shipping restrictions, they are listed below. If you'd like to buy an item that we cannot ship to your preferred address, we can accept your foreign credit card and ship to a USA address for you. Get free shipping with your $50 purchase today when you choose Standard Shipping at checkout. Please note this offer is only available to physical shipping addresses in the 48 continental United States (no PO Boxes), and oversize charges still apply on some heavy/large items | Low | [
0.525700934579439,
28.125,
25.375
] |
Congratulations to those that have made the finals of their fantasy leagues. Those that have made it this far should be proud of this accomplishment. That being said, all fantasy owners want to win their league’s championship. There is a ton of advice on who to start in the finals, but there is a reason why fantasy owners have made it this far. They are able to make the most sense out of playing matchups versus playing their top players. If owners in the finals continue their weekly lineup process, they should have no regrets about who they play in their lineup. That being said, it’s always a good idea to check how certain teams are trending heading into the fantasy finals. This week’s Smashmouth revisits two offensive lines that were previously reviewed, the Los Angeles Chargers and the Kansas City Chiefs. I’ll take a look at some of the players that fantasy owners may have questions about starting in their finals and determine if they can be trusted. Is Kareem Hunt really back? Can Philip Rivers bounce back after an awful Week 15 to deliver fantasy goodness in Week 16? Those questions answered and more below. Love the strategy of season-long fantasy sports? Live for the short term gratification of DFS? Try Weekly Fantasy Sports on OwnersBox - a new weekly DFS platform. Sign up today for a FREE $50 Deposit Match Offensive Line to Watch - Los Angeles Chargers Let’s revisit our first of two offensive lines from earlier in the season, the LA Chargers. Safe to say there has not been much consistency from this group throughout the season save for left tackle Russell Okung. Okung has turned back the clock so to speak this season, demonstrating he still has a lot left in the tank grading out at a 78.1 on the season according to Pro Football Focus. He’s been the Chargers best offensive lineman by far this season grading out 13 points higher than the next best performer, left guard Dan Feeney. Okung did miss part of their Week 15 game only playing 39 out of 64 snaps. Fantasy owners need to make sure Okung is in the lineup or there could be some major issues protecting the blindside of Philip Rivers. Sam Tevi came in for Okung and was sub-par. Not only could the left tackle position possibly be a big issue for the Chargers in Week 16 against the Jets, but the right tackle position has been a mess for the entire season. The combination of Joe Barksdale and Michael Schofield have graded out as Pro Football Focus’ number 57 and 65 ranked offensive tackles respectively in 2017. They have been wildly inconsistent in both the pass and run game, especially Barksdale. Barksdale has been passable in pass protection (pardon the awful pun), grading out at a 71.9 this season according to PFF, but has been a liability in the run game. During this second quarter run, Barksdale and right guard Kenny Wiggins are unable to generate vertical movement on the down linemen for the Chiefs. Without that movement the pulling guard and tight H-back are unable to create a seam for Melvin Gordon to attack. This run goes nowhere. For as bad as the previous effort was, the offensive line as a whole performs a lot better on this zone run in the first quarter. This time the combination of Barksdale and Wiggins do their job. Wiggins is able to cut off the down lineman, giving Melvin Gordon an easy read to get to the second level. As Wiggins is securing the first level, Barksdale helps secure Justin Houston on the first level and then climbs to the second level to allow Gordon to scamper for a 10 yard gain. This is the maddening part about the Chargers offensive line this season, in certain instances they can perform admirably, but for the vast majority of the attempts, Gordon is being met in the backfield. The Chargers offensive line ranks 25th in Stuffed percentage according to Football Outsiders meaning Chargers running backs were being met at the line of scrimmage or behind the line of scrimmage the seventh most in the NFL. Fantasy Impact Trust: Philip Rivers Coming off one of his worst outings of 2017, fantasy owners should be confident in Philip Rivers in Week 16. The Jets have surrendered over two passing touchdowns and over 283 passing yards per game over their last three outings. The Jets defensive line also ranks 24th in adjusted sack rate on the season at 5.8% of pass attempts. Rivers should be a safe QB1 as touchdown favorites in Week 16. Trust: Melvin Gordon Melvin Gordon may not find a ton of success on the ground against the Jets top-10 defensive line according to Football Outsiders adjusted line yards. Where a lot of Gordon’s success will come from will be in the passing game just like in Week 15. Gordon will face the number 24 DVOA pass defense against running backs according to Football Outsiders. Couple that Austin Ekeler’s season ending injury and Gordon has a higher than normal floor for Week 16. Offensive Line to Watch - Kansas City Chiefs After a few weeks of sub-par play, the Chiefs have started to find the rhythm that made then a dangerous offense earlier in the season. One of the biggest changes for the better has been the change at center due to the season-ending injury to Mitch Morse. Zach Fulton has taken over and provided more consistent play at the position than Morse from earlier in the season. Fulton has been particularly effective in the passing game, grading out at 87.3 as pass protector according to Pro Football Focus. Fulton, along with right guard Laurent Duvernay-Tardif have been a solid tandem in the middle of the Chiefs offensive line. Tardif has been extremely effective as a puller as well. Early in the first quarter the Chiefs run the one-back power scheme with precision. Tardif is given a clear runway to climb to the second level of the Chargers defense thanks to the front side blocks of Fulton and left guard Bryan Witzmann. Kareem Hunt is able to get to the second level for a near double digit gain on 2nd down. The Chiefs continue to exploit the left side of the Chargers defense later in the first quarter. This time both Witzmann and Duvernay-Tardif both pull to the left with Witzmann kicking out Melvin Ingram. Tardif then paves the way for Hunt to get to the second level for another strong gain. Just as all good teams do, they go back to what works. They go back to the one-back power scheme that was successful in the first half. Again, Witzmann is able to get to the second level and cut off the linebacker scraping over the top to make the tackle on Kareem Hunt. Tardif pulls and gets a good piece of the linebacker filling the whole allowing Hunt to waltz into the second level. It certainly seems like the Chiefs offensive line has improved by subtracting the underperforming Mitch Morse. Fantasy Impact Trust: Kareem Hunt After a lull through the middle part of the fantasy season, Kareem Hunt has found his way once again into the hearts of fantasy owners. The matchup for Hunt isn’t the best heading into Week 16 as the Dolphins defensive line ranks in the top 10 in both Football Outsiders Power Success and Stuffed metrics meaning their defensive line is near dominant near the line of scrimmage. Where Hunt can do his damage is in the second level as Miami is 31st in the league in 2nd level yards according to Football Outsiders. If Hunt is able to get past the impressive defensive front, he should be able to explode on the ground. Top Five Offensive Lines 1) Philadelphia Eagles 2) Pittsburgh Steelers 3) New Orleans Saints 4) Dallas Cowboys 5) Atlanta Falcons Bottom Five Offensive Lines 32) Tampa Bay Buccaneers 31) New York Giants 30) Seattle Seahawks 29) Houston Texans 28) Indianapolis Colts For any questions about offensive line play in the NFL, feel free to contact me @TheRealHalupka on Twitter. More Week 16 Lineup Prep | Mid | [
0.5498007968127491,
34.5,
28.25
] |
A morphology, porosity and surface conductive layer optimized MnCo2O4 microsphere for compatible superior Li(+) ion/air rechargeable battery electrode materials. Uniform surface conductive layers with porous morphology-conserved MnCo2O4 microspheres are successfully synthesized, and their electrochemical performances are thoroughly investigated. It is found that the microwave-assisted hydrothermally grown MnCo2O4 using citric acid as the carbon source shows a maximum Li(+) ion lithiation/delithiation capacity of 501 mA h g(-1) at 500 mA g(-1) with stable capacity retention. Besides, the given microsphere compounds are effectively activated as air cathode catalysts in Li-O2 batteries with reduced charge overpotentials and improved cycling performance. We believe that such an affordable enhanced performance results from the appropriate quasi-hollow nature of MnCo2O4 microspheres, which can effectively mitigate the large volume change of electrodes during Li(+) migration and/or enhance the surface transport of the LiOx species in Li-air batteries. Thus, the rationally designed porous media for the improved Li(+) electrochemical reaction highlight the importance of the 3D macropores, the high specific area and uniformly overcoated conductive layer for the promising Li(+) redox reaction platforms. | High | [
0.6847826086956521,
31.5,
14.5
] |
Superficial siderosis of the central nervous system. There have been 87 cases of superficial siderosis of the CNS reported in the world literature and 63 cases had developed the clinical syndrome with sufficient details to be reviewed. It is a distinct clinical syndrome characterized by sensorineural deafness (95%), cerebellar ataxia (88%) and pyramidal signs (76%). Other features include dementia (24%), bladder disturbance (24%), anosmia (at least 17%), aniscoria (at least 10%) and sensory signs (13%). Less frequent features are extra-ocular motor palsies, neck or backache, bilateral sciatica and lower motor neuron signs (5-10% each). Males are more often affected than females (3:1). The age of onset ranged from 14 to 77 years, age at death from 29 to 78 years and duration until death from 1 to 38 years excluding premature death due to the underlying cause or as a result of surgery. Up to 27% become bed bound at 1-37 years from the first symptom due to either cerebellar ataxia, a myelopathic syndrome or both. Symptomatic subarachnoid haemorrhage occurred in 37% and the CSF was haemorrhagic and/or xanthochromic in 75%. It is now accepted that superficial siderosis is due to chronic subarachnoid haemorrhage and a source of bleeding has been reported in 54% of cases; it was either due to dural pathology (47%) including a CSF cavity lesion or cervical root lesion, a vascular tumour (35%) or a vascular abnormality (18%). Arguments are presented that the remaining cases were also due to chronic haemorrhage and that there is no evidence for a non-haemorrhagic form of superficial siderosis. There have been 14 incidental cases diagnosed by MRI or at post-mortem with no symptoms attributable to superficial siderosis during life, supporting the notion of a pre-symptomatic phase to the illness. In 22 patients who had developed the syndrome, the duration of this pre-symptomatic phase could be calculated and ranged from 4 months to 30 years with an average of 15 years. At present the most promising treatment for superficial siderosis is surgical ablation of the bleeding sources. | High | [
0.675392670157068,
32.25,
15.5
] |
70577: Is it essential to move the tongue when reciting Qur’aan and dhikr? When we want to say some dhikrs, is it obligatory to move the mouth? For example, when we want to enter the bathroom and recite dhikr, should we move our mouths or is it sufficient to say it in our minds? And when we want to go to sleep or say the adhkaar for the morning?. Praise be to Allaah. Firstly: Remembering Allaah (dhikr) is one of the noblest deeds that a Muslim can do. Dhikr is not only verbal; rather we may remember Allaah in our hearts, on our lips and in our physical actions. Shaykh ‘Abd al-Rahmaan ibn Sa’di (may Allaah have mercy on him) said: The phrase dhikr Allaah (remembrance of Allaah) includes everything by means of which a person may draw close to Allaah, such as belief (‘aqeedah), thoughts, actions of the heart, physical actions, praising Allaah, learning and teaching beneficial knowledge, and so on. All of that is remembrance of Allaah. Al-Riyaadh al-Nadrah, p. 245 Shaykh Ibn ‘Uthaymeen said: Remembrance of Allaah (dhikr) may be in the heart, on the tongue or in one’s physical actions. The basic principle is remembrance in the heart as the Prophet (peace and blessings of Allaah be upon him) said: “In the body there is a piece of flesh which, if it is sound, the entire body will be sound, but if it is corrupt the entire body will be corrupt. It is the heart.” Narrated by al-Bukhaari and Muslim. What counts is remembrance in the heart, because Allaah says (interpretation of the meaning): “and obey not him whose heart We have made heedless of Our remembrance, and who follows his own lusts” [al-Kahf 18:28] Remembering Allaah with one's tongue or physical actions without remembering Him in one's heart is a serious shortcoming; it is like a body without a soul. Remembering Allaah in one's heart means thinking about the signs of Allaah, loving Him, venerating Him, turning in repentance to Him, fearing Him, putting one's trust in Him, and other actions of the heart. Remembering Allaah on one's tongue means speaking all words that will bring one closer to Allaah, above all saying Laa ilaaha ill-Allaah. Remembering Allaah with one's physical actions means every deed which brings one closer to Allaah, such as standing, bowing and prostrating in prayer, engaging in jihad, paying zakaah. All of these are remembrance of Allaah, because when you do them you are obeying Allaah. Hence you are remembering Allaah when you do these actions. Hence Allaah says (interpretation of the meaning): “and perform As‑Salaah (Iqaamat‑as‑Salaah). Verily, As‑Salaah (the prayer) prevents from Al‑Fahsha’ (i.e. great sins of every kind, unlawful sexual intercourse) and Al‑Munkar (i.e. disbelief, polytheism, and every kind of evil wicked deed) and the remembering(praising) of (you by) Allaah (in front of the angels) is greater indeed [than your remembering (praising) of Allaah in prayers]” [al-‘Ankaboot 29:45] One of the scholars said: this means that what prayer includes of remembrance of Allaah is more important. This is one of the two scholarly views concerning this verse. Tafseer Soorat al-Baqarah, 2/167, 168. Secondly: With regard to the adhkaar which are spoken on the tongue, such as reciting Qur’aan, saying tasbeeh (Subhaan Allaah – glory be to Allaah), tahmeed (al-hamdu Lillaah – praise be to Allaah) and tahleel (Laa ilaaha ill-Allaah – there is no god but Allaah), and the dhikrs to be recited in the morning and evening, when going to sleep, when entering the washroom, and so on, it is essential to move the tongue, and a person is not regarded as having said them if he does not move his tongue. Ibn Rushd narrated in al-Bayaan wa’l-Tahseel (1/490) that Imam Maalik (may Allaah have mercy on him) was asked about a person who recites when praying, but no one can hear him, not even himself, and he does not move his tongue. He said: “This is not recitation, rather recitation is that in which the tongue moves.” End quote. Al-Kasaani said in Badaa’i’ al-Sanaa’i’ (4/118) Recitation can only be done by moving the tongue to say the sounds. Do you not see that if a worshipper who is able to recite does not move his tongue, his prayer is not acceptable? Similarly he swears that he does not recite a soorah from the Qur’aan but he looks at it and understands it but he does not move his tongue, then he is not breaking his oath. End quote. i.e. because he has not recited it, rather he has only looked at it. This is also indicated by the fact that the scholars said it is not allowed for a person who is junub to recite Qur’aan with his tongue, but they said it is permissible for him to look at the Mus-haf and recite Qur’aan in his heart, without moving his tongue. This indicates that there is a difference between the two things, and that not moving the tongue is not counted as reading or reciting. See al-Majmoo’, 1/187-189 Shaykh Ibn ‘Uthaymeen (may Allaah have mercy on him) was asked: Is it obligatory to move the tongue when reciting Qur’aan in prayer or is it sufficient to say it in one's heart? He replied: Recitation must be done with the tongue. If a person recites it in his heart when he is praying, that is not sufficient. The same applies to all other adhkaar; it is not sufficient to recite them in one's heart, rather it is essential to move one's tongue and lips, because they are words to be spoken, and that can only be achieved by moving the tongue and the lips. End quote. | Mid | [
0.617169373549884,
33.25,
20.625
] |
In-line configured printers are important because they minimize the length (along the substrate or printing medium) of the print zone, and thereby minimize the overall envelope of the printing machine. Accommodating a longer print zone expands the overall printing machine envelope which is critical to cost, weight, installation space, inventory and shipping. In-line printers, particularly in-line printers for printing indicia, return address, destination address and/or destination barcode together with optional message line and/or destination barcode on a substrate such as a mail piece, use multiple spaced assemblies of print heads to carry out the required printing. The positioning of the print head assemblies in such in-line printers is typically accomplished by manual movement of the assemblies with respect to one another in those in-line printers that have movable print head assemblies and after such manual location are then locked in a fixed location. The position of the various areas of information to be printed are located relative to one another with variable spacing depending upon the width of the printing medium material, such as, for example, a print stock postal card, an envelope such as a #10 business envelope, a 9".times.12" flat mailing envelope or custom-sized envelope, to be printed. In such in-line printers, a first multiple print head assembly is located to print in a fixed print area of the substrate as the substrate passes relative to the print head. The first multiple print head assembly may be aligned and located to print in a fixed print area that, for example, may be in the print area that includes the return address or other indicia information. A second multiple print head assembly is located relative to the first print head assembly and positioned to print in a second print area, which may include, for example, the destination address and/or destination barcode. A third multiple print head assembly is located and positioned relative to the second and first multiple print head assemblies and located to print in a third print area, which may include, for example, a message line or optional barcode. The location of the first, second and third print areas on a mail piece are within predetermined areas of the mail piece and are typically specified by United States Postal Service standards to accommodate mechanized mail processing for each of the differently sized mail pieces. When a user desires to print with an in-line printer on a differently sized substrate or mail piece, the print head assemblies must be repositioned and located and locked in a different position to meet the location print area requirements for the size of the mail piece being printed. In-line printers such as those described above require operator intervention to relocate and reposition the multiple print heads each and every time a differently sized mail piece is printed. The operation and set-up of such in-line printers is labor intensive and cumbersome and less than satisfactory. In addition, the continual resetting and repositioning of the print head assemblies relative to one another may lead to positional error and requires constant verification that the print head assemblies are positioned and located properly to meet the addressing standards for the given size mail piece. Accordingly, it would be desirable to provide an in-line printer having multiple print head assemblies that are individually controllable and automatically positionable and movable relative to one another to accommodate different width substrates to print on each of the desired print areas as the substrate and print head assemblies move relative to one another to print in each of the predetermined print areas of a mail piece. It is an additional object of the present invention to provide an in-line printer that automatically determines the dimension of the mail piece as it is fed into the printer for controlling the print position of the assembly of print heads. | High | [
0.6845637583892611,
38.25,
17.625
] |
Rejoice Laker fans! It seems like the end of your suffering may finally be near. After a prolonged retirement ceremony for the great Kobe Bryant, the young talent now has the chance to take the torch and lead this new generation of Lakers to glory. With a new coach and a new system along with the addition of solid veterans and promising rookies, this Laker team looks ready to take the league by storm (within 2-3 years). In this article we’ll be taking a look at the new coach and the promising young core of the Los Angeles Lakers. The Coach: Luke Walton, once a second round draft pick by the Los Angeles Lakers in 2003 and now the head coach, brings a new offense and defensive mindset for the team. Coach Walton has completely revamped the Lakers’ offensive sets, encouraging more movement off ball leading to far more efficient possessions on offense as seen in their past preseason games. The influence of his time under great coaches like Phil Jackson and Steve Kerr is apparent, and although the weapons at his disposal are different, he has been able to find ways to make players shine. The players love his coaching style and compliment him constantly. One can only drool at the possibilities with him leading the development of the Lakers young stars. The Sophomores and Junior Once the young’uns watching in awe of a legend passing the torch, they are now the new stars ready to don the golden armor. While there is a lot of potential surrounding the Lakers young core, there are also a lot of questions. Will Julius Randle be able to develop a jumpshot? Will D’angelo find his niche as a point guard? Will Jordan Clarkson be able to play the two or will he be effective off the bench? Will Larry Nance develop into the all-around player that he has the potential to be? This season all of these questions will continue to swirl around this Laker team and these young stars seem ready to answer their critics. D’Angelo Russell has been given the keys to the Laker offense and is Luke Walton’s starting point guard. The coaches want him to execute the offense based on his superior feel for the game and it will be exciting to watch his explosiveness and craftiness on display. He has shown the ability to catch fire from three as well as consistently find ways to score from in close and mid-range. Although he showed superior vision in college and flashes of it throughout his rookie season he has not been able to fully grasp the passing potential that he has, often throwing flashy but ineffective passes to his teammates. While his scoring output may increase, look out for his assists to see whether his playmaking improves under the direction of Coach Walton and the increased opportunities in his offense. Jordan Clarkson was recorded putting in work during the offseason and it has showed so far throughout the preseason. He was the Lakers most consistent offensive threat last year but had questions surrounding his defensive ability. During the offseason Clarkson was shown building strength to deal with the larger guards that he will match up with when playing the two guard next to Russell. Although he hasn’t started, Clarkson’s defensive improvement have been on display the past couple preseason games and if it continues his quickness and decision making could continue to result in many transition fast break opportunities for him on offense. Expect his steals to rise this year along with an improved and more efficient approach to offense. The seventh pick in the 2014 draft, Julius Randle at times last season could be likened to a bull in a china shop. His aggressive style of play resulted in many possessions with him barreling down the lane and throwing up an ill-advised shot in traffic. He did however show a natural ability to crash the boards, make the right pass and create his own offense averaging a double double during his first full season in the NBA. Although that certainly is impressive it came at the cost of a low FG% for someone who plays so close to the rim. Many wonder whether Randle could develop the handles necessary to take advantage of his point forward potential while also developing into a perimeter threat to space the floor. While competition for the starting spot is fierce between him and the equally talented Larry Nance Jr., Randle is Coach Walton’s starting 4 for now. Although not much is known about Randle’s offseason improvement, there have been reports of him working on his shot and building strength to better battle the bigger power forwards in the league. Look toward his FG% to see whether or not he is showing signs of improvement on offense and hopefully his reworked jumpshot can pay dividends for him soon. A second first round steal (thank you r/lakers!) in 2015; Larry Nance Jr. showed flashes of his potential as an all-around power forward capable of defending multiple positions as well as seamlessly fitting into any role on offense. Last season he had replaced Julius Randle in the starting lineup during one of Byron Scott’s “lessons” and won the crowd over with his hustle and monstrous dunks. Throughout summer league and the preseason so far Nance has shown an improved shooting touch as well as the potential to be the Lakers best multi-faceted defender. Look forward to seeing more Larry Nance in the Lakers lineups and enjoy. The Rooks Although the Los Angeles Lakers missed out on the first pick in the 2016 draft, they did manage to snag a small forward with superstar potential in Brandon Ingram with the second pick and a promising young big man in Ivica Zubac in the second round. Although they weren’t expected to contribute right away, both have shown that their progress may not be as slow as some think. The second pick in the 2016 draft Brandon Ingram comes to the Lakers with lofty expectations to help the revival of a great franchise that has fallen on hard times. Joining a promising young core, Ingram gives the Lakers a small forward with natural scoring instincts and the tools to become a defensive monster to whom they have entrusted their future. Ingram may look extremely thin at first glance however his impact on the defensive end shows the strength of will that he has and Laker fans should look forward to his continued development into a defensive stalwart for the team. He is more offensively polished than other rookies, but will need time to acclimate to the speed of the game in the NBA. Expect him to be brought along slowly but his defensive impact will definitely shine while his offense will take a backseat until he feels more comfortable with the game. Zublocka. Zubac. Zubat. Ivica Zubac, a second round pick in the 2016 draft is already looking like a steal by General Manager Mitch Kupchak. Zubac was expected to stay overseas for another year but his excitement to join the NBA and the Laker franchise had him come over this year and his potential impact has been on display to Laker fans that have paid attention to Summer League as well as the minutes that he has been getting here and there during the preseason. Polished on offense, Zubac has shown the ability to score on the block as well as flash a midrange jumper to space the floor for the offense. His passing ability is also underrated and his further development on the offensive end will spell trouble for defenses in the future. His defensive impact like Brandon Ingram is immediate right when he steps on the floor. He has good timing on blocks and can alter opponent’s shots at the rim easily with his length. He does however need to get stronger to allow him to get better position for rebounds against stronger Centers. He probably won’t get a lot of playing time until the second half of the season, but it’ll be exciting to watch him. | High | [
0.6729857819905211,
35.5,
17.25
] |
Halwell and Moreleigh Halwell and Moreleigh is a civil parish in Devon, England. It comprises the villages of Halwell and Moreleigh. History The civil parish was formed in 1988 by the amalgamation of the former separate civil parishes of Halwell and Moreleigh. Halwell During the Saxon era Halwell was one of the four burhs, or fortified settlements, established in Devon by King Alfred the Great (d.899), King of Wessex from 871 to 899, to defend against invasion by Vikings. Moreleigh The manor of Moreleigh is listed in the Domesday Book of 1086 as Morlei, the 16th of the 22 Devonshire holdings of Alfred the Breton, one of the Devon Domesday Book tenants-in-chief of King William the Conqueror. In the 13th century the courthouse of Stanborough Hundred was situated above the New Inn. The Church of All Saints in Moreleigh had been built by 1239. Description Halwell and Moreleigh comprises the villages of Halwell and Moreleigh (also spelled Morleigh), approximately ½ mile apart. The parish has approximately 650 residents. Location Halwell and Moreleigh is situated in the South Hams local government district in Devon, England. It lies 5 miles (8 km) south of Totnes, 6 miles (11 km) west of Dartmouth and 5 miles north of Kingsbridge. Halwell and Moreleigh is surrounded, starting north and following the clock, by the parishes of Harberton, Ashprington, Cornworthy, Blackawton, East Allington, Woodleigh and Diptford. Notes | Mid | [
0.596194503171247,
35.25,
23.875
] |
Providing library services for an enterostomal therapy nursing education program. Serving a hospital-based educational program such as the School of Enterostomal Therapy (E.T.) provides the opportunity to teach library skills and expand library services to meet the needs of a growing specialty. This article includes: a synopsis of the E.T. educational program, a history of the specialty, and an explanation of the separate library services provided to students and faculty. Search strategy developed to more easily access literature pertinent to the E.T. nurse is described and examples given. | High | [
0.6841448189762791,
34.25,
15.8125
] |
--- abstract: 'Partitioned multiprocessor scheduling has been widely accepted in academia and industry to statically assign and partition real-time tasks onto identical multiprocessor systems. This paper studies fixed-priority partitioned multiprocessor scheduling for sporadic real-time systems, in which deadline-monotonic scheduling is applied on each processor. Prior to this paper, the best known results are by Fisher, Baruah, and Baker with speedup factors $4-\frac{2}{M}$ and $3-\frac{1}{M}$ for arbitrary-deadline and constrained-deadline sporadic real-time task systems, respectively, where $M$ is the number of processors. We show that a greedy mapping strategy has a speedup factor $3-\frac{1}{M}$ when considering task systems with arbitrary deadlines. Such a factor holds for polynomial-time schedulability tests and exponential-time (exact) schedulability tests. Moreover, we also improve the speedup factor to $2.84306$ when considering constrained-deadline task systems. We also provide tight examples when the fitting strategy in the mapping stage is arbitrary and $M$ is sufficiently large. For both constrained- and arbitrary-deadline task systems, the analytical result surprisingly shows that using exact tests does not gain theoretical benefits (with respect to speedup factors) if the speedup factor analysis is oblivious of the particular fitting strategy used.' author: - | Jian-Jia Chen\ $^1$Department of Informatics, TU Dortmund University, Germany\ E-mail: [email protected] bibliography: - 'real-time.bib' title: 'Partitioned Multiprocessor Fixed-Priority Scheduling of Sporadic Real-Time Tasks' --- [**Keywords:**]{} Sporadic real-time tasks, resource augmentation, approximation, schedulability analysis. Introduction {#sec:intro} ============ The sporadic task model has been widely adopted as the basic model for real-time systems with recurring executions [@Mok:1983:FDP:888951]. A sporadic real-time task $\tau_i$ is characterized by its *minimum inter-arrival time* $T_i$, its timing constraint or *relative deadline* $D_i$, and its (worst-case) *execution time* $C_i$. A sporadic task defines an infinite sequence of task instances, also called *jobs*, that arrive with the minimum inter-arrival time constraint. Under the minimum inter-arrival time constraint, any two consecutive jobs of task $\tau_i$ should be temporally separated by at least $T_i$. When a job of task $\tau_i$ arrives at time $t$, the job should finish no later than its *absolute deadline* $t+D_i$. If we consider a task releases its jobs periodically, such a task model is the well-known Liu and Layland task model [@liu73scheduling], where $T_i$ is the *period* of the task. An input task set is said to have 1) *implicit deadlines* if the relative deadlines of sporadic tasks are equal to their minimum inter-arrival times, 2) *constrained deadlines* if the minimum inter-arrival times are no less than their relative deadlines, and (3) *arbitrary deadlines*, otherwise. Through this paper, we only consider implicitly preemptive scheduling. That is, a job may be preempted by another job on a processor. For scheduling sporadic tasks on a processor, the preemptive earliest-deadline-first (EDF) policy is optimal [@liu73scheduling] to meet the timing constraints. However, EDF requires to prioritize the jobs in the ready queue by using their absolute deadlines, and the overhead is in general not negligible. The industrial practice is to use fixed-priority scheduling, also supported in most real-time operating systems, in which a task is assigned with a fixed priority level. The seminal work by Liu and Layland [@liu73scheduling] shows that rate monotonic (RM) scheduling is optimal for uniprocessor fixed-priority scheduling when considering implicit-deadline task systems. Moreover, deadline monotonic (DM) scheduling [@journals/pe/LeungW82] is optimal for uniprocessor fixed-priority scheduling for constrained-deadline task systems. For arbitrary-deadline task systems, Audsley et al. [@audsley1993applying] provide an optimal priority assignment algorithm to define the priority levels of the sporadic tasks for uniprocessor fixed-priority scheduling. Testing whether a task set can be feasibly scheduled by a scheduling algorithm is called a *schedulability test*. Even though RM and DM are known to be optimal for uniprocessor fixed-priority scheduling, the exact schedulability tests for uniprocessor fixed-priority scheduling requires pseudo-polynomial time by using the exact tests by Lehoczky, Sha, and Ding [@DBLP:conf/rtss/LehoczkySD89] for constrained-deadline systems and in exponential time by Lehoczky [@DBLP:conf/rtss/Lehoczky90] for arbitrary-deadline systems. Specifically, computing the worst-case response time of one (lowest-priority) task is shown ${\cal NP}$-hard by Eisenbrand and Rothvo[ß]{} [@DBLP:conf/rtss/EisenbrandR08]. There have been extensive results about testing the schedulability of uniprocessor fixed-priority scheduling. The more efficient strategy is to provide only sufficient conditions that can be verified in polynomial-time, like the utilization bound [@liu73scheduling; @journals/tc/LeeSP04; @DBLP:dblp_journals/tc/BurchardLOS95], the quadratic utilization bound [@DBLP:journals/tc/Bini15], the hyperbolic utilization bound [@bini2003rate; @ChenHLRTSS2015], the approximated request bound functions [@DBLP:conf/ecrts/AlbersS04; @DBLP:conf/rtss/ChakrabortyKT02; @DBLP:conf/ecrts/FisherB05]. implicit deadlines constrained deadlines arbitrary deadlines -- ------------------------------------------------------------- ----------------------------------------------- ----------------------------------------------- -- $\frac{4}{3}-\frac{1}{3M}$ [@DBLP:journals/siamam/Graham69] $3-\frac{1}{M}$ [@DBLP:journals/tc/BaruahF06] $4-\frac{2}{M}$ [@DBLP:conf/rtss/BaruahF05] PTAS [@DBLP:journals/jacm/HochbaumS87] $2.6322-\frac{1}{M}$ [@Chakraborty2011a] $3-\frac{1}{M}$ [@Chakraborty2011a] $\frac{7}{4}$ [@DBLP:dblp_journals/tc/BurchardLOS95] $3-\frac{1}{M}$ [@DBLP:conf/ecrts/FisherBB06] $4-\frac{2}{M}$ [@DBLP:conf/ecrts/FisherBB06] 1.5 [@DBLP:conf/waoa/KarrenbauerR10] $2.84306$ (*this paper*) $3-\frac{1}{M}$ (*this paper*) To quantify the performance loss due to efficient schedulability tests and assigning tasks with fixed priority levels, we will adopt the notion of speedup factors, (also known as resource augmentation factors). A fixed-priority scheduling algorithm with a speedup factor $\rho$ guarantees to produce feasible schedules by running (each processor) $\rho$ times as fast as in the original platform (speed), if there exists a feasible schedule (under arbitrary policies) for the task system. The speedup factors of DM scheduling, with respect to the optimal uniprocessor EDF scheduling, are $\frac{1}{\ln 2}$, $1.76322$, and $2$ for implicit-deadline, constrained-deadline, and arbitrary-deadline task sets [@DBLP:journals/rts/DavisRBB09; @conf:/rtns09/Davis], respectively. To schedule real-time tasks on multiprocessor platforms, there have been three widely adopted paradigms: partitioned, global, and semi-partitioned scheduling. A comprehensive survey of multiprocessor scheduling in real-time systems can be found in [@DBLP:journals/csur/DavisB11]. In this paper, we consider *partitioned scheduling*, in which the tasks are statically partitioned onto processors and all the processors are identical. That is, all the jobs of a task are executed on a specific processor with fixed-priority scheduling. However, problems on multiprocessors become ${\cal NP}$-complete (or worse) in the strong sense even in the simplest possible cases. For example, deciding if an implicit-deadline task set with the same period is schedulable on multiple processors is already ${\cal NP}$-complete in the strong sense [@Mok:1983:FDP:888951]. To cope with these ${\cal NP}$-hardness issues, one natural approach is to focus on approximation algorithms, i.e., polynomial time algorithms that produce an approximate solution instead of an exact one. There have been many results for implicit-deadline task systems, as summarized in the survey paper [@DBLP:journals/csur/DavisB11]. But, only a few results are known for constrained-deadline and arbitrary-deadline task systems. When considering sporadic task sets with constrained or arbitrary deadlines, the problem becomes more complicated, when EDF or fixed-priority scheduling is adopted on a processor. The recent studies in [@BaruahRTSS2011; @ChenECRTS12] provide polynomial-time approximation schemes for some special cases when speeding-up is adopted for EDF scheduling. For general cases, Baruah and Fisher [@DBLP:conf/rtss/BaruahF05; @DBLP:journals/tc/BaruahF06] propose a simple method, denoted as *deadline-monotonic partitioning* in this paper, which 1) considers the tasks in a non-decreasing order of their relative deadlines, and 2) assigns a task (in the above order) to a processor if it can pass the schedulability condition. If there are multiple processors that are feasible for assigning a task, the deadline-monotonic partitioning algorithm by Baruah and Fisher [@DBLP:conf/rtss/BaruahF05; @DBLP:journals/tc/BaruahF06] uses the first-fit strategy, but the analysis works for any arbitrary fitting strategy. The (theoretical) advantage of the first-fit strategy was not shown in the literature when we consider constrained- or arbitrary-deadline task systems. The deadline-monotonic partitioning strategy is simple, but has been shown effective in the literature [@DBLP:conf/rtss/BaruahF05; @DBLP:journals/tc/BaruahF06; @Chakraborty2011a; @DBLP:conf/ecrts/FisherBB06]. When adopting speeding-up for resource augmentation, by using EDF on a processor, the deadline-monotonic partitioning proposed by Baruah and Fisher [@DBLP:conf/rtss/BaruahF05; @DBLP:journals/tc/BaruahF06] has been shown with a ${3-\frac{1}{M}}$ speedup factor by Chen and Chakraborty [@Chakraborty2011a], where $M$ is the given number of identical processors. Prior to this paper, for fixed-priority multiprocessor partitioned scheduling for constrained- and arbitrary-deadline task systems, the best known results are by Fisher, Baruah, and Baker [@DBLP:conf/ecrts/FisherBB06] with speedup factors $4-\frac{2}{M}$ and $3-\frac{1}{M}$ for arbitrary-deadline and constrained-deadline sporadic real-time task systems, respectively. All the above results are based on a linear-approximation to efficiently and safely test the schedulability under EDF or DM scheduling to decide whether a task can be assigned on a processor. [**Our Contributions:**]{} Table \[tab:summary\] summarizes the related results and the contribution of this paper for multiprocessor partitioned scheduling. We focus on fixed-priority multiprocessor partitioned scheduling, and improve the best known results by Fisher, Baruah, and Baker [@DBLP:conf/ecrts/FisherBB06]. The deadline-monotonic partitioning algorithm is explored in a great detail in this paper. Our contributions are: - We show that the deadline-monotonic partitioning algorithm has a speedup factor $3-\frac{1}{M}$ when considering task systems with arbitrary deadlines, where $M$ is the number of processors. Such a factor holds for polynomial-time schedulability tests and exponential-time (exact) schedulability tests. Moreover, we also improve the speedup factor to $2.84306$ when considering constrained-deadline task systems by using polynomial-time and pseudo-polynomial-time (exact) schedulability tests. - The existing results by adopting the deadline-monotonic partitioning algorithm were analyzed based on approximated schedulability tests. One of our key contributions is to answer the question: *Will it be possible to further reduce the speedup factors by using exact tests in the deadline-monotonic partitioning algorithm?* Our answer to this question is ***NO!!*** Using exact tests in the above algorithm does not have any chance to reduce the speedup factors if the speedup factor analysis is oblivious of the particular fitting strategy used. We show that all the speedup factor analyses in this paper are asymptotically tight with polynomial-time schedulability tests and exponential-time (or pseudo polynomial-time) schedulability tests if the speedup factor analysis is oblivious of the particular fitting strategy used. As a result, to improve the speedup factor, better fixed-priority scheduling strategies or more precise analyses for concrete fitting strategies are needed. System Models and Preliminary Results {#sec:model} ===================================== Task and Platform Model ----------------------- We consider a set ${\bf T}={\left\{{\tau_1, \tau_2, \ldots, \tau_N}\right\}}$ of $N$ independent sporadic real-time tasks. A task $\tau_i$ is defined by $(C_i, T_i, D_i)$. That is, for task $\tau_i$, $D_i$ is its relative deadline, $T_i$ is its minimum inter-arrival time (period), and $C_i$ is its (worst-case) execution time. We consider identical processors in the platform. Therefore, no matter which processor a task is assigned to, the execution and timing property remains. According to the relations of the relative deadlines and the minimum inter-arrival times of the tasks in ${\bf T}$, the task set can be identified to be with 1) implicit deadlines, i.e., $D_i=T_i, \forall \tau_i \in {\bf T}$, 2) constrained deadlines, i.e., $D_i \leq T_i, \forall \tau_i \in {\bf T}$, or 3) arbitrary deadlines. For brevity, the *utilization* of task $\tau_i$ is denoted by $U_i=\frac{C_i}{T_i}$. Moreover, let $\Delta_i$ be $\max\{U_i, \frac{C_i}{D_i}\}$. For a set ${\bf X}$, its cardinality is denoted by $|{\bf X}|$. We will consider preemptive fixed-priority scheduling on each processor. Specifically, we will only use deadline-monotonic (DM) scheduling on each processor to assign the priority levels of the tasks. That is, task $\tau_i$ is with higher priority than $\tau_j$ if $D_i < D_j$, in which the ties are broken arbitrarily. Therefore, for the rest of this paper, we index the tasks from the shortest relative deadline to the longest, i.e., $D_i \leq D_j$ if $i < j$. Note that DM priority assignment is an optimal fixed-priority scheduling for implicit-deadline and constrained-deadline task sets [@journals/pe/LeungW82]. Although DM priority assignment is not an optimal fixed-priority assignment when we consider arbitrary-deadline task systems, it has a constant speedup factor, to be discussed in Section \[sec:def-speedup\]. Problem Definition ------------------ Given task set ${\bf T}$, a *feasible task partition* on $M$ identical processors is a collection of $M$ subsets, says, ${\bf T}_1, {\bf T}_2, \ldots, {\bf T}_M$, of ${\bf T}$ such that ${\bf T}_m \cap {\bf T}_{m'}=\emptyset$ for all $m\neq m'$, $\cup_{m=1}^{M} {\bf T}_m$ is equal to the input task set ${\bf T}$, and set ${\bf T}_m$ can meet the timing constraints by DM scheduling on a processor $m$. Without loss of generality, we can assume that $U_i \leq 100\%$ and $\frac{C_i}{D_i} \leq 100\%$, i.e., $\Delta_i \leq 100\%$, for any task $\tau_i$; otherwise, there is clearly no feasible task partition. Speedup Factors/Bounds {#sec:def-speedup} ---------------------- This paper focuses on the case where the arrival times of the sporadic tasks are not specified. Therefore, the approximation is for the worst cases by considering the worst-case behaviour to be feasibly scheduled by DM. If an algorithm ${\cal A}$ for the studied problem has a *speedup factor* $\rho$, it guarantees to *always produce a feasible solution by speeding each processor up to $\rho$ times of the original speed in the platform, if task set ${\bf T}$ can be feasibly scheduled (not restricted to DM) on the original $M$ identical processors*. In other words, by taking the negation of the above statement, we know that *if the algorithm ${\cal A}$ fails to feasibly partition the task set ${\bf T}$ on $M$ identical processors, there is no feasible task partition when each processor runs $\frac{1}{\rho}$ times slower than the original platform speed.* For the rest of this paper, we use $1$ to denote the original platform speed. Therefore, running the platform at speed $s$ implies that the execution time of task $\tau_i$ becomes $\frac{C_i}{s}$. Note that speedup factors are used for quantifying the behaviour of the designed algorithm. This is useful, especially for the negation part to quantify the error the algorithm makes when it does not provide a feasible solution. For fixed-priority scheduling, the speedup factors of DM scheduling, with respect to the optimal uniprocessor EDF scheduling, are $\frac{1}{\ln 2}$, $1.76322$, and $2$ for implicit-deadline, constrained-deadline, and arbitrary-deadline task sets [@conf:/rtns09/Davis], respectively. To quantify the schedulability of the input task set, we would need to know the necessary condition for being schedulable at speed $s$ on the $M$ processors. The necessary conditions $\max_{\tau_i \in {\bf T}} \Delta_i \leq s$ and $\sum_{\tau_i \in {\bf T}} \frac{U_i}{M} \leq s$ are pretty straightforward. As we focus on arbitrary-deadline and constrained-deadline sporadic task systems, we can also quantify the necessary condition defined by the demand. Here, we can release the first job of tasks synchronously (say, at time $0$), and the subsequent job arrivals should be as rapidly as legally possible. A necessary condition to be schedulable is to ensure that the total execution time of the jobs arriving no earlier than $a$ and with relative deadlines no later than $d$ is no more than $M\cdot (d-a)$ for any $a < d$. This is identical to the well-known *demand bound function* ${\sc dbf}(\tau_i, t)$, as in [@DBLP:conf/rtss/BaruahMR90], of a task $\tau_i$ within any time interval with length equal to $t$, defined as $$\label{eq:dbf} {\sc dbf}(\tau_i, t) = \max\left\{0, {\left\lfloor{\frac{t-D_i}{T_i}}\right\rfloor}+1\right\}\times C_i.$$ Therefore, as a necessary condition, to ensure the schedulability on $M$ processors, if a task set is schedulable for an algorithm on $M$ processors, then $$\label{eq:dbf-necessary} \forall t > 0, \qquad\sum_{\tau_i \in {\bf T}} {\sc dbf}(\tau_i, t) \leq M t.$$ With the above discussions, we can conclude the following lemma for the necessary condition to be schedulable by any algorithm, which has also been utilized by Chen and Chakraborty [@Chakraborty2011a]. \[lemma:lower-speed-bound\] A task set is not schedulable by any multiprocessor scheduling algorithm by running the $M$ processors at any speed $s$ if $$\label{eq:def-s-overall} \max\left\{\max_{t> 0}\frac{\sum_{\tau_i \in {\bf T}} dbf(\tau_i, t)}{Mt}, \frac{\sum_{\tau_i \in {\bf T}} U_i}{M},\max_{\tau_i \in {\bf T}} \Delta_i \right\} > s.$$ For the rest of the paper, we will focus ourselves on the negation part of the speedup factor analysis. That is, we are only interested in the failure cases of the partitioning algorithm and use Lemma \[lemma:lower-speed-bound\] to quantify $s$ for showing the speedup factors. Note that Lemma \[lemma:lower-speed-bound\] is also the necessary condition for global multiprocessor scheduling. It may seem that we are more pessimistic by comparing to the necessary condition of global multiprocessor scheduling instead of that of partitioned multiprocessor scheduling. However, in our tightness analysis, comparing to partitioned scheduling and global scheduling does not differ very much. Deadline-Monotonic Partitioning {#sec:deadline-monotonic} =============================== This section presents the deadline-monotonic partitioning strategy, proposed by Baruah and Fisher [@DBLP:journals/tc/BaruahF06; @DBLP:conf/rtss/BaruahF05; @DBLP:conf/ecrts/FisherBB06], for the multiprocessor partitioned scheduling problem. Note that such a strategy works in general for fixed-priority scheduling (RM, DM) and dynamic-priority scheduling (EDF), by adopting proper schedulability tests. The speedup factor for EDF/DM was shown to be $3-\frac{1}{M}$ and $4-\frac{2}{M}$ [@DBLP:journals/tc/BaruahF06; @DBLP:conf/rtss/BaruahF05; @DBLP:conf/ecrts/FisherBB06] for constrained-deadline systems and arbitrary-deadline systems, respectively. When considering EDF scheduling, Chen and Chakraborty [@DBLP:journals/rts/ChenC13] improved the speedup factor to $2.6322-\frac{1}{M}$ and $3-\frac{1}{M}$ for constrained-deadline systems and arbitrary-deadline systems, respectively. set ${\bf T}$ of $N$ tasks, $M$ processors; re-index (sort) tasks such that $D_i \leq D_j$ for $i < j$; ${\bf T}_1 \leftarrow {\left\{{\tau_1}\right\}}$;${\bf T}_m \leftarrow \emptyset, \forall m=2,3,\ldots,M$; \[algo:fitting-test\] choose $m \in {\left\{{1, 2, \ldots, M}\right\}}$ ***by preference*** such that ${\bf T}_m\cup {\left\{{\tau_k}\right\}}$ is schedulable by DM fixed-priority scheduling; \[algo:fitting\] assign $\tau_k$ to processor $m$ with ${\bf T}_m \leftarrow {\bf T}_m \cup {\left\{{\tau_k}\right\}}$; return “no feasible schedule is found”; return feasible task partition ${\bf T}_1, {\bf T}_2, \ldots, {\bf T}_M$; For completeness, we repeat the algorithm in [@DBLP:journals/tc/BaruahF06; @DBLP:conf/rtss/BaruahF05; @DBLP:conf/ecrts/FisherBB06], in which the pseudo-code is presented in Algorithm \[alg:dmp\]. Deadline-monotonic partitioning considers the given tasks from the shortest relative deadline to the longest relative deadline for assignment. When a task $\tau_k$ is considered, a processor $m$ with $m \in {\left\{{1,2,\ldots,M}\right\}}$ is selected to assign task $\tau_k$, where ${\bf T}_m$ is the set of the tasks (as a subset of ${\left\{{\tau_1, \tau_2, \ldots, \tau_{k-1}}\right\}}$), which have been assigned to processor $m$ before considering $\tau_k$. If there is no feasible $m$ that can feasibly schedule $\tau_k$ and ${\bf T}_m$ on the processor, we return that no feasible solution is found by this algorithm. Fitting Strategy {#sec:fitting} ---------------- The fitting strategy when we consider to assign task $\tau_k$ on a processor $m$ can be the *first-fit* strategy: by choosing the minimum $m$ that is feasible; the *arbitrary-fit* strategy: by choosing any $m$ that is feasible (this is also the case if the speedup factor analysis is oblivious of the particular fitting strategy used); the *best-fit* strategy: by choosing the index $m$ that has the maximum *workload-index*; the *worst-fit* strategy: by choosing the index $m$ that has the minimum *workload-index*. The workload-index can be defined as the total utilization or other means. The analysis in the literature [@DBLP:journals/tc/BaruahF06; @DBLP:conf/rtss/BaruahF05; @DBLP:conf/ecrts/FisherBB06; @DBLP:journals/rts/ChenC13] works in general by using any fitting strategy listed above, even though in several cases only the first-fit strategy was mentioned in the descriptions [@DBLP:journals/tc/BaruahF06; @DBLP:conf/rtss/BaruahF05; @DBLP:conf/ecrts/FisherBB06]. Schedulability Tests for DM {#sec:test-for-dm} --------------------------- Therefore, the remaining building block is to test whether task $\tau_k$ can be feasibly scheduled on a processor $m$ under DM scheduling. This has been widely studied in the literature. We will review some of these methods and explain their corresponding speedup factors when they are adopted in Step \[algo:fitting-test\] in Algorithm \[alg:dmp\]. [**Constrained Deadline:**]{} To verify the schedulability of constrained-deadline task $\tau_k$ under fixed-priority scheduling in uniprocessor systems, the time-demand analysis (TDA) [@DBLP:conf/rtss/LehoczkySD89] can be adopted. That is, if and only if $$\label{eq:exact-test-constrained-deadline} \exists t \mbox{ with } 0 < t \leq D_k {\;\; and \;\;} C_k + \sum_{\tau_i \in {\bf T}_m} {\left\lceil{\frac{t}{T_i}}\right\rceil}C_i \leq t,$$ then task $\tau_k$ is schedulable under DM scheduling, where ${\bf T}_m$ is the set of tasks with higher priority than task $\tau_k$ since we sort the tasks according to their relative deadlines. TDA requires pseudo-polynomial-time complexity, as all the points that lie in $(0, D_k]$ need to be checked for Eq. . Fisher, Baruah, and Baker [@DBLP:conf/ecrts/FisherBB06] approximate the test in Eq. by testing only $$\label{eq:approxi-test-constrained-deadline} \exists t \mbox{ with } 0 < t \leq D_k {\;\; and \;\;} C_k + \sum_{\tau_i \in {\bf T}_m} \left(1+\frac{t}{T_i}\right)C_i \leq t.$$ Due to the linearity of the condition in Eq. , the test is equivalent to the verification of whether $$\begin{aligned} C_k + \sum_{\tau_i \in {\bf T}_m} \left(1+\frac{D_k}{T_i}\right)C_i \leq D_k \label{eq:fbb-constrained-1}\end{aligned}$$ for constrained-deadline systems. We can also approximate the schedulability test by using utilization-based analysis as follows: We classify the task set ${\bf T}_m$ into two subsets: - ${\bf T}_m^1$ consists of the higher-priority tasks with periods smaller than $D_k$. - ${\bf T}_m^2$ consists of the higher-priority tasks with periods larger than or equal to $D_k$. The following theorem has been concluded recently by using a utilization-based schedulability-test framework [@ChenHLRTSS2015]. \[theorem:sporadic-general\] Task $\tau_k$ in a sporadic task system with constrained deadlines is schedulable by DM scheduling algorithm on processor $m$ if $$\label{eq:schedulability-sporadic-any-a} (\frac{C_{k,m}'}{D_k}+1) \prod_{\tau_j \in {\bf T}_m^1} (U_j + 1)\leq 2.$$ where $C_{k,m}'$ is $C_k + \sum_{\tau_i \in {\bf T}_m^2} C_i$. [**Arbitrary Deadline:**]{} For arbitrary-deadline systems, the exact schedulability test is to use a *busy-window* concept to evaluate the worst-case response time [@DBLP:conf/rtss/Lehoczky90] by using TDA. The finishing time $R_{k,h}$ of the $h$-th job of task $\tau_k$ in the busy window is the minimum $t$ such that $$h C_k + \sum_{\tau_i \in {\bf T}_m} {\left\lceil{\frac{t}{T_i}}\right\rceil}C_i \leq t.$$ Therefore, its response time is $R_{k,h}-(h-1)T_k$. To test the busy window length of task $\tau_k$, the busy window of task $\tau_k$ finishes on the $h$-th job if $R_{k,h} \leq h T_k$. The maximum response time among the jobs in the busy window is the worst-case response time [@DBLP:conf/rtss/Lehoczky90]. The schedulability test is exact, but this takes exponential time complexity, since the busy window length can be up to the hyper-period, which is exponential of the input size. The approximation by Fisher, Baruah, and Baker [@DBLP:conf/ecrts/FisherBB06] in Eq. remains feasible for analyzing the arbitrary-deadline systems. This leads to test whether $$\begin{aligned} C_k + \sum_{\tau_i \in {\bf T}_m} \left(1+\frac{D_k}{T_i}\right)C_i \leq D_k & \;\;\;\mbox{ and } \label{eq:fbb-arbitrary-1}\\ U_k + \sum_{\tau_i \in {\bf T}_m} U_i \leq 1. \label{eq:fbb-arbitrary-2}\end{aligned}$$ Eq. is important in arbitrary-deadline systems to ensure that the approximation in Eq. does not underestimate the workload after $D_k$. Moreover, Bini et al. [@DBLP:journals/tc/BiniNRB09] provide a tighter analysis than Eq. . They show that the worst-case response time of task $\tau_k$ is at most $$\frac{C_k+ \sum_{\tau_i \in {\bf T}_m} C_i - \sum_{\tau_i \in {\bf T}_m } U_i C_i}{1-\sum_{\tau_i \in {\bf T}_m} U_i}.$$ Therefore, the schedulability condition in Eqs. and can be rewritten as $$\begin{aligned} C_k + D_k(\sum_{\tau_i \in {\bf T}_m} U_i)+ \sum_{\tau_i \in {\bf T}_m} C_i - \sum_{\tau_i \in {\bf T}_m } U_i C_i\leq D_k, \label{eq:fbb-arbitrary-3}\\ U_k + \sum_{\tau_i \in {\bf T}_m} U_i \leq 1. \label{eq:fbb-arbitrary-4}\end{aligned}$$ Time Complexity and Correctness ------------------------------- Since we use partitioned scheduling, as long as Algorithm \[alg:dmp\] returns a task partition, it is guaranteed to be feasible if the test in Step \[algo:fitting-test\] is a sufficient schedulability test for task $\tau_k$ by using DM scheduling. The time complexity of the algorithm depends upon the time complexity of the schedulability test and the fitting strategy. Suppose that the fitting strategy requires time complexity $O(F)$ for one task and the time complexity to test whether task $\tau_k$ is schedulable on processor $m$ is $O(H)$. Then, the overall time complexity is $O(NMH + NF)$. All the fitting strategies mentioned in Section \[sec:fitting\] are in polynomial time. Since $H$ can be polynomial, pseudo polynomial, or exponential of the input size, the time complexity is dominated by the adopted schedulability test algorithm. The main issue here is to answer what can be guaranteed when Algorithm \[alg:dmp\] returns failure in task partitioning. We will quantify such failures by showing that $s$ in Eq. is also sufficiently large to provide the speedup factor guarantee (by using the negation arguments). Analysis for Arbitrary-Deadline Systems {#sec:arbitrary} ======================================= This section presents our analysis for arbitrary-deadline systems. Our analysis is similar to the analysis by Fisher, Baruah, and Baker [@DBLP:conf/ecrts/FisherBB06], but is tighter. Here, we will mainly analyze the property by using the schedulability condition in Eqs. and . At the end of this section, we will explain why the analysis also works for arbitrary-deadline TDA analysis by Lehoczky [@DBLP:conf/rtss/Lehoczky90] and response time analysis by Bini et al. [@DBLP:journals/tc/BiniNRB09]. \[theorem:sporadic-arbitrary\] The speedup factor of Algorithm \[alg:dmp\] is $3-\frac{1}{M}$ when adopting Eqs. and for DM schedulability test under any fitting strategy. Suppose that Algorithm \[alg:dmp\] fails to find a feasible assignment for task $\tau_k$ due to the failure when testing Eq. or Eq. . Let ${\bf M}_1$ be the set of processors in which Eq. fails. Let ${\bf M}_2$ be the set of processors in which Eq. succeeds but Eq. fails. Since task $\tau_k$ cannot be assigned on any of the $M$ processors, we have $|{\bf M}_1|+|{\bf M}_2|=M$. By the violation of Eq. , we know that $$\begin{aligned} & |{\bf M}_1|C_k + \sum_{m \in {\bf M}_1}\sum_{\tau_i \in {\bf T}_m}\left(1+\frac{D_k}{T_i}\right)C_i > |{\bf M}_1|D_k \nonumber\\ \Rightarrow & |{\bf M}_1|\frac{C_k}{D_k} + \sum_{m \in {\bf M}_1}\sum_{\tau_i \in {\bf T}_m}\left(\frac{C_i}{D_k}+U_i\right) > |{\bf M}_1|. \label{eq:fbb-arbitrary-violate-1}\end{aligned}$$ By the violation of Eq. , we know that $$\label{eq:fbb-arbitrary-violate-2} |{\bf M}_2|U_k + \sum_{m \in {\bf M}_2}\sum_{\tau_i \in {\bf T}_m} U_i > |{\bf M}_2|.$$ Recall that $\Delta_k$ is defined as $\max\{U_k, \frac{C_k}{D_k}\}$. By Eqs. and , we know that [$$\begin{aligned} & |{\bf M}_1|\frac{C_k}{D_k} + |{\bf M}_2|U_k + \sum_{i=1}^{k-1}U_i + \sum_{m \in {\bf M}_1}\sum_{\tau_i \in {\bf T}_m}\frac{C_i}{D_k} > M\nonumber\\ \Rightarrow \;\;\;& M \Delta_k + \sum_{i=1}^{k-1}U_i + \sum_{i=1}^{k-1}\frac{C_i}{D_k} > M. \nonumber\\ \Rightarrow \;\;\;& (M-1)\Delta_k + \sum_{i=1}^{k}U_i + \sum_{i=1}^{k}\frac{C_i}{D_k} > M. \nonumber\\ \Rightarrow \;\;\;& (1-\frac{1}{M})\Delta_k + \frac{\sum_{i=1}^{k}U_i}{M} + \sum_{i=1}^{k}\frac{C_i}{M D_k} > 1. \nonumber\\ \Rightarrow \;\;\;& (3-\frac{1}{M})\max\left\{\Delta_k, \frac{\sum_{i=1}^{k}U_i}{M}, \sum_{i=1}^{k}\frac{C_i}{M D_k}\right\} > 1. \label{eq:arbitrary-final}\end{aligned}$$ ]{} Therefore, we know that either $\Delta_k > \frac{1}{3-\frac{1}{M}}$, or $\frac{\sum_{i=1}^{k}U_i}{M} > \frac{1}{3-\frac{1}{M}}$, or $\sum_{i=1}^{k}\frac{C_i}{M D_k} > \frac{1}{3-\frac{1}{M}}$. Either of the former two cases implies the unschedulability of any scheduling algorithm with speed $\frac{1}{3-\frac{1}{M}}$. The demand bound function at time $D_k$ is $\sum_{i=1}^{N} dbf(\tau_i, D_k) \geq \sum_{i=1}^{k} C_i$. Therefore, by Eq. , we know that the condition $\sum_{i=1}^{k}\frac{C_i}{M D_k} > \frac{1}{3-\frac{1}{M}}$ implies the unschedulability of any scheduling algorithm with speed $\frac{1}{3-\frac{1}{M}}$. Therefore, by using Lemma \[lemma:lower-speed-bound\], we reach the conclusion. The following corollaries show that the speedup factor $3-\frac{1}{M}$ holds for any schedulability tests discussed in Section \[sec:deadline-monotonic\] for arbitrary-deadline sporadic task systems under DM scheduling. \[cor:sporadic-arbitrary-poly\] The speedup factor of Algorithm \[alg:dmp\] is $3-\frac{1}{M}$ when adopting Eqs. and for DM schedulability test under any fitting strategy. By not considering the term $- \sum_{\tau_i \in {\bf T}_m } U_i C_i$ in Eq. , the violation of Eq. leads to the same conclusion in Eq. . Therefore, the speedup factor remains $3-\frac{1}{M}$. \[cor:sporadic-arbitrary-arbitrary\] The speedup factor of Algorithm \[alg:dmp\] is $3-\frac{1}{M}$ when adopting the exact schedulability test for DM scheduling under any fitting strategy. If task $\tau_k$ cannot pass the exact schedulability test, it also does not pass the sufficient test by using Eqs. and . Therefore, we reach the same conclusion. Tightness Analysis ------------------ The following theorem shows that the analysis in Theorem \[theorem:sporadic-arbitrary\] is asymptotically tight even for implicit-deadline systems with first-fit strategy. \[theorem:sporadic-arbitrary-tight1\] The speedup factor of Algorithm \[alg:dmp\] is at least $3-\frac{3}{M+1}-\gamma$ when adopting Eqs. and for DM schedulability test under the first-fit strategy, where $\gamma$ is an arbitrarily small positive number. This theorem is proved by a concrete input task system with $N=2M$ tasks. There are $M$ light tasks with execution time $\frac{1}{3M}$ and $M$ heavy tasks with execution time $\frac{1+\epsilon}{3}$, in which $\epsilon$ is a small positive real, i.e., $\epsilon > 0$. The $M$ light tasks are all with period $1-\delta$ and relative deadline $1-\delta$ with arbitrarily small and positive $\delta \ll \epsilon$. The $M$ heavy tasks are all with period $1$ and relative deadline $1$. Therefore, the $2M$ tasks are indexed such that - $C_i=\frac{1}{3M}$, $T_i=D_i=1-\delta$, for $i=1,2,\ldots, M$, and - $C_i=\frac{1+\epsilon}{3}$, $T_i=D_i=1$, for $i=M+1,M+2,\ldots, 2M$. The setting of $0 < \delta \ll \epsilon$ is just to enforce the indexing. *We will directly take $\delta \rightarrow 0$ for the rest of the proof.*[^1] By using Algorithm \[alg:dmp\] for the above task set when adopting Eqs. and for DM schedulability test under the first-fit strategy, the $M$ light tasks are assigned on processor $1$. Then, when task $\tau_k$ with $k > M$ is considered, the condition in Eq. always fails for any of the first $k-M$ processors. Therefore, task $\tau_k$ is assigned to processor $k-M+1$, for $k=M+1, M+2, \ldots, 2M-1$. It is then clear that task $\tau_{2M}$ cannot be assigned on any of the $M$ processors. Therefore, Algorithm \[alg:dmp\] returns “no feasible solution is found”. By the above setting, we have $\sum_{i=1}^{2M} U_i = \frac{1+M+M\epsilon}{3}$. By using Lemma \[lemma:lower-speed-bound\], we know that the speedup factor of the above task set is at least $$\begin{aligned} \frac{1}{\frac{1+M+M\epsilon}{3}} = &3 - \frac{3+3\epsilon M}{M+1+\epsilon M} = & 3-\frac{3}{M+1} - \gamma \end{aligned}$$ in which the factor $\gamma = \frac{3\epsilon M^2}{(M+1)(M+1+\epsilon M)}$ becomes negligible when $\epsilon$ is sufficiently small. Such a factor can also be shown by a concrete partitioned schedule. By the pigeonhole principle, the solution that minimizes the maximum utilization of a processor is to assign a light task and a heavy task on a processor, in which the utilization on the processor is $\frac{1+\epsilon}{3}+\frac{1}{3M}$. Therefore, the task set is not schedulable on $M$ processors only when the speed is slower than $\frac{1+\epsilon}{3}+\frac{1}{3M}$, provided that $\delta$ is $0$. As a result, we reach the same conclusion. It may seem at first glance that the speedup factor $3-\frac{1}{M}$ in Corollary \[cor:sporadic-arbitrary-arbitrary\] is pessimistic, since we do not actually use any property in the exponential-time exact schedulability test. However, the following theorem shows that the speedup factor $3-\frac{1}{M}$ is asymptotically tight for an arbitrary fitting strategy, for any schedulability tests used in Theorem \[theorem:sporadic-arbitrary\], Corollary \[cor:sporadic-arbitrary-poly\], and Corollary \[cor:sporadic-arbitrary-arbitrary\]. As a result, to improve the speedup factor, better fixed-priority scheduling strategies or more precise analysis for concrete fitting strategies are needed. \[theorem:sporadic-arbitrary-tight2\] The speedup factor of Algorithm \[alg:dmp\] is at least $3-\frac{3}{M+1}-\gamma$ under an arbitrary fitting strategy, for any schedulability tests used in Theorem \[theorem:sporadic-arbitrary\], Corollary \[cor:sporadic-arbitrary-poly\], and Corollary \[cor:sporadic-arbitrary-arbitrary\], where $\gamma$ is an arbitrarily small positive number. This theorem is proved by a concrete input task system with $3M$ tasks. Let $\delta$ and $\epsilon$ be very small positive real numbers, with $\delta \ll \epsilon$. There are $M$ tasks with execution time $\frac{1}{3M}$, period $\infty$, and relative deadline $1-\delta$. There are $M$ tasks with execution time $\frac{\epsilon}{3}$, period $\epsilon$, and relative deadline $1$. There are $M$ tasks with execution time $\frac{1+\epsilon}{3}$, period $\infty$, and relative deadline $1+\delta$. Therefore, the $3M$ tasks are indexed such that - $C_i=\frac{1}{3M}$, $T_i=\infty$, $D_i=1-\delta$, for $i=1,2,\ldots, M$, and - $C_i=\frac{\epsilon}{3}$, $T_i=\epsilon$, $D_i=1$, for $i=M+1,M+2,\ldots, 2M$. - $C_i=\frac{1+\epsilon}{3}$, $T_i=\infty$, $D_i=1+\delta$, for $i=2M+1,2M+2,\ldots, 3M$. Again, the setting of $\delta \ll \epsilon$ is just to enforce the indexing. *We will directly take $\delta \rightarrow 0$ for the rest of the proof.* Now, we consider a feasible task assignment for the first $3M-1$ tasks, in which - $\tau_1, \tau_2, \ldots, \tau_{M+1}$ are assigned on processor $1$, and - $\tau_i$ and $\tau_{i+M-1}$ are assigned on processor $i-M$ for $i=M+2, M+3, \ldots, 2M$. By using Algorithm \[alg:dmp\] for task $\tau_{3M}$, we know that task $\tau_{3M}$ cannot be feasibly assigned on any of the $M$ processors since $\forall 0 < t \leq 1$ and $m=1,2,\ldots,M$, we have $\frac{1+\epsilon}{3} + \sum_{\tau_i \in {\bf T}_m} {\left\lceil{\frac{t}{T_i}}\right\rceil}C_i > t$. Therefore, Algorithm \[alg:dmp\] returns “no feasible solution is found”. By the above setting, we know that (1) $\sum_{i=1}^{3M} dbf(\tau_i, t)=0$ for $0 < t < 1$, (2) $\sum_{i=1}^{3M} dbf(\tau_i, 1)=\frac{2\epsilon M+M+1}{3}$, and (3) for $1 < t$, $$\begin{aligned} \sum_{i=1}^{3M} dbf(\tau_i, t) \leq& \frac{1}{3} + (t-1)\frac{1}{3}M + \frac{1+\epsilon}{3}M + \frac{\epsilon}{3}M\\ =& \frac{2\epsilon M+Mt+1}{3}. \end{aligned}$$ As a result, $\max_{t > 0}\frac{\sum_{i=1}^{3M} dbf(\tau_i, t)}{M t} = \frac{1+2\epsilon+\frac{1}{M}}{3}$, when $\epsilon$ is small enough. Since $\max_{\tau_i\in {\bf T}} \Delta_i = \frac{1+\epsilon}{3}$ and $\sum_{i=1}^{3M}\frac{U_i}{M}=\frac{1}{3}$, by Lemma \[lemma:lower-speed-bound\], the speedup factor of the above task set is $$\begin{aligned} \frac{1}{\frac{1}{3M} + \frac{2\epsilon}{3} + \frac{1}{3}} = &\frac{3M}{M+2\epsilon M+1}\\ =& 3 - \frac{3+6\epsilon M}{M+1+2\epsilon M} = 3-\frac{3}{M+1} - \gamma, \end{aligned}$$ in which the factor $\gamma=\frac{6\epsilon M^2}{(M+1)(M+1+2\epsilon M)}$ becomes negligible when $\epsilon$ is sufficiently small. The above analysis also works for the specific task partitioning which assigns three tasks $\tau_i$, $\tau_{i+M}$, and $\tau_{i+2M}$ on one processor for $i=1,2,\ldots,M$, and assigns the priority levels by using the optimal priority assignment by Audsley et al. [@audsley1993applying], i.e., $\tau_{i+M}$ has the lowest priority on the processor. Analysis for Constrained Deadlines ================================== This section presents the analysis for constrained-deadline sporadic real-time systems. By Theorem \[theorem:sporadic-arbitrary-tight1\], we know that the method by Fisher, Baruah, and Baker [@DBLP:conf/ecrts/FisherBB06] leads to a speedup factor $3$ when $M$ is sufficiently large even for implicit-deadline systems. The reason is mainly due to the pessimism of Eq. in the schedulability test. To get better results, we do need better tests. A more precise strategy is to simply use the exact test for constrained-deadline systems by spending pseudo-polynomial time complexity. We have already shown (by Corollary \[cor:sporadic-arbitrary-arbitrary\] and Theorem \[theorem:sporadic-arbitrary-tight2\]) that spending more time complexity does not help in arbitrary-deadline systems if the analysis does not use the property of any specific fitting strategy. Is this also the same for constrained-deadline systems? We will first present the analysis by using TDA as the schedulability test in Step \[algo:fitting-test\] in Algorithm \[alg:dmp\]. We will conclude later that such high time complexity also does not help reduce the speedup factor, compared to the results by using the hyperbolic bound in Theorem \[theorem:sporadic-general\]. Speedup Factor by Adopting TDA {#sec:constrained-TDA} ------------------------------ Now, suppose that task $\tau_k$ is the first task that fails to be assigned on any of the $M$ processors by using TDA schedulability analysis in Step \[algo:fitting-test\] in Algorithm \[alg:dmp\]. For notational brevity, let ${\bf T}^*$ be the set ${\left\{{\tau_1, \tau_2, \ldots, \tau_{k-1}}\right\}}$ of the tasks Therefore, we know that this leads to $$\forall m, \forall t,\mbox{ with } 0 < t \leq D_k, {\;\; \qquad \;\;} C_k + \sum_{\tau_i \in {\bf T}_m} {\left\lceil{\frac{t}{T_i}}\right\rceil}C_i > t.$$ By taking a summation of all the $m=1,2,\ldots,M$ inequalities with respect to any $t$, we know that the unschedulability of task $\tau_k$ by Algorithm \[alg:dmp\] implies that $$\label{eq:necessary-unschedulability-TDA-constrained} \forall t \mbox{ with } 0 < t \leq D_k, {\;\; \qquad \;\;} MC_k + \sum_{\tau_i \in {\bf T}^*} {\left\lceil{\frac{t}{T_i}}\right\rceil}C_i > Mt.$$ Therefore, by taking the negation, we know that if $$\label{eq:sufficient-schedulability-TDA-constrained} \exists t \mbox{ with } 0 < t \leq D_k, {\;\; \mbox{and} \;\;} C_k + \sum_{\tau_i \in {\bf T}^*} \frac{{\left\lceil{\frac{t}{T_i}}\right\rceil}C_i }{M}\leq t,$$ then Algorithm \[alg:dmp\] by using TDA should succeed to assign task $\tau_k$ on one of the $M$ processors. This is basically very similar to TDA with a minor difference by dividing the higher-priority workload by $M$. Testing the schedulability condition of task $\tau_k$ according to Eq. can be done by using the same strategy used in the ${\bf k^2U}$ framework [@ChenHLRTSS2015] to prove Theorem \[theorem:sporadic-general\] as follows. We classify the $k-1$ tasks in ${\bf T}^*$ into two subsets. - ${\bf T}^{*1}$ consists of the tasks in ${\bf T}^*$ with periods smaller than $D_k$. - ${\bf T}^{*2}$ consists of the tasks in ${\bf T}^*$ with periods larger than or equal to $D_k$. Now, let $C_k'$ be defined as follows: $$\label{eq:Ckprime} C_k' = C_k + \sum_{\tau_i \in {\bf T}^{*2}} \frac{C_i }{M}.$$ Suppose that we have $\kappa-1$ tasks in ${\bf T}^{*1}$. Clearly, according to the definition $\kappa \geq 1$. Now, we can rewrite the condition in Eq. as follows: if $$\label{eq:sufficient-schedulability-TDA-k2u-constrained} \exists t \mbox{ with } 0 < t \leq D_k {\;\; \mbox{and} \;\;} C_k' + \sum_{\tau_i \in {\bf T}^{*1}} \frac{{\left\lceil{\frac{t}{T_i}}\right\rceil}C_i }{M}\leq t,$$ then Algorithm \[alg:dmp\] by using TDA should succeed to assign task $\tau_k$ on one of the $M$ processors. For completeness, we repeat the definition of the [$\mathbf{k^2U}$]{} framework and the key Lemma (with some simplifications to remove individual coefficients for each task $\tau_i$) as follows. \[def:kpoints\] A $k$-point effective schedulability test is a sufficient schedulability test of a fixed-priority scheduling policy by verifying the existence of $t_j \in {\left\{{t_1, t_2, \ldots t_k}\right\}}$ with $t_1 \leq t_2 \leq \cdots \leq t_k$ such that $$\label{eq:precodition-schedulability} C_k + \sum_{i=1}^{k-1} \alpha t_i U_i + \sum_{i=1}^{j-1} \beta t_i U_i \leq t_j,$$ where $C_k > 0$, $\alpha > 0$, $U_i > 0$, and $\beta >0$ are dependent upon the setting of the task models and task $\tau_i$. \[lemma:framework-constrained\] For a given $k$-point effective schedulability test, defined in Definition \[def:kpoints\], of a scheduling algorithm, in which $0 < \alpha \neq \infty$, and $0 < \beta \neq \infty$, task $\tau_k$ is schedulable by the scheduling algorithm if the following condition holds $$\label{eq:schedulability-constrained} \frac{C_k}{t_k} \leq \frac{\frac{\alpha}{\beta}+1}{\prod_{j=1}^{k-1} (\beta U_j + 1)} - \frac{\alpha}{\beta}.$$ This comes from Lemma 1 in [@ChenHLRTSS2015]. By adopting the [$\mathbf{k^2U}$]{} framework [@ChenHLRTSS2015], we can conclude the following theorem. \[thm:k2u-dm-hypobolic\] If $$\prod_{\tau_i \in {\bf T}^{*1}} (1+\frac{U_i}{M})\leq \frac{2}{ 1+\frac{C_k'}{D_k}} ,$$ then task $\tau_k$ is schedulable under Algorithm \[alg:dmp\] by using TDA. In the proof, we will reindex the tasks to satisfy the monotonicity of $t_i$ in Definition \[def:kpoints\]. That is, the $\kappa-1$ higher-priority tasks in ${\bf T}^{*1}$ are reindexed to form the corresponding sequence $\tau_1, \tau_2, \ldots, \tau_{\kappa-1}$ for ensuring that the arrival times of the last jobs no later than $D_k$ are in a non-decreasing order. For task $\tau_i$ in ${\bf T}^{*1}$, we set $t_i$ as ${\left\lfloor{\frac{D_k}{T_i}}\right\rfloor}T_i$. Now, we reindex the $\kappa-1$ higher-priority tasks such that $t_1 \leq t_2 \leq \cdots \leq t_{\kappa-1}$. Moreover, let $t_{\kappa}$ be $D_k$. Since $T_i < D_k$ for any task $\tau_i$ in ${\bf T}^{*1}$, we have $t_i \geq T_i$. Therefore, for a given $t_j$ with $j=1,2,\ldots,\kappa$, the demand requested up to time $t_j$ in Eq. is at most $$\begin{aligned} & C_k + \frac{\sum_{\tau_i \in {\bf T}^{*2}} C_i + \sum_{\tau_i \in {\bf T}^{*1}} {\left\lceil{\frac{t_j}{T_i}}\right\rceil}C_i}{M}\nonumber\\ = & C_k' + \frac{\sum_{i=1}^{\kappa-1} {\left\lceil{\frac{t_j}{T_i}}\right\rceil}C_i}{M}\nonumber\\ \leq & C_k' + \frac{\sum_{i=1}^{\kappa-1} \frac{t_i}{T_i}C_i}{M} + \frac{\sum_{i=1}^{j-1} C_i}{M},\nonumber\end{aligned}$$ where the inequality comes from the indexing policy defined above, i.e., ${\left\lceil{\frac{t_j}{T_i}}\right\rceil} \leq \frac{t_i}{T_i}+1$ if $j > i$ and ${\left\lceil{\frac{t_j}{T_i}}\right\rceil} \leq \frac{t_i}{T_i}$ if $j \leq i$. We only apply the test for these $\kappa$ different $t_i$ values, which is equivalent to the test of the existence of $t_j$ for $j=1,2,\ldots,\kappa$ such that $C_k' + \frac{\sum_{i=1}^{\kappa-1} \frac{t_i}{T_i}C_i}{M} + \frac{\sum_{i=1}^{j-1} C_i}{M} \leq t_j$. This satisfies Definition \[def:kpoints\] (when $k$ is $\kappa$) with $\alpha=\frac{1}{M}$ and $\beta=\frac{1}{M}$. Therefore, by using Lemma \[lemma:framework-constrained\], if $$\frac{C_k'}{D_k} \leq \frac{1+1}{\prod_{\tau_i \in {\bf T}^{*1}} (\frac{U_i}{M} + 1)} - 1,$$ then task $\tau_k$ is schedulable under Algorithm \[alg:dmp\] by using TDA. By reorganizing the above equation, we reach the conclusion. The following corollary comes from the same proof of Lemma \[lemma:framework-constrained\] and Theorem \[thm:k2u-dm-hypobolic\], which shows that the schedulability condition also implies a lower bound of the workload $\frac{C_k'}{D_k}+ \frac{ \sum_{\tau_i \in {\bf T}^{*1}} t_i U_i}{M D_k}$. \[cor:k2u-dm-extreme\] If the schedulability condition in Theorem \[thm:k2u-dm-hypobolic\] is violated, i.e., $\prod_{\tau_i \in {\bf T}^{*1}} (1+\frac{U_i}{M})> \frac{2}{ 1+\frac{C_k'}{D_k}}$, then $$\frac{C_k'}{D_k}+ \frac{ \sum_{\tau_i \in {\bf T}^{*1}} {\left\lfloor{\frac{D_k}{T_i}}\right\rfloor}T_i U_i}{M D_k} > \prod_{\tau_i \in {\bf T}^{*1}} \left(1+\frac{U_i}{M}\right).$$ This comes from the same proof as in Lemma \[lemma:framework-constrained\] (Lemma 1 in [@ChenHLRTSS2015]) by changing the objective from minimizing $C_k^*$ to minimizing $C_k^* + \sum_{i=1}^{k-1}\alpha t_i U_i$ to enforce the unschedulability. This property has been provided by Chen, Huang, and Liu [@ChenHLRTSS2015] to prove the speedup factor of deadline-monotonic scheduling in uniprocessor systems. Moreover, this condition has also been exploited by von der Brüggen, Chen, and Huang [@DBLP:conf/ecrts/BruggenCH15] to prove the speedup factor of non-preemptive DM scheduling with respect to non-preemptive EDF scheduling. The remaining proofs in this section require some mathematical tools, which are provided in the following lemmas. \[lemma:hypo-worst-case\] Suppose that $\sum_{\tau_i \in {\bf T}^{1*}} U_i > 0$ is fixed and $U_i \geq 0$ for each task $\tau_i$. Then, $\prod_{\tau_i \in {\bf T}^{1*}} \left(\frac{U_i}{M} + 1\right)$ is maximized when $U_1=U_2= \cdots = U_{|{\bf T}^{1*}|}$. This can be easily proved by the fact that $\prod_{\tau_i \in {\bf T}^{1*}} \left(\frac{U_i}{M} + 1\right)$ is a concave function with respect to the (non-negative) values of $U_i$. \[lemma:hypo-worst-case-total\] The infimum $\sum_{\tau_i \in {\bf T}^{1*}} \frac{U_i}{M}$ to enforce $\prod_{\tau_i \in {\bf T}^{1*}} \left(\frac{U_i}{M} + 1\right) > x$ is $\ln(x)$. This can be derived by using Lagrange Multiplier Method to find the minimum $\sum_{\tau_i \in {\bf T}^{1*}} \frac{U_i}{M}$ such that $\prod_{\tau_i \in {\bf T}^{1*}} \left(\frac{U_i}{M} + 1\right) \geq x$. By Lemma \[lemma:hypo-worst-case\], it is clear that the worst case is to have all the tasks with the same utilization. Suppose that $|{\bf T}^{1*}|$ is $n$. We know that all the tasks are with utilization $M(x^{\frac{1}{n}}-1)$, and the utilization bound $\sum_{\tau_i \in {\bf T}^{1*}} \frac{U_i}{M}$ is $n(x^{\frac{1}{n}}-1)$. This converges to $\ln(x)$ when $n$ approaches $\infty$. With the above discussions, we can conclude the speedup factor. \[thm:speedup-dm\] The speedup factor of Algorithm \[alg:dmp\] for constrained-deadline task systems by using TDA is $\frac{1}{W(0.5)}\approx 2.84306$, where $W(z)$ is the Lambert W function, i.e., the unique solution of $z=W(z)e^{W(z)}$. If $\prod_{\tau_i \in {\bf T}^{*1}} (\frac{U_i}{M} + 1) \geq 2$, we can already conclude that $\sum_{\ \tau_i \in {\bf T}^{*1}} \frac{U_i}{M} \geq \ln{2}$ by using Lemma \[lemma:hypo-worst-case-total\], and the speedup factor is $1/\ln{2} < 2.84306$ for such a case. We focus on the other case with $\prod_{\tau_i \in {\bf T}^{*1}} (\frac{U_i}{M} + 1) < 2$. Suppose that $\sigma$ is $\frac{2}{\prod_{\tau_i \in {\bf T}^{*1}} (\frac{U_i}{M} + 1)}-1$, in which $\sigma > 0$. If $\tau_k$ is not schedulable under Algorithm \[alg:dmp\] by TDA, then [$$\begin{aligned} &\frac{C_k}{D_k} + \frac{\sum_{i=1}^{k-1} dbf(\tau_i,D_k)}{M D_k}\\ = \;\;&\frac{C_k}{D_k} + \frac{\sum_{\tau_i \in {\bf T}^{*2}}C_i}{M D_k}+ \frac{\sum_{\tau_i \in {\bf T}^{*1}} dbf(\tau_i,D_k)}{M D_k} \\ \geq\;\;& \frac{C_k'}{D_k} + \frac{ \sum_{\tau_i \in {\bf T}^{*1}} {\left\lfloor{\frac{D_k}{T_i}}\right\rfloor}T_i U_i}{M D_k} \\ >_1 &\prod_{\tau_i \in {\bf T}^{*1}} \left(1+\frac{U_i}{M}\right) = \frac{1+\sigma}{2}, \end{aligned}$$]{} where $>_1$ is by Corollary \[cor:k2u-dm-extreme\]. Suppose that $\frac{C_k}{D_k}$ is $x$. Therefore, we know that $$\label{eq:DM-dbf-final} \sum_{\tau_i \in {\bf T}^*} \frac{dbf(\tau_i,D_k)}{M} > \frac{1+\sigma}{2}-x.$$ Moreover, with $\prod_{\tau_i \in {\bf T}^{*1}} (1+\frac{U_i}{M}) = \frac{2}{ 1+\sigma}$ and the fact that $\tau_k$ is not schedulable under Algorithm \[alg:dmp\] by using TDA, by Lemma \[lemma:hypo-worst-case-total\], we have $$\label{eq:DM-utilization} \sum_{\tau_i \in {\bf T}^{*1}} \frac{U_i}{M} > \ln(\frac{2}{1+\sigma}).$$ For the rest of the proof, we consider two separate cases:[^2] [**Case 1**]{} $x \geq \sigma$: This is an easier case. We can conclude the speedup factor by using Eq. $$\begin{aligned} &\max\left\{\frac{C_k}{D_k}, \sum_{\tau_i \in {\bf T}^*} \frac{U_i}{M}\right\} \geq \max\left\{\sigma, \ln(\frac{2}{1+\sigma})\right\} \\ \geq &\min_{\sigma > 0}\left\{\max\{\sigma, \ln(\frac{2}{1+\sigma})\} \right\}=_1 \frac{1}{2.66793}, \end{aligned}$$ where $=_1$ holds when $e^{\sigma}(1+\sigma)=2$. [**Case 2**]{} $x <\sigma$: There are two subcases - [**Case 2a**]{}: If $x > \frac{1+\sigma}{4}$, we know that $x > \frac{1+\sigma}{2}-x$. Therefore, by Eq. , $\max\left\{\frac{C_k}{D_k}, \sum_{\tau_i \in {\bf T}^*} \frac{dbf(\tau_i,D_k)}{M}\right\} \geq x > \frac{1+\sigma}{4}$. Hence, $$\begin{aligned} &\max\left\{\frac{C_k}{D_k}, \sum_{\tau_i \in {\bf T}^*} \frac{U_i}{M}, \sum_{\tau_i \in {\bf T}^*} \frac{dbf(\tau_i,D_k)}{M}\right\}\\ > &\max\left\{\frac{1+\sigma}{4}, \ln(\frac{2}{1+\sigma})\right\} \geq \min_{y \geq 0} \max\left\{y, \ln\frac{1}{2y}\right\} \\ =& W(0.5)\approx \frac{1}{2.84306}, \end{aligned}$$ where $=$ holds when $ye^{y}=0.5$. - [**Case 2b**]{}: If $x \leq \frac{1+\sigma}{4}$, we know that $x \leq \frac{1+\sigma}{2}-x$. Therefore, by Eq. , $\max\left\{\frac{C_k}{D_k}, \sum_{\tau_i \in {\bf T}^*} \frac{dbf(\tau_i,D_k)}{M}\right\} > \frac{1+\sigma}{2}-x \geq \frac{1+\sigma}{4}$. Hence, $$\begin{aligned} &\max\left\{\frac{C_k}{D_k}, \sum_{\tau_i \in {\bf T}^*} \frac{U_i}{M}, \sum_{\tau_i \in {\bf T}^*} \frac{dbf(\tau_i,D_k)}{M}\right\}\\ > &\max\left\{\frac{1+\sigma}{4} , \ln\left(\frac{2}{1+\sigma}\right)\right\} \geq \min_{y \geq 0} \max\left\{y , \ln(\frac{1}{2y})\right\}\\ =& W(0.5)\approx \frac{1}{2.84306}, \end{aligned}$$ where $=$ holds when $ye^{y}=0.5$. Therefore, by all the above cases, we know that [$$\max\left\{\frac{C_k}{D_k}, \sum_{\tau_i \in {\bf T}^*} \frac{U_i}{M}, \sum_{\tau_i \in {\bf T}^*} \frac{dbf(\tau_i,D_k)}{M}\right\} > W(0.5)\approx \frac{1}{2.84306},$$]{}which concludes the proof by applying Lemma \[lemma:lower-speed-bound\]. Speedup Factor by Hyperbolic Bound {#sec:constrained-hyperbolic} ---------------------------------- This subsection further presents the speedup factor of Algorithm \[alg:dmp\] when adopting the hyperbolic bound in Eq. for testing the schedulability of DM scheduling. The speedup factor analysis in Theorem \[thm:speedup-dm\] for TDA schedulability analysis relies only on the violation of the schedulability condition in Theorem \[thm:k2u-dm-hypobolic\]. We will show that adopting the hyperbolic bound of Eq. results in the same condition in Theorem \[thm:k2u-dm-hypobolic\]. Therefore, we can reach the same conclusion as in Theorem \[thm:speedup-dm\] by using the hyperbolic bound in polynomial time. We use the same notations, e.g., ${\bf T}^{*1}$, ${\bf T}^{*2}$, $\kappa$, etc., as used in Section \[sec:constrained-TDA\]. \[thm:k2u-dm-hypobolic-poly\] If $$\prod_{\tau_i \in {\bf T}^{*1}} \left(1+\frac{U_i}{M}\right)\leq \frac{2}{ 1+\frac{C_k'}{D_k}} ,$$ then task $\tau_k$ is schedulable under Algorithm \[alg:dmp\] by using the hyperbolic bound in Eq. , where $C_k'$ is $C_k+ \frac{\sum_{\tau_i \in {\bf T}^{*2}} C_i}{M}$. We prove this by contrapositive. Suppose that task $\tau_k$ is not schedulable under Algorithm \[alg:dmp\] by using the hyperbolic bound in Eq. . Therefore, for $m=1,2,\ldots, M$, we have $$\left(\frac{C_k + \sum_{\tau_i \in {\bf T}_m^2} C_i}{D_k}+1\right) \prod_{\tau_i \in {\bf T}_m^1} (U_i + 1) > 2.$$ By multiplying the above $M$ inequalities we reach $$\begin{aligned} 2^M <& \left(\prod_{m=1}^{M}\left(\frac{C_k + \sum_{\tau_i \in {\bf T}_m^2} C_i}{D_k}+1\right)\right) \left(\prod_{\tau_i \in {\bf T}^{*1}} (U_i + 1)\right)\\ \leq_1 & \left(\frac{C_k + \frac{\sum_{\tau_i \in {\bf T}^{*2}} C_i}{M}}{D_k}+1\right)^M \left(\prod_{\tau_i \in {\bf T}^{*1}} \left(\frac{U_i}{M} + 1\right)^M\right), \end{aligned}$$ where $\leq_1$ comes from Lemma \[lemma:hypo-worst-case\] (for the first part) and from the fact $(1+U_i) \leq (1+U_i/M)^M$ when $M$ is a positive integer and $U_i \geq 0$ (for the second part). Therefore, we conclude that the unschedulability of task $\tau_k$ implies that $$2 < \left(\frac{C_k'}{D_k}+1\right) \left(\prod_{\tau_i \in {\bf T}^{*1}} \left(\frac{U_i}{M} + 1\right)\right).$$ By contrapositive, we reach the conclusion. \[thm:speedup-dm-hyper\] The speedup factor of Algorithm \[alg:dmp\] by using the hyperbolic bound in Eq. is $\frac{1}{W(0.5)}\approx 2.84306$, where $W(z)$ is the Lambert W function, i.e., $z=W(z)e^{W(z)}$. Since the schedulability condition remains the same as in Theorem \[thm:k2u-dm-hypobolic\], the speedup factor is also the same as in Theorem \[thm:speedup-dm\]. Tightness Analysis {#sec:constrained-tightness} ------------------ We conclude this section by showing that the above speedup factor analysis is tight when $M$ is sufficiently large under an arbitrary fitting strategy. \[theorem:sporadic-constrained-tight1\] For constrained-deadline task systems, the speedup factor of Algorithm \[alg:dmp\] is at least $\frac{1}{W(0.5)} \approx 2.84306$ when adopting TDA or the hyperbolic bound in Eq for DM schedulability test under an arbitrary fitting strategy, when $M$ is sufficiently large. We prove this theorem by providing a concrete task system by assuming that $M$ is sufficiently large. There are $N=2M^2+ 1$ tasks. Let $f$ be $\frac{2}{\frac{1}{W(0.5)}} \approx 0.7034674$, i.e., $\ln(\frac{1}{f}) = \frac{f}{2}$. Let $\delta$ be an arbitrarily small positive number just for enforcing the indexing: - $T_i = D_i = f + ({\left\lceil{\frac{i}{M}}\right\rceil}-1)\frac{1-f}{M-1}$, $C_i = \frac{1-f}{M-1}$, for $i=1,2,\ldots, M^2$, - $T_i=\infty$, $D_i=1+\delta$, $C_i=\frac{1.5f-1}{M}\approx \frac{0.0552}{M}$, for $i=M^2+1,M^2+2,\ldots, 2M^2$, and - $T_N = \infty$, $D_N = 1+2\delta$, $C_N = 0.5f+\epsilon$, with $N=2M^2+1$, where $\epsilon$ is a positive small number. *We again simply take $\delta$ to $0$ for the rest of the proof.* Moreover, $\frac{1}{M}$ is also consider negligible for the simplicity of computation, since $M$ is assumed to be sufficiently large. For an arbitrary fitting algorithm, consider the following task assignment by assigning task $\tau_{i+jM}$ to processor $i$ with $i=1,2,\ldots,M$ for every $j=0,1,2,\ldots,2M-1$. It is not difficult to see that the above task assignment can be achieved feasibly and results in a feasible task assignment for the first $2M^2$ tasks. The set of the tasks assigned on processor $m$ is denoted as ${\bf T}_m$. Now, consider task $\tau_{2M^2+1}$, i.e., $\tau_N$ to be assigned on processor $m$. The overall execution time request at time $0$ is $0.5f+\epsilon + 1.5f-1+1-f=f+\epsilon$ on processor $m$. Therefore, it can be easily seen that task ${\bf T}_m\cup {\left\{{\tau_N}\right\}}$ is not schedulable under DM scheduling on processor $m$ since the TDA test in Eq. fails. As a result, task $\tau_N$ cannot be assigned on any processor. In this input task set, the utilization of the individual task and $\frac{C_i}{D_i}$ are not more than $\frac{f}{2}+\epsilon$ for each task $\tau_i$. Moreover, the overall task utilization is $M\sum_{i=0}^{M-1}\frac{\mu}{f+i \mu}$, where $\mu = \frac{1-f}{M-1}$. Due to the assumption that $M$ is sufficiently large, the above total utilization is a *left Riemann sum*, i.e., $M\sum_{i=0}^{M-1}\frac{\mu}{f+i \mu} \approx M\int_{0}^{1-f} \frac{1}{f+ x} dx= M\ln(\frac{1}{f})$. By the fact that $\ln(\frac{1}{f}) = \frac{f}{2}$, we know that the total utilization is $M\frac{f}{2}$ when $M$ is sufficiently large. Now, we examine $\max_{t > 0}\frac{\sum_{i=1}^{N} dbf(\tau_i, t)}{Mt}$. By definition, $\max_{t > 0}\frac{\sum_{i=1}^{N} dbf(\tau_i, t)}{Mt}> \max_{t > 0}\frac{\sum_{i=1}^{N-1} dbf(\tau_i, t)}{Mt}$. By the construction of the task set, we have (1) $\frac{\sum_{i=1}^{N-1} dbf(\tau_i, t)}{Mt} = 0$ if $0 < t < 1$, and (2) $\frac{\sum_{i=1}^{N-1} dbf(\tau_i, 1)}{M} = \frac{f}{2}$ if $t=1$. Therefore, we know that the speedup factor for this task set is purely dominated by $\max_{t > 0}\frac{\sum_{i=1}^{N-1} dbf(\tau_i, t)}{Mt}$. However, proving that $\frac{\sum_{i=1}^{N-1} dbf(\tau_i, t)}{Mt} \leq \frac{f}{2}$ if $t > 1$ is pretty complicated. The proof involves quite some mathematical derivations, and is left in Appendix A It should be clear that we can ignore the $M-1$ duplicated copies of the tasks by considering only the tasks assigned on one processor (before considering $\tau_N$). The complete proof is Appendix A The proof strategy first makes an over-approximation, denoted as $dbf^{\sharp}(t)$, of the sum $\sum_{\tau_i \in {\bf T}_m} dbf(\tau_i, t)$ of the demand bound functions at time $t$ (after removing the $M-1$ duplicated copies). Based on such an over-approximation, it can be shown that $\max_{t>0} \frac{dbf^{\sharp}(t)}{t}$ happens when $t$ is a positive integer for ${\bf T}_m$. It can then be proved that the maximum $\frac{dbf^{\sharp}(t)}{t}$ happens when $t=1$ or $t=\infty$, in which both leads $\frac{dbf^{\sharp}(t)}{t}$ to $\frac{f}{2}$. Figure \[fig:segment-curve\] draws the functions $dbf^{\sharp}(t)$ and $\frac{dbf^{\sharp}(t)}{t}$ in the range of $[1, 6]$. Figure \[fig:dbf-tight\] provides an illustrative view of $\frac{dbf^{\sharp}(t)}{t}$ from $t=1,2,\ldots, 4000$. It can also be easily shown by assigning $\tau_N$ to one processor alone, we can find a task partition that requires a speedup factor asymptotically equal to $\frac{2}{f}$ when $M$ is sufficiently large. \ \ Concluding Remarks {#sec:conclusion} ================== This paper provides detailed analysis for the deadline-monotonic partitioning algorithm proposed by Fisher, Baruah, and Baker [@DBLP:conf/ecrts/FisherBB06] for multiprocessor partitioned fixed-priority scheduling, by using exact schedulability tests and approximated schedulability tests. It may seem at first glance that using exact schedulability tests is more precise, but the proof shows that such exact tests are with the same speedup factors as approximated tests. We show that the deadline-monotonic partitioning algorithm has a speedup factor $3-\frac{1}{M}$ when considering task systems with arbitrary deadlines. Such a factor holds for polynomial-time schedulability tests and exponential-time schedulability tests. Moreover, we also improve the speedup factor to $2.84306$ when considering constrained-deadline task systems. The speedup factor analyses in this paper are asymptotically tight if the analysis is oblivious of the particular fitting strategy used. In all the tightness analyses, we only take Lemma \[lemma:lower-speed-bound\], which also implicitly implies the reference to optimal global scheduling. The tasks are designed on purpose, e.g., $M^2$ tasks (instead of $M$ tasks) with period $\infty$ in the proof of Theorem \[theorem:sporadic-constrained-tight1\], to show that such factors also hold (asymptotically or with minor changes) for optimal partitioned scheduling. However, this does not limit the potential to have better speedup factors by adopting better fixed-priority scheduling strategies or more precise analysis for concrete fitting strategies. [**Acknowledgements.**]{} This paper is supported by DFG, as part of the Collaborative Research Center SFB876 (http://sfb876.tu-dortmund.de/). [1]{} [^1]: That is, the tightness examples in Theorems \[theorem:sporadic-arbitrary-tight1\], \[theorem:sporadic-arbitrary-tight2\], and \[theorem:sporadic-constrained-tight1\] hold even when $\delta$ is $0$ if the tasks are indexed in the specified order. Setting $\delta$ to an arbitrarily small positive number is more precise mathematically, but this just complicates the presentation of the proofs without any added value. [^2]: These cases are concluded by the following trick: Suppose that $g_1(y)$ is an increasing function and $g_2(y)$ is a decreasing function with respect to $y$ when $y \geq 0$. Then, we know that the lower bound on $\max\{g_1(y), g_2(y)\}$ is the intersection of these two functions, i.e., $g_1(y^*)$, where $g_1(y^*)=g_2(y^*)$ if such a value $y^*$ exists. That is, $\max\{g_1(y), g_2(y)\} \geq \min_{y \geq 0}\max\{g_1(y), g_2(y)\}= g_1(y^*)$. | High | [
0.6622691292875991,
31.375,
16
] |
California Senator Kamala Harris announced in January that she would be running for president. But aside from being a United States Senator and a 2020 presidential candidate, she's also a stepmom to her husband Doug's children, Cole and Ella. In honor of Mother's Day, Sen. Harris writes about what it's like to be a stepmom—or, as her kids call her "Momala." When I met Doug, the man who would become my husband, I also met a man who was a divorced father of two children, Cole and Ella, named after John Coltrane and Ella Fitzgerald. As a child of divorce, I knew how hard it could be when your parents start to date other people. And I was determined not to insert myself in their lives until Doug and I had established we were in this for the long haul. Children need consistency; I didn’t want to insert myself into their lives as a temporary fixture because I didn’t want to disappoint them. There’s nothing worse than disappointing a child. So, we took it slow, and Doug and I put a lot of thought into when and how I would first meet the kids. And that meant waiting. As we waited, anticipation grew. When the day finally came, I had butterflies in my stomach. The plan was to go to a seafood hut off the Pacific Coast Highway called the Reel Inn, a favorite of the kids. On my way to meet Doug, I picked up a tin of cookies and tied a ribbon in a bow around them. I took a few deep breaths. I was excited, and I was nervous. I rehearsed what I would say. Would the kids think the cookies were really nice or really weird? Was the ribbon too much? (The ribbon was probably a little extra, but over the years Cole and Ella have spared me by not telling me that.) Harris with her stepson, Cole. Courtesy of Harris Cole and Ella could not have been more welcoming. They are brilliant, talented, funny kids who have grown to be remarkable adults. I was already hooked on Doug, but I believe it was Cole and Ella who reeled me in. To know Cole and Ella is to know that their mother Kerstin is an incredible mother. Kerstin and I hit it off ourselves and are dear friends. She and I became a duo of cheerleaders in the bleachers at Ella’s swim meets and basketball games, often to Ella’s embarrassment. We sometimes joke that our modern family is almost a little too functional. A few years later when Doug and I got married, Cole, Ella, and I agreed that we didn’t like the term “stepmom.” Instead they came up with the name “Momala.” Our time as a family is Sunday dinner. We come together, all of us around the table, and over time we’ve fallen into our roles. Cole sets the table and picks the music, Ella makes beautiful desserts, Doug acts as my sous-chef, and I cook. Harris with her stepdaughter, Ella. Courtesy of Harris Flash forward two years—and it truly felt like a flash—I was being sworn into the United States Senate. Cole had already graduated and was off at college, but Ella was just entering her senior year of high school in Los Angeles. This new job meant that I would be splitting time between California and Washington, D.C., and the hardest part was going to be being away from my Ella. I knew I was inevitably going to miss more than a few swim meets. And as you might guess, it ended up being more than swim meets. On June 8, 2017, FBI Director James Comey was asked to testify before the Senate Intelligence Committee about his firing and the Russia investigation. It was the same day as Ella’s high school graduation, a scheduling conflict that I was acutely aware of, but that the Senate Intelligence Committee—and for that matter the rest of the country—was not. “Our kids love us for who we are and the sacrifices we make.” I agonized over the scheduling conflict and ultimately took a deep breath and called Ella from D.C. She could not have been more understanding when I told her I wouldn't be able to make it back in time, but I still felt awful about it. I sought the advice of my female colleagues in the Senate. And it was Maggie Hassan, the senator from New Hampshire, who offered me some sage wisdom. “Our kids love us for who we are and the sacrifices we make,” she said. “They get it.” I believe you don’t have to be a U.S. Senator or a candidate for President of the United States for that to ring true. Time is precious, and so many of us understand the struggle to seek balance. Harris and her stepdaughter, Ella. Courtesy of Harris I ended up missing the graduation ceremony during the day but made it home in time for our time: Family dinner that night. And Maggie was right. Fortunately for me, both Ella and Cole do get it. They are my endless source of love and pure joy. I am so thankful to Doug, to Kerstin, and most of all, to Ella and Cole. And as our family embarks together on this new journey—one that has taken me to South Carolina, Iowa, New Hampshire, Ohio, Nevada, and Michigan in the last few weeks alone—I can say one thing with certainty, my heart wouldn’t be whole, nor my life full, without them. Kamala Harris Kamala Harris is a United States Senator from California. This content is created and maintained by a third party, and imported onto this page to help users provide their email addresses. You may be able to find more information about this and similar content at piano.io | Mid | [
0.55795677799607,
35.5,
28.125
] |
To See, or Not To See. Thinking about getting an eyeball tattoo? Well not in the state of Oklahoma you won’t. The recent fad of having the white of the eye tattooed has just been made illegal in the state of Oklahoma. The Oklahoma state Senate voted unanimously to ban tattooing of the eyeball, and I’ve little doubt that other states will soon follow suit. Sen. Cliff Brannan, (Oklahoma City Rep.), said scleral tattooing is a dangerous fad that can cause damage to the eye or even blindness. This public health issue was brought to the senate’s attention by several concerned ophthalmologists, and I have to applaud them for it. Now I’m not one for overly restrictive laws, especially where tattooing is involved, but it is just possible that the lawmakers may have something here. Almost every ophthalmologist who has taken a look at this new fad has had the same thing to say about it. Its dangerous. Take it from someone who has partially lost some of their sight. Any risk to your eyes is too much. No fad, or trend is worth losing your sight over. Ask any blind person what they would wish for if they had one wish and the answer will be, sight. | Low | [
0.518939393939393,
34.25,
31.75
] |
Designer Information Adam Lippes is loved for his elegant take on American sportswear. From impeccably tailored tops and track pants to sophisticated dresses, the New York-based designer offers luxe pieces for every occasion. Delivery & Returns Enter your postcode to see the options available You have 28 days to exchange or return your item. Plus, we'll come and collect from your home, work or alternate address. | Low | [
0.49632352941176405,
33.75,
34.25
] |
package org.myrobotlab.memory;
public interface MemoryChangeListener {
// public void onAdd(String parentPath, Node node);
public void onPut(String parentPath, Node node);
public void publish(String path, Node node);
}
| Low | [
0.536992840095465,
28.125,
24.25
] |
A blog about me, my Standard Poodle, Teddy, and whatever else I feel like including. "[Poodles] are Labradors with a college education. After a day of retrieving, your Lab wants to curl up and snore in front of the fire. A poodle wants to be a fourth at bridge and tell naughty stories." -Anne Rogers Clark Sunday, February 3, 2008 closes a door & OPENs A window They say when God closes a door, He opens a window. Well, that is the story of my weekend showing in open A obedience. Saturday, like most of our first trial days, was a disaster. The judge was nice and easy going. He joked with me that he takes 10 points off for those who wear the same colored pants as their dog. Everything that could go wrong, did. I won't embarass myself by posting the video, but the bright spots were that our heeling is improving and Teddy did his sit and down stays. Besides that, I learned some valuable lessons. Proof for noises on the drop on recall. His drop was slow and almost complete when a dog barked and people applauded loudly. This made an already nervous dog panic, and he walked in to me before I was allowed to call him. At least this gives me something I can practice. Don't groom your dog the day before a trial. I should know this by now, but I was not thinking properly when I made the appointment. They shaved Teddy's tail a little too close, giving him a bit of razor burn. This suddenly bothered him on the retrieve on the flat. He ran out after the dumbbell quickly, but on the way back, he acted like something bit him on the tail. He dropped the dumbbell to check out what got him, but he did pick it back up and came in nicely. Work attention and distractions on the retrieve over the high jump. Although it should not matter, we were doing our retrieves toward the adjacent ring. This is how we practice at our training center, but it does provide an extra set of distractions. Teddy ran out quickly and took the jump, however, his pick up was slow, and his ring nerves got him again. He dropped the dumbbell to sniff a spot on the mat, then picked it back up and forgot what he was doing. I had to call him back over the jump. Ack! I know he knows this exercise, but we have work to do. Oh the dreaded broad jump! For some reason, Teddy lost all confidence in his ability to do the broad jump in the last week or so. I don't know why this happened all of the sudden, but it did. We've been working diligently on it. I've had him jump it over and over, chasing toys, and for jackpots. I think part of the problem is where the judge stands. So, I need to get many different people standing in different places around the broad jump. Anyway, on Saturday, when I left him in front of the jump, he was unsure and stood up, and I had to give him an extra command to jump, then he auto finished. So, there are the ugly details. On top of that, I came down with a terrible cough on Saturday, the kind that burns in your lungs. We were fortunate to show early, so that we could come home and get a lot of rest that night. I doped up on cough medicine and watched the Eukanuba dog show. I wasn't sure that I would be able to get up the next morning and drive to the show, and I would not have, had we had an early ring time. I'm so glad that we did make it, although I was coughing so much that I was not sure that I could give a verbal command. I kept popping cough drops to get me through. Our heeling was not quite as good as the day before, but again, I'm just glad to see Teddy trying. It's nice when we go from losing 15-16 points on heeling last year to losing 4-8 points. We are finally making progress. He usually does better the second day of a trial, and he did not break tradition this weekend. We made it through all of the exercises nicely, without second commands or too much distraction. I'm so glad I video these runs because it really helps me see why some things happen and what we need to work on. We lost the most points on, surprise, the broad jump. He took the jump, which made me very happy, but he sniffed the mat and did an auto finish. So that brought us our second open leg with a so-so score of 182.5 and a fourth place. I was worried when I saw that there were more than 4 qualifiers, but we still pulled off a placement. Yea! Here's the whole thing, minus the stays: Two down, one more to go. It is difficult to get comfortable in the ring when we have so few shows and/or matches in our area. The last trial that we entered was the first weekend in October, so I guess it is just natural for us to be so rusty getting back into the ring. However, you should have seen us at this same trial one year ago when Teddy did zoomies in the ring and tried to run out. I kind of felt like we redeemed ourselves. I'm so grateful for the people who stayed to watch and cheer for us, and maybe even entertain Teddy on his sit-stay. :) Anyway, got to get to bed to get up early to go to the doctor. 6 comments: Great job! I noticed you did the heeling into position with him, and I think it's helping with his set up! I think it helped his BJ as well. You are gaining so much confidence. I am so proud of you. I wish we could have been there to cheer you guys on! Thanks! Wish you guys could have been there, too. I do think heeling in is helping. The only problem was that we were second in the ring, so I had to warm Teddy up and did not get to see the heeling pattern or where we were doing what. For example, she wanted us to start heeling on the cross mat, so we were too far forward, and that's why we had to back up at the start. I'm sure you could tell, I had no idea where we were supposed to do the figure 8! Our heeling was actually better on Saturday (hard to believe). It's a miracle that we qualified at all- on the video, notice that when I threw the DB over the jump, Teddy looked completely behind us and didn't see the throw! Thanks again! You and Teddy have made incredible strides since you started! Sometimes, when it all goes poorly at a trial, it's hard to recall just how far you have come. I am just learning about proofing for noise.....and we only just started Rally class 3 weeks ago. This week, Willie was really, really focused and doing terrific, and then a big dog started barking very close to us. it was nearly our undoing, so i was happy that he was able to regain his concentration. | Low | [
0.492537313432835,
28.875,
29.75
] |
Q: Creating a Buzzer System using python We are having a holiday party at work, and are trying to set up a Family Feud game. With that, I'm trying to program a buzzer system. I am very new to pygame so maybe there is a better approach to what I'm trying to do. I've written the following code which works to some degree. Right now, it recognizes the button and displays the picture as it should; however, it is recognizing all button presses where I only want it to recognize the first until after it is reset. For example, the left side buzzes in first, I want their picture to be displayed - then if the right team buzzes in after, I want that button to be ignored. Then if a third (reset) button is pushed, it resets back to the beginning to begin tracking for the first button pushed again. Any help would be greatly appreciated! import pygame import pdcurses #import RPi.GPIO as GPIO import image import time import clock from pygame import mixer from pygame.locals import * displayWidth = 1600 displayHeight = 1200 pygame.init() #mixer.init() #pygame.display.init() screen = pygame.display.set_mode((displayWidth, displayHeight)) pygame.display.set_caption('Family Feud') pygame.display.update() def reset(): global screen kids = pygame.image.load("kids.jpg") screen.blit(kids, (0,0)) pygame.display.update() gameExit = False while not gameExit: for event in pygame.event.get(): if event.type == KEYDOWN: if event.key == K_LEFT: leftBuzzer = pygame.image.load("ice cream.jpg") screen.blit(leftBuzzer,(0,0)) pygame.display.update() if event.key == K_RIGHT: rightBuzzer = pygame.image.load("snowman.jpg") screen.blit(rightBuzzer,(0,0)) pygame.display.update() if event.key == K_q: pygame.quit() if event.key == K_r: reset() A: You could add an alreadyPressed boolean and for each buzzer press have an if statement check alreadyPressed before displaying anything. | Mid | [
0.617647058823529,
36.75,
22.75
] |
Native amorphous nanoheterogeneity in gallium germanosilicates as a tool for driving Ga2O3 nanocrystal formation in glass for optical devices. Nanoparticles in amorphous oxides are a powerful tool for embedding a wide range of functions in optical glasses, which are still the best solutions in several applications in the ever growing field of photonics. However, the control of the nanoparticle size inside the host material is often a challenging task, even more challenging when detrimental effects on light transmittance have to be avoided. Here we show how the process of phase separation and subsequent nanocrystallization of a Ga-oxide phase can be controlled in germanosilicates - prototypal systems in optical telecommunications - starting from a Ga-modified glass composition designed to favour uniform liquid-liquid phase separation in the melt. Small angle neutron scattering data demonstrate that nanosized structuring occurs in the amorphous as-quenched glass and gives rise to initially smaller nanoparticles, by heating, as in a secondary phase separation. By further heating, the nanophase evolves with an increase of nanoparticle gyration radius, from a few nm to a saturation value of about 10 nm, through an initial growing process followed by an Ostwald ripening mechanism. Nanoparticles finally crystallize, as indicated by transmission electron microscopy and X-ray diffraction, as γ-Ga(2)O(3)- a metastable gallium oxide polymorph. Infrared reflectance and photoluminescence, together with the optical absorption of Ni ions used as a probe, give an indication of the underlying interrelated processes of the structural change in the glass and in the segregated phase. As a result, our data give for the first time a rationale for designing Ga-modified germanosilicates at the nanoscale, with the perspective of a detailed nanostructuring control. | High | [
0.6900000000000001,
34.5,
15.5
] |
<?xml version="1.0" encoding="utf-8"?>
<selector xmlns:android="http://schemas.android.com/apk/res/android">
<item android:drawable="@drawable/progress_thumb" android:state_pressed="true"/>
<item android:drawable="@drawable/progress_thumb_pressed"/>
</selector> | Low | [
0.24528301886792403,
8.125,
25
] |
Eco Friendly Partners Our Location Arrange Flexible End of Tenancy Cleaning in Chiswick Guarantee that your deposit will be returned by picking our end of tenancy cleaning service in Chiswick. This type of cleaning is always required when you move out of a rented property, and your landlord will insist that the property is perfectly clean upon your departure. Hire us and you’ll get cleaners who know their responsibility and won’t rest until they’ve cleaned every nook and cranny in your soon to be former home. You can connect with our customer service team whenever you like since we keep our hotlines open at all times – get dialling! We Provide Affordable and Comprehensive Move Out Cleaning Get a service that’s: Suitable – it doesn’t matter whether you’re a tenant, landlord, agency or just someone who’s looking to buy or sell a property, you’ll get the benefit of our expertise Flexible – schedule both morning and afternoon appointments 7 days a week Immediate – same-day services are available upon request Thorough – your move out cleaning session isn’t limited in time, so our cleaners won’t leave until the job is completed Inclusive – you don’t need to provide any equipment and won’t pay a penny extra for the gear we bring Want to save some money? Combine this service with another such as our removals services or rubbish removals. Understand Your End of Tenancy Cleaners in Chiswick Prior to our arrival please make sure that the property is free of all your personal belongings, and that any fridges and freezers have been turned off for at least 24 hours. Access to running water and electricity must be readily available as well. Also, be aware that only a one-off service can be carried out if you or someone else is still living at the property. Our end of tenancy cleaners in Chiswick will begin by moving systematically throughout every room of your property. Woodwork will be dusted, mirrors shined and tables wiped down. Particular attention will be paid to the bathroom and kitchen – are the oven and shower dirty? Don’t worry – they’ll be taken care of. Upon completion of your service you’ll be asked to give your thoughts on the results of our efforts. Remember that once we’ve gone there is a 48 hour period in which you can call us back to perform a FREE re-clean. You’ll get a truly top-to-bottom clean from us! When We’re Your End of Tenancy Cleaning Company: You’ll be treated with respect and consideration at all times. This is your service and don’t hesitate to tell our certified professionals of any areas in the property that you think need extra attention. You’ll benefit from our large arsenal that includes a vacuum cleaner, special degreasers, disinfectants and toilet cleaner. Tenancy cleaning services are easy to arrange – just call us on 020 3404 1366. Otherwise input your information in the contact form on our website to receive an instant free quote, or speak to us online via the chat facility. | Mid | [
0.604347826086956,
34.75,
22.75
] |
This Saturday, the hosts of Discovery’s MythBusters show will tackle one of gaming’s most iconic franchises in a special DOOM-themed episode. In this wonderfully geeky special, Adam and Jamie will team up with id Software’s Tim Willits to answer a question that’s been on the mind of every shooter fan at one point or another: “Is it really possible for someone to carry all those health packs, guns, and even a chainsaw?” I’ve ask myself this question every day, but I have yet to come up with an answer. I’m sure they’ll have better luck, especially since they’ll be pulling out the, uh, big guns for this episode. They’re even going to recreate an entire DOOM level, because science. Once they’ve finished answering this question, maybe they can find out when that next DOOM game is coming. That answer would make a lot of gamers happy. The special airs on Discovery on Saturday, January 31st at 9/8c. | Mid | [
0.6479481641468681,
37.5,
20.375
] |
Chemical inhibitors suggest endophytic fungal paclitaxel is derived from both mevalonate and non-mevalonate-like pathways. Taxus trees possess fungal endophytes reported to produce paclitaxel. Inhibitors that block early steps in plant paclitaxel biosynthesis were applied to a paclitaxel-producing fungus to determine whether these steps are shared. The plant paclitaxel backbone is reportedly derived from the non-mevalonate terpenoid pathway, while the side chain is phenylalanine-derived. Evidence that the shikimate pathway contributes to fungal paclitaxel was shown by decreased paclitaxel accumulation following inhibition of phenylalanine ammonia lyase. Expression of another shikimate pathway enzyme, 3-dehydroquinate synthase, coincided with paclitaxel production. The importance of the mevalonate pathway in fungal paclitaxel biosynthesis was shown by inhibition of fungal paclitaxel accumulation using compactin, a specific inhibitor of 3-hydroxy-3-methyl-glutaryl-CoA reductase. Expression of another mevalonate pathway enzyme, 3-hydroxy-3-methyl-glutaryl-CoA synthase, coincided with fungal paclitaxel accumulation. Unexpectedly, results from using fosmidomycin suggested that fungal paclitaxel requires 1-deoxy-D-xylulose-5-phosphate reductoisomerase (DXR), an enzyme in the 2-C-methyl-D-erythritol-4-phosphate (MEP) pathway normally found in bacteria/plants. Additional lines of evidence support this finding; first, a plant DXR antibody recognized a fungal peptide of the correct size; second, expression of an apparent fungal DXR ortholog correlated to changes in paclitaxel production; finally, BLAST searching identified a gene putatively encoding 1-deoxy-D-xylulose-5-phosphate synthase, the first enzyme in the MEP pathway in Aspergillus. | High | [
0.6616161616161611,
32.75,
16.75
] |
174 N.W.2d 372 (1970) David BANGS, Appellant, v. Hillary G. KEIFER, Appellee. No. 53854. Supreme Court of Iowa. February 10, 1970. Rehearing Denied April 6, 1970. *373 Alfred A. Beardmore and T. A. Beardmore, Charles City, for appellant. Larson & Carr, Charles City, for appellee. LARSON, Justice. The plaintiff David Bangs brought this action at law for damages as a result of an accident at a street intersection in Charles City, Iowa, on March 11, 1967. When defendant's automobile, driven with his consent by his son, failed to slow or stop before entering this stop intersection, it struck the left rear of plaintiff's automobile. Defendant pleaded legal excuse, claiming that the accelerator on his automobile unexpectedly stuck as it approached the intersection and that reasonable efforts to remedy the situation failed. Although plaintiff objected to any instruction on legal excuse, and particularly the one proposed by the court, Instruction No. 13 was given and the jury returned a verdict for defendant. Plaintiff appealed. We affirm. Errors relied on for reversal are: (1) The court erred in submitting an instruction on legal excuse when as a matter of law the defendant's evidence showed that it was reasonably practicable for the defendant's driver to avoid violating the statutes. (2) The court erred in giving Instruction No. 13, the legal excuse instruction, in that it failed to instruct the jury that a legal excuse must be something that made it reasonably impracticable for the defendant's driver to comply with the statute or statutes, and merely instructed it that if the defendant's driver acted as a reasonably prudent man under the circumstances he would not be negligent. I. There is no substantial dispute in the evidence. Defendant's driver admitted that he did not stop at the stop sign before entering the intersection, that he entered it at an unlawful speed of approximately 40 miles per hour, and that his car struck plaintiff's vehicle while in the intersection. His testimony, corroborated by two of his passengers, was that as he approached the intersection when about half a block or 138½ feet therefrom, he discovered that his accelerator was stuck. It also appeared when he entered that block his speed was about 15 miles per hour. At first he accelerated his speed, but as he approached the intersection and let up on the accelerator, there was no response. At this time his speed had increased to about 30 miles per hour and a light application of his brakes did not help. Concluding that his accelerator was stuck, he attempted to free it by kicking and jiggling it, but to no avail. He then discovered plaintiff's vehicle, applied his brakes hard, sliding all four of his wheels, but this did not slow his car sufficiently to avoid the collision. On cross-examination defendant's driver admitted if he had thrown the car out of gear when he first discovered the stuck accelerator, or if he had at that time turned off the ignition, the brakes would have stopped his car before it entered the intersection. His passengers were not quite so sure. At any rate he did not attempt those *374 remedies, asserting he did not have the additional time to do so. Appellant argues that, because of the driver's admission of several statutory violations, plus his statement that there was something he could have done to avoid the collision besides trying to free the accelerator, he was not entitled to a legal excuse instruction. Appellee argues that from this record it appears defendant's driver had less than two seconds to act in the best and most effective way to avoid violating these statutory mandates, that although perhaps hindsight is better than foresight, it is clear the driver was faced with an emergency not of his own making, and that this is a classic example of the reasonable and proper application to our heretofore-recognized and adhered-to legal excuse doctrine. II. Legal excuse, we have said, is a doctrine by which one seeks to avoid the consequences of one's conduct by showing justification for acts which would otherwise be considered negligent. Gibbs v. Wilmeth, Iowa, 157 N.W.2d 93, 96. This doctrine has been considered and applied by our court many times. As a result of our leading case of Kisling v. Thierman, 214 Iowa 911, 916, 243 N.W. 552, 554, legal excuse has been defined to mean (1) anything that would make it impossible to comply with the statute or ordinance; (2) anything over which the driver has no control which places his car in a position contrary to the provisions of the statute or ordinance; (3) where the driver of the car is confronted by an emergency not of his own making and, by reason thereof, he fails to obey the statute; (4) where a statute specifically provides an excuse or exception. Baker v. Wolfe, Iowa, 164 N.W.2d 835, 838; Pinckney v. Watkinson, 254 Iowa 144, 116 N.W.2d 258; Oakes v. Peter Pan Bakers, Inc., 258 Iowa 447, 138 N.W.2d 93, 10 A.L.R.3d 247; Peters v. Rieck, 257 Iowa 12, 131 N.W.2d 529; McCoy v. Miller, 257 Iowa 1151, 136 N.W.2d 332; Gibbs v. Wilmeth, supra ; Yost v. Miner, Iowa, 163 N.W.2d 557; Clubb v. Osborn, 256 Iowa 1154, 130 N.W.2d 648; Winter v. Moore, 255 Iowa 1, 121 N.W.2d 82; McKeever v. Batcheler, 219 Iowa 93, 257 N.W. 567; 7 Am.Jur.2d, Automobiles and Highway Traffic, § 359, pp. 905, 906; Iowa State Bar Association's Uniform Jury Instruction No. 5.7, Legal Excuse. A violation of statutory rules of the road or ordinances, of course, constitutes negligence per se, and to excuse such a violation the emergency must not have been caused or contributed to by the one claiming legal excuse. Gibbs v. Wilmeth, supra, and citations ; Florke v. Peterson, 245 Iowa 1031, 1034, 65 N.W.2d 372, 373; Winter v. Moore, supra. III. An emergency has been defined as (1) an unforeseen combination of circumstances which calls for immediate action; (2) a perplexing contingency or complication of circumstances; (3) a sudden or unexpected occasion for action, exigency, pressing necessity. Oakes v. Peter Pan Bakers, Inc., supra, 258 Iowa 447, 458, 138 N.W.2d 93, 100, 10 A.L.R.3d 247; Young v. Hendricks, 226 Iowa 211, 215, 283 N.W. 895, 898; Harris v. Clark, 251 Iowa 807, 810, 103 N.W.2d 215, 217; Yost v. Miner, supra ; Band v. Reinke, 227 Iowa 458, 288 N.W. 629; Jakeway v. Allen, 227 Iowa 1182, 290 N.W. 507; Noland v. Kyar, 228 Iowa 1006, 292 N.W. 810; Fagen Elevator v. Pfiester, 244 Iowa 633, 56 N.W.2d 577; Iowa Uniform Jury Instruction No. 5.4, Sudden Emergency. The extent and nature of an emergency is usually a fact question and, if there is substantial evidence that an emergency had developed, the jury should be instructed thereon. Yost v. Miner, supra, Iowa, 163 N.W.2d 557, 562. IV. Appellant's first contention poses the question of whether, in the case of a sudden emergency resulting in a statutory violation, the driver of a motor vehicle must be found negligent as a matter of law unless he can show by a preponderance *375 of the evidence that he comes within all three of the categories recognized in Kisling v. Thierman, supra, 214 Iowa 911, 243 N.W. 552, or under the exception in the fourth category. We have not so construed this law. The claimant may choose his category. Florke v. Peterson, supra; 245 Iowa 1031, 65 N.W.2d 372. Appellant's principal contention, however, is that, in order to excuse a violation of a statutory rule of the road constituting negligence per se which resulted from an emergency not of his own making, one must establish that he could do nothing "practicable" that would have avoided the violation and that the action of a reasonably prudent man in such an emergency would not be a proper issue for jury determination. We cannot agree. We have never adopted the "practicable" approach to this problem, but have always adhered to the reasonably-prudent-man test to determine whether one acted properly in an emergency not created or contributed to by him. We have always permitted a jury to find compliance with the statute or statutes involved was impossible if he acted as a reasonably prudent man in his attempt to avoid the violation. Since to adopt the "practicable" approach here would compel a finding of negligence as a matter of law, we decline to do so. We have consistently held, when one has not caused or contributed to the emergency facing him, he is not negligent for statutory violations if the jury finds he acted as a reasonably prudent person placed in that circumstance. In any event, in the matter before us it is not seriously claimed that the emergency facing defendant's driver was caused or contributed to by him, nor was it something over which the driver had control which placed his car in a position contrary to the provisions of a statute or ordinance. It is clear that the statutes involved did not themselves specifically provide an excuse or exception so that this claim of legal excuse must be based upon the first category, which would be anything that would make it impossible to comply with the statute or ordinance. The question of whether it was possible or impossible is generally one for the jury under proper instructions from the court. We can think of no better instructional guideline than that the acts must be those of a reasonably prudent man faced with that emergency, and hold, if we are to recognize and apply a legal excuse doctrine, it is the just and fair method to determine that fact. Appellant relies heavily upon the case of Bush v. Harvey Transfer Co., 146 Ohio St. 657, 664, 665, 67 N.E.2d 851, 855, 856, which appears to reject the so-called common-law rule of reasonable care under the circumstances in cases involving legal excuse for violation of safety statutes. It is true, the Ohio Supreme Court said therein: "Since the failure to comply with * * * a safety statute constitutes negligence per se, a party guilty * * * cannot excuse himself * * * by showing that `he did or attempted to do what any reasonably prudent person would have done under * * * similar circumstances.' A legal excuse * * * must be something that would make it impossible to comply with the statute * * *." Standing alone, that showing may not be sufficient, but when coupled with a showing that the emergency was not due to claimant's fault, we believe legal excuse may be established. We considered the Ohio position in Florke v. Peterson, supra, and adopted it only so far as it related to cases where the person claiming the legal excuse did in fact cause the emergency, and then denied him the right to show that his acts in creating and seeking to avoid the violation were those of a reasonably prudent person. That is not the case at hand, and we cannot agree that it is the burden of a driver innocent of any fault in creating the emergency to also show he did everything practicable to avoid the statutory violation under that circumstance. In Florke v. Peterson, supra, we said at page 1036 of 245 Iowa, page 375 of 65 N.W.2d: "Plaintiff must base his *376 claim of `legal excuse' upon some one of the four categories already enumerated * * *." (Emphasis supplied.) In that case the court found plaintiff selected the first category, that the conditions were such as to make compliance with the statute impossible. In denying the application of legal excuse there it was held that, even viewing the evidence in a light most favorable to plaintiff, the so-called emergency was partially caused by plaintiff's failure to observe the T-intersection ahead and that in such instance the common-law rule of reasonable care or the care which a reasonably prudent man would exercise under those circumstances was not applicable. A careful review of the cases cited in Florke v. Peterson, supra, indicate those pronouncements relate to an attempted excuse of one not free from fault in creating the emergency. In other words, the claimant attempted to excuse his act in creating the emergency by showing that he acted as a reasonably prudent man in that situation. It seems to us there is quite a difference between that situation and this case where the emergency is created without fault of the operator. We have said that one whose own negligence has caused or contributed to a situation which makes it impossible for him to obey the law may not rely upon such conduct as a basis for invoking the legal excuse doctrine. Whether one has established a legal excuse is usually, but not invariably, a jury question. Gibbs v. Wilmeth, supra, Iowa, 157 N.W.2d 93, 96. We held, under the circumstances there presented, it was properly submitted. V. In its Instruction No. 13 the court here told the jury: "The defendant claims that if it is found that Dennis Keifer violated a statute or statutes as set out in plaintiff's specifications of negligence 2, 3, and 4 in Instruction No. 1 hereof and as explained to you in Instructions 10, 11, and 12, that Dennis Keifer had a legal excuse for so doing and was therefore not negligent. "You are instructed that the burden of proof is upon the defendant to establish the defense of legal excuse by the greater weight or preponderance of the evidence. "By `legal excuse' is meant that one who violates a statutory rule of the road may relieve himself from liability for damages arising from such violation by showing that he had a legal excuse for such violation. "One such legal excuse is when the driver is confronted with an emergency not of his own making and by reason thereof fails to obey the statute or statutes. "When one is confronted with a sudden emergency, not brought about by his own fault, and because thereof is required to act upon the impulse of the moment without sufficient time to determine with certainty the best course to pursue, he is not held to the same accuracy of judgment as would be required of him if he had time for deliberation. Under such circumstances he is required to act only as an ordinarily, careful and prudent person would act when suddenly placed in a similar position, and if he so acts he is not liable for injury or damage resulting from his conduct. "As applied to this case, if you find that Dennis Keifer in the operation of his motor vehicle at said time and place violated a statute or statutes, and that because the accelerator stuck on the car he was driving so that he was confronted with a sudden emergency and he could do nothing to prevent violating the statute or statutes, then a legal excuse for violating such statute or statutes has been established and Dennis Keifer would not be negligent for violating the particular statute or statutes involved. "If, however, you find from the evidence that Dennis Keifer after learning that the accelerator had stuck failed to act as a reasonable and prudent person under the circumstances, then the sticking of the accelerator would not be a legal excuse, and if you find he did violate a statute or statutes, such violation would be negligence." *377 The Iowa Uniform Jury Instruction on Sudden Emergency, No. 5.4, states: "When one is confronted with a sudden emergency, not brought about by his own fault, and because thereof is required to act upon the impulse of the moment without sufficient time to determine with certainty the best course to pursue, he is not held to the same accuracy of judgment as would be required of him if he had time for deliberation. Under such circumstances he is required to act only as an ordinarily careful and prudent person would act when suddenly placed in a similar position, and if he so acts he is not liable for injury or damage resulting from his conduct." The Iowa Uniform Jury Instruction on Legal Excuse, No. 5.7, states: "The defendant claims that if it is found that he violated a statute or ordinance in the operation of his motor vehicle, that he had a legal excuse for doing so and was, therefore, not negligent. You are instructed that the burden of proof is upon the defendant to establish a legal excuse by a preponderance of the evidence. "By the term `legal excuse' is meant: "1. Anything that would make it impossible to comply with the statute or ordinance. "2. Anything over which the driver has no control which places his car in a position contrary to the provisions of the statute or ordinance. "3. When the driver is confronted by an emergency not of his own making, and by reason thereof he fails to obey the statute. "4. Where the statute specifically provides an excuse or exception. "If you find that the defendant has violated a statute or ordinance, as submitted to you in other instructions, and that he has established a legal excuse for doing so under any one of the four definitions given to you in this instruction, then you should find the defendant not negligent for violating the particular statute or ordinance involved." In the case at bar it is apparent the trial court combined Iowa Uniform Jury Instructions Nos. 5.4 and 5.7 in its Instruction No. 13 and fairly and sufficiently advised the jury as to the law in this jurisdiction. In an abundance of caution Instruction No. 13A told the jury that, if it found this driver was driving at a speed in excess of the statutory speed when the accelerator stuck, he could not excuse the violation. In such instance there would be contributing fault of the driver, but the jury apparently found such was not the case here. We are satisfied the trial court did not err in giving Instruction No. 13, that to be entitled to an instruction on legal excuse the claimant must show by a preponderance of the evidence that he comes under at least one of the four categories listed in Kisling v. Thierman, supra, 214 Iowa 911, 243 N.W. 552, that he did not cause or contribute to the emergency to avoid negligence for a statutory violation, and that after this emergency arose he acted as a reasonably prudent person to avoid the violation. We are also satisfied the "practicable" approach used in some jurisdictions is too severe and places too heavy a burden on one innocent of fault to do the best thing to avoid the violation under a penalty of being found negligent as a matter of law. Here, for instance, defendant's driver's opinion after the accident that he could have avoided the statutory violations by turning off the ignition or throwing the car out of gear should not be conclusive of his failure to do that which, to a reasonably prudent person, would seem best to avoid the statutory requirement. He should be held to no greater standard of care under that situation. VI. A brief review of the following cases indicates our past consideration of *378 these questions and this court's application of the legal excuse doctrine. In the recent case of Yost v. Miner, supra, Iowa, 163 N.W.2d 557, 562, 563, plaintiff collided with defendant on defendant's side of the road, but claimed legal excuse because just prior to the accident it was defendant who was allegedly traveling in the wrong lane. In holding plaintiff's requested instruction on legal excuse should have been given, we said: "* * * if a sudden emergency did confront him, then his duty would have been to exercise only the care of an ordinarily careful and prudent person when suddenly confronted by a like emergency when placed in a similar position. * * * `the nature and extent of an emergency is usually a fact question and if the party urging the existence of "sudden emergency" sustains his contention by substantial evidence that such an emergency had developed * * *, the jury should be instructed thereon. (Citations.)'" In Winter v. Moore, supra, 255 Iowa 1, 4, 121 N.W.2d 82, 83, we reiterated our view that for a sudden emergency to be an excuse for a motorist's violation of a statutory rule, it must not have been of his own making. Therein we found an instruction on sudden emergency was error where defendant turned into the left lane to pass a truck when her vision was obstructed by an automobile passing a second truck and she was unable to see an approaching car in time to avoid a collision. In Gibbs v. Wilmeth, supra, Iowa, 157 N.W.2d 93, 96, we found defective a jury instruction which did not adequately advise the jury of one of the essential elements to establish sudden emergency as legal excuse, i. e., absence of fault by the one who invokes it. Therein we stated: "It is, of course, well settled that one whose own negligence has caused or contributed to a situation which makes it impossible for him to obey the law may not rely upon such conduct as a basis for invoking the doctrine. (Citations.) Whether one has established a legal excuse is usually, but not invariably, a jury question. In considering this matter the evidence is to be viewed in the light most favorable to the one asserting the existence of legal excuse. (Citations.)" The case of Oakes v. Peter Pan Bakers, Inc., supra, 258 Iowa 447, 457, 458, 138 N.W.2d 93, 100, 10 A.L.R.3d 247, involved the collision of six motor vehicles in a snow storm. In upholding a verdict for defendants who had pleaded sudden emergency, we stated: "To constitute a legal excuse for violation of a statute, of course an emergency must not be of the driver's own making. (Citations.)" After stating the various definitions of an emergency, we said the question of whether one was without fault in bringing about an emergency generally is for the jury. In Peters v. Rieck, supra, 257 Iowa 12, 20, 131 N.W.2d 529, 533, plaintiff was stopped at a stop sign when struck from the rear by defendant's truck. Defendant stated he was about 15 to 20 feet from the rear of plaintiff's truck when his brakes suddenly failed. The emergency brake was working, but he did not have time to use it or do anything between the time of the failure of the brakes and the impact. We upheld a jury verdict for defendant and found that the following jury instruction sufficiently informed the jury on the matter of legal excuse: "If you find that the driver * * * was faced with an emergency not of his own making and because thereof was required to act upon the impulse of the moment without sufficient time to determine with certainty the best course to pursue, he is not to be held to the same accuracy of judgment as would be required of him if he had had time for deliberation, and under such circumstances he was required to act only as an ordinarily careful and prudent person would act when suddenly placed in a similar position, and if you find that he did so act, then you may find that the defense of sudden emergency is available to him as applied to any failure on his part to take measures to avoid the collision *379 after he found that his brakes had failed to work." A similar instruction was approved in Pinckney v. Watkinson, supra, 254 Iowa 144, 150, 116 N.W.2d 258, 261, and we held it was a proper matter of determination for the jury. In that case defendant came over a knoll in the road and had only three seconds to avoid plaintiff's car, which was stopped partially on the highway, with a car approaching in the other lane. The jury there was told: "* * * Accordingly, if you find that the defendant * * * was confronted by an emergency not of his own creation, and if he exercised such care as an ordinarily reasonable, prudent and cautious man would exercise when suddenly confronted by a like emergency, and placed in similar circumstances, he is not guilty of negligence because of the result, even though another course of conduct might have been more judicious or more safe or might have avoided the accident." In Wachter v. McCuen, 250 Iowa 820, 96 N.W.2d 597, plaintiff found his passage to the left was blocked by defendant's truck moving down the road in the same direction, and he commenced to pass on the right as defendant pulled back over. We found therein that plaintiff's failure to obey the ordinance was negligence per se and he could not claim legal excuse for his violation where it appears, if he had slowed his speed, he would have found the truck returning to the right side, and the emergency which arose was at least in part created by the motorist. In McKeever v. Batcheler, supra, 219 Iowa 93, 95-96, 257 N.W. 567, 568, in dealing with the term "sudden emergency" under a revealed circumstance, we quoted with approval from 45 C.J. 710, § 92, saying: "* * * `where one is confronted with a sudden emergency, without sufficient time to determine with certainty the best course to pursue, he is not held to the same accuracy of judgment as would be required of him if he had time for deliberation. * * * Accordingly, if he exercises such care as an ordinarily prudent man would exercise when confronted by a like emergency, he is not liable for an injury which has resulted from his conduct, even though another course of conduct would have been more judicious or safer or might even have avoided the injury, * * *.'" VII. From the foregoing it appears a reversal of the judgment in this case would require a departure from our past pronouncements regarding the application of the "legal excuse" doctrine. We decline to do so and affirm the judgment rendered herein. Affirmed. MOORE, C. J., and SNELL, STUART, LeGRAND and REES, JJ., concur. MASON, J., takes no part. RAWLINGS and BECKER, JJ., dissent. | Mid | [
0.588377723970944,
30.375,
21.25
] |
Why choose Non Toxic Anti Aging Serums? Serum can be defined as both as a moisturizer and not a moisturizer. Serums is full of active ingredients that helps the skin retain moisture. But the skin serums are more lighter in context and are easily absorbable than moisturizers. The Serums are best used after cleansing the face. Serum is generally water based liquid and they easily penetrate through the skin and keeps the skin moisturized throughout the day. Why to choose natural non toxic products? Many of the chemical based skincare products nowadays contain parabens and phthalates which are equally harmful for the skin. Phthalates are carcinogenic substances and are responsible for problems in the reproductive system of both males and females. Besides, phthalates as a substance is so harsh that it is used in the softening of plastic. Parabens, on the other hand, though resists the formation of bacteria on yeast, but is quite harmful to the human skin type. Equally carcinogenic in nature just like the phthalates, parabens can cause breast cancer in young people. Non Toxic Anti Aging Serums It is really hard to find skincare products, especially serum, that could fit these criterion. And as everyone knows, there certainly are some areas of skincare where natural or organic alternatives are very hard to find. Majority of the serums seem to be loaded with parabens and artificial dyes and synthetic fragrances, that could take care of the big guns such as the hideous neck wrinkles that could appear any day and wreck the look. The non toxic anti aging serums are mainly natural oil based products that are completely devoid of parabens, phthalates, artificial dyes and most importantly synthetic fragrances. Therefore, without the hint of doubt in mind, one can pronounce all the natural serums as healthy, non-toxic, and non-irritating. And as it’s “natural” it is also “safe”. The Aftermath of using Non Toxic Natural Serums? This Skincare commentary is about how using Natural Serums will leave you with people complimenting about your skin and asking whether you got a very pricey facial anytime soon! The skin around the neck and face feels smoother and firmer. You will also feel astonished to find that you will need lesser moisturizer and even in winter. Even using the serum with natural oils could help you prevent the winter tightness and flakiness. It is true that most of the non toxic anti aging serums do not come in cheap, but they are packed in such a way that a single bottle lasts at least five to six months, which makes them economical. | High | [
0.669902912621359,
34.5,
17
] |
When the Pittsburgh Steelers square off against the Philadelphia Eagles on Sunday they will be doing so for the 78th time. 78 times the two greatest cities in Pennsylvania (Sorry, Harrisburg) will battle for NFL supremacy and bragging rights for their respected fanbases over the next four years. Pittsburgh Steelers-Philadelphia Eagles: The Battle for the Commonwealth Steelers-Eagles is much more than just a “football game” in Pennsylvania. For 60 minutes on Sunday it pits family against family, Broad Street against South Side, Cheesesteaks against Primanti Brothers and Broad Street Bullies against Yinzers. The Rivalry The Philadelphia Eagles hold an all-time record of 46-28-3 against the Pittsburgh Steelers. The rivalry dates back to the 1933 season when both franchises entered the National Football League (Pittsburgh as the Pittsburgh Pirates). More recently, the two Pennsylvania franchises have faced each other every four years since 2000, with each team winning two games apiece. Over those four previous meetings the Steelers have outscored the Eagles 72-58, but three out of the four games have been decided by ten points or fewer. Even though the Eagles hold the all-time head to head advantage over the Steelers, every Steelers fan in the nation can tell you the one important category Pittsburgh holds the edge in. And that would be Super Bowl victories. The Steelers have been able to capture an NFL best six Lombardi Trophies, while their Commonwealth brethren in Philadelphia have failed to capture a Super Bowl in their two attempts. But that is neither here nor there, and doesn’t mean a lick on Sunday. Let’s get down to the football! Steelers Offense vs. Eagles Defense When the Steelers take the field they will do so boasting the NFL’s leading rusher in DeAngelo Williams (58 attempts, 237 yards), and the NFL’s leader in passing touchdowns in Ben Roethlisberger (six). Quarterback Ben Roethlisberger is averaging 280 yards a game passing and has weapons to utilize at every position, including tight end. He will need to utilize every one of his weapons if the Steelers are going to win on Sunday. The Eagles defense has some impressive statistics through the first two weeks of the season. They boast the fourth best defense in total yards allowed (286 yards per game), the fifth best passing defense (194 yards per game) and the tenth best rushing defense (92 yards per game). Pittsburgh has a potent passing attack that will put pressure on the Philadelphia secondary on every play. Led by Antonio Brown (22 targets, 12 receptions, 165 yards, two touchdowns), the Steelers receiving corps has been excellent through the first two games. The top can be taken off the Eagles secondary, and I expect the Steelers to try repeatedly with the likes of Sammie Coates and Darrius Heyward-Bey. Speedster Markus Wheaton is also set to return from an injury that has kept him out the first two weeks of the season. Philadelphia has been susceptible to the deep ball early in the season. Corey Coleman and Terrelle Pryor had long receptions of 58 yards and 44 yards respectively. While Alshon Jeffery and Eddie Royal had long receptions of 49 yards and 31 yards respectively. Throwing the ball deep sounds like a great strategy, but it requires a lot of time being protected in the pocket. The Philadelphia Eagles have a done a great job of disrupting the quarterback in the pocket. The defense has recorded six sacks with Brandon Graham leading the way individually with two sacks. Safety Rodney McLeod leads the team in tackles (nine) and also has an interception and a forced fumble. In what has been a typically sore spot for the Steelers in years past, the offensive line play has been excellent through two games. The Steelers have given up only two sacks and block for the NFL’s leading rusher and passing touchdowns leader. The key to disrupting Pittsburgh is pressure, and I expect the Eagles to blitz early and often to try and bring down Big Ben Roethlisberger. Eagles Offense vs. Steelers Defense The 2-0 Philadelphia Eagles are led by rookie quarterback Carson Wentz. The number two overall pick in the 2016 NFL Draft, Wentz has looked every bit the part of an NFL quarterback. As always, expectations are high in Philadelphia and the rookie quarterback has exceeded them. Granted, only two weeks have passed. Head Coach Doug Pederson has slimmed down the playbook and put Carson Wentz in position to succeed by getting the ball into his play-makers hands. Wentz is averaging 225 yards passing a game, completing 60.6% of his passes, and has a QBR of 94.1. Pretty good for a rookie six months removed from playing the likes of Weber State and Southern Illinois. The Eagles backfield is led by Ryan Matthews (31 attempts, 109 yards, three touchdowns) and always dangerous Darren Sproles (52 yards rushing, 32 yards receiving). The wide receiver corps is led on the outside by Jordan Matthews (13 receptions, 185 yards, one touchdown) and Nelson Agholor (8 receptions, 99 yards, one touchdown). Dorial Green-Beckham is a matchup nightmare at 6’6″, and tight end Trey Burton snagged five catches for 49 yards and a touchdown filling in for the injured Zach Ertz. The Pittsburgh Steelers defense has employed a “bend but don’t break” philosophy since the start of the 2015 season. It looks like they’ll be employing the same strategy in 2016. The Steelers rank 21st in total defense and 30th in the NFL in passing yards against (347.5 yards/game). On the flip side, though, the Steelers rank second in the NFL in rushing yards against (50.5 yards/game). Led by standout linebackers Ryan Shazier (17 tackles, two passes defended, one interception, one forced fumble) and veteran stalwart Lawrence Timmons (15 tackles), the Steelers defense will look to shake the confidence of rookie quarterback Carson Wentz. This “bend but don’t break” strategy relies on the quarterback to beat you consistently down the field, and in the red-zone when it counts the most. The Steelers defense has been excellent at holding opponents to field goals over the first two games, and I expect that to continue on Sunday. The Prediction The previous two matchups between the Eagles and the Steelers (2008 & 2012) saw each team score no more than 16 points (15-6 & 16-14). I do not expect to see a defensive struggle this Sunday afternoon. Rather, I expect to see a shootout. The Eagles defense hasn’t seen an offense like the Steelers this year (the Eagles have played Cleveland & Chicago), and I expect it to show. Ben Roethlisberger, Antonio Brown and DeAngelo Williams will all score touchdowns respectively, while wide receiver Sammie Coates catches a long ball or two for a touchdown. The rookie quarterback Carson Wentz’ success will continue against the porous Steelers secondary. Both of the Matthews will score a touchdown, but the Steelers will pull away in the second half. Furthermore, since Mike Tomlin has taken over as Head Coach of the Pittsburgh Steelers in 2007, the Steelers are 14-1 against rookie quarterbacks. Steelers 31, Eagles 27. The 78th Battle of the Commonwealth will belong to Pittsburgh and all will be right in the world for the next four years. | Mid | [
0.6114130434782601,
28.125,
17.875
] |
Q: " not found", only happens in C++ mode I am testing and playing a bit with flex before I start using it for a real project, but I am facing sone issues. I am working on Android using a Linux emulator named Termux. I've installed flex and clang executing respectively $ apt install flex and $ apt install clang. I have noticed that if I write flex code for C, process it with $ flex filename, and then compile it with $ gcc -lfl lex.yy.c, everything compiles and the binary works perfectly. But if I write flex code for C++ (i.e. using C++ only features), process it with $ flex -+ filename and compile it with $ g++ -lfl lex.yy.cc, during compilation an error pops out saying that a file FlexLexer.h, included as #include <FlexLexer.h> was not found. Why does this only happen when using C++? Since I actually need it for C++, how can I fix this issue, minding that I am working on Android using an emulator? A: This was a bug in the flex package in Termux and has now been fixed - run apt update && apt upgrade to get the updated package which contains FlexLexer.h. | High | [
0.7000000000000001,
29.75,
12.75
] |
The four women suing Danny Masterson for alleged sexual assault have slapped the Church of Scientology’s leader David Miscavige with legal papers. According to court documents obtained by The Blast, Masterson’s alleged victims are informing the court they have legally served Miscavige with their lawsuit. The service was done at the Church of Scientology Celebrity Centre International on Hollywood Boulevard. The papers were given to an employee at the front of the center. The documents being served will allow their suit to continue on against Miscavige Back in August, the four women - two of whom are identified by name, the other two are Jane Does, sued Masterson, the Church of Scientology and Miscavige. They accused the defendants of stalking them in an effort to silence their sexual assault allegations against Masterson. Related: Danny Masterson and the Church of Scientology Sued for Allegedly Stalking Sexual Assault Accusers Danny Masterson Shows Up to 'The Ranch' Wrap Party After Ousting Over Sexual Assault Allegations Danny Masterson Accused of Rape by Fifth Woman The suit claims the defendants engaged in "conspiracy to cover up that Daniel Masterson sexually assaulted four young women." "When those women came forward to report Masterson’s crimes," the lawsuit claims, "the Defendants conspired to and systematically stalked, harassed, invaded their and their family’s privacy, and intentionally caused them emotional distress and silence and intimidate them." The women claim that the Church of Scientology has rules against reporting crimes. | Mid | [
0.575824175824175,
32.75,
24.125
] |
Sunday, September 14, 2008 Hey. Thank you. The sweet comments (and there are so many of them) about the little dream garden we planted have been such a treat. If you haven't decided to make one of your own, I highly recommend you give it a try. Or hopefully you already have a space where wonders never cease! Paul noticed that the post was labeled under "prayers" and "play," and he's right, they do go together. Play is such a creative and active act of faith, hope and love. Nikkipolani was wise to remind me that even small gardens need constant attention and even a willingness to to accept loss. Oh, be sure to read all the comments... everyone has such kind thoughts and good insights. We have been having fun and we've been enjoying the peacefulness that springs from that tiny space, and hearing from all of you has heightened my appreciation for what we have. Right now I am taking calming breaths and trying to retain the happy, peaceful feelings. It's wonderful to reflect on all of the good and beautiful things, but I gotta tell ya, life is as hectic as ever and I still freak out a bit when I tally up all the things I am not addressing... how that list does grow! Maria and I are stealing time, everyday, to go on garden walks, visit playgrounds and do simple activities together. The boys are treasuring their time outside of school and making the most of their smarts and hard work while in school... they are doing very well, and making us prouder than ever. Geoff is preparing for crunch time, when his long hours get longer, and we will be missing him extra much. And errands, chores, meetings, correspondences, plans, hopes, aspirations, and ideals are juggled constantly. I know people who do it all better than me... I am in awe of those people. I feel like I am always behind, late, forgetful, out of the loop and playing catch-up. I need one of those refrigerator magnets that say reassuring things like: "A Messy House is a Sign of Genius (creativity, intelligence, beauty, whatever.") Geoff bought one that says "A Clean House is a Sign of a Wasted Life." Either he's lost all hope, or he really appreciates me for everything else besides shiny surfaces. I can assure you we have no "Wasted Life" around here! In a moment I will publish this post, then hustle over to the laundry room and pull out my uniform from the dryer, get Maria dressed and Max cleaned up. I am taking them to a birthday party. Afterwards, we'll get to the market and buy lunch foods and other staples. I need to go to the car wash, get gas and find new wiper blades. There are 1 or 30 papers, appointments, errands and don't forgets that I mustn't forget. And I will do my best to do as many of the things I have to do, and I will not get to all of them. Sooner or later I will run smack into something really, really important that I have completely lost sight of and then... and then I can either cry, scream, evaporate and be blown away like dust or I can reflect on all the things I did right, and just sigh. It's not that I want to embrace my mediocrity, but living with acceptance of my weaknesses is rather liberating, and it gives me the strength to stand up and try again. Reflecting on my successes, on the happy things that have transpired, feels good. Deep down good, like breathing in a forest, or coming to the surface from a long, deep swim. I am already running late. But I wanted to show you these big frogs, and pretty lily pads, and I wanted to thank you for reading Chickenblog and sharing your thoughts, for giving me happy things to reflect on. Does anyone know what these are called? I think they are an alien species. People who claim to have it "all together" are either lying, or have assistants. Glad you can take a breath and accept what you can do in the moment. There will always, always be more to do. It's better to take time away to do more being, as you're doing with the garden breaks. Hey, I was gonna say that! My hubby bought me a magnet that said, "women with clean houses have no life!". Ain't it the truth, lol. I've said it before but revel in the business it doesn't last forever and you will miss it (at least some of it!)XXOO About You are visiting Chicken Blog~ Deep thoughts and other musings, from a woman who writes about the man she loves, their 3 sons and 1 daughter, Chango the cat, and Mister Washburn Foo Cat, Tasha Goat and Ada Goat, our dear Chicas, sewing, gardening & cooking, making, art, science, playing...And our lives in a home with a view. *Blogged Since May 24, 2002* COPYRIGHT: 2002-2016 by Chickenblog and its family members. All rights reserved. Please do not use our original photos, or drawings, or reprint our writing without obtaining my permission. Thank you! We Love Your Comments Please, join the conversation. We enjoy reading your feedback, and when we can, we like to respond in the comments section.When a comments field does not appear, just hit "refresh."It works! Followers Pink Martini Memories It was a "Big One!" Chirp-Chirp-Chirp BirdHouse Notes It was snowing in Oregon. There's snow atop Mauna Loa! And Massachusetts, too. Maybe in Wisconsin? It's got me thinking of all the wonderful traveling we enjoyed this year... me and Maria, especially. We are about as lucky as can be. But... wouldn't it be fabulous to visit any of our favorite places while it's snowing? Even if such a thing is a bit far fetched, I am enjoying the thought, and thinking of loved ones in their winter-wonderlands. Send some our way, or we'll come yours! December 6, 2016 1:17 pm Hello December! I don't know what more I can say... I feel like this day snuck up on me, and I am not ready! Never mind. With any luck, my cold is on its way out, and all sugarplum visions, aspirations, and other seasonal ambitions will fall neatly into place. Lights, music, friends, and cheer... it's all I need to get this holiday rolling! December 1, 2016 11:50 am Benevolent Order of Makers Passionate about S.T.E.A.M.M.! An Open Air Barn This is the place we designed and built to keep our chickens, goats, and bunnies happy and safe. It's a dream come true! | Mid | [
0.587654320987654,
29.75,
20.875
] |
1. Introduction {#sec1-membranes-09-00117} =============== Membrane filtration processes are regarded as a solution to overcome freshwater scarcity by enabling the utilization of water sources such as seawater and wastewater to produce clean water for industrial, agricultural, municipal and potable use. Reverse osmosis (RO) is by far the most commonly applied membrane filtration process due to its effectiveness in removing pollutants and monovalent ions, ease of operation and cost-effectiveness \[[@B1-membranes-09-00117],[@B2-membranes-09-00117]\]. The use of polyamide RO membranes in spiral-wound configurations is prevalent in commercial systems \[[@B3-membranes-09-00117]\]. The fouling of membrane modules continues to be the major limitation in the effective application of RO membrane installations. More than 45% of all cases of membrane fouling are caused by biofouling (excessive growth of biomass) \[[@B4-membranes-09-00117]\] leading to filtration process failure, high operational costs and early membrane replacement. Biofouling is operationally diagnosed when the normalized pressure drop (NPD) is increased by 15% or the normalized flux is decreased by 10% of the start-up values \[[@B5-membranes-09-00117],[@B6-membranes-09-00117],[@B7-membranes-09-00117]\]. Biofouling is inevitable during long-term operation \[[@B8-membranes-09-00117]\]. Even with extensive pretreatment of feed water using disinfectants \[[@B9-membranes-09-00117]\] and biocides \[[@B10-membranes-09-00117]\], it is not possible to remove all micro-organisms and biodegradable substances from the feed water \[[@B11-membranes-09-00117],[@B12-membranes-09-00117]\]. Membrane surface and feed spacer modifications can somewhat delay biofilm formation \[[@B13-membranes-09-00117],[@B14-membranes-09-00117],[@B15-membranes-09-00117]\], but cannot completely eliminate biofouling. However, slowing down the biofilm formation rate gives plant operators more time to diagnose the cause of biofouling and implement the most appropriate control strategies. Bucs et al. (2018) recommended that research should be aimed at (i) slowing down biofilm formation; (ii) reducing its impact on membrane performance and (iii) removing biofilms by advanced cleaning strategies. The work presented herein pursues an advanced cleaning strategy for biofouling control. Chemical cleaning of membrane modules is routinely carried out at full-scale installations to restore membrane performance. Several studies have highlighted the need for new chemical cleaning strategies since the conventional cleaning by NaOH and HCl fails to provide highly effective membrane regeneration \[[@B16-membranes-09-00117],[@B17-membranes-09-00117],[@B18-membranes-09-00117],[@B19-membranes-09-00117]\]. The ability of urea to dissolve biofilm proteins has been discussed briefly in the literature \[[@B20-membranes-09-00117],[@B21-membranes-09-00117],[@B22-membranes-09-00117]\]. Recently, controlled laboratory experiments have been conducted using membrane fouling simulators to assess the efficiency of concentrated urea as a chemical cleaning agent for RO membranes \[[@B23-membranes-09-00117]\]. These studies demonstrated considerable potential of urea to enhance biofilm solubilization and removal. However, lab-scale biofouling experiments may not be completely representative for "real world" membrane applications whereby a combination of biofouling, colloidal fouling, inorganic scaling and the organic fouling of membranes may occur simultaneously. Membrane performance at full-scale RO plants is also affected by variations in feed water parameters, pre-treatment techniques and their effectiveness, as well as operating conditions (such as flux) \[[@B24-membranes-09-00117]\]. Membrane autopsies of full-scale modules are therefore necessary in order to (i) identify the types and degree of fouling, and (ii) ascertain the applicability of novel chemical cleaning agents and strategies at full-scale installations. This study examined the efficiency of urea as a chemical cleaning agent in contrast to the conventional acid/alkali cleaning protocol, applied to 8-inch diameter spiral-wound RO membrane elements taken from a full-scale installation and cleaned in a pilot test facility. To fulfil this objective, performance data of the membrane modules was assessed and a subsequent autopsy of the membrane modules was carried out, enabling detailed laboratory analysis using advanced analytical techniques which had not been incorporated in our previous lab-scale studies \[[@B23-membranes-09-00117]\]. 2. Materials and Methods {#sec2-membranes-09-00117} ======================== 2.1. Experimental Design {#sec2dot1-membranes-09-00117} ------------------------ The pilot test facility was located at the DECO water treatment plant, managed by Evides Industriewater in Terneuzen, the Netherlands. The DECO plant produces demineralized water and cooling tower supply water from membrane bioreactor (MBR) permeate, originating from the wastewater treatment plant of Terneuzen \[[@B9-membranes-09-00117]\]. The MBR permeate is transported over 13 km by pipeline to the DECO plant. Monochloramine is dosed in the pipeline to prevent biofouling. At the DECO plant, the effluent is passed through a 50 µm automatic screen filter. The residual monochloramine is removed by dosing a small excess of sodium hydrogen sulfite just upstream of the RO. The average flow to the RO is 254 m^3^/h. The system consists of two-pass RO units containing more than 700 8-inch FILMTEC™ membrane elements (BW30XFR-400/34i) (Delfgauw, the Netherlands) comprising 34 mil feed spacers. The production design capacity of each RO unit is 150--175 m^3^/h. At the plant, membrane fouling problems are inevitable due to the high fouling tendency of wastewater effluent. The decline in plant performance is identified as a rapid increase of feed channel pressure drop, requiring preventive cleaning as well as regular maintenance cleaning (using NaOH and HCl) every 3 days to avoid irreversible loss in membrane performance. For this study, an automatic RO pilot installation equipped with two single modules 8-inch pressure vessels was employed, built by Logisticon Water Treatment (Groot-Ammers, the Netherlands) ([Supplementary Material Figure S1](#app1-membranes-09-00117){ref-type="app"}). Freshwater (surface water from Belgium) was sourced as feed water to the RO pilot installation. Three fouled 8-inch membrane modules of the same age of operation (2.5 years) were harvested from the lead position of one of the full-scale RO units treating MBR permeate. Each spiral-wound membrane element had a surface area of 37.16 m^2^ (or 400 sq. ft.) and was mostly fouled on the inlet side ([Supplementary Material Figure S2](#app1-membranes-09-00117){ref-type="app"}). A membrane element was placed inside a vertically installed cleaning-in-place (CIP) vessel and feed water was fed from the top (inlet side of the module). The pilot installation was designed to record three key performance indicators (KPIs) including pressure, flow and conductivity. With the freshwater feed, the initial performance of the membrane element---including feed and concentrate flow (m^3^/h) and pressure (bar)---was measured. Second, the module was rinsed with demineralized water twice to displace the feed water. The demineralized water was drained from the system to avoid dilution of the chemical cleaning solutions before proceeding with the cleaning protocol. [Table 1](#membranes-09-00117-t001){ref-type="table"} describes the chemical cleaning protocol applied to each of the three membrane modules. NaOH and HCl were obtained from the DECO water treatment plant's chemical storage unit. Urea as crystals (technical grade, uncoated) was obtained from the chemical supplier for DECO (Brenntag Nederland BV, Dordrecht, the Netherlands). Demineralized water was used as the solvent to prepare 100 L of the cleaning solutions. The cleaning solutions (NaOH and urea) were heated to 35 °C because this is the optimum temperature for NaOH/HCl cleaning aimed at enhanced flux recovery \[[@B25-membranes-09-00117]\]. The alkali cleaning was applied at a concentration typically used in industry for chemical cleaning (0.01 M NaOH) and is reportedly quite effective at restoring membrane performance \[[@B7-membranes-09-00117],[@B26-membranes-09-00117]\]. The performance of the membrane elements was assessed after the recirculation of the first cleaning agent (NaOH or urea) and at the end of the cleaning protocol. After cleaning, membrane elements were stored and transported to the laboratory in heavy duty plastic bags containing ice for autopsy, sampling and analysis. 2.2. Key Performance Indicators {#sec2dot2-membranes-09-00117} ------------------------------- Membrane fouling results in an increase in pressure drop across the feed channel and a decline in permeate flux. Monitoring these KPIs allows for the early identification of fouling and is used to determine the cleaning frequency and strategy. The normalization of the performance indicators is required in order to accurately assess and compare the process performance, independent of varying parameters such as feed water temperature and flow. In this study, pressure drop was normalized for flow and temperature using the same method (see Equation 1) as employed by the DECO plant \[[@B27-membranes-09-00117]\]. $$NPD = ~\Delta P_{ACT}.Q_{CF\Delta P}.T_{CF\Delta P} = \left( {P_{FEED} - P_{CONCENTRATE}} \right)\left( {\frac{\left( {Q_{FEED,REF} + Q_{CONCENTRATE,REF}} \right)~ \div 2}{\left( {Q_{FEED} + Q_{CONCENTRATE}} \right)~ \div 2}~} \right)^{1.6}.\left( \frac{\eta_{T,REF}}{\eta_{T,ACT}} \right)^{0.4}$$ where *NPD* is the normalized pressure drop (bar), ΔP~ACT~ is the actual pressure difference, *Q~CF,ΔP~* is the flow correction factor, *T~CF,ΔP~* is the temperature correction factor, *P~FEED~* is the feed pressure, *P~CONCENTRATE~* is the concentrate pressure, *Q~FEED,REF~* is the reference feed flow rate (m^3^/h), *Q~CONCENTRATE,REF~* is the reference concentrate flow rate, *Q~FEED~* is the feed flow rate, *Q~CONCENTRATE~* is the concentrate flow rate, *η~T~,~REF~* is the viscosity (Pa·s) at reference temperature (°C) and *η~T,ACT~* is the viscosity at actual water temperature. Flux (permeation rate) is defined as the water volume flowing through the membrane per unit area and time (Lm^−2^ h^−1^) \[[@B28-membranes-09-00117]\]. The water flux normally increases by 3% for each degree of water temperature increase. Therefore, normalization of the flux to a standard temperature of 25 °C (for RO/NF membranes) accounts for fluctuations in water viscosity, as shown in Equation (2). $$J_{25} = \left( {Q_{PERMEATE}~ \div ~A_{MEMBRANE}} \right) \times TCF$$ where *J*~25~ is the permeate flux normalized to a temperature of 25 °C, *Q~PERMEATE~* is the permeate flow (m^3^/h), *A~MEMBRANE~* is the surface area of the membrane module (m^2^), and *TCF* is the temperature correction factor. 2.3. Membrane Autopsy {#sec2dot3-membranes-09-00117} --------------------- Membrane autopsies were carried out in order to retrieve membrane and feed spacer samples for the qualitative and quantitative analysis of the fouling layer. An electric saw was used to cut off the endcaps of the membrane element and to cut open the fiberglass casing. After the fiberglass casing was removed, the membrane and spacer sheets were unwound and laid out on a clean table. First, visual observations of membrane fouling were made and photographs were taken of the membrane/spacer surface. Membrane and spacer coupons were acquired from the inlet (most fouled part) of the membrane element. The coupon dimensions were measured with calipers so that the results are reported per area of the combined membrane and spacer surface area. The amount, distribution and composition of the fouling layer were analyzed using various analytical techniques that are described in the following sections. 2.4. Biomass Quantification {#sec2dot4-membranes-09-00117} --------------------------- ### 2.4.1. Adenosine Triphosphate (ATP) {#sec2dot4dot1-membranes-09-00117} ATP analysis measures the viable biomass content and it is an indicative parameter of biofouling \[[@B18-membranes-09-00117],[@B29-membranes-09-00117],[@B30-membranes-09-00117]\]. Membrane and spacer surface area (3--5 cm^2^) was swabbed with 3M clean-trace surface ATP swabs (3M, Delft, the Netherlands) from the inlet, middle and outlet of the membrane module. The amount of active biomass was measured using the 3M kit according to manufacturer protocol. The results were obtained in relative light units (RLU) and converted to pg ATP/cm^2^ using the equation of line from a calibration curve. ### 2.4.2. Total Organic Carbon (TOC) {#sec2dot4dot2-membranes-09-00117} The total carbon content of the accumulated organic matter was determined using total organic carbon (TOC), which is commonly used to obtain information on the degree of biofouling \[[@B29-membranes-09-00117],[@B31-membranes-09-00117]\]. Membrane and spacer coupons (4--9 cm^2^) were cut from the membrane element and placed in centrifuge tubes containing 30 mL of ultrapure water. The tubes were placed in an ultrasonic water bath (Bransonic, model 5510E-DTH, CT, USA, output 135 W, 42 kHz) for two minutes, followed by mixing on a Vortex for one minute to remove biomass from the membrane and spacer surface. The procedure was repeated three times and the coupons were removed from the solution. Since the samples could not be homogenized due to the presence of thick particulate matter, centrifugation was necessary in order to spin down the sediments to a pellet. TOC was measured using a Shimadzu (Japan) TOC-L analyzer and the results were given in mg TOC per cm^2^ of combined membrane and spacer surface area. The TOC content in the final stage rinse solution (HCl) was measured before and after cleaning the membrane modules. The HCl solution sampled after rinsing the membrane module cleaned with urea was dialyzed over a 3.5 kDa membrane in order to prevent interferences from urea molecules. A volume of 50 mL of the HCl solution post-cleaning was dialyzed over 1000 mL of demi-water. The dialysate solution (demi-water) was replaced two more times over a duration of approximately 30 h. This was to ensure that interferences from urea, if any, would be negligible. 2.5. Biofilm Composition {#sec2dot5-membranes-09-00117} ------------------------ ### 2.5.1. SEM--EDX Analysis {#sec2dot5dot1-membranes-09-00117} Scanning electron microscopy (SEM) combined with energy dispersive X-ray (EDX) analysis was used to study the elemental composition of the fouled membrane surface. Membrane coupons (4 cm^2^) were acquired from the inlet of each of the membrane modules and air dried. The membrane coupons were cut into smaller sections (about 1 cm^2^) and mounted onto an aluminum stub with carbon tape. The samples were coated with 5 nm iridium inside the Q150T S sputter coater (Quorum Technologies, Lewes, UK). Each sample was examined with SEM (Teneo VS SEM, Thermo Fisher Scientific, Waltham, MA, USA) at two different locations under magnifications ranging from 250× to 25,000×. EDX analysis (Octane Pro EDAX, AMETEK, MA, USA) was carried out on three different locations (full field view), followed by spot analysis at three different spots within each field of view (a total of 12 random locations on each membrane sample). A continuous X-ray energy spectrum from 0 to 10 keV was integrated for each elemental scan. Each element composition value was expressed by the average of three measurements from the full field view analysis for each sample. ### 2.5.2. ATR--FTIR Analysis {#sec2dot5dot2-membranes-09-00117} Attenuated total reflection--Fourier transform infrared spectroscopy (ATR--FTIR) was used to examine the molecular composition of the fouled membrane surface. The FTIR instrument (Nicolet is10, Thermo Fisher Scientific, Waltham, MA, USA) contained a SmartiTR diamond ATR accessory (angle of incidence of 45°), coupled with OMNIC software. Membrane coupons (4 cm^2^) were cut from the inlet of each of the membrane modules. After obtaining a blank spectrum (using air as the background signal), the air-dried membrane samples were placed on the sample holder and IR spectra were collected in the spectral range of 4000--525 cm^−1^ with a resolution of 4 cm^−1^ from 32 scans per measurement. 3. Results {#sec3-membranes-09-00117} ========== 3.1. Membrane Performance {#sec3dot1-membranes-09-00117} ------------------------- The performance of the membrane modules was characterized by the normalized pressure drop and normalized flux before, during and after cleaning ([Table 2](#membranes-09-00117-t002){ref-type="table"}). The reference module had a normalized pressure drop (NPD) of 208 mbar before cleaning, which was reduced by NaOH/HCl cleaning to 181 mbar ([Figure 1](#membranes-09-00117-f001){ref-type="fig"}A). The NPD for the test module was reduced from 133 mbar before cleaning to 115 mbar after cleaning with urea/HCl ([Figure 1](#membranes-09-00117-f001){ref-type="fig"}A). Thus, both cleaning protocols resulted in a 13% reduction in NPD ([Figure 1](#membranes-09-00117-f001){ref-type="fig"}B). The percent decrease in NPD is calculated from the initial and final values for each membrane module. Therefore, the comparison in percent decrease in NPD after each chemical cleaning is valid because each module is assessed according to its own performance parameters, independent of the parameters of the other two membrane modules. For the reference module, the normalized permeate flux remained unchanged (29 Lm^−2^ h^−1^) after cleaning with NaOH + HCl. However, cleaning the test module with urea + HCl increased the normalized permeate flux by 1.51 Lm^−2^ h^−1^ ([Figure 2](#membranes-09-00117-f002){ref-type="fig"}). 3.2. Visual Analysis {#sec3dot2-membranes-09-00117} -------------------- An autopsy of the membrane modules confirmed that fouling was predominantly present on the spacer surface at the inlet side of the element ([Supplementary Material Figure S3](#app1-membranes-09-00117){ref-type="app"}). The membrane module cleaned with urea appeared visibly cleaner compared to the control and reference membrane modules ([Figure 3](#membranes-09-00117-f003){ref-type="fig"}). A close-up view of the control, reference and urea membrane modules is also shown in [Supplementary Material Figure S4](#app1-membranes-09-00117){ref-type="app"}. 3.3. Biomass Parameters {#sec3dot3-membranes-09-00117} ----------------------- The concentration of accumulated biomass was quantified using ATP (active biomass parameter). The results of the biomass parameters are presented in [Figure 4](#membranes-09-00117-f004){ref-type="fig"}. The control membrane module (uncleaned) contained the highest amount of active biomass (6.0 × 10^3^ pg ATP/cm^2^). Of the two cleaned membrane modules, the test module (cleaned with Urea + HCl) contained the least amount of active biomass (1.8 × 10^2^ pg ATP/cm^2^) compared to the reference module cleaned with NaOH + HCl (7.5 × 10^2^ pg ATP/cm^2^). The amount of organic carbon was also measured in the final stage HCl rinse solution in the control and after cleaning the membrane modules. The TOC content was an order of magnitude greater in the HCl solution sampled after rinsing the membrane module cleaned with urea compared to the membrane module cleaned with NaOH ([Figure 5](#membranes-09-00117-f005){ref-type="fig"}). 3.4. Elemental Composition and Surface Morphology {#sec3dot4-membranes-09-00117} ------------------------------------------------- SEM imaging ([Figure 6](#membranes-09-00117-f006){ref-type="fig"}) showed the occurrence of a surface fouling layer on the membranes, which could be easily differentiated from the surface expression of the polyamide membrane layer. The presence of colloids and biomass was apparent. Structures resembling bacterial cells and diatoms were observed, suggesting their presence in the fouling layer. SEM examination revealed no significant difference between the control (uncleaned) and reference (cleaned with NaOH + HCl) membrane samples in terms of the fouling layer removal efficiency. However, the screening of random locations of the membrane sample cleaned with Urea + HCl showed that the membrane surface was much cleaner than the reference and control membranes with a scarcely dispersed fouling layer. The main elemental composition of the fouling layer was elicited using EDX analysis. Amongst the 13 elements detected in the EDX spectra ([Figure S5](#app1-membranes-09-00117){ref-type="app"}), C, N, O and S were the most predominant elements (adding up to \>90% weight), whereas Mg, Al, Si, P, K, Ca, Ti, Mn and Fe were only present in low concentrations ([Table 3](#membranes-09-00117-t003){ref-type="table"}). The EDX analysis suggests that biofouling and/or organic fouling plays the major role in the fouling of the membrane modules, as opposed to inorganic fouling and scaling. Proteins, polysaccharides and lipids are the main organic components encountered in the fouling of membranes and all of them contain carbon and oxygen. Nitrogen and trace amounts of sulphur are present in proteins and associated amino acids. 3.5. Molecular Composition {#sec3dot5-membranes-09-00117} -------------------------- The infrared spectra of the surface fouling layer deposited on the two cleaned membrane modules are presented in [Figure 7](#membranes-09-00117-f007){ref-type="fig"}. The peak assignments were allotted according to the literature \[[@B32-membranes-09-00117],[@B33-membranes-09-00117]\]. In general, the membrane module cleaned with NaOH + HCl had a very similar spectrum to the module cleaned with Urea + HCl. However, the absorbance bands of all functional groups were lower in the membrane cleaned with urea, suggesting a higher solubilization of organic foulants by urea. The main fouling constituents included polysaccharides, proteins, fatty acid chains, lipids, nucleic acids and other compounds derived from humic substances. The broad region of absorption between 3400 and 3000 cm^−1^ is due to stretching of the O--H bond in hydroxyl functional groups. The sharper peaks at 2961 and 2925 cm^−1^ are due to the stretching fatty chains (ʋCH~3~, ʋCH~2~, υCH). The absorbance peaks of amide I (1684--1614 cm^−1^) and amide II (1587--1541 cm^−1^) suggest the presence of proteins and amino acids in the EPS. The polysaccharides region is shown in the spectral region of 1200--900 cm^−1^, corresponding to different stretching and bending vibrations (υC--O, υC--C, δC--O--H, δC--O--C). There are also clear peaks visible for lipids (1487 cm^−1^) and phosphodiester, phospholipids, lipopolysaccharides, nucleic acids and ribose compounds (1243 cm^−1^). In summary, the results of the FTIR spectra corroborate with the SEM--EDX analysis in terms of identifying organic foulants and biogenic materials as the major contributors to the fouling of spiral-wound membrane modules at the DECO water treatment plant. Moreover, the solubility of macromolecules in the biofilm is moderately enhanced by urea compared to conventional cleaning chemicals. 4. Discussion {#sec4-membranes-09-00117} ============= Membrane cleaning is essential to restore the efficiency of filtration process operation in the water treatment industry. Routine cleaning of the RO membranes with acid and alkaline chemicals is the standard practice at the Evides DECO plant. This study examined the effect of replacing the typically used alkaline cleaning agent (sodium hydroxide) with a chaotropic agent (urea) in an effort to denature proteins and enhance the solubility of organic foulants. This research effort was the first of its kind in terms of employing urea for the chemical cleaning of spiral-wound RO membrane elements in a cleaning-in-place installation at a pilot-scale facility. 4.1. Membrane Regeneration {#sec4dot1-membranes-09-00117} -------------------------- Confirming the previous lab-scale studies \[[@B23-membranes-09-00117]\], the results of this pilot-scale study show that urea cleaning and the standard acid/alkali cleaning are equally effective with regards to restoring the normalized feed channel pressure drop. Both cleaning strategies fulfilled the aim of chemical cleaning i.e., to restore the feed channel pressure drop of the membrane element when it exceeds 10--15% of the start-up value. However, in terms of flux recovery, the performance of urea was better than NaOH cleaning. Urea cleaning increased the permeate flux by 5%, while the acid/alkali cleaning was not effective in improving the flux. This is probably due to the removal of surface adhered materials which are better dissolved by urea. The removal of the biomass from the spacer surface reduces the overall feed channel pressure drop, indirectly resulting in a higher flux. After cleaning with NaOH + HCl, the membrane permeability remained unchanged but the normalized pressure drop was restored by 13% ([Figure 1](#membranes-09-00117-f001){ref-type="fig"}). This may indicate a compaction of the fouling layer after NaOH cleaning. A similar finding was reported by Beyer et al., (2017). In this study \[[@B19-membranes-09-00117]\], examining chemical cleaning at three full-scale RO plants, feed channel pressure drop improved by 10%, but permeability decreased by 5% and salt rejection remained unchanged, indicating a compaction of the fouling layer. It is also plausible that NaOH requires a longer contact time than urea to effectively restore membrane permeability. 4.2. Biofilm Solubilization and Removal {#sec4dot2-membranes-09-00117} --------------------------------------- An autopsy and subsequent visual examination of the membrane elements revealed more fouling on the feed spacer surface than on the membrane. This finding is in agreement with previous studies which have shown that (i) initial biofouling deposition occurs on the surface of feed spacers and (ii) feed spacer biofouling effects overall performance more adversely than membrane biofouling \[[@B34-membranes-09-00117],[@B35-membranes-09-00117],[@B36-membranes-09-00117],[@B37-membranes-09-00117]\]. Urea molecules are able to diffuse into the biofilm matrix and bacterial cells resulting in extracellular and intracellular swelling of the biofilm, eventually leading to osmotic lysis \[[@B22-membranes-09-00117]\]. For this reason, biomass inactivation may be enhanced with urea-based chemical cleanings. With regards to biomass removal, the membrane module cleaned with urea + HCl visibly appeared cleaner than the module cleaned with the conventional chemicals. This was also observed during SEM and FTIR analysis, where urea cleaning produced a slightly better performance in terms of removing the biofilm. The membrane surface appeared cleaner post-urea-treatment and contained a lower concentration of organic compounds, suggesting an enhanced solubilization of the biofilm with urea treatment. Furthermore, total organic carbon analysis of the HCl rinse solution post cleaning the membrane modules revealed that urea is more efficient at solubilizing the surface fouling layer. The stability of the biofilm matrix is compromised when urea cleaning disrupts the hydrogen-bond network of the biofilm and creates a loose fouling layer, consequently enhancing the solubilization and removal of biomass. 4.3. Relevance of Urea Use {#sec4dot3-membranes-09-00117} -------------------------- The use of wastewater effluent as feed water at the DECO plant increases the fouling tendency of membrane elements, particularly biological fouling due to the high biodegradable organic carbon content of membrane bioreactor permeate \[[@B9-membranes-09-00117]\]. The analysis of the membrane surface morphology (SEM) and biofilm composition (EDX and FTIR) confirmed the presence of biological materials (biofouling) on the membrane modules. Cleaning of the membrane modules at the DECO plant with chemicals such as NaOH and urea is therefore a suitable cleaning strategy, since the reaction mechanism of both the cleaning agents results in the removal of organic fouling \[[@B19-membranes-09-00117],[@B38-membranes-09-00117]\]. Preliminary laboratory studies confirmed the compatibility of urea with the polyamide membranes \[[@B23-membranes-09-00117]\], where urea was not found to damage the polyamide layer of the membrane. Biocides such as 2,2-dibromo-3-nitrilopropionamide (DBNPA) \[[@B39-membranes-09-00117]\] and disinfectants such as monochloramine \[[@B9-membranes-09-00117]\] can prevent or delay the formation of a biofilm, but they cannot prevent the deposition of organic foulants onto the membrane surface. Urea is capable of removing both biofilm from the feed spacer and organic fouling from the membrane surface, helping with lowering feed spacer pressure drop and increasing membrane permeability. Therefore, urea cleaning is an effective curative strategy for biofouling control. The application of urea treatment in a preventive mode requires further investigation. Perhaps a continuous or shock dosage of DBNPA can be incorporated to delay and reduce biofilm formation, along with urea cleaning every 3 days for preventive biofouling control \[[@B10-membranes-09-00117]\]. However, given the toxicity of DBNPA, it must not be used in drinking water production. Similarly, during wastewater treatment, monochloramine application effectively controls biofouling in RO systems, but it is imperative to restrict the formation of disinfection by-products and decay of monochloramine. 4.4. Future Research {#sec4dot4-membranes-09-00117} -------------------- The fact that the membrane modules used in this study had been in operation for 2.5 years means there may have been some accumulation of an irreversible fouling layer in the membrane modules, making it difficult to fully restore the membrane permeability to the start-up values. Nevertheless, in order to increase the percentage of permeate flux recovery, the duration of cleaning should be extended from 1 h recirculation time to 3 or more hours in order to further disrupt the bonds between the foulants and the membrane surface, as well as weaken the chemical bonds within the EPS matrix. At the DECO plant, the NaOH and HCl cleaning phases last for \>4 h, consisting of periods of high flow recirculation and soaking. The urea cleaning protocol must be optimized to include multiple stages of high flow recirculation and soaking, as practiced during CIP regimens in industry. Extended periods of recirculation with urea may reduce the frequency of routine chemical cleanings, as already implemented by the DECO plant, to maintain filtration process productivity. The introduction of a surfactant in the cleaning protocol could result in greater cleaning efficiency by reducing the surface tension and increasing the solubility of foulants. Recent studies have demonstrated a greater cleaning efficiency with combined sequential cleaning with NaOH and sodium dodecyl sulfate (SDS), compared to the use of NaOH only \[[@B40-membranes-09-00117],[@B41-membranes-09-00117]\]. In contrast with the single cleaning cycle conducted in this study, conducting multiple urea cleaning cycles may be interesting to examine the impact on biofilm structure and composition. The effectiveness of urea cleaning to restore membrane performance during long-term membrane operation should be studied. Routine chemical cleaning with urea may be optimized such that urea is recycled from the waste solution after cleaning the membrane modules. Initial experiments have already been carried out successfully to recover the urea using eutectic freeze crystallization. The potential of recycling urea from the waste cleaning solution could result in significant reductions in the amount of chemical waste and the costs associated with cleaning, such as the purchase and transport of chemicals and the treatment of chemical waste. Suitable urea reuse methods must be applied in order to encourage the eco-friendly use of urea over the chemically wasteful conventional cleaning strategies. 5. Conclusions {#sec5-membranes-09-00117} ============== The chemical cleaning efficiency of urea was compared with the conventionally applied cleaning solutions (sodium hydroxide and hydrochloric acid) for spiral-wound RO membrane elements taken from a full-scale installation and cleaned at a pilot-scale facility in the Netherlands. Based on the results of this study, it can be concluded that: Biofouling plays the major role in the fouling of the membrane elements at the DECO plant. Urea cleaning is as effective as the conventional chemical cleaning in terms of restoring the normalized feed channel pressure drop, and more effective in terms of (i) restoring membrane permeability; (ii) solubilizing organic foulants and (iii) removing the surface fouling layer. The authors extend their gratitude to the plant operators at Evides Industriewater DECO plant for their assistance. ###### Click here for additional data file. The following are available online at <https://www.mdpi.com/2077-0375/9/9/117/s1>, Figure S1: Automated RO pilot installation equipped with two single 8-inch module pressure vessels, designed to measure key performance indicators in real time. Figure S2: Fouling on the inlet and outlet ends of spiral-wound membrane modules after 2.5 years of operation at the DECO water treatment plant. Figure S3: Unwound control membrane module (uncleaned) after membrane autopsy. Visual observations showed that the bulk of the fouling is present on (A) the inlet side rather than the middle or outlet of the module, and (B) the spacer surface rather than the membrane surface. Figure S4: Visual comparison of the membrane/spacer surface of cleaned membrane modules. Figure S5: Energy dispersive x-ray spectra of (A) Control module uncleaned, (B) Reference module cleaned with NaOH + HCl and (C) Test module cleaned with Urea + HCl. The EDX spectra show that C, N, O and S dominate the elemental composition, thereby confirming the presence of organic fouling and biofouling. Scaling or inorganic fouling may be very minor contributors to overall fouling of the membrane modules since elements like Al, Ca and Fe were present only in trace concentrations. Conceptualization, H.S., S.S.B., M.A.P., and J.S.V.; Methodology, H.S. and S.S.B.; Software, H.S. and M.A.P.; Validation, H.S., M.A.P., and J.S.V.; Formal Analysis, H.S.; Investigation, H.S., S.S.B., and J.Z.; Resources, J.S.V., M.A.P., G.-J.W.; Data Curation, H.S., J.Z.; Writing---Original Draft Preparation, H.S.; Writing---Review & Editing, N.M.F., J.S.V., G.-J.W., M.C.M.v.L., J.C.K.; Visualization, H.S.; Supervision, J.S.V.; Project Administration, J.S.V.; Funding Acquisition, J.S.V., and M.A.P. This research was funded by King Abdullah University of Science and Technology (KAUST) under grant number BAS/1/1024-01-01, and by Evides Industriewater. The APC was funded by TU Delft. The authors declare no conflict of interest. {#membranes-09-00117-f001} {#membranes-09-00117-f002} {#membranes-09-00117-f003} {#membranes-09-00117-f004} {#membranes-09-00117-f005} {#membranes-09-00117-f006} {#membranes-09-00117-f007} membranes-09-00117-t001_Table 1 ###### Chemical cleaning strategies applied to each membrane element. Performance data of all three membrane modules was recorded before, during and after cleaning. ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Module Code Cleaning Protocol Comment -------- ------------ --------------------------------------------------------------------- ----------------------------------------------------------------------------------------------- 1 Control None Control module. No cleaning 2 NaOH + HCl \(i\) NaOH (pH 12, 35 °C) recirculated for 1 h\ Reference module cleaned with conventional alkali/acid solutions as applied by DOW and Evides (ii) HCl (pH 1, room temperature) (\~18 °C) recirculated for 30 min 3 Urea + HCl \(i\) CO(NH~2~)~2~ (1340 g/L, 35 °C) recirculated for 1 h\ NaOH replaced by saturated urea solution (ii) HCl (pH 1, room temperature) (\~18 °C) recirculated for 30 min ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- membranes-09-00117-t002_Table 2 ###### Membrane performance parameters before, during and after cleaning. Performance Parameters Cleaning with NaOH + HCl Cleaning with Urea + HCl ---------------------------------------------- -------------------------- -------------------------- ------- ------- ------- ------- Normalized Feed Channel Pressure Drop (mbar) 208 202 181 133 173 115 Normalized Flux (Lm^−2^ h^−1^) 29.07 29.98 29.07 29.68 29.98 31.19 membranes-09-00117-t003_Table 3 ###### Comparison of elemental composition (% weight) of the fouling layer as determined by energy dispersive X-ray (EDX) analysis. Element C N O Mg Al Si P S K Ca Ti Mn Fe ------------ ------- ------ ------- ------ ------ ------ ------ ------ ------ ------ ------ ------ ------ Control 66.26 6.78 18.77 0.28 0.41 0.34 0.55 4.31 0.15 0.29 0.21 0.53 1.12 NaOH + HCl 62.44 3.34 21.98 0.30 0.60 0.79 0.59 5.96 0.21 0.27 0.18 0.44 2.91 Urea + HCl 59.31 6.88 24.88 0.37 0.68 0.91 0.61 5.02 0.23 0.66 0.26 0.47 2.42 | Mid | [
0.594786729857819,
31.375,
21.375
] |
L.A. County initiates program to supply recycling receptacles for area beaches The Los Angeles County Department of Beaches and Harbors implemented a new beach recycling program Monday, October 5th after securing a grant from the California Department of Conservation. Thirty-two recycling barrels will be placed along county beaches, including in the third and fourth districts, which are represented by Supervisors Zev Yaroslavsky and Don Knabe, respectively. The recycling areas will have two blue, side-by-side, 30-gallon capacity barrels to help keep recyclable cans, glass and plastic bottles off the beach and out of the ocean. Approximately 60 million people visit Los Angeles County beaches annually and until now, there has not been a widespread recycling program encouraging visitors to recycle beverage containers instead of placing them in the trash or leaving them behind, county officials said. Last year Californians recycled more than 16.1 billion beverage containers, an increase of more than 1.4 billion containers compared to 2007. California continues to lead the nation in total quantity of cans and bottles recycled. It is estimated that implementation of the recycling program will divert 20 percent of beach trash from local landfills, county officials said. For additional information about the project, Beaches and Harbors at (310) 305-9503 or [email protected]/. | High | [
0.6620370370370371,
35.75,
18.25
] |
Q: How to handle rails enums? How can I handle enums in rails? I have googled this, but not finding any clean solutions. So far I have come up with including the concern below on models that use interaction_type_id. This is my foreign key to my enum table in the database. Using this approach I don't have to use ids all over my code, but when saving an object that relates to an interact_type I can say myobject.interaction_type = :file_download This can then persist the the database with the correct id since the concern(see concern below - included on models that use the enum) will return the correct id. module InteractionTypeEnum extend ActiveSupport::Concern included do INTERACTION_TYPE = { file_download: 1, email: 2, telesales: 3, registration: 4, enrolment: 5 } end def interaction_type INTERACTION_TYPE.key(read_attribute(:interaction_type_id)).to_s.gsub('_',' ').capitalize end def interaction_type=(s) write_attribute(:interaction_type_id, INTERACTION_TYPE[s]) end end This just feels heavy. There must be an easier/cleaner way. Now when trying to write tests for this it gets even more messy. Most of the reasons for wanting my enums in code and database are performance (code) and reporting (database). Any help appreciated. Thanks. A: I recommend the active_enum gem. Example from their docs, if you have an integer column called sex on the class User: class User < ActiveRecord::Base enumerate :sex do value :name => 'Male' value :name => 'Female' end end Or you can define the enum in a seperate class: class Sex < ActiveEnum::Base value 1 => 'Male' value 2 => 'Female' end class User < ActiveRecord::Base enumerate :sex, :with => Sex end I like the abstraction it provides, and it saves you from having to create an entire database table just to store your enum values. | High | [
0.704918032786885,
32.25,
13.5
] |
Q: What are these pins for that I keep finding in my steel cabinets? I keep finding these pegs in the steel cabinets I just bought for my garage. During the process of assembly and every time I move them, new ones keep appearing inside the cabinets. Do they serve a purpose or are they a byproduct of the manufacturing process? A: They are the remnants from the rivets used to hold the pieces of steel together. Each rivet contains a piece that holds the metal together and a piece that looks similar to a finish nail. When the "nail like" piece is pulled by the riveting tool it distorts the head then breaks off. Pop Rivet set tool grips shank, draws ball head up through tube rivet to expand it till it bottoms out and breaks at neck inside tube rivet. | Mid | [
0.6009174311926601,
32.75,
21.75
] |
Synthesis and metal cation complexing properties of crown-annelated terthiophenes containing 3,4-ethylenedioxythiophene. Macrocyclic systems derived from crown-annelated terthiophene involving a median EDOT unit have been synthesized by coupling diiodooligooxyethylene chains and bis(2-cyanoethylsulfanyl)terthiophene under high dilution conditions. The metal cation complexing properties of the compounds have been analyzed using 1H NMR, UV-vis spectroscopy, and cyclic voltammetry. These various experiments provide consistent results showing that one of the compounds exhibits interesting complexing properties for Pb2+. | High | [
0.682414698162729,
32.5,
15.125
] |
Q: Well founded recursion in Coq I am trying to write a function for computing natural division in Coq and I am having some trouble defining it since it is not structural recursion. My code is: Inductive N : Set := | O : N | S : N -> N. Inductive Bool : Set := | True : Bool | False : Bool. Fixpoint sum (m :N) (n : N) : N := match m with | O => n | S x => S ( sum x n) end. Notation "m + n" := (sum m n) (at level 50, left associativity). Fixpoint mult (m :N) (n : N) : N := match m with | O => O | S x => n + (mult x n) end. Notation "m * n" := (mult m n) (at level 40, left associativity). Fixpoint pred (m : N) : N := match m with | O => S O | S x => x end. Fixpoint resta (m:N) (n:N) : N := match n with | O => m | S x => pred (resta m x) end. Notation "m - x" := (resta m x) (at level 50, left associativity). Fixpoint leq_nat (m : N) (n : N) : Bool := match m with | O => True | S x => match n with | O => False | S y => leq_nat x y end end. Notation "m <= n" := (leq_nat m n) (at level 70). Fixpoint div (m : N) (n : N) : N := match n with | O => O | S x => match m <= n with | False => O | True => pred (div (m-n) n) end end. As you can see, Coq does not like my function div, it says Error: Cannot guess decreasing argument of fix. How can I supply in Coq a termination proof for this function? I can prove that if n>O ^ n<=m -> (m-n) < m. A: The simplest strategy in this case is probably to use the Program extension together with a measure. You will then have to provide a proof that the arguments used in the recursive call are smaller than the top level ones according to the measure. Require Coq.Program.Tactics. Require Coq.Program.Wf. Fixpoint toNat (m : N) : nat := match m with O => 0 | S n => 1 + (toNat n) end. Program Fixpoint div (m : N) (n : N) {measure (toNat m)}: N := match n with | O => O | S x => match m <= n with | False => O | True => pred (div (m-n) n) end end. Next Obligation. (* your proof here *) A: Although gallais's answer is definitely the way to go in general, I should point out that we can define division on the natural numbers in Coq as a simple fixpoint. Here, I'm using the definition of nat in the standard library for simplicity. Fixpoint minus (n m : nat) {struct n} : nat := match n, m with | S n', S m' => minus n' m' | _, _ => n end. Definition leq (n m : nat) : bool := match minus n m with | O => true | _ => false end. Fixpoint div (n m : nat) {struct n} : nat := match m with | O => O | S m' => if leq (S m') n then match n with | O => O (* Impossible *) | S n' => S (div (minus n' m') (S m')) end else O end. Compute div 6 3. Compute div 7 3. Compute div 9 3. The definition of minus is essentially the one from the standard library. Notice on the second branch of that definition we return n. Thanks to this trick, Coq's termination checker can detect that minus n' m' is structurally smaller than S n', which allows us to perform the recursive call to div. There's actually an even simpler way of doing this, although a bit harder to understand: you can check whether the divisor is smaller and perform the recursive call in a single step. (* Divide n by m + 1 *) Fixpoint div'_aux n m {struct n} := match minus n m with | O => O | S n' => S (div'_aux n' m) end. Definition div' n m := match m with | O => O (* Arbitrary *) | S m' => div'_aux n m' end. Compute div' 6 3. Compute div' 7 3. Compute div' 9 3. Once again, because of the form of the minus function, Coq's termination checker knows that n' in the second branch of div'_aux is a valid argument to a recursive call. Notice also that div'_aux is dividing by m + 1. Of course, this whole thing relies on a clever trick that requires understanding the termination checker in detail. In general, you have to resort to well-founded recursion, as gallais showed. | Mid | [
0.546762589928057,
28.5,
23.625
] |
# coding: utf-8 # Copyright (c) Max-Planck-Institut für Eisenforschung GmbH - Computational Materials Design (CM) Department # Distributed under the terms of "New BSD License", see the LICENSE file. from __future__ import print_function from collections import OrderedDict import inspect from pyiron.atomistics.structure.atoms import Atoms from pyiron_base import ParallelMaster, JobGenerator, get_function_from_string from pyiron.atomistics.job.atomistic import AtomisticGenericJob __author__ = "Jan Janssen" __copyright__ = ( "Copyright 2020, Max-Planck-Institut für Eisenforschung GmbH - " "Computational Materials Design (CM) Department" ) __version__ = "1.0" __maintainer__ = "Jan Janssen" __email__ = "[email protected]" __status__ = "production" __date__ = "Sep 1, 2017" class AtomisticParallelMaster(ParallelMaster, AtomisticGenericJob): def __init__(self, project, job_name): super(AtomisticParallelMaster, self).__init__(project, job_name=job_name) @property def structure(self): if self.ref_job: return self._ref_job.structure else: return None @structure.setter def structure(self, basis): if self.ref_job: self._ref_job.structure = basis else: raise ValueError( "A structure can only be set after a reference job has been assinged." ) def get_structure(self, iteration_step=-1): if iteration_step == 0: return self.structure else: raise ValueError("iteration_step should be either 0.") class GenericOutput(OrderedDict): def __init__(self): super(GenericOutput, self).__init__() class MapMaster(AtomisticParallelMaster): def __init__(self, project, job_name): """ Args: project: job_name: """ super(MapMaster, self).__init__(project, job_name) self.__name__ = "MapMaster" self.__version__ = "0.0.1" self._job_generator = MapJobGenerator(self) self._map_function = None self.parameter_list = [] @property def modify_function(self): return self._map_function @modify_function.setter def modify_function(self, funct): self._map_function = funct def to_hdf(self, hdf=None, group_name=None): """ Store the ParameterMaster in an HDF5 file Args: hdf (ProjectHDFio): HDF5 group object - optional group_name (str): HDF5 subgroup name - optional """ super(MapMaster, self).to_hdf(hdf=hdf, group_name=group_name) if len(self.parameter_list) != 0: with self.project_hdf5.open("input") as hdf5_input: first_element = self.parameter_list[0] if isinstance(first_element, Atoms): with hdf5_input.open("structures") as hdf5_input_str: for ind, struct in enumerate(self.parameter_list): struct.to_hdf( hdf=hdf5_input_str, group_name="s_" + str(ind) ) elif isinstance(first_element, (int, float, str, list)): hdf5_input["parameters_list"] = self.parameter_list else: raise TypeError() if self._map_function is not None: try: hdf5_input["map_function"] = inspect.getsource( self._map_function ) except IOError: hdf5_input["map_function"] = "None" else: hdf5_input["map_function"] = "None" def from_hdf(self, hdf=None, group_name=None): """ Restore the ParameterMaster from an HDF5 file Args: hdf (ProjectHDFio): HDF5 group object - optional group_name (str): HDF5 subgroup name - optional """ super(MapMaster, self).from_hdf(hdf=hdf, group_name=group_name) with self.project_hdf5.open("input") as hdf5_input: if "structures" in hdf5_input.list_groups(): with hdf5_input.open("structures") as hdf5_input_str: self.parameter_list = [ Atoms().from_hdf(hdf5_input_str, group_name) for group_name in sorted(hdf5_input_str.list_groups()) ] else: self.parameter_list = hdf5_input["parameters_list"] function_str = hdf5_input["map_function"] if function_str == "None": self._map_function = None else: self._map_function = get_function_from_string(function_str) def collect_output(self): pass class MapJobGenerator(JobGenerator): @property def parameter_list(self): """ Returns: (list) """ return self._job.parameter_list def modify_job(self, job, parameter): return self._job._map_function(job, parameter) def pipe(project, job, step_lst, delete_existing_job=False): """ Create a job pipeline Args: project (pyiron.Project): Project to calculate pipeline in job (AtomisticGenericJob): Template for the calculation step_lst (list): List of functions which create calculations Returns: FlexibleMaster: """ job_lst_master = project.create_job(project.job_type.FlexibleMaster, job.job_name + '_lstmaster', delete_existing_job=delete_existing_job) if job_lst_master.status.finished: return job_lst_master else: for i, step_funct in enumerate(step_lst): job_lst_master.append(step_funct(job)) if i > 0 and 'for_each_structure' in step_funct.__name__: job_lst_master.function_lst.append(_structure_many_to_many) elif i > 0: job_lst_master.function_lst.append(_structure_one_to_one) return job_lst_master def _structure_one_to_one(job_prev, job_next): """ Copy final structure from previous job to the input structure of the next job Args: job_prev (AtomisticGenericJob): previous Job object job_next (AtomisticGenericJob): next Job object """ job_next.structure = job_prev.get_structure(iteration_step=-1) def _structure_many_to_many(job_prev, job_next): """ Copy list of final structures from previous job to the input structure list of the next job Args: job_prev (AtomisticParallelMaster): previous Job object job_next (AtomisticParallelMaster): next Job object """ job_next.structure_lst = job_prev.list_structures() | Low | [
0.516252390057361,
33.75,
31.625
] |
/* * Licensed to the Apache Software Foundation (ASF) under one * or more contributor license agreements. See the NOTICE file * distributed with this work for additional information * regarding copyright ownership. The ASF licenses this file * to you under the Apache License, Version 2.0 (the * "License"); you may not use this file except in compliance * with the License. You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, * software distributed under the License is distributed on an * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY * KIND, either express or implied. See the License for the * specific language governing permissions and limitations * under the License. */ package org.apache.usergrid.persistence.core.astyanax; import com.netflix.astyanax.model.Column; /** * Simple parser to parse column names */ public class StringColumnParser implements ColumnParser<String, String> { private static StringColumnParser INSTANCE = new StringColumnParser(); @Override public String parseColumn( final Column<String> column ) { return column.getName(); } /** * Get the singleton instance since this parser doesn't have state * @return */ public static StringColumnParser get(){ return INSTANCE; } } | Mid | [
0.6228239845261121,
40.25,
24.375
] |
The pound fell again on Monday – dipping below $1.20 at one point – as concern mounted that the UK was heading for a “hard” Brexit from the European Union and its single market, a day before a speech by Theresa May on the government’s plans. Some newspapers have billed the prime minister’s speech on Tuesday as a push away from preferential EU single market access and a hardening of the UK’s stance toward an economic bloc that accounts for roughly half its exports and imports. A spokeswomen for May, who will also attend a gathering of the world’s economic elite in Davos, Switzerland, this week, called the reports about the planned tone of her upcoming speech “speculation”. That helped steady sterling in London trading but couldn’t repair all the damage. The pound at one point had dropped below $1.20 to a three-decade low against the dollar, barring its “flash crash” in October, and as much as 2.5% against the Japanese yen. Pound v dollar, January 2017 Pound v dollar, January 2017 “It’s clear that sterling is still very vulnerable to ‘hard’ Brexit fears,” said Rabobank currency strategist Jane Foley. “The uncertainty is itself also a negative factor, and I think perhaps that’s one of the reasons for Theresa May’s speech on Tuesday, to provide a little bit of clarification.” With May expected to trigger article 50 by the end of March, which will start formal EU separation proceedings, the battle lines are already being drawn. British finance minister Philip Hammond also gave a thinly veiled warning in a German newspaper interview at the weekend that the UK could use corporate tax as a form of leverage in Brexit negotiations. “If we have no access to the European market, if we are closed off, if Britain were to leave the European Union without an agreement on market access, then we could suffer from economic damage at least in the short term,” he said. “In this case, we could be forced to change our economic model.” However, he added that Britain did not want to close its doors completely to EU citizens who wanted to work in the UK. May’s spokeswoman said on Monday her boss shared Hammond’s view on Britain’s tax framework. She added, though, that she did not recognise comments from Sunday Times sources that May’s office was expecting a “market correction” after her speech. Norway’s $885bn-nil advantage in Britain’s sea of social troubles Read more May has said she will trigger article 50, starting the formal withdrawal from the EU, by the end of March. So far, she has revealed few details about what kind of deal she will seek, frustrating some investors, businesses and MPs. May’s speech on Tuesday will stress the need for Britons, who voted for Brexit by 52% to 48% in last June’s referendum, to unite around common goals such as protecting and enhancing workers’ rights. Chris Weston, of IG in Melbourne, said: “The market is now positioning for some fairly punchy rhetoric from Theresa May and this idea of ‘hard Brexit’. A clean break from the single market seems increasingly likely. “We also hear from the UK supreme court this week amid a market is starting to head towards a ‘hard Brexit’ and the great unknown. Forget the run of good UK data, GBP is an out-and-out political currency (it has been for a while) and the prospect of volatility here is now very high.” Later on Monday, Bank of England overnor Mark Carney, who has delivered a string of warnings about the potential impact of Brexit, will give a speech at the London School of Economics on the policy issues affecting the bank. The central bank cut interest rates to a record low and pumped fresh stimulus into the economy shortly after the Brexit vote, but it is now seeing inflation accelerate as a result of sterling’s slide. The pound has fallen almost 20% against the dollar and nearly 14% against the euro since the vote. In afternoon trading on Monday, it was down more than 1% against the dollar at $1.2045 and 0.7% against the European single currency at €1.1370. Commenting on the moves, Michael Hewson, analyst at spread-betting and trading firm CMC Markets said: “While it is notable that the pound has revisited its October lows against the US dollar, against the euro it hasn’t come anywhere near close to them, reflecting perhaps the increased risks to Europe from upcoming political uncertainty in the coming months.” “The pound may well have also been helped by a further U-turn by the IMF as they upgraded their growth forecasts for the UK economy for 2017 from 1.1% to 1.5%,” he added, referring to the latest outlook for the UK and other economies from the International Monetary Fund. | Low | [
0.530751708428246,
29.125,
25.75
] |
1. Introduction {#sec1} =============== Environmental risk factors can interact with genetic factors or a sequence of disease-involving genes characteristic for each individual. These confounding factors can complicate the phenotype of the diseases and prevent identification of primary element(s) in different pathologies. Indeed, it is hard to determine whether any particular pathology is linked with the stress caused by a risk factor or if it is a consequence of the pathology or a combination of both. Oxidative stress is associated with many age-related diseases including age-related macular degeneration (AMD) \[[@B1]\]. Cells possess many different protective mechanisms to combat the acute detrimental effects of oxidative stress; however, chronically elevated stress can induce local pathological changes which may be irreversible. This can be due to a reduced cellular defense reaction towards the stress that subsequently leads to increased detrimental changes, and, eventually, a vicious cycle forms in which oxidative stress impairs the antioxidant properties of the cells and facilitates further the extent of stress. Damaged cellular components, which are no longer functional, should be degraded by cellular clearance systems including autophagy, which is a self-eating process triggered by oxidative stress and hypoxia. If the autophagic degradative pathway is faulty, an accumulation of damaged proteins as aggregated deposits takes place that may cause anatomical obstacles to physiological processes \[[@B1]\]. Therefore, the triplet of oxidative stress-hypoxia-impaired autophagy may play an important role in the pathophysiology of AMD. This review will elaborate the interplay between these triplet factors and how they associate with neovascular processes occurring in this disease. 2. Age-Related Macular Degeneration {#sec2} =================================== AMD is the main cause of irreversible vision loss in the elderly people accounting for about half of the newly registered cases of blindness in the developed world. The age-related increase in prevalence of the advanced form of the disease has been estimated to rise and reach an overall morbidity of 50% by the year 2020 \[[@B2], [@B3]\]. The initial symptoms of AMD include loss of central visual acuity, a subjective impression of the curvature of straight lines or metamorphopsia, and gradually enlarging central scotoma. The disease has a multifactorial etiology involving various environmental, demographic, and genetic risk factors. Although age is the most significant risk factor in AMD, the disease is also associated with hypertension, atherosclerosis, smoking, fat-rich diet, obesity, genetics, and epigenetics \[[@B4]--[@B7]\]. The abundance and complex interactions between all these risk factors limit the effectiveness of therapeutic options. The macular structures undergoing pathological changes are functionally and anatomically distinct but related, that is, photoreceptors, retinal pigment epithelium (RPE), Bruch\'s membrane, and choriocapillaris ([Figure 1](#fig1){ref-type="fig"}). The central processes involved in AMD pathology are, in the early or dry type of the disease, lipofuscinogenesis, autophagocytosis, and drusenogenesis, accompanied or followed by inflammation and neovascularization in the wet type of AMD (see later) \[[@B1]\]. 3. Association between Pathophysiological Factors in AMD {#sec3} ======================================================== Since the retina is one of the tissues with the most intense blood flow in the organism, retinal structural changes associated with AMD can result in disturbance of retinal blood flow. The Blue Mountains Eye Study indicated that AMD is associated with focal arterioral narrowing and arteriovenous nicking in the retinal vasculature \[[@B3]\]. Vascular factors have been reported to play an important role in the AMD pathogenesis. There is a growing body of evidence that choroidal and retinal blood flow are diminished in AMD \[[@B8], [@B9]\]. Therefore, hypoxia is thought to be associated with the progression of AMD. Normal retinal physiology and all forms of AMD are regulated by vascular growth factors, but under certain conditions, the physiological balance shifts to pathological \[[@B10]\]. Vascular dysfunctions may result in oxidative stress, that is, overproduction of ROS, which induces further changes in the retinal vessels. Such changes can also be evoked by hypoxia, since it stimulates synthesis and release of hypoxia-inducible factor-1 (HIF-1) and vascular endothelial growth factor (VEGF) that contribute to neovascularization (NV). Noteworthy here is that hypoxia is a classical inducer of autophagy \[[@B11]\], which in turn can be stimulated by oxidative stress in an attempt to clear macromolecules damaged by ROS. Therefore, interaction between hypoxia, oxidative stress, and autophagy exists and it can be postulated to play an important role in the pathogenesis of AMD ([Figure 1](#fig1){ref-type="fig"}). 4. Oxidative Stress in AMD {#sec4} ========================== Oxidative stress results from disturbances in the prooxidative/antioxidative cellular balance due to elevated levels of oxidation reactions producing ROS: superoxide anion (O~2~ ^−∙^), hydroxyl radical (OH^∙^), hydrogen peroxide (H~2~O~2~), and singlet oxygen (1O~2~). ROS can be formed in many ways, (1) as a product of the respiratory chain in mitochondria, photochemical and enzymatic reactions, (2) as a result of the exposure to UV light, (3) ionizing radiation, or (4) heavy metal ions. Hydrogen peroxide is a molecule with low reactivity, but it can readily penetrate cell membranes and generate the most reactive form of oxygen---the hydroxyl radical, via the Fenton reaction: H~2~O~2~ + Fe^2+^ → Fe^3+^ + OH^−^ + OH^∙^. ROS play an important role in the regulation of many physiological processes involved in intracellular signaling \[[@B12]\], but they can also induce serious damage to biomolecules. Lipid peroxidation (autooxidation) is a process of oxidation of polyunsaturated fatty acids due to the presence of several double bonds in their structure and it involves production of peroxides and reactive organic free radicals. The latter can then react with other fatty acids, initiating a free radical reaction cascade. ROS also attack structural and enzymatic proteins by the oxidation of residual amino acids, prosthetic groups, formation of cross links, and protein aggregates as well as proteolysis. The inactivation of key proteins can have serious consequences in the vital metabolic pathways. ROS can also react with nucleic acids attacking the nitrogenous bases and the sugar phosphate backbone. Furthermore, they can evoke single- and double-stranded DNA breaks. The cells\' inability to repair the incurred damage may lead to death or, alternatively, mutations may occur in the DNA leading to carcinogenesis or development of neurodegenerative diseases \[[@B13]\]. Mitochondrial DNA (mtDNA) is more susceptible to oxidative damage than its nuclear counterpart \[[@B14]\]. Mutations in mtDNA can cause disturbances in the respiratory chain and loss of control of ROS production. mtDNA is not protected by histones or other associated proteins, and since it has intronless regions and a high transcription rate, it has a higher susceptibility to oxidative modifications in its coding region. The much less effective repair system for mtDNA damage may be the cause for accumulating oxidative stress and its consequences thereof. Oxidative damage of the cellular components plays an important role in the senescence process \[[@B15]\]. The amount of accumulated damage increases with age due to impairs in the DNA repair system and an intensified oxidative stress and decreased antioxidant defense \[[@B14]\]. Mutations in the key DNA repair genes result in an impaired recognition system and an inefficient repair of DNA damage, which accelerates the aging of the organism, leading to age-related disruptions in cellular and tissue functions. The aging of the organism is inevitable since the formation of ROS is a result of normal daily cellular metabolism. Therefore, cells have developed complex defense mechanisms to combat both the formation of ROS and the impacts of their actions. Cells which are the most sensitive to oxidative damage are nonproliferative postmitotic cells, including photoreceptors and RPE cells, since they do not possess any DNA damage detection systems in the cell cycle checkpoints. Furthermore, the macular environment promotes the production of ROS. In the macula, the predominant photoreceptors are cones, which have higher demand and production of energy than rods and, therefore, higher demand for oxygen \[[@B16]--[@B19]\]. In addition, rods and cones differ in their susceptibility to oxidative stress, with cones exhibiting a higher sensitivity to free radicals \[[@B20]\]. The macula is constantly exposed to a high metabolic rate and oxidative stress due to the high partial pressure of choriocapillaris and the amount of polyunsaturated fatty acids (PUFAs) from the retinal outer segments \[[@B21]\]. Oxidated PUFAs are not efficiently digested in the lysosomes of aged RPE cells and become deposited in the form of lipofuscin ([Figure 1](#fig1){ref-type="fig"}). This is thought to be important in inducing the formation of drusen between the RPE cells and Bruch\'s membrane. Lipofuscin is a chromophore, serving as the main RPE photosensitizer \[[@B22]\], which, after absorbing a high-energy photon, especially that of blue light, undergoes a variety of photochemical reactions involving ROS formation, which, in turn, evoke photochemical damage in the retina and RPE cells \[[@B23]\]. 5. Hypoxia in AMD Pathophysiology {#sec5} ================================= In the majority of human tissues, the concentration of oxygen ranges from 3 to 5% and a decline below this range is usually considered hypoxia \[[@B24]\]. In a more general sense, hypoxia may be defined as a decrease in available oxygen reaching the tissues of the body. Hypoxia should not be considered dangerous in itself, because many human beings live at high altitudes and they have adapted to live under reduced oxygen tension. However, some serious consequences of hypoxia can occur, including failure of energy balance causing ATP depletion, ROS-induced damage of cellular components, uncontrolled excitatory neurotransmitter release, inflammation and stimulation of the immune system, and delayed cell death \[[@B25]\]. The cellular reactions to hypoxia evoke change in expression of many genes. HIF-1 is the main regulator of oxygen homeostasis and consists of HIF-1*α* and HIF-1*β* subunits \[[@B26]\]. HIF-1 regulates the expression of hundreds of genes to ensure cell survival under conditions of hypoxic stress, aimed at restoring O~2~ homeostasis. Under hypoxic conditions, HIF-1 interacts with pyruvate dehydrogenase kinase 1 (PDK1), lactate dehydrogenase A (LDHA), and BNIP3 and BNIP3L proteins involved in the mitochondrial autophagy pathway \[[@B26]--[@B30]\]. In general the inner retina layers are better protected from ischemic stress than other parts of the central nervous system; these cells are capable of recovering after an acute hypoxic insult, but not after chronic retinal ischemia and hypoxia which can lead to cell death and irreversible visual impairment \[[@B31]--[@B34]\]. There is a report that retinal blood flow is disturbed in both dry and wet or neovascular type of AMD \[[@B35]\]. Moreover, the reduction in choroidal perfusion has been positively correlated with AMD progression \[[@B36]\]. These observations indicate that hypoxia is associated with AMD. Nonetheless, the question remains: is the hypoxia a consequence or a reason for the disease? The answer to this question is hard to formulate as long as our knowledge about very early mechanisms of AMD is so scarce. Measurement of oxygen tension, perfusion pressure, and blood flow rate indicates that hypoxia is the result of diminished choroidal blood circulation \[[@B34], [@B35]\]. Inflammation and local hypoxia are present in the aging of choriocapillaris, RPE cells, and neural retina \[[@B36]\]. During inflammation, hypoxia in the retinal cells may result from increased consumption of oxygen due to the increased metabolic activity of the inflamed retina. In general, AMD can be characterized as presence of chronic inflammatory state, with local infiltration of inflammatory cells, higher circulatory levels of proinflammatory cytokines, and complement components \[[@B37]\]. Although the precise mechanisms underlying such chronic inflammation are not yet known, it can be speculated that oxidative stress-related damage to macromolecules in the retina may activate redox-regulated transcription factors, such as nuclear factor kappa B (NF-*κ*B), and increase the expression of proinflammatory molecules. NF-*κ*B can also be activated by advanced glycation end products (AGEs) and their receptor (RAGE) that are all overexpressed in AMD \[[@B38], [@B39]\]. Chronic oxidative stress and the presence of chronic inflammation decrease the ability of RPE cells to remove damaged or nonfunctional proteins via the lysosomal clearance system, including autophagy ([Figure 1](#fig1){ref-type="fig"}) \[[@B1]\]. 6. Autophagy: A Cellular Clearance System in AMD {#sec6} ================================================ Autophagy, also known as self-eating, is a process of degradation and elimination of no longer needed intracellular components \[[@B40]\]. It contributes to the equilibrium between the production of proteins and organelles and their clearance. In addition to removing defective structures, autophagy is a means of providing macromolecules for energy generation under conditions of nutritional starvation \[[@B41]\]. Autophagy can be categorized into at least three classes: macroautophagy, chaperone-mediated autophagy (CMA), and microautophagy. A marked reduction of macroautophagic activity with aging has been associated with an increase in CMA \[[@B42]\], while microautophagy has been less described in the pathogenesis of AMD. The main focus here will be on macroautophagy (often referred to as just autophagy), which involves the formation of autophagosomes, double-membrane vesicles, in a multistep process. The autophagosomes combine with lysosomes and degrade their contents with several acidic hydrolases. This process is mediated by more than 30 autophagy-related (Atg) proteins. Macroautophagy consists of two subsets: autophagy of specific organelles and selective macroautophagy. Although substantial progress has been made in understanding the complex mechanisms regulating autophagy, many interactions involved in controlling this process have not been adequately described so far \[[@B40]\]. ROS inhibits the activity of the signaling protein mammalian target of rapamycin (mTOR) that evokes dephosphorylation of Atg13, activation of Serine/threonine-protein kinases-ULKs, and recruitment of FIP200. The ULKs-Atg13-FIP200 complex plays a crucial role in the formation of double-membrane autophagic vacuoles---the autophagosomes \[[@B43]--[@B45]\]. Other important proteins in the autophagosome formation are Atg14L (Atg14L-Beclin 1-hVps34-p150) and UVRAG (UVRAG-Beclin 1-hVps34-p150) complexes. Atg8/LC3 is a ubiquitin-like protein which connects autophagy to the proteasomal clearance system via ubiquitin and p62 binding sites ([Figure 2](#fig2){ref-type="fig"}) \[[@B1], [@B46], [@B47]\]. LC3 is formed by the cleavage of its precursor by Atg4 and modification with phosphatidylethanolamine (PE) mediated by Atg7, Atg3, and Atg16L complex. Atg7 promotes the formation of the Atg10--Atg12, Atg5--Atg12, and LC3-PE conjugates, which also play an essential role in the creation of the final form of autophagosome \[[@B43]--[@B45]\]. Atg7, Atg3, and Atg10 are sensitive to redox signaling, which supports the association between autophagy and oxidative stress. We recently described that the SQSTM1/p62 protein is a connecting link between autophagy and proteasome-mediated proteolysis, which is upregulated under exposure to various oxidative stimuli in AMD donor samples \[[@B48]\]. One critical step in autophagy clearance is fusion of autophagosome and lysosome that is regulated by Rab7, LAMP-2, and a large superfamily of specific small proteins, SNAREs (SNAP (soluble N-ethyl-maleimide-sensitive-fusion-protein attachment protein) receptors) ([Figure 2](#fig2){ref-type="fig"}) \[[@B49]\]. SNAREs increase the permeability of membranes and drive the actual membrane opening leading to fusion of the contents of the two organelles \[[@B50]\]. After fusion, the lysosomal proteases, which include cathepsins D, B, and L, degrade the sealed cargo proteins \[[@B51], [@B52]\]. The enzyme activity of the cathepsins is suppressed by oxidized lipoprotein, emphasizing the mutual relationship between oxidative stress and autophagy \[[@B53]\]. Impaired lysosomal function evokes decreased autophagy flux that may be a critical aspect of RPE cell degeneration and AMD development \[[@B54]\]. 7. Neovascularization in AMD {#sec7} ============================ Unlike dry type of AMD, wet or exudative AMD is hallmarked by defects in Bruch\'s membrane or the outer blood-retina barrier, as well as formation of choroidal neovascularizations (CNVs) and/or subretinal neovascular membranes (SRNVMs). CNV evokes retinal edema that is one diagnostic criterion for wet AMD ([Figure 3](#fig3){ref-type="fig"}). Besides these, a direct pathological contact between RPE and endothelial cells (ECs) can enhance the proangiogenic potential of the ECs to proliferate and migrate, similar to the process induced by hypoxia. The linkage between pathological changes in the RPE and the development of CNVs is the result of a multifactorial interplay of oxidative stress, hypoxia, and autophagy in wet AMD pathogenesis. Using EpiphaNet\' interactive tool software (<http://epiphanet.uth.tmc.edu/>) and a mesh of linkage terms such as "angiogenesis," "autophagy," and "age-related macular degeneration," one can find putative connector pathways for these processes ([Figure 4](#fig4){ref-type="fig"}). Platelet endothelial cell adhesion molecule (PECAM-1) and Thrombospondin 1 (TSP-1) stood out as such linkage molecules in the EpiphaNet analysis, and, indeed, they have been shown in the literature to have a mutually reciprocal relationship with angiogenesis \[[@B55]\]. Impaired expression of TSP-1 in rodent eyes with AMD has been previously described, and the decreased TSP-1 level in Bruch\'s membrane and choroidal vessels during AMD has been claimed as the possible cause of CNV \[[@B56]\]. Similarly, interaction analysis between "autophagy" and "angiogenesis" found TSP-1 as a common denominator between angiogenesis, autophagy, and AMD, having been detected as antiangiogenic molecule and a target for antineovascular therapy as well \[[@B57]\]. Besides these, Tek and Angpt1 gene-encoded angiopoietin-1 and receptor, respectively, connect the physiologic and pathologic neovascularization processes with AMD. Indeed, Angp1 has been detected in surgically excised CNV membranes obtained surgically from eyes with AMD, while Tie2/Tek immunoreactivity has been observed in the vascular structures of CNVs, as well as the RPE monolayer \[[@B58]\]. 8. Concluding Remarks {#sec8} ===================== There is a growing body of evidence suggesting that oxidative stress is linked to hypoxia in AMD. Similar relationships probably also exist between oxidative stress and deficient autophagy as well as between faulty autophagy and hypoxia in AMD. Therefore, the trio of oxidative stress-hypoxia autophagy may represent a self-fueling chain reaction of events, which accelerates AMD progression. However, the question "Who was the first?" still remains open. In many cases, oxidative stress is a primary source of ROS, which can damage cellular biomolecules and organelles. Their accumulation should lead to their degradation by cellular clearance systems of which autophagy is one of the most important. However, since autophagy can be disturbed by the activities of ROS, this may lead to detrimental protein accumulation. These negative properties of ROS may also affect vascular molecules, disturbing the choroidal blood flow and inducing hypoxia. The relationship between hypoxia and ROS production has not been firmly established but many of the ambiguous results in this topic can be attributed to the lack of adequate techniques to detect or determine the exact ROS levels in the retina. Therefore, further studies investigating the mechanisms underlying the mutual associations between oxidative stress, hypoxia, and autophagy in the different forms of AMD, in particular neovascular AMD, should aim at clarifying this issue. The authors thank Ms. Ewelina Synowiec and Mr. Sylwester Glowacki for their help in editing the paper and Dr. Ewen Macdonald for checking the language. Conflict of Interests ===================== The authors declare that there is no conflict of interests regarding the publication of this paper. {#fig1} {#fig2} {#fig3} {#fig4} [^1]: Academic Editor: Daniel Petrovič | High | [
0.6799007444168731,
34.25,
16.125
] |
We went camping in Provo Canyon (near Squaw Peak and Little Rock Canyon Overlook) and saw some deer up on a hill that we wanted to get a closer look at. On our way up, we thought we saw a bear, until the monster stood up and looked right at us. We ran straight to the car after that, leaving our tent and everything behind. It's probably all still up there. We have lots of other videos from our camping trip that day that we'll post soon, including the deer and hiking up towards them. The video clip really didn't show enough to determine whether it was something known or something unknown. It would have been helpful if they could have recorded for about 5 more seconds, but as it stands I couldn't determine anything. jk .. because we dont really know the footage was awesome until they ruined the best of it running like scared chicken .. could have been the best evidence of Bigfoot but noooooooooooo .. they had to runn would have understand if it was nighttime .. but in day light is different Originally posted by TXRabbit Not sure about you guys but when I go camping, I like to wear boots. If I were to go out to make a video, I'd wear my street shoes. Personal preference though edit on 5-11-2012 by TXRabbit because: (no reason given) That's by total preference. I don't have hiking boots or any boots so when i camp I wear either a pair of sandals or an old pair of shoes. It all depends on where you are camping at and also what you are doing during that time of camping. The Above Top Secret Web site is a wholly owned social content community of The Above Network, LLC. This content community relies on user-generated content from our member contributors. The opinions of our members are not those of site ownership who maintains strict editorial agnosticism and simply provides a collaborative venue for free expression. | Low | [
0.5,
34,
34
] |
Q: java get user's home directory of the non current user on *NIX I came across System.getProperty("user.home") in java, but I want a way in which I can get the home directory of another user that's not the current user for a UNIX like system. A: Java has no such knowledge of the host system. However the information is present in the /etc/passwd file. One approach is to manually parse this file, given you have sufficient permissions. | Mid | [
0.6347607052896721,
31.5,
18.125
] |
17 F.2d 55 (1926) NORTH SIDE CANAL CO., Limited, v. STATE BOARD OF EQUALIZATION OF WYOMING et al. and seven other appeals. Nos. 7350-7357. Circuit Court of Appeals, Eighth Circuit. December 20, 1926. James R. Bothwell, of Twin Falls, Idaho, and C. R. Ellery, of Cheyenne, Wyo. (W. Orr Chapman, of Twin Falls, Idaho, and Kinkead, Ellery & Henderson, of Cheyenne, Wyo., on the brief), for appellant canal companies. Ethelbert Ward, Sp. Asst. Atty. Gen. (Albert D. Walton, U. S. Atty., and Clyde M. Watts, Asst. U. S. Atty., both of Cheyenne, Wyo., and B. E. Stoutemyer, Dist. Counsel, U. S. Reclamation Service, of Boise, Idaho, on the brief), for the United States. W. C. Mentzer, of Cheyenne, Wyo. (J. A. Christmas, of Kemmerer, Wyo., and W. W. Neilson, of Jackson, Wyo., on the brief), for appellee counties. Ray E. Lee, of Cheyenne, Wyo. (David J. Howell, Atty. Gen., of Wyoming, on the brief), for appellee State Board of Equalization. Before LEWIS, Circuit Judge, and MUNGER and FARIS, District Judges. LEWIS, Circuit Judge. These are appeals in four suits, all dismissed on final hearing, wherein the legality of certain tax levies and threatened future levies were assailed. Two of the suits were instituted by North Side Canal Company, an Idaho corporation, *56 one being against Lincoln County, Wyoming, its tax officials and the members of the State Board of Equalization of that State; and the other against Teton County, Wyoming, its tax officials and the members of the State Board. The other two suits were instituted by Twin Falls Canal Company, an Idaho corporation, against the same parties. The United States intervened in each of the suits, on the claim that the levies were an interference with its functions in the reclamation of its arid lands, and on dismissal of its petitions after final hearing, it has brought separate appeals. A statement of the principal facts developed at the hearing and a summary of the pleadings will present the situation and the issues involved. Two Carey Act projects (Act August 18, 1894, 28 Stat. 422, § 4 [Comp. St. § 4685]), both in Idaho, one on the north side of the Snake River and one on the south side, have been carried through. Wiel on Water Rights in the Western States (3d Ed.) c. 59, shows in general the legislative provisions made in Idaho and Wyoming, accepting the terms of the Federal statute and providing methods for initiating a complete reclamation of public lands under the Carey Act. The statutes of the two States are alike. The lands in the project on the south side of the river were segregated under the Act in 1902, and those on the north side in 1906. In the latter about 185,000 acres have been brought under cultivation by the application of water, and in the former about 205,000 acres. The State of Idaho entered into a contract with a corporation for the construction of the irrigation system for each project, as its statute accepting the terms of the Carey Act provides. These corporations, called construction companies, were required by the contract to sell to persons filing upon the segregated lands susceptible of irrigation a water right or share in the irrigation system for each acre filed upon. Each share represented a carrying capacity in the canal system for delivery of water at the rate of one-eightieth of one cubic foot per second per acre. These contracts also provided for the organization of corporations to take over and manage the systems after they had been constructed. The two managing companies, later organized, are known as operating companies. Their capital stock was on the basis of one share for each acre irrigated. They are holding and operating companies of the irrigation systems for the lands reclaimed under the two projects. They brought these suits. While reclamation was being carried on under these two Carey Act projects a reclamation project under the Act of June 17, 1902 (32 Stat. 388 [Comp. St. §§ 4700-4708]), was being developed in the same vicinity in Idaho, and to obtain water therefor the United States made application to the State of Wyoming for a permit (which was granted pursuant to the statutes of that State) to construct a dam in the south fork of Snake River in Wyoming for the purpose of impounding the waters of the stream in order to hold them for the irrigation season, then to release them into the river's channel and carry them down to the lands to be irrigated in Idaho. The dam was constructed by the United States. The waters so held were entirely for the reclamation project under the Act of June 17, 1902. In connection therewith and for the purpose of diverting the impounded waters as needed onto the lands to be reclaimed, a dam was constructed in Snake River near Minidoka, Idaho, some 300 miles, as the river flows, below the Wyoming dam. The lands thus to be reclaimed were called the Minidoka project. As reclamation of the lands in the two Carey Act projects proceeded it was discovered that the water supply theretofore obtained for them was not sufficient in amount; so on February 25, 1913, the Kuhn Irrigation & Canal Company, representing and acting in behalf of the Carey Act construction companies, entered into a contract with the United States whereby it was agreed that the latter would, at the cost and expense of the Kuhn Company, raise the height of the dam in Wyoming 17 feet, thus increasing its impounding capacity 400,000 acre feet. As originally constructed the dam was capable of storing water up to the elevation of 6752, U. S. Reclamation Service Survey and U. S. Geological Survey datum. This contract referred to the dam and the stored water as the Jackson Lake Dam and the Jackson Lake Reservoir. The Kuhn Company was to be entitled to all storage water above elevation 6752, and it was agreed that the water should be turned out as required during the low water period of the irrigation season and delivered and measured to and for the company at the outlet of the reservoir. The United States retained title to the reservoir and works, and its management and control, as provided in section 6 of the Act of June 17, 1902 (Comp. St. § 4705), and section 2 of the Act of February 21, 1911 (36 Stat. 925 [Comp. St. § 4739]), known as the Warren Act. Water, however, was not to be turned out and delivered until the Kuhn Company had paid its proportionate share of each year's cost of maintenance and management *57 of the reservoir, to be ascertained in a specified way, for the preceding year, and the company notified. It was further agreed that the United States would secure the protection of the water so turned out, between the reservoir and the points of intended use, and prevent its diversion by parties not entitled thereto. These services were to be included in the total annual maintenance cost, which it was agreed should be borne proportionately by the United States and the Kuhn Company. It was further agreed that the United States might deliver to the company in place of water to which it was entitled above elevation 6752, water which the United States impounded at Minidoka, to the extent of the capacity of the reservoir there, to wit, about 60,000 acre feet, and in that event one acre foot of water at the Minidoka dam should be accepted for the Carey Act projects as the equivalent of 1½ acre feet delivered at the dam in Wyoming. In addition to the storage capacity above elevation 6752, the United States agreed to allow the Kuhn Company 10,000 acre feet storage capacity in Jackson Lake Reservoir below that elevation. This concession is said in the contract to be in consideration or settlement of a suit brought by one of the Carey Act construction companies. The contract with the Kuhn Company shows that it was made in the interest of the two Carey Act projects, that the project on the south side of the Snake River should be entitled to 19/80 of the rights and benefits that might accrue under the contract, and that on the north side to 61/80. That is, the project on the south side of the river would be entitled to 95,000 acre feet of the increased storage capacity in Jackson Lake Reservoir and that on the north side of the river to the remainder thereof, to-wit, 305,000 acre feet, and also to the 10,000 acre feet below elevation 6752. The United States raised the dam at Jackson Lake Reservoir 17 feet, as agreed in the contract. The cost of its construction was something more than $800,000, which was paid by the two Carey Act construction companies. By assignments from the Kuhn Company all of the rights and benefits which it was to receive under the contract with the United States passed to the construction companies, and ultimately these rights and the two irrigation systems passed to the two operating companies which respectively manage and control the systems, for the sole use and benefit of water users whose interests are represented by the shares which they had purchased from the construction companies. The only stockholders in the two operating companies, plaintiffs-appellants, are the landowners, their shares being represented by certificates for their respective water rights in the irrigation systems, and they maintain the companies for their mutual and proportionate benefits. The dam at Jackson Lake Reservoir was originally constructed under permit from the State of Wyoming, as heretofore said, pursuant to the laws of that State. It was raised 17 feet in height pursuant to a like permit. The application for permit to raise the dam disclosed that the additional water to be impounded was to be used on the Carey Act projects in Idaho. In 1922, and prior thereto, Jackson Lake Reservoir was in Lincoln County, Wyoming, and it assessed and levied taxes for that year against each of the operating companies, North Side Canal Company and Twin Falls Canal Company. The Legislature of Wyoming created Teton County out of a part of the territory of Lincoln County, and after 1922 Jackson Lake Reservoir has been in Teton County. That county assessed and levied taxes against each of the operating companies for the years 1923 and 1924. Thereafter in June, 1924, those companies brought these suits. Each complaint alleges that the assessments and tax levies were illegal and void, in that the action of the tax officials was an attempt by local and State government to tax a contract of the United States, and they seek injunctions against collection of the taxes so levied, and to enjoin future levies. The answers deny that the assessments and levies were made on the contract with the United States, and allege that they were made for the purpose of taxing the water rights and storage capacity acquired by the respective plaintiffs under and by virtue of the contract, and that the rights aforesaid acquired by the plaintiffs were property rights and subject to taxation, and they admit that the defendants will continue to assess and levy taxes on those rights so acquired and will sell said rights for taxes if not paid, unless restrained by order of the court. The United States was permitted to intervene as a plaintiff in each case. It alleged in its bills of intervention that the tax assessments and levies were void, that the dam and reservoir at Jackson Lake were owned and operated by the United States, that the contract for raising the height of the dam was entered into pursuant to the provisions of the Act of February 21, 1911, that the only rights which the plaintiff companies have were based on that Act and the contract made pursuant thereto with the Kuhn Company, that the dam and reservoir were originally constructed by the United States under the provisions of the Act of June 17, 1902, known *58 as the Reclamation Act, and the Acts amendatory thereof, that the assessments and levies were wrongful and unlawful, constituting an attempt to tax property of the United States and to interfere with its rights to make and carry out the Kuhn contract and with its lawful functions and its public policy in aiding in the reclamation of its arid lands. It prayed for injunctive relief. The defendants' answers to the bill in intervention deny that the United States owns or is interested in the property rights assessed and taxed, deny that the assessments and levies were made upon the contract with the Kuhn Company, and allege that the tax was not a burden upon said contract nor did it interfere with its execution nor with the functions of the United States in aiding in the reclamation of its arid lands. There was apparent uncertainty in the minds of the tax officials who made the assessments and levies as to what the exact property was on which the assessments and levies were being made. The tax roll of Lincoln County for 1922 listed the property as "Improvements on lands not taxable." For the years 1923 and 1924 the tax roll of Teton County listed it as "Improvements on lands not taxable, water rights Jackson Lake." Appellant companies insist that these descriptions rendered the tax levies void for uncertainty, but the bills prayed for injunctions against future assessments and levies, the answers admit an intention to make future assessments and levies on what defendants claim to be property rights of the plaintiff companies within the State of Wyoming in Jackson Lake Reservoir, and counsel have argued at length as to whether the companies have any property interests there that are taxable; and so we do not think our disposition of the case should be confined to a consideration of the assessments and levies that had been made prior to the institution of the suits. The stored waters on being released from Jackson Lake Reservoir flow in the Snake River channel through canyons in a south-westerly direction a distance of about 50 miles to the Wyoming-Idaho State line. Passing thence into the State of Idaho, the river does not return to the State of Wyoming but continues in a southwesterly course about 250 miles, all the way within the State of Idaho, before reaching the vicinity of the lands to which the waters are applied. These waters, in addition to the water received from other sources, are not sufficient in amount to supply the needs of irrigation on the reclaimed lands in the two Carey Act projects. During no season prior to the trial had the increased storage capacity of the reservoir, provided for under the Kuhn contract, been filled. On final hearing the court found that the two operating companies (plaintiffs) each held a water right in Jackson Lake Reservoir which, though not appurtenant to lands within the State, were taxable as a severed estate. It thereupon entered decrees in Causes 7350 and 7352, adjudging that North Side Canal Company was the owner of property subject to taxation within the State of Wyoming (in Lincoln County in 1922 and in Teton County thereafter), "to-wit, 305,000 acre feet of storage capacity and water rights in Jackson Lake Reservoir above elevation 6752 feet, U. S. Reclamation Service Survey, and 10,000 acre feet below said elevation," and that the taxes levied thereon were legal; and in Causes 7354 and 7356 that Twin Falls Canal Company was the owner of property subject to taxation within the State of Wyoming, "to-wit, 95,000 acre feet of storage capacity and water rights above the elevation of 6752 feet, U. S. Reclamation Service Survey, in Jackson Lake Reservoir," and that the taxes levied thereon were legal. The court further found that the tax levies were not made upon the contract rights evidenced by the contract between the United States and the Kuhn Company, nor did they interfere with the discharge of any governmental function. And thereupon the complaints and the petitions in intervention were all dismissed. The only ground for equitable relief stated in the complaints was that the tax levies were illegal and void; and their sufficiency for equitable relief was challenged below and that contention is advanced here. Ordinarily the objection would be good. Shelton v. Platt, 139 U. S. 591, 11 S. Ct. 646, 35 L. Ed. 273; Risty v. Railway Co. (C. C. A.) 297 F. 710. In opposition to this contention appellants rely on section 6302, Wyoming Comp. Stat. 1920, which reads: "District courts shall have jurisdiction to enjoin the illegal levy of taxes and assessments, or the collection of either, and of actions to recover back such taxes or assessments as have been collected, without regard to the amount thereof; but no recovery shall be had unless the action be brought within one year after the taxes or assessments are collected." This statute was construed by the Supreme Court of Wyoming in Bunten v. Rock Springs Grazing Ass'n., 29 Wyo. 461, 215 P. 244, and it was said that the section was adopted from Ohio, and under its provisions a plaintiff need not aver and show, in addition to the illegality of the tax, facts bringing the case under *59 some acknowledged head of equity jurisdiction, that it is sufficient to only aver that the tax is illegal. The Ohio statute was considered by the Supreme Court in Cummings v. Merchants' National Bank, 101 U. S. 153, 25 L. Ed. 903, and the court held that the statute created a new right and provided a new remedy, and that right and remedy would be enforced in the Federal court within the State creating the new right and remedy. The Court of Appeals for the Sixth Circuit has followed the Cummings Case in applying the Ohio statute. Grether v. Wright (C. C. A.) 75 F. 742; Mercantile National Bank v. Hubbard (C. C. A.) 105 F. 809; McKnight v. Dudley (C. C. A.) 148 F. 204. A like statute of Arkansas has been followed by the Federal court sitting in that State; Mudge v. McDougal (D. C.) 222 F. 562. In Davis v. Gray, 16 Wall. 203, 21 L. Ed. 447, it is said: "A party by going into a national court does not lose any right or appropriate remedy of which he might have availed himself in the State courts of the same locality." And in Dawson v. Kentucky Distilleries & Warehouse Co., 255 U. S. 288, 41 S. Ct. 272, 65 L. Ed. 638, it is said: "And if the equitable remedy was available in the State courts it was not lost by suing in the Federal court." See also Darragh v. H. Wetter Mfg. Co. (C. C. A.) 78 F. 7; Brun v. Mann (C. C. A.) 151 F. 145, 12 L. R. A. (N. S.) 154. On the merits the prime inquiry is, whether the two Idaho operating companies, or their beneficiary stockholders, held or owned title to property or property rights in Jackson Lake Reservoir subject to taxation in Wyoming. The dam and reservoir were not and could not be taxed, admittedly they belong to the United States; nor is it claimed that the corpus of the impounded water can be taxed. But it is contended for defendants that plaintiffs obtained for their stockholders through the Kuhn contract with the United States the perpetual use of certain waters to be stored in Jackson Lake Reservoir and the perpetual and exclusive use of certain storage capacity therein, that they acquired an easement in the reservoir; and that the rights so obtained were property and property rights subject to taxation in Wyoming. In substance this claim seems to be that the means and facilities necessary to the storage, diversion and transportation of water to the place of application are property and constitute taxable entities. A right to use water for the irrigation of arid lands is a property right in both Wyoming and Idaho. Such rights are acquired by appropriation, that is, by the diversion and application of water to beneficial uses. It may be diverted from the natural flow of the stream, and for that purpose diversion structures, head-gates and carrying canals to the places of application are necessary. If flood waters are taken they must be impounded in artificial reservoirs provided for that purpose or by damming the stream and thereafter releasing them into carrying canals or ditches for delivery at the points of application. There is, of course, a right in the use of these structures and in their protection. But they are valueless except for the intended purpose; and they are integral and indispensable parts of the water right itself, which under the general rule in the arid States becomes appurtenant to the lands to which the water is applied. Water could not be applied to the lands to be irrigated unless diverted and brought to the place of application, and the means for doing so are indispensable to the right to use them. It was in recognition of rights so to be acquired that the Warren Act was passed, under which the United States was authorized through its Reclamation Service to raise the dam at Jackson Lake Reservoir; and it is the expressed intention of that Act, and also of the statutes of Wyoming passed in recognition and acceptance of the Carey Act, that the impounded waters may be used only on the lands for which they are to be impounded. A clause in the first section of the Warren Act (Comp. St. § 4738) reads: "Water so impounded, stored, or carried under any such contract [the contract with the Kuhn Company], shall be for the purpose of distribution to individual water users by the party with whom the contract is made." And the Wyoming statute accepting the Carey Act reads: "The water rights to all lands acquired under the provisions of this chapter shall attach to and become appurtenant to the land as soon as title passes from the United States to the State." Section 794, Comp. Stat. Wyo. 1920. In the Idaho statute accepting the Carey Act there is a section in the same terms as the section of the Wyoming statute just quoted. In Lakeview Canal Co. v. Manufacturing Co., 31 Wyo. 182, 224 P. 853, the Supreme Court of Wyoming said: "The laws of the State of Idaho are substantially the same as those in this State, in relation to Carey Act lands." When the State of Wyoming issued its permit to raise the dam it knew that the 400,000 acre feet of water to be impounded was to be used on the two projects in Idaho. The *60 application for the permit said so. The fact that Snake River is an interstate stream does not change or affect the rights of Idaho appropriators. They have the same rights that they would have had if their lands had been in Wyoming. In Weiland v. Pioneer Irrigation Co., 259 U. S. 498, 42 S. Ct. 568, 66 L. Ed. 1027, the suit was brought by landowners in Nebraska against officials of the State of Colorado whose duty it was to see that water was distributed from the stream to appropriators for irrigation according to their rights. The stream flow was from Colorado into Nebraska, and the canal to irrigate Nebraska lands had been taken out of the stream on the Colorado side. It was claimed by Colorado appropriators from the same stream that their rights to water to irrigate their lands were different and superior to the rights of the Nebraska appropriators. As to that contention the Supreme Court said: "Both of the lower courts ([C. C. A.] 238 F. 519 [D. C.] 236 F. 790) held that the presence of the State line did not affect the superiority of right and enjoined the Colorado State officials from treating the appellee in the distribution of water otherwise than it would be treated if the canal were wholly within the State of Colorado and all the lands irrigated therefrom were in that State. The question thus presented is so fully disposed of on principle and authority in the opinion of the court this day announced in No. 3 Original, Wyoming v. Colorado [259 U. S.] ante, 419 [42 S. Ct. 552, 66 L. Ed. 999], that further discussion of it would be superfluous and upon the authority of that decision the decree of the Circuit Court of Appeals is affirmed." See also Bean v. Morris (C. C. A.) 159 F. 651; Willey v. Decker, 11 Wyo. 496, 73 P. 210, 100 Am. St. Rep. 939; Perkins County v. Graff (C. C. A.) 114 F. 441. In addition to the provisions of the Wyoming and Idaho statutes which make water rights for irrigation appurtenant to the lands to which the water is applied, that is the general rule in the western States where irrigation is practiced. Rickey L. & C. Co. v. Miller & Lux (C. C. A.) 152 F. 11, 14, and cases there cited. On the facts stated, settlers on lands in the two Carey Act projects acquired water rights for the irrigation of their lands. The right is said to be a right in a natural resource, hence classed as real estate. Wiel (3d Ed.) § 283. It is not land, but when used for irrigation it becomes appurtenant to the land to which it is applied, an incorporeal hereditament. An appurtenant thing is attached to and belongs to another thing as the principal thing. Harris v. Elliott, 10 Pet. 25, 9 L. Ed. 333. And its situs is the same as that of the principal thing. In Cooley on Taxation (4th Ed.) § 568, it is said: "So far as taxing water rights is concerned, it is a generally conceded principle that water rights and water power are not taxable independently of the land to which they are appurtenant or incident." Mr. Wiel says (section 284) that water rights should not be assessed separately from the lands to which they are appurtenant. This is the rule in Wyoming. In Ver Straten v. Board of Commissioners, 246 P. 916, the Supreme Court of Wyoming said: "Water rights appurtenant to lands are usually taxed with the lands, and not listed or valued separately. Water rights not appurtenant to taxed lands may no doubt in some circumstances be `property' subject to taxation [citing cases]. An entryman of lands under a Carey Act project must have a contract for a water right with the company that has undertaken to furnish the water for reclamation of the lands. C. S. Wyo. 1920, § 788. This water right becomes appurtenant to the land when title passes from the United States to the state. C. S. § 794." In Hicks v. Cheyenne Land & Live Stock Co., 4 Wyo. 502, 35 P. 475, that court said: "Thus it seems that the doctrine is very general, in the States of the arid region, that a water right becomes appurtenant to the land upon which the water is used, and the ditch, water pipe, or other conduit for the water becomes attached to the land, either as appurtenant or incident to the land, and necessary to its beneficial enjoyment, and therefore becomes part and parcel of the realty. * * * The appurtenance is subject to the same conditions as the principal thing, subject to its liabilities and entitled to its exemptions." In Hale v. Jefferson County, 39 Mont. 137, 101 P. 973, the Supreme Court of Montana said on this subject: "Viewed as independent property rights, ditches and the right to use the water conveyed by them are property subject to taxation; but, when made appurtenant to lands, they have no independent use. So situated and used, the value of this species of property enters as an element into the value of the corpus or principal estate to which it is attached or appurtenant, and bears its proportionate burden of taxation by the added taxable value which it gives to the principal estate." There has never been a severance of these water rights from the Idaho lands. There is no property or property right involved in these suits, except the right to continue to *61 apply the impounded waters to the lands in Idaho to which they have become appurtenant. This right constitutes property not personalty, but partaking of the nature of real estate an incorporeal hereditament with its situs in Idaho; and, in our judgment, it is not taxable in the State of Wyoming. Cooley on Taxation (4th Ed.) § 94; Wharton on the Conflict of Laws (3d Ed.) vol. 1, § 80a; Louisville, etc., Ferry Co. v. Kentucky, 188 U. S. 385, 23 S. Ct. 463, 47 L. Ed. 513. It is the contention of intervener that the tax levies were and will continue to be a burden on the contract between the Kuhn Company and the United States and will interfere with its right to aid in the reclamation of its arid lands. The learned District Judge held this contention to be without merit, and we are satisfied with his able discussion of that branch of the case. 8 F.(2d) 739, 745, 746. But we think the petitions in intervention should have been dismissed without prejudice. For the reasons stated the court erred in finding against the original plaintiffs in the four suits and in dismissing their complaints. It is ordered that all of the decrees be reversed, that they be set aside and vacated, that decrees be entered for complainants as prayed in their complaints, and that the petitions in intervention be dismissed without prejudice against intervener. | Low | [
0.530612244897959,
29.25,
25.875
] |
Hepatitis B virus genome variability and disease progression: the impact of pre-core mutants and HBV genotypes. The hepatitis B virus (HBV), a member of the Hepadnaviridae family, is prone to mutations due to its asymmetric replication via reverse transcription of an RNA intermediate. The estimated mutation rate of the hepadnavirus genome is 2 x 10(4) base substitutions/site/year. This mutation rate is approximately 100 times higher than that of other DNA viruses but between 100 and 1000 times lower than that of RNA viruses. Analyses of both naturally occurring viral variants and in vitro mutagenesis studies have identified some mutations that have a role in viral latency, pathogenesis of liver disease, immune escape, and resistance to antiviral therapy. | High | [
0.6623036649214661,
31.625,
16.125
] |
1944 in animation Events in 1944 in animation. January January 8: Bob Clampett's Bugs Bunny short What's Cookin' Doc? premiers, in which Bugs competes for an Academy Award for Best Actor. January 28: Jack Kinney's Goofy cartoon How To Be A Sailor premiers, produced by the Walt Disney Company. February February 3: Hans Fischerkoesen's Der Schneemann premiers. February 18: Jack King's Donald Duck cartoon Trombone Trouble, produced by the Walt Disney Company, premiers. February 26: Chuck Jones' Bugs Bunny and the Three Bears premiers, which marks the debut of The Three Bears. Hanna-Barbera's Tom & Jerry cartoon The Zoot Cat premiers. March March 2: 16th Academy Awards: Hanna-Barbera's Tom & Jerry short The Yankee Doodle Mouse wins the Academy Award for Best Animated Short, the first of seven Oscars the franchise will win over the years. George Pal wins the Academy Honorary Award. March 10: Jack Kinney's Goofy short How To Play Golf, produced by the Walt Disney Company, is first released. March 25: Chuck Jones' war-time cartoon The Weakly Reporter premiers. March 31: Jack King's Donald Duck and the Gorilla, produced by the Walt Disney Company, is first released. April April 1: Tex Avery's Screwball Squirrel premiers, which marks the debut of Screwy Squirrel. April 22: The classic Woody Woodpecker short The Barber of Seville premiers, produced by Walter Lantz Productions. Friz Freleng's Bugs Bunny Nips the Nips premiers, a war propaganda cartoon in which Bugs Bunny fights the Imperial Japanese Army. May May 20: Bob Clampett's Russian Rhapsody premiers, a wartime propaganda short in which a group of gremlins ridicule Adolf Hitler. May 27: Friz Freleng's Daffy Duck and Porky Pig cartoon Duck Soup to Nuts premiers. June June 2: Jack King's Donald Duck short Commando Duck premiers, a wartime propaganda cartoon , produced by the Walt Disney Company, in which Donald fights Japanese soldiers. June 3: Chuck Jones's Angel Puss premiers, an one-shot cartoon which will later become part of the Censored Eleven. June 23: Charles Nichols' Springtime for Pluto, produced by the Walt Disney Company, is first released. June 24: Tex Avery's Screwy Squirrel cartoon Happy-Go-Nutty is first released. Bob Clampett's Bugs Bunny short Hare Ribbin' premiers. July Chuck Jones directs Hell-Bent for Election, a propaganda cartoon to promote U.S. presidential candidate Franklin D. Roosevelt. August August 26: Bob Clampett's Buckaroo Bugs premiers. September September 2: Friz Freleng's Goldilocks and the Jivin' Bears premiers. September 15: Jack Kinney's Goofy cartoon How to Play Football , produced by the Walt Disney Company, is first released. September 16: Frank Tashlin's war-time propaganda cartoon Plane Daffy is first released, in which Daffy Duck fights a female Nazi spy and fools Adolf Hitler, Joseph Goebbels and Hermann Göring. November November 3: The Hungarian film Svatba v korálovém moři premiers. November 8: Hans Fischerkoesen's Das dumme Gänslein premiers. November 23: Hanna-Barbera's Tom & Jerry short Mouse Trouble premiers. November 25: Frank Tashlin's Daffy Duck short The Stupid Cupid premiers. December December 21: The Walt Disney Company releases The Three Caballeros, which marks the debut of Panchito Pistoles. Films released Deaths November November 27: Willard Bowsky, American animator (Fleischer Studios), dies in combat at age 37. References See also List of anime by release date (1939–1945) | Mid | [
0.6388888888888881,
31.625,
17.875
] |
Q: linear transformations Finding $T(v_1) - T(v_3)$ Question: Solution: I get 3) a but I don't get 3 b, how are they getting these numbers? im stumped A: $$\begin{aligned} T(v_1)&=1\cdot v_1 + 2\cdot v_2 + 6\cdot v_3\\ &=3x+3x^2+2(-1+3x+2x^2)+6(3+7x+2x^2)\\ &=16+51x+19x^2 \end{aligned}$$ The other two are similar. | Mid | [
0.6153846153846151,
30,
18.75
] |
Q: Using input field as label not working in Chrome This is working fine in IE, but not in chrome? IE will open the filebrowser by pressing the 'test' or the input field But chrome will only open the filebrower by pressing 'test'? http://jsfiddle.net/ut4jedqb/1/ <input id="fileupload" style="display: none;" type="file" name="fileupload"> <label for="fileupload"> test <input disabled="disabled" id="fil_field" style="cursor: pointer;" placeholder="Choose.."> </label> A: you could do something like this as the input is disabled anyway,needs a bit of work to make it look exact. <input id="fileupload" style="display: none;" type="file" name="fileupload"/> <label for="fileupload"> test <div style="width:150px;height:21px;background-color:#f3f3f3;border:1px solid black;cursor: pointer;">Choose....</div> | Low | [
0.5240083507306891,
31.375,
28.5
] |
Q: Use component from imported module I want to use product-carousel.module.ts in home component. My product-carousel module looks like const COMPONENTS = [ ProductBlockComponent, ProductCarouselComponent, ProductCarouselContainerComponent ]; @NgModule({ imports: [ CommonModule, RouterModule ], declarations: COMPONENTS, providers: [], exports: COMPONENTS }) export class ProductCarouselContainerModule {} Than I register it in home.module.ts @NgModule({ imports: [ ProductCarouselContainerModule, CommonModule, FormsModule, ProductCarouselContainerModule, ComponentsModule, ]), ], declarations: [ HomeContainer ], providers: [ ProductApiService ] }) export class HomeModule {} I want to use ProductCarouselContainerComponent. It has selector 'offer-carousel'. In home component I using it like this <div class="container-fluid currently-funding"> <product-carousel></product-carousel> </div> And as result I have Error: Template parse errors: 'Product-carousel' is not a known element: 1. If 'offer-carousel' is an Angular component, then verify that it is part of this module. 2. If 'Product-carousel' is a Web Component then add 'CUSTOM_ELEMENTS_SCHEMA What I missed? A: The error is actually displayed in your screenshot. The issue is that the HomeComponent is declared in the ComponentsModule and not in the HomeModule. Changing this in your ComponentsModule will make it work (well there is an async pipe error but that's something else obviously) : app/home/components/index.ts : import { OfferCarouselModule } from './../../offer/offer-carousel.module'; @NgModule({ imports: [ CarouselModule.forRoot(), CommonModule, ReactiveFormsModule, RouterModule, SlickModule, OfferCarouselModule ], declarations: COMPONENTS, exports: COMPONENTS, }) export class ComponentsModule { } | Mid | [
0.614609571788413,
30.5,
19.125
] |
We rescued our cat Meatshake from a local shelter shortly after moving to Los Angeles in 2008. We first introduced her to the world here. For those of you who don’t already know, Meatshake’s name is a nod to the Long Beach-bred hip-hop group Ugly Duckling, who featured a fictional fast food chain of the same name on their 2003 album Taste the Secret. A few weeks ago, Ugly Duckling contacted me and asked if Meatshake would be interested in becoming their official mascot. Needless to say, Meatshake couldn’t be more honored or excited to contribute to the Ugly Duckling cause! They even put together the above image of Meatshake sporting the legendary gold dookie chain as she tears up the wheels of steel! Meatshake made her debut as Ugly Duckling’s mascot yesterday. Check out the announcement on their site here. Meatshake will be making a few more appearances on the site as they near the October release of their new full-length, Moving at Breakneck Speed. So stay tuned to “The Blarg” for more Ugly Duckling and Meatshake updates, and learn more about the fellas here. | Low | [
0.522593320235756,
33.25,
30.375
] |
Nancy Pelosi: The Rolling Stone Interview It was a bone-cold January day in the nation’s capital. The federal government — finally back in business after the longest shutdown in American history — opened three hours late due to a dusting of snow and a “flash freeze” in the forecast. Not that it mattered to anyone who worked inside the speaker’s office. Nancy Pelosi was there at her usual time, and her aides were expected to be there too. There was work to do: committees to finish assigning, a postponed State of the Union to organize, and less than three weeks to hammer out a deal with the White House on border security before funding was set to run out again. Pelosi is at the height of her power, having recaptured the House, dispatched an attempted coup of her leadership, and faced down the president in a very public, extremely high-stakes fight. Her approval rating has risen eight points since November, and now sits higher than it has been in more than a decade. Nancy Pelosi has waited a long time for this. Born 78 years ago, she was the youngest of Baltimore Mayor Thomas D’Alesandro Jr.’s seven children, and the only girl. While her elder brother was groomed to follow in their father’s footsteps, Pelosi got married, moved to San Francisco, and raised five children before she seriously considered a run for office. When she arrived in Congress, after winning a special election in 1987, women made up just five percent of the House of Representatives. Pelosi served for two decades before she was elected the first female speaker of the House, in 2007, the highest-ranking woman in the U.S. government, and second in line to the presidency. She welcomed Rolling Stone staff writer Tessa Stuart and the magazine’s founder, Jann S. Wenner, into the speaker’s office, where there are frescoes on the ceiling, oil paintings of the San Francisco Bay and the California coastline, and an expansive view of the Washington Monument. She wore a long, thin gold pin, with a tiny eagle perched on top. It was a mace: the ancient Roman symbol of power. Technically, it’s a bludgeon — the person who wields the bludgeon holds the power. After retreating from a 35-day standoff with her over funding for his border wall, President Trump seemed well aware who wielded the bludgeon in their relationship, at least for the moment. Wenner had come to the interview with a gift: a box of fancy chocolates. (Pelosi is well-known for her love of chocolate.) Nancy Pelosi: Oh, my goodness. Maison du Chocolat. This is the real thing. Thank you so much. Should we start? Rolling Stone: Yeah, let’s start, because you’re busy. No, I meant start with the chocolate. Of course. Life has changed. Rolling Stone interviews used to start with pot. . . . Now it’s chocolate. Isn’t that true. So what do you think your chief purpose is now, in this era of divided government? The wisdom of our founders was that we would have co-equal branches of government. I think in a large sense, my responsibility now — and it seems to be having an impact — is to impress upon the other branches of government, the executive and the judiciary, the role of the legislative branch. That means to not only pass laws — the Constitution gives us the power of the purse, it gives us the responsibility for oversight, and we will exercise that power. And if we don’t, we would be delinquent in our duties. As speaker of the House, I see my responsibility to honor the Constitution — separation of powers as a co-equal branch of government. Would you say respect for the concept of co-equal branches of government has been in decline in the past decade or two? Mostly since this president. President Obama recognized the role of Congress. Right now, we see some Republicans — [Senate Majority Leader] Mitch McConnell for one — complicit in this president usurping the power of the Congress by saying, “If he doesn’t sign it, we won’t pass it.” Well, that’s not the way the balance works. We put forth legislation for the good of the people, and we send it to the president. If he doesn’t sign, you try to override it. What is your relationship with McConnell like these days? I’ve worked with him over the years as a member of the Appropriations Committee, back when I was still on committees. I have a respectful relationship with him. I have been disappointed that he was willing to have the government shut down because he wouldn’t face down the president on the president’s bad policy. That’s discouraging for the leader in the United States Senate. Does he take an oath to the president? No. He takes an oath to protect the Constitution. Do you think there’s anything the president would do that would cause McConnell to break with him? Another government shutdown, or if he declares a national emergency, or a damning report from [Special Counsel Robert] Mueller? I’m starting a new club. It’s called the Too Hot to Handle Club. The reason the government is open now is because we did make a shutdown too hot to handle. Finally Mitch was feeling the heat, which he conveyed to the president, and here we are with open government, able now to negotiate on how to protect our borders. Public opinion is everything. Lincoln said: Public sentiment is everything. With it, you can accomplish almost everything; without it, almost and practically nothing. I’m paraphrasing, but nothing is more powerful than the stories of the people affected. You can roll out statistics and timetables, but the consequences — the emotional connection to the rest of the public — is what really weighed in. Would they back him if he tried to declare a phony national emergency at the border? The national emergency has its critics on the Republican side. If [Trump] does it, then the next president — whom, we predict, will be a Democrat — can also do it, and they don’t want to establish a precedent that a president can do this, because that really totally usurps the power of the government. A damning report from Mueller — would that lead us toward impeachment? You want to remember that President Nixon was not impeached. The Republicans went to him when they saw [the evidence]. The House proceeded with the hearings, but they never impeached because of information that came out that made it clear that they shouldn’t put the country through this process. It’s a very disruptive process to put the country through, and it’s an opportunity cost in terms of time and resources. You don’t want to go down that path unless it is unavoidable. We have no idea — nor should we — what Mueller may have, if it involves the president or his campaign. I don’t know how bad it would have to be for them to do something, but the Republicans in Congress have ignored a great deal. You have a Cabinet that is a partially “acting Cabinet” because people have left in disgrace or dismay. You have a White House which is a fact-free zone. They have no interest in evidence, data, science or truth when it comes to making decisions. You would think that there would be some check, but remember this about the Republicans in Congress: There is nothing that President Trump advocates for as president that our Republican colleagues in the House haven’t been [doing] there longer and worse. Name any subject. Name a woman’s right to choose. Name climate. Name LGBTQ discrimination issues. Name gun safety. Name immigration policy. Name fairness in our economy. He’s terrible. They’ve been there longer, and more so, he’s their guy. Don’t you think he’s worse on immigration? Look, Ronald Reagan and George Herbert Walker Bush were great on immigration. The president I quoted most in the campaign was Reagan. Reagan said, “We must recognize that the vital force for America’s pre-eminence in the world is every generation of new immigrants who comes to our shores, and when America fails to recognize that, we will fail to be pre-eminent in the world.” Reagan, Bush, Bill Clinton, George W. Bush, Barack Obama — all excellent on immigration. George W. Bush couldn’t convince his party because they were just never going to be there. This president comes in, and he’s worse. On this, I have to say, they’re bad on the policy, he’s terrible on the policy, and the people and the way he describes them, he’s so disrespectful and discriminatory. As the Republican Party has gotten more racist and undemocratic, how does that change how you think about working to find compromise? You’ve said America is experiencing a “schism of the soul.” That’s Toynbee. I also quote St. Augustine — I’m a very devout Catholic — St. Augustine, 17 centuries ago, said, “Any government that is not formed to promote justice is just a bunch of thieves.” Seventeen hundred years ago. The Republicans are anti-science. They are anti-governance. They don’t have to do anything! They don’t have to do anything about climate, which is the challenge of this generation. They don’t have to do anything about meeting the needs of people because they don’t even care to hear what the needs of the people are. The list goes on. I promised we would have an open Congress, that we would try to start out with the issues where we can find common ground. We have a responsibility to find common ground — if we can’t, to stand our ground. We talked about infrastructure from Day One. How can I say this? I’m respectful of the office that he holds. I see every challenge as an opportunity, and I pray for him and I pray for the United States of America. You said the wall is “like a manhood thing with him.” Were you purposely trying to get under his skin? I was saying it in a private meeting, and of course it went right out of the room. Boom. It was out the door before I even walked out myself. What do you think makes him tick? Does he tick? Why are we assuming? “Tick” has a certain predictability to it. How do you negotiate with someone like that — when there’s no agreed-upon standards of truth or fact or morality or precedents or ethics? He completely can pull anything on you. How do you deal with that? I’ll take you to my first meeting with the president, as president. It’s the first meeting with the House and Senate Democratic and Republican leadership — like eight people and then him. This is historic. I’ve been there as leader, and I’ve been there as speaker. Article One meeting Article Two of the Constitution. We would have normally been in a Cabinet Room, but he wanted to do this in the East Wing for some reason, so we could have snacks or something. It was weird. But anyway, so we’re in this meeting, and I’m thinking, “How will he begin this historic meeting? Will he quote the Bible? Will he quote the Constitution or any of our founders? Will he tell a personal story of his family, and what this means?” [Hunches over, scowls, glances sideways] “You know I won the popular vote?” What?! That was shocking. And then he said — I’m getting to your point, you’ll see why — “Because 3 to 5 million people voted illegally.” There’s a protocol to these meetings: The president speaks, he makes his spiel or whatever, and then the speaker speaks, and then the majority leader, and then the minority leader in the House, and the Senate. I’m looking around, and I’m thinking, “Chuck Schumer has never been to this meeting before. Paul Ryan’s never been to this meeting before. Donald Trump has never been to this meeting before.” You’re the only one? And Mitch McConnell — who rarely speaks — so I thought, “They don’t know the protocol.” “Mr. President, that is not true,” I say. “That is not true. What you are saying has no evidence, no data, no truth, no fact to it.” He doesn’t realize he’s supposed to be making some kind of an opening statement about America and “These are our priorities” and “Let’s see how we can work together,” but he didn’t go there. And I didn’t go there. If he’s not going to respect his office, why should I? So when I say, “That’s not true.” He says — a good comeback, I have to give him credit — “I’m not even counting California.” I said, “The reason I’m saying what I’m saying to you is the following: If we are going to work together, you have to stipulate to a fact — whether it’s a dollar number that is your budget, or a time frame — you have to stipulate. You can’t negotiate unless you have a starting point, and you have to agree on what that is to a fact. And if you’re not going to do that, it’s impossible to come to any agreement. Isn’t that right, my colleagues?” Because they know. They would never go into a negotiation unless you say, “What’s our bottom line?” So I said, “I thought that this conversation might take us to what our needs are for infrastructure, because you’ve always talked about that. . . .” He said, “Infrastructure. Infrastructure! Yeah, infrastructure, I have a plan right here.” [Picks up the lining of the chocolate box, and waves it around] It wasn’t the lining of a candy box, but it could have been a napkin or something. “I have the plan right here. It’s a trillion-dollar plan, and we can pass it right away. Right, Mitch?” Mitch says, “Not unless it’s paid for.” That was the end of that. It puts you in an interesting position because you’re having to anticipate things that were unthinkable in the past. For example, you’ve mentioned that there was a plan in case he declared the 2018 midterm results illegal. What was the plan? Well, I’m not going to divulge it, because we may still use it. But we were ready. We’ve been ready for a number of things. We’ve been ready for over one year if he were to fire Mueller, and we’ve been ready if he would fire [Deputy Attorney General Rod] Rosenstein. We had rallies on the ground. We had scores of bipartisan or nonpartisan leaders around the country to say, “That’s a constitutional crisis.” We are always ready for what he might do, and I think our readiness kept him at bay. Do you have a plan for 2020, if he declares the election illegitimate? You just have to win big. When the women marched, that made such a big difference. He gets inaugurated — one of the most disgraceful inaugural addresses ever, with no competition whatsoever for that title — then the next day the women marched. The women marched! Oh, my God. It made such a difference. It wasn’t political. We didn’t organize it. It was spontaneous. It was organic, and women spoke and they saw the value of their presence. And we saw, right after that, the Muslim bans at the airports. [The administration] couldn’t achieve what they set out to do because of the relentless, persistent, dissatisfied outside mobilization. The Women’s March was a galvanizing moment — many women decided to run afterward. When you first were elected, in 1987, there were 23 women in the House. Now there are more than a hundred. How has Congress changed in that time? Imagine: [Out of] 435 people, 23 women? You must be kidding. We made a decision, on our side, that we’d reach out and encourage women to run. Before the November election, three months ago, [Democrats] had 65. [Since I was elected in 1987], we had increased our number by more than five times, from 12 to 65. [Republicans] had gone from, like, 11 to 20. Now they’re down to 15 because they lost some in [2018]. We have 87, I think it is. A third of our caucus are women. Women marched, women ran, women voted, women won, women are here, and it is fabulous. What kind of difference is that making? Is it changing the way laws are made? Well, over the years it has made a tremendous difference. Today we celebrated the 10th anniversary of the Lilly Ledbetter Act, and celebrating it, we introduced the equal-pay-for-equal-work bill, which we hope to have signed into law. But I don’t want to confine women to just [women’s] issues, as important as they are. Women here are leaders on national security, they’re leaders on economic security. Women have made their mark across the board. Certainly the impact on a woman’s right to choose and the rest of that. No denying that women have made a tremendous difference, but not to confine women to what you might think of as typical women’s issues. Every issue is a woman’s issue. Has it changed the way, for example, that caucus meetings run? You know, the reason I always won my votes is because we build by consensus. And so people would say to me after meetings when I was speaker first time around, “Do you realize how different that meeting would have been if a man were running it?” Which was interesting. Because it is just different. You listen, you know? You really don’t go in with the thought, “This is what I’m gonna do. I’ll listen to what you have to say, [but] there’s one vote that counts in this room.” You first came to Congress in the Eighties — did you ever have an experience with sexual harassment or overreaching? When I came here, it was such a non-thing. I mean, I came as a mother of five children. I had five older brothers. I wasn’t impressed by anything any of these people had to say. I mean, I was an Italian-American Catholic — liberal in terms of politics, but very conservative in terms of family and how people interacted with one another. That’s the aura I must have given off when I came here. In November, there was a sit-in in your office, demanding action on climate change, and some of your new caucus members participated. What was your gut reaction? You have to understand: I came into the political arena as an organizer. You know, people say, “Oh, she was a fundraiser.” Well, no, I wasn’t a fundraiser. I had to raise money to keep the doors open so that we could march in the streets. But I was not a fundraiser, I was an organizer. I was a mom, with five children, who just really could not tolerate the idea that one in five children in America lived in poverty. That was my kitchen-to-Congress motivation, and still is. Every day I’m like, “Don a suit of armor, put on your brass knuckles, eat nails for breakfast, and go out there and stop them from taking children out of the arms of their parents, food out of the mouths of babies.” I mean, it’s just the way it is. So, in my day — go back 30 years or more — I was pushing strollers and carrying signs myself. I say to these people who come in, “I was carrying single-payer signs before you were born.” I understand that to be an advocate you are persistent, dissatisfied and relentless. I was chair of [the Democratic Party for] Northern California for a long time. We were like, “We worked so hard to elect these people, and then they go back and they compromise. We are the purists.” I’ve been there. I understand it. You have that responsibility as an advocate — I have a different responsibility as a leader, but enjoy. You know, enjoy. That’s a new generation. People kept asking me, “Are you sick of that?” I’m like, “I’d probably be doing that myself.” The group that staged that sit-in are advocates for the Green New Deal. There seems to be a lot of energy around the idea, but not a lot of specifics. You’ve resurrected the Select Committee on the Climate Crisis. What do you want this committee empowered to do? What does it have as a goal? When I was elected speaker — Bush is president, mind you — my flagship issue was the climate. It’s a public-health issue: clean air, clean water. It’s a national-security issue, to protect us from all of the things that engender violence, [such as] competition for food. The generals have come to tell us it is a national-security issue. It’s an economic issue, and it is a moral issue to pass this planet on to future generations in the best possible way. As a Catholic, I believe that this is God’s creation, and we have a moral responsibility to be good stewards of it. President Bush was a denier. I mean, I loved him dearly, but he was a denier. We had Republicans on our committee who were deniers. Now, they’re a little more like, “It’s happening, but I’m not sure what the human role is.” When we lost [the Democratic majority of the House], one of the first things [Republicans] did was to restore Styrofoam to the cafeteria, no more recycling, everything went in the same trash. You know, they’re really pathetic. Because they are just handmaidens of the fossil-fuel industry, period — when they’re not handmaidens of the gun industry. So they have those two wonderful things going for them. With George W. Bush, we passed the biggest energy bill in the history of our country, taking tens of millions of cars off the road, changed emission standards, and many of the actions that President Obama was able to take by executive order sprang from authorities in that bill. So we made a big difference. Now here we are, and technology is way down the road. There are so many more opportunities to protect. I think coal is a disaster. It’s an oxymoron: “clean coal.” It doesn’t exist. It’s impossible. However, I fight for [miners], for their health benefits and their pension benefits. Anytime they come to Capitol Hill, 30 or 40 of them gravitate to our office as their kind of headquarters, because while the president is advertising coal, we can’t get them to pass bills for black-lung disease. I mean, we do, but it’s an effort to do it. In any event, to reduce our dependence on fossil fuels, we have to put a price on coal, on carbon. It might be a carbon tax. We’ll see, but that’s the reason you have hearings and see what’s possible, what the market will be, what the private sector is willing to invest in, what is working in some other countries, and what we can do working together. You have to make decisions that you’re going to reach certain goals, and some of our goals we think are achievable. That’s why public opinion is so important. Young people know better than people who serve here in Congress that this is important to do. How do you deal with entrenched interests — the energy companies, the coal companies, the oil companies? Yeah, they have a lot of power here, there’s no question, but again, we have to take it to the public, and I think it should be an important part of the presidential campaign. That’s sort of the main attraction in politics — during a presidential year, we’ll be the lounge act, that’s the main event. Everything that we’re talking about has to be elevated to the presidential level. Now, in terms of the Green New Deal [as conceived], that goes beyond what our charge is. Our charge is about saving the planet. They have in there things like single-payer and . . . what is it? Guaranteed income? Pelosi: And then they have, I don’t know if it’s single-payer or Medicare for All. . . . It’s kind of, like, a broader agenda. All good values, but nonetheless, not what we hope to achieve with this focused, determined, decision-making: You’re either for the planet or you are not. There is no “plan B” for the planet. We have to preserve it, and it is in great jeopardy. Are you going to require that appointees on the Select Committee not accept contributions from energy companies? No. But I don’t think any of them have. This is about [finding] people who care very much about the issue and know very much about the issue. I haven’t checked their filings, but I think our chairwoman — who’s fabulous — Kathy Castor from Florida, her local utility, I don’t know, 10 years ago, gave her a contribution. And [environmental activists] said, “She received money from the industry!” And it was like, “What?” She’s absolutely spectacular on this subject, killer. What I want to know is: What is your vision about saving this planet? Secondly, what do you know about the subject? This is not a learning [process]. I have to have people who have a commitment and a knowledge about the decisions that we have to make. Tell me your vision, tell me your knowledge. We have to make some very tough decisions. Let’s work together for a plan to get this done in the soonest-possible way. The most important part of it all: vision, knowledge, judgment and strategic thinking about how to get it done. And how does it connect with the American people, so we can get it to pass the Senate and the White House? We’re thinking big on this. We’re not holding [it against] somebody if she got a utility contribution within her lifetime. That’s just not — I mean, my daughter is really on everybody’s case about taking contributions, so I know the program. But I just want the best possible people. There’s a lot of debate on the question of single-payer, Medicare for All — we’ve heard that expression just recently. What do you think should be done? Where do you want this to go? This is a very interesting debate, and in any debate, as I start off this conversation, you must define your terms. Let’s stipulate to some facts here: When we passed the Affordable Care Act, for us, it was a pillar of health and economic security for America’s working families — 125 million families got better benefits, more reasonably priced, with no annual or lifetime caps, and with no prohibition if you had pre-existing consumer protections. We were on a good path, and when [Republicans] took over [Congress], they let certain things expire. People say, “Well, it’s not doing this or that.” Well, it did until it expired. Restore the reinsurance. Elect more Democratic governors so that Medicaid can be expanded and millions more people can have access in an affordable way. I myself wanted to have the public option. We couldn’t get that through the Senate, but we enabled states to do a public option if they want. This made as drastic a difference as day and night. Now, of course, everyone isn’t covered because in certain states they didn’t expand Medicaid, so now [people are proposing] Medicare for All. When they say Medicare for All, people have to understand this: Medicare for All is not as good a benefit as the Affordable Care Act. It doesn’t have catastrophic [coverage] — you have to go buy it. It doesn’t have dental. It’s not as good as the plans that you can buy under the Affordable Care Act. So I say to them, come in with your ideas, but understand that we’re either gonna have to improve Medicare — for all, including seniors — or else people are not gonna get what they think they’re gonna get. And by the way, how’s it gonna be paid for? Now, single-payer is a different thing. People use the terms interchangeably. Sometimes it could be the same thing, but it’s not always. Single-payer is just about who pays. It’s not about what the benefits are. That is, administratively, the simplest thing to do, but to convert to it? Thirty trillion dollars. Now, how do you pay for that? So I said, “Look, just put them all on the table, and let’s have the discussion, and let people see what it is. But know what it is that you’re talking about.” All I want is the goal of every American having access to health care. You don’t get there by dismantling the Affordable Care Act. As Californians have said to me, “We get billions and billions of dollars out of the Affordable Care Act coming into California. Now they want to get rid of that.” How are they gonna go to single-payer in California without the money from the Affordable Care Act? Anyway, this is not a bumper-sticker war — this is a complicated issue. What was it like to work with Obama? People will never fully understand that every single day his administration did great things for our country. The only way they could probably see it is to see the undoing of it now. Obama was not a bragger. You know, he did great things, never talked about it that much. We were all in the trenches, fighting these people who did not necessarily share our values. Every day they spew forth horrible things into the air our children breathe and the water they drink, food safety, undoing of consumer protections. Almost every day they do something very destructive, but you don’t want to be a fearmonger. You have to kind of just keep the fight where it needs to be and win the elections, because they have ramifications. One more complicated legislative agenda is the need to deal with the tech giants. All the privacy violations are pretty staggering — and then they are behaving like classic monopolies, which we’ve seen throughout history, and which requires a legislative solution, no? The more people know about how some of the businesses are conducted, I think the stronger the case is for how we go forward. And again, you have to handle it in the most strategic way, so you succeed. This is not a question of making headlines back home — it’s a question of making a statute to make a difference. But some of the things that were made known about Facebook in the past couple of weeks are very stunning, in terms of exploiting children’s access to Facebook, using their parents’ credit cards. The monopoly issue is something we have to look into because it’s so related to privacy. You can’t really separate them out. I think we’ll have more hearings. Some of these firms are responsible, some are exploitive. And I don’t know how you make a judgment — whether it’s the size of the company, or the vertical or horizontal expansion of their control of the system. I don’t want to go into it right now with names, but some of them are much better than others. So we have to do it with care. This is what the majority is about: to have the hearings, to get the data, to make the judgment. Otherwise, you have a hearing that’s a grandstand, and it never leads to anything. On privacy, just know that we will have legislation. We have to ask as part of our official duties: What is your favorite music of all time? And what are you listening to these days? Usually, I like to leave my kids’ music alone, you know? And now my grandchildren. But we have three generations of U2 fans. We’re obsessed. We go to every concert. I’ve probably been to more U2 concerts than, well, certainly anybody in Congress. I love all the music. I saw the Bruce Springsteen show on Broadway; that was great. I loved that. I loved that. I love all music from rap to — I won’t say Wagner, but I’ll say Beethoven. I mean, I like Wagner, but there are other, easier things that I like. More Italian, shall we say? Even though Beethoven wasn’t Italian. Can we be more specific? What’s your favorite album? I hate to say this, because it sounds not as relaxed as it should. I love some of the songs better than others, but “One” is so appropriate now. Read the words to “One.” In fact, my daughter just sent them to me over the phone. There’s not like a “Deadhead” thing for U2 — there’s not a name for U2 fans. Deadheads are like family to us. No, I’m telling you, in California, that’s like family to us. And actually, [Dead & Company] was planning a concert the night of our swearing-in. Idina Menzel was coming, too, and they were going to play this thing together. But since the government shut down, we had to cancel the concert, so that was too bad. We lost a lot of money. Beatles, Stones, Dylan? Where are you on the three greats of the Sixties and the Seventies? I probably know the words to more Beatles songs, if that means anything. I love Dylan, and I love the Stones. I’ve been to many of their concerts. I was at one concert in Argentina. I was down there for a security visit. On the street, they had the banners: the Rolling Stones with Bob Dylan. Oh, my God! We had to go, right? So we had to rearrange everything. And we go, and there is Bob Dylan singing “Like a Rolling Stone”! It was just incredible. And at that concert — this is having nothing to do with anything — [Rep.] Nita Lowey, who’s [Appropriations] chair now, she’d never been to a concert. I said, “Look, Nita. We’re concertgoers. You may smell things you don’t recognize, but we are concertgoers. If you go, you have to stay.” Through the last song. So we go there, and I’m telling you, Argentina — the mosh pit must have been 50,000 people. They just turn out, right? Now it’s the Stones and Bob Dylan. This guy comes up to Nita, who’s sitting on the end, at her first-ever concert, and he says to her, “Miss, make a contribution to fight HIV/AIDS, and then you get this gift.” And the gift was a pack of condoms. And she’s like, “What? What?” “Never mind, just put it in your purse.” Of all people, 80,000 people in the place, they pick her to go give a pack of condoms to, at her first concert ever. As you’re looking toward the next two to four years, what is one thing you feel you need to get done before you retire? The Affordable Care Act, to grow it and expand it, and increase the number of people who are covered by it. The climate thing is a big deal for me. It is. But, here’s the thing: We have some overarching challenges to our economy, and therefore our society. The disparity in income in our country is an obscenity. And I’ve said to the members, “Everything that we put forth has to be in furtherance of reducing that disparity.” Whether we’re talking about tax policy, whether we’re talking about investments in education and workforce development, whether we’re talking about infrastructure and how we do it in a way that increases paychecks, or how we do our oversight. We don’t begrudge anybody their success or their wealth. We just don’t like exploitation of the worker. And we’ve had this conversation a number of times. Forty years ago, the disparity between income was maybe 40 times, [between] the CEO and the worker. When productivity increased, everybody’s pay went up. About 20 years ago, that all changed: bottom line, quarterly reports. So now the disparity is more like 350 to 400 times. CEO pay goes up because he’s cut costs by either firing people or they’re not paying them very much. This is sinful, this is sinful. So for me, how we get onto a path of addressing that has to be a very important part of this next Congress. The only way our economy is going to be really strong is if you have increased purchasing power of the middle class. It’s not about giving tax breaks to the wealthiest people in our country. That wasn’t supposed to happen. The [Republicans] told us that wasn’t going to happen: “Oh, we just want to change the corporate tax — we’re not changing anything with individuals.” And then they did it in the dark of night — 83 percent of the benefits to the top one percent. It is shameful what they’re doing to the national debt, to enrich people. I mean, again, we don’t resent people their success and their wealth, but then they say, “Well, now we have to cover it by cutting Medicare and Medicaid and Social Security and the rest of that, because we have this national debt”? The budget should be a statement of our values. And I look forward to putting us on that course. Then before you know it — 18 more months or so, 19, is it? — we’ll have a new president. And we can accomplish some of that. But you have to be ready. And you have to build the case. I call it “crescendo,” to use a musical metaphor. You’re always building, building, building. Building the knowledge, building the public awareness, building the strategy, as you keep revamping it in new circumstances, so that we can win. As you look back on your legacy in the House, and at your career, do you have any regrets? Regrets? I don’t know if I have any regrets. I’ve become a target of the Republicans because I’m effective. And because I can out-raise them, outsmart them politically and out-negotiate them and the rest. And they know that, and they had to take me down. My name was in 132,000 ads paid for by the Republicans in the last election. Some people said, “Oh, you should have had your own PR campaign.” Well, I couldn’t even think of doing that. I spent every dollar to elect the Democrats. I don’t know, I don’t call that a regret. Regret? Do I have any regrets, Drew? Have I ever mentioned regret? Drew Hammill: No. Pelosi: We don’t deal in regrets. What we deal with is, every situation is an opportunity, including the guy down the street [points behind her head toward the White House]. How do we use this to spring into something better? And quite frankly, he’s been a real asset. Terrible for the country, but a great organizer. You mentioned all of the commercials that were run about you in the last election— Yeah, 132,000. In the past, when you’ve been asked about those kinds of commercials, you’ve brushed it off and said, “I’m not worried about my own approval, I’m worried about electing more Democrats.” That’s right. But does it feel good to finally be getting some approval? Do you get to enjoy it? Well, it feels good. I accept all the compliments on behalf of the unity of my caucus. As I say to them, and maybe I said it earlier, forgive me, “Our diversity is our strength, our unity is our power.” I always remember Mario Cuomo saying this to me when he became governor [of New York]. I knew him through the Italian community. I said, “How’s it feel to be governor?” He said, “I feel like the Thanksgiving turkey. They bring you out on the tray and everybody oohs and ahs, and then they begin to carve you up.” So, who knows what’s next? But for the moment, we want to do what we can to protect the workers, 800,000 families deprived of a paycheck [in the shutdown]. We want to do what we have to do to protect our DREAMers and the Temporary Protective Status folks, and end this conversation about who’s sincere about protecting the border, so people can see the other work that we are doing, which is addressing their kitchen-table issues. It’s all about that kitchen table. And now our caucus looks like America — 60 percent of it women, people of color, LGBTQ. Isn’t that a fabulous thing | Mid | [
0.5526838966202781,
34.75,
28.125
] |
Consequences and management of hyperphosphatemia in patients with renal insufficiency. Consequences and management of hyperphosphatemia in patients with renal insufficiency. Progressive renal insufficiency leads to hyperphosphatemia, hypocalcemia, and secondary hyperparathyroidism. Bone demineralization in secondary hyperparathyroidism may induce fractures, while joint and subcutaneous precipitations of calcium pyrophosphate limit mobility, and may cause crippling. Strategies to preempt bone and joint destruction in chronic kidney disease and end-stage renal disease have focused on limiting dietary phosphorus, intra-gut binding of ingested phosphorous, enhancing calcium absorption, and limiting parathyroid hormone secretion. Deciding which regimen is most effective to meet these treatment objectives challenges nephrologists; they often uncover conflicting evidence about which abnormal metabolite should be the prime treatment objective. Especially vexing is the question of whether hypercalcemia is a cardiotoxic consequence of calcium-based phosphate binders. | High | [
0.675,
30.375,
14.625
] |
Q: images in a banner disappear when I use max-width or width: auto I have rotating banner images which I'd like to work (scale to fit) in any screen size. When I use the following, it works: .banner{ position:absolute; width: 80%; height: 30%; top:5%; left:20%; background:#FFF; border:hidden; } However, when I try to change the width to for example 40%, the images truncate rather than scale down. When I tried to use, for example, max-width: 80%, or width: auto, the images totally disappear, even if I use a high z-index. A: Setting both width and height on your images, will not care about aspect ratio. Just use width = 100%, and leave the height related to it (with the technique below). And then set the container width to whatever you want: #banner {
width: 100%;
height: 0;
padding-top: 30%;
background: red;
}
#banner-container {
width: 400px;
} <div id="banner-container">
<div id="banner"></div>
</div> If you want to show an image inside it, use CSS background-image with background-size: cover: #banner {
width: 100%;
height: 0;
padding-top: 30%;
background: gray;
background-position: 50% 50%;
background-size: cover;
background-repeat: no-repeat;
}
#banner-container {
width: 400px;
} <div id="banner-container">
<div id="banner" style="background-image: url('http://placekitten.com/800/500');"></div>
</div> | Mid | [
0.547677261613691,
28,
23.125
] |
The Washington Wizards declined a trade with the Oklahoma City Thunder for James Harden, according to multiple people with knowledge of the proposed deal. Wizards' owner Ted Leonsis was unwilling to commit to an $80 million max contract offer over five seasons to Harden. Bradley Beal and Chris Singleton would have been traded to the Thunder in return for Harden, according to sources. Harden was ultimately traded by Oklahoma City to the Rockets. One Wizards official denied that Oklahoma City had offered Harden in exchange for Beal and Singleton, stating that the Thunder was also seeking an established player — which the Wizards didn’t have — in return. “That’s not true,” the official said about the proposed deal. | Low | [
0.522807017543859,
37.25,
34
] |
Introduction {#s1} ============ Radiotherapy is a mainstay of cancer therapy in multiple disease contexts, but treatment is not always curative. A great deal of effort is directed not only at improving the delivery of radiotherapy by increasingly sophisticated spatial and dosimetric methods, and also to identify combination strategies to improve radiation responses. In regard of the latter, ionizing radiation can promote activation of receptor and non-receptor tyrosine kinases (TKs), and modulation of cytoprotective influences, such as increased DNA repair, proliferation and reduced apoptosis [@pone.0027806-Cosaceanu1], [@pone.0027806-Cuneo1], [@pone.0027806-Dittmann1], [@pone.0027806-Dittmann2], [@pone.0027806-Li1], [@pone.0027806-Meyn1], [@pone.0027806-Park1]. Since these responses contribute to cellular radio-resistance, which can obviously limit the effectiveness of radiotherapy in cancer treatment, understanding the contribution of TKs may provide new molecular targets for radio-sensitisation, and potentially improve tumour responses. One example is the Epidermal Growth Factor Receptor (EGFR), which is the current most extensively studied TK in this context. Strong preclinical evidence implies a capacity of EGFR inhibition to enhance the anti-tumour effects of ionizing radiation, and this has translated into the clinical setting based on results of a Phase III trial in head and neck cancer [@pone.0027806-Bonner1], [@pone.0027806-Bonner2]. This demonstrates the importance of robust intervention strategies to establish whether particular TKs contribute to cellular radio-sensitivity, or to radio-resistance. In contrast to the emerging evidence for EGFR, the role of other TKs, especially non-receptor TKs, is less clear. Focal Adhesion Kinase (FAK) is located at sites of integrin adhesion from where it transduces signals into cells that control multiple cancer-associated properties, including adhesion and actin dynamics, migration, invasion, angiogenesis, protection of cells from suspension-induced cell death (sometimes termed anoikis) and proliferation in 3-dimensions [@pone.0027806-Duxbury1], [@pone.0027806-Frisch1], [@pone.0027806-Hauck1], [@pone.0027806-Hungerford1], [@pone.0027806-Ilic1], [@pone.0027806-Sieg1], [@pone.0027806-Sieg2], [@pone.0027806-Zhang1]. FAK is often over-expressed in human cancer [@pone.0027806-GabarraNiecko1], [@pone.0027806-McLean1], [@pone.0027806-Siesser1], [@pone.0027806-vanNimwegen1], and plays a role in tumorigenesis, as demonstrated in multiple tissue types *in vivo* [@pone.0027806-Ashton1], [@pone.0027806-Lahlou1], [@pone.0027806-Luo1], [@pone.0027806-McLean2], [@pone.0027806-Provenzano1], [@pone.0027806-Pylayeva1], [@pone.0027806-SlackDavis1]. We previously showed that FAK deletion inhibits mouse skin cancer development and malignant progression, and that FAK deletion promotes apoptotic death of normal skin keratinocytes in culture [@pone.0027806-McLean2]. More recently, we have also made use of the K14-Cre-ER^T2^/f*lox*-FAK mouse system to derive squamous cancer cells (SCC) from chemically-induced tumours [@pone.0027806-Serrels1], [@pone.0027806-Serrels2]. FAK deletion causes multiple defects, including impaired polarization and responses to directional cues, such as chemotactic invasion, as well as impaired growth in 3-dimensions (although growth on 2-D plastic is unaffected) and delayed growth as xenografts *in vivo* [@pone.0027806-Serrels1], [@pone.0027806-Serrels2]. FAK mediated pro-survival functions are thought to play an important role in cancer cell survival, and that this likely involves the p53 pathway [@pone.0027806-Frisch2]. Moreover, the FAK promoter contains p53 responsive elements and can be down-regulated by DNA-damage in a p53-dependent manner, while FAK expression correlates with mutant p53 in breast cancer [@pone.0027806-Golubovskaya1], [@pone.0027806-Golubovskaya2], [@pone.0027806-Golubovskaya3]. There is also *in vitro* and *in vivo* evidence demonstrating that FAK knock-down can sensitise cells to cytotoxic chemotherapy [@pone.0027806-Cuneo1], [@pone.0027806-Duxbury2], [@pone.0027806-Halder1], [@pone.0027806-Halder2], [@pone.0027806-Halder3], [@pone.0027806-Hochwald1], [@pone.0027806-Smith1], [@pone.0027806-Chen1]. In contrast, there are relatively few studies on the role of FAK in radiation sensitivity. FAK phosphorylation is induced following exposure to ionizing radiation *in vitro* [@pone.0027806-Beinke1], although this may only have been a transient stress response as FAK\'s role was not explore. However, there is one report that siRNA-mediated FAK knock-down promotes radio-sensitisation in pancreatic cancer cells [@pone.0027806-Cordes1], although the underlying mechanism is unclear. Additionally, over-expression of FAK in HL-60 cells confers marked resistance to a variety of apoptotic stimuli, including ionizing radiation [@pone.0027806-Kasahara1], all suggesting that inhibition of signaling through FAK is likely to promote radio-sensitivity. Here we have used a clean genetic deletion/reconstitution system to test FAK\'s role in cellular radiation response *in vitro* and *in vivo*, specifically in FAK-deficient SCC cells (and their FAK-expressing counterparts), and begin to dissect out the underlying mechanism. Results {#s2} ======= We derived SCC cells from chemically-induced squamous cell cancers in mice that expressed a *floxed* form of the ATP-binding coding exon of *fak* under the control of skin-specific (K14) *Cre* recombinase fused to the estrogen-receptor [@pone.0027806-McLean2]. Excision of *floxed*-*fak* upon a single treatment with 4-hydroxy-tamoxifen (4-OHT) resulted in complete FAK protein deficiency [@pone.0027806-Serrels1], [@pone.0027806-Serrels2] (see also [**Fig. 1C**](#pone-0027806-g001){ref-type="fig"} and [**2B**](#pone-0027806-g002){ref-type="fig"}), which we could reverse by re-expressing wt FAK, allowing us to study how cancer cells cope with severe perturbation of the integrin/FAK signalling pathway. To assess radio-sensitivity, a limiting dilution clonogenic assay was performed comparing FAK −/− with FAK wt cells at increasing doses of radiation up to 10 Gy. This revealed that the complete absence of FAK in these cells was associated with increased radio-resistance *in vitro* ([**Fig. 1A**](#pone-0027806-g001){ref-type="fig"}). A statistically significant difference in surviving fraction was seen at doses of 4 Gy, 6 Gy, 8 Gy and 10 Gy (p values of 0.0136, 0.0097, 0.0045, and 0.0036 respectively, analysed by student\'s unpaired t-test, n = 9). {#pone-0027806-g001} {#pone-0027806-g002} We also tested whether FAK influenced radio-sensitivity *in vivo*, by comparing FAK −/− and FAK wt SCC xenografts. 2×10^5^ cells were injected subcutaneously into the right flank of female nude mice and the animals were either irradiated with 5 Gy (in the form of whole body irradiation) or mock irradiated when the xenografts reached approximately 150 mm^3^. This size was selected as the FAK −/− tumours had overcome an initial delay in their growth *in vivo*, and their proliferation rate at this point did not significantly differ from their FAK wt counterparts. Previous studies demonstrated that the CD1 strain of nude mice could tolerate 5 Gy total body dose for 10--14 days. After 7 days, the xenografts were measured and the animals were sacrificed. Tumour volumes were calculated before and after 5 Gy irradiation or mock irradiation, and analysed by student\'s unpaired t-test. A statistically significant reduction in tumour volume was observed in the irradiated FAK wt xenografts compared with the mock-irradiated controls (p = 0.0030, n = 10), but this was not replicated in the FAK −/− xenografts (p = 0.3300, n = 10) ([**Fig. 1B**](#pone-0027806-g001){ref-type="fig"}). Protein extracts were prepared from 5 mice in each group and subjected to western blotting to confirm the level of FAK expression in FAK −/− and FAK wt tumours ([**Fig. 1C**](#pone-0027806-g001){ref-type="fig"}). The low levels of FAK present from FAK −/− tumour-derived material is likely from the small amount of stromal or immune infiltrate ([**Fig. 1C**](#pone-0027806-g001){ref-type="fig"}). The SCC cells we used here expressed wild type p53 (confirmed by sequencing (not shown)), and we identified a FAK-dependent difference in induction of the p53 target gene, p21, after irradiation ([**Fig. 2**](#pone-0027806-g002){ref-type="fig"}; see also later). Specifically, induction of p21 was evident by 2 hours after treating FAK −/− cells with 5 Gy irradiation; by contrast, p21 was not induced when FAK was present ([**Fig. 2A**](#pone-0027806-g002){ref-type="fig"}). Interestingly, basal levels of p21 protein and mRNA in sub-confluent populations of both FAK −/− and FAK wt cells were similar ([**Fig. 2B and 2C**](#pone-0027806-g002){ref-type="fig"}, respectively), while p21 levels were elevated in both cell lines with increasing confluency ([**Fig. 2D**](#pone-0027806-g002){ref-type="fig"}). This was in keeping with the widely accepted role for p21 in contact-induced cell cycle arrest ([**Fig. 2D**](#pone-0027806-g002){ref-type="fig"}), and demonstrated that a different stimulus was able to increase p21 levels irrespective of FAK status. To ensure the discrepancy in induction of p21 following exposure to ionizing radiation was not related to differences in cell density, care was taken in all experiments to ensure that cells were irradiated at comparable confluency, typically 70%. The FAK-dependence of p21 regulation was reproduced *in vivo*. Specifically, nude mice were injected subcutaneously with 2.5×10^5^ FAK −/− or FAK wt cells, xenografts were allowed to establish, and the animals were then irradiated with 5 Gy irradiation when tumours reached approximately 500 mm^3^ in volume. Mice were sacrificed at 0, 2 hrs, 6 hrs, and 24 hrs after irradiation (n = 3 per group) and p21 levels were assessed by both western blotting of tumour lysates and immunohistochemistry (IHC) staining of paraffin embedded tissue. The FAK −/− xenografts exhibited an increase in p21 protein levels as early as 2 hours post irradiation ([**Fig. 3A**, left panel](#pone-0027806-g003){ref-type="fig"}s); p21 levels appeared maximal around this time. The increase in p21 was also visible by IHC ([**Fig. 3A**, right panel](#pone-0027806-g003){ref-type="fig"}s). Mean p21 positivity (based on scoring of 20 fields) was analysed across all time points and this demonstrated a significant difference in the p21 levels in the tumours of irradiated *versus* un-irradiated animals (Kruskal-Wallis, p = 0.038, n = 3). Further, individual comparison of the separate time points illustrated a statistically significant increase in p21 scoring compared with baseline levels (Mann Whitney, p = 0.0404, n = 3). In contrast, the FAK wt xenografts did not demonstrate any consistent increase in p21 levels at any of the time points examined. Western blotting of FAK wt-expressing tumour lysates confirmed the presence of FAK, but there was no appreciable increase in p21 protein levels ([**Fig. 3B**](#pone-0027806-g003){ref-type="fig"}). Further analysis of IHC ([**Fig. 3B**, right panel](#pone-0027806-g003){ref-type="fig"}s) confirmed there was no significant increase in p21 expression at 2 hrs (p = 0.6625), 6 hrs (p = 0.6625), or 24 hrs (p = 0.3827) (Mann Whitney, n = 3), when compared with controls. {#pone-0027806-g003} We extracted RNA from sub-confluent populations of FAK −/− and FAK wt cells at various time points following 5 Gy irradiation, and qRT-PCR was performed using primers for endogenous p21. There was a biphasic increase in p21 mRNA levels, peaking at 2 hours and 6 hours post irradiation in FAK −/− cells; by contrast p21 mRNA levels were not induced in the FAK wt cell line after irradiation ([**Fig. 4A**](#pone-0027806-g004){ref-type="fig"}). RNA was also extracted from both cell lines 2 hours after a range of radiation doses (0, 2, 5, 10, 20, and 30 Gy) and analysed by qRT-PCR. We found that p21 mRNA levels increased in FAK −/− SCC cells in a dose-dependent fashion (range from 2 Gy to 10 Gy); further dose escalation did not result in further increased p21 mRNA. The dose-dependent increase in p21 transcription was attenuated upon re-expression of FAK wt in the FAK-deficient SCC cells ([**Fig. 4B**](#pone-0027806-g004){ref-type="fig"}). In parallel experiments, we found that increased steady state levels of p21 protein were evident after irradiation at various doses in FAK −/− SCC cells, and that this was attenuated when FAK expression was restored ([**Fig. 4C**](#pone-0027806-g004){ref-type="fig"}, compare left and right panels). To complement the genetic deletion of FAK, we also used a FAK kinase inhibitor (PF-562,271; [@pone.0027806-Roberts1]) at a dose of 0.5 µM (which is optimal for inhibition of FAK kinase activity in these cells (not shown)) for 2 hours prior to irradiation, and collected protein lysates for immunoblotting at 0, 2, 4, and 6 hours after 5 Gy. p21 levels were visibly increased by 2 hours after radiation in 0.5 µM PF-562,271 treated FAK wt cells when compared to untreated cells ([**Fig. 4D**](#pone-0027806-g004){ref-type="fig"}). {#pone-0027806-g004} As expected, p21 steady state levels in the SCC cells were at least partly dependent on p53, and radiation-induced p21 in SCC cells was inhibited by knock-down of p53 using siRNA ([**Fig. 5A--C**](#pone-0027806-g005){ref-type="fig"}). However, we also noted that p53 induction after irradiation was not particularly strong and was similar in both FAK −/− and FAK wt SCC cells ([**Fig. 5D**](#pone-0027806-g005){ref-type="fig"}), indicating that the presence of FAK was leading to some uncoupling of p53 and p21 induction, and sensitivity to irradiation in these cancer cells. Densitometry was carried out to quantify fold changes in p21 and p53 protein levels after irradiation of FAK-proficient and FAK-deficient SCC cells (**[Figure S1](#pone.0027806.s001){ref-type="supplementary-material"}**). These findings imply that substantially increased transcription and expression of p21 protein occurs in FAK −/− cells after clinically relevant doses of ionizing radiation, and that this response is blunted by the presence of FAK. Thus, FAK functions in these advanced cancer cells to suppress the p53-dependent transcription of p21 after irradiation. This is not visibly linked to differential induction of cell cycle arrest ([Figure S3](#pone.0027806.s003){ref-type="supplementary-material"} (determined as described in [Methods S1](#pone.0027806.s006){ref-type="supplementary-material"})) or apoptosis, which is difficult to detect after SCC cell irradiation as judged by lack of sub-G1 DNA content (not shown). This is despite differential regulation of expression of the p53 target gene PUMA ([Figure S4](#pone.0027806.s004){ref-type="supplementary-material"}) that can be associated with apoptosis. {#pone-0027806-g005} Previous work has established clear links between FAK and p53 that promotes survival after stress-induced signalling (in cells that lack p21), *via* the FAK FERM domain binding to p53 in the nucleus, facilitating p53 degradation and survival [@pone.0027806-Lim1]. Therefore, we immunoprecipitated FAK from lysates of FAK wt SCC cells before and after 5 Gy irradiation, and immunoblotted for p53 and for Src (as a positive control). As expected, Src was bound to FAK, and this was unaltered by irradiation (**[Figure S2A](#pone.0027806.s002){ref-type="supplementary-material"}** (determined as described in [Methods S1](#pone.0027806.s006){ref-type="supplementary-material"})). However, we found that FAK did not interact with p53 (**[Fig. S2A](#pone.0027806.s002){ref-type="supplementary-material"}**). Lysates were probed for FAK, Src and p53 to ensure equal loading (**[Fig. S2B](#pone.0027806.s002){ref-type="supplementary-material"}**). We also found that p53 was efficiently translocated to the nucleus in both FAK −/− and FAK wt cells after irradiation (not shown). Since p21 has been associated with both resistance and sensitivity to DNA damaging agents, including ionizing radiation, we next depleted p21 using siRNA. We achieved around 90% knock-down of p21 in SCC cells ([**Fig. 6A and 6B**](#pone-0027806-g006){ref-type="fig"}). Clonogenicity was then assessed at 0, 4, and 8 Gy and comparison made between cell populations transfected with p21 siRNA, scrambled siRNA or control cell populations which had been mock transfected. We found a significant difference in surviving fraction at 8 Gy (p = 0.0129) between the scrambled siRNA- and p21 siRNA-treated cells, such that p21 promoted radio-resistance in the SCC cells ([**Fig. 5C**](#pone-0027806-g005){ref-type="fig"}). There is therefore a strong link between radiation-induced p21 in FAK-deficient cells (but not in their FAK-expressing counterparts) and the finding that FAK loss induces radio-resistance in which p21 has a causal role in the SCC cells. {#pone-0027806-g006} Finally, we assessed whether FAK deficiency affected more general features associated with DNA damage. We found that mRNA levels of a number of p53 target genes, which are involved in repair following ionizing radiation, namely *gadd45*, *p53R2* and *ddb2*, and are known to be down-regulated by c-Myc [@pone.0027806-Ceballos1], were stimulated in FAK −/− SCC cells, but consistently less so in their FAK-expressing counterparts ([**Fig. 7**](#pone-0027806-g007){ref-type="fig"}). This was particularly true for *ddb2* at the 2 hour time point, for *gadd45* at later time points, and for *p53R2* throughout the 0--24 hours after irradiation ([**Fig. 7A, B and C**](#pone-0027806-g007){ref-type="fig"}). Since we showed that FAK is required for c-Myc up-regulation downstream of *Apc* deletion in mouse intestine [@pone.0027806-Ashton1], it may be that FAK impairs radiation-induced expression of the genome integrity maintenance genes in SCC cells *via* c-Myc-mediated repression. However, we noted that BRCA1 provides an example of a DNA-damage responsive gene that is only minimally affected by FAK loss; indeed, BRCA1 expression is suppressed by FAK deficiency at later times after irradiation ([**Fig. 7D**](#pone-0027806-g007){ref-type="fig"}). Thus, we conclude that radiation-induced transcription of a sub-set of p53-responsive genes is modulated by the presence or absence of FAK, and so is not simply due to general p53 dysfunction. {#pone-0027806-g007} As mentioned, there was no readily detectable apoptosis or differential cell cycle arrest that can be attributed to FAK status. Hence, we next examined phosphorylation on serine 139 of Histone γH2AX that occurs in response to ionizing radiation [@pone.0027806-Rogakou1] and is considered to be a reliable surrogate of double strand break repair. Quantification of the percentage of nuclei containing \<5 or ≥5 γH2AX foci showed that both FAK −/− and FAK wt populations had ≥5 γH2AX foci in virtually all cells 1 hour post irradiation with 5 Gy ([**Fig. 8A**](#pone-0027806-g008){ref-type="fig"}). However, the FAK −/− cells started to clear these foci within 6 hours and these returned to baseline level within 24 hours; in contrast FAK re-expression in the FAK wt cells caused a slower foci clearance rate (compare 6 and 24 hour time points, ([**Fig. 8A**](#pone-0027806-g008){ref-type="fig"}). This is consistent with more efficient DNA repair activity in the FAK −/− cells, and a slower rate of repair when FAK is present. Representative images of γH2AX immunofluorescence in FAK −/− cells (before and 1 hour after 5 Gy irradiation) are shown ([**Fig. 8B**](#pone-0027806-g008){ref-type="fig"}). We also found that FAK −/− SCC cells appeared to have generally higher levels of γH2AX foci under control conditions (0 hours) than their FAK-expressing counterparts (images not shown), with most FAK −/− cells displaying several foci and around 10--15% displaying ≥5 foci ([**Fig. 8A**](#pone-0027806-g008){ref-type="fig"}, 0 hours). This suggests that FAK-deficient SCC cells may have greater genetic instability than their FAK wt counterparts; at least it appears that the FAK −/− SCC cells have generally enhanced DNA repair functions and this correlates with radio-resistance. Interestingly, we did not find any difference in FAK-dependent regulation of radiation-induced phosphorylation of either p53 or Chk2 (**[Fig. S5](#pone.0027806.s005){ref-type="supplementary-material"}**). {#pone-0027806-g008} Discussion {#s3} ========== We here show that, in stark contrast to a previous report in which FAK knock-down sensitised pancreatic cancer cells to ionizing radiation [@pone.0027806-Cordes1], FAK deletion (and a FAK kinase inhibitor) can suppress signalling to radiation-induced, p53-mediated induction of p21, and this is linked to radio-resistance in advanced SCC cells. We think it is important to record that FAK\'s role in cellular responses to ionizing radiation, and perhaps pro-survival signalling in general, may be context dependent, and that there needs to be caution when considering therapeutic combinations of FAK inhibitors and radiotherapy, as this may not always be clinically beneficial. In the work described here, we show that deleting FAK (or inhibiting its kinase activity) can release constraints FAK places on signalling from p53 to the induction of several target genes, namely p21 and at least a sub-set of p53-regulated genes involved in DNA repair in SCC cells. Moreover, FAK −/− SCC cells appear to be more efficient at repair after radiation-induced DNA damage. However, in these cells we did not find any significant effect of FAK deletion on p53 protein stability (whether in response to irradiation or DNA damaging drugs), p53 phosphorylation or the ability of p53 to translocate to the nucleus, and we could not find evidence of a FAK/p53 complex that has been reported to operate in other contexts. Thus, our work adds to a growing body of evidence that there is functional cross-talk between the FAK and p53 signalling pathways, but demonstrates that there are additional ways in which this can occur. Although we do not fully understand the mechanism, we found that in the SCC cells from which we could delete FAK by genetic recombination, FAK functions to suppress the radiation-induced DNA repair functions of p53 by blocking induction of p21, and that this is linked to enhanced resistance to ionizing radiation upon loss of FAK signalling. Materials and Methods {#s4} ===================== Cell culture {#s4a} ------------ Squamous carcinoma cells (SCC) were isolated from chemically induced skin tumours removed from K14*Cre*ER FAK^flox/flox^ transgenic FVB mice. Skin carcinomas were induced using a two-stage chemical carcinogenesis protocol as previously described [@pone.0027806-McLean2]. Cells were grown in growth media (DMEM, 10% foetal bovine serum and 2 mM glutamine) and maintained in a dry 5% CO~2~ incubator at 37°C, and sub-cultured using standard trypsinisation procedures. Subcutaneous tumour growth {#s4b} -------------------------- Cells were trypsinised, washed in Hanks Balanced Saline Solution (HBSS; Invitrogen, Paisley, UK), and re-suspended at a concentration of between 2.5×10^5^ and 1×10^6^ cells/100 µl in HBSS. 100 µl of cell suspension was injected into the flanks of immune-compromised CD1 nude mice (Charles River Ltd, Margate, Kent, UK) and tumour growth measured every two to three days using callipers. Tumour volume measurements were taken from at least 8 mice for each cell line. Irradiation of cells and mice {#s4c} ----------------------------- Cells were grown to 70% confluency and exposed to γ-irradiation from a cobalt (~60~Co) source (Alcyon II teletherapy unit, General Electric, France). The receptacles were set at a distance of 80 cm from the source and a Perspex layer added to the surface of the receptacles in order to achieve build-up. The average dose rate was 1--1.20 Gy/minute and doses of 1--30 Gy were applied. Mice with tumours were treated with whole body irradiation using the cobalt source described. Clonogenic assay (limiting dilution method) {#s4d} ------------------------------------------- Cells were passaged at 70% confluence, counted, and diluted in complete growth medium to yield a final concentration that would permit single colony growth after the required period of incubation. 100 µl of this cell suspension was added to each well of a flat bottomed 96 well microplate. The plates were incubated for 6 hours to allow cell adhesion then irradiated at increasing doses of irradiation. After 7 days (to allow 6 cell doubling times), the plates were washed in PBS, fixed in methanol, and stained with crystal violet (Sigma Chemical Co, Poole, UK). The numbers of colonies present per plate were counted on low power bright field microscopy. Plating efficiency was determined by dividing the number of colonies present by the total number of cells seeded per plate. Surviving fraction was then calculated by dividing the plating efficiency at each radiation dose by the plating efficiency of unirradiated cells. Each experiment was performed in triplicate and on at least 3 separate occasions. The data was combined and displayed graphically as mean ± SEM. Transient transfection with siRNA {#s4e} --------------------------------- The Dharmacon Smartpool method (Dharmacon, Abgene Ltd., Epsom, UK) of mammalian cell transfection was used for the transfection of sub-confluent SCC 7.1 FAK −/− and FAK wt cells. The siRNA for transfection was diluted in sterile PBS and added to serum free MEM containing 5 µl of Dharmafect Transfection Reagent 1 to give a total volume of 400 µl. The complexes were incubated at room temperature for 20 minutes then added directly to wells containing 1600 µl of complete medium (final concentration of siRNA, 100 nM). The plates were incubated for 24 hours at 37°C in an atmosphere of 95% air and 5% CO~2~ prior to any cell treatments and harvesting. In each experiment, a scrambled pool of siRNA was used as control. Immunohistochemsitry and immunofluorescence {#s4f} ------------------------------------------- Fixed paraffin embedded tissue sections mounted on slides were dewaxed in xylene solution followed by stepped rehydration via a series of graded alcohols to water. Antigen retrieval was then performed by boiling the slides in sodium citrate solution (pH 6) for 20 minutes. The slides were incubated with peroxidase block for 5 minutes to quench endogenous peroxidase activity, blocked in 10% FBS in 0.01 M Tris buffered saline (pH 7.5) for one hour at room temperature, and incubated with p21 antibody (SC-421 (Autogen bioclear (Wiltshire UK) at 1∶800 dilution) overnight at 4°C. A non-immune IgG control was compared in parallel to the investigated sections by omitting the primary antibody step. Visualisation was carried out with a DAKO EnVision kit ™ (Dako UK Ltd, Ely, UK) as per manufacturers\' instructions. The resulting sections were analysed and images captured digitally using an Olympus BX51 microscope and cell∧D software (Olympus UK Ltd, Hertfordshire, UK). For phospho-γH2AX staining, cells were fixed in 4% paraformaldehyde for 15 minutes. Permeabilisation was with 0.2% Triton X-100 in PBS for 5 minutes, staining with primary antibody (anti-phospho-gH2AX (1∶250; Upstate (Millipore), Hampshire, UK)) and treatment with secondary antibody conjugated to Alexa® 488 or 594 fluorescent dyes (Invitrogen, Paisley, UK) at a 1/200 dilution for one hour. Cells were visualised by confocal microscopy. Protein analysis: SDS-PAGE and Western blotting {#s4g} ----------------------------------------------- Confluent cells were harvested in RIPA (50 mM Tris/HCl, pH 7.4, 150 mM NaCl, 1% Sodium Deoxycholate, 1% NP40, 5 mM EGTA plus standard protease inhibitor cocktail) lysis buffer. Cell lysates were centrifuged in a bench-top, refrigerated centrifuge at 13000 rpm at 4°C and the supernatant retained. The cell lysates were then snap frozen on dry ice and stored at −80°C. Animal tissue was removed post mortem and immediately frozen in liquid nitrogen for storage at −80°C. At the required time the frozen tissue was added to a Precellys tube (Bertin Technologies, Provence, France) with 100 µl of ice-cold T-PER buffer. The samples were homogenised (Precellys 24 device -- Bertin Technologies, Provence, France), transferred to a 1.5 ml Eppendorf® tube and centrifuged as outlined above. Protein concentration was determined using the MicroBCA™ Protein Assay Kit (PERBIO, Glasgow, UK) and quantified by measuring light absorbance with a DU® 650 spectrophotometer at a wavelength of 562 nm (Beckman Coulter UK Ltd, Buckinghamshire, UK). Proteins were separated on SDS-polyacrylamide gels; specifically, protein lysates of 5--40 µg were denatured and reduced by addition of NuPAGE® 4× LDS sample buffer (Invitrogen, Paisley, UK). The samples were boiled for 5 min and then loaded directly to an appropriate well of a NuPAGE® Bis-Tris polyacrylamide gel immersed in Invitrogen™ NuPAGE® MOPS SDS running buffer. 10%, 12% or 4--12% gradient gels were used depending on the molecular weight of the protein of interest. The gels were run at 200 V for 1 h. For western blotting, separated proteins were transferred to a nitrocellulose membrane using wet blotting apparatus (Jencons, Leighton Buzzard, UK) with an applied voltage of 30 V for 90 minutes, blocked in 5% bovine serum albumin (BSA), re-constituted in 20 mM Tris-Cl; pH 7.6, 150 mM NaCl and 0.1% Tween20 (TBST), for one hour at room temperature with gentle agitation. The primary antibody (FAK (New England Biolabs) -- 1∶1000; β-actin (Sigma) -- 1∶5000; p21 -- 1∶1000; p53 (C12 New England Biolabs) -- 1∶1000); phospho-Chk2 (S68 New England Biolabs) -- 1∶1000); phospho-p53(IC12 New England Biolabs) -- 1∶500 was added at the dilutions stated overnight at 4°C. The membrane was then washed several times with TBST before the application of the appropriate horseradish peroxidase (HRP) conjugated anti-immunoglobulin G (IgG) secondary antibody diluted 1∶5000 in 5% BSA - TBST solution. Detection was by Amersham Biosciences (Little Chalfont, UK) enhanced chemiluminescence (ECL). Extraction of RNA and qRT-PCR analysis {#s4h} -------------------------------------- RNA was isolated from 1×10^6^ cells using miRNeasy mini RNA extraction kit (Qiagen, Crawley, UK). 1 µg of RNA was then converted to cDNA using Superscript First-Strand cDNA synthesis kit (Qiagen, Crawley, UK). The cDNA was diluted 1 in 5 then prepared for qRT-PCR analysis by adding 5 µl to 45 µl SybrGreen master mix (Invitrogen, Paisley, UK) containing 1 µM of paired validated primers directed against the target gene of choice (Qiagen, Crawley, UK). All primer pairs were assessed for linearity prior to use and produced a PCR single product of the correct size as outlined by the manufacturer. Real time PCR was performed on a gradient cycler (Bio-Rad, Hertfordshire, UK) with the following programme: 95°C for 15 minutes (1 cycle); 95°C for 15 seconds+55°C for 30 seconds+72°C for 30 seconds (39 cycles); 72°C for 5 minutes (1 cycle); melting curve 70--95°C, hold every 0.1 seconds; 72°C for 10 minutes (1 cycle); 15°C for 10 minutes (1 cycle). Data was analysed using Opticon software V3.1 (Bio-Rad, Hertfordshire, UK). Beta-actin controls were included with each reaction to act as a housekeeping gene and fold change in mRNA levels calculated by the ddC(t) method {Livak, 2001 \#476}. The samples were loaded in triplicate and the mean ± SEM from three combined experiments displayed graphically. Primers for p21 were **5′-3′** AGC CTG ACA GAT TTC CAC and **5′-3′** CTT TAA GTT TGG AGA CTG GGA (provided by VH Bio, Gateshead, UK); primers for ddb2, gadd45, p53R2, Brca1, PUMA and β-actin genes are Quiagen Quantifect Validated Primer Pairs for which the sequences were not disclosed to us. Statistical analysis {#s4i} -------------------- Graphs and bar charts were created in Excel and represent the mean value ± SD or mean value ± SEM from three separate experiments. Statistical tests were performed in Minitab 15, p\<0.05 was considered significant and is denoted by \*. An unpaired t-test was used to compare the means of two populations with approximately equal variance and normal distribution, where n = number of data sets that contributed towards the mean. For the purposes of IHC data analysis, the mean percentage of positively stained cells per xenograft was calculated based on examination of twenty high powered fields. The mean values of two test groups were analysed by either the Kruskal-Wallis test or the Mann Whitney U test (typically three to five xenografts from separate mice were included in each defined experimental group). Supporting Information {#s5} ====================== ###### **p21, but not p53, induction after irradiation of SCC cells is dependent on FAK status.** Densitometric quantification of p21 at times after 5 Gy irradiation of SCC cells (**A**; upper panel) and of p53 at 2 hours after various radiation doses or following overnight treatment with 0.1 M actinomycin D (**B**; lower panel). (TIF) ###### Click here for additional data file. ###### **There is no interaction between FAK and p53 in SCC cancer cells.** (**A**) FAK wt cells were irradiated at around 70% confluency and lysates prepared at 0 (FAK wt) and 2 hours (FAK wt+5 Gy). 1 mg of protein was immunoprecipated with an anti-FAK agarose conjugated antibody at 4°C overnight. The IPs were separated by SDS-PAGE and immunoblots probed with anti-FAK (upper panel), anti-Src (middle panel), and anti-p53 (lower panel). As a negative control, irradiated FAK wt cell lysates were also immunoprecipitated with an anti-histidine agarose conjugated antibody. (**B**) 20 µg of protein lysates were immunoblotted and probed with anti-FAK, anti-Src, anti-p53, and anti-β-actin. (TIF) ###### Click here for additional data file. ###### **FAK loss does not promote radioresistance by increasing the length of cell cycle arrest in response to ionising radiation.** FAK −/− (**A**) and FAK wt (**B**) cells were irradiated with 5 Gy at 70% confluence; at various time points samples were fixed in 70% ethanol, stained with propidium iodide and subjected to cell cycle analysis. The percentage of gated cells in each of the component phases (G1, S, and G2/M) of the cell cycle was evaluated at each time point. The graphs shown represent the mean ± SEM from three experiments. (TIF) ###### Click here for additional data file. ###### **PUMA is stimulated in FAK −/− cells after irradiation.** (**A**) RNA was extracted from subconfluent FAK −/− and FAK wt cell populations at various time points after 5 Gy irradiation. qRT-PCR analysis was then performed as previously described using PUMA primers with β-actin as a loading control. (**B**) FAK −/− and FAK wt cells were irradiated with 5 Gy at 70% confluence and lysates prepared at the indicated time points. Immunoblotting was then performed with anti-PUMA (upper) and anti-β-actin (lower) antibodies. Species corresponding to PUMA-α and PUMA-β are shown. (TIF) ###### Click here for additional data file. ###### **Phosphorylation of p53 and Chk2 after irraditaion are similar in FAK-proficient and FAK-deficient SCC cells.** Subconfluent populations of FAK −/− and FAK wt cells were irradiated with 5 Gy and protein extracts were prepared at various time points. The extracts were then separated by SDS-PAGE, transferred to nitrocellulose, and probed with anti-phosph-p53, anti-p53, and anti-β-actin as indicated (**A**), and anti-phospho-Chk2 and anti-β-actin (**B**). (TIF) ###### Click here for additional data file. ###### **Supplementary methods are provided for immunoprecipitation and cell cycle analysis.** (DOCX) ###### Click here for additional data file. We would like to thank Susan Mason and Saadia Karim for help with experiments. **Competing Interests:**The authors have declared that no competing interests exist. **Funding:**This work was funded by Cancer Research UK Program Grant (C157/A9148). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. [^1]: Conceived and designed the experiments: MCF KG OJS VGB. Performed the experiments: KG KM-J. Analyzed the data: KG MCF VGB KM-J. Contributed reagents/materials/analysis tools: KG OJS MCF VGB. Wrote the paper: MCF KG OJS VGB. | High | [
0.6810966810966811,
29.5,
13.8125
] |
Q: Yagi-Uda antenna - energy flow density calculation This task is our milestone, even the lecturer doesn't know how to do it, I will be grateful for even the smallest clue, thank you in advance. There are given two, identical, parallel, short dipoles perpendicular to the OX axis connecting their centers, located at a distance of λ / 4 and supplied with a phase shift of π / 2 (figure below). How much higher is the energy flux density (in dB) sent in the direction of the positive half axis OX by the described pair of dipoles from the density of the power jet sent in the direction described by the azimuthal angle φ = 52 ° and the angle of elevation Θ = 37 °? A: Here are some hints : 1) two dipoles usually interact strongly, so the current on one is dependent on the current in the other. This is how a Yagi Uda antenna works - the elements are mostly parasitic, i.e. not driven by a source, but still carry current. In this case you don't have to worry about this at all. The two currents are given. 2) the fields at some point in space are the linear superposition of the time-varying fields due to the current in each element - without considering the other. 3) you need to find an expression, in a textbook or online, for the retarded electric potential of a half wave dipole. This is the electric (or magnetic) field in space due to the current on the element. Most importantly, it contains an $e^{-j \beta r}$ term, which is a the delay in time caused by being some distance away. Hence "retarded". This term is key to adding the two fields correctly. You'll need to find $r$ for each dipole, for each of the positions you want to find the total field... this will be an expression in $\theta$ and $\phi$. It also contains a $1/r$ term which you will ignore, because when you're far away, these terms are identical. And a $sin^2\theta$ term, which is the radiation pattern. Note there is no $\phi$ term because each dipole radiates equally in all directions. The pattern of the array will come out when you find the vector sum of the fields. Also some constants which aren't important if you're looking for the ratio of two fields. 4) You only need consider Theta-directed fields - and most derivations will only consider these anyway, in the far field. In the near field there are radial fields too, but these die off as $1/{r^2}$ so don't matter in the far field. 5) finally, the power flux density is the square of the electric field (times a constant). | High | [
0.6769230769230771,
30.25,
14.4375
] |
Questioning in preclinical and clinical instruction. Questioning has long been a basic teaching technique. Dental instructors are encouraged to use questions more frequently in preclinical and clinical courses. The objective of this educational method is to stimulate the independent thinking essential to daily practice and professional growth. This article discusses one category of questions and presents various strategies for questioning in the technique laboratory and clinic. | High | [
0.71377245508982,
37.25,
14.9375
] |
[Inhalation therapy of sinusitis with the Breathing Mask 500]. The subject of this analysis are the results of treatment of sinusitis in its varying forms and degrees with the "Climate Mask 500" in conjunction with antrum puncture. Either dry or humit warm-air inhalations with coniferous oil additives were prescribed depending on the type of sillness. In 100% of the cases so treated normalisation or improvement of the subjective complaint could be observed. The objective findings normalised or improved in 80% of the cases. Because of its therapeutic value, its simplicity, the reduction in medication and the lack of side effects, inhalation treatment with the "Climate Mask 500" can be said to be a useful aid in a causal therapy of sinusitis. | Mid | [
0.65149359886202,
28.625,
15.3125
] |
Q: Keep program running after decode_json() error decode_json() terminates my program when the argument is not valid json. How can I keep my program running and handle the error? Example: #!/usr/bin/perl -w use strict; use JSON; my $json='<html></html>'; my $ticker=decode_json($json); print $json; The last print shall be executed. A: This seems like a prime example of a time to wrap the decode_json() in a try catch block. Doing so will enable you to continue execution, and it also opens up the door to handle the error so that you can have a specific response to the cases where the error occurs. | Mid | [
0.6543535620052771,
31,
16.375
] |
Q: How many people died during the last battle in Ender's Game? In the final battle, human space fleet approaches the enemy planet, and most of the ships are sacrificed in a tactical maneuver. How many people were on these ships, and what was their role? A: In the movie, the small fighters are actually indeed drones controlled by the pilots at Ender's side. However, as Colonel Graff reveals, "We lost a thousand men on the transporters you abandoned!", the Transports do indeed have personnel onboard if only in minimal amounts. Also, if you notice when Ender is giving commands, he refers to the collective as a "Battle Group", and he orders them to deploy their drones, implying that the carriers and dreadnoughts themselves are not unmanned. A: Just saw this movie not long ago for the advanced screening. Its seems that thousands were killed in the battle as Ender was made to believe he was in a simulation but he actually wasn't. Harrison Ford states that thousands were necessarily sacrificed in the battle. | Mid | [
0.590425531914893,
27.75,
19.25
] |
All releases of Plone CMS Release Notes: The project has seen a number of releases up to this one, which fixes several security problems and provides significant improvements, like HTML5 support, a new collection type, official support for Python 2.7, and support for Diazo out of the box (plone.app.theming). Release Notes: This release works with the fully eggified Zope 2.12 and Python 2.6, so you can finally dispose of Python 2.4. It's significantly faster than Plone 3. It has a greatly improved default theme. Support for Zope3 style development methods has also improved. Release Notes: This release includes Zope 2.10.11, which fixes a potential XSS issue in the default error page in Zope. An important issue in the base2 JavaScript library would cause the Java plugin to be invoked if you had Java on your computer and were using Firefox 3.5, since there is a "magic" variable that starts the Java VM when accessed. This has been fixed. Release Notes: Many bugfixes as well as performance improvements and better and easier APIs. Plone is now fully eggified and has installers for all major platforms. Plone 3.3.x should be backwards-compatible down to Plone 3.0.x, so older products should continue to work. | Mid | [
0.6457831325301201,
33.5,
18.375
] |
Activists push for Darfur divestment Lobbyists were at the Capitol Monday, on behalf of divestment for Darfur. Activists believe the best way to end genocide in Darfur is to divest from Chinese oil companies doing business with the Sudanese government. Branton Kunz is with the Darfur Action Coalition of Wisconsin . “Eight states have divested now,” said Kunz. “Last week, Rhode Island and Colorado divested. We're talking about hundreds of billions of dollars . . . and that has a real impact.” The coalition's Sachin Chheda said over 400,000 people in the Darfur region of Sudan have been killed in over four years, and it's time for individuals and the state to step up: “they can divest their personal holdings, and we can divest the holdings of the state of Wisconsin Investment Board.” The Wisconsin Investment Board cites a number reasons in opposing legislation , from state Sen. Sheila Harsdorf (R-River Falls) and Rep. Fred Kessler (D-Milwaukee) to divest from companies that do business with Sudan. The board's Executive Director, Dave Mills, testified against the bill last month. Mills said the bill raises several legal questions, and could require repayment of hundreds of millions of dollars by the state. | Mid | [
0.5976470588235291,
31.75,
21.375
] |
7 Solid Online Alternatives to Paying Hefty Cable Bills When people are looking for ways to save money, one of the first suggestions they usually come across is to “cut cable.” The cost of traditional cable or satellite television continues to rise. Eliminating this monthly bill can have a considerable impact on your finances. However, you will probably still want to enjoy watching some of your favorite entertaining programs. Fortunately, there are many options available to help you save money while still being able to watch television. 1. Netflix Netflix was one of the first online streaming media companies. It was originally started as a DVD-by-mail business. You can still receive DVD’s from them in the mail. However, the main draw of Netflix is the unlimited, instant streaming of a large variety of shows and movies for a monthly subscription fee (currently, $7.99, $9.99, or $11.99 depending on the plan). You can watch Netflix on your computer or smartphone. Also, there are many different devices that can be used to access Netflix on your television, including gaming systems like Xbox and PlayStation. Netflix has been producing more and more original content, including movies and television shows. Some popular series that you can only watch on this platform include House of Cards, Orange Is the New Black, and Stranger Things. The Ridiculous 6, a comedy starring Adam Sandler, is also only available on Netflix. 2. Hulu Hulu launched in 2008 and has been one of the main competitors of Netflix. They have a long-standing relationship with Disney, which gives subscribers special access to shows and movies that you can’t find on other streaming platforms. Like Netflix, they also release their own, original productions. Hulu tends to have more television shows than movies. It is not compatible with as many devices for streaming to your television. Hulu’s basic plan ($5.99) is cheaper than Netflix, but subjects you to some commercials. If you upgrade, for an increased monthly fee ($11.99), you can access commercial-free viewing. 3. Apple TV Apple TV is a digital media player. It attaches to your television to provide internet streaming entertainment, comes with a remote control, and works with Siri to react to voice commands. There is no monthly fee to use Apple TV. One special feature of this device is that it can be used to access everything in your iTunes account. Purchased television shows can be watched over and over again, on multiple devices. You can also access free entertainment through various apps. Finally, Apple TV can be used to stream entertainment from other providers, like Netflix and Hulu. 4. YouTube There are millions of videos to watch on YouTube; literally, something for everyone. These videos are always available for free on smartphones or your computer. Or, you can purchase a streaming device to send the videos to your television. YouTube Red was recently introduced as a new option in the world of online streaming entertainment. The monthly subscription fee provides you with ad-free videos and allows downloading of videos for watching offline. It also provides access to Google Play music and exclusive YouTube Original shows. 5. HBO Now If any of your favorite shows are on HBO, this streaming service is one of the only ways that you can legally watch them without a cable subscription. There are many movies available on HBO Now, including feature films that were recently playing in theaters and movies from decades ago. HBO has distribution rights to movies from 20th Century Fox, Universal Pictures, and Warner Bros. Pictures. All original HBO series are available to stream, on a permanent basis. HBO Now works with your computer, tablet, and smartphone, or it can be streamed to your television. The current subscription pricing is $14.99 per month on the HBO Now website. 6. Amazon Amazon provides a couple of different options for television streaming. They have the Amazon Fire Stick or Amazon Fire TV. Both of these devices attach to your television, provide internet streaming services, and come with a remote control. Amazon streaming will work with paid subscription sites like Hulu and Netflix. In addition, these devices allow you to download a variety of different apps to your television. There are many free options, including news, sports, children's, and entertainment video apps. If you are a frequent purchaser of products online, you may want to consider a subscription to Amazon Prime. This membership provides free two-day shipping on orders and special pricing on certain items. In addition, it provides you with access to Amazon’s database of on-demand entertainment. The selection of things to watch is less as compared to other providers, but you have the added benefits of shipping and can download one free book every month. 7. Sling TV Sling TV is a relatively new option for streaming entertainment. The monthly fee is higher than its predecessors ($20 – $40), but still easily beats the cost of cable television. This service provides unlimited access to live streams of popular channels including TNT, TBS, Disney Channel, Lifetime, CNN, HGTV, Comedy Central, and ESPN. It is not “on-demand,” where you watch what you want, when you want. However, Sling TV provides access to shows that are not available on the other platforms. If sporting events are a dealbreaker for cutting cable, Sling TV may be the solution for you. Sling TV has on-demand movies, although you have to pay a separate rental fee for each one that you watch. There are add-on options for additional channel packages, and for HBO. Library [Bonus Idea] If you’re looking for ways to really save money, try using the library as your source for entertainment. They have DVD’s that you can borrow for free. In addition, more and more libraries are implementing online access to electronic materials. The days of expensive cable or satellite television may be numbered with all of the different alternatives that continue to increase and expand. Switching to a streaming service provider should be a fairly painless experience that will keep you supplied with entertaining television while saving you money. Even subscribing to two different services is still likely to be cheaper than what you normally pay the cable company. It’s just a matter of figuring out what you really want to watch, instead of worrying about having as many channels as possible. Do you have a favorite online streaming service? If so, let us know about it in the comments. Join 38,500 subscribers improving their financial life. Subscribe for free. Get my book (31 Days to Improve Your Financial Life), intro series, and article digest. Last Edited: July 25, 2017 @ 6:22 pmThe content of ptmoney.com is for general information purposes only and does not constitute professional advice. Visitors to ptmoney.com should not act upon the content or information without first seeking appropriate professional advice. In accordance with the latest FTC guidelines, we declare that we have a financial relationship with every company mentioned on this site. About Harmony Smith Harmony Smith blogs at CreatingMyKaleidoscope.com. She is a working mom of five who is fighting to pay off debt, so she can escape from her 9-5 job, and spend more time with her family. Harmony blogs about saving money, increasing her income with side hustles, DIY projects, and other adventures. Up Next... Comments With so many great alternatives now, I don’t know why anyone needs expensive cable. We have Netflix and Amazon, plus we can stream ESPN for the hubs. We also got bunny ears for the tv so we can get a few local channels. Works for us! Join 38,500 subscribers improving their financial life. Sign up for free. Get our ebook (31 Days to Improve Your Financial Life), intro series, and article digest. About PT Hi, I'm Philip Taylor. I'm a husband, father, blogger, CPA, and entrepreneur. I love learning to do more with my money and sharing it all here with you. Join in on the conversation and start improving your financial life today. Read more... Social Disclosures: The content of ptmoney.com is for general information purposes only and does not constitute professional advice. Visitors to ptmoney.com should not act upon the content or information without first seeking appropriate professional advice. | Mid | [
0.579399141630901,
33.75,
24.5
] |
{% extends "index.html" %} {% block content %} <div class="post"> <h1 class="post-title">{{ page.title }}</h1> {{ page.content | safe }} </div> {% endblock content %} | Low | [
0.49118942731277504,
27.875,
28.875
] |
In the United States Court of Federal Claims OFFICE OF SPECIAL MASTERS No. 17-884V Filed: August 10, 2018 UNPUBLISHED MARTHA TAPIA, Special Processing Unit (SPU); Joint Petitioner, Stipulation on Damages; Tetanus v. Diphtheria acellular Pertussis (Tdap) Vaccine; Shoulder Injury Related to SECRETARY OF HEALTH AND Vaccine Administration (SIRVA) HUMAN SERVICES, Respondent. Jeffrey S. Pop, Jeffrey S. Pop & Associates, Beverly Hills, CA, for petitioner. Adriana Ruth Teitel, U.S. Department of Justice, Washington, DC, for respondent. DECISION ON JOINT STIPULATION1 Dorsey, Chief Special Master: On June 28, 2017, petitioner filed a petition for compensation under the National Vaccine Injury Compensation Program, 42 U.S.C. §300aa-10, et seq.,2 (the “Vaccine Act”). Petitioner alleges that she suffered a shoulder injury related to vaccine administration (“SIRVA”) as a consequence of a Tetanus0diphtheria-acellular pertussis (“Tdap”) vaccination administered on April 18, 2016.3 Petition at 1; Stipulation, filed August 9, 2018, at ¶ 1. Petitioner further alleges that the vaccination was administered within the United States, that she experienced the residual effects of her injury for more than six months, and that there has been no prior award or settlement of a civil action for damages as a result of her condition. Petition at 1; Stipulation at ¶¶ 3-5. 1 Because this unpublished decision contains a reasoned explanation for the action in this case, the undersigned intends to post it on the United States Court of Federal Claims' website, in accordance with the E-Government Act of 2002. 44 U.S.C. § 3501 note (2012) (Federal Management and Promotion of Electronic Government Services). In accordance with Vaccine Rule 18(b), petitioner has 14 days to identify and move to redact medical or other information, the disclosure of which would constitute an unwarranted invasion of privacy. If, upon review, the undersigned agrees that the identified material fits within this definition, the undersigned will redact such material from public access. 2 National Childhood Vaccine Injury Act of 1986, Pub. L. No. 99-660, 100 Stat. 3755. Hereinafter, for ease of citation, all “§” references to the Vaccine Act will be to the pertinent subparagraph of 42 U.S.C. § 300aa (2012). 3 Petitioner also received a varicella and MMR vaccine on April 18, 2016, but has alleged no injury related to the administration of those vaccinations. “Respondent denies that the Tdap, varicella, or MMR vaccine caused petitioner’s SIRVA or any other injury or her current condition.” Stipulation at ¶ 6. Nevertheless, on August 9, 2018, the parties filed the attached joint stipulation, stating that a decision should be entered awarding compensation. The undersigned finds the stipulation reasonable and adopts it as the decision of the Court in awarding damages, on the terms set forth therein. Pursuant to the terms stated in the attached Stipulation, the undersigned awards the following compensation: A. A lump sum payment of $111.11, representing compensation for full satisfaction of the State of California Medicaid lien, in the form of a check payable jointly to petitioner and Department of Health Care Services Recovery Branch – MS 4720 P.O. Box 997421 Sacramento, CA 95899-7421 DHCS Case No. C94767219A-VAC02 Petitioner agrees to endorse this check to the Department of Health Care Services; and B. A lump sum of $45,000.00 in the form of a check payable to petitioner. Stipulation at ¶ 8. This amount represents compensation for all items of damages that would be available under 42 U.S.C. § 300aa-15(a). Id. The undersigned approves the requested amount for petitioner’s compensation. In the absence of a motion for review filed pursuant to RCFC Appendix B, the clerk of the court is directed to enter judgment in accordance with this decision.4 IT IS SO ORDERED. s/Nora Beth Dorsey Nora Beth Dorsey Chief Special Master 4 Pursuant to Vaccine Rule 11(a), entry of judgment can be expedited by the parties’ joint filing of notice renouncing the right to seek review. 2 | Mid | [
0.549425287356321,
29.875,
24.5
] |
Dear visitor, welcome to SPRINKLER TALK FORUM - You Got Questions, We've Got Answers. If this is your first visit here, please read the Help. It explains how this page works. You must be registered before you can use all the page's features. Please use the registration form, to register here or read more information about the registration process. If you are already registered, please login here. WELL UNDER SWMING POOL? I had an inground pool installed several years ago. During the installation phase, the ground water nearly filled the deep end of the pool with water. The installer told me I could probably run a sprinkler system from the water under the pool. There a permanently installed pipe running down there to be used to pump out the ground water for liner replacement later if needed. My question is, would it be pheasible to pump this water to supply a sprinkler system I am thinking of installing. If so, what size pump would I need? My main concern is that I don't know how fast the water would flow into the area once the pump is started. I have a swamp behind my house and a few wet spots in the yard, so the water table is very high. My intensions were to try this and if it did not work out, I would then tie on the the house supply system. Given a big budget, you can make the pumped-pool-liner water supply work, but you have to determine how much of a flow you can sustain. Don't expect much, but you might luck out. It takes the combination of high water table and sandy or gravelly soil to get the best results. Figure a half-horsepower pump, which, by the way, is about all you can run on a typical circuit. If you test it out, and get a sustainable flow, come back for further advixe. Come back anyway, to inform us of the test results. Thanks for the info WB. I live in Ga so the chances of sandy or rocky soil are pretty slim. Most likely red clay, but they did dump a load of gravel down there before finishing the pool. The pipe installed under the pool is 1.5 inch PVC. I don't think a 1/2 HP pump will supply enough water though, do you? Most lake pump recommendations I have read about suggested 1.5 HP pumps. I plan to water between 15 and 20 thousand square feet. I guess the only way to find out is to rent a gas powered pump and test the flow, agree? I am willing to cut the zone sizes down if necessary in order to get free water, especially since I have to pay an equal amount for sewer on all the water I use. It is very unlikely that enough water will flow through heavy clay soil quickly enough to give you what flow that you need, even if you had a more conventional well point. Where a big budget comes in, is when a tiny ground water supply is pumped into a separate reservoir or water tank(s) and in turn, is pumped into a lawn sprinkler system. Thought I would update. Have 1-1/4 pvc running under pool. Connected 1/2 hp pump. Filed up 5 gal bucket in approx 12 seconds(25gpm). Ran for 1 hr, then went dry. Left off for 30 min and it ran for another 25 min before going dry. To me this means there is enough water down there to use for my system. May have to allow for 10 minute rebuild period between watering zones. Well, that's good performance. If you throttled the discharge of that half-horse pump, you might achieve continuous pumping. And when you operate with higher pressure from that pump, that's what you'll be doing. With around 10 gpm or more, you'll be in good shape. And, by the way, you could also configure the system to use 'dirty water' sprinkler heads and valves, and reduce the filtering required. | Mid | [
0.5595505617977521,
31.125,
24.5
] |
1. Field of the Invention The present invention relates to an apparatus and a method for conditioning the polishing surface of a polishing pad with high precision. 2. Related Background Art With the recent progress in the ultra fine geometry and in the multi-layered wiring of the semiconductor devices, there is being required high precision polishing apparatuses for flattening the surface of a substrate such as semiconductor wafer for example of Si, GaAs, InP or SOI, with high precision. Among such apparatuses, there is known a chemical mechanical polishing (CMP) apparatus for flattening the surface of a substrate such as a wafer on which the semiconductor devices are formed, with high precision. The CMP apparatuses can be divided into two types as shown in FIGS. 1 and 2. (1) FIG. 1 is a schematic view of a polishing part of a CMP apparatus for executing the polishing operation in the state of facing the surface to be polished of a wafer 100 downwards. As shown in FIG. 1, the wafer 100 is supported by a wafer chuck 400 in the state of facing the polished surface downwards and is pressed, in the state of rotation of the wafer (Hereinafter, "rotation" means the action of an object of turning on its own axis.), to a polishing pad 200 of a diameter larger than that of the wafer 100 to thereby polish the wafer. In the polishing operation, a polishing agent (slurry) 300 is supplied by dripping onto the upper surface of the polishing pad 200. The wafer chuck 400 supports the wafer 100 by attachment utilizing, for example, vacuum suction, wax, solution or deionized water, and a guide ring (not shown in the drawings) may be provided along the periphery of the wafer 100 in order to prevent displacement thereof. The diameter of the polishing pad 200 on a polishing table 500 is 3 to 5 times that of the wafer 100, and the slurry consists of a suspension of finely powdered silicon oxide mixed in the aqueous solution of potassium hydroxide. As shown in FIG. 1, the CMP apparatus is further provided with conditioning means 600. The conditioning means 600 has an annular shape with a diameter smaller than that of the polishing pad 200, and is maintained in contact with a part of the polishing pad 200. The conditioning means 600 moves on the polishing pad 200 while executing a rubbing movement such as rotation or swinging, thereby removing the particles of the slurry and the polished wastes generated in the polishing operation from the entire surface of the polishing pad 200. There is also proposed, as illustrated in FIG. 2, a method of supporting a wafer 100 in the state of facing the surface to be polished upwards by a wafer chuck 800 provided on a wafer table 700 and having a guide ring (not shown in the drawings) and then polishing the wafer 100 with a polishing pad 900 of a diameter smaller than that of the wafer 100. Such polishing apparatus and method are suitable for polishing the currently employed semiconductor wafers of 8 inches in diameter, but it is said that the wafers are shifted from 8 inches to 12 inches in the near future, following the continuing progress in the semiconductor technology toward the finer geometry of the integrated circuits and the larger diameter of wafer. For polishing the wafer of a large diameter, the above-described technology is associated with the following technical problems. In the above-described polishing apparatus, in polishing the 8-inch wafer, the polishing performance is adjusted by optimizing the thickness and elasticity of the polishing pad, but it is difficult to achieve delicate adjustment or to maintain uniformity in the material of the polishing pad, so that high-quality polishing is difficult to attain in the wafer of a larger diameter such as 12 inches. For example, in case of employing a polishing pad of a diameter smaller than that of the wafer as described in the foregoing, it is difficult to obtain a uniform polishing amount over the entire surface of the wafer. Also there is required a long polishing time in case of polishing the entire surface of the wafer with a polishing pad of a diameter smaller than that of the wafer. Also in case of polishing the entire wafer with a polishing pad of a diameter larger than twice that of the wafer, the polishing amount becomes larger in the central area of the polishing pad than in the peripheral area of the polishing pad, because of the circumferential speed between the central area of rotation of the polishing pad and the peripheral area thereof, so that it is difficult to control the polishing amount. Also, since the rotation of the polishing pad is executed while only a part of the polishing pad is in contact with the wafer, it may be degraded, abraded or even deformed in a donut shape. Furthermore, the polishing pad may be deformed by the pressure applied thereto during the wafer polishing. All these phenomena cause the degradation of the uniformity of polishing and the flatness by the polishing. Also in case of polishing the surface of a wafer to be polished facing downwards by the polishing pad of a diameter larger than twice that of the wafer as described in the foregoing, the polishing agent is supplied not only to the area of the polishing pad in contact with the wafer but also to the entire surface of the polishing pad. For this reason, there is consumed a large amount of the polishing agent, thereby leading to a higher cost. Also in the above-described polishing apparatus, it is difficult to achieve uniform conditioning over the entire surface of the polishing pad with the conditioning means. This is because the conditioning means is in contact with only a part of the polishing pad. More specifically, the polishing pad is deformed at the boundary of an area in contact with the conditioning means and an area not in contact therewith, and this causes generation of uneven conditioning in such deformed part. As explained above, the above-described conditioning technology results, within the conditioned polishing pad, in an area sufficiently conditioned having a high polishing ability and an area not sufficiently conditioned. It is difficult to uniformly polish the substance to be polished such as a wafer by using the polishing pad showing such unevenness. Also in case of employing the conditioning means with an area smaller than that of the polishing pad, there is required a long time for conditioning the entire surface of the polishing pad. | Mid | [
0.643617021276595,
30.25,
16.75
] |
Q: Canvas is not showing I want to draw an image with canvas. But the image is not showing up. If I try this code in JSFiddle, it works. I hope you can help me. Here is my script: window.onload = function() { var canvas = document.getElementById("myCanvas"); var ctx = canvas.getContext("2d"); var img = new Image(); imageObj.onload = function() { ctx.drawImage(img, 0, 0); }; img.src = "http://imageshack.us/a/img19/1158/tx2a.png"; }; This is how I place my canvas in the HTMl body: <canvas id="myCanvas" width="1011" height="1700">Hier sollte eine Grafik sein</canvas> And this is the working Fiddle: http://jsfiddle.net/5P2Ms/454/ I hope you can help me! Full new HTML Code: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"> <title>Insert title here</title> </head> <body> <script> var can = document.getElementById('myCanvas'); var ctx = can.getContext('2d'); var img = new Image(); img.onload = function() { ctx.drawImage(img, 0, 0); } img.src = "http://imageshack.us/a/img19/1158/tx2a.png"; </script> <canvas id="myCanvas" width="1011" height="1700">Hier sollte eine Grafik sein</canvas> </body> </html> A: There was no window.onload in your full html. This is the problem <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"> <title>Insert title here</title> </head> <script type="text/javascript"> window.onload = function(){ var can = document.getElementById('myCanvas'); var ctx = can.getContext('2d'); var img = new Image(); img.onload = function() { ctx.drawImage(img, 0, 0); } img.src = "http://imageshack.us/a/img19/1158/tx2a.png"; } </script> <body> <canvas id="myCanvas" width="1011" height="1700">Hier sollte eine Grafik sein</canvas> </body> </html> | Mid | [
0.65296803652968,
35.75,
19
] |
Inefficiency of renin-angiotensin inhibitors in preventing atrial fibrillation in patients with a normal heart. Recent scientific evidence has emphasized the possible role of inhibitors of the renin-angiotensin system in preventing arrhythmic relapses in patients with paroxysmal or persistent atrial fibrillation and co-existing left ventricular hypertrophy or left ventricular dysfunction. In order to verify the effects of these drugs on patients with a normal heart, we collected a series of 187 patients admitted to our division of cardiology for paroxysmal or persistent atrial fibrillation. All patients underwent cardioversion (with antiarrhythmic drugs and/or by electrical cardioversion) and were discharged in sinus rhythm. Episodes of recurrent arrhythmia were recorded during a mean follow-up period was 2 years. Patients were subdivided into 2 groups according to therapy: group 1 comprised patients receiving renin-angiotensin system inhibitors, group 2 comprised those not receiving therapy with these agents. All 91 patients in group 1 and 76 of those in group 2 had hypertension. Among the 91 patients in the group 1, 55 were treated with angiotensin-converting enzyme (ACE) inhibitors and 36 with angiotensin receptor blockers. There were no statistically significant differences in cardiovascular risk factors or antiarrhythmic drug use between the 2 groups. In group 1, 83% of patients experienced <2 recurrences of atrial fibrillation during the follow-up period, while 17% had >2 episodes. In group 2, 86% of patients experienced <2 relapses during the follow-up period, while the remaining 14% had >2 relapses. There was no statistically significant difference between the 2 groups (P=0.85). A subgroup analysis showed that treatment with angiotensin receptor blockers, beta-blockers, diuretics, and calcium-channel blockers brought no advantage in sinus rhythm maintenance. In our sample of hypertensive patients with a healthy heart, treatment with ACE inhibitors showed no statistically significant advantage in the prevention of atrial fibrillation relapses. | Mid | [
0.63953488372093,
27.5,
15.5
] |
Work same as Body through Rnd 4: 8{10-12} dc, 8{10-12} Clusters, and 8{10-12} sps. MITTSBody Foundation (RS): Work 32{40-48} Fsc; being careful not to twist piece, join with slip st to first Fsc to begin working in rnds. Loop a short piece of yarn around any stitch to mark Foundation as right side. Rnd 1: Ch 5 (counts as first dc plus ch 2, now and throughout); dc in same st as joining, skip next 3 Fsc, work (Cluster, ch 3, Cluster) in next Fsc, skip next 3 Fsc, * (dc, ch 2, dc) in next Fsc, skip next 3 Fsc, work (Cluster, ch 3, Cluster) in next Fsc, skip next 3 Fsc; repeat from * around; join with slip st to first dc: 8{10-12} dc, 8{10-12} Clusters, and 8{10-12} sps. Rnds 2 thru 4{5-5}: Turn; slip st in next Cluster and in next ch-3 sp, ch 5, dc in same sp, work (Cluster, ch 3, Cluster) in next ch-2 sp, * (dc, ch 2, dc) in next ch-3 sp, work (Cluster, ch 3, Cluster) in next ch-2 sp; repeat from * around; join with slip st to first dc. Do not finish off. Thumb Opening Row 1: Ch 3 (counts as first dc, now and throughout), turn; * (dc, ch2, dc) in next ch-3sp, work Cluster, ch 3, Cluster) in next ch-2sp; repeat from * around, dc in next dc (joining dc), do not join: 10{12-14} dc, 8{10-12} Clusters, and 8{10-12} sps. Row 2: Ch 3, turn; * (dc, ch2, dc) in next ch-3sp, work (Cluster, ch3, Cluster) in next ch-2sp; repeat from * across to last 2 dc, skip next dc, dc in last dc. Row 3: Ch 3, turn; * (dc, ch2, dc) in next ch-3sp, work (Cluster, ch3, Cluster) in next ch-2sp; repeat from * across to last 2 dc, skip next dc, dc in last dc; join with slip st to first dc to begin working in rnds. Next Rnd: Turn; slip st in next 2sts and in next ch-3sp, ch5, dc in same sp, work (Cluster, ch3, Cluster) in next ch-2sp, * (dc, ch2, dc) in next ch-3 sp, work (Cluster, ch3, Cluster) in next ch-2sp; repeat from * around; join with slip st to first dc: 8{10-12} dc, 8{10-12} Clusters, and 8{10-12} sps. Last 3{44} Rnds: Turn; slip st in next Cluster and in next ch-3sp, ch5, dc in same sp, work (Cluster, ch3, Cluster) in next ch-2sp, * (dc, ch2, dc) in next ch-3 sp, work (Cluster, ch3, Cluster) in next ch-2sp; repeat from * around; join with slip st to first dc. Finish off. Cuff Rnd 1: With right side facing and working in chs at base of Fsc, join yarn with hdc in ch at base of first Fsc (When instructed to join with hdc, begin with a slip knot on hook. YO, holding loop on hook, insert hook in stitch or space indicated, YO and pull up a loop, YO and draw through all 3 loops on hook) hdc in next ch and in each ch around; join with slip st to first hdc: 32 {40-48} hdc. Rnds 2-10: Ch 2, front hdc around same st as joining, back hdc around next st, (front hdc around next st, back hdc around next st) around; skip beginning ch-2 and join with slip st to first front hdc. Finish off. | Mid | [
0.5436105476673421,
33.5,
28.125
] |
19 F.3d 27 NOTICE: Ninth Circuit Rule 36-3 provides that dispositions other than opinions or orders designated for publication are not precedential and should not be cited except when relevant under the doctrines of law of the case, res judicata, or collateral estoppel.Edith L. JAMES, Plaintiff-Appellant,v.Luis CACERES; Jana Corrington, Defendants-Appellees. No. 93-55251. United States Court of Appeals, Ninth Circuit. Submitted Feb. 22, 1994.*Decided Feb. 25, 1994. Before: SCHROEDER, CANBY, and WIGGINS, Circuit Judges. 1 MEMORANDUM** 2 Edith L. James appeals pro se the district court's summary judgment for Luis Caceres and Jane Corrington, employees of the California State Personnel Board. James claims Caceres and Corrington denied her a job in violation of Title VII of the 1964 Civil Rights Act, 42 U.S.C. Secs. 2000e et seq., the Age Discrimination in Employment Act, 29 U.S.C. Sec. 621 et seq., and various civil rights statutes and state law. We have jurisdiction under 28 U.S.C. Sec. 1291, and we affirm for the reasons set forth in the Magistrate Judge's report and recommendation, which fully and fairly addressed all the arguments raised in this appeal. 3 AFFIRMED. * The panel unanimously finds this case suitable for decision without oral argument. Fed.R.App.P. 34(a); 9th Cir.R. 34-4 ** This disposition is not appropriate for publication and may not be cited to or by the courts of this circuit except as provided by 9th Cir.R. 36-3 | Low | [
0.431906614785992,
27.75,
36.5
] |
I’ve said it before and I’ll say it again – there are way too many movies that use female characters only as walk-ons, tokens, eye candy, the straight man for joke scenes. This isn’t an isolated phenomenon, there really has been a slide from when movies had male and female characters, to now, where there are male characters and their female appendages. There’s a fun technique some people use now, to decide whether or not a movie can be said to be a movie with women in it. It’s called the Bechdel Rule, named after the cartoonist and graphic novelist Allison Bechdel. And the rule is: does the movie have two female characters? Do they ever talk to each other? And when they talk, is it about something besides a man? It’s surprising how uncommon movies passing these three rules are. So let’s look at some that definitely pass this test. “Hey Hey it’s Esther Blueburger” Dir / Wri: Cathy Randall. 12 year old Esther (Danielle Catanzariti) lives in Adelaide, Australia, with her eccentric, computer geek twin brother and her nice, middle-class, but detached, parents. She goes to a private girls school in pigtails, a plaid skirt, shirt and tie, and an old fashioned straw hat. She looks like a Jewish Anne of Green Gables, but with black hair, not red. She’s a bit of an outcast in this hierarchical, conformist, school of rules, bullies and guards, and she has no friends, except her brother and a little duck she adopts. She sits in a toilet stall and asks, Are you there God? It’s Me Margaret… I mean Esther. So she hangs out near a public high school built on the grounds of an old zoo, looking in at the kids who get to do dancing and karate and drumming instead of singing in a choir. When something terrible happens at her school, Esther rebels. She’s befriended by Sunni (Keisha Castle-Hughes), an older tough girl from the public school who lends her a spare uniform. Esther becomes a stealth student at another school. She tries new things, pierces an ear, starts to wear makeup, express herself, creates a brand new personality. But at the expense of her truer, better self? “Hey, Hey It’s Esther Blueburger”, is a nice, cute, coming of age story, a sort of an Aussie Holden Caulfield about a young girl finding herself, and learning about the world. The movie doesn’t always work – it’s formulaic, and wavers from after school special, to light comedy, to fantasy, to more serious drama – but I enjoyed it. It’s also really well made – what’s with these Australian movies? One made in North America would just churn out something like this as a cheap knock-off; but the Australians put so much work into the look of this movie, with stylized, almost choreographed scenes, repeating colour images, running visual themes… the art direction is noticeably superior, and the editing, direction, everything, are all really good. And Catanzaritti is terrific (if sometimes too terrific) as a young girl growing up. “The Kids are All Right” Dir: Lisa Cholodenko …is a real honey of a movie. It’s about a nice Southern California family, with two kids, Joni and Laser, and two mommies, Nic a doctor, and Jules, a housewife. Both kids have the same anonymous donor as their biological father, with each mother giving birth. So… as part of their agreement, the sperm bank keeps a record of the donor, and when Joni turns 18, she decides to initiate contact, mainly because 15-year-old Laser wants a chance to meet his dad. That’s where the plot thickens. All of their lives are suddenly disrupted with the introduction of Paul. Let me say who’s playing whom, so you can get an idea of this movie: Nic and Jules is Annette Bening as the uptight doctor, in maybe her best role ever; Julianne Moore, going against type, as an insecure, bumbling, apologetic mum; and Mia Wasikowska (who was Alice in Wonderland) as the gentle Joni. The third wheel dad/sperm donor is Mark Ruffallo, a motorcycle riding, college drop out, organic farmer restauranteur, who hits on every pretty woman he sees – quite successfully, it seems. He’s a do-er. He’s still the 19 year old sperm donor, but in his 40’s now, and suddenly wants to settle down and fly right… sort of. Normally I’m not a big fan of light family dramas, but this movie has such good acting, is so funny, is such a good story – I really liked it. And it wasn’t actors playing roles, Nic and Jules really are this middle class married lesbian couple, with all their quirks and foibles and embarrassing squirmy personality traits — like they get off watching gay male porn! — that transcend the usual stereotypes, but let a few choice ones in, too. Great movie! Act of Dishonour Dir: Nelofer Pazira A much graver story, Act of Dishonour is a Canadian movie that takes place in a polyglot and diverse Afghan village, a village at peace. Mejgan, played by Nelofer Pazira who also wrote and directed, is a woman returning to Afghanistan to find out about her past, and also to work on a Canadian movie being shot there. The Hazera are returning to the village as well, as are people who had fled to the west, to Kabul or to Iran, or are returning from a Taliban prison. And members of the Taliban still live there too. Kids are being educated again, allowed to watch animated movies at school, buut women are still kept sequestered away. Meanwhile, a pretty, 15 year old girl who dresses in red and weaves and dyes cloth behind the clay walls of her home, is hoping to get married soon, and she sometimes sees a boy her age who she would like to marry, but needs a burqa to wear to her wedding. So Mejgan makes a deal – she’ll give her a bright purple burqa if the girl agrees to appear in a movie scene. Here’s where the subtle irony comes in: A decade ago, Pazira starred in a great movie about the oppression of women in Afghanistan, called “Kandahar”. In that movie the burqa was a symbol of oppressed women and their lack of freedom. But in this village it’s a symbol of honour, tradition and beauty. The smug director, though, is set in his ways – there’s no way he’s going to play a part in this subjugation of woman – he will not give a woman a burqa! A day or two later the Canadians will be moving on to Kabul, but what are the consequences of what they’ve done? Acts of Dishonour deals with the stubbornness of earnest Canadian visitors, the violence of the fundamentalists, the ethnic unrest, and the concept of foreigners versus locals, (which doesn’t necessarily mean westerners) and how even the appearance of sin or dishonour to a family’s name can lead to revenge, death, or even the threat of honour killing. I’ve only seen two movies about contemporary Afghanistan – both involving Pazira – and together they give a good before and after view of the Afghan war, (not to say that it’s over now) bookends of a decade of conflict. It’s not a gripping thriller, or a melodrama; it’s a subtle film, nicely shot — stark cold, plain, realistic — that gives a glimpse into the lives of the people there and some of the intractable conflicts and violence they face. It makes a nice metaphor about Canadians’ generous, earnest intentions for Afghanistan… and how divorced from reality they sometimes end up being. So there you are, three interesting movies — Canadian, Australian, and American — all with at least two female characters, who talk to each other, and not just about a man. That’s a solid “three” on the Bechdel scale. | Mid | [
0.6469248291571751,
35.5,
19.375
] |
It's been a sad slope from love into hate. If he was able to give me something of substance nowadays I probably wouldn't mind. Only he's utterly worthless now, combined with his bad attitude to boot, I really can do without him. | Low | [
0.36503856041131105,
17.75,
30.875
] |
Team News Service, Humility Define Serena Barr in NCAA Woman of the Year Journey Helping others and serving Christ is not just something former Liberty field hockey student-athlete Serena Barr does. It is at the fabric of who she is. This was evident on Oct. 22, as Barr was recognized as a Top 9 Honoree at the 2017 NCAA Woman of the Year Awards Dinner in Indianapolis. She flew in with her family from Northern Ireland to attend the weekend-long event, in which the Top 30 Honorees for the prestigious award were also in attendance and recognized for their achievements. After the Top 30 were honored and following dinner, the NCAA played a video of each of the nine finalists, and each finalist appeared on stage to answer one question from ESPN's Jessica Mendoza, the host for the evening. Barr, whose video played second, shared with Mendoza and the audience about her life's passion and purpose. "Going to Uganda at such a young age, I saw what life was like for the majority of the world. I really wanted to educate myself and equip myself to be able to give children the opportunity to play a sport, to get an education, to get past the first five years of life without dying because of malnutrition," Barr stated. "So that is what really drives me." Barr received a bachelor's degree in public health at Liberty, earning a perfect 4.0 GPA in the process while playing for the Liberty field hockey program for four years (2013-16). She graduated from Liberty in May and is currently pursuing her master's degree in dietetics at the University of Leeds in the United Kingdom. With her education, she plans to help people both locally and globally. Barr and her family, with whom she is very close, have spent significant time in Uganda serving through Charlene's Project. The organization, founded by her late sister, Charlene, seeks to relieve poverty, hardship and distress while also providing for the advancement of education for children, young people and beyond. The book Chosen: The Story of Charlene Barr, authored by Serena's brother David Barr, shares the vision Charlene had for the children of Uganda. The Barr family is living that vision out, making trips to Uganda to aid in the project. Today, the project sponsors over 100 children, supports over 20 teachers and has built two schools and two wells. The journey for Barr and her twin sister Bethany began when her older sister, Natalie, began playing field hockey for the Lady Flames and former head coach Jodi Murphy in 2012. Murphy and the Barrs had a mutual friend, Joshua Opolut, Executive Director and Founder of Youth Sport Uganda. Serena Barr played for Liberty from 2013-15 with both Bethany and Natalie, and in 2016, Natalie coached Serena and Bethany during their last season at Liberty. Both Bethany and Natalie shared in Serena's experience at the NCAA Woman of the Year Awards Dinner, while her parents Dickie and Janice, oldest sister Rebecca, grandfather Jim and aunt Lorraine also attended the event. The Barr family often traveled from Lurgan, Northern Ireland to the United States to attend Liberty field hockey games throughout the course of her four years in a Liberty uniform. "Where I am today is massively because of them," Barr said. "Anything I've achieved is their achievement as well. We are so close and celebrate each other's accomplishments." Reflecting back on her time at Liberty, Barr is grateful for the support she received, along with the holistic educational experience. "It's because of them that I'm here, and they gave me the opportunity to play at a collegiate level. They made it possible for me to play, study hard and be able to be involved in the community," Barr stated. "It's definitely something that has to come back to Liberty, and it's on their shoulders why I'm here," she said. Barr became the first Liberty student-athlete in athletics department history to make the Top 30 for NCAA Woman of the Year. A two-time NorPac Champion, Longstreth/National Field Hockey Coaches Association (NFHCA) All-American honoree and College Sports Information Directors of America (CoSIDA) Academic All-America® selection are just a few of Barr's long list of accomplishments. She says her top field hockey memory as a Lady Flame was defeating No. 10 Stanford in the 2013 NorPac Championship game to claim an NCAA Division I Field Hockey Championship berth in just the program's third year of existence. Barr cherished the relationships she built with her Liberty field hockey teammates, as well as with those on campus and in the Lynchburg community and surrounding area. She developed friendships with people who built her up spiritually and poured into her. She also felt her experience at Liberty widened her perspective and allowed her to see how sports are a universal language and a platform to reach people. Lizzy Crist of Wash. U in St. Louis received the NCAA Woman of the Year award. "I'm so thankful for the opportunity to have been here and met some amazing people who are doing amazing things. It was an honor to be among some of those girls and to enjoy that celebration," Barr stated. Barr's legacy she leaves at Liberty and what she will do in the world moving forward is not about her accomplishments. "I hope I made a lasting impression on the lives of others by putting others' needs above my own and utilizing the gifts and talents to make a difference in the lives of others." | Mid | [
0.6519607843137251,
33.25,
17.75
] |
Q: Codename One - Test Recorder: check if a component is completely shown without scrolling Using the Test Recorder of the Simulator of Codename One, how can I do the following tests? The test has success if a given component (that has an assigned name) is shown in the current form. The test has success if a given component (that has an assigned name) is completely shown in the visible part of the current form (without scrolling it). A: For 1 you can do: assertNotNull(findByName(componentName)); Number 2 is a bit trickier as there is no builtin assert for that. I would try something in this vain: Component myCmp = findByName(componentName); Container parent = myCmp.getParent(); Rectangle viewArea = new Rectangle(parent.getScrollX(), parent.getScrollY(), parent.getHeight(), parent.getWidth()); assertBool(viewArea.contains(myCmp.getX(), myCmp.getY()); assertBool(viewArea.contains(myCmp.getX() + myCmp.getWidth(), myCmp.getY() + myCmp.getHeight()); | High | [
0.65648854961832,
32.25,
16.875
] |
There was a huge dust-up in the IT community this week after Microsoft caved to a developer who complained about a festive Santa hat embedded in the code, saying the “religious” symbol was “offensive.” The drama played out on GitHub, the leading open-source code repository, which hosts Microsoft’s open-source projects, including the popular developer tool VSCode. Earlier this week, a user named Christian-Schiffer opened an “issue” on the platform complaining that someone at Microsoft had inserted an “ Easter egg ” into the code, displaying a Santa hat to users. “Santa Hat on vscode insiders and pushing of religion is very offensive to me,” he wrote in the subject line.“Additionally xmas has cost millions of Jews their lives over the centuries, yet even if that was not the case, pushing religious symbols as part of a product update is completely unacceptable,” he went on to say. “Please remove it immediately and make it your top priority. To me this is almost equally offensive as a swastika.” Yeah, right. Exactly like a swastika. I mean, who doesn’t remember the jackbooted Santas storming the Warsaw Ghetto? Let’s take a moment, shall we, to appreciate the irony, not to mention the cognitive dissonance and hubris, of a user with the name “Christian” complaining about a Santa hat as a “religious symbol.” (We’ll get back to him in a moment.) Christian-Schiffer included a screenshot of the itty bitty Santa hat that had offended his fragile sensibilities. Yes, that’s it. That microscopic little Santa hat is what has caused our Grinch so much consternation. That should have been the end of it, but because it’s 2019 and the snowflakes must never be made to cast their gaze upon anything they disagree with, Microsoft stepped in to save our hero. Kai Maetzel, whose LinkedIn profile describes him as a “Partner Software Engineering Manager” for Microsoft, responded with: “@Christian-Schiffer we’re sorry we hurt your and other’s feelings. We’ll remove the Santa Hat.” And that’s just what Microsoft did. The company removed the Santa hat, which has nothing to do with the Christian holiday Christmas, to appease the developer whose heart is three sizes too small. Mission accomplished. Christian-Schiffer was elated. “Thank you Microsoft, I am very pleased with that decision,” he wrote. “I understand many find this strange, therefor [sic] I would like to add an article about how offensive xmas is to many so you understand why.” He linked to an article about the Jewish view of Christmas and went on to complain about people who “did not understand the offence, I am very surprised and in fact shocked about that.” Poor dear. Blowback over the decision came fast and hard, with developers in user forums blasting Microsoft for caving in to one lone complainer. “Removing the Santa Hat on vscode insiders is very offensive to me,” wrote LibraryFormid. “Getting offended by one person is against my atheist religion. Bowing before SJW’s as part of a product update is completely unacceptable. Please readd [sic] it immediately and make it your top priority. To me this is almost equally offensive as censorship.” And there were more. Lots more. Here are just a few of the (unedited) comments, culled from the VSCode user forum and Reddit: “Comparing my religion to nazi germany is incredibly hateful, and I don’t think this is a story microsoft wants getting to the news.” “I mean.. at a certain point someone is just looking to be offended and will continue to be offended no matter how many times you capitulate.” “The funny thing is that santa hats barely have anything to do with modern religion. It’s not like Santa is a biblical figure.” “His angle seems to be ‘now that I have your attention I need you to all stop this Christmas thing because it makes ME uncomfortable.’ I’m not even religious but holy hell he can take a long walk off a short pier.” “It’s a hat. It’s a red stocking hat with a white (furry?) hem. Santa is NOT a religious symbol. That’s like saying the ‘ok’ hand gesture is a white supremacist symbol.” “If that’s true, then literally everything is offensive. Some people may be offended that most code is written in a form of English, which is clearly a case of Anglo/European/Western imperialism!” “Why not just tell that time traveling snowflake to stop using VSCode? I will celebrate the day a company like MS or Google etc tell people to take a hike and use some other sh** product if they are offended by something so trivial that makes most people/users/customers happy.” My thought exactly. PJM reached out to Microsoft for comment and was told: “Microsoft has no comment. Please see below for the updated GitHub Issues page.” “Well, that was unexpected,” Chris Dias wrote on the Issues page. “If you didn’t notice, we locked down the vscode repository for the last ~24 hours because of what some are calling ‘SantaGate’. We learned a lot, made some changes, and now we want to share with everyone what happened, how we handled it, and how we will handle this going forward.” “Earlier this week, we were notified through an issue (and on twitter) that the design of the gear with the Santa hat was divisive and offensive to some of our users (even a single person being offended is one too many), meaning it represented the opposite of what we wanted to convey to our users,” Dias explained. “In the spirit of the season, and to practice inclusiveness, we reverted the gear to something (hopefully) less controversial (a snowflake) and checked it into the Insiders build.” [Emphasis added] Yes, you read that right. The tech giant swapped out the offensive Santa hat for a snowflake: This was a brilliant move by Microsoft — assuming it was their intention to jab back at the whiny snowflakes who objected to a digital Santa hat. There was more from Dias: As a result of the massive blowback, Microsoft had to lock down comments: To adhere to our values and the Code of Conduct, we had to delete a handful of comments, which is unfortunate but not uncommon. Our responses triggered more responses. Bots were being employed to create issues and comments. Temporary accounts were being created to spam the system. Offensive issues were being created. The repository was filling up with issues which, frankly, were uncalled for, and we needed to do something, fast. It was at that point we decided to lock the repository down to contributors using the Moderation feature of GitHub, so that we could clean up the backlog and let emotions settle. We posted this issue (which was titled “Why can’t I file an issue right now?”), locked it, and then went to work cleaning up the backlog. Eventually, they decided to give users the option to customize their holiday icons in an attempt to make everyone happy. No word on whether they plan to incorporate a gender-fluid bi-racial snowman. Getting back to our hero, many are claiming he’s a troll. A user named Xaekai wrote: Given that the article the original author of #87268 cited was titled “What does Judaism say about Christmas”, the site it is hosted on is a self-identified religious text repository, and the article itself describes how Christmas is now de facto secular holiday, I believe the original issue author was incontestably acting in bad faith when he purported this request was motivated by offense to religious symbols. Additionally, examination of his GitHub profile reveals just two non-fork repositories with a total of 8 commits. The combinations of name/employer/country revealed no other matching social media accounts in a web search. However the profile image shows up in reverse image search to public profiles of accounts on other sites with a different name. This is at minimum very suspicious. There has been overwhelming opposition to this decision, and I believe it would damage public faith in the maintainers ability to discern when they are being trolled if it moves forward.” Whether or not our hero is actually a troll (if he is, I salute him for his masterful gaslighting of the insane SJW cancel culture), the dust-up at Microsoft is but a small skirmish in a war that’s being played out in tech companies large and small, with SJWs becoming more unhinged with every passing day, demanding ever more radical codes of conduct. A year ago Richard Hipp, the founder of SQLite, ignited a firestorm in the tech community after it was revealed that he had posted a code of conduct for users based on the teachings of the Bible and an ancient order of monks founded by Benedict of Nursia. I wrote at the time: Many in the tech community, accustomed to CoCs focused on sexual diversity, an obsession with gender, and safe spaces, were startled by Hipp’s move to adopt the overtly religious Code of Benedict. “After the SQLite CoC went viral, I began seeing lots of comments on Twitter rebuking me for doing the CoC wrong,” Hipp told PJM. Critics said that his CoC lacked a means of enforcement and insisted that a CoC must make people feel safe and welcomed. That was news to Hipp. “Who decided this?” he asked. “Did I miss a memo? All this time, I was thinking a CoC was what it says — a set of guidelines (a ‘code’) on how to behave (‘conduct’). Who knew that there were all these other requirements?” “I’m now beginning to understand that, unbeknownst to me, an entire subculture of codes of conduct has sprung up, with lots of specifications on what a good code of conduct should and should not do,” he lamented, noting that the Rule of St. Benedict does not meet those specifications. Most of this garbage originates on the Left Coast, but the rank and file in the tech community are fighting back. Talk to some devs who frequent these online forums and they’ll tell you they’re sick and tired of having their creativity and ingenuity stifled by SJWs who show up to cause problems and insert politics into their profession. As a user on Reddit pointed out, “The biggest problem with nonsense like this is it never ends.” Giving in to these miscreants just emboldens them and they always come back for more. One can never be woke enough to please them, and we’re all just a misstep (or mis-tweet) away from having our lives blown up over some imagined offense. Follow me on Twitter @pbolyard. | Low | [
0.503118503118503,
30.25,
29.875
] |
<!DOCTYPE html> <html lang="en"> <head> <meta charset="utf-8"> <meta http-equiv="X-UA-Compatible" content="IE=edge,chrome=1"> <meta name="viewport" content="width=700" /> <meta name="keywords" content="ScrollMagic, scrolling, animation, Superscrollorama, Scrollorama" /> <meta name="description" content="ScrollMagic - The jQuery plugin for magical scroll interactions. A jQuery plugin which essentially lets you use the scrollbar like a playback scrub control." /> <meta name="author" content="Jan Paepke (www.janpaepke.de)" /> <meta name="designer" content="Jan Paepke (www.janpaepke.de)" /> <meta property="fb:admins" content="595418934" /> <meta property="og:type" content="website" /> <meta property="og:url" content="http://janpaepke.github.io/ScrollMagic/" /> <meta property="og:image" content="http://janpaepke.github.io/ScrollMagic/img/demo_fb_preview.jpg" /> <meta property="og:title" content="ScrollMagic" /> <meta property="og:description" content="The jQuery plugin for magical scroll interactions. ScrollMagic is a jQuery plugin which essentially lets you use the scrollbar like a playback scrub control." /> <title>ScrollMagic - Demo</title> <link href='http://fonts.googleapis.com/css?family=Source+Sans+Pro:300,400,700,400italic|Josefin+Slab:400,700,700italic' rel='stylesheet' type='text/css'> <link rel="stylesheet" href="css/normalize.css" type="text/css"> <link rel="stylesheet" href="css/style.css" type="text/css"> <link rel="stylesheet" href="css/demo.css" type="text/css"> <script type="text/javascript" src="js/_dependent/greensock/TweenMax.min.js"></script> <script type="text/javascript" src="js/_dependent/greensock/plugins/ScrollToPlugin.min.js"></script> <script type="text/javascript" src="js/_dependent/jquery-1.11.0.min.js"></script> <script type="text/javascript" src="js/_examples/modernizr.custom.min.js"></script> <script type="text/javascript" src="js/_mobile/iscroll.js"></script> <script type="text/javascript" src="js/jquery.scrollmagic.min.js"></script> <script type="text/javascript" src="js/_examples/demo.js"></script> </head> <body> <a id="github-ribbon" href="https://github.com/janpaepke/ScrollMagic"><img src="https://github-camo.global.ssl.fastly.net/52760788cde945287fbb584134c4cbc2bc36f904/68747470733a2f2f73332e616d617a6f6e6177732e636f6d2f6769746875622f726962626f6e732f666f726b6d655f72696768745f77686974655f6666666666662e706e67" alt="Fork me on GitHub" data-canonical-src="https://s3.amazonaws.com/github/ribbons/forkme_right_white_ffffff.png"></a> <div id="msg"> please <span class="word">scroll</span> <div class="scroll"></div> <a class="skip" href="#info">or click here to <span class="word">skip</span> <img src="img/demo_arrow_skip.png"></a> </div> <div id="content-wrapper"> <script type="text/javascript"> var controller; if (Modernizr.touch) { var myScroll; $(document).ready(function () { // wrap for iscroll $("#content-wrapper") .addClass("scrollContainer") .wrapInner('<div class="scrollContent"></div>'); // add iScroll myScroll = new IScroll('#content-wrapper', {scrollX: false, scrollY: true, scrollbars: true, useTransform: false, useTransition: false, probeType: 3}); // update container on scroll myScroll.on("scroll", function () { controller.update(); }); // overwrite scroll position calculation to use child's offset instead of parents scrollTop(); controller.scrollPos(function () { return -myScroll.y; }); // refresh height, so all is included. setTimeout(function () { myScroll.refresh(); }, 0); $("#content-wrapper").on("touchend", "a", function (e) { // a bit dirty workaround for links not working in iscroll for some reason... e.preventDefault(); window.location.href = $(this).attr("href"); }); // manual set hight (so height 100% is available within scroll container) $(document).on("orientationchange", function () { $("section") .css("min-height", $(window).height()) .parent(".scrollmagic-pin-spacer").css("min-height", $(window).height()); }); $(document).trigger("orientationchange"); // trigger to init }); // init the controller controller = new ScrollMagic({ container: "#content-wrapper", globalSceneOptions: { triggerHook: "onLeave" } }); } else { // init the controller controller = new ScrollMagic({ globalSceneOptions: { triggerHook: "onLeave" } }); } </script> <section id="start"> <div id="intro"> <img class="floor" src="img/demo_floor.png"> <h1>ScrollMagic</h1> <img class="tophat" src="img/demo_tophat.png"> <img class="wand" src="img/demo_wand.png"> <div class="sparkpoint"></div> </div> <script type="text/javascript"> // wrap each title letter $("#start h1").wrapEach(/(.)/g, "<span>$1</span>"); // animations var nervousHat = new TimelineMax({repeat: -1, yoyo: true}) .add(TweenMax.to("#start .tophat", 0.3, {bottom: "+=5", left: "-=6", rotation: -3})) .add(TweenMax.to("#start .tophat", 0.3, {bottom: "-=10", left: "+=6", rotation: 0})) .add(TweenMax.to("#start .tophat", 0.3, {bottom: "+=5", left: "+=6", rotation: 3})) .add(TweenMax.to("#start .tophat", 0.3, {bottom: "-=5", left: "-=3", rotation: 1.5})) .add(TweenMax.to("#start .tophat", 0.3, {bottom: "+=5", left: "-=6", rotation: -1.5})) .add(TweenMax.to("#start .tophat", 0.3, {bottom: "+=5", left: "+=3", rotation: 0})) .add(TweenMax.to("#start .tophat", 0.3, {bottom: "-=10"})); var abracadabra = TweenMax.fromTo("#start .wand", 1, {top: -$(window).height()/3, left: 370, rotation: 20}, {top: 10, rotation: -20}); var reveal = new TimelineMax() .add([ TweenMax.to("#start .tophat", 1, {bottom: $(window).height(), left: "-=50", rotation: -20}), TweenMax.from("#start h1", 1, {scale: 0.4, top: "+=70", delay: 0.1}), TweenMax.to("#start .wand", 0.8, {top: -$(window).height()/3, left: 450, rotation: 30}), TweenMax.to("#start .floor", 1, {autoAlpha: 0}) ]); var laola = new TimelineMax() .add(TweenMax.staggerTo("#start h1 span", 0.5, {top: -20}, 0.2)) .add(TweenMax.staggerTo("#start h1 span", 0.5, {top: 0}, 0.2), 0.5); // container pin var startpin = new ScrollScene({ duration: 700 }) .setPin("section#start") .addTo(controller); // msg scroll ani new ScrollScene({ duration: 140, offset: -100 }) .setTween(TweenMax.to("#msg div.scroll", 1, {backgroundPosition: "0 13px", repeat: -1, delay: 1, repeatDelay: 2, ease: Linear.easeNone})) .addTo(controller); // msg hide new ScrollScene({ offset: 40 }) .setTween(TweenMax.to("#msg", 0.5, {bottom: -40})) .addTo(controller); // hat movement new ScrollScene({ duration: 300, offset: -100 }) .setTween(nervousHat) .addTo(controller); // magic wand new ScrollScene({ offset: 20, duration: 180 }) .on("end", function (e) { if (e.scrollDirection == "FORWARD" && startpin.progress() < 0.37) { // check pin progress so it doesnt launch on refresh // make it rain! $("#start .sparkpoint").sparkle({ amount: 40, duration: 0.2 }); } }) .setTween(abracadabra) .addTo(controller); // big reveal new ScrollScene({ duration: 300, offset: 260 }) .setTween(reveal) .addTo(controller); // jumping text new ScrollScene({ duration: 200, offset: 450 }) .setTween(laola) .addTo(controller); </script> </section> <section id="tweens"> <h3>fade</h3> <h3>move</h3> <h3>spin</h3> <h3>scale</h3> <h3>text properties</h3> <script type="text/javascript"> var sceneOptions = {duration: 200, offset: -100}; var elements = $("#tweens h3"); // fade new ScrollScene(sceneOptions) .addTo(controller) .triggerHook("onCenter") .triggerElement(elements[0]) .setTween(TweenMax.from(elements[0], 1, {autoAlpha: 0})); // move new ScrollScene(sceneOptions) .addTo(controller) .triggerHook("onCenter") .triggerElement(elements[1]) .setTween(TweenMax.from(elements[1], 1, {left: "-50%", marginLeft: -200, ease: Back.easeOut})); // spin new ScrollScene(sceneOptions) .offset(200) .addTo(controller) .triggerHook("onCenter") .triggerElement(elements[1]) // use previous element as trigger, as top position changes during spin .setTween(TweenMax.to(elements[2], 1, {rotation: 360})); // scale new ScrollScene(sceneOptions) .addTo(controller) .triggerHook("onCenter") .triggerElement(elements[3]) .setTween(TweenMax.from(elements[3], 1, {scale: 0, ease: Back.easeOut})); // text properties $(elements[4]).wrapEach(/(.)/g, "<span>$1</span>");// wrap letters new ScrollScene(sceneOptions) .addTo(controller) .triggerHook("onCenter") .triggerElement(elements[4]) .setTween(TweenMax.staggerTo($(elements[4]).children("span"), 0.0001, {textDecoration: "underline", textTransform: "uppercase"}, 0.2)); </script> </section> <section id="pin"> <h3 id="hlpin">pin</h3> <div id="wipe"> <h3>wipe</h3> </div> <div id="slide"> <h3>slide</h3> <h3>color</h3> </div> <h3 id="unpin">unpin</h3> <script type="text/javascript"> // ani var pinani = new TimelineMax() // pin move down .add(TweenMax.from("#pin>h3:first-child", 0.5, {top: "0%", marginTop: 0})) // wipe .add(TweenMax.to("#wipe", 1, {width: "100%"})) // slide .add(TweenMax.to("#slide", 1, {top: "0%", ease: Bounce.easeOut, delay: 0.2})) // color .add([ TweenMax.to("#slide h3:first-child", 0.2, {autoAlpha: 0}), TweenMax.from("#slide h3:last-child", 0.2, {autoAlpha: 0}) ]) .add([ TweenMax.to("#slide", 0.3, {backgroundColor: "yellow"}), TweenMax.to("#slide h3:last-child", 0.3, {color: "blue"}) ]) .add([ TweenMax.to("#slide", 0.3, {backgroundColor: "green"}), TweenMax.to("#slide h3:last-child", 0.3, {color: "red"}) ]) .add([ TweenMax.to("#slide", 0.3, {backgroundColor: "red"}), TweenMax.to("#slide h3:last-child", 0.3, {color: "white"}) ]) .add([ TweenMax.to("#slide", 0.3, {backgroundColor: "#c7e1ff"}), TweenMax.to("#slide h3:last-child", 0.3, {color: "black"}) ]) // unpin .add(TweenMax.from("#unpin", .5, {top: "100%"})); // pin new ScrollScene({ triggerElement: "section#pin", duration: 1100 }) .on("progress", function () { // keep centered even though width changes $("#wipe h3").width($("#pin>h3").width()); }) .setTween(pinani) .setPin("section#pin") .addTo(controller); </script> </section> <section id="parallax"> <div id="parallaxbg"> <div class="top"></div> <div class="bottom"></div> </div> <h3>parallax</h3> <h3 id="big">parallax</h3> <script type="text/javascript"> // parallax new ScrollScene({ triggerElement: "section#parallax", duration: $(window).height() + 300, offset: -150 }) .addTo(controller) .triggerHook("onCenter") .setTween(new TimelineMax().add([ TweenMax.fromTo("#parallax #big", 1, {scale: 2, alpha: 0.1, top: "100%"}, {top: "0%", ease: Linear.easeNone}), TweenMax.to("#parallax #parallaxbg", 1, {backgroundPosition: "0 -260%", ease: Linear.easeNone}) ])); </script> </section> <section id="info"> <h1>ScrollMagic</h1> <h2> The jQuery Plugin for magical scroll interactions. <div id="sublinecover"></div> </h2><br> <div id="content"> <div id="hatcontainer"> <a href="examples/index.html"> <div id="speechbubble"> <p>check out the</p> <p>examples</p> </div> <img class="hat" src="img/demo_hat.png"> <div id="bunny"> <img src="img/demo_bunny.png"> <img class="eye" src="img/demo_bunny_wink.png"> </div> <img class="hat" src="img/demo_hat_front.png"> </a> </div> <p> ScrollMagic is a jQuery plugin which essentially lets you use the scrollbar like a playback scrub control.<br> It's the plugin for you, if you want to ... </p> <ul class="nexttohat"> <li>... start an animation at a specific scroll position.</li> <li>... synchronize an animation to the scrollbar movement.</li> <li>... pin an element at a specific scroll position (sticky elements).</li> <li>... pin an element for a limited amount of scroll progress (sticky elements).</li> <li>... easily add a parallax effect to your website.</li> <li>... create an inifinitely scrolling page (ajax load of additional content).</li> <li>... call functions when the user hits certain scroll positions or react in any other way to the current scroll position.</li> </ul> <p> <b>Browse <a href="examples/index.html">the examples</a> or read <a href="docs/index.html">the documentation</a> to get started.</b><br> For the installation manual and source code visit the <a href="https://github.com/janpaepke/ScrollMagic">project on github</a> or download the latest version as <a href="https://github.com/janpaepke/ScrollMagic/zipball/master">zip</a> or <a href="https://github.com/janpaepke/ScrollMagic/tarball/master">tar</a>. </p> <h3>History</h3> <p> ScrollMagic is a complete rewrite of its predecessor <a href="https://github.com/johnpolacek/superscrollorama" target="_blank">Superscrollorama</a> by <a href="http://johnpolacek.com">John Polacek</a>.<br> Like Superscrollorama it relies on the <a href="http://www.greensock.com/gsap-js/" target="_blank">Greensock Animation Platform (GSAP)</a> to build animations, but was developed with specific regard to former shortcomings. </p> <p> The major perks of using ScrollMagic include: </p> <ul> <li>optimized performance</li> <li>flexibility</li> <li>mobile compatibility</li> <li>ready for responsive webdesign</li> <li>object oriented programming and object chaining</li> <li>event management</li> <li>support for both scroll directions (even different on one page)</li> <li>support for scrolling inside div containers (even multiple on one page)</li> <li>extensive debugging and logging capabilities</li> </ul> <h3>Made with ScrollMagic</h3> <p> Check out these amazing websites that were created using ScrollMagic. <div id="madewith"> <a href="https://developers.google.com/cardboard/" target="_blank" title="The Google Cardboard Project"> <img src="img/madewith_googlecardboard.jpg" alt=""> </a> <a href="http://www.appliancetecltd.com" target="_blank" title="Appliance Tec Limited"> <img src="img/madewith_appliancetec.jpg" alt=""> </a> <a href="http://www.framescollection.com/tunnelrats.html" target="_blank" title="Frames Collection Edition 2: Tunnel Rats"> <img src="img/madewith_framescollection.jpg" alt=""> </a> </div> </p> <h3>Credits</h3> <p> ScrollMagic © <a href="http://www.janpaepke.de" target="_blank">Jan Paepke</a> <a href="https://twitter.com/janpaepke" class="twitter-follow-button" data-show-count="false">follow @janpaepke</a> <script>!function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0];if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src="//platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs");</script> </p> <p> <a href="https://github.com/janpaepke/ScrollMagic/blob/master/LICENSE.md">License Information</a> </p> <p> <a href="http://www.greensock.com/gsap-js/" target="_blank">Greensock Animation Plattform (GSAP)</a> by <a href="http://www.greensock.com" target="_blank">Greensock</a> </p> <a id="donate" href="https://www.paypal.com/cgi-bin/webscr?cmd=_s-xclick&hosted_button_id=8BJC8B58XHKLL" target="_blank"><img src="https://www.paypalobjects.com/en_US/i/btn/btn_donate_SM.gif"></a> </div> <script type="text/javascript"> // subline new ScrollScene({ triggerElement: "section#info", duration: 250, offset: -50 }) .addTo(controller) .triggerHook("onCenter") .on("progress", function () { $("#info h2").sparkle({ x: $("#info #sublinecover").position().left, y: 10, amount: 5, duration: 0.1 }) }) .setTween(TweenMax.to("#info #sublinecover", 1, {left: "100%", ease: Linear.easeNone})); // bunny TweenMax.set("#hatcontainer #speechbubble", {rotation: -10}); // rotate bubble a bit new ScrollScene({ triggerElement: "#info #hatcontainer", offset: -20 }) .addTo(controller) .triggerHook("onCenter") .setTween( new TimelineMax({delay: 1}) .add(TweenMax.from("#hatcontainer #bunny", 0.5, {bottom: 5, ease: Power2.easeOut})) .add(TweenMax.from("#hatcontainer #speechbubble", 1, {autoAlpha: 0, left: "+=60", top: "+=50", scale: 0.2, ease: Elastic.easeOut, delay: 0.3})) ); TweenMax.set("#hatcontainer #speechbubble", {rotation: -10}); // rotate bubble a bit new ScrollScene({ triggerElement: "section#info" }) .addTo(controller) .setTween(new TimelineMax({repeat: -1}) .add(TweenMax.from("#hatcontainer #bunny .eye", 0.001, {display: "block", delay: 0.15})) .add(TweenMax.from("#hatcontainer #bunny .eye", 0.001, {display: "none", delay: 3})) ); // donate btn new ScrollScene({ triggerElement: "#info #donate", offset: 50 }) .addTo(controller) .triggerHook("onEnter") .setTween(TweenMax.from("#info #donate img", 0.5, {scale: 0, ease: Elastic.easeOut, delay: 0.5})); </script> </section> </div> <script> (function(i,s,o,g,r,a,m){i['GoogleAnalyticsObject']=r;i[r]=i[r]||function(){ (i[r].q=i[r].q||[]).push(arguments)},i[r].l=1*new Date();a=s.createElement(o), m=s.getElementsByTagName(o)[0];a.async=1;a.src=g;m.parentNode.insertBefore(a,m) })(window,document,'script','//www.google-analytics.com/analytics.js','ga'); ga('create', 'UA-37524344-3', 'janpaepke.github.io'); ga('send', 'pageview'); </script> </body> </html> | Mid | [
0.55036855036855,
28,
22.875
] |
Shawnee, Oklahoma Call Today For Immediate Roofing Services in Shawnee Oklahoma: (405) 451-4820 Meet Josh Williams Our Owner Meet Josh Williams the owner of Cobar Roofing. Josh has many years in the roofing industry in and around Shawnee Oklahoma. Josh has extensive experience in storm related roof damage as well as siding, gutters and windows. Watch this client testimonial video to see how Cobar Roofing handles every roofing job. Watch as Mrs. Debbie Hill talks about how Josh got her approved for a new roof with her insurance company and also came in and helped with new siding and new windows. Ms. Debbie talks about how great the clean up was after the new roof was installed. Mrs. Hill talks about how happy she is with Josh and Cobar Roofing. Check out her video and become another happy roofing client of Josh Williams and Cobar Roofing Cobar Roofing is Shawnee Oklahoma’s premier roofer providing roof repair, new roof installation, skylight repair, and replacement services, siding and windows for residential and commercial clients in Shawnee and the surrounding areas. The Cobar Roofing team members are experts in handling insurance-related roofing claims and are committed to offering the best workmanship warranties in the state of Oklahoma. You can also visit our sister company All Out Roofing. Cobar Roofing keeps proving it’s a leader in the roofing industry. Cobar Roofing uses its very own roofing CRM, so every client of Cobar has their very own client portal. Cobar Roofing has certifications from the roofing industry’s biggest names. Cobar Roofing is a Preferred Roofing Contractor with Owens Corning Corporation. Owens Corning has been around for decades and has been recognized as a top brand in roofing. Owens Corning’s power in the industry gives Cobar Roofing the ability to offer better warranties than your average local roofer. Owens Corning gives Cobar Roofing the backing so Shawnee homeowners can have true peace of mind with any project with Cobar. Cobar Roofing is also Top of The House certified with Owens Corning. The Top of The House certification positions Cobar Roofing to give homeowners expertise in blown-in attic insulation projects as well. Cobar Roofing will explain to you how attic insulation, attic ventilation, and your roof work as one system. All being your complete roofing system. Your Name (required) Your Email (required) Your Number Your Message A Little About Our Great City of Shawnee, Oklahoma Shawnee Oklahoma is the county seat of Pottawatomi County OK. We have a very nice town in Shawnee with close to 30,000 people as of our latest census numbers in the year 2000. Shawnee Oklahoma was settled just after the Civil War by a few Indian tribes. The Sac and the Fox were two Indian tribes that originally settled Shawnee but were soon joined by the Pottawatomi, Kickapoo and of course the Shawnee Indians. These tribes are all federally recognized and still live in Shawnee to this day. A very interesting note for Shawnee is the Sonic Drive-in was originated in Shawnee. Troy Smith and Joe McKimmey were partners in another food-related venture and in 1959 Smith and McKimmey split and went their own directions. Mr. Smith opened a hamburger drive-in in on Harrison Street and he decided to install a call-in feature rather than the standard carhops that were so popular at the time. Mr. Smith called his new place the Sonic and as we know now, a ledge was born. Shawnee Oklahoma not only has the very first Sonic Drive-in it is also home to the 3,000th Sonic. Shawnee is proud to be home to the Sonic Drive-in. Shawnee is located at 35.3273° N, 96.9253° W The area zip codes for Shawnee are 74801 74802 74804 Shawnee, Oklahoma is a large geographical city encompassing just under 50 square miles of land mass. Frequently Asked Questions for Shawnee Oklahoma Roofing Contractor Do you service the Shawnee area? Yes, Cobar Roofing has been servicing the Shawnee Oklahoma for years now. Do you do roof repairs? Yes, we do every type of roof repair you may need, from a roof leak, skylight leak to a major repair on a commercial building. How long with a roof repair last? That one is hard to say without looking at each repair before answering. We recommend doing a roof repair unless the cost of a roof repair goes over 31% of the cost of a new roof. Then, depending on the age of the roof and your plans for your home it makes sense to go ahead and get a new roof. Do you repair skylights? Yes, If the skylight is able to be repaired, we certainly do fix leaky skylights. If it can’t be repaired, we recommend the Velux no-leak skylight. The Velux skylights are the very best in the industry. If Cobar does a skylight replacement with a Velux and we use their flashing kit you can get a 10-year no-leak warranty from Velux. | Mid | [
0.5980148883374691,
30.125,
20.25
] |
Cape Town - Herschel Jantjies and Elton Jantjies look set to form the scrumhalf-flyhalf combination for the Springboks against the Wallabies at Ellis Park in Johannesburg on Saturday. Springbok coach Rassie Erasmus is expected to name a 'B team' for Saturday's match, with a group of 15 players to travel to New Zealand on Wednesday to prepare for the Test against the All Blacks in Wellington next weekend (July 27). Faf de Klerk and Handre Pollard are the first-choice halfbacks and expected to board the plane for New Zealand, paving the way for the Jantjies duo to start against Australia. Cobus Reinach is the other scrumhalf option, while Frans Steyn could also be utilised at No 10. However, according to Netwerk24, there is a strong possibility that the Herschel and Elton Jantjies will start on Saturday. Assistant coach Mzwandile Stick said he believes the two players complement each other, with 33-Test capped Elton bringing experience and Herschel bringing youth and an element of surprise. "If you talk about combinations it is something new for them, but if you look at the style of play both players are playing I think they will complement one another," said Stick. "Herschel Jantjies has got a good service and we know on a good day Elton Jantjies can really destroy teams when he is getting front-foot ball, so that is something that will be a balance between their strengths," Stick told reporters at the team hotel in Johannesburg. Erasmus will name his starting team on Wednesday (15:15), with Saturday's Test scheduled to start at 17:05. ALSO READ: Jantjies can become a great Bok scrumhalf - Stick | Mid | [
0.653927813163481,
38.5,
20.375
] |
576 N.E.2d 361 (1991) 216 Ill. App.3d 514 159 Ill.Dec. 692 Dr. Jaya Krishna DHARMAVARAM, Plaintiff-Appellant, v. The DEPARTMENT OF PROFESSIONAL REGULATION and Stephen F. Selke, Director of the Department of Professional Regulation, Defendants-Appellees. No. 1-90-2649. Appellate Court of Illinois, First District, Sixth Division. July 5, 1991. *362 Schwartz & Rubin, Chicago (Martin J. Rubin, of counsel), for plaintiff-appellant. Roland W. Burris, Atty. Gen., Rosalyn B. Kaplan, Sol. Gen., Chicago (Susan Fredrick Rhodes, Asst. Atty. Gen., of counsel), for defendants-appellees. Justice LaPORTA delivered the opinion of the court: Plaintiff, Dr. Jaya Krishna Dharmavaram, appeals from an order of the circuit court which affirmed the decision of the Illinois Department of Professional Regulation (Department) revoking plaintiff's temporary certificate to practice medicine and denying his application for a permanent license to practice medicine in Illinois. On appeal, plaintiff contends that (1) the decision of the Department was against the manifest weight of the evidence; (2) he was *363 deprived of the right to equal protection; and (3) he was deprived of the right to due process. The record indicates that plaintiff earned his medical degree in 1981 in India. In 1987, he commenced post-graduate study at Cook County Hospital to obtain training in the field of plastic surgery. At the time plaintiff entered this post-graduate program, he held a temporary certificate to practice medicine at Cook County Hospital, and he had applied for a permanent license to practice medicine in Illinois. In December 1987, the Department brought charges against plaintiff, alleging that he had violated the Medical Practice Act of 1987 (Act) (Ill.Rev.Stat.1987, ch. 111, par. 4400-1 et seq.) in connection with his work at the Cook County Hospital Ambulatory Screening Clinic (ASC). The Department asserted, inter alia, that plaintiff had violated the Act by performing services beyond those prescribed by and incidental to his program of residency training as authorized by his temporary certificate, by engaging in dishonorable, unethical or unprofessional conduct of a character likely to deceive, defraud or harm the public, by engaging in immoral conduct in the commission of any act related to his practice, and by exhibiting a pattern of practice which demonstrated incapacity or incompetence to practice under the Act (Ill.Rev.Stat.1987, ch. 111, pars. 4400-17, 4400-22(A)(5), 4400-22(A)(20), 4400-22(A)(26)). The Department sought to revoke plaintiff's temporary certificate to practice and requested that his application for a permanent license be denied. At an administrative hearing, the Department introduced evidence in support of the charges against plaintiff. The Department presented evidence that the ASC provides medical services to patients whose complaints are of a less serious nature and where the patients do not require admission to the hospital. The Department introduced evidence that plaintiff's work at the ASC was not prescribed by or incidental to his program of residency training in plastic surgery, but was voluntary and performed by plaintiff in order to earn extra money. The Department presented the testimony of Mary R., who testified that she went to the ASC on August 10, 1987, because she was suffering from what she believed to be a kidney infection. After waiting several hours, she was treated by plaintiff at the ASC. Mary R. stated that when she entered the examining room, plaintiff hugged her "like I would embrace my mother." She testified further that it took her several minutes to understand plaintiff's accent. Plaintiff did not initially ask her about her symptoms or complaints, but asked her about her sexual activity with her husband and about her husband's nationality. Mary R. stated that plaintiff continually grinned at her during the entire examination and that this behavior was unnerving to her. Mary R. informed plaintiff that she had previously undergone a hysterectomy. Mary R. also testified that at plaintiff's instruction, she put on an examining gown and removed only her slacks and underpants. Plaintiff then pinched the nipple of each breast through the gown, her brassiere, and her blouse. Thereafter, plaintiff conducted a vaginal examination while her legs were flat on the table and her feet were extended straight out from her body. Plaintiff did not direct her to place her feet into the stirrups of the examining table. First, plaintiff put a glove on his hand and commented to Mary R. that his fingers were very small. He then placed two or three fingers of his right hand into her vaginal cavity while his other hand rested on the table. Plaintiff manipulated his fingers in and out approximately 10 to 12 times over three to five minutes. Plaintiff did not speak to Mary R. at all during the examination except to comment that she had a very long vaginal canal. Plaintiff never asked Mary R. whether she was experiencing any pain during his examination. Mary R. testified further that plaintiff removed his fingers from her vaginal cavity, stepped over, kissed her twice on the cheek, and said that she was nice. Mary R. then sat straight up and told plaintiff that a man had just been taken to jail for trying to kiss her. Plaintiff then asked Mary R. whether she had any girlfriends, whether *364 they were married, whether they were pretty, and whether they "fooled around." Plaintiff repeated these questions about three times. Mary R. stated that as soon as she was able to get dressed, she "was on the way to the door." Plaintiff gave her no diagnosis or prescription for her kidney problem. Plaintiff prescribed only vitamins and Tylenol and referred her to the urology clinic. Plaintiff also told Mary R. that he thought she should receive psychiatric treatment for the problem she was experiencing with her kidneys. Mary R. testified that when she left the examining room, she went directly to one of the nurses to complain that plaintiff had kissed her. After speaking with Dr. Salem, the supervisor of the ASC, Mary R. made a written complaint which accused plaintiff of kissing her twice on the cheek, embracing her, and asking about her girlfriends. Mary R. stated that she did not detail the improprieties of the breast and vaginal examinations because it was then 1 a.m. and she wanted to go home. Dr. Salem, supervisor of the ASC, testified that Mary R. told him that plaintiff had behaved in an unprofessional manner in that he embraced her and kissed her on the cheek twice. Dr. Salem then told plaintiff that a patient had complained that he had embraced her, kissed her, and asked personal, sexual questions. Plaintiff told Dr. Salem that he kissed Mary R. on the hand and had tried to be courteous. Dr. Salem asked Mary R. whether she would repeat her complaint in the presence of plaintiff, and she agreed. Plaintiff again denied that he had kissed Mary R. Dr. Salem then had Mary R. re-examined by a nurse practitioner. Dr. Salem allowed plaintiff to finish out his work shift, but Salem reported the incident to the director of the ASC the next morning. Leon Lee, investigator with the Cook County Hospital Police Department, testified that he interviewed Mary R. over the telephone the day following her examination by plaintiff. During that conversation, Mary R. described the events of the previous day. This account of the examination conducted by plaintiff substantially corroborated Mary R.'s testimony at the administrative hearing. Lee was not questioned whether Mary R. told him that plaintiff had kissed her. Plaintiff testified that when he met Mary R. she appeared upset, and he hugged her in a motherly fashion and kissed her two times. He stated that he asked all his patients questions regarding their personal life because he wanted to develop a good rapport. He asked questions regarding the nationality of Mary R.'s husband to have a better understanding of her history. Plaintiff denied that he examined Mary R.'s breasts through her clothing and stated that she was wearing only an examining gown, which he pulled down in order to perform the examination. Plaintiff testified that he always offers to do a breast examination on all women patients. Plaintiff testified further that the stirrups on the examining table were broken, but he did not request another examining room. He told Mary R. that he had small hands to relax her and to show her that he was not going to hurt her. Plaintiff stated that he manipulated his fingers several times in her vaginal canal to determine if there was any discharge, but there was none. He did not use two hands to examine Mary R.'s internal organs because she had told him she had undergone a hysterectomy. Plaintiff testified that he inquired as to Mary R.'s sexual practices and her relations with her girlfriends because he believed that she had difficulty in her relations with men based upon her answers to his questions. He diagnosed Mary R.'s trouble as incontinence and referred her to a urologist and gynecologist for further treatment. In plaintiff's opinion, Mary R. was not happy to be referred to other doctors after she waited all day to see a doctor for treatment. Plaintiff denied that he kissed Mary R. while she was lying on the examining table, but stated that he kissed her when she entered the examining room. Tyna T. testified that she went to the ASC on August 10, 1987, complaining of an earache in both ears and of a headache. She stated that plaintiff initially asked her *365 questions about her symptoms, but then began to ask her about personal issues. Plaintiff asked whether she was married, whether she had boyfriends, whether she had sexual relations with men other than her husband, and if she had any children. She told plaintiff that she did not have any children, and he said that he wanted her to have children. Tyna T. thought that it was unusual for plaintiff to ask her these questions, and she thought he would warn her about AIDS or other sexually transmitted diseases, but he never did. Tyna T. testified further that while plaintiff was asking her these questions, he was caressing her arms and face. He put his hands on her lymph glands and then moved his hands downward. Plaintiff then said that he could not hear her heartbeat and asked her to raise her top. Tyna T. refused to raise her top because her vital signs had been taken by a nurse earlier. After she refused to raise her top, plaintiff fondled her breasts by cupping them with his hands. Tyna T. testified that she was very nervous and embarrassed by this. Plaintiff told her that "she did not look like a Black girl because she did not have a wide nose or large breasts." Tyna T. testified that these comments were insulting and upsetting to her. Plaintiff continued to rub her arms and neck and to caress her cheek, and Tyna T. pulled away from him. Tyna T. stated further that plaintiff then took her to another examining room to look into her ears with a light. He told her there was nothing wrong with her ears and sent her back to the first examining room. When plaintiff returned to the first examining room, he closed the door, leaned down, and kissed Tyna T. on the cheek. When she pulled away from him and stood up to leave, plaintiff told her to wait for a prescription. He then prescribed mineral oil and Q-tips. Tyna T. testified that plaintiff never advised her that her ears were impacted with wax. When she left the examining room, Tyna T. warned a waiting patient about the plaintiff. Plaintiff testified that during his examination of Tyna T., he was looking for needle tracks or indications of IV drug abuse on her arms. He also stated that he palpated her face and sinuses to determine if there was any tenderness. Plaintiff stated further that at his request Tyna T. removed her blouse, and he listened to her heart and lungs. He testified that she gave her permission for a breast examination, but admitted that a breast examination was not related to the patient's complaints of earaches and a headache. Plaintiff stated that because her ears were impacted with wax, he was unable to see anything in Tyna T.'s ears. He told her to wash her ears and to return in a day or two for an ear examination. Plaintiff acknowledged that he told Tyna T. that she was "a nice patient," and he kissed her on the cheek. Teresa W. went to the ASC on August 10, 1987, because she believed that she had a vaginal infection. When plaintiff entered the examining room, he shut the door and told her that he thought she was very pretty. Teresa W. testified that although plaintiff spoke with an accent, she did not have any trouble understanding him. When she told plaintiff that she thought she had a vaginal infection, he asked her how many boyfriends she had, when she last had sex, and whether she had oral sex. He then told her to remove her clothes and to get on the examining table. After she removed her clothing, Teresa W. put on an examining gown. Teresa W. testified further that plaintiff put on some gloves and inserted one or two fingers of his right hand into her vaginal canal and moved his fingers around for one or two seconds. She stated that plaintiff did not touch her with his left hand during the examination. He then moved his fingers to her clitoris and touched it for several seconds. Plaintiff told Teresa W. that she had "big lips" on her vagina. He then moved around to her side and kissed her on the jaw. Plaintiff subsequently touched her breasts just around the nipple, but did not touch any other part of her breasts. When plaintiff stopped touching her nipples, Teresa W. asked whether he was through. Plaintiff said that he was not finished, and he began touching her clitoris again. He then moved to her side and *366 kissed her on the jaw again. Plaintiff then told Teresa W. that she could get dressed, and he left the room while she was dressing. Teresa W. testified that when plaintiff returned to the examining room, she asked what was wrong with her, and he told her that she had "a lot of germs." Teresa W. stated that plaintiff never told her that she had gonorrhea. Plaintiff testified that he conducted a bi-manual pelvic examination of Teresa W. and that his breast examination included her entire breast. He stated that he found Teresa W.'s vaginal lips swollen which indicated possible disease. Plaintiff also stated that he told her that she had gonococcal urethritis, but because she did not understand what that meant, he told her that she had "a lot of germs." Plaintiff testified that he kissed Teresa W. when she entered the examining room. As she was leaving the room, she was upset so he told her to "be a good girl, you are nice looking, change your life and be good." He then kissed her on the cheek. Plaintiff denied that he kissed Teresa W. while she was lying on the examining table. The Department also presented the testimony of Barbara N. and of Linda M. who testified that they were examined by plaintiff and that he exhibited unprofessional and improper conduct during their examinations. The hearing officer found, however, that the evidence given by these two patients did not support a finding that plaintiff's conduct was violative of the Act. The Department next introduced the testimony of Dr. Rocco Lobraico as an expert witness. Dr. Lobraico testified that he was a doctor of obstetrics and gynecology and had been practicing medicine since 1941. He stated that he had never kissed a patient, but he was not aware of any written standards prohibiting hugging or kissing patients. Dr. Lobraico reviewed the medical records and testimony of each of the patients who had complained about the plaintiff's conduct. He testified that in his opinion, plaintiff breached the standards of professionalism and ethics prevailing in Cook County in 1987 in his examination of each of these patients. Dr. Lobraico testified that it was inappropriate for plaintiff to embrace Mary R. and to question her about her sexual history while ignoring her complaints regarding her kidneys. He also stated that the breast examination performed by plaintiff was improper. Plaintiff should not have examined Mary R.'s breasts through her clothing and should not have pinched only the nipples. Plaintiff should have examined the entire breast tissue with two hands to see if there were any tumors or breast tenderness. Dr. Lobraico also indicated that the pelvic examination performed by plaintiff on Mary R. was not proper. He stated that it was very important in conducting a pelvic examination for the patient to have her feet in the stirrups so the doctor can readily palpate the internal organs. Plaintiff should have placed two fingers into her vagina and used his other hand to bring the internal organs down to palpate them and determine their size, shape, and consistency. Because Mary R. had complained of kidney problems, plaintiff should have manipulated the bladder down to his examining fingers to determine if the bladder was tender to the touch. Although Mary R. had undergone a hysterectomy, plaintiff should have examined her ovaries, and he should have palpated the area around her kidneys determine whether they were enlarged or tender. In Dr. Lobraico's opinion, plaintiff failed to examine Mary R. properly considering her complaint of urinary problems, and he acted unprofessionally in kissing her while he was conducting a pelvic examination. Dr. Lobraico testified that in his opinion, plaintiff's examination of Tyna T. was improper and unprofessional. He stated that it was unusual to perform a breast examination on a patient who has complained of an earache. He stated further that plaintiff conducted the breast examination in an unorthodox manner, by cupping both breasts in his hands and by performing the exam through the patient's clothing. Plaintiff made insulting remarks about the *367 patient's appearance, and his conduct made her nervous and embarrassed. Dr. Lobraico stated further that it was improper and unprofessional for plaintiff to kiss Tyna T. on the cheek and to attempt to embrace her. Dr. Lobraico testified that it was unusual for plaintiff to conduct a pelvic examination on Teresa W., then a breast examination, and then another pelvic examination. He stated further that it was improper for plaintiff to perform the pelvic examinations with only one hand, and it was not proper to manipulate the patient's clitoris. In addition, it was improper for plaintiff to limit his examination of the patient's breasts to only the nipple area. Dr. Lobraico also stated that plaintiff's explanation that she had "a lot of germs" failed to adequately inform the patient of her condition. Dr. Lobraico stated further that checking a patient's arms for needle marks is not improper considering the prevalence of drug use among patients at Cook county Hospital. He also testified that it is proper to check lymph nodes when addressing a complaint of earaches and headaches. Lobraico indicated that it is proper for a doctor to recheck a patient's vital signs which had been taken over eight hours earlier. He also acknowledged that mineral oil is a means to remove excess ear wax from the ear canal. The plaintiff called Dr. William Nowlin as an expert witness. Dr. Nowlin testified that he was a general surgeon, practicing in northwestern Indiana. Dr. Nowlin reviewed the medical records and testimony of each of the patients who had complained about the plaintiff's conduct. In Dr. Nowlin's opinion, plaintiff did nothing inappropriate and did not breach any standards of care in his examination of these patients. Dr. Nowlin admitted, however, that it was unprofessional to kiss a patient during a vaginal examination. He also acknowledged that a bi-manual examination is necessary to perform a complete pelvic examination, and that a one-handed exam would be incomplete. Dr. Nowlin testified that a pelvic examination normally takes approximately one minute, and there was nothing in Mary R.'s medical history which indicated a need to take as long as plaintiff did to perform the pelvic examination on her. Dr. Nowlin indicated, however, that a longer examination might be understandable where the doctor is of limited experience as was plaintiff. Dr. Nowlin stated that he did not see the relevance in plaintiff's questioning Mary R. concerning the sexual activity of her female friends. He also indicated that a breast examination which was limited to pinching of the nipple area would be incomplete and that a proper breast exam should not be performed through the patients' clothing. Dr. Nowlin testified that it was unprofessional, not good judgment, and not in good taste to kiss a patient. He also stated that it was in poor taste for plaintiff to comment to Tyna T. about the appearance of most Black women. Dr. Nowlin stated further that he saw no medical reason for plaintiff to ask Tyna T. whether she had sex with men other than her husband. Although he felt that kissing a patient was in poor taste, this did not change his opinion that plaintiff's examinations and evaluations were appropriate. Plaintiff also called Dr. Bharat Barai as an expert witness. Dr. Barai testified that he was licensed to practice medicine in Illinois and in Indiana and was certified in the specialties of internal medicine, oncology and hematology. Dr. Barai worked in the ASC at Cook County Hospital for one month in 1975 as part of his internship. He held a temporary certificate at that time. Dr. Barai testified that he does not practice obstetrics or gynecology, and he has never treated patients with the symptoms experienced by the patients seen by plaintiff. Dr. Barai reviewed the medical records of the patients who had made complaints about plaintiff's conduct. In Dr. Barai's opinion, plaintiff did what was medically appropriate in taking the histories of these patients and in his examination, referral, and treatment of them. Dr. Barai indicated, however, that plaintiff needed more coaching and education on how to deal with *368 patients. He stated further that it was not a breach of any medical standards to embrace a patient and that it was not inappropriate to ask Mary R. if her girlfriends were married and whether they were pretty. Dr. Barai also testified that in his opinion a pelvic examination done with only one hand was not inappropriate or incomplete. Dr. Barai stated that an inexperienced doctor such as the plaintiff would take longer to perform a pelvic exam than would an experienced practitioner. He also stated that rechecking an area where a problem is suspected is acceptable medical practice. Plaintiff, testifying on his own behalf, stated that when he arrived in the United States, he worked for one year as an assistant to Dr. William Nowlin in Indiana. In 1987, he entered the post-graduate program in plastic surgery at Cook County Hospital. At that time, he held a temporary certificate to practice medicine at Cook County Hospital, and his permanent license application was pending. During his first year in the program, he rotated through and performed examinations at the ASC as part of his training. During his second year in the program, he voluntarily applied to work in the ASC to earn extra money. To be employed at the ASC, a person was required to (1) be on the Cook County Hospital payroll, (2) attend an orientation course offered by them and to pass a test, and (3) hold a temporary certificate with a permanent license application pending or must hold a permanent license. Although employment at the ASC was voluntary during the second year of the program, Cook County Hospital encouraged all residents, whether permanently or temporarily licensed, to work in the ASC. Although he received additional compensation, plaintiff considered his employment at the ASC a part of his training program. Like the other doctors working there, plaintiff had no choice as to the patients or the nature of the complaints he was required to treat. Plaintiff stated further that he asked all of his patients questions regarding their personal life because he wanted to develop a good rapport. He confined questions regarding sex to those patients who experience problems relating to the pelvic area. He also stated that he always offered to do a breast examination on all of his female patients. Plaintiff testified further that he did not kiss all patients upon their first meeting, but only those who appeared upset or depressed. Plaintiff stated that he kissed these patients in an attempt to console them, saying "you are nice, be easy." He testified that he kissed several other patients on August 10, 1987, who had not been called as witnesses. Plaintiff stated that he had seen other doctors and nurse practitioners kiss and hug patients of the opposite sex. Following the hearing, the hearing officer issued a report detailing his findings of fact and conclusions regarding the charges brought against plaintiff by the Department. The hearing officer noted that plaintiff's accent may have contributed to certain difficulties in the patient's ability to communicate with him, but found that this circumstance was not the sole basis for the complaints made by the women who testified. The hearing officer found that plaintiff's examination of Mary R. and of Teresa W. demonstrated unprofessional conduct of a character likely to harm the public. He found that plaintiff's examination of Tyna T. demonstrated incompetence to practice. The hearing officer recommended the Department revoke plaintiff's temporary certificate and deny his application for a permanent license. The hearing officer also found that plaintiff's employment at the ASC was not prescribed by nor incidental to the program of residency in which he was enrolled and, therefore, exceeded the scope of practice authorized by his temporary certificate. Although the hearing officer found that plaintiff violated the statutory provisions restricting his practice of medicine within the scope of his temporary certificate, he recommended that the Department take no action on this violation because plaintiff's conduct had been encouraged by the hospital and was a common practice there. *369 The Medical Disciplinary Board adopted all of the findings of fact and conclusions of law by the hearing officer and recommended that plaintiff's temporary certificate of registration be revoked. The Medical Licensing Board adopted all of the findings of fact and conclusions of law by the hearing officer and recommended that plaintiff's application for a permanent license be denied. Plaintiff filed a petition for rehearing on the ground that the hearing officers' conclusions were against the manifest weight of the evidence. Plaintiff alleged further that he was denied due process by the variance between the charges contained in the Department's amended complaint and the grounds relied upon to revoke his temporary certificate and to deny his application for a permanent license. Additionally, plaintiff asserted that he was denied equal protection of the law, and he cited five cases involving permanently licensed doctors facing similar charges who were accorded disciplinary measures far less stringent than those imposed upon him. The Director of the Department denied plaintiff's request for rehearing, holding that plaintiff had failed to present any new evidence to warrant a rehearing and that substantial justice had been done in the case. The Director adopted the findings of fact, conclusions of law and recommendations of the Medical Disciplinary Board and ordered that plaintiff's temporary certificate be revoked. The Director also adopted the findings of fact, conclusions of law and recommendations of the Medical Licensing Board, but rejected the hearing officer's recommendation that no sanction be imposed for plaintiff's employment at the ASC. The Director ordered that plaintiff's application for a permanent license be denied. Plaintiff thereafter filed a complaint for administrative review. After briefing and oral argument by the parties, the circuit court affirmed the decision of the Department. In a memorandum opinion, the court found that the evidence supported the result and that the decision was not arbitrary, capricious, or against the manifest weight of the evidence. The court also rejected plaintiff's claim that certain specific allegations found against him were never charged. The court found that the charges were sufficiently clear and detailed and that plaintiff was adequately apprised of the extent and seriousness of the charges prior to the hearing. The court declined to decide whether plaintiff's employment at the ASC exceeded the scope of practice authorized by his temporary certificate. The court found that any finding on this issue would not affect the holding in the case because the court had already affirmed the revocation of plaintiff's temporary certificate and the denial of his application for a permanent license. Plaintiff has appealed the decision of the circuit court. Initially, plaintiff asserts that the decision of the Department was against the manifest weight of the evidence. The findings and conclusions of an administrative agency on questions of fact are considered to be prima facie true and correct (Ill.Rev.Stat.1987, ch. 110, par. 3-110; Cicmanec v. Department of Registration and Education (1989), 182 Ill. App.3d 710, 131 Ill.Dec. 610, 538 N.E.2d 1166) and are not to be disturbed on review unless they are against the manifest weight of the evidence (Massa v. Department of Registration and Education (1987), 116 Ill.2d 376, 107 Ill.Dec. 661, 507 N.E.2d 814; Eastman Kodak Co. v. Fair Employment Practices Comm'n (1981), 86 Ill.2d 60, 55 Ill.Dec. 552, 426 N.E.2d 877; Cicmanec, 182 Ill.App.3d 710, 131 Ill.Dec. 610, 538 N.E.2d 1166). For a judgment to be contrary to the manifest weight of the evidence, an opposite conclusion must be clearly evident. Cicmanec, 182 Ill.App.3d 710, 131 Ill.Dec. 610, 538 N.E.2d 1166; United Air Lines, Inc. v. Illinois Fair Employment Practices Comm'n (1979), 69 Ill.App.3d 519, 26 Ill.Dec. 45, 387 N.E.2d 875. A court of review is not to reweigh the evidence or make an independent determination of the facts. (Sheldon v. *370 Edgar (1985), 131 Ill.App.3d 489, 86 Ill.Dec. 577, 475 N.E.2d 956; Odell v. Village of Hoffman Estates (1982), 110 Ill.App.3d 974, 66 Ill.Dec. 564, 443 N.E.2d 247.) Rather, the function of a court on review it to ascertain whether the final decision of the administrative agency is just and reasonable in light of the evidence presented. (Sheldon, 131 Ill.App.3d 489, 86 Ill.Dec. 577, 475 N.E.2d 956; Odell, 110 Ill.App.3d 974, 66 Ill.Dec. 564, 443 N.E.2d 247.) If there is any evidence in the record which fairly supports the determination of the agency, the decision is not against the manifest weight of the evidence and must be sustained on judicial review. Sheldon, 131 Ill.App.3d 489, 86 Ill.Dec. 577, 475 N.E.2d 956; O'Boyle v. Personnel Board (1983), 119 Ill.App.3d 648, 75 Ill.Dec. 177, 456 N.E.2d 998. In the instant case, the administrative agency found that plaintiff's treatment of Mary R., Tyna T., and Teresa W. violated professional standards and sections 22(A)(5), 22(A)(20), and 22(A)(26) of the Act. (Ill.Rev.Stat.1987, ch. 111, pars. 4400-22(A)(5), 4400-22(A)(20), 4400-22(A)(26).) In addition, the agency found that plaintiff's employment at the ASC was not prescribed by or incidental to his program of residency training and was beyond the scope of practice authorized by his temporary certificate in violation of section 17 of the Act. Ill.Rev.Stat.1987, ch. 111, par. 4400-17(D). The hearing officer noted that plaintiff's accent may have contributed to certain difficulties in the patients' ability to communicate with him, but found that this circumstance was not the sole basis for the complaints made by the women who testified. In fact, Tyna T. and Teresa W. both testified that they had no difficulty understanding plaintiff, and Mary R. testified that she was able to understand plaintiff after a few minutes. The hearing officer heard and considered all of the evidence presented, including all of the testimony by the complainants, by plaintiff, and by the expert witnesses called by both parties. Upon review of the evidence presented and after forming conclusions as to the credibility of the witnesses, the hearing officer determined that plaintiff's conduct was violative of the Act and warranted revocation of his temporary certificate and denial of his application for a permanent license. This determination was adopted by the Medical Disciplinary Board, by the Medical Licensing Board, and by the Director of the Department. There is ample evidence in the record to support this decision. Consequently, it cannot be found on review that the decision was against the manifest weight of the evidence. Plaintiff argues that the hearing officer, the Medical Disciplinary Board, the Medical Licensing Board, and the Director of the Department employed an improper standard of review in considering the charges against him. Plaintiff claims that they inappropriately relied upon the standard of review for actions predicated upon assertions of medical malpractice. Plaintiff also asserts that the standard level of care in the ASC was cursory and not the same as one would expect to receive in a private doctor's office. Yet, plaintiff points to nothing in the record to support this claim. In addition, plaintiff contends that in reviewing a case of license revocation or denial, the agency ought to consider the experience of the physician generally and within the area in which the questioned practice occurred, and the context in which the service was performed. He argues that a person with less training ought to be held to a different standard than one with substantially greater training. Yet, plaintiff offers no legal authority for this argument. To the contrary, the Act mandates that the Department hold a new applicant to the same standards of discipline as a person holding a permanent license. Ill. Rev.Stat.1987, ch. 111, par. 4400-9(B)(1). Moreover, we find that plaintiff was not so inexperienced as his argument might indicate. The record reveals that plaintiff practiced in India for approximately three years and worked with Dr. Nowlin in Indiana for one and one-half years. Thereafter, plaintiff completed one year of his residency at Cook County Hospital. Consequently, plaintiff had approximately five *371 years of practical and clinical experience with patients before the instant complaints were raised. The record indicates that in reviewing the charges against plaintiff, the Department considered the provisions of the Act and the evidence presented at the administrative hearing. On this record, it does not appear and plaintiff has not shown that the Department employed an incorrect or inappropriate standard of review. Plaintiff next contends that he was deprived of the right to equal protection because the Department's action was based upon his statutory classification as a temporary licensee. In his petition for rehearing, plaintiff cited five cases of licensed physicians who allegedly were charged with conduct similar to that of the plaintiff but received sanctions which were more lenient than those imposed upon plaintiff. For each case, plaintiff listed the physician's name, the case number, and a one-sentence summary of the charges against the physician and the sanction imposed. Plaintiff did not provide any of the specific facts of the cases, mitigating circumstances, or the findings and conclusions of the Department in these cases. In addition, plaintiff did not present any affidavits, Department records, or testimony in support of his claim that these cases were decided under a different standard than that employed in his case. Consequently, plaintiff has not presented sufficient evidence to prove that he was judged by a harsher standard than were the other licensed doctors or to establish that he was deprived of the right to equal protection. Moreover, even if plaintiff had shown that the five doctors whose cases he cited received more lenient sanctions than those imposed upon plaintiff, it is for the Department to determine the appropriate sanction to be imposed in each individual case. (Massa, 116 Ill.2d 376, 107 Ill.Dec. 661, 507 N.E.2d 814.) The mere fact that five other physicians received lesser sanctions does not in and of itself render the Department's decision in plaintiff's case violative of his right to equal protection where there was ample evidence in the record to support the Department's decision. Plaintiff argues further that he was entitled to be judged by a less stringent standard than that employed for experienced practitioners because he was inexperienced. This argument is without merit. As previously indicated, the Act mandates that the Department hold a new applicant to the same standards of discipline as a person holding a permanent license. (Ill.Rev.Stat. 1987, ch. 111, par. 4400-9(B)(1).) In addition, the record established that plaintiff had approximately five years of practical and clinical experience with patients before the instant complaints were raised. Finally, plaintiff contends that he was deprived of the right to due process because certain conduct which was found to be violative of the Act by the Department was never charged in the complaint against him. He asserts that he was, therefore, unable to present an adequate defense at the administrative hearing. Specifically, plaintiff refers to the fact that the complaint did not include any allegations that he used only one hand during his pelvic examinations of Mary R. and of Teresa W. Plaintiff also refers to the fact that certain conduct was found by the hearing officer to be demonstrative of plaintiff's incompetence to practice where plaintiff was under the impression that his conduct would be reviewed only as it related to the Department's claim that he acted improperly. In order to charge a violation, an administrative agency is only required to present charges which are sufficiently clear and detailed to enable the respondent to intelligently prepare a defense. (Brija v. Board of Fire & Police Commissioners (1990), 202 Ill.App.3d 363, 147 Ill.Dec. 638, 559 N.E.2d 978; Altman v. Board of Fire & Police Commissioners (1982), 110 Ill. App.3d 282, 66 Ill.Dec. 33, 442 N.E.2d 305.) Such charges need not be technically precise or drawn with the same refinements and subtleties as court pleadings. (Brija, 202 Ill.App.3d 363, 147 Ill.Dec. 638, 559 *372 N.E.2d 978.) The complaint need only reasonably apprise the respondent of the charges against him. Wierenga v. Board of Fire & Police Commissioners (1976), 40 Ill.App.3d 270, 352 N.E.2d 322. In the instant case, plaintiff was sufficiently informed of the charges brought against him. The complaint against plaintiff specifically referred to the statutory sections he was alleged to have violated, the names of the patients involved, the conduct complained of, and the proposed sanctions for those violations. The allegations of improper touching, kissing, embracing, and of improper questioning of patients clearly put plaintiff on notice of the basis of the charges against him. In addition, counts IV through VIII of the complaint specifically charged plaintiff with incompetence in violation of section 22(A)(26) of the Act (Ill.Rev.Stat.1987, ch. 111, par. 4400-22(A)(26)). Each of these counts clearly alleged that plaintiff improperly conducted medical examinations of the named female patients. On this record, we find that plaintiff was adequately apprised of the nature, extent, and seriousness of the charges against him and that he was able to intelligently prepare a defense. For the foregoing reasons, the judgment of the circuit court of Cook County is affirmed. Affirmed. RAKOWSKI, P.J., and McNAMARA, J., concur. | Mid | [
0.54337899543379,
29.75,
25
] |
President Donald Trump's friendliness with Russia's president has come back to haunt him throughout his presidency. | Chip Somodevilla/Getty Images White House Trump claims to be tough on Russia after Mattis resignation President Donald Trump pushed back on claims that he is unwilling to be tough on Russia and China, writing on Twitter that no one has been harder on U.S. adversaries shortly after Defense Secretary Jim Mattis quit partly in protest of the president's hesitance to take a firmer stance against rivals. "There has never been a president who has been tougher (but fair) on China or Russia - Never, just look at the facts. The Fake News tries so hard to paint the opposite picture," Trump wrote Friday on Twitter. Mattis' resignation largely came in protest of Trump's decision to withdraw U.S. forces from Syria and half the U.S. military presence in Afghanistan. Both moves were widely condemned by Republicans and Democrats alike, but his withdrawal from Syria drew applause from Russian President Vladimir Putin, who is allied with Syrian President Bashar Al-Assad. Sen. Lindsey Graham (R-S.C.), one of Trump's most vocal supporters in the Senate, warned the president that removing troops from Syria would be a gift to Russia and Iran, who could use the security vacuum in Syria to easily access its Hezbollah allies in Lebanon. Mattis wrote in his resignation letter Thursday that he was at odds with Trump's insular world view and that the president has "the right to have a Secretary of Defense whose views are better aligned with yours" — a shocking rebuke from one of Trump's most senior administration officials. Mattis had long been viewed as a steady hand in a mercurial White House — a narrative that irritated the president. POLITICO Playbook newsletter Sign up today to receive the #1-rated newsletter in politics Email Sign Up By signing up you agree to receive email newsletters or alerts from POLITICO. You can unsubscribe at any time. This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply. Trump has also lambasted the international alliances that have defined American security abroad since World War II as one-sided, urging NATO allies to increase spending in the common defense. Mattis, along with most mainstream international observers, viewed those alliances as critical to global stability and pushed back on antagonizing vital partners. Trump's friendliness with Russia's president has come back to haunt him throughout his presidency. During a Helsinki summit with Putin this summer, Trump sided with Putin's word over his own intelligence reports that Russia interfered in the 2016 election. Several members of Trump's inner circle are under the microscope or have been charged in connection with special counsel Robert Mueller's probe. Trump has repeatedly denied there was any collusion with Russia, though he has spoken admirably about Putin, seemingly putting his rhetoric at odds with Friday's tweet. He was accused of being slow to issue sanctions on Russia for its role in the 2016 elections and the botched assassination of a former Russian spy in the United Kingdom last March. Still, the administration has placed 272 Russian entities and individuals under sanction since the beginning of Trump's presidency for those charges. Trump's rhetoric toward China has been less forgiving, constantly blaming the People's Republic of distorting trade in its favor and stealing U.S. intellectual property. The Trump administration and the Chinese government escalated a trade battle over the summer on a spate of goods, though the two sides reached a temporary ceasefire earlier this month to allow negotiations. | Low | [
0.5292887029288701,
31.625,
28.125
] |
Muslim Woman Denied Job Over Head Scarf Wins in Supreme Court The Supreme Court on Monday revived an employment discrimination lawsuit against Abercrombie & Fitch, which had refused to hire a Muslim woman because she wore a head scarf. "This is really easy," Justice Antonin Scalia said in announcing the decision from the bench. The company at least suspected that the woman, Samantha Elauf, wore the head scarf for religious reasons, Justice Scalia said, and its decision not to hire her was motivated by a desire to avoid accommodating her religious practice. That was enough, he concluded, to allow her to sue under federal employment discrimination law. | Mid | [
0.618004866180048,
31.75,
19.625
] |
1. Technical Field of the Invention The invention relates to the early detection of colorectal adenoma and carcinoma. In particular it relates to the detection of secreted or cell surface markers in easily collectible bodily samples. 2. Background of the Art Colorectal cancer is the second leading cause of cancer death in the United States, with ˜130,000 patients diagnosed each year and ˜50,000 ultimately succumbing to the disease (1). Most colorectal cancers develop slowly, beginning as small benign colorectal adenomas which progress over several decades to larger and more dysplastic lesions which eventually become malignant. This gradual progression provides multiple opportunities for prevention and intervention. Indeed, benign adenomas can be detected and removed by simple colonoscopy and polypectomy, precluding the need for radical surgical and adjuvant treatments. It is therefore believed that early detection and removal of these benign neoplasms provides the best hope for minimizing morbidity and mortality from colorectal cancer. Various screening methods for detecting early colorectal tumors are available, such as fecal occult blood testing, sigmoidoscopy, and colonoscopy (reviewed in 2). However, none of these methods are optimal, and new approaches are needed. | Mid | [
0.629533678756476,
30.375,
17.875
] |
Synesthesia improves sensory memory, when perceptual awareness is high. Empirical evidence suggests that synesthesia is associated with enhanced sensory processing. A separate body of empirical literature suggests that synesthesia is linked to a specific profile of enhanced episodic and working memory performance. However, whether sensory (iconic) memory performance is also affected by synesthesia remains unknown. Therefore, we tested 22 grapheme-color synesthetes and compared their performance in a partial-report paradigm with 22 individually matched non-synesthete controls. Participants were briefly presented with a circular-letter array and required to report the identity of the letter at a probed target location after various delays. Furthermore, they were required to indicate the subjective clarity of the target letter after every trial. The results suggest that sensory memory performance is enhanced in synesthesia, but only when subjective clarity of the target letter is high. Additional exploratory analyses revealed that synesthetic consistency, which is widely used to confirm the genuineness of synesthesia, correlated significantly with performance in the partial report paradigm. We conclude that synesthesia does not generally enhance sensory memory performance, but that synesthetic experiences may enhance sensory memory performance when perceptual awareness of the target is high. Furthermore, the stability of synesthetic associations may be linked to sensory memory performance. | Mid | [
0.649874055415617,
32.25,
17.375
] |
Indexed Universal Life Insurance: An Overview Indexed universal life policies put a portion of the policyholder’s premium payments toward annual renewable term insurance with the remainder added to the cash value of the policy after fees are deducted. On a monthly or annual basis, the cash value is credited with interest based on increases in an equity index. The gains are applied based on a participation rate that’s set by the insurance company, which can be anywhere from 25% to more than 100%. These policies are generally best for those with a large upfront investment who are planning for tax-free retirement. Let’s take a look at some typical marketing material for an IUL policy: “Indexed universal life insurance provides death benefit protection and the opportunity to build money inside your policy, called cash value, based in part on the increases of market indexes. Even if these indexes dip, you’re still safe with a guaranteed minimum interest rate.” – Voya Financial “Indexed universal life insurance combines life insurance protection with equity-linked accumulation potential. It has some of the same features as universal life, like premium flexibility, and offers more growth potential, but with potentially less risk than variable universal life insurance.” – AXA Indexed universal life insurance is often pitched as a cash value insurance policy that benefits from the market’s gains–tax free–without the risk of loss during a market downturn. Key Takeaways Drawbacks include that there are caps on returns and no guarantees as to the premium amounts or market returns. In general, these policies are best for those with a large upfront investment who are seeking options for a tax-free retirement. While the sales pitch certainly sounds compelling on the surface, critics warn that market returns are far from guaranteed and the term nature of the insurance could make it expensive to maintain the policy later in life when premiums tend to rise sharply. Pros of Indexed Universal Life Insurance Key benefits of these policies include: Higher Return Potential These policies leverage call options to gain upside exposure to equity indexes without the risk of losses, while whole life policies provide only a small interest rate that may not even be guaranteed. Greater Flexibility Policyholders can decide how much risk they’d like to take in the market, adjust death benefit amounts as needed, and choose among a number of riders that make the policy customizable to their needs. Tax-Free Capital Gains Policyholders do not pay capital gains on the increase in cash value over time unless they abandon the policy before it matures, whereas other types of financial accounts may tax capital gains upon withdrawal. Cons of Indexed Universal Life Insurance There are several gotchas associated with indexed universal life insurance policies that critics are quick to point out. For instance, someone who establishes the policy over a time when the market is performing poorly could end up with high premium payments that don’t contribute at all to cash value. The policy could then potentially lapse if the premium payments aren’t made on time later in life, which could negate the point of life insurance altogether. Other drawbacks of these policies include: Caps on Returns Insurance companies often set maximum participation rates of less than 100% and as low as 25% in some cases. In addition, returns on equity indexes are often capped at certain amounts during good years. No Guarantees Whole life policies often include a guaranteed interest rate with predictable premium amounts throughout the life of the policy. IUL policies, on the other hand, have variable returns based on an index and have variable premiums over time. Compare Popular Online Brokers Provider Name Description × The offers that appear in this table are from partnerships from which Investopedia receives compensation. | Mid | [
0.6370370370370371,
32.25,
18.375
] |
MOSCOW -- If Russian journalism has a patron saint, his name is Yasen Zasursky. The ailing 85-year-old headed the Moscow State University (MGU) journalism department for more than 40 years before becoming its president emeritus in 2007. The roster of respected journalists who received their diplomas from him is astounding: Yury Shchekochikhin, longtime investigative journalist who died suddenly and mysteriously with symptoms resembling acute poisoning in 2003; Anna Politkovskaya, the investigative journalist who was murdered in Moscow in 2006; Mikhail Beketov, the former muckraking editor of Khimkinskaya Pravda who died in 2013 of injuries suffered when he was savagely beaten in 2008; and many others. But Zasursky is far from impressed by the work of others who have taken his courses -- and are now stars of Russian state television under the government of President Vladimir Putin. In fact, he is deeply disheartened. Watch Zasursky Interview "It is unpleasant for me to see what they are conveying," he told RFE/RL's Russian Service. "It is pointless trying to get your information from television. Everything there is official announcements. There is nothing analytical, so you risk being turned into a person with blinders on." "There isn't even one journalist there who I would say has his own opinions," he adds. It is a harsh assessment coming from someone who devoted his entire life to producing his country's journalists. Zasursky cringes a bit when told that one of his students, state TV news presenter Ernest Matskyavichyus, recently declared that Russia is in the throes of an information war and journalists must reject formerly accepted international standards of journalism. "Let's remember how journalism was in 1942," in the midst of World War II, Matskyavichyus said. "Did they present both sides of the story -- interview one side and then the other in turns?" Matskyavichyus was "an excellent student," Zasursky says. "But, no, I don't agree with that," Zasursky says of the Vesti presenter's rejection of one of the basic principles of balanced journalism. "People are only disarmed when they have insufficient or incomplete information. Then we have surrendered even before the enemy attacks." He is at a loss to explain the popularity of another MGU graduate -- Dmitry Kiselyov, who heads the Rossiya Segodnya state media conglomerate and dispenses anti-Western venom as the host of a weekly news round-up on state-run Rossia television. "He was an interesting journalist," Zasursky says of Kiselyov. "Was." "He was a very smart young man," he continues. "He wrote some very smart things. But now he is simply repeating various ideas. And that has nothing to do with journalism. A journalist must help people to understand events. He must not only convey information, but knowledge as well." "I wouldn't say [Kiselyov] is highly esteemed in the circles that I move in," Zasursky adds. "I guess he is just a highly skilled propagandist." Zasursky is an admirer of former Soviet President Mikhail Gorbachev, whose glasnost reforms in the late 1980s resulted in a golden age for journalists. He is less enthusiastic about former Russian President Boris Yeltsin, who he says was unable to bring Gorbachev's reforms to fruition. "At the critical moment, he was lost," Zasursky says, adding that although Putin has accomplished some positive things, Yeltsin's decision to name him successor was "not the optimal path" for the country. Zasursky has seen a lot in his long life. Born in 1929, he has lived in Moscow his entire life except the time he spent in evacuation in Barnaul, Siberia, during World War II. He graduated from the Moscow State Pedagogical University of Foreign Languages in 1948 with a specialization in English. He got his doctorate in 1967 with a dissertation on 20th-century American literature. He joined the journalism faculty of Moscow State University in 1955 and served as its dean from 1965 until 2007. In recent months, he has suffered from health problems and has been confined to a wheelchair. But he says he is feeling better and is optimistic that he will be on his feet again by the New Year. As for the fate of honest journalists under Putin's government, he is less optimistic. He recalls how in the 1950s he worked as an editor for the Foreign Literature publishing house and how the firm gave translation work to Soviet poets who couldn't be published for political reasons. "Not all those poets were...appreciated, in a manner of speaking," Zasursky says. "But it was allowed to give them translations and they made a living on that. Maybe [journalists now] should do translations. I think it is possible to find some intellectual work." | Mid | [
0.559241706161137,
29.5,
23.25
] |
Q: Why did Luffy ring the bell 16 times? I'm confused as to why Luffy rung the bell 16 times. A navy member said it's a declaration of war whereas a pirate said it's about the change of an era. Can someone please explain what exactly is the reason behind it?? A: The bell is called the Ox-Bell. What does the ringing of the bell signify? The ringing of the bell signifies the end of one year and the beginning of another. It is rung eight times to give thanks for the old year, and another eight times to welcome the new year. If it is rung twice, it signifies some sort of disaster or distress. How others interpreted 16 rings: Lieutenant Commander Brandnew of the Marines analyzed it as a declaration of war, and Killer of the Kid Pirates interpreted the meaning of it as the end of one era and the beginning of another. The real reason behind it: Luffy's ringing of the bell was only a distraction, along with his other actions, so nobody in the world outside of the Straw Hat Pirates would notice the real message; in the picture of Luffy after ringing the Ox Bell, a mark is seen on his arm that reads 3D2Y with the 3D crossed out, representing the amount of time the crew would be separated. | Mid | [
0.63254593175853,
30.125,
17.5
] |
March 14th, 2010 Are you looking for Easter dishes that are easy and fun to make? If yes, then these “newly hatched chicks” made from hard-boiled eggs are perfect for you (along with chicken mommy, of course). You can offer them as a snack or use them to garnish a salad. Or how about an Easter picnic? Simply pack them in the egg carton you bought them in. Safe transportation and a cute way to serve. Easter is approaching soon so it’s about time to present some Easter recipes. I like this chick egg very much because it’s so simple. And it totally makes sense to reshape boiled eggs so they look like hatched chicks. No wait, that’s actually kind of creepy. Nevermind, they do look cute after all :-) I’ve encountered the basic idea of this chick egg on lots of bento blogs (or here on Flickr), so its origin remains unclear. Everyone has their own way of styling the faces. I attempted to come up with a personal variation, too. And I tried to find a way to make it that is as quick and easy as possible. Have fun! How to make a Chicken Family from Hard-Boiled Eggs eggs carrot slices thin red pepper slice black olives or nori (like the seaweed sheets you use for sushi) | Low | [
0.482758620689655,
28,
30
] |
Successful transfer of day 10 horse embryos: influence of donor-recipient asynchrony on embryo development. A total of 78 day 10 horse embryos were transferred non-surgically to recipient mares that had ovulated 9, 7, 6, 5, 4, 3, 2 or 1 day after (negative asynchrony), on the same day (synchronous), or 2 or 4 days before (positive asynchrony) the donor (n=6 or 8 mares per group). Pregnancy rates between 100% (6/6) and 63% (5/8) were seen in recipient mares that were between +2 and -6 days asynchronous. Embryo survival to the heartbeat stage declined in recipients that were -7 days asynchronous and no embryos survived in recipients that were -9 days asynchronous. Irrespective of uterine asynchrony, cessation of embryo mobility and fixation at the base of a uterine horn occurred when the conceptus was approximately 17 days old. Conceptus growth and development was slowed when embryos were placed in negatively asynchronous uteri. At the greatest degree of negative asynchrony at which embryos survived to the heartbeat stage, i.e. -7 and -6 days, development of the embryo proper and allantois was retarded. Luteostasis was achieved in recipient mares when day 10 embryos were transferred to recipient mares at any stage of asynchrony between -9 and +2 days with respect to the donor. These results indicate that in the horse, there is a wide window for establishment of pregnancy following embryo transfer to asynchronous recipients. Although progesterone priming of the uterus to a stage equivalent to that of the transferred embryo does not appear to be a prerequisite for embryo survival, it does nonetheless influence embryonic development. | Mid | [
0.634615384615384,
33,
19
] |
Social – Disclaimer: In accordance with Title 17 U.S.C. Section 107, any copyrighted work in the Aladins Miracle Lamp is archived here under fair use without profit or payment to those who have expressed a prior interest in reviewing the included information for personal use, non-profit research and educational purposes only. Ref. http://www.law.cornell.edu/uscode/17/107.shtml. The opinions rendered are exclusively those of the authors/sources and not those of this website or Aladin whose sole function is to collect and not to write or comment articles. The function "Author" does not exist 1. February 2017 Emperor Netanyahu to meet Governor Trump “Prime Minister Benjamin Netanyahu sees himself as the savior of the Jews and the American Jewish community as within his jurisdiction, rather than as citizens loyal to their country and president,” Ben Caspit, columnist for Jewish Al-Monitor, August 11, 2015. “Benjamin Netanyahu, as the mad emperor of Isramerica and other subject nations, does not handle disobedience well. Emperors seldom do,” Greg Felton, Canadian journalist and author. Emperor Netanyahu has announced that he would meet Donald Trump, the new Governor of Israel’s US colony on February 15, 2017. The main agenda on the table would be Netanyahu’s Iranophobia. On January 31, Netanyahu cried wolf over Iran’s recent missile testing. He said that he would raise this new danger to Israel with Donald Trump during his coming meeting – and would demand new sanctions against Iran. Netanyahu tweeted that “Stopping the Iranian threat, and the threat reflected in the bad nuclear agreement with Iran, continues to be a supreme goal of Israel.” Interestingly, Donald Trump has not invited Russian president Vladimir Putin whom he praised so much during his presidential campaign – and whom the Jewish Lobby is still blaming of covertly helping trump to win. “The world has spoken in unison that it will no longer tacitly accept Israeli cruelty and criminality in the name of Zionist determinism. Trump can either accept reality and join the civilized world in asserting an honorable, non-Zionist Middle East policy, or he can continue to isolate the US by acting as Israel’s bitch. Reagan was an inept president who managed to rise above his limitations on one crucial issue. Let’s hope Trump can overcome his prejudices to recognize Israel as an existential threat to the US,” Greg Felton said (here). On January 30, 2017, American writer, journalist, author, and critic of the Organized Jewry John Kaminski wrote an Epitah for America which says a lot what Netanyahu and American Israel Firsters have in store for the United States. “Jews have turned America into a trash heap of broken families, poison food and bad medicine. If you ever took the trouble to contemplate the true significance of 9/11 in which the highest levels of the US government were complicit in the destruction of the Twin Towers in New York City, you would realize that this jarring epiphany opens a window onto the entire history of the American republic and you would realize the whole system was long ago converted into an endless money machine for the Jewish bankers, who engineer wars as their primary moneymaking technique, says Kaminski. IDF vehicles reportedly operating inside Lebanon Hezbollah says bulldozers carrying out work beyond border fence; army declines to comment ed note–2 things worth noting here– 1. Yet another example as to ‘how they do it’. Jews, masters at ‘writing the script’ and ‘setting the scene’ understand the need for provocation in creating the narrative and steering the discourse. Therefore, in order to get the war they want started off on the ‘right foot’–meaning the AY-rabs as the aggressor and the po’ lil’ persecuted Jooz as the victims, they have to make sure that everything is arranged just right, so that when the director yells ‘ACTION’ and the cameras start rolling, it is a silverscreen production from start to end, or, as Moshe Sharett, Israel’s first Foreign Minister and 2nd Prime Minister, once famously put it– ‘The state of Israel must invent dangers, and to do this it must adopt the methods of provocation and revenge…. And above all, let us hope for a new war with the Arab countries so that we may finally get rid of our troubles and acquire our space…’ and, 2. Remember, that according to ‘protocols’ embraced by Judea, Inc, Lebanon does not exist. It is an artificial name given to that territory lying to the north of Israel which Jews consider to be theirs according to the dictates of the Torah, to wit– ‘On that day the LORD made a covenant with Abraham, saying “To your descendants I give this land, from the river of Egypt to the great river Euphrates”…–Genesis, 15:18 ‘And God spoke unto us saying, ‘Go to the hill-country and all the places nigh thereunto… in the Arabah, the hill-country and in the Lowland… in the South and by the sea-shore, the land of the Canaanites, and Lebanon, as far as the great river, the river Euphrates…Go in therefore and possess the land which the Lord swore unto your fathers, to Abraham, Isaac, and Jacob, unto them and to their seed after them…’ Deuteronomy 1:6–8 ‘Every place whereon the sole of your foot shall tread shall be yours, from the wilderness, and Lebanon, from the river Euphrates, even unto the hinder sea shall be your border…’ Deuteronomy 11:24 Times of Israel The reported cited Hezbollah as saying IDF bulldozers were carrying out work near the border. Photos allegedly taken of the area showed a bulldozer and soldiers, although their country of origin was not clear. The IDF declined to comment about the reports. The IDF occasionally carries out work on the border fence, including activities on the Lebanese side of the border. In October 2016 an IDF soldier was shot and lightly injured by gunfire coming from Lebanon while he was on duty in northern Israel. The shots were fired from a passing car across the border, according to the IDF. The Israeli troops had been working on the defenses along the border, when they came under attack near Reches Ramim, southwest of Kiryat Shmona, the IDF said. The Lebanese military denied that the shooting had taken place, telling the government news outlet NNA that “there is no truth to the claims by some media reports from the Zionist enemy” — meaning Israel — “that shots were fired from a car within Lebanon at an Israeli soldier.” The injured soldier was taken to a nearby hospital for treatment. Hezbollah, an Iran-proxy terror organization, maintains a large arsenal, which includes hundreds of thousands of rockets aimed at Israel. Share this: Netanyahu faces possible arrest in Spain over Marmara affair JERUSALEM POST Prime Minister Benjamin Netanyahu and seven other former and current government officials are at risk of arrest if they step foot on Spanish soil over the Marmara affair after a judge drew up warrants earlier this week, Spanish media reported Friday. Other officials in the case include former foreign minister Avigdor Liberman; current and former defense minister Moshe Ya’alon and Ehud Barak, respectively; former interior minister Eli Yishai; former minister of intelligence Dan Meridor; minster without portfolio Benny Begin; and former head of the Navy Eliezer Marom. Together with Netanyahu, and excluding Morom, the officials make up the so called ‘Forum of Seven,” an ad-hoc committee of ministers that made key decisions on security issues. In response to the judge’s order, Foreign Ministry spokesman Emmanuel Nachshon said: “We consider it to be a provocation. We are working with the Spanish authorities to get it canceled. We hope it will be over soon.” In the 2010 incident, a group of human rights activists and a smaller group of IHH activists (which the quasi-government Turkel Commission Report identified as affiliated with the Muslim Brotherhood) boarded several ships to try to break Israel’s blockade of the Gaza Strip. Israel commandeered and stopped most of the ships without incident, yet when Israel Navy commandos boarded the Mavi Marmara, IHH activists attacked them, leading to some commandos being wounded and, eventually, 10 deaths on the IHH side. Turkey and many others in the international community accused Israel of war crimes, but it was cleared by the Turkel Commission and the UN-sponsored Palmer Report, which validated some of Israel’s narrative of fighting in self-defense or said there was not sufficient evidence to pursue Israel for war crimes, even as the Palmer Report said some of the IDF’s force was excessive. | Low | [
0.425101214574898,
26.25,
35.5
] |
/*
* FreeRTOS Kernel V10.4.1
* Copyright (C) 2020 Amazon.com, Inc. or its affiliates. All Rights Reserved.
*
* Permission is hereby granted, free of charge, to any person obtaining a copy of
* this software and associated documentation files (the "Software"), to deal in
* the Software without restriction, including without limitation the rights to
* use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of
* the Software, and to permit persons to whom the Software is furnished to do so,
* subject to the following conditions:
*
* The above copyright notice and this permission notice shall be included in all
* copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
* IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS
* FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR
* COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER
* IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
* CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*
* http://www.FreeRTOS.org
* http://aws.amazon.com/freertos
*
* 1 tab == 4 spaces!
*/
/* Scheduler include files. */
#include "FreeRTOS.h"
#include "portable.h"
/* Demo application include files. */
#include "partest.h"
/*-----------------------------------------------------------
* Simple parallel port IO routines.
*
* This is for the demo application which uses port 2 for LED outputs.
*-----------------------------------------------------------*/
/* Value for the LED to be off. */
#define partstLED_OUTPUTS ( ( unsigned char ) 0xff )
/* P2.0 is not used as an output so there are only 7 LEDs on port 2. */
#define partstMAX_LEDs ( 7 )
#define partstALL_OUTPUTS_OFF ( ( unsigned char ) 0 )
/* Maps the LED outputs used by the standard demo application files to
convenient outputs for the EDK2329. Mainly this insures that the LED
used by the Check task is one of the on board LEDs so the demo can be
executed on an EDK without any modification. */
static inline unsigned char prvMapLED( unsigned portBASE_TYPE uxLED );
/*-----------------------------------------------------------*/
void vParTestInitialise( void )
{
/* LED's are connected to port 2. P2.1 and P2.2 are built onto the EDK.
P2.3 to P2.7 are soldered onto the expansion port. */
P2DDR = partstLED_OUTPUTS;
P2DR = partstALL_OUTPUTS_OFF;
}
/*-----------------------------------------------------------*/
/*
* Described at the top of the file.
*/
static inline unsigned char prvMapLED( unsigned portBASE_TYPE uxLED )
{
switch( uxLED )
{
case 0 : return ( unsigned char ) 2;
case 1 : return ( unsigned char ) 3;
case 2 : return ( unsigned char ) 4;
case 3 : return ( unsigned char ) 5;
case 4 : return ( unsigned char ) 6;
case 5 : return ( unsigned char ) 0;
case 6 : return ( unsigned char ) 1;
default : return 0;
}
}
/*-----------------------------------------------------------*/
/*
* Turn an LED on or off.
*/
void vParTestSetLED( unsigned portBASE_TYPE uxLED, signed portBASE_TYPE xValue )
{
unsigned char ucLED;
if( uxLED < partstMAX_LEDs )
{
ucLED = prvMapLED( uxLED );
/* Set a bit in the required LED position. LED 0 is bit 1. */
ucLED = ( unsigned char ) 1 << ( ucLED + 1 );
if( xValue )
{
portENTER_CRITICAL();
P2DR |= ucLED;
portEXIT_CRITICAL();
}
else
{
portENTER_CRITICAL();
P2DR &= ~ucLED;
portEXIT_CRITICAL();
}
}
}
/*-----------------------------------------------------------*/
void vParTestToggleLED( unsigned portBASE_TYPE uxLED )
{
unsigned char ucLED;
if( uxLED < partstMAX_LEDs )
{
ucLED = prvMapLED( uxLED );
/* Set a bit in the required LED position. LED 0 is bit 1. */
ucLED = ( unsigned char ) 1 << ( ucLED + 1 );
portENTER_CRITICAL();
{
if( P2DR & ucLED )
{
P2DR &= ~ucLED;
}
else
{
P2DR |= ucLED;
}
}
portEXIT_CRITICAL();
}
}
| Low | [
0.525,
36.75,
33.25
] |
Vintage Cameos Plastic Floral Gold and Turquoise 25x18mm (2)Size/Shape: About 25x18mm OvalColor: Gold background, Turquoise & Yellow flowersMaterial: Plastic & decalQuantity: 2Additional info: Vintage stock. Pretty turquoise & yellow flowers against a gold background. The base color varies piece to piece on these- but this does not show on the front, only the back side. These have a flat back. *Please note! Vintage items may have imperfections due to their age. All of our vintage stock is unused new old stock. Color may vary on different monitors and in different lighting. | Low | [
0.52267818574514,
30.25,
27.625
] |
I'm in Varanasi, looking for the house of JP Singh. Spirituality soaks everyone and everything in Varanasi, also called Benares and Kashi - the holiest of seven holy cities in Hinduism. Key to the founding of both Buddhism and Sikhism, home to Tulsidas and Kabir and one of the oldest living cities in the world. Stepping out of Varanasi railway station early in the morning though, there's none of that mature tradition on display. It's just another small town bursting at its seams. Roads with minds of their own that wander away from intersections. Autos, jeeps and buses jutting out haphazardly, all waiting for the day's first passengers. At Rajatalab, an inconspicuous market crossing about an hour away, the rush is gone. Everyone seems to know the house of JP Singh, the beejwala. But no one's in a hurry to get there. Thirty minutes of waiting and five minutes of arguing later, we're on our way. The roads are narrow and cobblestoned, winding around years of haphazard constructions. A railway crossing happens. Then suddenly, there are green fields on both sides. Groups of girls flit past, grey salwar kameezes neatly pressed, white dupattas daintily clipped, all cycling in tandem to school. Their mothers are already at work, leading buffaloes out to pasture, drying out dung patties they'll burn in stoves later. The city is suddenly a distant memory. Fifteen minutes later I'm outside his house. This is a man who's been awarded by two successive Presidents - in 2002 by President APJ Abdul Kalam and in 2009 by President Pratibha Patil. In May this year, Minister for Agriculture Sharad Pawar picked him for the Plant Genome Saviour award. In September, he hosted scientists and farmers from South India, the US, Brazil, Haiti and Indonesia. His claim to fame? He develops indigenous, high-yielding and disease resistant varieties of plants. So far, he's perfected more than 460 types of paddy, 120 of wheat, 40 kinds of arhar dal and three of mustard. He's also grown a special type of wood apple or bel, one that yields 8-10 fruits in a single bunch, multiplying harvests for poor farmers. One million farmers in about seven Indian states swear by the seeds he provides. He sells them for Rs 30-40 per kilo, compared to the Rs 200-300 that agents charge for genetically modified (GM) crops. Still, his crops outperform the GM ones on yield. And from their grain, farmers plant for the next harvest - something they can't do with a GM crop. Yet, when Jai Prakash Singh walks out to greet you, there's no arrogance. Just the humility of years spent in struggle. The smile is warm and welcoming. But the eyes appraise you, check your worth - the instinct of a hard driving man, for whom getting results is important. On the other side of the road, there's a big seed storehouse. On this side is a sprawling bungalow and on the porch, a number of cars. But they all belong to his brother - Chandra Shekhar Singh Raghuvanshi, a big shot seed tradesman and lawyer - says JP as he leads me out back, to a simple, single-storeyed concrete house that's been under construction for three long years. It is here, in an unpainted room that still has a floor lined with cowdung paste, that he tells me his story over a hot cup of delicious tea. *** "We are five brothers and sisters. I'm number three. I was the one who was weak in school. I never passed my tenth standard exam in 1983," says JP. "Our father, Shitala Prasad Singh, was a primary school teacher. He was a strong, outspoken man, well known in the villages around here. He even stood for elections once. But he never became an MLA. He was too blunt for anything like that." In the 1970s, around the time of the Green Revolution, a busload of agricultural scientists came down to JP's village from the university in Pant Nagar. They asked if anyone wanted high yielding seeds and training on how to grow them. JP's father roped in his friends from the village and together, they reaped some of the biggest harvests ever reported in these parts. Later, Shitala Prasad became an agent for the National Seeds Corporation, with small shops in a few towns in UP. "Since I was the school dropout, I used to hang out at his shop a lot, in the first few years after 1983. One day, a customer came in when Father wasn't around. He'd had successive bad crops, was under financial pressure. He wanted seeds that would guarantee a good harvest. I gave him a government variety called UP 2003, which was pretty hot around that time." A few months later, the man came back to Shitala Prasad's shop. He was beaming from ear to ear. He sought JP out and when he had his attention, he said he'd had the best harvest in his village. His money problems were gone and his relatives didn't think he was a loser anymore. "That one incident changed everything for me. I was stunned to find that a simple seed could so dramatically change a man's fortunes. And after being treated as a no-good school dropout, I was elated to receive praise for a job well done. That's when I decided I'd experiment with seeds." JP got married in 1984, a year after flunking his Class 10 exams. He eventually fathered two daughters and two sons. But without a degree, he could never land a job or earn enough to sustain his family comfortably. Shitala Prasad's seed business soon ran into losses. A number of his shops closed down. And JP had to leave home for a while, making a living as best as he could, even if it meant working as a farm hand or labourer. But he never forgot his dream. When he came back to Tandiya village around 1990, he picked up where he'd left off. He would cycle 25 km up and down everyday, to and from the Banaras Hindu University. There was a senior scientist there, a Dr Mahatir Singh, who was working on hybrid wheat varieties. JP went just to watch him at work. Story continues View photos "He'd open the grain pod of a desi variety with pincers, remove the stuff inside, clean the pod with a chemical and then fill it with germinating grain from another, higher yielding wheat plant. In a few weeks, the original plant would put forth much larger, heavier ears of wheat than it normally would. We'd get a hybrid plant with a higher yield. "I didn't have his expertise, or access to the chemicals he used. So I just messed around with the plants in my own field. I'd open their pods, and remove two of the three tiny flowers inside. I'd replace those with miniscule flowers from a higher yielding variety. Somewhere along my fumbling around, I managed to whip up a robust strain that performed better than its siblings. That was my first discovery - I called that strain Mahesh." All the wheat varieties JP has today - Dollar, Samrat, Viraat, the whole JP series - are offshoots of that first strain Mahesh, developed around 1991. View photos "From then on, I'd simply identify plants that grew larger, or faster, or gave higher yields than the rest and segregate their seeds. Those seeds I'd plant in a separate plot in the next season - and then again segregate the best performing plants. Over time, they've given me the hundreds of varieties I sell today - all champion performers. All products of careful selection." *** Unknown perhaps to JP, different scientists have different takes on his claims to fame. Dr KP Singh is a retired professor from the Chaudhary Charan Singh Haryana Agricultural University in Hisar, Haryana. He's been associated with JP Singh for close to 15 years. He's also well known in academic circles as a reputed plant geneticist. He reveals an angle to JP's story that not many might know about. "In the '70s and '80s, there was a bunch of geneticists in India, myself and Dr Sanjay Rajaram [wheat specialist and Padma Shri awardee] included, that was researching high yielding varieties of wheat. We collaborated with institutions in Ukraine and Mexico, collected plant material, did gene modifications and got some outstanding test results in India. Curiously, not many in the Indian bureaucracy paid much attention in those days. We had a load of high potential seeds on our hands and a government supremely dis-interested in supporting them. So we donated those seeds to farmers." Dr Singh believes that the spectacular yields that JP and other rustic plant breeders in UP are witnessing now might be a late byproduct of solid scientific work done decades ago in Indian labs. Dr Bhim Singh Dahiya was Director of Research at the same university till a few years ago. Today, he is Chief Coordinator of Research at Kaveri Seed Company in Hyderabad, a private firm with a Rs 900 crore annual turnover. He agrees in part with Dr Singh. "Way back then, India had poor technology, low access to resources and poor seeds. The Agriculture Ministry was focusing on all rounder seeds - that would give consistently high yields in all sorts of climates and conditions, if given generous doses of fertilizer and pesticide. That aim unconsciously biased the way we collected our data and the way we evaluated our seeds." "No two farms have exactly the same type of soil. Different parts of Uttar Pradesh can have dramatically different water tables, salinity and fertility. Crops developed by scientists like Dr KP Singh were tailor made for specific soil and climate conditions - they'd deliver average yields in certain places but outstanding yields where other crops might not survive. That's why they were ignored by the government and why Dr Singh ultimately decided to give them away." "Today, the tables are turned. We've reached a tipping point in the amount of fertilizers and pesticides we can use. In the amount of land and irrigation we can provide with conventional methods. As a country, we do have access to money and latest technology. What we need now are seeds bred to survive and thrive in differing conditions. Particular seeds for particular soil types. The sort of work that was ignored years ago." But Dr Dahiya is clear that JP has every right to the credit he gets today. "The first plant breeders in the world were illiterate farmers. Not scientists. Before the green revolution, the seeds our farmers picked and grew for centuries were selected purely on their suitability and performance in differing conditions. That's exactly the sort of work JP is doing now. It takes years of observation and selection to propagate a particular trait in a plant. JP does it so well, his seeds are better than some developed in our research institutions." Just how much better is pointed out by Dr Jagveer Rawat, a scientist formerly with the Krishi Vigyan Kendra in Panipat and now with the Lala Lajpat Rai University of Animal and Veterinary Sciences in Hisar. He met JP in 2002. "In 2002-2003 and 2003-2004, JP's plants were put under observation on the Krishi Vigyan Kendra farm. Both Dr KP Singh and Dr Bhim Singh Dahiya were part of the study. One particular strain of wheat, called the X-JP 52, was found to be exceptionally rich in iron content. It was also almost immune to damage from water-logging. After almost two years of work, about 16 cultivars - or plant strains which showed promise under test conditions, were taken away by the Chaudhary Charan Singh Haryana Agricultural University for further studies." Dr Rawat himself was so impressed with JP's seeds, he got his own NGO, the Manav Kalyan Sewa Samiti, to work with him. He's now lobbying with the Planning Commission to get low cost farmer innovation centers established in every district in India. The idea is to get such centers to work with enterprising local farmers like JP Singh - to cross pollinate ideas that could drive India's next green revolution. *** By 1997, JP Singh's seeds were the rage in many parts of Uttar Pradesh (UP). But he'd give them all sorts of names, whatever caught his fancy at the time. In 1997 Dr Ram Kirpal Singh, the Krishi Zilla Adhikari, happened to visit his farm. Tagging along was an AIR radio crew. View photos "Live on air, Dr Singh told me he'd never seen ears of wheat so big, even on farms abroad. Still on air, he suggested I give my own name to the varieties I develop - JP, for Jai Prakash." The idea caught on. Before long, farmers were clamoring for JP seeds. When business began to look like it would take root, JP did what people expected him to do. He would suddenly takeoff. Between 2000 and 2002, he'd take furtive breaks from work - sometimes 2 days, sometimes a whole week. He'd tell his wife he was away visiting friends. What he was actually doing was state hopping. Bihar, Bengal, Jharkhand, Chattisgarh, Maharashtra - he visited them all. He'd travel without reservation in general compartments, sleep on the pavements, eat at the homes of acquaintances. They'd also introduce him to farmers in remote villages in those states. With signs and gestures, he'd tell those farmers he was looking for unusual seeds - wheat or rice with high iron content, plants that were drought resistant, that took very little time to grow, or ones that delivered bumper harvests. He'd wrap those seeds in small bundles and like squirrels that carry back nuts to their nests, JP Singh would carry his precious seeds back home to UP. There, on a paltry one bigha plot his uncle had left him in his will, JP would plant the seeds he'd gathered - and begin the process of observation and segregation all over again. When his father died, JP got another five bigha, which were immediately devoted to more experimentation. Another few bighas were borrowed from his mother and other uncles. There was never enough money to buy land outright - but just to work with his seeds, JP was prepared to scrounge around. Sometime after 2002, JP started the Nav Gram, Nav Ratna Yojana. The idea was to adopt nine villages within a 50 km radius. In each of those villages, people would try to focus on at least one important initiative. One village could focus on animal husbandry - breeding high milk-yielding Murrah buffaloes, for example. Another would concentrate on developing a seed warehouse. A third could work on cottage industries based around farm produce - for example - making biscuits from iron-fortified wheat. A fourth would set up an Agromart, a one-stop mall for everything you need in agriculture. JP's movement began to take root. Starting on June 8 every year, he'd take out a walkathon to all the nine villages he'd adopted around Tandiya. Hundreds of folks joined in, most simply for the fun of it. For nine days and nine nights, they'd be on the road - sleeping in the open, sharing food cooked on village hearths. They'd talk about the problems of each village, till the fields together, lobby the panchayats, the District Collector and the Block Development Officer for funds. Not content to do the exercise only in Uttar Pradesh, he branched out. In 2003, he did a padayatra in Gurgaon, just outside Delhi. In 2004, he was in Haryana's Kathal district. In 2006, Madhya Pradesh. The more places he went to, the more his fame spread. The more famous he became, the more his seeds came to be in demand. Soon JP began to experiment with chemical-free organic farming. Crops don't grow well without a fortified diet to help them along. So JP Singh concocted his own mix. "I'd take 10 kilos of cow dung, 2-4 liters of cow urine, 2 kg of jaggery, 2 kg of wheat flour, 2 kg of old mud from beneath a peepal tree. Add half a kilo of a chemical called Trichoderma. Top up the tank with water and stir, till the entire thing became a viscous slag. Then, I'd leave it out to dry." "The dry powder is what I'd spread on my fields. I call it Jai Amrit Fertilizer. It promotes the growth of healthy bacteria and other living organisms, which help fix nutrients and enrich the soil. I've had bumper yields with that stuff on my fields. I dare any scientist to show me a chemical fertilizer that can do better." It isn't an empty boast. The Gurukul, a residential school in Kurukshetra, Haryana, spread the stuff on 32 acres of their private farms and planted his own JP 1091 strain of wheat. They harvested 20 quintals of wheat per acre. JP claims the average yield in the area, with chemical fertilizers, is about 12 quintals per acre. As we talk, JP's phone keeps ringing. Someone calls from Satara in Maharashtra requesting a few quintals of seeds. Another chap calls from Itarsi in UP. Has the seed truck crossed the check posts, he asks. How much longer before it gets here? To each caller, JP talks in that same polite, mellifluous dialect peculiar to this part of Uttar Pradesh. "Everything's on schedule", he assures. "Just hang on, the seeds will be there before you know it." As he hangs up JP says, "This phone is my shop now. People keep calling from all over India. And I keep sending out my seeds. Isn't technology great?" Even as he talks, young farmers from the neighborhood sort through sacks of seeds in his living room. "Babuji, I'm sowing my crop rather late this year. Give me something that'll thrive despite that change," shouts one. JP smiles. *** Out in his fields in Tandiya village, JP proudly points out the plant varieties he peddles today. In the distance, an especially potent strain of wheat. Up towards the left, a strain of black rice. It's the sort that's popular in the North East and in countries like South Korea. But JP says he found this one in his own fields, just selecting and hoarding unusual seeds. "Just look at the colour. I even got the grain tested. The scientists say it's rich in iron," he says delightedly. And yet, in all this success, there is a tinge of sadness. "The crops this year didn't do as well as they should have. First, we didn't have a tractor. I sold mine when the family property was being redistributed among us brothers. A new one costs Rs 4-5 lakh and I don't have that sort of cash. So this year, we tilled our fields using bullocks. Old style.' "Then, we didn't have enough water at the right time. My submersible pump gave up the ghost this year. And we didn't have the money to get it repaired. Without water, the crops this year are slightly stunted. Their yield will probably go down too." I ask him why he won't sell his seeds at higher prices. After all, they're champion varieties, ones that practically guarantee bumper harvests. Their GM competitors cost upto 10 times as much - and yet, people buy them. JP Singh smiles when he hears my question. "I'm not in this game for the money", he says. "If it was just money I wanted, I'd have made it a long time ago.' "I'm happy when farmers benefit from my seeds. I've never calculated if they'll cheat me, if they'll pass off seeds from my crops as their own. Some do, you know - but word gets around. Word of mouth is everything in this business. Nobody forces people to call my seeds by the names I've given them. But they do. Maybe it's because they trust me.' "Money is important. But there's enough to go around. It's we humans who have to help other humans. That's humanity. That's what will save us all. That's probably why I keep my seeds cheap." He tells me about his encounter almost 20 years ago with a sage, believed by everyone to be around 130 years old. "His name was Ram Dass, and he was so old, he moved on all four limbs - but he did move fast. He clambered up the rock he used as a seat. And before I could speak a word, this man who I had never met before, who could have known nothing about me or my visit, said calmly - I know why you've come. You'll help bring back Ram Rajya." Ram Dass told JP he'd preserved documents 120 years old - texts written on parchment, minutes of meetings long since forgotten. They were meetings of ancient sages in Kashi, laying a road-map for the return of Ram Rajya. Three or four days after JP met the sage, Ram Dass died. It was almost like he'd been waiting for JP to arrive. Before he died, he entrusted to JP the documents he'd been guarding. "From ancient times, he said, there has been an unbroken line of storytellers. To them was given the task of telling the world a true story. Of how the sages cursed the royal traditions of kings and caused them to crumble. They were disgusted by the vile lives those emperors led. But their curse disrupted a system of law that had held the world together since the beginning of time. It was the beginning of massive upheavals around the globe. This age will pass away one day. And with it, will go the problems of our present world. But that will happen only if men know of the bliss that once existed on Earth. When they work for it and yearn for it with all their hearts. This is the time when leaders of all nations and faiths must unite. To hasten the return of Ram Rajya.' "Sant Ram Das told me he was a storyteller. A custodian of ancient truths. A herald of the time to come. I didn't realize it then. But when he handed those withered parchments to me, he was passing on the tradition. I'm the storyteller now. I'm the one who has to bear witness to the world." A few minutes before I was to leave his house, JP Singh suddenly asked, "Bhaisaheb, what does one do to get a Nobel Prize?" I tried explaining to him the importance and perhaps the impossibility of snagging a Nobel. The educational intricacies, the need for peer reviewed work. Midway through my soliloquy, I realized how hollow I must have sounded. I was preaching theory to a man who enjoys the trust of thousands. He heard me out patiently. Didn't interrupt, didn't demur. But there was that calm look in his eyes. City boys can talk all they want. But this farmer has his heart set on a Nobel. No one can tell him he can't have it. Jaimon Joseph is a multimedia journalist who reports on science, technology, defence and international affairs. Follow him at https://twitter.com/jaithemon | Mid | [
0.630071599045346,
33,
19.375
] |
Successful extraction of DNA from plant tissues generally has been most successful from freshly field-collected tissue placed into either liquid nitrogen or, more commonly, into silica gel desiccant. When possible, the samples are then stored frozen in ultracold liquid nitrogen tanks or in boxes containing additional silica gel at −20°C to −80°C. Subsequent nucleic acid extractions most commonly have involved either some form of a cetyltrimethylammonium bromide (CTAB)--based technique ([@bib7]) or use of a QIAGEN DNeasy kit (QIAGEN, Venlo, The Netherlands). However, previous research has also shown success with an alternative genomic DNA extraction method using Whatman FTA PlantSaver Cards (Whatman, Maidstone, United Kingdom), with effectiveness for agricultural plant species, entomology, mycology, and other food sciences ([@bib14]; [@bib12]; [@bib1]; [@bib4]; [@bib6]). Nevertheless, remarkably little research has been done to test the effectiveness of this extraction method on non-agricultural plant species. Additionally, it has been shown that methods employing DNeasy kits and/or CTAB-based methods may not be optimal for all plant genera and families because inhibitors can be coprecipitated with the DNA ([@bib5]; [@bib1]). Therefore, it is proposed that alternative extraction methods, such as use of the FTA cards, be tested as to whether they are more effective for some plant genera. To help gain a better understanding of the potential uses and limitations of FTA card extraction, this study assessed FTA card--extracted DNA quality in terms of concentration, spectral absorption, degree of fragmentation, and amplification and sequencing ability on a wide phylogenetic range of non-agricultural species. The data collected using these methods helped to indicate which plant species may be most compatible with the FTA card extraction method. Both successful and failed extractions provided valuable insights into the potential advantages and limitations of this alternative extraction method. MATERIALS AND METHODS ===================== Collection ---------- Samples from 15 phylogenetically diverse taxa possessing varying leaf characteristics were collected from the following vascular plant families: Apocynaceae, Aquifoliaceae, Asteraceae, Cactaceae, Cyperaceae, Fabaceae, Lamiaceae, Magnoliaceae, Oleaceae, Oxalidaceae, Poaceae, Typhaceae, Vitaceae, Pinaceae, and Aspleniaceae ([Table 1](#tbl1){ref-type="table"}). Collection of samples was completed on the morning of 23 June 2015, alongside a gravel utility road, sloping hillsides, and free-standing trees in Suitland, Maryland, USA. Voucher specimens for each species were deposited in the National Museum of Natural History's Herbarium (US), the University of Illinois at Urbana-Champaign Plant Biology Herbarium (ILL), and the Chicago Botanic Garden (CHIC). ###### Species sampled in this study. All specimens were collected in Camp Springs, Maryland, USA (GPS coordinates 38°50′40.4″N, 76°56′17.4″W). Triplicate vouchers were made for deposit at the National Museum of Natural History's Herbarium (US), the University of Illinois at Urbana-Champaign Plant Biology Herbarium (ILL), and the Chicago Botanic Garden (CHIC). Samples are organized alphabetically by family name. Family Genus/Species (Common name) Voucher no. ---------------- ---------------------------------------------------------------------------- ---------------- Aquifoliaceae *Ilex glabra* (L.) A. Gray (inkberry) *C. Siegel 11* Asclepiadaceae *Asclepias syriaca* L. (common milkweed) *C. Siegel 10* Aspleniaceae *Asplenium platyneuron* (L.) Britton, Sterns & Poggenb. (ebony spleenwort) *C. Siegel 6* Asteraceae *Ratibida pinnata* (Vent.) Barnhart (pinnate prairie coneflower) *C. Siegel 8* Cactaceae *Opuntia* cf. *laevis* J. M. Coult. (prickly pear) *C. Siegel 15* Cyperaceae *Carex lurida* Wahlenb. (shallow sedge) *C. Siegel 3* Fabaceae *Albizia julibrissin* Durazz. (silktree) *C. Siegel 7* Lamiaceae *Monarda fistulosa* L. (wild bergamot) *C. Siegel 1* Magnoliaceae *Magnolia virginiana* L. (sweetbay magnolia) *C. Siegel 12* Oxalidaceae *Oxalis dillenii* Jacq. (wood sorrel) *C. Siegel 13* Pinaceae *Pinus virginiana* Mill. (Virginia pine) *C. Siegel 5* Poaceae *Dichanthelium commutatum* (Schult.) Gould (panicgrass) *C. Siegel 14* Simaroubaceae *Ailanthus altissima* (Mill.) Swingle *C. Siegel 9* Typhaceae *Typha angustifolia* L. (narrowleaf cattail) *C. Siegel 2* Vitaceae *Ampelopsis glandulosa* (Wall.) Momiy. (Amur peppervine) *C. Siegel 4* Samples were preserved using Whatman FTA PlantSaver Cards and in silica gel (Flower Drying Type A silica with indicator; AGM Container Controls, Tucson, Arizona, USA). Samples were applied to the FTA cards directly in the field, then stored at room temperature. To make the plant print, a ceramic pestle was used like a hammer to smash the leaf tissue onto the card paper ([Fig. 1](#fig1){ref-type="fig"}). Enough plant prints were made for seven replicate extractions to be performed for each species. {#fig1} Additionally, 2--3 in^2^ of leaf tissue were collected into individual silica gel--containing bags to be extracted later, using the CTAB-based technique on the AutoGen DNA isolation system (AutoGen, Holliston, Massachusetts, USA). Bags were stored in a plastic box containing additional silica gel at room temperature prior to extraction and then moved to a −20°C freezer for long-term storage. Extraction ---------- ### FTA card extraction After collecting the samples on the FTA cards, small punched disks were removed from the sample cards followed by a series of washes on the disks. The protocol used was closely modeled after the method outlined in [@bib1], with a modified disk size and centrifugation added after the incubation period to reduce bubbles. Eight disks, 2.0 mm in diameter, were used in this study so as to have a comparable total disk surface area to that found in [@bib1]. Additionally, the protocol of Adugna et al. called for centrifugation only after the addition of TE in the last step of the protocol. In our study, plates were centrifuged at 6200 rpm for 2 min at 4°C in between each purification wash. Using the 2.0-mm-diameter Harris Micro Punch and Mat (Whatman), 56 disks were removed from each specimen's plant-pressed FTA card. A 96-well, Square V-Bottom 2-mL Assay Block (Costar, Corning Inc., Corning, New York, USA) was used with eight punched disks placed in each well. The disks were only added to the innermost wells (rows 3--10 out of 12) of the plates for more effective and cleaner transfer from one plate to another. Disk punches were taken from the leaves' darker print areas on the cards, which were presumed to contain the most concentrated residue. Once disks had been collected from each plant, a series of washes were employed according to the manufacturer's protocol. First, 400 μL of FTA purification reagent was added to each well. The plate of samples was then covered with Microseal 'F' foil seals (Bio-Rad, Hercules, California, USA) to reduce contamination, vortexed, and incubated at room temperature for 4 min before centrifugation at 6200 rpm for 2 min at 4°C. The supernatant was removed and the plates were then centrifuged a second time before the foil was removed. The FTA purification reagent wash was repeated once, followed by two low TE buffer washes. After completing the four washes, the remaining supernatant was removed. The samples were left to dry at room temperature for 20 min. The disks were then transferred to a new plate and centrifuged to separate them from as much remaining supernatant as possible. Any punches not in the new plate were manually transferred using cleaned forceps. Finally, 80 μL of TE was added to the plate containing the washed disks. The plate was centrifuged at 6200 rpm for 1 min and then incubated for 5 min at 95°C. The paper disks were left in the sample wells with the TE and eluted DNA. ### CTAB-based extraction For each replicate, a 1.0-cm^2^-sized piece of dried and shredded leaf tissue was added to a 2.0-mL tube containing 2.3-mm-diameter zirconia-silica beads and 1.0-mm-diameter glass beads (BioSpec, Bartlesville, Oklahoma, USA). The tissue was then macerated using the TissueLyser (QIAGEN) at 30 Hz for 30 s before 400 μL of CTAB, warmed to 65°C, was added. The Cactaceae samples produced a viscous gel, so 75 μL of 20 mg/mL Proteinase K and 500 μL of CTAB were added to further clean the sample. All samples were incubated overnight in a rotary incubator at 65°C and 150 rpm. The resulting lysate solutions were centrifuged at 13,000 rpm for 5 min and 300 μL of supernatant was transferred to each well of a 96-well AutoGen plate. DNA extraction was completed using the automated DNA isolation system AutoGenprep 965 (AutoGen) as outlined by the manufacturer's protocol, and the final pellets were resuspended in 80 μL of TE buffer. Quantification and quality assessment ------------------------------------- To assess the quality of the extractions generated with the two techniques, 260/280 nm absorbance ratios and fluorometric determinations of DNA concentration were performed using a Synergy HT Microplate Reader (BioTek, Winooski, Vermont, USA). The Quant-iT Broad-Range dsDNA Assay Kit (Invitrogen, Waltham, Massachusetts, USA) was used with the Synergy Microplate Reader according to the manufacturer's protocol ([Fig. 2](#fig2){ref-type="fig"}). The DNA size range and degree of fragmentation were determined using gel electrophoresis ([Fig. 3](#fig3){ref-type="fig"}). The samples (10 μL) were run alongside a HiLo DNA size standard (Minnesota Molecular, Minneapolis, Minnesota, USA) on a 1.5% SeaKem Agarose LE gel in 1× SB ([@bib3]). The loading dye used to prepare these electrophoretic separations contained a 1:1000 dilution of Gel Red fluorescent nucleic acid stain (Biotium, Fremont, California, USA). {#fig2} {#fig3} PCR amplification and DNA sequencing ------------------------------------ To compare the amplification success of DNA extracted with the two methods, a portion of the low-copy nuclear gene *At103*, the nuclear ribosomal intergenic spacer (ITS), and the plastid ribulose-bisphosphate-dismutase large subunit (*rbcL*) were amplified. Each amplification reaction contained 2.5 μL of FTA card--extracted sample or 2.5 μL of 1:50 diluted CTAB-extracted sample. The *At103* region was amplified with forward primer CTTCAAGCCMAAGTTCATCTTCTA and reverse primer TTGGCAATCCATTGAGGTACATNGTM ([@bib11]), and the ITS region was amplified with primers ITS5a (CCTTATCATTTAGAGGAAGGAG) and ITS4 (CAGGAGACTTGTACACGGTCCAG; [@bib10]). For these primer pairs, the PCR program used was: 95°C for 4 min; four cycles at 95°C for 45 s, 57°C for 30 s, 72°C for 1.5 min; four cycles at 95°C for 45 s, 54°C for 30 s, 72°C for 1.5 min; 35 cycles at 95°C for 45 s, 52°C for 30 s; 72°C for 1.5 min; and a final extension at 72°C for 10 min. For *rbcL*, PCR was conducted with forward primer ATGTCACCACAAACAGAGACTAAAGC and reverse primer GTAAAATCAAGTCCACCRCG ([@bib10]) using the following thermal cycler protocol: 95°C for 3 min; 34 cycles at 94°C for 30 s, 55°C for 45 s, 72°C for 2 min; and a final extension at 72°C for 5 min. Success of the PCR was assessed by gel electrophoresis. Two successful replicates for each marker and species were chosen for sequencing. These products were enzyme-treated with ExoSAP-IT (Affymetrix, Santa Clara, California, USA) to remove unincorporated primer and deoxynucleotide triphosphates (dNTP) prior to being used as template for cycle sequencing with BigDye Terminator version 3.1 Ready Reaction Mix (Thermo Fisher Scientific, Grand Island, New York, USA). The resulting Sanger sequencing fragments were purified through Sephadex G-50 and analyzed on an ABI 3730xl automated capillary sequencer (Life Technologies, Carlsbad, California, USA). Chromatograms were analyzed using Geneious 9.0.5 (Biomatters, Auckland, New Zealand), and successful sequences were submitted to GenBank ([Table 2](#tbl2){ref-type="table"}). ###### Results of DNA amplifications and sequencing.[^a^](#tblfn1){ref-type="table-fn"} Family Marker Extracted using CTAB method Extracted using FTA method ---------------- --------- ----------------------------- ---------------------------- ------- ---------- --- --- ------- ---------- Aquifoliaceae *At103* 0 7 0 No 0 7 0 KX394243 ITS 0 0 **7** KX352749 0 0 **7** KX352750 *rbcL* 4 0 **3** --- 0 7 0 KX702293 Asclepiadaceae *At103* 4 2 **1** No 7 0 0 No ITS 0 7 0 KX352744 0 7 0 KX352745 *rbcL* 0 0 **7** KX702286 0 0 **7** KX702287 Aspleniaceae *At103* 6 0 **1** KX394240 7 0 0 --- ITS 0 5 **2** No 1 1 **5** No *rbcL* 0 0 **7** KX702288 2 0 **5** KX702289 Asteraceae *At103* 2 5 0 No 3 1 **3** No ITS 0 0 **7** KX352753 0 0 **7** KX352754 *rbcL* 0 0 **7** KX702303 0 5 **2** KX702304 Cactaceae *At103* 0 7 0 KX394245 0 0 **7** KX394246 ITS 0 7 0 KX352751 1 6 0 KX352752 *rbcL* 1 0 **6** KX702298 0 7 0 KX702299 Cyperaceae *At103* 7 0 0 --- 6 0 **1** No ITS 1 1 **5** No 0 0 **7** KX352746 *rbcL* 0 6 **1** KX702290 0 2 **5** KX702291 Fabaceae *At103* 0 7 0 KX394236 0 7 0 KX394237 ITS 0 6 **1** No 0 7 0 No *rbcL* 0 2 **5** KX702282 0 1 **6** KX702283 Lamiaceae *At103* 0 0 **7** KX394244 6 1 0 No ITS 1 4 **2** No 7 0 0 --- *rbcL* 0 7 0 KX702296 4 0 **3** KX702297 Magnoliaceae *At103* 7 0 0 --- 5 2 0 No ITS 0 7 0 --- 0 7 0 --- *rbcL* 0 5 **2** KX702295 0 7 0 KX702294 Oxalidaceae *At103* 0 7 0 KX394247 1 5 **1** KX394248 ITS 0 0 **7** No 0 1 **6** No *rbcL* 0 4 **3** KX702300 1 6 0 KX702301 Pinaceae *At103* 0 7 0 No 7 0 0 --- ITS 0 5 **2** No 7 0 0 --- *rbcL* 0 0 **7** KX702302 7 0 0 --- Poaceae *At103* 0 7 0 KX394241 3 3 **1** KX394242 ITS 0 7 0 KX352747 0 7 0 KX352748 *rbcL* 0 4 **3** No 2 5 0 KX702292 Simaroubaceae *At103* 3 4 0 KX394234 0 0 **7** KX394235 ITS 2 3 **2** No 0 7 0 KX352741 *rbcL* 3 0 **4** KX702280 0 7 0 KX702281 Typhaceae *At103* 0 0 **7** KX394249 3 0 **4** KX394250 ITS 0 6 **1** No 0 7 0 No *rbcL* 0 4 **3** KX702305 2 1 **4** No Vitaceae *At103* 0 0 **7** KX394238 4 0 **3** KX394239 ITS 1 1 **5** KX352742 0 5 **2** KX352743 *rbcL* 0 0 **7** KX702284 4 3 0 KX702285 Families are listed alphabetically with the number of replicates (out of a total of seven) that showed no bands, multiple bands, or one band. The number of replicates that were successfully amplified with a single band are provided in boldface. Plant samples were amplified with three different primer pairs: ITS, *rbcL*, and *At103*. --- = PCR was not successful and, as a result, sequencing was not performed; No = sequencing was performed on an amplicon, but was not successful. GenBank accession numbers are provided for amplicons for which PCR and sequencing were successful. RESULTS ======= Quantification and quality assessment ------------------------------------- Spectrophotometric estimations of nucleic acid concentrations of CTAB-extracted samples were considerably higher than those of FTA card--extracted samples ([Fig. 2A](#fig2){ref-type="fig"}). However, there was not a substantial difference in average detected concentration among the 15 sampled species. Although the CTAB-extracted samples were much more concentrated, the CTAB sample concentration values were more variable than those of the FTA card--extracted samples. FTA card samples had an average standard error for concentration of 7.81 ng/μL while that of the CTAB-extracted samples was 37.96 ng/μL. The average 260/280 absorbance ratio was closer to 1.8 for CTAB-extracted samples compared to those for FTA card--extracted samples ([Fig. 2B](#fig2){ref-type="fig"}). The FTA card--extracted, amplified samples also had 260/280 ratios that were indicative of lower quality. Quant-iT fluorometry showed that the CTAB-extracted samples contained large, but highly variable concentrations of DNA, while the DNA extracted with the FTA cards was relatively undetectable with this method ([Fig. 2C](#fig2){ref-type="fig"}). Like the spectrophotometric measurements, there were no substantial differences in average concentration among the 15 sampled species. Because spectrophotometry does not discriminate between RNA and DNA as effectively as the fluorometric method, the greater quantities of DNA estimated by the spectral absorbance values ([Fig. 2A](#fig2){ref-type="fig"} vs. [Fig. 2C](#fig2){ref-type="fig"}) might be an artifact of the copurified RNA with the DNA in the samples. Gel separations of the samples indicate that all of these total genomic DNA extracts contained unfragmented, high-molecular-weight DNA, except for the Typhaceae samples extracted with the FTA card method ([Fig. 3](#fig3){ref-type="fig"}). PCR amplification and DNA sequencing ------------------------------------ CTAB and FTA card samples for all families were generally successful in amplification of *At103*, ITS, and *rbcL* ([Table 2](#tbl2){ref-type="table"}). Despite the differences seen in the appearance of each plant print on the FTA cards ([Fig. 1](#fig1){ref-type="fig"}), all but the conifer *Pinus virginiana* could be successfully amplified with at least one primer pair ([Table 2](#tbl2){ref-type="table"}). The *rbcL* amplicons were the most amenable to cycle sequencing, resulting in high-quality chromatograms for at least one CTAB and/or FTA card sample of each species ([Table 2](#tbl2){ref-type="table"}). The *At103* marker most readily amplified and sequenced for families Aquifoliaceae, Aspleniaceae, Cactaceae, Fabaceae, Lamiaceae, Oxalidaceae, Poaceae, Simaroubaceae, Typhaceae, and Vitaceae. The most successful families for amplification and sequencing with the ITS5a/ITS4 primers were Aquifoliaceae, Asclepiadaceae, Asteraceae, Cactaceae, Cyperaceae, Poaceae, Simaroubaceae, and Vitaceae. These results indicated that, even if the leaf did not create a dark chlorophyll print, amplifiable DNA was captured by the FTA card. DISCUSSION ========== The FTA card method could have great utility in the study of non-agricultural plant phylogenetics and population genetics, as it addresses some shortcomings of the CTAB-based technique, including facility of collection and transportation. During field collection, kilogram quantities of silica would not need to be transported to preserve specimens for CTAB-based extraction methods, allowing more specimens to be collected. While collection permits are usually required for sampling plants, a U.S. Department of Agriculture Animal and Plant Health Inspection Service (USDA-APHIS) permit is not necessary for acquiring the actual plant tissue embedded on an FTA card, because the material cannot be propagated, as would whole-rooted plants, rhizomes, and seeds (V. Funk, personal communication). Additionally, because the FTA card embedding procedure may destroy RNA from viruses ([@bib9]), biosafety issues may not arise when transporting plant tissues between states and between countries. The FTA cards are more compactly stored and do not require refrigeration. Finally, the FTA card--extraction method requires less laboratory expertise and fewer hazardous chemicals such as CTAB, chloroform, and phenol ([@bib14]; [@bib12]; [@bib6]). The FTA card and CTAB extraction methods both exhibited varying levels of success. CTAB-extracted samples contained higher concentrations of DNA as estimated by their A260/A280 absorbance ratios. Between replicates of the same species there was greater variation in concentration among those extracted with the CTAB-based vs. the FTA card methods. This inconsistent quantity of DNA recovered from the CTAB procedure may have been an artifact of the AutoGen instrument, as has been previously reported ([@bib13]). The increased concentrations of DNA detected in the CTAB-extracted samples is a major consideration in determining the overall utility of the two methods. The differences in DNA concentration for CTAB- and FTA card--extracted samples could have been due to the differences in amount of leaf tissue originally used for extraction. Approximately 1 cm^2^ of leaf tissue was used for each CTAB-extracted sample, while for FTA card--extracted samples the amount of DNA produced depended on the concentration and amount of fluid transferred from the leaves to the card. The total genomic DNA gels ([Fig. 3](#fig3){ref-type="fig"}) indicated that the FTA card--extracted samples contained a less-fragmented DNA when compared to the CTAB-extracted samples. In contrast to the FTA card--extracted DNA, it was observed that RNA and/or degraded DNA could easily be detected in gel separations of the CTAB-extracted DNA.The amount of PCR product generated was approximately correlated with the concentration of the DNA extract used. Although many of the amplification success rates were similar between the two extraction methods, the CTAB-extracted samples on average amplified more consistently ([Table 2](#tbl2){ref-type="table"}). Only the Cactaceae, Cyperaceae, and Simaroubaceae species were amplified more successfully with the FTA card--extracted samples. In addition to the conifer and fern species, the families of the species that successfully amplified and sequenced were distributed evenly throughout the Angiosperm Phylogeny Group (APG) III phylogeny for flowering plants ([@bib2]; [Tables 1](#tbl1){ref-type="table"}, [2](#tbl2){ref-type="table"}). In summary, this study provided a more comprehensive understanding of the strengths and weaknesses of using Whatman FTA cards for non-agricultural species. Although the FTA card--extracted samples had a substantially lower concentration of DNA, the method is a good alternative for field collection if well-optimized primer pairs are being used that can amplify low concentrations of template DNA. The previous success of FTA cards with large sample sizes in agricultural studies indicates that it could be a suitable method for studies in plant population genetics and conservation biology that require the analysis of hundreds to thousands of samples ([@bib1]; [@bib6]). The FTA card method may work better for some families than for others. For example, we believe the FTA card method may work well for those families and genera phylogenetically related to and/or physiologically similar to the Cactaceae and Pinaceae. Finally, while FTA cards have been used previously for extracting insect nucleic acids for RNA-Seq next-generation sequencing studies ([@bib8]), future work should focus on whether plant DNA and/or RNA extracted with the FTA cards could be used for some next-generation sequencing techniques (i.e., RNA-Seq, and possibly RAD-Seq, Genotyping by Sequencing \[GBS\], and targeted enrichment; [@bib15]). By increasing the number and size of punches produced from the cards, FTA card--extracted samples might provide enough material suitable for the latter DNA-based next-generation sequencing methods. [^1]: The study could not have been completed without the field expertise of Dr. Carol Kelloff. The authors would also like to thank Gabriel Johnson of the Smithsonian Institution and Juannan Zhou of the University of Maryland, who provided invaluable insights and mentorship throughout the research process. Laboratory and computer work were conducted in and with the support of the Laboratories of Analytic Biology facilities of the Smithsonian National Museum of Natural History. [^2]: These authors contributed equally to this work. | Mid | [
0.651994497936726,
29.625,
15.8125
] |
Alex Salmond has been accused of trying to ruin Christmas after it emerged the Faslane naval base which houses the UK’s nuclear deterrent is nothing more than a workshop for creating children’s toys. Prime Minister David Cameron, in an unplanned move, announced to the House of Commons yesterday that the Trident system had been a “cover-up for something bigger” ever since it was announced in 1980. The Faslane base alongside the creation and maintaining of four submarines with nuclear warheads had been a front for the increasing commercialisation of Christmas, Mr Cameron said, and that stopping Mr Salmond was now of a higher priority than pretending to the rest of the world that the nation was packed with weapons of mass destruction. Ministers opposed to Scottish independence immediately attacked the First Minister for not only putting the UK at risk but “for destroying all that is pure about the festive season”. Shadow Defence Secretary Jim Murphy said: Last month, the Washington Post announced that Scotland becoming independent will probably cause World War III. This week, the SNP have declared war on Christmas by continuing to talk about the end of ‘Trident’. I don’t know what’s worse. Every parent up and down the country will want reassured that their children will have enough toys to play with in their bomb shelters when the inevitable comes under independence.” Labour MSP Jackie Baillie said: The hard work of keeping the truth from the British public has been well and truly undone by the scandalous actions of the First Minister. Around 11 thousand million jobs are at risk in the area and if they all go there will be nobody to make your traditional festive toys – things like a rocking horse, a space hopper, and a little abacus so people can learn how to count properly.” Scottish Conservative Leader Ruth Davidson, in another of her unfunny monologues, said: Not content with wowing us by impersonating Nixon, Clinton, Del Boy, Shaun of the Dead and the First Minister on the Moon all at once, we can add another moniker – the First Minister is now The Nat Before Christmas. “Where does the Abominable Snowman get off on trying to take holiday cheer away from the children of this United Kingdom? It’s not very ice at all. Maybe we should all give him the cold shoulder. I certainly wouldn’t want to show up at any SNP Christmas dinner – will we have Brussels on our plate, or won’t we? In this matter, and in every other matter regarding independence, the First Minister is looking more and more ice-olated. “We would do well to remember this point – snow man is an island, unless his name is Alex Salmond.” The SNP’s Mark McDonald hit back at the claims, saying: It’s hypocritical of David Cameron to say we’ve ruined Christmas when he has just told the world that Santa’s toys are made by normal-sized but hard-working people in manky Faslane garages rather than by elves in the glistening North Pole. In an independent Scotland we will shield our children from these outrageous shenanigans.” A spokesperson for Scottish Labour confirmed that leader Johann Lamont was currently busy trying to figure out her party’s policy on Christmas. And on the Council Tax. And on education funding. And on sectarianism. And on gay marriage. And on alcohol pricing. And on train fares. And on nuclear weapons. And on local taxation. And on the constitution… Meanwhile, the Yes campaign has remained silent on Salmond’s plans for the moon, Scotland’s ability to cope with zombie invasions and uncertainty surrounding the Loch Ness Monster’s place in the UK. Ray McRobbie National Collective raymcrobbie.com | Low | [
0.49792531120331907,
30,
30.25
] |
FIREHOSE: New York Times Opinion Page (Leyla Acaroglu) From today's NYT... An Opinion piece in support of the type of "export police" I've been writing about this month, in the Firehose Series. "In far-flung, mostly impoverished places like Agbogbloshie, Ghana; Delhi, India; and Guiyu, China, children pile e-waste into giant mountains and burn it so they can extract the metals — copper wires, gold and silver threads — inside, which they sell to recycling merchants for only a few dollars. In India, young boys smash computer batteries with mallets to recover cadmium, toxic flecks of which cover their hands and feet as they work. Women spend their days bent over baths of hot lead, “cooking” circuit boards so they can remove slivers of gold inside. Greenpeace, the Basel Action Network and others have posted YouTube videos of young children inhaling the smoke that rises from burned phone casings as they identify and separate different kinds of plastics for recyclers. It is hard to imagine that good health is a by-product of their unregulated industry."Smashing batteries to recover cadmium? Descriptions of the same Youtube videos which have been discredited? There is no new information in the column at all. A lot of imagery of harsh conditions, poverty, victimization. Who wrote the article? Leyla Acaroglu is a sustainability strategist based in Melbourne, Australia. Here are pictures of the people who buy and recycle cell phones. Some of these pictures will look familiar. Most will not. I got these from a rare blog kept by David Kousemaker (dkousemaker),TechTravels Blog, a mostly photo blog (much less wordy) about used technology. But unlike BAN and Greenpeace's photography, it's not political, and he isn't soliciting your "charitable donation". I've put a handful of these photos in small scale below (fair use, and Kouserman actually allows non commercial commons use, see bottom). Leyla, if you want to talk about sustainability in development, give me a ring. I chose repair and refurbishing because the "Network of Tinkerers" is a model for development which offers an alternative from the curse of natural resources (and foreign aid, which appears to have the same effect as oil and diamonds, creating a Darwinistic government class that provides the greatest rewards to the sharpest elbows). Tinkerers, networkers, technicians, fixers, repairers, geeks... those are the people who turn discarded tech into affordable access. We called it "Yankee Ingenuity" in the Northeast. There is no better way for a smart kid without connections to make $300 per day than by fixing and salvaging.Read the other blogs here, Leyla, and you'll find that BAN and Greenpeace are filming the city dumps at major cities, and the used imports are mostly not the same stuff people throw away here after using it for 20 years. Five reports show 9%, 10%, 13%, 15% of the imports are waste, which is actually less than new "affordable" product imported into places like Africa or sold in shops in China. The free market is not as bad as you've described. And no one can afford to pay for scrap to be shipped across the ocean just to dump it, something of value must be there for the ride (and it isn't batteries smashed for cadmium... who told you that?).In May, 2011, I channeled a book from 1960. No, not Vance Packard's "The Waste Makers", about planned obsolescence. No, not Rachael Louise Carlson's "Silent Spring", about the invisible toxics from our heavy industry, and their heavy poisonous toll. In "E-Waste Bloggers Play Atticus Finch", I referenced Harper Lee's dramatic novel, "To Kill a Mockingbird". Ms. Lee, who has recently been in the news over copyright and author control, told the simple story of her native Monroeville, Alabama. "You never really understand a person until you consider things from his point of view... until you climb into his skin and walk around in it."- Harper Lee, To Kill a Mockingbird The point here is that was 2011, and I've had many earnest discussions with Jim Puckett and the team at Basel Action Network. They have quietly taken down the "80-90%" dumping statistic, but done so in a way which shows more concern about their defamation lawsuits than it does setting the record straight. Meanwhile, Interpol arrests African geeks, I tell Jim, and he says "that's not me, I didn't do that".If I were to use the term "accidental racist" about the woman Leyla from Melbourne Australia who really cares about sustainability, and obviously cares about the women in Shenzhen and the scrap boys in Abogbloshie, I'd probably alienate her (like I did David Fedele). But she thinks she's helping Africans. She's hurting them, she's causing them to be arrested. "As you grow older, you'll see white men cheat black men every day of your life, but let me tell you something and don't you forget it - whenever a white man does that to a black man, no matter who he is, how rich he is, or how fine a family he comes from, that white man is trash." When people like photographer Pieter Hugo describe repair, reuse, and imports as 'trash', they are firefighters. They believe they are responding to an emergency.Please, help me to help them redirect their firehoses. It's not their fault. David Fedele used statistics from Basel Action Network, and so did Ms. Leyla Acaroglu. They are not racists, accidental or otherwise. But when you go to the Toyota dealership in Yonkers, and take pictures of junk trade ins, and then tell people that the junk trade ins were "externalized waste" from Tokyo, rather than trade ins for better product, trade ins that worked for years, you have some responsibility when the New York Times reports the story, and the Toyota dealership owner is arrested. This is what is happening to reuse shops in Accra. Greenpeace filmed the sea containers being unloaded. They are not the same as the stuff at the Abogbloshie junk yard, any more than the junk cars came out of the Toyota transport ship.It's a sin to kill a Mockingbird. "The majority of refurbished products stem from imports via the ports of Lagos. The interimresults from project component 2, the Nigerian e-Waste Country Assessment, show that 70%of all the imported used equipment is functional and is sold to consumers after testing. 70%of the non-functional share can be repaired within the major markets and is also sold toconsumers. 9% of the total imports of used equipment is non-repairable and is directlypassed on to collectors and recyclers." About TechTravelswith 3 commentsThis blog deals with some of unintended effects of the collision between culture and technology. These pages will be dedicated in particular to the repair, mod and hack ecosystems that have sprung up around consumer electronics in developing countries. As an interaction designer and one of the principal founders of Blendid, David Kousemaker researches this topic from a designer/maker perspective. Techtravels /at/ gmail /dot/ com for questions related to this blog (or if you have any spare frequent flyer miles you’d like to donate).All content of this side is published by David Kousemaker and licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License. | Low | [
0.45433255269320805,
24.25,
29.125
] |
Here is a new screenshot (64KB .gif) showing the colour VDI mode (800x608x16) with STonX running on an Alpha clone with a Sun IPC as X display. The values are "real" timings, since the Timer C is running at 200Hz (as it has done since STonX 0.5.3 or so). This is how fast STonX runs on a 366MHz 21164 based Alpha workstation running Red Hat Linux 4.1. Note, that this is not even a particularly high-end system, since a major german PC distributor is going to sell 500MHz 21164 based Alphas for approx. 6000DM soon. VDI-Driver for Xlib - speeds up the graphics output of "clean" applications, since VDI functions are implemented using Xlib functions (so e.g. accelerated line routines of your graphics card may be used). Uses an X window (monochrome displays may still work with the monochrome ST mode, but this is untested) or SVGAlib with Linux. TOS 2.06 runs under the emulator without modification. TOS 1.4 has also been tested with STonX 0.5a and works. 1.0 and 1.2 work with limitations. TOS 2.05 has been tested and works with STonX 0.5.3. Features that have been implemented but not yet released: (Almost complete) 68020/030 emulation (without MMU), sufficient to run TOS 3.06 without the TT graphics modes, implemented by Thorsten Otto (thanks!), who also contributed many bug fixes in the GEMDOS routines etc.. Raster interrupt support (requires 16bpp displays) Precise instruction timing and MFP timers Stuff on the schedule: Dynamic recompilation? I'm still thinking about this, perhaps translation to a portable VM like the JavaVM would be a better idea. The current JavaVM implementations available to me (and most other people) suck, though. Translation also requires many more modifications to the TOS used. I'll be putting snapshots of versions under development in this place, so that you can see what's happening. These versions will be broken most of the time, sometimes they may even fail to compile. Don't despair; if you think you can fix portability problems with these versions, let me know. For other problems, please wait until a new "release" is made available, which should be more usable. As of pre-release version 0.6.7-delta, I recommend using this instead of the "release" versions; it is more stable, bug-free (several emulation bugs are gone again!) but not tested enough to replace 0.6.5 completely. A discussion forum using HyperNews has been set up at http://kali.vbs.at/hn/. It is still in testing stage and the connection is slow, so please be careful with it. If this works, it may become a very useful source of information about STonX. | Mid | [
0.558241758241758,
31.75,
25.125
] |
1. Field of Invention This invention relates to a method of processing a workpiece in a chamber. 2. Background of Invention There are nowadays many manufacturing techniques in which workpieces are treated using a first gas or gas combination, in which at least one of the gases is reactive, and then the workpiece is subjected to a second process. In many cases, both for chemical and processing reasons and for workpiece throughput reasons, it is desirable to perform the second process in the same chamber as the first, often without the chamber being exposed to atmosphere. In such circumstances a reactive gas can become absorbed on or linger in those parts of the gas delivery system and can become active during the second process, particularly if it is an energetic process, such as a plasma process. In those circumstances if, for example, the first process is a deposition process, then additional deposition may take place during the second process resulting in over thick films and loss of uniformity. One example of such a multi-step process is the deposition of thin layers, e.g. TiN using a metal organic chemical vapour deposition (MOCVD) vapour such as Tetrakis (Diethylamido) Titanium (TDEAT) and NH3 as precursors. Such a process is described in detail in U.S. Pat. No. 5,139,825, which incorporated herein by reference. The main application of such TiN films is to coat high aspect ratio feature devices, such as trenches and contact structures on wafers containing microelectronic devices. For example TiN is used as a liner between Ti and WF6 during W plug formation. The TiN liner prevents an adverse reaction that occurs between Ti and WF6, thus allowing formation of a pure W plug in the contact. In order to prevent any intermixing of the reactants prior to entering the chamber, and hence preventing the unwanted deposition within the gas supply lines, it is typical to have the reactive gases entering from different inlets, such as via a dual port showerhead. It is important that there is a continuous coating of TiN and preferably this coating should be as conformal as possible. The coatings are typically less than 15 nm in thickness with some manufactures using as little as 5 nm. This thickness is likely to reduce even further as microchip critical dimensions decrease. Such thin coatings require very little process gas. It has been found that TiN deposited using these or similar precursors are prone to absorbing oxygen and moisture on exposure to atmospheres and that a subsequent in situ H2/N2 plasma treatment of the film reduces oxygen uptake, increases density and makes the fill resistivity more stable and improves the line of properties of the TiN. The plasma treatment has to be performed without a wafer breaking vacuum and this is an example of a case where it is advantageous to be able to deposit a plasma treat in the same process chamber. In unpublished work the Applicants have determined experimentally that TiN deposition can occur during the subsequent in situ H2/N2 plasma step thus increasing the film thickness. This is reported more fully below. Current teaching would suggest that in order to overcome the problem that the Applicants have identified, one should pump or gas purge the TDEAT line after deposition, for example using the kind of arrangement described in U.S. Pat. No. 5,772,771. However, the Applicants have determined, in unpublished work, that TDEAT confirmly decompose in an uncontrolled manner on the wafer surface during purging and that purging takes in excess of several minutes which will impact wafer throughput. | Mid | [
0.588914549653579,
31.875,
22.25
] |
The Eagles are in the market for cornerbacks via free agency and the draft. The addition of two new corners is more than likely set to take place during the offseason. While big names such as A.J. Bouye and Stephon Gilmore are being thrown around as potential targets for Philadelphia, a more sensible approach is to acquire a quality player without breaking the bank. The Jaguars have a new coaching staff in place which means there will be a new defensive scheme. As a result, former starting cornerback Davon House is being shopped by Jacksonville according to NFL Network’s Ian Rapaport. Jacksonville signed House to a four-year, $24.5 million contract in 2015. House paid immediate dividends by registering four interceptions and 23 pass breakups. The Jaguars are set to release House if they can not trade him. House has a $6 million cap number in each of the next two seasons but can be released without penalty. Related Middle Tennessee State CB Jeremy Cutrer could be a surprise day 2 pick The veteran corner was originally drafted by the Packers in the fourth round (No.131) of the 2011 NFL Draft. House is an aggressive press corner that would fit what the Eagles want their corners to do on an island in Jim Schwartz’s defense. Philadelphia has nine picks in the 2017 NFL Draft. They will likely use two picks to help their secondary. It would be wise for Howie Roseman and the Eagles staff to inquire about House as an option for a future conditional pick. | Mid | [
0.64203233256351,
34.75,
19.375
] |
using System.ComponentModel; namespace Microsoft.PowerApps.Tools.AppMerger { public class EntityModel : INotifyPropertyChanged { #region private private bool _isSelected = true; private bool _isNew = false; public event PropertyChangedEventHandler PropertyChanged; #endregion private #region Properties public bool IsSelected { get { return _isSelected; } set { this._isSelected = value; this.RaisePropertyChanged("IsSelected"); } } public bool IsNew { get { return _isNew; } set { this._isNew = value; this.RaisePropertyChanged("IsNew"); } } public string Screen { get; set; } public string Source { get; set; } #endregion Properties #region Methods private void RaisePropertyChanged(string propertyName) { // take a copy to prevent thread issues PropertyChangedEventHandler handler = PropertyChanged; if (handler != null) { handler(this, new PropertyChangedEventArgs(propertyName)); } } #endregion Methods } } | High | [
0.663072776280323,
30.75,
15.625
] |
We couldn't find anything matching the term "the heartbreaking story of how one man spent 12000 on final fantasy and nearly lost his family" on Kotaku You can try expanding your search to all G/O Media sites | Low | [
0.46472019464720105,
23.875,
27.5
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.