text
stringlengths 8
5.74M
| label
stringclasses 3
values | educational_prob
sequencelengths 3
3
|
|---|---|---|
1. Field of the Invention The present invention relates to a contact image-sensing module, and more particularly, to a contact image-sensing module having a fingerprint-scanning function. 2. Description of the Prior Art An individual's fingerprint is unique, and thus has gradually become one viable option with higher security protection when serving as the individual's password. Along with the popularity of electronic devices and the increase in storage volume thereof, protection of the personal information stored therein against unauthorized invasion becomes more and more important. As the result, having the individual's fingerprint serve as the password for use of electronic devices is becoming a more effective way of protecting personal information from unauthorized use. Reference is made to FIG. 1, which shows a schematic, cross-sectional view of a prior art image-sensing module with fingerprint scanning function. The image-sensing module includes a rigid circuit substrate 71, a linear sensing element array 72, a plurality of light sources 73, a focusing device 74, and a light penetrating device 75. The linear element array 72 and light sources 73 are located on the rigid circuit substrate 71. The light penetrating device 75 is for placing a fingerprint 9 thereon. Light emitted from the light source 73 travels upwardly to the light penetrating device 75 and is reflected to the focusing device 74 by the fingerprint 9. The focusing device 74 focuses the light upon the linear sensing element array 72, which further processes the light in order to finish the fingerprint authorization task. However, having the linear sensing element array 72 and light sources 73 on the rigid circuit substrate 71 leads to a bigger image-sensing module, contrary to current trends of increasingly minimized electronic devices. Additionally, the focusing device 74 has to be appropriately positioned somewhere so as to have the light travel to the linear sensing element array 72, leaving less room for positioning error and demanding higher assembly accuracy, both of which seriously and negatively affect the product yield. Reference is made to FIG. 2, which is a schematic, cross-sectional view along the line 2-2 of the prior art image-sensing module shown in FIG. 1. Light sources 73 are placed under the light penetrating device 75. However, the light intensity of these light sources 73 projecting upon the light penetrating device 75 is not uniform, leading to a more complicated fingerprint image processing and thus undermining the processing efficiency. Furthermore, because of the use of a large number of light sources, the power consumption increases and shortens the lifetime of the whole image-sensing module. | Mid | [
0.586497890295358,
34.75,
24.5
] |
SON Dakika Köse:\"We Need to Make \" Regional Amateur Group 8 winner Aydin derby played with the FC lost 2-1 to Valens İncirliova Belediyespor'da experiencing great happiness . Aydın news: Photo green-white team's manager you are Kose, back stating that they never be out of the game despite the fall , \"We got a nice win. He did what our football . We are pleased to have won. We believe we broke the misfortune above us ,\"he said . of İncirliova match for themselves league Kose outline to the return match , \"We have a very important match we play with Balikesir BSB . I believe we will win if we get to the level of this match ,\"he said . | Mid | [
0.6024691358024691,
30.5,
20.125
] |
Cost of inappropriate use of ciprofloxacin in ambulatory care. To determine the incidence of inappropriate ciprofloxacin use and the resulting cost thereof in ambulatory care. Retrospective cost analysis. Ambulatory care clinic of a Department of Veterans Affairs Medical Center. One hundred thirty-seven ambulatory patients prescribed ciprofloxacin during March, April, and May 1992. Forty-six patient charts were available for review. Indications for ciprofloxacin use were determined from chart review. Chart review of 46 of the 137 patients prescribed ciprofloxacin during the three-month study period indicated that only 8 (17 percent) had infections that were appropriately treated with this antibiotic. If 550 patients had received ciprofloxacin that year (figure extrapolated from the three-month totals), the cost of prescribing would have been $29,260. This study indicates that $20,500 per year could be saved by prescribing equally efficacious oral antibiotics. Restricting ciprofloxacin use to its proven indications in the ambulatory setting may result in considerable cost savings to medical centers. | Mid | [
0.640915593705293,
28,
15.6875
] |
The Backcountry Inn- 10 comfortable, modern rooms and 3 extended-stay residences, all include a flat-screen TV, mini-fridge, microwave, coffee-maker, phone and air-conditioning located about 33 miles from downtown Telluride. | Low | [
0.42403628117913805,
23.375,
31.75
] |
// Mantid Repository : https://github.com/mantidproject/mantid // // Copyright © 2018 ISIS Rutherford Appleton Laboratory UKRI, // NScD Oak Ridge National Laboratory, European Spallation Source, // Institut Laue - Langevin & CSNS, Institute of High Energy Physics, CAS // SPDX - License - Identifier: GPL - 3.0 + #pragma once #include <cxxtest/TestSuite.h> #include "MantidCrystal/FindSXPeaksHelper.h" #include "MantidKernel/ProgressBase.h" #include "MantidKernel/WarningSuppressions.h" #include "MantidTestHelpers/WorkspaceCreationHelper.h" #include <gmock/gmock.h> #include <string> using namespace Mantid::Crystal::FindSXPeaksHelper; using namespace testing; namespace { GNU_DIAG_OFF_SUGGEST_OVERRIDE class MockProgressBase : public Mantid::Kernel::ProgressBase { public: MOCK_METHOD1(doReport, void(const std::string &)); }; GNU_DIAG_ON_SUGGEST_OVERRIDE } // namespace class FindSXPeaksHelperTest : public CxxTest::TestSuite { public: // This pair of boilerplate methods prevent the suite being created statically // This means the constructor isn't called when running other tests static FindSXPeaksHelperTest *createSuite() { return new FindSXPeaksHelperTest(); } static void destroySuite(FindSXPeaksHelperTest *suite) { delete suite; } /* ------------------------------------------------------------------------------------------ * Single Crystal peak representation * ------------------------------------------------------------------------------------------ */ // Test out of bounds constuction arguments void testSXPeakConstructorThrowsIfNegativeIntensity() { auto workspace = WorkspaceCreationHelper::create2DWorkspaceWithFullInstrument(10, 10); const auto &spectrumInfo = workspace->spectrumInfo(); double intensity = -1; // Negative intensity. std::vector<int> spectra(1, 1); TSM_ASSERT_THROWS("SXPeak: Should not construct with a negative intensity", SXPeak(0.001, 0.02, intensity, spectra, 0, spectrumInfo), const std::invalid_argument &); } // Test out of bounds construction arguments. void testSXPeakConstructorThrowsIfSpectraSizeZero() { auto workspace = WorkspaceCreationHelper::create2DWorkspaceWithFullInstrument(10, 10); const auto &spectrumInfo = workspace->spectrumInfo(); double intensity = 1; std::vector<int> spectra; // Zero size spectra list TSM_ASSERT_THROWS( "SXPeak: Should not construct with a zero size specral list", SXPeak(0.001, 0.02, intensity, spectra, 0, spectrumInfo), const std::invalid_argument &); } void testSXPeakGetters() { auto workspace = WorkspaceCreationHelper::create2DWorkspaceWithFullInstrument(10, 10); const auto &spectrumInfo = workspace->spectrumInfo(); double intensity = 1; std::vector<int> spectra(1, 1); SXPeak peak(0.001, 0.02, intensity, spectra, 1, spectrumInfo); TSM_ASSERT_EQUALS("Intensity getter is not wired-up correctly", 1, peak.getIntensity()); TSM_ASSERT_EQUALS("Detector Id getter is not wired-up correctly", 2, peak.getDetectorId()); } /* ------------------------------------------------------------------------------------------ * Background Strategy * ------------------------------------------------------------------------------------------ */ void testThatAbsoluteBackgroundPerformsRightComparison() { // GIVEN auto workspace = WorkspaceCreationHelper::create1DWorkspaceConstant( 10 /*size*/, 1.5 /*value*/, 1. /*error*/, true /*isHisto*/); const auto &y = workspace->y(0); // WHEN auto backgroundStrategy = AbsoluteBackgroundStrategy(2.); // THEN TSM_ASSERT("The intensity should be below the background", backgroundStrategy.isBelowBackground(1., y)); TSM_ASSERT("The intensity should be above the background", !backgroundStrategy.isBelowBackground(2., y)); } void testThatPerSpectrumBackgroundStrategyPerformsRightComparison() { // GIVEN auto workspace = WorkspaceCreationHelper::create1DWorkspaceConstant( 10 /*size*/, 1.5 /*value*/, 1. /*error*/, true /*isHisto*/); const auto &y = workspace->y(0); // WHEN auto backgroundStrategy = PerSpectrumBackgroundStrategy(1.); // THEN TSM_ASSERT("The intensity should be below the background", backgroundStrategy.isBelowBackground(1., y)); TSM_ASSERT("The intensity should be above the background", !backgroundStrategy.isBelowBackground(2., y)); } /* ------------------------------------------------------------------------------------------ * Peak Finding strategy * ------------------------------------------------------------------------------------------ */ void testThatFindsStrongestPeakWhenPerSpectrumBackgroundStrategyIsUsed() { auto backgroundStrategy = std::make_unique<PerSpectrumBackgroundStrategy>(1.); doRunStrongestPeakTest(backgroundStrategy.get()); } void testThatFindsStrongestPeakWhenAbsoluteBackgroundStrategyIsUsed() { auto backgroundStrategy = std::make_unique<AbsoluteBackgroundStrategy>(3.); doRunStrongestPeakTest(backgroundStrategy.get()); } void testThatFindsAllPeaksWhenAbsoluteBackgroundStrategyIsUsed() { // GIVEN auto backgroundStrategy = std::make_unique<AbsoluteBackgroundStrategy>(3.); auto workspace = WorkspaceCreationHelper::create2DWorkspaceWithFullInstrument( 1 /*nhist*/, 15 /*nbins*/); auto &mutableY = workspace->mutableY(0); doAddDoublePeakToData(mutableY); const int workspaceIndex = 0; const auto &x = workspace->x(0); const auto &y = workspace->y(0); const auto &spectrumInfo = workspace->spectrumInfo(); // WHEN auto peakFindingStrategy = std::make_unique<AllPeaksStrategy>( backgroundStrategy.get(), spectrumInfo); auto peaks = peakFindingStrategy->findSXPeaks(x, y, workspaceIndex); // THEN TSM_ASSERT("There should be two peaks that are found.", peaks.get().size() == 2); TSM_ASSERT("The first peak should have a signal value of 7.", peaks.get()[0].getIntensity() == 7.); TSM_ASSERT("The second peak should have a signal value of 11.", peaks.get()[1].getIntensity() == 11.); } void testThatThrowsWhenBackgroundStrategyIsNotAbsoluteBackgroundStrategyWhenUsingAllPeaksStrategy() { // Note that the AllPeaksStrategy is currently only supporting the absolute // background strategy // GIVEN auto backgroundStrategy = std::make_unique<PerSpectrumBackgroundStrategy>(3.); auto workspace = WorkspaceCreationHelper::create2DWorkspaceWithFullInstrument( 1 /*nhist*/, 15 /*nbins*/); const auto &spectrumInfo = workspace->spectrumInfo(); // WHEN + THEN TSM_ASSERT_THROWS("Should throw a invalid argument error when background " "strategy is not AbsoluteBackgroundStrategy", AllPeaksStrategy(backgroundStrategy.get(), spectrumInfo); , const std::invalid_argument &); } void testThatCanReduceWithSimpleReduceStrategy() { // GIVEN auto workspace = WorkspaceCreationHelper::create2DWorkspaceWithFullInstrument(10, 10); const auto &spectrumInfo = workspace->spectrumInfo(); const auto resolution = 0.001; auto compareStrategy = std::make_unique<RelativeCompareStrategy>(resolution); auto simpleStrategy = std::make_unique<SimpleReduceStrategy>(compareStrategy.get()); std::vector<SXPeak> peaks; peaks.emplace_back(1 /*TOF*/, 1 /*phi*/, 0.1 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); peaks.emplace_back(1 /*TOF*/, 1 /*phi*/, 0.2 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); peaks.emplace_back(1 /*TOF*/, 1.1 /*phi*/, 0.3 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); peaks.emplace_back(1 /*TOF*/, 1.1001 /*phi*/, 0.4 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); peaks.emplace_back(3 /*TOF*/, 2 /*phi*/, 0.5 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); peaks.emplace_back(3 /*TOF*/, 2.0001 /*phi*/, 0.6 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); PeakList peakList = peaks; NiceMock<MockProgressBase> progress; EXPECT_CALL(progress, doReport(_)) .Times(0); // We only report if there are more than 50 peaks // WHEN auto reducedPeaks = simpleStrategy->reduce(peakList.get(), progress); // THEN const double tolerance = 1e-6; TSM_ASSERT("Should have three peaks", reducedPeaks.size() == 3); TSM_ASSERT("Should have a value of 0.1 + 0.2 = 0.3", std::abs(reducedPeaks[0].getIntensity() - 0.3) < tolerance); TSM_ASSERT("Should have a value of 0.3 + 0.4 = 0.7", std::abs(reducedPeaks[1].getIntensity() - 0.7) < tolerance); TSM_ASSERT("Should have a value of 0.5 + 0.6 = 01.1", std::abs(reducedPeaks[2].getIntensity() - 1.1) < tolerance); TS_ASSERT(Mock::VerifyAndClearExpectations(&progress)); } void testThatCanReduceWithFindMaxReduceStrategy() { // GIVEN auto workspace = WorkspaceCreationHelper::create2DWorkspaceWithFullInstrument(10, 10); const auto &spectrumInfo = workspace->spectrumInfo(); const auto resolution = 0.001; auto compareStrategy = std::make_unique<RelativeCompareStrategy>(resolution); auto findMaxReduceStrategy = std::make_unique<FindMaxReduceStrategy>(compareStrategy.get()); std::vector<SXPeak> peaks; peaks.emplace_back(1 /*TOF*/, 0.99 /*phi*/, 0.1 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); peaks.emplace_back(1 /*TOF*/, 0.99 /*phi*/, 0.2 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); peaks.emplace_back(1 /*TOF*/, 1.1 /*phi*/, 0.3 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); peaks.emplace_back(1 /*TOF*/, 1.1001 /*phi*/, 0.4 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); peaks.emplace_back(3 /*TOF*/, 2 /*phi*/, 0.5 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); peaks.emplace_back(3 /*TOF*/, 2.0001 /*phi*/, 0.6 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); PeakList peakList = peaks; NiceMock<MockProgressBase> progress; EXPECT_CALL(progress, doReport(_)) .Times(0); // We only report if there are more than 50 peaks // WHEN const auto reducedPeaks = findMaxReduceStrategy->reduce(peakList.get(), progress); // THEN const double tolerance = 1e-6; TSM_ASSERT("Should have three peaks", reducedPeaks.size() == 3); TSM_ASSERT("Should have a value of max(0.1, 0.2) = 0.2", std::abs(reducedPeaks[0].getIntensity() - 0.2) < tolerance); TSM_ASSERT("Should have a value of max(0.1, 0.2) = 0.2", std::abs(reducedPeaks[1].getIntensity() - 0.4) < tolerance); TSM_ASSERT("Should have a value of max(0.1, 0.2) = 0.2", std::abs(reducedPeaks[2].getIntensity() - 0.6) < tolerance); TS_ASSERT(Mock::VerifyAndClearExpectations(&progress)); } /* ------------------------------------------------------------------------------------------ * Comparison Strategy * ------------------------------------------------------------------------------------------ */ void testThatRelativeComparisonWorks() { // GIVEN auto workspace = WorkspaceCreationHelper::create2DWorkspaceWithFullInstrument(2, 2); const auto &spectrumInfo = workspace->spectrumInfo(); SXPeak peak1(1. /*TOF*/, 0.99 /*phi*/, 0.1 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); SXPeak peak2(1. /*TOF*/, 0.90 /*phi*/, 0.1 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); SXPeak peak3(1. /*TOF*/, 1.99 /*phi*/, 0.1 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); const auto resolution = 0.1; auto compareStrategy = std::make_unique<RelativeCompareStrategy>(resolution); // WHEN auto result12 = compareStrategy->compare(peak1, peak2); auto result13 = compareStrategy->compare(peak1, peak3); // THEN TSM_ASSERT("The peaks should be the same", result12) TSM_ASSERT("The peaks should not be the same", !result13) } void testThatAbsoluteComparisonWorks() { // GIVEN auto workspace = WorkspaceCreationHelper::create2DWorkspaceWithFullInstrument(2, 2); const auto &spectrumInfo = workspace->spectrumInfo(); const double degreeToRad = M_PI / 180.; SXPeak peak1(1. /*TOF*/, degreeToRad /*phi*/, 0.1 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); SXPeak peak2(1.5 /*TOF*/, degreeToRad /*phi*/, 0.1 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); SXPeak peak3(3. /*TOF*/, degreeToRad /*phi*/, 0.1 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); SXPeak peak4(1. /*TOF*/, degreeToRad /*phi*/, 0.1 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); SXPeak peak5(1. /*TOF*/, 1.5 * degreeToRad /*phi*/, 0.1 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); SXPeak peak6(1. /*TOF*/, 3. * degreeToRad /*phi*/, 0.1 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); const auto tofResolution = 1.; const auto thetaResolution = 1.; const auto phiResolution = 1.; auto compareStrategy = std::make_unique<AbsoluteCompareStrategy>( tofResolution, thetaResolution, phiResolution); // WHEN auto result12 = compareStrategy->compare(peak1, peak2); auto result13 = compareStrategy->compare(peak1, peak3); auto result45 = compareStrategy->compare(peak4, peak5); auto result46 = compareStrategy->compare(peak4, peak6); // THEN TSM_ASSERT("The peaks should be the same", result12) TSM_ASSERT("The peaks should not be the same", !result13) TSM_ASSERT("The peaks should be the same", result45) TSM_ASSERT("The peaks should not be the same", !result46) } void testGivenWorkspaceInDSpacingWhenAbsoluteComparisonThatCorrectNumberOfPeaks() { // GIVEN auto workspace = WorkspaceCreationHelper::create2DWorkspaceWithFullInstrument(2, 2); const auto &spectrumInfo = workspace->spectrumInfo(); constexpr double degreeToRad = M_PI / 180.; SXPeak peak1(1. /*TOF*/, degreeToRad /*phi*/, 0.1 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); SXPeak peak2(1.5 /*TOF*/, degreeToRad /*phi*/, 0.1 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); SXPeak peak3(3. /*TOF*/, degreeToRad /*phi*/, 0.1 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); SXPeak peak4(1. /*TOF*/, degreeToRad /*phi*/, 0.1 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); SXPeak peak5(1. /*TOF*/, 1.5 * degreeToRad /*phi*/, 0.1 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); SXPeak peak6(1. /*TOF*/, 3. * degreeToRad /*phi*/, 0.1 /*intensity*/, std::vector<int>(1, 1), 1, spectrumInfo); const auto dResolution = 0.01; const auto thetaResolution = 1.; const auto phiResolution = 1.; auto compareStrategy = std::make_unique<AbsoluteCompareStrategy>( dResolution, thetaResolution, phiResolution, XAxisUnit::DSPACING); // WHEN auto result12 = compareStrategy->compare(peak1, peak2); auto result13 = compareStrategy->compare(peak1, peak3); auto result45 = compareStrategy->compare(peak4, peak5); auto result46 = compareStrategy->compare(peak4, peak6); // THEN TSM_ASSERT("The peaks should be the same", result12) TSM_ASSERT("The peaks should not be the same", !result13) TSM_ASSERT("The peaks should be the same", result45) TSM_ASSERT("The peaks should not be the same", !result46) } private: void doRunStrongestPeakTest(BackgroundStrategy *backgroundStrategy) { // GIVEN auto workspace = WorkspaceCreationHelper::create2DWorkspaceWithFullInstrument( 1 /*nhist*/, 15 /*nbins*/); auto &mutableY = workspace->mutableY(0); doAddDoublePeakToData(mutableY); const int workspaceIndex = 0; const auto &x = workspace->x(0); const auto &y = workspace->y(0); const auto &spectrumInfo = workspace->spectrumInfo(); // WHEN auto peakFindingStrategy = std::make_unique<StrongestPeaksStrategy>( backgroundStrategy, spectrumInfo); auto peaks = peakFindingStrategy->findSXPeaks(x, y, workspaceIndex); // THEN TSM_ASSERT("There should only be one peak that is found.", peaks.get().size() == 1); TSM_ASSERT("The peak should have a signal value of 11.", peaks.get()[0].getIntensity() == 11.); } void doAddDoublePeakToData(Mantid::HistogramData::HistogramY &y) { std::vector<double> newDataValues = {1.5, 1.5, 3.0, 5.0, 7.0, 4.0, 1.5, 1.5, 1.5, 6.0, 9.0, 11.0, 2.5, 1.5, 1.5}; if (y.size() != newDataValues.size()) { throw std::runtime_error( "The data sizes don't match. This is a test setup issue. " "Make sure there is one fake data point per entry in the histogram."); } for (size_t index = 0; index < y.size(); ++index) { y[index] = newDataValues[index]; } } }; | Mid | [
0.6041666666666661,
36.25,
23.75
] |
WMED WMED may refer to: WMED (FM), a radio station (89.7 FM) licensed to Calais, Maine, United States WMED-TV, a television station (channel 13) licensed to Calais, Maine, United States | Low | [
0.44949494949494906,
22.25,
27.25
] |
Q: How to deform a 2d shape to make a 3d object? I have a 2d flat mesh that i would like to manipulate without any distortion to create a 3D shape. Typically for the pie below, joining the 2 edges together would make a 3D cone. Do you have any idea of which modifier to use ? A: Using a script to make the two shape keys. Change the r and h of result cone. Example of radius 1, height 2, 1 and 0.5 cones. import bpy import bmesh from mathutils import Vector from math import radians, sin, cos, sqrt from bpy import context # for testing r = 1 # radius of cone h = 1 # height of cone sectors = 16 l = sqrt(r**2 + h**2) # hypotenuse # sector will have angle theta = radians(360) * r / l dtheta = theta / sectors # build the base bm = bmesh.new() verts = [] for i in range(sectors + 1): a = i * dtheta verts.append(bm.verts.new((l * cos(a), l * sin(a), 0))) topvert = bm.verts.new((0, 0, 0)) for i in range(sectors): bm.faces.new([verts[i + 1], topvert, verts[i]]) cone_mesh = bpy.data.meshes.new("Cone") cone = bpy.data.objects.new("Cone", cone_mesh) bm.to_mesh(cone_mesh) # add base as basis shape key basis_shape_key = cone.shape_key_add("Basis") # add second shape key cone_shape_key = cone.shape_key_add("Cone") offset = (radians(360) - theta) / 2 dtheta = radians(360) / sectors for v in verts: a = v.index * dtheta - offset cone_shape_key.data[v.index].co = ((r * cos(a), r * sin(a), 0)) cone_shape_key.data[topvert.index].co = (0, 0, h) # link to scene scene = context.scene scene.objects.link(cone) scene.objects.active = cone cone.select = True A: Managed to approximate this with Shape Keys, starting out with a cone, it's easier than starting out with a flat shape and bending it into your will. Add a cone mesh with whatever final dimensions you want it to have Move it in edit mode so it's center is on the center of the base (not mid height) Erase the left part and the bottom face and then add a Mirror modifier Add two new shape keys one is the base as it currently is, and another (Key 1) will be it's flat shape. Now some math, in edit mode check the length of one of the cone large side edges with the 3D view > Properties Region > Mesh Display > Length that will determine the radius of the final flat shape Add a new mesh circle object, it's radius should be the length of the previously measured edge, and it the number radius vertices should be 1 1/4 the number of vertices of the cone. So if by default a cone has 32 vertex so the circle should have 1.25 x 32 = 40 vertices. Erase one quarter of the circle's edges so that they are centered around the edge you ripped in Step 3 Now with shape Key 1 selected enter edit mode on the cone, move the central vertex down until it is flat Scale all the vertex in the cone base so that they reach the circle radius (use snap for better precision) Press .(Period Key) to transform centered in 3D Cursor Hide all the cone vertex but the outer rim of the base, including the vertex at X=0 With Proportional Edit set to Connected and the Fallof type set to Linear, select only the lower vertex and rotate them all 1/8 of a turn, so they snap to the open end of the circle. Adjust the Proportional Edit radius with the mouse wheel. 13.Profit! (Adjust progression with the shapekey Value Slider) You may then give it a more natural or organic looking transition with some modifiers or with manually bending the shape a little with more shapekeys | Mid | [
0.630136986301369,
25.875,
15.1875
] |
Extracellular terbium and divalent cation effects on the red blood cell Na pump and chrysoidine effects on the renal Na pump. We examined the effect of extracellular terbium (Tb(3+)) and divalent metal cations (Ca(2+), Sr(2+), and Ba(2+)) on (86)Rb(+) influx into rabbit and human red blood cells. We found that Tb(3+) at 15 and 25 microM was a non-competitive inhibitor of (86)Rb(+) influx suggesting that Tb(3+) is not binding to the transport site. This result reduces the usefulness of Tb(3+) as a potential probe for the E(out) conformation (the conformation with the transport site facing extracellularly). Ba(2+), Sr(2+) and Ca(2+), at concentrations >50 mM, had minimal effects on Rb(+) influx into red blood cells (1 mM Rb-out). This suggests that the outside transport site is very specific for monovalent cations over divalent cations, in contrast to the inside transport site. We also found that chrysoidine (4-phenylazo-m-phenylenediamine) competes with Na(+) for ATPase activity and K(+) for pNPPase activity suggesting it is binding to the E(in) conformation. Chrysoidine and similar compounds may be useful as optical probes of the E(in) conformation. | Mid | [
0.587912087912087,
26.75,
18.75
] |
@echo off echo "Started..." mkdir app\src\main\jniLibs\armeabi DEL /F /Q app\src\main\jniLibs\armeabi\libtox4j.so echo "Removed old version: libtox4j.so" echo "Downloading latest version: libtox4j.so" powershell -Command "(New-Object Net.WebClient).DownloadFile('https://build.tox.chat/job/tox4j_build_android_arm_release/lastSuccessfulBuild/artifact/artifacts/armeabi/libtox4j.so', 'app\src\main\jniLibs\armeabi\libtox4j.so')" echo "Downloaded." mkdir app\libs DEL /F /Q app\libs\tox4j_2.11.jar echo "Removed old version: tox4j_2.11.jar" echo "Downloading latest version: tox4j_2.11.jar" powershell -Command "(New-Object Net.WebClient).DownloadFile('https://build.tox.chat/job/tox4j_build_android_arm_release/lastSuccessfulBuild/artifact/artifacts/tox4j_2.11-0.1-SNAPSHOT.jar', 'app\libs\tox4j_2.11.jar')" echo "Downloaded." DEL /F /Q app\libs\protobuf-java-2.6.1.jar echo "Removed old version: protobuf-java-2.6.1.jar" echo "Downloading latest version: protobuf-java-2.6.1.jar" powershell -Command "(New-Object Net.WebClient).DownloadFile('https://build.tox.chat/job/tox4j_build_android_arm_release/lastSuccessfulBuild/artifact/artifacts/protobuf.jar', 'app\libs\protobuf-java-2.6.1.jar')" echo "Downloaded." echo "...Finished!" @echo ON | Mid | [
0.622222222222222,
35,
21.25
] |
Portugal face Chile in their Confederations Cup semi-final on Wednesday night It will see Portugal's Cristiano Ronaldo go head-to-head with Chile's Arturo Vidal In April, Bayern Munich's Vidal was sent off against Ronaldo's Real Madrid Vidal has hit out at 'smart a**' Ronaldo, insisting that he 'doesn't exist' to him Chile talisman Arturo Vidal has condemned Portugal captain Cristiano Ronaldo ahead of the two sides coming together on Wednesday. The South American Copa America winners take on their European Euro 2016 counterparts at the Kazan Arena in the Confederations Cup semi-final, held in Russia. ADVERTISEMENT And ahead of that match, Vidal has blasted Portugal's No 7 as a 'smart a**' and even predicted that Chile will bypass them en-route to facing Germany in Sunday's final - despite the World Cup winners having to play Mexico in Thursday's other semi-final. Cristiano Ronaldo has come under attack from Arturo Vidal ahead of Wednesday's encounter The Portugal captain has been blasted as a 'smart a**' ahead of their Confederations Cup semi Vidal will hope to back up his words when Chile take them on at the Kazan Arena in Russia He also predicted too that he will face Germany's Joshua Kimmich (right) in Sunday's final Click here to resize this module Chile earned a spot in the knockout stages by finishing second in Group B, behind the Germans while Ronaldo led Portugal to top of Group A ahead of Mexico. Ronaldo has scored twice and set up another for Fernando Santos' side but that hasn't impressed Vidal. 'Cristiano is a smart a**!' Vidal told reporters in Russia. 'For me he does not exist. 'I have already told my Bayern Munich team-mate [and Germany international] Joshua Kimmich that we will meet again in the final!' Show Player Vidal's encounter with Ronaldo will be he his first since April when the former was sent off for Bayern Munich as they were knocked out in the Champions League quarter-finals by eventual winners Real Madrid. | Mid | [
0.5383022774327121,
32.5,
27.875
] |
--- abstract: 'In this paper we report on results of our investigation into the algebraic structure supported by the combinatorial geometry of the cyclohedron. Our new graded algebra structures lie between two well known Hopf algebras: the Malvenuto-Reutenauer algebra of permutations and the Loday-Ronco algebra of binary trees. Connecting algebra maps arise from a new generalization of the Tonks projection from the permutohedron to the associahedron, which we discover via the viewpoint of the graph associahedra of Carr and Devadoss. At the same time, that viewpoint allows exciting geometrical insights into the multiplicative structure of the algebras involved. Extending the Tonks projection also reveals a new graded algebra structure on the simplices. Finally this latter is extended to a new graded Hopf algebra (one-sided) with basis all the faces of the simplices.' address: 'S. Forcey: Tennessee State University, Nashville, TN 37209' author: - Stefan Forcey - Derriell Springfield bibliography: - 'mybib.bib' title: 'Geometric combinatorial algebras: cyclohedron and simplex' --- ¶[P]{} \[thm\][Proposition]{} \[thm\][Lemma]{} \[thm\][Corollary]{} \[thm\][Question]{} \[thm\][Conjecture]{} \[thm\][Definition]{} \[thm\][Example]{} \[thm\][Remark]{} Introduction ============ Background: Polytope algebras ----------------------------- In 1998 Loday and Ronco found an intriguing Hopf algebra of planar binary trees lying between the Malvenuto-Reutenauer Hopf algebra of permutations [@MR] and the Solomon descent algebra of Boolean subsets [@LR]. They also described natural Hopf algebra maps which neatly factor the descent map from permutations to Boolean subsets. Their first factor turns out to be the restriction (to vertices) of the Tonks projection from the permutohedron to the associahedron. Chapoton made sense of this latter fact when he found larger Hopf algebras based on the faces of the respective polytopes [@chap]. Here we study several new algebraic structures based on polytope sequences, including the cyclohedra, $\w_n,$ and the simplices, $\Delta^n$. In Figure \[f:cyc1\] we show the central polytopes, in three dimensions. ![The main characters, left to right: $\P_4, \w_4,$ ${\mathcal{K}}_4,$ and $\Delta^3.$ []{data-label="f:cyc1"}](polytrio_all_sm.eps){width="\textwidth"} We will be referring to the algebras and maps discussed in [@AS-LR] and [@AS-MR]. In these two papers, Aguiar and Sottile make powerful use of the weak order on the symmetric groups and the Tamari order on binary trees. By leveraging the Möbius function of these two lattices they provide clear descriptions of the antipodes and of the geometric underpinnings of the Hopf algebras. The also demonstrate cofreeness, characterize primitives of the coalgebras, and, in the case of binary trees, demonstrate equivalence to the non-commutative Connes-Kreimer Hopf algebra from renormalization theory. Here we generalize the well known algebras based on associahedra and permutohedra to new ones on cyclohedra and simplices. The cyclohedra underlie graded algebras, and the simplices underlie a new (one-sided) Hopf algebra. We leave for future investigation many potential algebras and coalgebras based on novel sequences of graph associahedra. The phenomenon of polytopes underlying Hopf structure may be rare, but algebras and coalgebras based on polytope faces are beginning to seem ubiquitous. There does exist a larger family of Hopf algebras to be uncovered in the structure of the polytope sequences derived from trees, including the multiplihedra, their quotients and their covers. These are studied in [@newFLS]. Background: Cyclohedra ---------------------- The cyclohedron $\mathcal{W}_n$ of dimension $n-1$ for $n$ a positive integer was originally developed by Bott and Taubes [@bott], and received its name from Stasheff. The name points out the close connection to Stasheff’s associahedra, which we denote ${\mathcal{K}}_n$ of dimension $n-1.$ The former authors described the facets of $\mathcal{W}_n$ as being indexed by subsets of $[n] = {1,2,\dots,n}$ of cardinality $\ge 2$ in cyclic order. Thus there are $n(n-1)$ facets. All the faces can be indexed by cyclic bracketings of the string $123\dots n$, where the facets have exactly one pair of brackets. The vertices are complete bracketings, enumerated by ${2(n-1) \choose n-1}.$ ![The cyclohedron $\w_3$ with various indexing.[]{data-label="f:indexing"}](wthree_sm.eps){width="\textwidth"} The space $\mathcal{W}_n \times S^1$, seen as the compactification of the configuration space of $n$ distinct points in ${{\mathbb R}}^3$ which are constrained to lie upon a given knot, is used to define new invariants which reflect the self linking of knots [@bott]. Since their inception the cyclohedra have proven to be useful in many other arenas. They provide an excellent example of a right operad module (over the operad of associahedra) as shown in [@markl]. Devadoss discovered a tiling of the $(n-1)$-torus by $(n-1)!$ copies of $\mathcal{W}_n$ in [@devspace]. Recently the cyclohedra have been used to look for the statistical signature of periodically expressed genes in the study of biological clocks [@morton]. The faces of the cyclohedra may also be indexed by the centrally symmetric subdivisions of a convex polygon of $2n$ sides, as discovered by Simion [@simion]. In this indexing the vertices are centrally symmetric triangulations, which allowed Hohlweg and Lange to develop geometric realizations of the cyclohedra as convex hulls [@hohl_lang]. This picture is related to the work of Fomin, Reading and Zelevinsky, who see the cyclohedra as a generalization of the associahedra corresponding to the $B_n$ Coxeter diagrams [@reading-camb]. From their perspective the face structure of the cyclohedron is determined by the sub-cluster structure of the generators of a finite cluster algebra. In contrast, for Devadoss the cyclohedra arise from truncating simplex faces corresponding to sub-diagrams of the $\tilde{A}_n$ Coxeter diagram, or cycle graph [@dev-carr]. In this paper we will work from the point of view taken by Devadoss and consider the faces as indexed by tubings of the cycle graph on $n$ vertices. Given a graph $G$, the *graph associahedron* ${{{\mathcal{K}}} G}$ is a convex polytope generalizing the associahedron, with a face poset based on the full connected subgraphs, or tubes of $G$. For instance, when $G$ is a path, a cycle, or a complete graph, ${{{\mathcal{K}}} G}$ results in the associahedron, cyclohedron, and permutohedron, respectively. In [@dev-real], a geometric realization of ${{{\mathcal{K}}} G}$ is given, constructing this polytope from truncations of the simplex. In [@dev-carr] the motivation for the development of ${{{\mathcal{K}}} G}$ is that it appears in tilings of minimal blow-ups of certain Coxeter complexes, which themselves are natural generalizations of the moduli spaces [${\overline{\mathcal M}}{_{0, n}({{\mathbb R}})}$]{}. The value of the graph associahedron to algebraists, as we hope to demonstrate here, is twofold. First, a unified description of so many combinatorial polytopes allows useful generalizations of the known algebraic structures on familiar polytope sequences. Second, the recursive structure described by Carr and Devadoss in a general way for graph associahedra turns out to lend new geometrical meaning to the graded algebra structures of both the Malvenuto-Reutenauer and Loday-Ronco algebras. The product of two vertices, from terms $P_i$ and $P_j$ of a given sequence of polytopes $\{P_n\}_{n=0}^{\infty}$, is described as a sum of vertices of the term $P_{i+j}$ to which the operands are mapped. The summed vertices in the product are the images of classical inclusion maps composed with our new extensions of the Tonks projection. ### Acknowledgements We would like to thank the referees for helping us make connections to other work, and for making some excellent suggestions about presentation of the main ideas. We also thank the following for tutorials and helpful conversations on the subject matter: Satyan Devadoss, Aaron Lauve, Maria Ronco and Frank Sottile. Summary ------- ### Notation The Hopf algebras of permutations, binary trees, and Boolean subsets are denoted respectively $\ssym, \ysym $ and $\qsym,$ as in [@AS-LR] and [@AS-MR]. Note that some of our sources, including Loday and Ronco’s original treatment of binary trees, actually deal with the dual graded algebras. The larger algebras of faces of permutohedra, associahedra and cubes are denoted $\tilde{\ssym}, \tilde{\ysym} $ and $\tilde{\qsym}.$The new algebras of cyclohedra vertices and faces are denoted $\wsym$ and $\tilde{\wsym}.$ The new algebra of vertices of the simplices is denoted $\dsym.$ Finally the new one-sided Hopf algebra of faces of the simplices is denoted $\tilde{\dsym}.$ Throughout there are three important maps we will use. First we see them as polytope maps: $\hat{\rho}$ is the inclusion of facets defined by Devadoss as a generalization of the recursive definitions of associahedra, simplices and permutohedra; $\eta$ is the projection from the polytope of a disconnected graph to its components; and $\Theta$ is the generalization of Tonks’s projection from the permutohedron to the associahedron. This last gives rise to maps $\hat{\Theta}$ which are algebra homomorphisms. ### Main Results In Theorem \[t:biggy\] we demonstrate that $\wsym$ is an associative graded algebra. In Theorem \[t:wface\] we extend this structure to the full poset of faces to describe the associative graded algebra $\tilde{\wsym}.$ In Theorem \[t:sim\] we demonstrate an associative graded algebra structure on $\dsym.$ In Theorem \[t:hopf\] we show how to extend this structure to become a new graded (one-sided) Hopf algebra $\tilde{\dsym},$ based upon all the faces of the simplices. Thus its graded dimension is $2^n$. Theorems \[t:geo\_pro\], \[r:geo\] and \[t:geochap\] and Remark \[r:geo\_cyc\] point out that the multiplications in all the algebras studied here can be understood in a unified way via the recursive structure of the face posets of associated polytopes. To summarize, the products can be seen as a process of projecting and including of faces, via $\Theta,\hat{\rho}$ and $\eta$. The algebras based on the permutohedron don’t use $\Theta$ or $\eta,$ and the algebras based on the simplices don’t use $\Theta,$ but otherwise the definitions will seem quite repetitive. We treat each definition separately to highlight those differences, but often the proofs of an early version will be referenced rather than repeated verbatim. The coproducts of $\ysym$ and $\ssym$ are also understandable as projections of the polytope geometry, as mentioned in Remarks \[r:geo\_cop\] and \[r:y\_cop\]. Before discussing algebraic structures, however, we build a geometric combinatorial foundation. We show precisely how the graph associahedra are all cellular quotients of the permutohedra (Lemma \[l:newtonks\]), and how the associahedron is a quotient of any given connected graph associahedron (Theorem \[t:ftonks\]). Results similar to these latter statements are implied by the work of Postnikov in [@post], and were also reportedly known to Tonks in the cases involving the cyclohedron [@dev-carr]. The various maps arising from factors of the Tonks projection are shown to be algebra homomorphisms in Theorems \[t:permhom\], \[t:whom\] and Lemma \[l:next\]. Corollary \[c:cool\] points out the implication of module structures on $\wsym$ over $\ssym$; and on $\ysym$ over $\wsym.$ ### Overview of subsequent sections Section \[s:defns\] describes the posets of connected subgraphs which are realized as the graph associahedra polytopes. We also review the cartesian product structure of their facets. Section \[s:tonks\] shows how the Tonks cellular projection from the permutohedron to the associahedron can be factored in multiple ways so that the intermediate polytopes are graph associahedra for connected graphs. We also show that the Tonks projection can be extended to cellular projections to the simplices, again in such a way that the intermediate polytopes are graph associahedra. In particular, we focus on a factorization of the Tonks projection which has the cyclohedron (cycle graph associahedra) as an intermediate quotient polytope between permutohedron and associahedron. In Section \[s:newview\] we use the viewpoint of graph associahedra to redescribe the products in $\ssym$ and $\ysym$, and to point out their geometric interpretation. The latter is based upon our new cellular projections as well as classical inclusions of (cartesian products of) low dimensional associahedra and permutohedra as faces in the higher dimensional polytopes of their respective sequences. In Section \[s:cyclo\] we begin our exploration of new graded algebras with the vertices of the cyclohedron. Then we show that the linear projections following from the factored Tonks projection (restricted to vertices) are algebra maps. We extend these findings in Section \[s:chap\] to the full algebras based on all the faces of the polytopes involved. Finally in Section \[s:simp\] we generalize our discoveries to the sequence of edgeless graph associahedra. This allows us to build a graded algebra based upon the vertices of the simplices. By carefully extending that structure to the faces of the simplices we find a new graded (one-sided) Hopf algebra, with graded dimension $2^n$. Review of some geometric combinatorics {#s:defns} ====================================== We begin with definitions of graph associahedra; the reader is encouraged to see [@dev-carr Section 1] and [@dev-forc] for further details. Let $G$ be a finite connected simple graph. A *tube* is a set of nodes of $G$ whose induced graph is a connected subgraph of $G$. Two tubes $u$ and $v$ may interact on the graph as follows: 1. Tubes are *nested* if $u \subset v$. 2. Tubes are *far apart* if $u \cup v$ is not a tube in $G,$ that is, the induced subgraph of the union is not connected, or none of the nodes of $u$ are adjacent to a node of $v$. Tubes are *compatible* if they are either nested or far apart. We call $G$ itself the *universal tube*. A *tubing* $U$ of $G$ is a set of tubes of $G$ such that every pair of tubes in $U$ is compatible; moreover, we force every tubing of $G$ to contain (by default) its universal tube. By the term $k$-*tubing* we refer to a tubing made up of $k$ tubes, for $k \in \{1,\dots,n\}.$ When $G$ is a disconnected graph with connected components $G_1$, …, $G_k$, an additional condition is needed: If $u_i$ is the tube of $G$ whose induced graph is $G_i$, then any tubing of $G$ cannot contain all of the tubes $\{u_1, \ldots, u_k\}$. However, the universal tube is still included despite being disconnected. Parts (a)-(c) of Figure \[f:legaltubing\] from [@dev-forc] show examples of allowable tubings, whereas (d)-(f) depict the forbidden ones. ![(a)-(c) Allowable tubings and (d)-(f) forbidden tubings, figure from [@dev-forc].[]{data-label="f:legaltubing"}](legaltubings_sm.eps){width="\textwidth"} \[t:graph\] For a graph $G$ with $n$ nodes, the *graph associahedron* ${{{\mathcal{K}}} G}$ is a simple, convex polytope of dimension $n-1$ whose face poset is isomorphic to the set of tubings of $G$, ordered by the relationship $U \prec U'$ if $U$ is obtained from $U'$ by adding tubes. \[d:pg\] The vertices of the graph associahedron are the $n$-tubings of $G.$ Faces of dimension $k$ are indexed by $(n-k)$-tubings of $G.$ In fact, the barycentric subdivision of ${\mathcal K}G$ is precisely the geometric realization of the described poset of tubings. Many of the face vectors of graph associahedra for path-like graphs have been found, as shown in [@post2]. This source also contains the face vectors for the cyclohedra. There are many open questions regarding formulas for the face vectors of graph associahedra for specific types of graphs. Figure \[f:kwexmp\], partly from [@dev-forc], shows two examples of graph associahedra. These have underlying graphs a path and a disconnected graph, respectively, with three nodes each. These turn out to be the 2 dimensional associahedron and a square. The case of a three node complete graph, which is both the cyclohedron and the permutohedron, is shown in Figure \[f:indexing\]. ![Graph associahedra of a path and a disconnected graph. The 3-cube is found as the graph-associahedron of two disjoint edges on four nodes, but no simple graph yields the 4-cube.[]{data-label="f:kwexmp"}](assoc_tube_sm.eps){width="\textwidth"} To describe the face structure of the graph associahedra we need a definition from [@dev-carr Section 2]. For graph $G$ and a collection of nodes $t$, construct a new graph ${G^*(t)}$ called the *reconnected complement*: If $V$ is the set of nodes of $G$, then $V-t$ is the set of nodes of ${G^*(t)}$. There is an edge between nodes $a$ and $b$ in ${G^*(t)}$ if $\{a,b\} \cup t'$ is connected in $G$ for some $t'\subseteq t$. Figure \[f:recon\] illustrates some examples of graphs along with their reconnected complements. ![Examples of tubes and their reconnected complements.[]{data-label="f:recon"}](reconcomp2.eps) For a given tube $t$ and a graph $G$, let $G(t)$ denote the induced subgraph on the graph $G$. By abuse of notation, we sometimes refer to $G(t)$ as a tube. \[t:facet\] [@dev-carr Theorem 2.9] Let $V$ be a facet of ${{{\mathcal{K}}} G},$ that is, a face of dimension $n-2$ of ${\mathcal K}G$, where $G$ has $n$ nodes. Let $t$ be the single, non-universal, tube of $V$ . The face poset of $V$ is isomorphic to $ {{{\mathcal{K}}} G}(t) \times {\mathcal{K}}{G^*(t)}$. A pair of examples is shown in Figure \[f:facet\]. The isomorphism described in [@dev-carr Theorem 2.9] is called $\hat{\rho}.$ Since we will be using this isomorphism more than once as an embedding of faces in polytopes, then we will specify it, according to the tube involved, as $\hat{\rho}_t:{{{\mathcal{K}}} G}(t) \times {\mathcal{K}}{G^*(t)}\hookrightarrow{{{\mathcal{K}}} G}.$ Given a pair of tubings from $T\in {{{\mathcal{K}}} G}_t$ and $T'\in {\mathcal{K}}{G^*(t)}$ the image $\hat{\rho}(T,T')$ consists of all of $T$ and an expanded version of $T'.$ In the latter each tube of $T'$ is expanded by taking its union with $t$ if that union is itself a tube. A specific example of the action of $\hat{\rho}_t$ is in Figure \[f:eta\_rho\]. In fact, often there will be more than one tube involved, as we now indicate: \[c:mfacet\] Let $\{t_1,\dots ,t_k,G\}$ be an explicit tubing of $G$, such that each pair of non-universal tubes in the list is far apart. Then the face of ${{{\mathcal{K}}} G}$ associated to that tubing is isomorphic to ${{{\mathcal{K}}} G}(t_1)\times \dots \times {{{\mathcal{K}}} G}(t_n)\times {\mathcal{K}}{G^*(t_1\cup\dots\cup t_k)}.$ We will denote the embedding by: $$\hat{\rho}_{t_1\dots t_k}:{{{\mathcal{K}}} G}(t_1)\times \dots \times {{{\mathcal{K}}} G}(t_n)\times {\mathcal{K}}{G^*(t_1\cup\dots\cup t_k)}\hookrightarrow{{{\mathcal{K}}} G}.$$ This follows directly from Theorem \[t:facet\]. Note that the reconnected complement with respect to the union of several tubes $t_1,\dots,t_k$ is the same as taking successive iterated reconnected complements with respect to each tube in the list. That is, $${G^*(t_1\cup\dots\cup t_k)} = (\dots((G^*(t_1))^*(t_2))^*\dots)^*(t_k).$$ ![Two facets of the cyclohedron $\w_6$.[]{data-label="f:facet"}](4dcross_sm.eps){width="\textwidth"} As shown in [@dev-real], the graph associahedron of the graph consisting of $n$ nodes and no edges is the $(n-1)$-simplex $\Delta^{(n-1)}$. Thus the graph associahedron of a graph with connected components $G_1, G_2,\dots,G_k$ is actually equivalent to the polytope ${{{\mathcal{K}}} G}_1 \times\dots\times{{{\mathcal{K}}} G}_k\times\Delta^{(k-1)}.$ This equivalence implies that: \[l:comp\] For a disconnected graph $G$ with multiple connected components $G_1, G_2,\dots,G_k$, there is always a cellular surjection $$\eta: {{{\mathcal{K}}} G}\to {{{\mathcal{K}}} G}_1 \times\dots\times{{{\mathcal{K}}} G}_k.$$ An example is in Figure \[f:eta\_rho\]. ![Example of the action of $\eta$ and $\hat{\rho}_t,$ where $t$ is the cycle sub-graph of the final graph.[]{data-label="f:eta_rho"}](eta_rho_sm.eps){width="\textwidth"} Factoring and extending the Tonks projection. {#s:tonks} ============================================= Loday and Ronco’s Hopf algebra map ---------------------------------- The two most important existing mathematical structures we will use in this paper are the graded Hopf algebra of permutations, $\ssym$, and the graded Hopf algebra of binary trees, $\ysym$. The $n^{th}$ component of $\ssym$ has basis the symmetric group $S_n$, with number of elements counted by $n!$. The $n^{th}$ component of $\ysym$ has basis the collection of binary trees with $n$ interior nodes, and thus $n+1$ leaves, denoted $\y_n$. These are counted by the Catalan numbers. The connection discovered by Loday and Ronco between the two algebras is due to the fact that a permutation on $n$ elements can be pictured as a binary tree with $n$ interior nodes, drawn so that the interior nodes are at $n$ different vertical heights from the base of the tree. This is called an *ordered binary tree*. The interior nodes are numbered left to right. We number the leaves $0,1,\dots,n-1 $ and the nodes $1,2,\dots,n-1.$ The $i^{th}$ node is “between” leaf $i-1$ and leaf $i$ where “between” might be described to mean that a rain drop falling between those leaves would be caught at that node. Distinct vertical levels of the nodes are numbered top to bottom. Then for a permutation $\sigma \in S_n$ the corresponding tree has node $i$ at level $\sigma(i).$ The map from permutations to binary trees is achieved by forgetting the levels, and just retaining the tree. This classical surjection is denoted $\tau: S_n \to \y_n$. An example is in Figure \[perm1\]. By a *cellular surjection* of polytopes $P$ and $Q$ we refer to a map $f$ from the face poset of $P$ to that of $Q$ which is onto and which preserves the poset structure. That is, if $x$ is a sub-face of $y$ in $P$ then $f(x)$ is a sub-face of or equal to $f(y).$ A *cellular projection* is a cellular surjection which also has the property that the dimension of $f(x)$ is less than or equal to the dimension of $x.$ In [@tonks] Tonks extended $\tau$ to a cellular projection from the permutohedron to the associahedron: $\Theta: \P_n \to {\mathcal{K}}_n$. In the cellular projection a face of the permutohedron, which is leveled tree, is taken to its underlying tree, which is a face of the associahedron. Figure \[perm2\] shows an example. The new revelation of Loday and Ronco is that the map $\tau$ gives rise to a Hopf algebraic projection $\bs{\tau}:\ssym \to \ysym$, so that the algebra of binary trees is seen to be embedded in the algebra of permutations. ![The permutation $\sigma = (2431) \in S_4$ pictured as an ordered tree and as a tubing of the complete graph; the unordered binary tree, and its corresponding tubing.[]{data-label="perm1"}](perm1_sm.eps){width="\textwidth"} Tubings, permutations, and trees. --------------------------------- Our new approach to the Tonks projection is made possible by the recent discovery of Devadoss in [@dev-real] that the graph-associahedron of the complete graph on $n$ vertices is precisely the $n^{th}$ permutohedron $\P_n$. Each of its vertices corresponds to a permutation of $n$ elements. Its faces in general correspond to ordered partitions of $[n].$ Keep in mind that for a permutation $\sigma \in S_n,$ the corresponding ordered partition of $[n]$ is $(\{\sigma^{-1}(1)\},\{\sigma^{-1}(2)\},\dots\{\sigma^{-1}(n)\}).$ Here is how to describe a bijection from the $n$-tubings on the complete graph to the permutations, as found by Devadoss in [@dev-real]. First a numbering of the $n$ nodes must be chosen. Given an $n$-tubing, since the tubes are all nested we can number them starting with the innermost tube. Then the permutation $\sigma \in S_n$ pictured by our $n$-tubing is such that node $i$ is within tube $\sigma(i)$ but not within any tube nested inside of tube $\sigma(i).$ Figure \[perm1\] shows an example. It is easy to extend this bijection between $n$-tubings and permutations to all tubings of the complete graph and ordered partitions of $[n]$. Given a $k$-tubing of the complete graph, each tube contains some numbered nodes which are not contained in any other tube. These subsets of $[n],$ one for each tube, make up the $k$-partition, and the ordering of the partition is from innermost to outermost. Recall that an ordered $k$-partition of $[n]$ corresponds to a leveled tree with $n+1$ leaves and $k$ levels, numbered top to bottom, at which lie the internal nodes. Numbering the $n$ spaces between leaves from left to right (imagine a raindrop falling into each space), we see that the raindrops collecting at the internal nodes at level $i$ represent the $i^{th}$ subset in the partition. We denote our bijection by: $$f: \{ \text{leveled trees with $n$ leaves} \} \to {\mathcal{K}}( \text{complete graph on $n-1$ nodes}).$$ Figure \[perm2\] shows an example. ![The ordered partition $(\{1,2,4\},\{3\})$ pictured as a leveled tree and as a tubing of the complete graph; the underlying tree, and its corresponding tubing.[]{data-label="perm2"}](partition_sm.eps){width="\textwidth"} The binary trees with $n+1$ leaves (and $n$ internal nodes) correspond to the vertices of the $(n-1)$-dimensional associahedron, or Stasheff polytope ${\mathcal{K}}_n$. In the world of graph-associahedra, these vertices correspond to the $n$-tubings of the path graph on $n$ nodes. Carr and Devadoss realized that in fact the path graph associahedron is precisely the Stasheff associahedron [@dev-carr]. Thus for any tree with $n+1$ leaves we can bijectively determine a tubing on the path graph. This correspondence can be described by creating a tube of the path graph for each internal node of the tree. We number the leaves from left to right $0,1,\dots,n$ and the nodes of the path from left to right $1,\dots,n.$ The tube we create contains the same numbered nodes of the path graph as all but the leftmost leaf of the subtree determined by the internal node. This bijection we denote by: $$g: \{ \text{trees with $n$ leaves} \} \to {\mathcal{K}}( \text{path on $n-1$ nodes} ).$$ Figures \[perm1\] and \[perm2\] show examples. Generalizing the Tonks projection --------------------------------- The fact that every graph of $n$ nodes is a subgraph of the complete graph leads us to a grand factorization of the Tonks cellular projection through all connected graph associahedra. Incomplete graphs are formed simply by removing edges from the complete graph. As a single edge is deleted, the tubing is preserved up to connection. That is, if the nodes of a tube are no longer connected, it becomes two tubes made up of the two connected subgraphs spanned by its original set of nodes. Let $G$ be a graph on $n$ nodes, and let $e$ be an edge of $G$. Let $G-e$ denote the graph achieved be the deletion of $e,$ while retaining all $n$ nodes. We define a cellular projection $\Theta_e: {\mathcal{K}}G \twoheadrightarrow {\mathcal{K}}(G - e).$ First, allowing an abuse of notation, we define $\Theta_e$ on individual tubes. For $t$ a tube of $G$ such that $t$ is not a tube of $G-e,$ then let $t', t''$ be the tubes of $G-e$ such that $t'\cup t'' = t.$ Then: $$\Theta_e(t) = \begin{cases} \{t\}, &t \text{ a tube of } G-e \\ \{t',t''\}, & otherwise. \end{cases}$$ Now given a tubing $T$ on $G$ we define its image as follows: $$\Theta_e(T) = \bigcup_{t\in T} \Theta_e(t).$$ See Figures \[f:tonks\], \[f:slant\] and \[f:disc\] for examples. ![The Tonks projection performed on $(1 2 4 3)$, factored by graphs. []{data-label="f:tonks"}](tonks_sm.eps){width="\textwidth"} \[l:newtonks\] For a graph $G$ with an edge $e$, $\Theta_e$ is a cellular surjection of polytopes ${\mathcal{K}}G \twoheadrightarrow {\mathcal{K}}(G - e).$ By Theorem \[t:graph\] we have that the face posets of the polytopes are isomorphic to the posets of tubings. The map takes a tubing on $G$ to a tubing on $G-e$ with a greater or equal number of tubes. This establishes its projective property. Also, for two tubings $U \prec U'$ of $G$ we see that either $\Theta_e(U) = \Theta_e(U') $ or $\Theta_e(U) \prec \Theta_e(U').$ Thus the poset structure is preserved by the projection. Finally, the map is surjective, since given any tubing $T$ on $G-e$ we can find a (maximal) preimage $T'$ as follows: First consider all the tubes of $T$ as a candidate tubing of $G.$ If it is a valid tubing, we have our $T'.$ If not, then there must be a pair of tubes $t',t'' \in T$ which are adjacent via the edge $e,$ and for which there are no tubes containing one of $t',t''$ but not the other. Then let $T_1$ be the result of replacing that pair in $T$ with the single tube $t = t' \sqcup t''.$ If $T_1$ is a valid tubing of $G$ then let $T'=T_1.$ If not, continue inductively. Composition of these cellular projections is commutative. \[l:comm\] Let $e,e'$ be edges of $G.$ Then $\Theta_e \circ \Theta_{e'} = \Theta_{e'} \circ \Theta_{e}.$ Consider the image of a tubing of $G$ under either composition. A tube of $G$ that is a tube of both $G-e$ and $G-e'$ will persist in the image. Otherwise it will be broken, perhaps twice. The same smaller tubes will result regardless of the order of the breaking. By Lemma \[l:comm\] we can unambiguously use the following notation: \[d:bige\] For any collection $E$ of edges of $G$ we denote by $\Theta_E:{{{\mathcal{K}}} G}\twoheadrightarrow {\mathcal{K}}(G-E)$ the composition of projections $\{\Theta_e ~|~e \in E\}.$ Now the Tonks projection from leveled trees to trees can be described in terms of the tubings. Beginning with a tubing on the complete graph with numbered nodes, we achieve one on the path graph by deleting all the edges of the complete graph except for those connecting the nodes in consecutive order from 1 to $n$. See Figures \[perm1\], \[perm2\] and \[f:tonks\] for a picture to accompany the following: \[t:ftonks\] Let $e_{i,k}$ be the edge between the nodes $i,i+k$ of the complete graph $G$ on $n$ nodes. Let $P = \{e_{i,k}~|~ i \in \{1,\dots,n-2\}~ and~ k \in \{ 2,\dots,n-i\}\}.$ These are all but the edges of the path graph. Then the following composition gives the Tonks map: $$g^{-1}\circ \Theta_P \circ f = \Theta.$$ We begin with an ordered $j$-partition of $n$ drawn as a leveled tree $t$ with $n+1$ leaves numbered left to right, and $j$ levels numbered top to bottom. The bijection $f$ tells us how to draw $t$ as a tubing of the complete graph $K_n$ with numbered nodes. Consider the internal nodes of $t$ at level $i$. In $f(t)$ there corresponds a tube $u_i$ containing the nodes of $K_n$ with the same numbers as all the spaces between leaves of the subtrees rooted at the internal nodes at level $i.$ The set in the partition which is represented by the internal nodes at level $i$ is the precise set of nodes of $u_i$ which are not contained by any other tube in $f(t).$ The relative position of this subset of $[n]$ in our ordered partition is reflected by the relative nesting of the tube $u_i$. The map $\Theta_P$ has the following action on tubings. Let $u$ be a tube of $f(t).$ We partition $u$ into subsets of consecutively numbered nodes such that no union of two subsets is consecutively numbered. Then the tubing $\Theta_P(f(t))$ contains the tubes given by these subsets. Now we claim that the tree $g^{-1}(\Theta_P(f(t)))$ has the same branching structure as $t$ itself. First, for any interior node of $t$ there is a tube of consecutively numbered nodes of the path graph, arising from the original tube of $f(t)$. This then becomes a corresponding interior node of our tree, under the action of $g^{-1}$. Secondly, if any interior node of $t$ lies between the root of $t$ and a second interior node, then the same relation holds in the tree between the corresponding interior nodes. This follows from the fact that the action of any of our maps $\Theta_{e_{i,k}}$ will preserve relative nesting. That is, for two tubes $u \subset v$ we have that in the image of $\Theta_{e_{i,k}}$ any tube resulting from $u$ must lie within a tube resulting from $v.$ To sum up, there is a factorization of the Tonks cellular projection through various graph-associahedra. An example on an $n$-tubing is shown in Figure \[f:tonks\], and another possible factorization of the projection in dimension 3 is demonstrated in Figure \[f:slant\]. ![A factorization of the Tonks projection through 3 dimensional graph associahedra. The shaded facets correspond to the shown tubings, and are collapsed as indicated to respective edges. The first, third and fourth pictured polytopes are above views of $\P_4, \w_4$ and ${\mathcal{K}}_4$ respectively.[]{data-label="f:slant"}](tonks_slant_sm.eps){width="\textwidth"} Disconnected graph associahedra. -------------------------------- The special case of extending the Tonks projection to graphs with multiple connected components will be useful. Consider a partition $S_1 \sqcup \dots \sqcup S_k$ of the $n$ nodes of a connected graph $G$, chosen such that we have connected induced subgraphs $G(S_i).$ Let $E_S$ be the set of edges of G not included in any $G(S_i).$ Thus the graph $G-E_S$ formed by deleting these edges will have the $k$ connected components $G(S_i).$ In this situation $\Theta_{E_S}$ will be a generalization of the Tonks projection to the graph associahedron of a disconnected graph. In Figure \[f:disc\] we show the extended Tonks projections in dimension 2. ![Extending the Tonks projection to the 2-simplex. The highlighted edges are collapsed to the respective vertices. []{data-label="f:disc"}](tonks_disc_sm.eps){width="\textwidth"} Geometrical view of $\ssym$ and $\ysym$ {#s:newview} ======================================= Before proving the graded algebra structures on graph associahedra which our title promised, we motivate our point of view by showing how it will fit with the well known graded algebra structures on permutations and binary trees. Review of $\ssym$ ----------------- Let $\ssym$ be the graded vector space over ${{\mathbb Q}}$ with the $n^{th}$ component of its basis given by the permutations $S_n.$ An element $\sigma \in S_n$ is given by its image $(\sigma(1),\dots,\sigma(n))$, often without commas. We follow [@AS-MR] and [@AS-LR] and write $F_{u}$ for the basis element corresponding to $u\in S_n$ and 1 for the basis element of degree 0. A graded Hopf algebra structure on $\ssym$ was discovered by Malvenuto and Reutenauer in [@MR]. First we review the product and coproduct and then show a new way to picture those operations. Recall that a permutation $\sigma$ is said to have a descent at location $p$ if $\sigma(p) > \sigma(p+1).$ The $(p,q)$-shuffles of $S_{p+q}$ are the $(p+q)$ permutations with at most one descent, at position $p.$ We denote this set as $S^{(p,q)}.$ The product in $\ssym$ of two basis elements $F_u$ and $F_v$ for $u\in S_p$ and $v\in S_q$ is found by summing a term for each shuffle, created by composing the juxtaposition of $u$ and $v$ with the inverse shuffle: $$F_u\cdot F_v = \sum_{\iota \in S^{(p,q)}} F_{(u\times v)\cdot \iota^{-1}}.$$ Here $u\times v$ is the permutation $(u(1),\dots,u(p),v(1)+p,\dots,v(q)+p)$. Geometry of $\ssym$ ------------------- The algebraic structure of $\ssym$ can be linked explicitly to the recursive geometric structure of the permutohedra. In $\ssym$ we may view our operands (a pair of permutations) as a vertex of the cartesian product of permutohedra $\P_p \times \P_q.$ Then their product is the formal sum of images of that vertex under the collection of inclusions of $\P_p \times \P_q$ as a facet of $\P_{p+q}.$ An example is in Figure \[perm3\], where the product is shown along with corresponding pictures of the tubings on the complete graphs. To make this geometric claim precise we use the facet isomorphism $\hat{\rho}_t$ which exists by Theorem \[t:facet\]. \[t:geo\_pro\] The product in $\ssym$ of basis elements $F_u$ and $F_v$ for $u\in S_p$ and $v\in S_q$ may be written: $$F_u\cdot F_v = \sum_{\iota\in S^{(p,q)}} F_{\hat{\rho}_{\iota}(u,v)}$$ where $\hat{\rho}_{\iota}$ is shorthand for $\hat{\rho}_{\iota([p])}.$ ![The product in $\ssym$. Here (and similarly in all our pictorial examples) we let the picture of the graph tubing $u$ stand in for the basis element $F_u.$ In the picture of $\P_4$ the circled vertices from bottom to top are the permutations in the product, as listed from left to right above.[]{data-label="perm3"}](demo_perm_sm.eps){width="\textwidth"} From Theorem \[t:facet\] we have that for each tube $t$ of the graph, the corresponding facet of ${{{\mathcal{K}}} G}$ is isomorphic to ${\mathcal{K}}{G^*(t)} \times {{{\mathcal{K}}} G}(t).$ In the case of the complete graph $G = K_{p+q}$, for any tube $t$ of $p$ nodes, we have the facet inclusion $\hat{\rho}_t:\P_q \times \P_p \to \P_{p+q}.$ We just need to review the definition of the isomorphism $\hat{\rho}$ from the proof of [@dev-carr Theorem 2.9], and point out that the permutation associated to the tubing $\hat{\rho}_{\iota}(u,v)$ is indeed $(u\times v)\cdot\iota^{-1}$. Given a shuffle $\iota$, the $(p+q)$-tubing $\hat{\rho}_{\iota}(u,v)$ on $K_{p+q}$ is given by including for each tube $t$ of $u$ the tube with nodes the image $\iota(t).$ Denote the resulting set of tubes by $\overline{\iota(u)}.$ For each tube $s$ of $v$ we include the tube formed by $\iota([p])\cup\hat{\iota}(s),$ where $\hat{\iota}(i) = \iota(i+p).$ We denote the resulting set of tubes as $\overline{\hat{\iota}(v)}.$ Now the tubing $\hat{\rho}_{\iota}(u,v)$ is defined to be $\overline{\iota(u)}\cup\overline{\hat{\iota}(v)}.$ This tubing is precisely the complete tubing which represents the permutation $(u\times v)\cdot\iota^{-1}$. To sum up, in our view of $\ssym$ each permutation is pictured as a tubing of a complete graph with numbered nodes. Since any subset of the nodes of a complete graph spans a smaller complete graph, we can draw the terms of the product in $\ssym$ directly. Choosing a $(p,q)$-shuffle is accomplished by choosing $p$ nodes of the $(p+q)$-node complete graph $K_{p+q}$. First the permutation $u$ (as a $p$-tubing) is drawn upon the induced $p$-node complete subgraph, according to the ascending order of the chosen nodes. Then the permutation $v$ is drawn upon the subgraph induced by the remaining $q$ nodes–with a caveat. Each of the tubes of $v$ is expanded to also include the $p$ nodes that were originally chosen. This perspective will generalize nicely to the other graphs and their graph associahedra. In [@AS-MR] and [@AS-LR] the authors give a related geometric interpretation of the products of $\ssym$ and $\ysym$ as expressed in the Möbius basis. An interesting project for the future would be to apply that point of view to $\wsym.$ \[r:geo\_cop\] The coproduct of $\ssym$ can also be described geometrically in terms of the graph tubings. The coproduct is usually described as a sum of all the ways of splitting a permutation $u\in S_n$ into two permutations $u_i \in S_i$ and $u_{n-i} \in S_{n-i}$: $$\Delta (F_u) = \sum_{i=0}^{n}F_{u_i}\otimes F_{u_{n-i}}$$ where $u_i = (u(1)\dots u(i))$ and $u_{n-i} = (u(i+1)-i\dots u(n)-i).$ Given an $n$-tubing $u$ of the complete graph on $n$ vertices we can find $u_i$ and $u_{n-i}$ just by restricting to the sub graphs (also complete) induced by the nodes $1,\dots, i$ and $i+1,\dots, n$ respectively. For each tube $t\in u$ the two intersections of $t$ with the respective subgraphs are included in the respective tubings $u_i$ and $u_{n-i}.$ An example is in Figure \[permcop\]. Notice that this restriction of the tubings to subgraphs is the same as the result of performing the Tonks projection. Technically, $(u_i,u_{n-i}) = \eta(\Theta_{E_i}(u)),$ where $$E_i = \{e ~ an~edge ~ of ~G ~|~e \text{ connects a node $j\le i$ to a node $j' > i$}\}.$$ and $\eta$ is from Lemma \[l:comp\]. ![The coproduct in $\ssym.$[]{data-label="permcop"}](perm_cop2_sm.eps){width="\textwidth"} $$\Delta F_{(1 3 4 2)}= 1\otimes F_{(1342)}+F_{(1)}\otimes F_{(231)}+F_{(12)}\otimes F_{(21)}+F_{(123)}\otimes F_{(1)}+F_{(1342)}\otimes1.$$ Review of $\ysym$ ----------------- The product and coproduct of $\ysym$ are described by Aguiar and Sottile in terms of splitting and grafting binary trees [@AS-LR]. We can vertically split a tree into smaller trees at each leaf from top to bottom–as if a lightning strike hits a leaf and splits the tree along the path to the root. We graft trees by attaching roots to leaves (without creating a new interior node at the graft.) The product of two trees with $n$ and $m$ interior nodes (in that order) is a sum of ${{n+m} \choose n}$ terms, each with $n+m$ interior nodes. Each is achieved by vertically splitting the first tree into $m+1$ smaller trees and then grafting them to the second tree, left to right. A picture is in Figure \[map24a\]. Geometry of $\ysym$ {#s:geomy} ------------------- Since Loday and Ronco demonstrated that the Tonks projection, restricted to vertices, gives rise to an algebra homomorphism $\bs{\tau}:\ssym\to\ysym,$ it is no surprise that the processes of splitting and grafting have geometric interpretations. Grafting corresponds to certain face inclusions of associahedra, and splitting corresponds to the extension of Tonks’s projection to disconnected graphs. To see the latter, note that splitting at leaf $i$ is the same as deleting the edge from node $i$ to node $i+1.$ Thus the product in $\ysym$ can be described with the language of path graph tubings, using a combination of facet inclusion and the extended Tonks projection. An example is shown in Figure \[map24a\]. Let $U$ be the path graph with $p$-tubing $u$ and $V$ the path graph with $q$-tubing $v.$ Given a shuffle $\iota\in S^{(p,q)}$ we can partition the nodes of $U$ into the preimages $s_1,\dots,s_k$ of the connected components $\iota(s_1),\dots,\iota(s_k)$ of the possibly disconnected subgraph induced by the nodes $\iota([p])$ on the $(p+q)$-path. Let $E_{\iota}$ be the edges of $U$ not included in the subgraphs $U(s_i)$ induced by our partition. For short we denote the extended Tonks projection $\Theta_{E_{\iota}}$ as simply $\Theta_{\iota}.$ Now $\Theta_{\iota}(u)$ is the projection of $u$ onto the possibly disconnected graph $U-E_{\iota}.$ Recall from Lemma \[l:comp\] that a vertex of ${\mathcal{K}}(U-E_{\iota})$ may be mapped to a vertex of ${\mathcal{K}}U(s_1)\times\dots\times{\mathcal{K}}U(s_k).$ We call this map $\eta_{\iota}.$ \[r:geo\] The product in $\ysym$ can be written: $$F_u\cdot F_v = \sum_{\iota \in S^{(p,q)}}F_{\hat{\rho}_{\iota}(\eta_{\iota}(\Theta_{\iota}(u)),v)}.$$ Where $\hat{\rho}_{\iota}$ is shorthand notation for the isomorphism $\hat{\rho}_{\iota(s_1)\dots \iota(s_k)}$ from Corollary \[c:mfacet\]. ![The product in $\ysym$. The circled vertices of ${\mathcal{K}}_4$ which are at the upper end of highlighted edges are the fifth, third and second terms of the product, in that order respectively from bottom to top in the picture. []{data-label="map24a"}](demo_perm_assoc_sm.eps){width="\textwidth"} We will explain how the splitting and grafting of trees in a term of the product may be put into the language of tubings, and then argue that the term thus described is indeed the image of projections and inclusions as claimed. The product in $\ysym$ of two basis elements $F_u$ and $F_v$ for $u\in \y_p$ and $v\in \y_q$ is found by summing a term for each shuffle $\iota \in S^{(p,q)}.$ We draw $u$ and $v$ in the form of tubings on path graphs of $p$ and $q$ nodes, respectively. Here is the non-technical description: first the $p$-tubing $u$ is drawn upon the induced subgraph of the nodes $\iota([p])$ according to the ascending order of the chosen nodes. However, each tube may need to be first broken into several sub-tubes. Then the $q$-tubing $v$ is drawn upon the subgraph induced by the remaining $q$ nodes. In this last step, each of the tubes of $v$ is expanded to also include any of the previously drawn tubes that its nodes are adjacent to. To be precise, we first choose a shuffle $\iota \in S^{(p,q)}.$ Let $\hat{\iota}(i) = \iota(i+p).$ Our term of $F_u\cdot F_v$ is the $(p+q)$-tubing on the $(p+q)$-path given by the following: First for each tube $t \in u$ we include in our new tubing the tubes which are the connected components of the subgraph induced by the nodes $\iota(t).$ Let $\overline{\iota(u)}$ denote the tubing constructed thus far. After this step in terms of trees, we have performed the splitting and chosen where to graft the (non-trivial) subtrees. In terms of trees the splitting occurs at leaves labeled by $\hat\iota(i)-i$ for $i\in [q].$ Second, for each tube $s \in v$ we include in our term of the product the tube formed by $$\hat{\iota}(s) \cup \{j \in t' \in \overline{\iota(u)} ~|~ t' \text{ is adjacent to } \hat{\iota}(s) \}.$$ Let $\overline{\hat{\iota}(v)}$ denote the tubes added in this second step. Now we have completed the grafting operation. Now we just point out that $\hat{\rho}_{\iota}(\eta_{\iota}(\Theta_{\iota}(u)) ,v)$ is precisely the same as $\overline{\iota(u)}\cup\overline{\hat{\iota}(v)}$ . The splitting of tubes of $u$ is accomplished by $\Theta_{\iota}$; and $\eta_{\iota}$ simply recasts the result as an element of the appropriate cartesian product. Then $\hat{\rho}_{\iota}$, as defined in [@dev-carr], performs the inclusion of that element paired together with $v.$ To summarize, the product in $\ysym$ can be seen as a process of splitting and grafting, or equivalently of projecting and including. From the latter viewpoint, we see the product of two associahedra vertices being achieved by projecting the first onto a cartesian product of smaller associahedra, and then mapping that result paired with the second operand into a large associahedron via face inclusion. Notice that the reason the second path graph tubing $v$ can be input here is that any reconnected complement of a path graph is another path graph. \[r:y\_cop\] The coproduct of $\ysym$ can also be described geometrically in terms of the graph tubings. The coproduct is usually described as a sum of all the ways of splitting a binary tree $u\in \y_n$ along leaf $i$ into two trees: $u_i \in \y_i$ and $u_{n-i} \in \y_{n-i}$: $$\Delta (F_u) = \sum_{i=0}^{n}F_{u_i}\otimes F_{u_{n-i}}.$$ Given an $n$-tubing $u$ of the path graph on $n$ vertices we can find $u_i$ and $u_{n-i}$ just by restricting to the sub graphs (also paths) induced by the nodes $1,\dots, i$ and $i+1,\dots, n$ respectively. For each tube $t\in u$ the two intersections of $t$ with the respective subgraphs are included in the respective tubings $u_i$ and $u_{n-i}.$ An example is in Figure \[assocop\]. Notice that this restriction of the tubings to subgraphs is the same as the result of performing the extended Tonks projection, just as described in Remark \[r:geo\_cop\]. ![The coproduct in $\ysym.$ []{data-label="assocop"}](assoc_cop_sm.eps){width="\textwidth"} The algebra of the vertices of cyclohedra {#s:cyclo} ========================================= Recall that the $(n-1)$-dimensional cyclohedron $\mathcal{W}_n$ has vertices which are indexed by $n$-tubings on the cycle graph of $n$-nodes. We will define a graded algebra with a basis which corresponds to the vertices of the cyclohedra, and whose grading respects the dimension (plus one) of the cyclohedra. Let $\wsym$ be the graded vector space over ${{\mathbb Q}}$ with the $n^{th}$ component of its basis given by the $n$-tubings on the cycle graph of $n$ cyclically numbered nodes. By $W_n$ we denote the set of $n$-tubings on the cycle graph $C_n.$ We write $F_{u}$ for the basis element corresponding to $u\in W_n$ and 1 for the basis element of degree 0. Graded algebra structure ------------------------ Now we demonstrate a product which respects the grading on $\wsym$ by following the example described above for $\ssym.$ The product in $\wsym$ of two basis elements $F_u$ and $F_v$ for $u\in W_p$ and $v\in W_q$ is found by summing a term for each shuffle $\iota\in S^{(p,q)}.$ First the $p$-tubing $u$ is drawn upon the induced subgraph of the nodes $\iota([p])$ according to the ascending order of the chosen nodes. However, each tube may need to be first broken into several sub-tubes, since the induced graph on the nodes $\iota([p])$ may have connected components $\iota(s_1),\dots,\iota(s_k)$ (as described in Section \[s:geomy\]). Then the $q$-tubing $v$ is drawn upon the subgraph induced by the remaining $q$ nodes. However, each of the tubes of $v$ is expanded to also include any of the previously drawn tubes that its nodes are adjacent to. \[d:cyc\_prod\] $$F_u\cdot F_v = \sum_{\iota \in S^{(p,q)}}F_{\hat{\rho}_{\iota}(\eta_{\iota}(\Theta_{\iota}(u)),v)}.$$ Where $\hat{\rho}_{\iota}$ is shorthand notation for the isomorphism $\hat{\rho}_{\iota(s_1)\dots \iota(s_k)}$ from Corollary \[c:mfacet\]. Also 1 is a two-sided unit. An example is shown in Figure \[permcyc\]. For an example of finding a term in the product given a specific shuffle $\iota,$ see the second part of Figure \[f:hom\]. \[t:biggy\] The product we have just described makes $\wsym$ into an associative graded algebra. Given a shuffle $\iota$ we will use the fact that $$\hat{\rho}_{\iota}(\eta_{\iota}(\Theta_{\iota}(u)) ,v) = \overline{\iota(u)}\cup\overline{\hat{\iota}(v)}$$ as defined in the proof of Theorem \[r:geo\]. First we must check that the result of the product is indeed a sum of valid $(p+q)$-tubings of the cycle graph $C_{p+q}.$ We claim that in each term the new tubes we have created are pairwise compatible. This being shown, we will be able to deduce that since $p+q$ tubes were used in the construction, then the resulting term will necessarily have $p+q$ tubes as well. To check our claim we compare pairs of tubes in one or both of $\overline{\iota(u)}$ and $\overline{\hat{\iota}(v)}.$ There are six cases: 1. By our method of construction, any tube of $\overline{\iota(u)}$ is either nested within some of or far apart from all of the tubes of $\overline{\hat{\iota}(v)}.$ 2. If two tubes of $\overline{\iota(u)}$ are made up of nodes in $\iota(t)$ and $\iota(t')$ respectively for nested tubes $t$ and $t'$ of $u$ then they will be similarly nested. 3. Two tubes from $\overline{\iota(u)}$ might both be made up of nodes in $\iota(t)$ for a single tube $t$ of $u.$ In that case they are guaranteed to be far apart, since their respective nodes together cannot be a consecutive string (mod $p+q$). 4. If two tubes of $\overline{\iota(u)}$ are made up of nodes in $\iota(t)$ and $\iota(t')$ respectively for far apart tubes $t$ and $t'$ of $u,$ then we claim they will be far apart. This is true since if two nodes $a$ and $b$ are nonadjacent in the cycle graph $C_p$ then the two nodes $\iota(a)$ and $\iota(b)$ will be nonadjacent in $C_{p+q}.$ 5. If two tubes of $\overline{\hat{\iota}(v)}$ contain some nodes in $\hat{\iota}(t)$ and $\hat{\iota}(t')$ respectively for nested tubes $t$ and $t'$ of $u$ then they will be similarly nested. This follows from the fact that $\iota(t)$ will only be adjacent to nodes that $\iota(t')$ is also adjacent to. 6. Finally, if two tubes of $\overline{\hat{\iota}(v)}$ contain some nodes in $\hat{\iota}(t)$ and $\hat{\iota}(t')$ respectively for far apart tubes $t$ and $t'$ of $u,$ then we claim they will be far apart. This final case depends on a special property which the cycle graphs exemplify. Given any subset of $k$ of the nodes of $C_n$, the reconnected complement of that subset is the cycle graph $C_{n-k}.$ Specifically the reconnected complement of $C_{p+q}$ with respect to the nodes $\iota(p)$ is the graph $C_q.$ Thus even the expanded tubes of $\overline{\hat{\iota}(v)}$ remain far apart as long as their components from $\hat{\iota}(q)$ were far apart; and this last property is guaranteed since $\iota$ preserves the cyclic order. Thus we have shown that the result of multiplying two basis elements is again a basis element, and that this multiplication respects the grading. That this multiplication is associative is a corollary of the following result regarding how the multiplication is preserved under a map from $\ssym,$ specifically a corollary of Theorem \[t:permhom\]. ![A product of cycle graph tubings (10 terms total). []{data-label="permcyc"}](permcyc_sm.eps){width="\textwidth"} Note that the cases (1) and (2) are explainable simply by the fact that we start with two valid tubings and multiply them in the given order. Cases (3)-(6) however can be jointly explained based upon the fact that given any subset of $k$ of the nodes of $C_n$, the reconnected complement of that subset is the cycle graph $C_{n-k}.$ Cases (3)-(5) specifically rely on the fact that the reconnected complement of $C_{p+q}$ with respect to the nodes $\hat{\iota}(q)$ is the graph $C_p.$ This property is true of many other graph sequences, including the complete graphs and the path graphs. The property is also more simply stated as follows: the reconnected complement of $G_i$ with respect to any single node is $G_{i-1}.$ \[r:geo\_cyc\] Once again we can interpret the product geometrically. The entire contents of the proof of Theorem \[r:geo\] apply here, with the term “path” everywhere replaced with the term “cycle.” Thus a term in the product can be seen as first projecting the cyclohedron vertex $u$ onto a collection of sub-path-graphs of the cycle. We then map the vertex of this cartesian product of associahedra, paired with the second vertex of the cyclohedron represented by $v,$ into the large cyclohedron via the indicated face inclusion. The usual picture is in Figure \[f:demo\_cyc\]. ![The product in $\wsym$. The second and fifth terms of the product are the ones that use a Tonks projection; they are found as the two vertices at the tips of included (highlighted) edges.[]{data-label="f:demo_cyc"}](demo_perm_cyc_sm.eps){width="\textwidth"} Algebra homomorphisms --------------------- Next we consider the map from the permutohedra to the cyclohedra which is described via the deletion of edges–from the complete graphs to the cycle graphs–and point out that this is an algebra homomorphism. Recall from Theorem \[t:ftonks\] that $\Theta_P$ is the Tonks projection viewed from the graph associahedra point of view; via deletion of the edges of the complete graph except for the path connecting the numbered nodes in order. Let $\Theta_c$ be the map defined just as $\Theta_P$ but without deleting the edge from node $n$ to node $1.$ Thus we will be deleting all the edges except those making up the cycle of numbered nodes in cyclic order. Define a map from $\ssym$ to $\wsym$ on basis elements by: $$\hat{\Theta}_c(F_u) = F_{\Theta_c(u)}.$$ \[t:permhom\] The map $\hat{\Theta}_c$ is an algebra homomorphism from $\ssym$ onto $\wsym.$ For $u\in S_p$ and $v\in S_q$ we compare $\hat{\Theta}_c(F_u\cdot F_v)$ with $\hat{\Theta}_c(F_u)\cdot \hat{\Theta}_c(F_v).$ Each of the multiplications results in a sum of ${p+q \choose p}$ terms. It turns out that comparing the results of the two operations can be done piecewise. Thus we check that for a given shuffle $\iota\in S^{(p,q)}$ the respective terms of our two operations agree: we claim that $$\Theta_c(\hat{\rho}_{\iota}(\eta_{\iota}(\Theta_{\iota}(u)) ,v)) = \hat{\rho}_{\iota}(\eta_{\iota}(\Theta_{\iota}(\Theta_c(u))) ,\Theta_c(v))$$ or equivalently: $$\Theta_c(\overline{\iota(u)} \cup \overline{\hat{\iota}(v)}) = \overline{\iota(\Theta_c(u))} \cup \overline{\hat{\iota}(\Theta_c(v))}.$$ Here $\overline{\iota(u)}$ and $\overline{\hat{\iota}(v)}$ are as described in the proof of Theorem \[r:geo\], and the righthand side of the equation is using the notation of Definition \[d:cyc\_prod\]. The justification is a straightforward comparison of the indicated operations on individual tubes. There are two cases: 1. For $t$ a tube of $u$, the right-hand side first breaks $t$ into several smaller tubes by deleting certain edges of the $p$-node complete graph, then takes each of these to their image under $\iota,$ breaking them again whenever they are no longer connected. The left-hand side takes $t$ to $\iota(t),$ a tube of the complete graph on $p+q$ nodes, and then breaks $\iota(t)$ into the tubes that result from deleting the specified edges of the $(p+q)$-node complete graph. In this last step, by Lemma \[l:comm\], we can delete first those edges that also happen to lie in the complete subgraph induced by $\iota([p]),$ and then the remaining specified edges. Thus we have duplicated the left-hand side and get the same final set of tubes on either side of the equation. 2. For $s$ a tube of $v$, the right-hand side first breaks $s$ into several smaller tubes by deleting certain edges of the $q$-node complete graph, then takes each of these to their image under $\hat{\iota},$ expanding them to include tubes of $\overline{\iota(\Theta_c(u))}$. The left-hand side takes $s$ to $\hat{\iota}(s)\cup\iota([p]),$ and then breaks the result into the tubes that result from deleting the specified edges of the $(p+q)$-node complete graph. Again we can delete first those edges that also happen to lie in the complete subgraph induced by $\iota([p]),$ and then the remaining specified edges, duplicating the left-hand process. An illustration of the two sides of the equation is in Figure \[f:hom\]. The surjectivity of $\hat{\Theta}_c$ follows from the surjectivity of the generalized Tonks projection, as shown in Lemma \[l:newtonks\]. ![An example of the equation $\Theta_c(\overline{\iota(u)} \cup \overline{\hat{\iota}(v)}) = \overline{\iota(\Theta_c(u))} \cup \overline{\hat{\iota}(\Theta_c(v))}.$ where $u=(2314),$ $v=(312)$ and $\iota([4]) = \{2,4,6,7\}.$ []{data-label="f:hom"}](homom_demo_sm.eps){width="\textwidth"} Let $C_n$ be the cycle graph on $n$ numbered nodes and let $w$ be the edge from node $1$ to node $n.$ We can define a map from $\wsym$ to $\ysym$ by: $$\hat{\Theta}_w(F_u) = F_{\Theta_w(u)},$$ for $u\in W_n.$ \[t:whom\] $\hat{\Theta}_w$ is a surjective homomorphism of graded algebras $\wsym \to \ysym$. In [@LR] it is shown that the map we call $\bs{\tau}$ is an algebra homomorphism from $\ssym$ to $\ysym.$ In the previous theorem we demonstrated that the map $\hat{\Theta}_c$ is a surjective algebra homomorphism from $\ssym$ to $\wsym.$ Now, since $\tau$ is the same map on vertices as our $\Theta_P$ (from Theorem \[t:ftonks\]), then the relationship of these three is: $$\bs{\tau} = \hat{\Theta}_w \circ \hat{\Theta}_c.$$ Thus $\hat{\Theta}_w$ is an algebra homomorphism from $\ssym$ onto $\wsym.$ The existence of a surjective algebra homomorphism from $\ssym$ not only allows us a shortcut to demonstrating associativity, but leads to an alternate description of the product in the range of that homomorphism. This may be achieved in three steps: 1. Lifting our $p$ and $q$-tubings in $\wsym$ to any preimages of the generalized Tonks projection $\Theta_c$ on the complete graphs on $p$ and $q$ nodes. 2. Performing the product of these complete graph tubings in $\ssym$, 3. and finding the image of the resulting terms under the homomorphism $\hat{\Theta}_c$. This description is independent of our choices of preimages in $\ssym$ due to the homomorphism property. The following corollary follows directly from the properties of the surjective algebra homomorphisms of Theorems \[t:permhom\] and \[t:whom\]. \[c:cool\] $\wsym$ is a left $\ssym$-module under the definition $F_u\cdot F_{\Theta_c(v)} = \hat{\Theta}_c(F_u\cdot F_v)$ and a right $\ssym$-module under the definition $F_{\Theta_c(u)}\cdot F_v = \hat{\Theta}_c(F_u\cdot F_v).$ $\ysym$ is a left $\wsym$-module under the definition $F_u\cdot F_{\Theta_w(v)} = \hat{\Theta}_w(F_u\cdot F_v)$ and a right $\wsym$-module under the definition $F_{\Theta_w(u)}\cdot F_v = \hat{\Theta}_w(F_u\cdot F_v).$ Extension to the faces of the polytopes {#s:chap} ======================================= Chapoton was the first to point out the fact that in studying the Hopf algebras based on vertices of permutohedra, associahedra and cubes, one need not restrict their attention to just the zero-dimensional faces of the polytopes. He has shown that the Loday Ronco Hopf algebra $\ysym,$ the Hopf algebra of permutations $\ssym,$ and the Hopf algebra of quasisymmetric functions $\qsym$ are each subalgebras of algebras based on the the trees, the ordered partitions, and faces of the hypercubes respectively [@chap]. Furthermore, he has demonstrated that these larger algebras of faces are bi-graded and possess a differential. Here we point out that the cyclohedra based algebra $\wsym$ can be extended to a larger algebra based on all the faces of the cyclohedra as well, and conjecture the additional properties. Chapoton’s product structure on the permutohedra faces is given in [@chap] in terms of ordered partitions. Let $\tilde{\ssym}$ be the graded vector space over ${{\mathbb Q}}$ with the $n^{th}$ component of its basis given by the ordered partitions of $[n].$ We write $F_{u}$ for the basis element corresponding to the $m$-partition $u:[n] \to [m],$ for $0\le m\le n,$ and 1 for the basis element of degree 0. The product in $\tilde{\ssym}$ of two basis elements $F_u$ and $F_v$ for $u:[p]\to[k]$ and $v:[q]\to[l]$ is found by summing a term for each shuffle, created by composing the juxtaposition of $u$ and $v$ with the inverse shuffle: $$F_u\cdot F_v = \sum_{\sigma \in S^{(p,q)}} F_{(u\times v)\cdot \sigma^{-1}}.$$ Here $u\times v$ is the ordered $(k+l)$-partition of $[p+q]$ given by: $$(u\times v)(i) = \begin{cases} u(i), &i \in [p] \\ v(i-p)+k, & i \in \{p+1,\dots,p+q\}. \end{cases}$$ The bijection between tubings of complete graphs and ordered partitions allows us to write this product geometrically. \[t:geochap\] The product in $\tilde{\ssym}$ may be written as: $$F_u\cdot F_v = \sum_{\iota \in S^{(p,q)}} F_{\hat{\rho}_{\iota}(u,v)}$$ which is just Definition \[t:geo\_pro\] extended to all pairs of faces $(u,v).$ Recall that we found the bijection between tubings of complete graphs and ordered partitions by noting that each tube contains some numbered nodes which are not contained in any other tube. These subsets of $[n],$ one for each tube, make up the partition, and the ordering of the partition is from innermost to outermost tube. Now the Carr-Devadoss isomorphism $\hat{\rho}$ is a bijection of face posets. With this in mind, the same argument applies as in the proof of Theorem \[t:geo\_pro\]. In other words, we view our operands (a pair of ordered partitions) as a face of the cartesian product of permutohedra $\P_p \times \P_q.$ Then the product is the formal sum of images of that face under the collection of inclusions of $\P_p \times \P_q$ as a facet of $\P_{p+q}.$ An example is in Figure \[perm34\]. ![The product in $\tilde{\ssym}$. As an exercise the reader can delete edges in the graphs to illustrate the products in $\tilde{\wsym}$ and $\tilde{\ysym}.$ []{data-label="perm34"}](demo_perm_face_sm.eps){width="\textwidth"} We leave to the reader the by now straightforward tasks of finding the geometric interpretations of the coproduct on $\tilde{\ssym}$ and of the Hopf algebra structure on the faces of the associahedra, $\tilde{\ysym}.$ Each one can be done simply by repeating earlier definitions using tubings, but with all sizes of $k$-tubings as operands. Recall that the faces of the cyclohedra correspond to tubings of the cycle graph. We will define a graded algebra with a basis which corresponds to the faces of the cyclohedra, and whose grading respects the dimensions (plus one) of the cyclohedra. Let $\tilde{\wsym}$ be the graded vector space over ${{\mathbb Q}}$ with the $n^{th}$ component of its basis given by all the tubings on the cycle graph of $n$ numbered nodes. By $\mathcal{W}_n={\mathcal{K}}C_n$ we denote the poset of tubings on the cycle graph $C_n$ with a cyclic numbering of nodes. We write $F_{u}$ for the basis element corresponding to $u\in \mathcal{W}_n$ and 1 for the basis element of degree 0. The product in $\tilde{\wsym}$ of two basis elements $F_u$ and $F_v$ for $u\in \mathcal{W}_p$ and $v\in \mathcal{W}_q$ is found by summing a term for each shuffle $\iota \in S^{(p,q)}.$ First the $l$-tubing $u$ is drawn upon the induced subgraph of the nodes $\iota([p])$ according to the ascending order of the chosen nodes. However, each tube may need to be first broken into several sub-tubes. Then the $m$-tubing $v$ is drawn upon the subgraph induced by the remaining $q$ nodes. However, each of the tubes of $v$ is expanded to also include any of the previously drawn tubes that its nodes are adjacent to. $$F_u\cdot F_v = \sum_{\iota \in S^{(p,q)}}F_{\hat{\rho}_{\iota}(\eta_{\iota}(\Theta_{\iota}(u)),v)}.$$ where the facet inclusion $\hat{\rho}_{\iota}$ is the same as in the two previous definitions using this template: Definitions \[d:sim\_prod\] and \[d:cyc\_prod\]. \[t:wface\] The product we have just defined makes $\tilde{\wsym}$ into an associative graded algebra. The proof is almost precisely the same as for the algebra of vertices of the cyclohedra, $\wsym.$ The only difference is that the tubings do not always have the maximum number of tubes. First we must check that the result of the product is indeed a sum of valid tubings of the cycle graph $C_{p+q}.$ We claim that in each term the new tubes we have created are pairwise compatible. The cases to be checked and the reasoning for each are exactly as shown in the proof of Theorem \[t:biggy\]. Associativity is shown by lifting the tubings to be multiplied to tubings on the complete graphs which are preimages of the extended Tonks projection, and performing the multiplication in Chapoton’s algebra. The fact that the extended Tonks projection does preserve the structure here is again an easy check of corresponding terms, following the same pattern as for the $n$-tubings in Theorem \[t:permhom\]. Chapoton has shown the existence of a differential graded structure on the algebras of faces of the permutohedra, associahedra, and cubes [@chap]. The basic idea is simple, to define the differential as a signed sum of the bounding sub-faces of a given face. Here we leave for future investigation the possibility of extending this differential to algebras of graph associahedra. Algebras of simplices {#s:simp} ===================== We introduce a curious new graded algebra whose $n^{th}$ component has dimension $n.$ We denote it $\dsym.$ In fact $\dsym$ may be thought of as a graded algebra whose basis is made up of all the standard bases for Euclidean spaces. The graph associahedron of the edgeless graph on $n$ vertices is the $(n-1)$-simplex $\Delta^{n-1}$ of dimension $n-1.$ Thus the final range of our extension of the Tonks projection is the $(n-1)$-simplex (see Figure \[f:disc\].) The product of vertices of the permutohedra can be projected to a product of vertices of the simplices. First we define this product by analogy to the previously defined products of tubings of graphs. Then we will show the product to be associative via a homomorphism from the algebra of permutations. Finally we will give a formula for the product using positive integer coefficients and standard Euclidean basis elements. Let $\Delta Sym$ be the graded vector space over ${{\mathbb Q}}$ with the $n^{th}$ component of its basis given by the $n$-tubings on the edgeless graph of $n$ numbered nodes. By $D_n$ we denote the set of $n$-tubings on the edgeless graph. We write $F_{u}$ for the basis element corresponding to $u\in D_n$ and 1 for the basis element of degree 0. Graded algebra structure on vertices ------------------------------------ Now we demonstrate a product which respects the grading on $\dsym$ by following the example described above for $\ssym.$ The product in $\dsym$ of two basis elements $F_u$ and $F_v$ for $u\in D_p$ and $v\in D_q$ is found by summing a term for each shuffle $\iota \in S^{(p,q)}.$ Our term of $F_u\cdot F_v$ will be a $p+q$ tubing of the edgeless graph on $p+q$ nodes. Its tubes will include all the nodes numbered by $\iota([p]).$ We denote these by $\overline{\iota(u)}.$ In addition we include all the tubes $\hat{\iota}(t)$ for non-universal $t\in v,$ and the universal tube. We denote these by $\overline{\hat{\iota}(v)}.$ By inspection we see that in this case the union $$\overline{\iota(u)} \cup \overline{\hat{\iota}(v)} = \hat{\rho}_{\iota}(\eta(u),v).$$ Thus we write: \[d:sim\_prod\] $$F_u\cdot F_v = \sum_{\iota \in S^{(p,q)}} F_{\hat{\rho}_{\iota}(\eta(u),v)}.$$ Also 1 is a two-sided unit. An example is shown in Figure \[f:sim\]. ![The product in $\dsym.$[]{data-label="f:sim"}](simpro_sm.eps){width="\textwidth"} \[t:sim\] The product we have just described makes $\dsym$ into an associative graded algebra. First we must check that the result of the product is indeed a sum of valid $(p+q)$-tubings of the edgeless graph on $p+q$ nodes. This is clearly true, since there will always be only one node that is not a tube in any given term of the product. Associativity is shown by the existence of an algebra homomorphism $\ssym\to \dsym$ which we will see next in Lemma \[l:next\]. Let $E_n = $ the set of edges of the complete graph on $n$ nodes. Deleting these gives a projection $\Theta_n$ from the permutohedra to the simplices, as in Definition \[d:bige\]. Then we define $\hat{\Theta}_{\delta}:\ssym\to \dsym$ by $$\hat{\Theta}_{\delta}(F_u) = F_{\Theta_{n}(u)}$$ for $u$ an $n$-tubing of $K_n.$ \[l:next\] The map $\hat{\Theta}_{\delta}$ is an algebra homomorphism. The proof follows precisely the same arguments as the proof for Theorem \[t:permhom\], except that the cases are simpler. We consider $\hat{\Theta}_{\delta}(F_u\cdot F_v)$ for $u\in S_p$ and $v\in S_q$. We compare the result with $\hat{\Theta}_{\delta}(F_u)\cdot \hat{\Theta}_E(F_v).$ Each of the multiplications results in a sum of ${p+q \choose p}$ terms. It turns out that comparing the results of the two operations can be done piecewise. Thus we check that for a given shuffle $\iota$ the respective terms of our two operations agree: we claim that $$\Theta_{p+q}(\overline{\iota(u)} \cup \overline{\hat{\iota}(v)}) = \overline{\iota(\Theta_p(u))} \cup \overline{\hat{\iota}(\Theta_q(v))}.$$ On the left-hand side, $\Theta_{p+q}$ forgets all the information in the tubing it is applied to; except for the following data: which of the nodes is the only node in the universal tube and not in any other tube. This particular node is actually the node numbered by $j = \hat{\iota}(v^{-1}(q)).$ The effect of $\Theta_{p+q}$ is to create the $n$-tubing of the edgeless graph with node $j$ as the only node that is not a tube. On the right hand side $\Theta_p$ and $\Theta_q$ forget all but the value of $u^{-1}(p)$ and $v^{-1}(q)$ respectively. Then we create the tubing of the edgeless graph by first including all the nodes numbered by $\iota([p])$ and then all the nodes except node $j=\hat{\iota}(v^{-1}(q)).$ There are clearly algebra homomorphisms $\ysym\to\dsym$ and $\wsym\to\dsym$ described by the extended Tonks projections from associahedra and cyclohedra to the simplices. Formula for the product structure --------------------------------- There is a simple bijection from $n$-tubings of the edgeless graph on $n$ nodes to standard basis elements of ${{\mathbb Q}}^n.$ Let $e_m^n$ be the column vector of ${{\mathbb Q}}^n$ with all zero entries except for a 1 in the $m^{th}$ position. Associate $e_j^n = e_u$ with the $n$-tubing $u$ whose nodes are all tubes except for the $j^{th}$ node. Then use the product of $\dsym$ to define a product of two standard basis vectors of varying dimension: $e_u\cdot e_v $ is the sum of all $e_w$ for $F_w$ a term in the product $F_u\cdot F_v.$ Then: $$e_j^p\cdot e_l^q = \sum_{i=l}^{p+l}{i-1 \choose l-1}{p+q-i \choose q-l}e_i^{p+q}$$ Let $e_l^q = e_v$ for the associated tubing $v.$ The only node not a tube of $v$ is node $l.$ We need only keep track of where $l$ lands under $\hat{\iota}:[q]\to[p+q],$ where $\hat{\iota}$ is as in Definition \[d:sim\_prod\]. The only possible images of $l$ are from $l$ to $p+l,$ thus the limits of the summation. When $\hat{\iota}(l) = i$ there are several ways this could have occurred. $\hat{\iota}$ must have mapped $[l-1]$ to $[i-1]$ and the set $\{l+1,\dots,q\}$ to $\{i+1,\dots,p+q\}.$ The ways this can be done are enumerated by the combinations in the sum. Consider the example product performed in Figure \[f:sim\]. Here the formula gives the observed quantities: $$e_2^2\cdot e_2^3 = 3e_2^5 + 4e_3^5 +3e_4^5.$$ Faces of the simplex -------------------- Note that a product of tubings on the edgeless graph (with any number of tubes) is easily defined by direct analogy. Now we present a Hopf algebra with one-sided unit based upon the face posets of simplices. Tubings on the edgeless graphs label all the faces of the simplices. The number of faces of the $n$-simplex, including the null face and the $n$-dimensional face, is $2^n.$ By adjoining the null face here we thus have a graded bialgebra with $n^{th}$ component of dimension $2^n.$ It would be of interest to compare this with other algebras of similar dimension, such as $\qsym$. Let $\tilde{\Delta Sym}$ be the graded vector space over ${{\mathbb Q}}$ with the $n^{th}$ component of its basis given by the tubings on the edgeless graph of $n$ numbered nodes, with one extra basis element included in each component: corresponding to the null facet $\emptyset_n$ is the collection consisting of all $n$ of the singleton tubes and the universal tube. By ${\mathcal D}_n$ we denote the set of $n$-tubings on the edgeless graph, together with $\emptyset_n$. We write $F_{u}$ for the basis element corresponding to $u\in {\mathcal D}_n$ and 1 for the basis element of degree 0. Now we define the product and coproduct, with careful description of the units. Let $u \in {\mathcal D}_p$ and $v\in {\mathcal D}_q.$ For a given shuffle $\iota$ our term of $F_u\cdot F_v$ will be indexed by an element of ${\mathcal D}_{p+q}$ which will include all the nodes numbered by $\iota([p]).$ In addition we include all the tubes $\hat{\iota}(t)$ for non-universal $t\in v,$ and the universal tube. Thus the product is an extension of Definition \[d:sim\_prod\], with a redefined right multiplication by the unit: \[d:sim\_prod2\] $$F_u\cdot F_v = \sum_{\iota \in S^{(p,q)}} F_{\hat{\rho}_{\iota}(\eta(u),v)} ;~~ 1\cdot F_u = F_u ;~~ F_u\cdot 1 = F_{\emptyset_p}.$$ An example is shown in Figure \[f:sim2\]. ![The product in $\tilde{\dsym.}$[]{data-label="f:sim2"}](simpro_full_sm.eps){width="\textwidth"} The coproduct is defined simply by restricting an element of ${\mathcal D}_n$ to its subgraphs induced by the nodes $1,\dots, i$ and $i+1,\dots n.$ Given a tubing $u$ of the edgeless graph on $n$ vertices we can find tubings $u_i$ and $u_{n-i}$ as follows: for each tube $t\in u$ we find the intersections of $t$ with the two sub-graphs (also edgeless) induced by the nodes $1,\dots, i$ and $i+1,\dots, n$ respectively. $$\Delta (F_u) = \sum_{i=0}^{n}F_{u_i}\otimes F_{u_{n-i}}.$$ An example is shown in Figure \[f:sim\_cop2\]. ![The coproduct in $\tilde{\dsym.}$[]{data-label="f:sim_cop2"}](simpro_cop_sm.eps){width="\textwidth"} \[t:hopf\] The product and coproduct just defined form a graded bialgebra structure on $\tilde{\Delta Sym}$, and therefore a (one-sided) Hopf algebra. Associativity of the product is due to the observation that the result of multiplying a series of basis elements only depends on the final operand. Coassociativity of the coproduct follows from the fact that terms of both $(1\otimes \Delta)\Delta F_u$ and $(\Delta\otimes 1)\Delta F_u$ involve simply splitting the edgeless graph into three consecutive pieces, and restricting $u$ to those pieces. Now we demonstrate that the product and coproduct commute; that is, $\Delta(F_u\cdot F_v) = (\Delta F_u) \cdot (\Delta F_v).$ We describe a bijection between the terms on the left-hand and right-hand sides, which turns out to be the identity map. Let $u \in {\mathcal D}_p$ and $v\in {\mathcal D}_q.$ A term of the left-hand side depends first upon a $(p,q)$-shuffle $\iota$ to choose $p$ of the nodes of the $(p+q)$-node edgeless graph. Then after forming the product, a choice of $i \in 0,\dots,p+q$ determines where to split the result into the pieces of the final tensor product. Let $m= |\{x\in\iota([p]) ~:~ x \le i\}|.$ Thus $m$ counts the number of nodes in the image of $\iota$ which lie before the split. To create a term of the right hand side, we first split both $u$ and $v,$ then interchange and multiply the resulting four terms as prescribed in the definition of the tensor product of algebras. Our matching term on the right-hand side is the one formed by first splitting $u$ after node $m,$ and $v$ after node $i-m.$ Then in the first multiplication choose the $(m,i-m)$-shuffle $\sigma(x) =\iota(x)$, and in the second use the $(q-m,q-i+m)$-shuffle $\sigma'(x) = \iota(x+m)-i.$ These choices define an identity map from the set of terms of the left hand side to those on the right. $\tilde{\dsym}$ is closely related to the free associative *trialgebra* on one variable described by Loday and Ronco in [@LR3]. In [@LR3 Proposition 1.9] the authors describe the products for that trialgebra. Axiomatically, the first two products automatically form a *dialgebra*. The sum of these two products appears as two of the terms of our shuffle-based product! We leave it to an interested reader to uncover the precise relationship, perhaps duality, between the two structures. | Mid | [
0.5903954802259881,
26.125,
18.125
] |
Q: A script and keybindings to look for VIM commands in a file, and then execute them on that file This is a followup question to Auto sorting of lists of include files, which explains the motivation. EDIT I am looking for a script and/or keybindings to look for VIM commands in a file, and then execute them on that file. As mentioned in the referenced question, the idea is that the script and the key bound to it, will do the following: Look for lines that obey a certain patter in a file. E.g., '// vim: some vim command and execute these in sequence. A: A possible solution is to add the following lines to your .vimrc " mapping to execute the function nmap <F4> :call ExecuteCommandsFromFile()<CR> function! ExecuteCommandsFromFile() " The pattern which will indicate the commands let l:pattern="'// vim: " let l:res=1 " Go to the first line of the file normal gg " While some commands are found in the file while search(l:pattern, "We") != 0 " Get the position of the text representing the command let l:start=col('.') let l:end=col('$') " Get the command let l:line=strpart(getline('.'), l:start, l:end) " Execute the command execute l:line endwhile endfunction Notes You can replace <F4> by any key you want to use to start the function The variable l:pattern can be changed to match the pattern you'll use to indicate that the line contains a command to execute The search command in the whileloop uses the flag W not to wrap around the file and thus executing the commands only once. Edit I made this according to what I understood from the question but if the solution doesn't really fit your needs don't hesitate to give more details so that I can adapt the solution. Edit 2 I thought it could be interesting to execute the commands after parsing all the file instead of executing it as soon as the command is read. So here is a second version where the function firstly get all the commands and then execute them: function! ExecuteCommandsFromFile2() " The pattern which will indicate the commands let l:pattern="'// vim: " let l:res=1 " Go to the first line of the file normal gg " The list will contain the commands to execute let l:commands = [] " While some commands are found in the file while search(l:pattern, "We") != 0 " Get the position of the text representing the command let l:start=col('.') let l:end=col('$') " Get the command let l:line=strpart(getline('.'), l:start, l:end) " Add the command to the list call add(l:commands, l:line) endwhile " Execute each command for l:command in l:commands execute l:command endfor endfunction A possible evolution would be to refactor both of the function to get only one accepting an argument describing the mode to use... | High | [
0.690751445086705,
29.875,
13.375
] |
NEW YORK -- Justin Bieber has apologized by phone to Bill Clinton for cursing the former president and spraying his photo with cleaning fluid in a New York City restaurant kitchen earlier this year. Clinton's office said Thursday the pop star called and "he apologized and offered to help the Clinton Foundation." Clinton's office declined to provide any other details. A video released Wednesday by TMZ.com shows the 19-year-old Bieber urinating in a mop bucket as he and others race through the restaurant kitchen. Before exiting, Bieber sprays the Clinton photo and drops the f-bomb in reference to the former president. Bieber tweeted to his more than 41 million followers Wednesday night, thanking Clinton "for taking the time to talk." Bieber tweeted: "Your words meant alot. #greatguy." | Low | [
0.43902439024390205,
27,
34.5
] |
<!-- @license Copyright (c) 2015 The Polymer Project Authors. All rights reserved. This code may only be used under the BSD style license found at http://polymer.github.io/LICENSE.txt The complete set of authors may be found at http://polymer.github.io/AUTHORS.txt The complete set of contributors may be found at http://polymer.github.io/CONTRIBUTORS.txt Code distributed by Google as part of the polymer project is also subject to an additional IP rights grant found at http://polymer.github.io/PATENTS.txt --><!DOCTYPE html><html><head> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, minimum-scale=1.0, initial-scale=1.0, user-scalable=yes"> <meta name="theme-color" content="#00AA8D"> <title>Pesto by Polymer</title> <link rel="manifest" href="manifest.json"> <script src="https://unpkg.com/@webcomponents/webcomponentsjs@^2.0.0/webcomponents-loader.js"></script> <!-- Import Web Animations polyfill --> <script src="https://unpkg.com/web-animations-js@^2.0.0/web-animations-next-lite.min.js"></script> <link rel="stylesheet" href="//fonts.googleapis.com/css?family=Raleway:400,700"> <script type="module">import "../../../iron-ajax/iron-ajax.js"; import './src/recipe-app.js';</script> <style> body { margin: 0; font-family: Raleway, sans-serif; background-color: #f5f5f5; } </style> </head> <body unresolved=""> <dom-bind> <template is="dom-bind"> <iron-ajax url="data/recipes.json" auto="" last-response="{{recipes}}"></iron-ajax> <recipe-app recipes="[[recipes]]"></recipe-app> </template> </dom-bind> </body></html> | Mid | [
0.648648648648648,
33,
17.875
] |
Q: VBA error loading .NET COM Visible library I am trying to register and use a .NET library that I have created in C#.NET and up until now I have been getting Visual Studios to "Register COM" on build. I am now trying to go through the process of a how I might deploy so I have the following which registers the DLL: "%windir%\Microsoft.NET\Framework\v4.0.30319\"regasm.exe "%~dp0myDLL.dll" This is Windows XP and the folder with the batch script above and the myDLL.dll sits on the desktop. which registers the DLL file, but when I come to add a reference to it in VBA I am getting the following: Error in loading DLL I can see the library in the References list and the location looks correct. A: The answer can be found here: "Register for COM Interop" vs "Make assembly COM visible" I needed: regasm.exe /codebase /tlb path-to-dll.dll | Mid | [
0.6526610644257701,
29.125,
15.5
] |
You are not alone. A lot of people end up frustrated when trying to successfully & securely close a real estate transaction because they're using methods that just don't cut it. **You may have tried working with a non attorney owned title company. **Or maybe you have tried dealing with the lenders direct. Unfortunately, these solutions haven't worked that well and ended up leaving you without a real and lasting solution. But Now, There's an Answer that can fix that. Introducing Infinity Abstract & Title’s Title Insurance & Settlement Services. A Powerful and effective service that can help you to successfully & securely close a real estate transaction without all the headaches. Here's just a few things about Title Insurance & Settlement Services that will help you. Number 1: We’ve got the right tools and systems to close real estate transactions, which is good because this eliminates the pain and aggravation of not closing on time. Number 2: We are compliant with all CFPB and ALTA-S standards, which is a big help because as of October 3rd, 2015, all title companies will be required to follow new practice standards which Infinity Abstract & Title is up to speed on. Number 3: We have the availability to close deals within 24hrs, if everything falls within CFPB Guidelines, which is powerful because this helps with negotiation. And there's a whole lot more. Stop the Frustration of solutions that don't work and download our FREE Real Estate Buyers and Sellers Insiders Guide - This will help you answer and understand such topics as: 10 Things to Ask Your Lender; 10 Things A Real Estate Agent Should Know; The 3 Day Rule Infographic; The Value of Title Insurance; The Importance of an Owner's Title Insurance Policy; Protecting Your Investment; Preparing For Your Closing; Homeowner's Policy. TONS of information for FREE! In addition when you click to download you will receive a $100 Closing Title Premium Certificate … and a chance to receive a 15 minute legal consultation with a real estate attorney.. Absolutely FREE!! Now, act fast as this is an exclusive offer, We Will Only Be Giving Away 97 Copies. We only have a limited amount of closing title premium certificates and free 15-minute consultations with a real estate attorney. You can stop struggling to successfully & securely close a real estate transaction today. Download now! | High | [
0.7236679058240391,
36.5,
13.9375
] |
by Massive Voodoo Yet time again for another look on some new hobby material viaMV's Miniature Unpacked, but this time it is a mixture of unpacking, testing and some kind of tutorial. You might know that MV is well known to have a look on very interesting products outthere. Combined with our everyday painting of an average of eight hours since several years, we can also provide a good look on new material with practical experience. This said, we want to dig a little deeper into products of a company with you we really enjoy lately. Their products are mainly aimed for the hobby of Scale Models, at least this is what their page communicates, but we are sure this will change a lot in the future as their products are also great for our hobby of miniature painting. Let me introduce to you: Roman did get in contact with one of their products when Battlefield-Berlin sent him one bottle of "Normal Rust" and he got convinced by the result he recieved by using it. Modelmates has no shop on its own and is selling via different dealers in different countries. You can find a list of their retailers here! We are even updated that besides Battlefield-Berlin now also PK-Pro has Modelmates in stock! We are happy to announce that Modelmates is now official sponsor of MV Painting Classes and participants on our classes can find out why we like their products that much on their own, testing and experiencing them during the classes. In the following review we will take a look on theirBrick Joint Filler. In your massive jungle you can already find a review on their primers, Rust Effects, Verdigris Effects and Weathering Sprays.There will be more later on as their list of products is much bigger and MV is in the middle of experiments with them and is recieving very, very cool results. "Please know that this is just my own experience with these products. I tell you honestly what I do like and don't. I can not assure you that you will make the same experience as you might have a different taste or different requirements than I have." Roman This review I will have a look on two of Modelmates' Brick Joint Filler. Before we start in some testing we will have a look on what their homepage says about those sprays: "Opaque brick joint filler liquid creates realistic brick and stones joint. Water soluble: brush straight from pot over the full surface of the wall, filling the brick or stone joints, let fully dry, then wipe off the dry residue using a damp cotton bud leaving Brick Joint Filler trapped in the joints. Available in two sizes, 18ml and 50ml." Let's head over to a base Raffa did build and check on the brick wall there how the Brick Joint Filler works. First build up a base how you like it, and paint it with your basic colour setup you wish for it. We recommand painting it up to 70%~80% to finish before you apply the Brick Joint Filler. When testing something it is always got to get to know the product before you maybe mess up your paintwork. This being said, we took a metal cup and placed the liquid inside to have a look on it. Well it does not look like the typicall brick filler in this stage, rather like something else, but whatsoever, here we go: Placing it to the brickwall with a brush of your choice is looks like this when dried: Looks pretty rough here and there, but it dries out matte and white like we wished for. This is good, but what is even better is that you now can take a clean wet brush (not too wet) and carefully remove areas that look to rough. Clean up the surfaces of the bricks that are too packed with white now: This is really cool, as it also leaves a natural look behind on some stones, where the white still appears. One thing Raffa did was mentioning that the white is too powerful and has a lot of disturbing effect on the overall look of the base due the power of the whites. He used a watered wash from Army Painters Strong Tone to spray it gently with the airbrush to calm that white down a bit, really gentle and subtile effect: It is always very good to check back with reality if you work on your brickwall. What is happening there, what inspiration and inspiration can you get out of it when you take a closer look. Reality is the mother of all inspiration for us miniature painters. At least it should be. There are 5 Kommentare for Mu 55 - Modelmates, Brick Joint Filler Good idea indeed @Krawatte. We will give this a future try for sure! That is what we like about you jungle painters outthere, communication, throwing in your ideas and thoughts and oppinions, that is how everybody learns from another :) Thanks! @Didgman JensDepends about the gaps, just think about the scale. If you really scale such a brick wall down to 28 mm Miniatures, the bricks would not be really visible anymore. If you want them you can do them and I think they'll look fine though. @KilliakI think it will work great with Juweela bricks, but you have to put some material in between the bricks, filler, like on how building a real brick wall. I would use some Vallejo Putty 401 or Milliput for this. Post a Comment Search Massive Voodoo Newsletter FAST LINKS Welcome to the Jungle... ... MASSIVE VOODOO’s jungle, where some apes share their thoughts and ideas around their beloved passion, the hobby of miniature painting and sculpting. Feel welcome to come and check the jungle for tons of articles, interesting tutorials, creative competitions and the simple joy of happy painting hidden behind every tree. We hope that everyone finds their own banana in here, if not do not hesitate to ask the apes. We are more than happy for you to post in the comments section to help turn this jungle into the lush, overgrown painting corner we hope it will become. | Mid | [
0.58294930875576,
31.625,
22.625
] |
At first, there were 2 apples on the tree. After the wind blew, one apple fell on the ground. So there where no apples on the tree and there were no apples on the ground. *apples => more than one apple Another solution(non tricky one) The wind blew so hard that the apples fell of the tree and blew along the ground. A man of faith visits the holy land where three temple are erected in a row offering a surreal divinity to the place. Awestruck at the sight of the magnificent temples, he visits the first temple where he finds that the number of flowers in his basket increases to double the number as soon as he sets his foot inside the temple. Astonished by the miracle he is completely happy and seeks it as a blessing of his god. He offers a few flowers to the stone idol of god and moves out. Then he visits the second temple, where the same miracle happens again. The number of flowers in his basket again double up in number. With a smile on his face, he offers a few of flowers to the stone idol again and walks out after praying. The moment he enters the third temple, the number of flowers increases to double again. Now he feels entirely blessed. He offers all the flowers at the feet of the stone idol and walks out in a moment of bliss. When he walks out, he has no remaining flowers with him. He offered equal number of flowers at each of the temple. What is the minimum number of flowers he had before entering the first temple? How many flowers did he offer at each temple? Let m be initial number of flowers and n be the flowers offered at each temple by the man. Initial flowers = m After stepping into the first temple = 2m Flowers offered at the first temple = n Remaining flowers = 2m – n Imagine that you are travelling to a village. You happen to reach a point in the road where there is a fork. There are two ways that you can go into but only one amongst them is correct and leads to the village. You happen to see two men standing on the fork and you can ask them for the direction. To your bad luck, one amongst the two men always lies and the other one always says the truth. But you do not know who is a liar and who is not. At that point of the situation you are allowed to ask only one question to any one of the men standing there. You can ask this question to any one person, "if I ask the man who is next you: which is the correct way and the road to the village, what would the person next to you answer?" If you happened to ask this question to the liar, he will show you the wrong way. And if you happened to ask this question to the one who says truth, he will also show you the wrong way. Once you are done with this, take the other way. This will lead you to the village A worker is to perform work for you for seven straight days. In return for his work, you will pay him 1/7th of a bar of gold per day. The worker requires a daily payment of 1/7th of the bar of gold. What and where are the fewest number of cuts to the bar of gold that will allow you to pay him 1/7th each day? Day One: You make your first cut at the 1/7th mark and give that to the worker. Day Two: You cut 2/7ths and pay that to the worker and receive the original 1/7th in change. Day three: You give the worker the 1/7th you received as change on the previous day. Day four: You give the worker 4/7ths and he returns his 1/7th cut and his 2/7th cut as change. Day Five: You give the worker back the 1/7th cut of gold. Day Six: You give the worker the 2/7th cut and receive the 1/7th cut back in change. Day Seven: You pay the worker his final 1/7th. At a restaurant downtown, Mr. Red, Mr. Blue, and Mr. White meet for lunch. Under their coats they are wearing either a red, blue, or white shirt.Mr. Blue says, 'Hey, did you notice we are all wearing different colored shirts from our names?' The man wearing the white shirt says, 'Wow, Mr. Blue, that's right!' Can you tell who is wearing what color shirt? Six identical glasses are in a row. The first three glasses are filled with juice, and the last three glasses are empty. By moving only one glass, can you arrange them so that the full and the empty glasses are alternate? If you take a look closely, you will acknowledge the fact that every symbol in the given figure is somehow associated with the surrounding one’s position. The upside-down spade is used to the left of a right-side-up heart every time. Step 5 is invalid, because we are dividing by (x-y), and since x=y, we are thus dividing by 0. This is an invalid mathematical operation (division by 0), and so by not following basic mathematical rules All Digits [0-9] follow the following pattern: There is one occurrence of all digits in every 10 numbers Example. Digit-9 occurred one time between 10 and 19 in 9, between 20 and 29 in 29 However, for tens(91,92,93...99) and hundreds (900,901.... 999), the occurrence is much more. Since we have included 1000, Therefor 1 is the most occurred digit. Note: Despite three '0s' in 1000, 0 is not most occurred digit as they don't have tens and hundreds like other digits. | Mid | [
0.573333333333333,
32.25,
24
] |
Q: Bad image error on any exe files in Windows 10 I recently dual booted my Acer aspire E15 laptop with Ubuntu. The Ubuntu was working fine but when I opened the windows from grub menu, wireless networks like wifi wasn't detected and any exe files are not opening rather a bad image error is popping up which reads: “Example.exe – Bad Image” “C:\Windows\AppPatch\example.dll is either not designed to run on Windows or it contains an error. Try installing the program again using the original installation media or contact your system administrator or the software vendor for support. Error status 0xc000012f” It comes up when I open any kind of exe files including even task manager. I even deleted Ubuntu and included the partition created by Ubuntu into C drive. I guess I have made a huge mess of the PC by changing the settings. I tried regedit method as well but the value in AppInit_DLLs was null by default. I even tried resetting the pc but after 11% it is saying can't proceed,undoing the changes. Somebody please help, I have watched plethora of YouTube videos on this topic but to no avail. I did these changes in my bios https://askubuntu.com/questions/771455/dual-boot-ubuntu-with-windows-on-acer-aspire as well given by Umar having 5 upvotes during dual booting. How can I undo everything just like my new computer with windows 10 or fix this problem. A: Try contacting Microsoft Remote Assistance Support, they will format your PC via remote assistance. It worked for me. | Mid | [
0.542725173210161,
29.375,
24.75
] |
[Treatment of defects of soft tissue and sternum, as postoperative complications of A-C bypass, case report]. Medial sternotomy is optimal approach for great number of heart surgery. Deep infection of sternum and mediastinis are very rear, but very dangerous complications followed by high rate of morbidity and mortality. Factors which can be responsible for these complications are numerous: post operation bleedings, surgery reinterventions, extended mechanical ventilation, liver chronic diseases, older age, diabetes, previous irradiation therapy, respiratory obstructions and use of steroids. Clinical signs for these complications are: red skin around the surgical wound, leaking, dehiscence, increased body temperature and instability of sternum. Early diagnosis, adequate antimicrobial therapy, and aggressive surgical and multidisciplinary approach in initial phase, are base for successful treatment. Surgical treatment most often assumes use of flaps. Our main objective in this work was to present treatment of defect of sternum and soft tissues, after triple aorto-coronary bypass. After the surgery patients got slack of sternum's ficsation and reficsation. With satisfactory respiratory function, corrections of defect was achieved by omentum and bipedicular myocutan flaps. (m. pectoralis major flap). There was no complications. | Mid | [
0.643939393939393,
31.875,
17.625
] |
Get five ebooks on Easy Meals for Busy Families for just $7.40! It contains five ebooks with more than 125 simple recipes that are delicious and satisfying but don’t require a lot of prep time! Get everything from delicious slow cooker meals and main dish salads to crowd-pleasing comfort foods for only $7.40 (a savings of over 70%) for one week only. Crock On! by Stacy Myers Crock On! A Semi-Whole Foods Slow Cooker Cookbook by Stacy Myers features 40 all-original slow cooker recipes covering everything from soups to desserts. This full-color ebook includes high-quality photos, step-by-step instructions and reviews from recipe testers for every single recipe so that you can take advantage of this handy tool without sacrificing quality or taste! 20-Minute Meals by Leigh Ann Dutton If you’re looking for a plan to help you avoid the takeout crutch, 20-Minute Meals has everything you need. With four weeks of easy, 20-minute meals plus meal planning tools, printables and more, you’ll have the resource you need to fight the urge to eat out and know you’re serving your family healthy, nutritious meals in the process. Feast in 15 by Tiffany King Add even more recipes to your repertoire with Feast in 15: Speed Cooking Weeknight Dinners, which includes recipes like Italian Nachos, Meatball Gyros, Garlic Lime Shrimp and more that your family will love. Got Dinner? by Susan Heid Got Dinner? Quick & Easy Recipes from the Confident Mom features more than 40 favorite dinner recipes from Susan’s kitchen that are not only quick and easy but also easy on the family budget. Plus, find great conversation starters to encourage meaningful conversation at mealtimes! Eat This by Renee Tougas Eating more vegetables is an important part of almost any food philosophy, and Eat This: Meal Salads & Whole Food Dressings shows you how to make meal-sized salads that are not just delicious but satisfying for a hungry and growing family as well. | Mid | [
0.6538461538461531,
31.875,
16.875
] |
Sarpogrelate diminishes changes in energy stores and ultrastructure of the ischemic-reperfused rat heart. Although the involvement of serotonin in exacerbating vascular abnormalities in ischemic heart disease has been established, its role in mediating changes in cardiac function due to ischemia reperfusion (IR) is poorly understood. The aim of this study was to investigate the effect of a serotonin blocker, sarpogrelate (5-HT2A antagonist), in preventing cardiac injury due to IR. Isolated rat hearts were subjected to 30 min of global ischemia followed by 1 h of reperfusion. Sarpogrelate (50 nM-0.9 microM) was infused 10 min before ischemia as well as during the reperfusion period. The IR-induced changes in left ventricular developed pressure, left ventricular end diastolic pressure, rate of pressure development, and rate of pressure decay were attenuated (P < 0.05) with sarpogrelate treatment. Sarpogrelate also decreased the ultrastructural damage and improved the high energy phosphate level in the IR hearts (P < 0.05). This study provides evidence for the attenuation of IR-induced cardiac injury by 5-HT2A receptor blockade and supports the view that serotonin may contribute to the deleterious effects of IR in the heart. | Mid | [
0.652631578947368,
31,
16.5
] |
Introduction {#Sec1} ============ Eukaryotic DNA is packaged in the form of chromatin, which itself is organized in the form of nucleosomes. In turn, each nucleosome consists of two super-helical turns of DNA wrapped around a histone (H) octamer consisting of one H3/H4 tetramer and two H2A/H2B dimers^[@CR1]^. The nucleosomes are organized into higher order structures stabilized by histone H1. It is widely known that specific amino acid residues of histone tails are post-transcriptionally modified due to acetylation, phosphorylation, methylation, ubiquitylation, and SUMOylation, although all these modifications are reversible^[@CR2],[@CR3]^. Post-transcriptional methylation of specific amino-acid residues in histone proteins at specific lysine (K) residues is an epigenetic modification that regulates expression of many genes associated with these modified histones. Besides other modifications, these epigenetic modifications are mediated by proteins called histone methyltransfersaes (HMTase). A fairly large number of these proteins contain a SET domain, thus constituting a family of SET-domain methyltransferases. All HMTases belong to this family of SET domain proteins, with the solitary exception of the HMTase that is involved in methylation of H3K79^[@CR4]--[@CR6]^. In plants, histone methylation has been reported in lysine residues at positions 4, 9, 27, 36 and 79 of H3 and position 20 of H4^[@CR7],[@CR8]^, which are all important epigenetic marks. Each of these lysine residues may carry one, two or three methyl residue(s) so that the corresponding states are described as mono-, di- and tri-methylation states. In addition to catalyzing methylation of histone proteins, SET domain proteins are also known to be involved in methylation of few other proteins including large subunit of the Rubisco holoenzyme complex^[@CR9]^. The acronym SET \[**S**u(var)3--9, **E**nhancer-of-zeste and **T**rithorax\] was derived from three different conserved regions identified in the following three different proteins in *Drosophila*: (i) SUPPRESSOR OF VARIEGATION 3--9 \[SU(VAR)3--9\], a modifier of position-effect variegation^[@CR10]^; (ii) ENHANCER OF ZESTE \[E(Z)\], the polycomb-group chromatin regulator^[@CR11]^ and (iii) TRITHORAX (TRX), the trithorax-group chromatin regulator^[@CR12],[@CR13]^. The SET domain itself consists of \~ 130--150 amino acids. Some conserved residues within the SET domain sequence form a knot-like structure (catalytic core), which constitutes the site for histone methyltransferase (HMT) activity^[@CR14]^; methylation occurs, when AdoMet (methyl group donor) and the substrate lysines (e.g. H3Ks) are brought into close proximity. The hydroxyl group of a highly conserved tyrosine in the catalytic core of the SET domain forms Van der Waals interactions with the ribose of AdoMet and also deprotonate the amino group of the target lysine residue^[@CR15]^. This deprotonation primes the lysine in the side chain to make a nucleophilic attack on the methyl group of the AdoMet molecule, thus facilitating the transfer of methyl group to the lysine residue, resulting in the production of methylated histone and the co-factor AdoHcy (byproduct of AdoMet demethylation)^[@CR16]--[@CR19]^. The crystal structures of SET-domain proteins suggest that the SET domain is folded into several small β sheets^[@CR20]^. Often, slight variation is caused in the conformation of SET domain due to β-sheets. Such conformational changes modify the specificity of the target residue for methylation and enable methyltransferases to target several different residues. A SET domain is often flanked by N-terminal pre-SET and C-terminal post-SET domains. The pre-SET domain region contains nine cysteine residues that form triangular zinc clusters, which bind the zinc atoms and stabilize the structure. The C-terminal post-domain, on the other hand, has three cysteine residues which participate in the formation of a zinc-binding site. It has been shown that both N- and C-terminal regions flanking the SET-domain are also required for HMTase activity^[@CR18]^. The interaction between the pre-SET domain and the catalytic center of the SET domain is important for enzyme function^[@CR16]^. The SET-domain proteins have now been found in all eukaryotes/prokaryotes except some lower algae. Among plants, these proteins have been best characterized in *Arabidopsis thaliana*. The genes encoding these proteins have been variously classified in different studies using different criteria (including the site of methylation); following are some details of four such studies involving classification of SET domain genes: (i) 37 Arabidopsis genes were placed in four classes on the basis of characteristics of SET domain, cysteine-rich region and additional conserved domains^[@CR21]^; (ii) 32 Arabidopsis genes and 22 maize genes were placed in five classes (I-V), based on phylogenetic analyses and domain organization^[@CR22],[@CR23]^; the genes in a particular class were further classified in one (class IV) to seven (class V) orthology groups on the basis of position of SET domain and presence of other domains, the total number of orthology groups in five classes being 19. This system of placement of genes in orthology groups within a class (for classes I to V) was followed in the present study also; (iii) 47 Arabidopsis genes, 37 rice genes and 35 maize genes were placed in seven classes, on the basis of annotation using Pfam and ChromDB database^[@CR23]^; and (iv) 31 Arabidopsis genes encoding proteins with SET domain were placed in five classes^[@CR24]^. On the basis of their domain architectures and/or differences in enzymatic activity, a consensus classification containing seven classes has emerged; a summary of these seven classes (along with orthology groups in each class) is presented in Table [1](#Tab1){ref-type="table"}. Proteins within each class often share a higher level of similarity in the SET domain, relative to those from different classes. According to this classification, classes I-V have proteins with complete SET domain whereas proteins belonging to classes VI and VII have an incomplete/truncated SET domain. Members of classes I-VI are known to be involved in methylation of histone proteins, whereas members of class VII are involved in methylation of non-histone proteins. Members of individual classes of SET domain proteins have specificity to the following substrates: class I for H3K27, classes II and VI for H3K36, classes III and IV for H3K4, and class V for H3K9 (Table [1](#Tab1){ref-type="table"})^[@CR23]^.Table 1Details of 7 classes of SET domain proteins and the corresponding genes in *Arabidopsis thaliana*.Class of SET protein; methylation siteOG\*Genes in OG\*Domains presentFunctionI. Enhancer of Zeste \[E(z)\] homologs; H3K271*MEA* (*SDG5*)CXC (cysteine-rich region), SETRepress homeotic gene expression2*CLF* (*SDG1*)3*SWN* (*SDG10*)II. ASH1 homologs and related proteins (OGs based on position of SET domain); H3K361*ASHH3* (*SDG7*), ASHH4 (SDG24)AWS, SET, Post-SETPositive regulator of homeotic gene expression2*ASHR3* (*SDG4*)PHD, AWS, SET, Post-SET3*ASHH1* (*SDG26)*Zf, AWS, SET, Post-SET4*ASHH2* (*SDG8*)AWS, SET, Post-SET, CWIII. Trithorax homologs and related proteins ; H3K41*ATX1* (*SDG27*), *ATX2* (*SDG30*)SET, Post-SET, PWWP, FYRN, FYRC, PHDPositive regulator of homeotic gene expression2*ATX3* (*SDG14*), *ATX4* (*SDG16*), *ATX5* (*SDG29*)SET, Post-SET, PWWP, PHD3*ATXR3* (*SDG2*)SET, Post-SET4*ATXR7* (*SDG25*)SET, Post-SETIV. Proteins with a SET and a PHD domain; H3K41*ATXR5* (*SDG15*), *ATXR6* (*SDG34*)SET, PHDCell cycle regulation or DNA replicationV. Suppressor of variegation \[Su(var)\] homologs (SUVH) and relatives (SUVR); H3K91*SUVH1* (*SDG32*), *SUVH3* (*SDG19*), *SUVH7* (*SDG17*), *SUVH8* (*SDG21*)YDG, Pre-SET, SET, Post-SETHeterochromatin formation and DNA methylation in locus specific manner2*SUVH4* (*SDG33*), *SUVH6* (*SDG23*)YDG, Pre-SET, SET, Post-SET3*SUVH2* (*SDG3*), *SUVH9* (*SDG22*)YDG, Pre-SET, SET, Post-SET4*SUVR3* (*SDG20*)Pre-SET, SET, Post-SET5*SUVH5* (*SDG9*)YDG, Pre-SET, SET, Post-SET6*SUVR1* (*SDG13*), *SUVR2* (*SDG18*), *SUVR4* (*SDG31*)WIYLD, Pre-SET, SET, Post-SET7*SUVR5* (*SDG6*)Pre-SET, SET, Post-SETVI. proteins with an interrupted SET domain; H3K36NA*ASHR1* (*SDG37*), *ASHR2* (*SDG39*), *ATXR1* (*SDG35*), *ATXR2* (*SDG36*), *ATXR4* (*SDG38*)SET domain of ASHR1 interrupted by Zf-MYND domainRestricts cell cycle progressionVII. RBCMT and other SET-related proteins; methylation of non-histone proteinsNA*SDG40*, two anonymous proteins (corresponding to At2g18850 and At5g14260) and five uncharacterized proteinsSET domainCarbon fixation\*OG-Number of orthology group; NA-not available. Proteins with SET domain have actually been identified in chromatin-associated complexes that are formed during regulation of gene expression^[@CR25]^. Through regulation of gene expression, SET domain proteins are also known to play a crucial role in diverse physiological processes in plants, including control of flowering time, leaf morphogenesis, floral organogenesis and seed development^[@CR26],[@CR27]^. The genes encoding SET domain proteins that were the first to be characterized included the following: *CURLY LEAF* (*CLF*) and *MEDIA* (*MEA*), the latter also described as *FERTILIZATION INDEPENDENT SEED DEVELOPMENT 1* (*FISD1*) in *Arabidopsis thaliana*^[@CR24],[@CR28]^. Characteristic features of plant SET domain proteins include chromatin binding and histone methylation that were first reported for proteins encoded by tobacco gene *NtSET1* and *Arabidopsis* gene *KRYPTONITE* (*KYP*)^[@CR29],[@CR30]^. The availability of complete genome sequences for many plant species allowed identification of families of SET domain genes in a number of species including *Arabidopsis thaliana*^[@CR21],[@CR23]^, *Oryza sativa* (rice)^[@CR31]^, *Zea mays* (maize)^[@CR32]^, *Setaria italica* (foxtail millet)^[@CR33]^, *Brassica rapa* (field mustard/turnip)^[@CR34]^, *Vitis vinifera* (grapes)^[@CR35]^ and *Gossypium raimondii* (cotton)^[@CR36]^. The present study conducted for the first time in wheat, involved identification of 166 SET domain genes (SDGs), of which only 130 genes encoded proteins with complete SET domain (representing 117 unique genes excluding 13 duplicate genes). These genes were subjected to a systematic *in silic*o analysis, which included the study of gene structure, chromosomal distribution, gene duplication events, comparative genomics, promoter sequences and the presence of binding sites for miRNAs and genes for lncRNAs. The corresponding proteins were also subjected to a detailed study, which included the study of a variety of features including the following: (i) structure of proteins in terms of length and amino acid sequence; (ii) occurrence of functional domains and different classes of motifs; (iii) functional annotation; (iv) physicochemical properties, and (v) phylogenetic relationships. The study also included in silico analysis of expression of these genes in different tissues at different developmental stages under drought and heat stress using available expression database. Seven (7) representative SET genes were also used for qRT-PCR involving analysis of the expression of these SET domain genes under the following three contrasting conditions: (i) water stress using the two contrasting wheat genotypes, namely tolerant cv. C306 and sensitive cv. HD2967; (ii) heat stress using tolerant cv. HD2985 and sensitive cv. HD2329; and (iii) wheat-leaf rust infection, using a pair of NILs including the susceptible cv. HD2329 and its resistant NIL (carrying the gene *Lr28*). The study provides a strong base for further characterization and functional validation of SET domain genes in wheat. Results {#Sec2} ======= During the present study, using reference wheat genome sequence, we identified and characterized 166 SDGs and described them as TaSDGs to specify that they belong to wheat. In the published literature, different numbering systems were used for different plant species (1--99 for Arabidopsis; 101--199 for maize, etc.). The 166 TaSDGs were labeled following numbering system used earlier for Arabidopsis^[@CR22],[@CR23]^. Since only \~ 40 types of Arabidopsis genes were known and labeled as SDG1 to SDG40, additional numbers were used, wherever necessary, so that TaSDGs1 to TaSDG51 were available in the present study. Homoeologues were given the same numbers and distinguished using identity of homoeologous chromosomes (1A, 1B and 1D, etc.). Also, if TaSDGs having similarity to one Arabidopsis gene belonged to more than one homoeologous groups, these were distinguished by using alphabets a, b, c, etc. after the number (e.g. TaSDG34a, b, c, d). Identification of TaSDGs and their assignment to chromosomes {#Sec3} ------------------------------------------------------------ The 166 TaSDGs identified as above, were placed in seven classes (class I--VII) on the basis of their similarity with SDGs in other diploid species (Supplementary Table S2). However, the proteins encoded by only 130 SDGs had full length SET domain; these 130 SDGs belonged to six of the seven (excluding class VI) classes and were distributed on all the 21 chromosomes \[with three sub-genomes (A, B and D) and seven homoeologous groups (1--7)\] (Fig. [1](#Fig1){ref-type="fig"}). Two genes, namely *TaSDG34a* and *TaSDG31d*, could not be assigned to any of the 21 chromosomes. Of the remaining 128 genes, the maximum number of genes were present in homoeologous group 3 (32), followed by group 2 (24), 5 (22), 6 and 1 (14 on each group), 7 (13) and group 4 (9). Among individual chromosomes, 3A carried the maximum of 12 genes, while 4A, 4B and 4D each carried a minimum of three genes. Almost equal number of genes were distributed on the three sub-genomes as follows: 44 genes on B sub-genome, 42 genes each on A and D sub-genomes (Fig. [1](#Fig1){ref-type="fig"}). Most genes were located in the terminal regions of chromosomes; only few genes were located in the sub-terminal or centric positions (Fig. [1](#Fig1){ref-type="fig"}). The above 128 SDGs could be placed in three sets, depending on their occurrence on all the three, or on only two or only one homoeologous groups: (i) 84 genes constituted 28 sets (each set with one gene on each of the three homoeologues); three TaSDGs belonging to each of these sets of homoeologues were homologous to one of the 20 SDGs of Arabidopsis, sometimes more than one set being homologous with the same Arabidopsis SDG. (ii) 12 genes comprised six sets of two homoeologues each distributed on two of the three sub-genomes of wheat (3 pairs on A/B, 2 pairs on A/D, and 1 pair on B/D), (iii) 6 genes had no homoeologues and were independently distributed on six individual chromosomes (5A, 2B, 3B, 3D, 4D and 7D) (Supplementary Table S2).Figure 1Chromosomal localization of TaSDGs on 21 chromosomes of wheat. The chromosome numbers are indicated on top of chromosomes. On each chromosome, the gene names are indicated on the right side and their physical positions are indicated on the left side. The TaSDGs were mostly located in the terminal regions and only a few TaSDGs were located in the sub-terminal or centric regions of different chromosomes. The figure was drawn using MapInspect software (<https://www.plantbreeding.wur.nl/UK/> software_map-inspect.html). Of the 130 genes (each encoding protein with complete SET domain), 13 genes had duplicate copies; the duplications were either tandem or interspersed. The values of Ka (non-synonymous substitutions), Ks (synonymous substitutions) and Ka/Ks ratios for all the 13 duplicate (5 tandem and 8 interspersed) gene pairs is presented in Supplementary Table S3. The Ka/Ks ratio was \< 1 for nine duplicate gene pairs, and was \> 1 for three duplicate gene pairs (Ka/Ks ratio for the remaining one pair of duplicate genes could not be calculated, since Ka = Ks = zero). Estimates of timeline for divergence of duplicate genes were also calculated on the basis of Ka/Ks ratio, and were found to be in the range of 1.88--3.65 MYA for the origin of tandem duplications, and 1.65--6.65 MYA for interspersed duplications. Structure analysis of TaSDGs {#Sec4} ---------------------------- Considerable variation was observed in the lengths of individual TaSDGs (867--22,640 bp), their corresponding cDNAs (819--7,516 bp) and CDSs (819--6,765 bp). Variation was also observed in the number of exons (1--24) and introns (0--23) in individual TaSDGs; 35 of the 73 TaSDGs in class V had no introns. Distribution of intron phases was as follows: phase 0 (58.41%), phase 2 (23.53%) and phase 1 (18.06%). Maximum number of genes (65) have all the three intron phases (0, 1, 2) followed by 14 genes having two phases (0 and 2); remaining 15 genes had one or two intron phases (Supplementary Figs. S1a-S1f.). Eighty five (85) TaSDGs each had only a single transcript while the remaining 45 genes had each 2--7 splice variants. The summary of the results of structure analysis of TaSDGs is presented in Table [2](#Tab2){ref-type="table"} and detailed information is available in Supplementary Table S4.Table 2A summary of the variation in the lengths of TaSDGs, cDNA and CDS belonging to six different classes in wheat.Classes of genesRange of gene lengths (bp)Range of cDNA lengths (bp)Range of CDS lengths (bp)Range of number of exons/geneRange of number of transcripts/geneI7,367--13,5172,907--3,4292,406--2,90715--172--4II4,481--22,6401,068--6,8871,017--5,49910--172--3III2,221--17,5001,278--7,5161,278--6,7958--242--7IV1,483--3,946819--1532819--1,0925--60V867--20,933867--5,817867--4,8991--152--5VII2,306--9,2231649--3,7441,491--3,7445--142 Promoter analysis allowed identification of elements for basal transcription (TATA box and CAAT box) as well as specific cis-regulatory response elements (light responsive, tissue specific, biotic and abiotic stress responsive) within 1 kb 5′ upstream sequence of each of the 130 TaSDGs. The details of these elements for basal transcription and specific response elements is provided in Supplementary Table S5. Eleven (11) response elements were identified which could be grouped as follows: (i) two response elements for biotic stress, namely GARE and TC rich repeat, and (ii) nine response elements for abiotic stress, namely, ARE, ABRE, P-box, CCATT, LTR, MBS, GARE, GC and TCA \[one response element (GARE) was common between biotic and abiotic stresses\]. These response elements were identified in 127 of 130 TaSDGs. However, tissue specific response elements were present in relatively fewer genes (33 of 130). Some response elements were present in multiple copies (Supplementary Table S6). Promoter sequences of only 47 of 130 genes had transcription factor binding sites (TFBS) related to nine families of transcription factors (ERF, C2H2, BBR-BPC, Dof, MIKC-MADS, MYB, GATA, NAC and Nin-like). Of these 47 genes, the promoters of 33 genes each had a single TFBS; promoters of the remaining 14 genes had 2--6 TFBS (Supplementary Table S7). TFBS for ERF was present in 25 genes followed by C2H2 (6 genes), BBR-BPC (5 genes), Dof (4 genes), MIKC-MADS/MYB (2 genes each). A solitary TFBS was present in each of the remaining genes and were meant for binding of TFs belonging to one of the following TF families i.e. GATA, NAC and Nin-like TF. As many as 196 SSRs were detected in different genic regions (exons, introns, UTRs) of 96 of the 130 TaSDGs. The SSRs included mononucleotide to octanucleotide repeats. The number of SSRs per TaSDG varied from 1 to 10 (Supplementary Table S8). Trinucleotide repeats were most abundant (79 SSRs) followed by hexanucleotide repeats (47 SSRs), tetranucleotide repeats (24 SSRs), and others. A total of 42 TE were also identified in 25 of the 130 TaSDGs. These TEs were mainly DNA transposons (En/Spm) and retro-elements \[LTR (Copia and Gypsy) and non-LTR (SINE)\] (Supplementary Table S9). Target sites for some miRNAs and gene sequences for some lncRNAs were also available in TaSDGs. Nearly 20% of TaSDGs (27/130) had target sites for 18 different miRNAs. The promoters of only two TaSDGs (*TaSDG22b-4D* and *TaSDG22c-3D*) each had target sites for two different miRNAs. The expression of TaSDGs with target sites for miRNAs were apparently inhibited through post-transcriptional cleavage except the following four miRNAs, which were found to inhibit expression of the target genes at the translational level: (i) tae-miR1120c-5p inhibiting genes *TaSDG1b-7D* and *TaSDG6-6A/B,* (ii) tae-miR1122b-3p inhibiting gene *TaSDG1b-7D*, (iii) tae-miR1137b-5p inhibiting gene *TaSDG17a-3A,* and (iv) tae-miR1130b-3p inhibiting the gene *TaSDG33b-1D* (Supplementary Table S10). Forty nine (49) of 130 TaSDGs also carried genes (or parts thereof) encoding as many as 122 lncRNAs, with a range of 1--10 lncRNAs within the same TaSDG, but majority of TaSDGs (24 of 49) each carried a gene for a single lncRNA. The length of gene sequences for lncRNAs ranged from 201--3,64,413 bp, the maximum size of lncRNA genes, sometimes exceeding the maximum lngth of TaSDG, so that the TaSDG carried only part of a gene for lncRNA (Supplementary Table S11). Structure analysis of TaSDG proteins {#Sec5} ------------------------------------ A summary of the details about lengths of proteins, their molecular weights and other important features are available in Table [3](#Tab3){ref-type="table"} (more details are available in Supplementary Table S12). Taken together, the number of positively charged amino acids was greater (26--1,339) relative to negatively charged amino acids (32--342). The TaSDG proteins also contained some important domains other than SET domain. These other domains included the following: AWS, WIYLD, Pre-SET, PHD, PWWP, FYRC, FYRN, Post-SET, YDG, Zf, CXC (Supplementary Table S13). It is on the basis of these domains that TaSDG proteins were grouped into six different classes (except class VI). TaSDGs within classes I-V were further classified into one (class IV) to seven (class V) orthology groups, as done in earlier studies^[@CR22],[@CR23]^ (for details, see Supplementary Table S13).The distribution of the motifs in TaSDG proteins belonging to the six different classes (I-V and VII) is presented in Supplementary Table S14. The proteins within a class were also examined for common motifs, which ranged from 2 (class III) to 18 (class I). Among these motifs, some novel motifs were also identified; these novel motifs within a class ranged from one (class II) to 11 (class I) (for details of motif sequences, see Supplementary Table S14).Table 3A summary of the different chracateristics of proteins encoded by TaSDGs in wheat.ClassPr. lengthMol wtPIPRNRIIAIGRAVY(Range)(Range)(Range)(Range)(Range)(Range)(Range)(Range)I801--89089.1--99.56.6--8.7107--142111--12450--5760.5--65.30.13II338--1,33239.1--201.74.8--9.246--23042--24246--7560.3--74.70.48III425--2,26448.7--255.56.4--9.574--1,33978--34239--5962.7--76.20.26IV272--36330.80--40.18.7--9.041--5236--4549--6674.3--82.00.21V288--16327.5--183.65.0--9.126--18532--21138--6345.5--88.50.72VII496--1,24755.2--140.64.6--9.048--16760--21346--5678.4--97.80.44Mol wt-Molecular weight; PI-Isoelectric point; PR-Positively charged amino acids; NR- Negitively charged amino acids; II- Instbility index; AI-Aliphatic index; GRAVY-Grand average of Hydropathy. Gene ontology terms for predicted TaSDG proteins were classified into three well-known classes, namely biological process, cellular component and molecular function (Supplementary Fig. S2). Among the biological processes, most of the predicted TaSDG proteins were localized in the nucleus and were apparently involved in methylation of lysine residues of histone proteins (Supplementary Fig. S2); the proteins encoded by the following four genes belonging to class VII were located in chloroplast: *TaSDG41-6A/B/D* and *TaSDG44-5A*; these are involved in methylation of non-histone proteins such as Rubisco. The molecular functions of TaSDG proteins generally included the following: (i) zinc-ion binding, (ii) histone-lysine N-methyltransferase activity and (iii) protein binding (Supplementary Fig. S2). Phylogenetic analysis of TaSDG proteins {#Sec6} --------------------------------------- Phylogenetic tree prepared using aa sequences of SDG proteins of wheat, rice, maize, foxtail millet and Arabidopsis is presented in Fig. [2](#Fig2){ref-type="fig"}. The tree contains two major clusters, namely Cluster I and Cluster II. The Cluster I had all the SDG proteins belonging to class VII and SDG2 proteins (class III) for all the five species including wheat. The Cluster I also contained SDG8 protein (class II) of Arabidopsis. The Cluster II contained two sub-clusters IIa and IIb. The sub-cluster IIa contained SDG proteins of class IV belonging to all the five species including wheat. Similarly, sub-cluster IIb comprised 13 sub-sub-clusters, which contained SDG proteins belonging to different orthology groups of four classes, namely classes I to III and V for each of the five different species.Figure 2An un-rooted Neighbor-joining phylogenetic tree (created using MEGA version 6.0;^[@CR66]^) showing relationship of TaSDG proteins with SDG proteins of *A. thaliana*, *O. sativa*, *Z. mays* and *S. italica*. The tree has two main clusters (cluster I and II). The cluster II is further divided into two sub-clusters IIa and IIb. Cluster IIb contains 13 sub-sub-clusters. In silico expression analysis of TaSDGs {#Sec7} --------------------------------------- The expression data for 114 of the 130 TaSDGs was available in the WheatExp database. The expression of these genes was examined in five different tissues (root, stem, leaf, spike and grain) sampled at different growth stages (according to Zadoks growth scale (Z00 to Z95) and under conditions of heat and drought. The summary data in terms of level of expression (up-regulation and down-regulation) is presented in Fig. [3](#Fig3){ref-type="fig"}; more details are available in Supplementary Table S15. Following expression results were particularly noteworthy: (i) very high expression (FPKM \> 55) of *TaSDG4b-3D* in grain at Z85 stage and that of *TaSDG51-2B* in leaf at Z75 stage; (ii) tissue specific and developmental stage specific high expression (FPKM \> 20) of the following genes: *TaSDG4b-3D* (grain_Z71/85, leaf_Z71 and root_Z10), *TaSDG31e-2B* (spike_Z32/39/65), *TaSDG31c-2D* (spike_Z32), *TaSDG41-6A/B/D* (leaf_Z10), *TaSDG44-5A* (leaf_Z10) and *TaSDG51-2B* (leaf_Z71).Figure 3Heat map (generated using the online software tool ClustVis; <https://biit.cs.ut.ee/clustvis/>) showing in silico expression profile of 114 TaSDGs belonging to six classes at different developmental stages of five different tissues of wheat. The figures mentioned in parenthesis represent number of genes within a class. For further details of genes within each class see Supplementary Table S15. As many as 36 of 114 genes responded to heat and drought stress at the seedling stage and their expression pattern changed by ± twofold under heat/drought (Fig. [4](#Fig4){ref-type="fig"}, Supplementary Table S16). Many more genes were down-regulated (30 genes; range of fold change:-2.0 to -5.39) relative to the number of genes that were up-regulated (6 genes; range of fold change: 2 to 4.58). Under heat stress, the number of genes showing differential expression ranged from 6 genes (one up-regulated and five down-regulated) at 1 h to 13 genes (four up-regulated and nine down-regulated) at 6 h; one gene (*TaSDG1a-7B*) was common under both the treatments. Under drought, the number of differentially expressed genes ranged from 2 (both genes showed up-regulation) at 1 h to 3 (all three showed down-regulation) at 6 h. The results were opposite under the combined heat and drought stress, so that the number of differentially expressed genes included one up-regulated and 23 down-regulated genes at 1 h; four genes up-regulated and five genes down-regulated at 6 h (four genes were common under 1 h and 6 h; one up-regulated \[*TaSDG22b-4A*\] and three down-regulated \[*TaSDG1a-7B, TaSDG4b-3D and TaSDG25c-5D* \]). The details of these differentially expressed genes and the levels of expression are shown as heat maps in Fig. [4](#Fig4){ref-type="fig"}.Figure 4Heat map (generated using the online software tool ClustVis; <https://biit.cs.ut.ee/clustvis/>) showing in silico expression profile of TaSDGs (fold change ± 2) under heat, drought and combined stress of heat and drought. qRT-PCR analysis in response to heat, drought and leaf rust {#Sec8} ----------------------------------------------------------- For validating the results of in silico expression analysis, seven representative genes were selected and their expression was examined in three pairs of contrasting genotypes, one pair for each stress. However, qRT-PCR data was available for all the seven genes for heat stress, for six genes under water stress, and for only two genes for leaf rust infection. The results of differential expression obtained using qRT-PCR are summarized in Table [4](#Tab4){ref-type="table"}.Table 4A summary of the results of qRT-PCR analysis for seven TaSDGs in two contrasting wheat cultivars each under water stress and heat stress and in a pair of NILs for leaf rust gene *Lr28*.Description of TaSDGWater stress 1 hWater stress 6 hHeat stressLeaf rust (96hai)HD2967 (S)C306 (T)HD2967 (S)C306 (T)HD2329 (S)HD2985 (T)HD2329 (S)HD2329 + *Lr28* (R)*TaSDG1a−7A* (class I; H3K27)NSNS↑(2.14)NS↓ (− 3.87)↓ (− 3.16)↓ (− 31.42)↑ (8.68)*TaSDG16-3A* (class III; H3K4)NS↓ (− 2.33)NSNSNSNS----*TaSDG22a-1D* (class V; H3K9)NS↓ (− 5.06)NS↓ (− 3.82)NSNS----*TaSDG20-3D* (class V; H3K9)NSNS↓(− 2.46)NS↑ (2.85)↑ (2.24)↓ (− 6.46)↑ (2.63)*TaSDG25c-5D* (class V; H3K9)--------↓ (− 3.78)↓ (− 2.4)----*TaSDG44-5A* (class VII; methylation of non-histone proteins)NSNSNSNS↓ (− 3.62)NS----*TaSDG51-2B* (class VII; methylation of non-histone proteins)NS↑ (4.17)NS↓ (− 2.13)↓(− 2.64)NS----T: tolerant; S: sensitive/susceptible; R: resistant; 96hai: 96 h after inoculation; ↑: 2.14 to 8.68 fold upregulation; ↓: 2.13 to 31.42 fold downregulation; NS: non-significant expression; -: despite repeated attempts qRT-PCR was not successful. Discussion {#Sec9} ========== During the present study, we identified and characterized 166 TaSDGs using reference wheat genome sequence. However, complete sequence for SET domain was available in only 130 of these genes. The 166 TaSDGs were classified into seven widely known classes (I-VII) following the nomenclature of SDGs initially used in Arabidopsis. The proteins encoded by genes belonging to classes VI and VII in Arabidopsis contain only truncated or incomplete SET domain; the genes of class VII have not been given the SDG nomenclature in Arabidopsis (except SDG40), but only their IDs are available. The 130 TaSDGs, each encoding protein with complete SET domain, belonged to six (I to V and VII) of the seven well-characterized classes of SDGs^[@CR23]^. The SDGs belonging to class VI encoded proteins with incomplete SET domain; hence were not analyzed further during the present study. However, six genes belonging to class VII encoded proteins, which had complete SET domains (unlike Arabidopsis) and therefore were included in detailed study; TaSDG nomenclature was given to these six genes belonging to class VII also (Supplementary Table S2). It may be recalled that during the present study, the number of TaSDGs with full length SET domain in hexaploid wheat was 130, which is more than four times the number in each of the following diploid species: 27 in rice, 39 in maize, 37 in foxtail millet and 31 in Arabidopsis (Supplementary Table S17). Thus the number in hexaploid wheat exceeds even the expected three times the number in diploid species maize with the highest number of SDGs among the four diploid species examined. This may be attributed to availability of some duplicate genes in wheat, which might have originated during the course of two-step evolution of wheat^[@CR37],[@CR38]^, although interspersed duplications of SDGs have also been reported in the above diploid species^[@CR31],[@CR32],[@CR36]^. Particularly, in maize, one would expect duplications, since it has been shown to be a tetraploid on the basis of data on reference whole genome sequence of maize^[@CR39]^. Other diploid species have also been shown to be palaeo-polyploids, so that duplications are common even in diploid species. Origin of duplicate gene is also a widely discussed subject and does not deserve any detailed discussion. Most of these duplicate genes in the present study belong to class V, a feature that has also been observed in maize and Arabidopsis^[@CR22]^. The evolutionary time-line suggested that the tandem duplications (range: 1.88--3.65 MYA) are of more recent origin relative to the interspersed duplications (range: 1.65--6.65 MYA). However, Ka/Ks ratio of most of the tandem duplicate gene pairs was \> 1 indicating positive selection on these genes contributing to molecular evolution^[@CR40]^. The interspersed duplications, on the other hand, had Ka/Ks ratio \< 1, indicating that these gene pairs are under purifying selection. The duplication events are known to give rise to new genes and create functional novelty in any organism^[@CR41]^. In hexaploid wheat, we expect three homoeologues for each gene, although this is not true for all genes. In the present study also, there were 18 TaSDGs, which did not have all the three homoeologues. However, these genes with missing homoeologues are available in the diploid (AA and DD) and tetraploid (AABB) wheat progenitors, suggesting that the missing genes might have been eliminated during the course of evolution of the hexaploid wheat. Otherwise also, gene loss has been reported as a common phenomenon during the course of evolution of hexaploid wheat from its diploid progenitors^[@CR42]^. Another interesting feature of the present study is the absence of some wheat homologues of Arabidopsis SDGs^[@CR19]^ including the following: (i) *MEA* gene (class I-OG1); (ii) *SDG24* (class II-OG1), (iii) *SDG30* (class III-OG1), (iv) *SDG14* (class III-OG2) and (v) *SDG15* (class IV-OG1) (for details see Supplementary Table S2). Similar results were also reported in some other monocots including rice, maize and foxtail millet^[@CR31]--[@CR33]^. It might be possible that the functional diversification of homologs of SET domain genes occurred after the divergence of monocots and dicots \~ 200 MYA^[@CR32]^. Some of the missing homologs in the monocots (wheat, rice, maize and foxtail millet) were perhaps lost after their divergence from other dicots like Arabidopsis. Future studies may provide answer to this problem. Structural analysis of TaSDGs also revealed some interesting features including the following: (i) Enormous variation in the length of individual TaSDGs (867--22,640 bp), which is also reflected in the lengths of corresponding proteins (272aa to 2264aa). This is not surprising, since the length (22.64 kb) of the longest wheat gene *TaSDG7a-5B* is still smaller than the longest SDG reported in maize (44.5 kb)^[@CR32]^ and that the length of SDG proteins also varied in several diploid species \[foxtail millet (301--2267aa), rice (298-2257aa), maize (173-1815aa) and Arabidopsis (203--2,351 aa)\]^[@CR23],[@CR31]--[@CR33]^. The variation in the length of SDGs is mainly due to the number of introns and their relative lengths, and not due to number of exons, suggesting the occurrence of same coding potential in different SDGs in wheat and other species; the codons also appear to be conserved, as apparent from high frequency of intron phase 0 (58.4%)^[@CR43]^. The variation in translation products, however seems to result from variation in the number of splice variants (2--6) and alternate splicing^[@CR44]--[@CR46]^. (ii) Presence of YDG domain in TaSDGs belonging to class V-OGs 1, 2, 3, and 5; (iii) Absence of introns except for the five genes (belonging to class V), namely *TaSDG33a-3A/B/D* and *TaSDG33b-1A/D* (each containing 14--15 introns; for details see Supplementary Fig. S1e), which were homologs of Arabidopsis gene *SDG33* with four introns. The observed absence of introns in most of the class V SDGs in wheat, maize and Arabidopsis might be due to an ancient retro-transposition-like event that occurred before the divergence of monocots like wheat and maize and dicots like Arabidopsis^[@CR22]^; (iv) Presence of complete SET domain in six TaSDG proteins derived from class VII genes (*TaSDG41-6A/B/D*, *TaSDG44-5A*, *TaSDG45-3B* and *TaSDG51-2B*); the proteins derived from class VII SET domain genes generally carry truncated SET domain in Arabidopis and other species. Surprisingly, in the diploid and tetraploid progenitors of wheat also, five of the six TaSDGs (except *TaSDG45-3B*, which had complete SET domain) lacked complete SET domain. Therefore, it appears that the evolution of the above complete SET domain containing TaSDGs occurred after the evolution of the hexaploid wheat. Some of these SDGs are believed to be involved in the methylation of non-histone proteins. For instance, the genes *TaSDG41-6A/B/D* and *TaSDG44-5A* encode Rubisco small sub-unit methyltransferases (RSSMT) and Rubisco large sub-unit methyltransferases (RLSMT), respectively. The RLSMT is known to methylate lysine 14 in the large subunit of Rubisco protein while the RSSMT is known to methylate the methionine in the small subunit of Rubisco protein^[@CR47]^. Other interesting features of TaSDGs recorded in the present study include occurrence of SSRs, transposon elements (TE), target sites for some miRNAs and genes (complete or part thereof) for lncRNAs; these will be briefly discussed one-by-one. First, the presence of SSRs can lead to phenotypic variation, since SSRs affect several processes including transcription, translation, mRNA splicing, export to cytoplasm, and loss of function^[@CR48]^; polymorphism in SSRs may also be used for molecular breeding, once we know the association of specific SSRs to the target traits. Second, the TE including En/Spm, Copia, Gypsy and SINE, which occur in 20% TaSDGs, may help in bringing about epigenetic changes during heat stress, as shown in Arabidopsis mutant for *suvh2/SDG18* gene (deficient in H3K9 methyltransferase activity)^[@CR49]^. Third, a number of TaSDGs have been shown to be the targets of miRNAs. From among 18 miRNAs for which target sites were available in TaSDGs during the present study, miR1135 and miR5049-3p are known to occur in Brachypodium and miR5049-3p occurs in *Saccharum*. The target sites of different miRNAs obviously differed. For instance, different miRNA differ for regions of the target genes (3′UTR, 5′UTR, promoter) with which they interact; miR1137a shows interaction with UTR of *TaSDG22b-4D* and tae-miR1127a shows interaction with promoter of *TaSDG22c-3D*; this information is important because binding of miRNAs to 5′UTR is known to have silencing effects^[@CR50],[@CR51]^, whereas miRNA interaction with promoter region is known to induce transcription^[@CR52]^. Interaction of miRNAs with 3′UTR of their target mRNAs (resulting in translational repression and mRNA deadenylation and decapping) has also been reported, in several earlier studies^[@CR53],[@CR54]^. However, functions of some of the miRNAs, namely miR1120c-5p, tae-miR1130b-3p, tae-miR1120b-3p and tae-miR5049-3p having TaSDGs as their targets are known to regulate transcription leading to their effect on flower development and pollen recognition^[@CR55]^; this information, along with other information about miRNAs, may be utilized in designing strategies for using miRNA for wheat improvement. Future experiments may also be designed to understand the mechanism of action of miRNAs. Fourth, the 122 lncRNAs, for which genes were available in 49 TaSDGs provide useful information for further detailed study, since a number of lncRNAs are known to mediate epigenetic changes by recruiting chromatin-remodeling complex to specific genomic loci. For instance, COOLAIR and COLDAIR lncRNAs are necessary for recruiting PHD-PRC2 complex to enable histone modifications of *FLC* (a key regulator of flowering time) in Arabidopsis, which acts as a repressor to inhibit flowering under cold temperature^[@CR56]^. In addition to the widely known structure of SET domain proteins including the presence of SET domain and their function as HMTases, these proteins may perform other important functions including those due to a number of other domains (detected during the present study) including PHD and PWWP domains^[@CR57],[@CR58]^. These other functions can be resolved only through a study of their high resolution structure, which needs availability of these genes in crystalline form. Unfortunately, all TaSDG proteins are unstable and hydrophilic in nature (except TaSDG25b-7D and TaSDG31b-U), as evident from the values of their aliphatic indices (45.5-- 97.8)^[@CR59],[@CR60]^ and GRAVY values (− 0.16 to − 0.811). A detailed study of all TaSDG proteins is therefore necessary to make full use of these genes in wheat improvement programmes. The results of phylogeny also provide some interesting feature, although evolutionary patterns appear to be largely conserved. It may be seen from the results that Cluster I included SDG2 proteins of class III (for all species examined), including the three SDG2 proteins of wheat (TaSDG2-7A/7B/7D); these were however grouped with proteins from class VII TaSDGs, which may be attributed to high similarity of TaSDG2-7A/7B/7D with class VII SDG proteins (including presence of no other domain except SET domain). Since contrary to expectation, class VII TaSDGs carried complete SET domain, we were expecting that the clustering pattern of TaSDG proteins may also show some other important differences from those in Arabidopsis, rice, maize and foxtail millet. However, no such difference was observed in the clustering pattern of SDG proteins in the present study and earlier studies in a number of dicots and monocots (including Arabidopsis, foxtail millet, maize, rice, mustard/turnip and diploid wild cotton)^[@CR21],[@CR31]--[@CR34],[@CR36]^. Further investigations may help to find out the reason for the occurrence of complete SET domain in class VII wheat SDG proteins, and that of incomplete SET domain in class VII SDG proteins of other species. Expression of TaSDGs in time (development stages) and space (different tissues) also provided some interesting results, particularly when expression results were examined along with information about the occurrence of some regulatory cis-elements in TaSDGs. This was necessary since SDGs are known to play a major role in plant development and also in response to different biotic and abiotic stresses including hormonal treatments^[@CR13],[@CR31],[@CR33],[@CR61]^. In the present study, cis-elements were found to be present in almost all wheat TaSDGs with some exceptions (*TaSDG31c-2B*, *TaSDG6-6B* and *TaSDG29-3A*). These cis-elements include those, which are the binding sites for some important transcription factors and thus also respond to biotic and abiotic stresses (GARE and TC rich elements for biotic stresses; ARE, ABRE, P-box, CCATT, LTR, MBS, GARE, GC and TCA for abiotic stresses). Perhaps these regulatory cis-elements respond to different developmental cues and stresses through expression of these TaSDGs in the form of HTMases, which bring about histone methylation as also mentioned in the Introduction^[@CR62]^. The expression of these TaSDGs in response to biotic and abiotic stresses is mediated through activation of a number of transcription factors (mentioned in "[Results](#Sec2){ref-type="sec"}"), for which binding sites occur in these TaSDGs. It may also be recalled that under stress, as many as 30 TaSDGs were down-regulated, but only six were up-regulated in different plant organs such spike, grain, leaf, stem and roots. The six up-regulating genes (*TaSDG19b-1A*,-*1B*,-*1D*, *TaSDG23b-1B*, *TaSDG22b-4A* and *TaSDG22b-4D*) belong to class V and are known to be involved in methylation of H3K9. This epigenetic mark is likely to repress the expression of genes that positively respond to heat (*TaSDG19b-1A*), drought (*TaSDG23b-1BI*) and heat + drought (*TaSDG19b-1B*,-*1D*, *TaSDG22b-4A* and *TaSDG22b-4D*). The results of in silico expression analysis could be validated through qRT-PCR at least for some genes (Supplementary Table S16, Table [4](#Tab4){ref-type="table"}). Five of the seven genes used for qRT-PCR are involved in methylation of H3K4, 9 and 27 and the remaining two genes (*TaSDG44-5A* and *TaSDG51-2B*) are involved in methylation of non-histone protein (Table [4](#Tab4){ref-type="table"}). Following are some important conclusions involving differential expression of TaSDGs, which may be involved in methylation of specific lysine residues of H3 protein and may respond to water stress, heat stress and leaf rust: (i) Under water stress, *TaSDG1a-7A* is up-regulated in sensitive cultivar HD2967; (ii) Under heat stress, *TaSDG20-3D* is up-regulated in both the sensitive (HD2329) and tolerant (HD2985) cultivars; (iii) During leaf rust infection, two genes (*TaSDG1a-7A* and *TaSDG20-3D*) showed significant up-regulation in resistant NIL (HD2329 + *Lr2*8) 96 h after inoculation with leaf rust. The genes *TaSDG1a-7A* (class I) and *TaSDG20-3D* (class V) respond to all the three stresses including water stress, heat stress and leaf rust resistance due to *Lr28*. Since it is known that SDGs belonging to class I and V are involved in methylation of H3K9 and H3K27^[@CR23]^, and that both these epigenetic histone marks suppress gene expression, it appears that the expression of these two genes is induced by these abiotic and biotic stresses which may indirectly be involved in downregulation of genes providing tolerance to these stresses. Therefore, the genes *TaSDG1a-7A* and *TaSDG20-3D* with their cis-regulatory elements may prove useful for improvement of stress tolerance in wheat. This received support from the results of our other studies, where a set of genes carrying domains of bHLH TF, auxin response factor, F-box, etc. were associated with high affinity differential binding sites of H3K27me3 (a repressor mark) in resistant NIL (HD2329 + *Lr28*). This binding perhaps acts as negative regulators of leaf rust resistance^[@CR63]^. Materials and methods {#Sec10} ===================== Identification of SET domain genes in wheat and their homologs in other plant species {#Sec11} ------------------------------------------------------------------------------------- Following different approaches were used to identify putative SET domain genes (SDGs) from wheat: (*i*) BLASTP search against wheat proteome (<https://plants.ensembl.org/Triticum_aestivum/Tools/Blast?db=core>) containing amino acid sequences of wheat proteins; these were downloaded from Pfam database using Pfam ID (PF00856) of SET domain; (ii) tBLASTx search against the wheat genome (<https://plants.ensembl.org/Triticum_aestivum/> Tools/Blast?db = core) using known CDS sequences of SDGs of rice, maize, Arabidopsis and *Setaria* (containing nucleotide sequences corresponding to SET domain); (iii) Keyword search using 'SET domain', conducted in EnsemblPlants and, (iv) HMMER tool (available at EnsemblPlants) used to retrieve additional genes. The hits retrieved from the above methods were examined for the presence of SET domain using conserved domain database (CDD) batch search tool at NCBI (<https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi>). Wheat SDGs (TaSDGs) identified as above were checked for their homologs in rice, maize, Arabidopsis and *Setaria*. The sequences having complete SET domains were then used as query in TblastN against EnsemblPlants to retrieve all the information (gene, transcript, splice variants, cDNA, CDS and protein) related to corresponding SDGs in wheat. Homoeologous relationships between SDGs of wheat were established on the basis of their chromosome assignment and percentage of protein sequence identity (\> 90%). TaSDGs were named following the classification of SDGs in Arabidopsis^[@CR23]^. Physical map of TaSDGs and identification of duplicate genes {#Sec12} ------------------------------------------------------------ Information regarding chromosome location and the coordinates for individual SDG of wheat was obtained from EnsemblPlants database (<https://mar2016plants.ensembl.org/Triticum_aestivum/Info/Index>). Physical map of TaSDGs was prepared using MapInspect software (<https://www.plantbreeding.wur.nl/UK/> software_map-inspect.html). In order to identify gene duplications, CDS sequences of TaSDGs were blasted against each other and the genes having \> 90% identity were accepted as duplications^[@CR64]^. If two or more than two genes were found to be located on the same chromosome adjacent to each other, these genes were treated as tandem duplications^[@CR65]^. Ka/Ks analysis {#Sec13} -------------- Synonymous substitutions (Ks) and non-synonymous substitutions (Ka) were calculated for duplicated gene pairs using MEGA 6.0^[@CR66]^ software. Ka/Ks ratio of \< 1 suggested purifying selection, Ka/Ks ratio of \> 1 suggested positive selection and Ka/Ks ratio was used to infer neutral selection. The time of duplication and divergence in terms of million years ago (Mya) for each duplicate gene pair was also calculated using a synonymous mutation rate of λ substitutions per synonymous site per year as (T) = Ks/2λ × 10^−6^ (λ = 6.1 × 10^--9^). Analysis of TaSDG nucleotide sequences {#Sec14} -------------------------------------- In order to analyse the structure of TaSDGs, the full length CDSs of TaSDGs were compared with their corresponding genomic sequences; Gene Structure Display Server (GSDS) v2.0 (<https://gsds.cbi.pku.edu.cn/>) was used for this purpose^[@CR67]^. Identification of intron phases (0, 1, 2) was done using criteria that were used in our earlier studies^[@CR68],[@CR69]^. The presence of cis-regulatory response elements was checked in one kb genomic region 5′ upstream of the translation start site (ATG) (i.e. promoter region) of each gene using PlantCARE database (<https://bioinformatics.psb.ugent.be/webtools/plantcare/html/>)^[@CR70]^ following the criteria used by us in our earlier studies^[@CR71],[@CR72]^. Transcription factor binding sites (TFBS) in the promoter region of each gene were predicted using PlantRegMap (<https://planttfdb.cbi.pku>. edu.cn/prediction.php)^[@CR73]^. BatchPrimer3v1.0 (<https://probes.pw.usda.gov/> batchprimer3/) was used to identify simple sequence repeats (SSRs) and transposable elements (TEs) within the gene sequences. The miRNAs and their targets in TaSDGs and their promoters were predicted employing web-based psRNATarget server (<https://plantgrn.noble.org/psRNATarget/>)^[@CR74]^ using default parameters; the range of e-value was 0--2. The TaSDGs were also analysed for the presence of sites for lncRNAs using IWGSC database (<https://urgi.versailles.inra.fr/jbrowseiwgsc/gmod_jbrowse/?data=myData%2FIWGSC_RefSeq_v1.0>). Analysis of TaSDG protein sequences {#Sec15} ----------------------------------- The physicochemical properties of TaSDG proteins were studied using ExPASy ProtParam tool (<https://web.expasy.org/protparam/>). Major domains in the predicted protein sequences were identified through PROSITE (<https://prosite.expasy.org/>) and conserved domain (CD)-search program of conserved domain database (CDD) at NCBI (<https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi>). Common motifs in proteins of individual class (I-V and VII) were identified using online motif finding tool MEME (Multiple Expectation Maximization for Motif Elicitation, v3.5.454) (<https://meme-suite.org/tools/meme>)^[@CR75]^, using the option of 0 or 1 for a specific motif, and setting the upper limit of the number of motifs as 20, with an optimum length of each motif set at 6--50 amino acids. All identified motifs were annotated using InterProScan database (<https://www.ebi.ac.uk/Tools/pfa/iprscan/>). The TaSDGs were functionally annotated using BioMart available at EnsemblPlants. Gene ontology (GO) terms were classified into the following three well known classes: cellular component, molecular function and biological process. Phylogenetic analysis of SET domain containing proteins in wheat {#Sec16} ---------------------------------------------------------------- Based on amino acid sequences of SET domain containing proteins, an un-rooted phylogenetic tree was constructed using MEGA version 6.0^[@CR66]^ employing Neighbor-joining method of distance matrix, with a bootstrap involving 1,000 iterations using p-distance substitution model. The phylogenetic tree involved SET domain containing proteins from the following plant systems: wheat (130), rice (27), maize (38), Arabidopsis (33) and foxtail millet (37). All these protein sequences were aligned by multiple sequence alignment (MSA) tool available in MEGA version 6.0; the aligned files were used to generate a phylogenetic tree. In silico expression analysis of TaSDGs {#Sec17} --------------------------------------- The in silico expression analysis of TaSDGs in five different tissues (grain, leaf, root, spike and stem) each sampled at three developmental stages and during major abiotic stresses (heat, drought and heat + drought \[1 h and 6 h stress\]) was carried out using publicly available transcriptome data at wheat expression database (<https://wheat.pw.usda.gov/WheatExp/>). The online software tool ClustVis (<https://biit.cs.ut.ee/clustvis/>) was used to generate the heat maps. For this purpose, normalized gene expression values which are expressed as the number of fragments per kilobase of exon per million fragments mapped (FPKM), were transformed using log~2~. qRT-PCR for validation of in silico expression of TaSDGs {#Sec18} -------------------------------------------------------- Expression of seven representative TaSDGs using qRT-PCR was also examined at the seedling stage in pairs of contrasting genotypes in response to abiotic stresses (water and heat) and biotic stress (leaf rust). The genes were selected on the basis of results of in silico expression analysis during water and heat stresses. However, although in silico expression data was not available for leaf rust, qRT-PCR was also conducted for leaf rust, to find out the role of TaSDGs during leaf rust infection. The seven genes included the following: *TaSDG1a-7A* (class I), *TaSDG16-3A* (class III), *TaSDG22a-1D*, *TaSDG20-3D*, and *TaSDG25c-5D* (class V) and *TaSDG44-5A* and *TaSDG51-2B* (class VII). Primers for these selected genes were designed using Primer3 software (Supplementary Table S1). The analysis was conducted using the material and methods that were used in our earlier study^[@CR72]^. Briefly, following three pairs of contrasting genotypes were utilized and were subjected to three different stresses as follows: (i) For water stress, samples were taken from seedlings of a pair of genotypes (tolerant cv. C306 and sensitive cv. HD2967) that were subjected to 1 h and 6 h of water stress. (ii) For heat stress, samples were taken from tolerant cv. HD2985 and sensitive cv. HD2329 that were subjected to 2 h of heat stress. (iii) For leaf rust, samples were collected at 0 h before inoculation (0hbi) and 96 h after inoculation (96hai) from a pair of NILs including susceptible cultivar HD2329 and its resistant NIL HD2329 + *Lr28* that were inoculated with virulent race of the pathogen (77--5). The material for three qRT-PCR experiments were collected as described in an earlier study^[@CR72]^. Water stress was given by transferring the seedlings to modified Hoagland's solution containing 20% PEG 8,000. Similarly, heat stress given by exposing 7 days old normal wheat seedlings to 42 °C for 2 h; The heat stress was given in a sinusoidal mode by increasing 1 °C temperature per 10 min till the temperature reached 42 °C, which was maintained for 2 h; seedlings at 22 °C were used as control. For leaf rust, the material was collected as described in an earlier study^[@CR72]^. For each treatment in each experiment, two replications were used. Supplementary information ========================= {#Sec19} Supplementary information 1Supplementary information 2 **Publisher\'s note** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Supplementary information ========================= is available for this paper at 10.1038/s41598-020-71526-5. P.K.G. was awarded NASI Senior Scientist Platinum Jubilee Fellowship, and INSA Senior Scientist position. H.S.B. was awarded INSA Senior Scientist position during the period of the study. R.B. was awarded Dr D.S. Kothari Post-Doctoral Fellowship by UGC, Government of India, New Delhi. T.G. is working as a SRF in a NASF-ICAR, New Delhi funded project whereas R and IJ are working as J.R.Fs in the resercah projects funded by DBT, Government of India. The facilities provided by Bioinformatics Infrastructure Facility (BIF) Laboratory, CCS University, Meerut made this study possible. P.K.G. and H.S.B. conceived the experiment. R.B. with the help of T.G., S.P., D.C., R. and I.J. conducted data analysis. R.B. also prepared the first draft of the manuscript which was edited and finalised by P.K.G. and H.S.B. All data generated or analysed during this study are included in this published article (and its Supplementary Information files). The authors declare no competing interests. | Mid | [
0.617647058823529,
31.5,
19.5
] |
T.C. Memo. 2007-237 UNITED STATES TAX COURT RICHARD FRANSEN, Petitioner v. COMMISSIONER OF INTERNAL REVENUE, Respondent Docket No. 8682-06L. Filed August 20, 2007. Richard Fransen, pro se. Marie E. Small, for respondent. MEMORANDUM OPINION CHIECHI, Judge: This case is before the Court on respon- dent’s motion for summary judgment (respondent’s motion). We shall grant respondent’s motion. Background The record establishes and/or the parties do not dispute the following. - 2 - Petitioner resided in Brooklyn, New York, at the time he filed the petition in this case. Petitioner did not file a Federal income tax (tax) return for each of his taxable years 2000, 2001, and 2002. On August 10, 2004, respondent issued to petitioner a notice of deficiency with respect to his taxable year 2002 (2002 no- tice), which he received. In that notice, respondent determined the following deficiencies in, and additions to, petitioner’s tax: Additions to Tax Sec. Sec. Sec. Year Deficiency 6651(a)(1)1 6651(a)(2) 6654 2002 $53,753 $3,704.40 $1,811.04 $411.70 On September 14, 2004, respondent issued to petitioner a notice of deficiency with respect to his taxable years 2000 and 2001 (2000 and 2001 notice), which he received. In that notice, respondent determined the following deficiencies in, and addi- tions to, petitioner’s tax: Additions to Tax Sec. Sec. Sec. Year Deficiency 6651(a)(1) 6651(a)(2) 6654 2000 $43,959 $4,631.17 $4,837.00 $967.34 2001 35,660 3,294.22 2,562.17 486.97 1 All section references are to the Internal Revenue Code in effect at all relevant times. All Rule references are to the Tax Court Rules of Practice and Procedure. - 3 - Petitioner did not file a petition with the Court with respect to the 2002 notice or the 2000 and 2001 notice.2 On February 7, 2005, respondent assessed petitioner’s tax, as well as additions to tax and interest as provided by law, for his taxable year 2002. (We shall refer to those unpaid assessed amounts, as well as interest as provided by law accrued after February 7, 2005, as petitioner’s unpaid liability for 2002.) On February 7, 2005, respondent issued to petitioner the notice and demand for payment required by section 6303(a) with respect to petitioner’s unpaid liability for 2002. On February 21, 2005, respondent assessed petitioner’s tax, as well as additions to tax and interest as provided by law, for each of his taxable years 2000 and 2001. (We shall refer to those unpaid assessed amounts, as well as interest as provided by law accrued after February 21, 2005, as petitioner’s unpaid liabilities for 2000 and 2001.) On February 21, 2005, respondent issued to petitioner the notice and demand for payment required by section 6303(a) with respect to petitioner’s unpaid liabilities for 2000 and 2001. On September 20, 2005, respondent filed a notice of Federal 2 Form 4340, Certificate of Assessments, Payments, and Other Specified Matters (Form 4340), with respect to petitioner’s taxable year 2002 indicates that the 2002 notice was “closed” on Dec. 28, 2004. Form 4340 with respect to each of petitioner’s taxable years 2000 and 2001 indicates that the 2000 and 2001 notice was “closed” on Feb. 1, 2005. - 4 - tax lien with respect to petitioner’s taxable years 2000, 2001, and 2002. On September 27, 2005, respondent issued to petitioner a notice of Federal tax lien filing and your right to a hearing (notice of tax lien) with respect to those years. On October 27, 2005, petitioner’s authorized representative mailed to respondent Form 12153, Request for a Collection Due Process Hearing (petitioner’s Form 12153), and requested a hearing with respondent’s Appeals Office (Appeals Office). In that form, petitioner’s authorized representative indicated disagreement with the notice of tax lien3 and stated: TAXPAYER HASN’T FILED HIS 1999-2004 INCOME TAX RETURNS. HE HAS ENGAGED OUR FIRM TO PREPARE SUCH INCOME TAX RETURNS AND OBTAIN FINANCING TO LIQUIDATE HIS IRS LIABILITIES AND REQUEST AN ABATEMENT OF PENALTIES AND INTEREST DUE TO HIS EMOTIONAL AND PHYSICAL STATE. AMENDED INCOME TAX RETURNS ARE REQUIRED. IT WILL TAKE APPROXIMATELY 60 DAYS TO PREPARE SUCH AMENDED INCOME 3 In petitioner’s Form 12153, petitioner’s authorized repre- sentative indicated disagreement with not only the notice of tax lien that respondent issued to petitioner but also certain notices of intent to levy and your right to a hearing (notice of intent to levy) that respondent issued to petitioner. In this connection, Form 4340 with respect to petitioner’s taxable year 2002 indicates that on Apr. 18, 2005, respondent issued a notice of intent to levy with respect to petitioner’s taxable year 2002 and that on May 9, 2005, respondent issued a notice of intent to levy with respect to petitioner’s taxable years 2000 and 2001. Petitioner’s authorized representative did not mail petitioner’s Form 12153 until Oct. 27, 2005, which was more than 30 days after the respective dates on which respondent issued those notices of intent to levy. As discussed below, the notice of determination concerning collection action(s) under section 6320 and/or 6330 (notice of determination) addresses only the notice of tax lien and makes no determination with respect to the respective notices of intent to levy issued with respect to petitioner’s taxable years 2000 and 2001 and 2002. - 5 - TAX RETURNS. THEREFORE, A LIEN AND LEVY WILL INHIBIT THE TAXPAYER TO OBTAIN PROPER FINANCING. [Reproduced literally.] On January 19, 2006, a settlement officer with the Appeals Office (settlement officer) sent a letter to petitioner with respect to petitioner’s Form 12153. In that letter, the settle- ment officer offered petitioner the opportunity to have a hearing on February 28, 2006. On February 28, 2006, petitioner’s autho- rized representative called the settlement officer and requested a two-week period within which to (1) submit a tax return for each of petitioner’s taxable years 2000, 2001, and 2002 and (2) propose a collection alternative. The settlement officer granted that request. On March 28, 2006, the settlement officer called petitioner’s authorized representative (March 28, 2006 call). During the March 28, 2006 call, petitioner’s authorized representative indicated that he had nothing to submit with respect to petitioner’s taxable years 2000, 2001, and 2002 and requested that a notice of determination be issued with respect to those years. On April 5, 2006, the Appeals Office issued to petitioner a notice of determination with respect to petitioner’s taxable years 2000, 2001, and 2002. That notice stated in pertinent part: Summary of Determination You did not offer any collection alternatives for Appeals consideration. Collection is sustained. - 6 - An attachment to the notice of determination stated in pertinent part: Summary You filed a request for a Collection Due Process (CDP) hearing under Internal Revenue Code (IRC) § 6320 fol- lowing receipt of a Letter 3172 Notice of Federal Tax Lien Filing and Your Rights to a Hearing. A copy of the Notice of Federal Tax Lien (NFTL) and Letter 3172 were provided with the administrative file. Accord- ingly, the tax periods shown above [taxable years 2000, 2001, and 2002] were those on the NFTL sent for filing on September 27, 2005. Balances are still due as verified by computer transcripts. Your Form 12153 requesting a CDP hearing, was received on November 1, 2005. This was timely submitted as it was mailed within the 30-day period for requesting a CDP hearing. I mailed you a letter on 1/19/2006 giving you the opportunity for a hearing on 2/28/2006. On 2/28/2006 your representative * * * contacted me and requested an additional two weeks to prepare your delinquent returns and submit a collection alternative. [petitioner’s authorized representative] * * * was granted the addi- tional time. On 3/28/2006 I contacted him again for the information. He stated he had nothing to submit and requested this determination be issued. You have not filed an income tax return since 1989, The IRS requested that you file returns for 2000, 2001 and 2002 and gave you an opportunity to appeal the proposed assessments. You did not do so, therefore the underlying liability issue is precluded within Collec- tion Due Process under IRC §6330. There is no informa- tion in the file that warrants the withdrawal of the filed NFTL. The filed NFTL is the appropriate action in this case. Brief Background The CDP notice was for unpaid income tax liabilities for your 2000, 2001 and 2002 Form 1040. The returns were prepared by the IRS when you failed to file them yourself. The IRS assessed tax as follows: - 7 - 2000 $ 43,959.00 Withholding $ 23,226.00 2001 $ 35,660.00 Withholding $ 21,019.00 2002 $ 53,753.00 Withholding $ 37,289.00 You were also assessed late filing penalty on these years. Interest and failure to pay penalty continue to accrue on the unpaid assessment. Your lack of compliance is considered egregious. You have not filed an income tax return since 1989. You have made no estimated tax payments and have not had sufficient withholding to cover the tax. You have not been in compliance with the filing and payment require- ments for 14 years, despite the fact that you have had considerable income and you were able to set aside more than $225,000 in pension and stocks and bonds in lieu of filing and paying your taxes. You have not supplied financial information to help us resolve your account. You have not presented any alternatives to the NFTL or future collection action, including possible seizure of your assets. Discussion and Analysis Verification of Legal and Procedural Requirements The requirements of applicable law or administrative procedures have been met and the actions taken were appropriate under the circumstances. * I verified through transcript analysis that assess- ment was made on the applicable CDP notice periods per IRC § 6201 and the notice and demand for payment letter was mailed to the taxpayer’s last known address, within 60 days of the assessment, as required by IRC § 6303. * Per transcript analysis, there was a balance due when the NFTL filing was requested. This balance is still due. * IRC § 6321 provides a statutory lien when a taxpayer neglects or refuses to pay a tax liability after notice and demand for payment. Transcripts of the account show that the IRS issued notice and demand for each of the tax periods involved and those periods remain unpaid. - 8 - * Per review of computer transcripts, the CDP notice (Letter 3172) was sent by certified mail to your last known address, no later than 5 business days after the NFTL was recorded (IRC § 6320(a)). This was also the address shown on your CDP hearing request. The lien was filed on September 20, 2005 and the Letter 3172 was mailed on September 27, 2005, which is within 5 busi- ness days of the lien filing. * The collection period allowed by statute to collect these taxes has been suspended by the appropriate computer codes for the tax periods at issue. Transac- tion Code 520, has been posted for each of the taxes and periods listed on the NFTL as the date the IRS received the CDP hearing request. * Per transcript analysis, a CP504 notice, warning of a possible filing of a NFTL, was issued for the tax periods subject to the hearing at least 31 days prior to the NFTL filing. The notice was mailed on May 9, 2005. * There is no pending bankruptcy case, nor did you have a pending bankruptcy case at the time the CDP notice was sent (11 U.S.C. § 362(a)(6)). ! This Appeals employee has had no prior in- volvement with this taxpayer concerning the applicable tax periods before this CDP case. Issues Raised by the Taxpayer Challenges to the Existence or Amount of the Liability You have challenged the existence or the amount of the liability on the returns prepared by the IRS under IRC §6020(b). The underlying liability issue is precluded from this hearing. Furthermore, you have not prepared and submitted your own returns which would allow the IRS to adjust your tax liabilities. Challenges to the Appropriateness of the Collection Action You have not requested the NFTL be withdrawn. However, I have considered whether any of the criteria for allowing withdrawal of the lien existed in your case. - 9 - IRC § 6323(j) allows the withdrawal of a filed notice of lien without full payment and without prejudice under the following conditions: * The filing of the notice of lien was premature or otherwise not in accordance with administrative proce- dures of the Internal Revenue Service; * The taxpayer had entered into an agreement under IRC § 6159 to satisfy the tax liability for which the lien was imposed by means of installment payments, unless such agreement provides otherwise; * Withdrawal of the lien will facilitate collection of the tax liability; or * Withdrawal of the lien would be in the best interests of the taxpayer (as determined by the National Taxpayer Advocate) and the United States. Similar to the above provision, each set of circumstances should be analyzed to determine if this condition exists. There is nothing in the Collection administrative file that indicates withdrawal of the filed lien should be considered and you have provided no additional informa- tion that indicates the withdrawal of the filed lien should be considered. Collection Alternatives Offered by the Taxpayer On your Form 12153 requesting the CDP hearing, you raised no other issues or offered an alternative to collection. You failed to present me with the delin- quent returns and financial information as I had re- quested, and your representative offered no collection alternatives at the hearing, other than to request an additional delay for an undetermined period of time. Other issues raised by the Taxpayer You raised no other issues. Balancing of Need for Efficient Collection With Taxpayer Concern That the Collection Action Be No More Intrusive Than Necessary I balanced the competing interests when finding the filing of the NFTL is appropriate. You did not offer any collection alternatives during the CDP hearing process. As discussed above, the assessment(s) at issue are valid. - 10 - During the past 16 years you set aside funds for a pension and invested in stocks and bonds while know- ingly failing to file and pay your income taxes, de- spite the fact that you had earned income from wages and self-employment income. The fact that you filed returns up until 1989 indicates that you were aware of the filing and withholding requirements. You invested your income during the past 16 years in lieu of filing and paying your taxes, which indicates your failure to file and pay your tax as willful and egregious. Given your failure to propose any collection alterna- tives and your non-compliance with the tax laws, the Notice of Federal Tax Lien balances the need for effi- cient collection with your concern that the collection action be no more intrusive than necessary. The notice of determination makes no determination with respect to the respective notices of intent to levy issued with respect to petitioner’s taxable years 2000 and 2001 and 2002. Petitioner filed a petition with respect to the notice of determination. In that petition, petitioner alleged: 5. The determination of the tax set forth in the said notice of deficiencies are based upon the following errors. (a). The notices of deficiency did not take into ac- count allowable cost bases for stock transactions. (b). The notices of deficiency did not take into ac- count certain allowable itemized deductions including real estate taxes and other deductible expenses. 6. The facts upon which the Petitioner relies, as the bases of the Petitioner’s case, are as follows: (a). Petitioner’s income should be reduced by his costs of securities sold and certain allowable itemized deductions. - 11 - (b). The taxpayer will file his 2000, 2001 and 2002 income tax returns with the Internal Revenue Service Hartford, Connecticut Office reflecting the correct information. (c). The penalties should be abated due to reasonable causes as discussed in Form 12153, copy enclosed. Discussion The Court may grant summary judgment where there is no genuine issue of material fact and a decision may be rendered as a matter of law. Rule 121(b); Sundstrand Corp. v. Commissioner, 98 T.C. 518, 520 (1992), affd. 17 F.3d 965 (7th Cir. 1994). We conclude that there are no genuine issues of material fact regarding the questions raised in respondent’s motion. In the petition, petitioner alleged that the 2000 and 2001 notice and the 2002 notice are wrong and that the additions to tax for those years “should be abated”.4 We first address petitioner’s allegation in the petition that the Court should abate the respective additions to tax for his taxable years 2000, 2001, and 2002. Although not altogether clear, petitioner appears to be requesting the Court to review 4 In the petition, petitioner refers to the respective no- tices of intent to levy that respondent issued with respect to petitioner’s taxable years 2000 and 2001 and 2002. Petitioner’s authorized representative did not file timely petitioner’s Form 12153 with respect to those notices, see sec. 6330(a)(2) and (3)(B) and (b), and the notice of determination makes no determi- nation with respect to those notices. We conclude that we do not have jurisdiction to consider petitioner’s arguments with respect to the notices of intent to levy. See Offiler v. Commissioner, 114 T.C. 492, 498 (2000). - 12 - under section 6404 respondent’s failure to abate those additions to tax. We hold that we do not have jurisdiction to do so. See sec. 6404(h); see also Washington v. Commissioner, 120 T.C. 114, 124 n.15 (2003); Krugman v. Commissioner, 112 T.C. 230, 237 (1999). We now address petitioner’s allegation in the petition that the 2000 and 2001 notice and the 2002 notice are wrong. A taxpayer may raise challenges to the existence or the amount of the taxpayer’s underlying tax liability if the taxpayer did not receive a notice of deficiency or did not otherwise have an opportunity to dispute the tax liability. Sec. 6330(c)(2)(B). Respondent issued to petitioner the 2000 and 2001 notice and the 2002 notice, which he received. Petitioner did not file a petition with the Court with respect to either of those notices. On the instant record, we find that petitioner may not challenge the existence or the amount of the underlying tax liability, including any additions to tax,5 for each of his taxable years 5 Assuming arguendo that petitioner’s allegation in the petition that the Court should abate the respective additions to tax for his taxable years 2000, 2001, and 2002 is not intended as a request by petitioner for the Court to review under sec. 6404 respondent’s failure to abate those additions, but instead is a request to review de novo the propriety of those additions to tax, we shall not do so. That is because the phrase “underlying tax liability” in sec. 6330(c)(2)(B) is “a reference to the amounts that the Commissioner assessed for a particular tax period.” Montgomery v. Commissioner, 122 T.C. 1, 7 (2004). What the Court concluded in Montgomery applies in the instant case: “petitioners’ underlying tax liability consists of the amount (continued...) - 13 - 2000, 2001, and 2002. Where, as is the case here, the validity of the underlying tax liability is not properly placed at issue, the Court will review the determination of the Commissioner of Internal Revenue for abuse of discretion. Sego v. Commissioner, 114 T.C. 604, 610 (2000); Goza v. Commissioner, 114 T.C. 176, 181-182 (2000). Based upon our examination of the entire record before us, we find that respondent did not abuse respondent’s discretion in making the determinations in the notice of determination regard- ing the notice of tax lien with respect to petitioner’s taxable years 2000, 2001, and 2002. We have considered all of the contentions and arguments of the parties that are not discussed herein, and we find them to be without merit, irrelevant, and/or moot. On the record before us, we shall grant respondent’s motion. To reflect the foregoing, An order granting respondent’s motion and decision for respondent will be entered. 5 (...continued) that petitioners reported due on their tax return along with statutory interest and penalties.” Id. at 8. | Low | [
0.49064449064449006,
29.5,
30.625
] |
Give ‘Em Enough Rope Arrows: The Iphone’s Spider Share this: This is outside of our usual mandate, but fuck it. Tiger Style – who comprise of Ion Storm veterans Randy Smith (Lead on Thief: Deadly Shadows, co-designer of the Cradle, designer of Return to the Haunted Cathedral, that guy) and David Kalina (Thief: Deadly Shadows and – er – other malarkies) have released their first game for the Macintosh Individual Phone – or, Iphone. It’s called the Spider: The Secret of Bryce Manor and is an adventurey-thing where you play a spider, bouncing around and making webs. And similar. Reviews so far are absolute fountains and it looks mechanically pretty novel. You can get it from here or watch the video below… And while we’re talking arachnids, just to make this post even more off topic, here’s Phil Jupitus’ splendid stand-up routine about Spiders. I got myself a shiny new iPhone 3GS (my first Apple product ever, go figure) just a week or so ago – in fact, a couple of my posts here have been made on it (it’s surprisingly easy to type properly on), so this is of great interest to me. It’s a nifty little omnigadget, and, as of the 3GS upgrade it’s hovering somewhere around the PSP in terms of raw graphical power, and far above it in terms of processor. Continuing on this off-topic tangent, the two best things about the iPhone: 24/7 broadband internet in your pocket. I pull down about 230kb/s out in the street. Games are VERY VERY CHEAP. The vast majority of the stuff I’ve gotten so far has been $1/59p, and we’re not talking cheap flash games here – there’s stuff like Siberian Strike, which is a high-budget 2.5d shooter in the style of 194X. Also, I just got Spider. Played the first couple of training levels – the controls are REALLY sharp. The whole ‘point to move’ thing is clever and intuitive. It puts the emphasis of skill on the jumping around, rather than basic navigation. And just for the hat trick, here’s something for iPhone owners to look forward to: link to youtube.com A 100% complete (well, excluding the editing suite, but nobody wants to even TRY to use that on a phone) port of PC/Linux/Mac gigantonormous fantasy-strategy game The Battle For Wesnoth. Yes, the user-content browser and download system is still in. Yes. iPod touch and iPhone are equal devices, running the same OS. The only apps you might not be able to run are any which require any of the phone hardware (camera being the only one really appropriate for games). I second the sub-blog for mobile gaming. Bring out the really obscure stuff so I don’t have to wade through the TouchArcade RSS all the time :) Yeah, the touch can do most of what the phone can, but the latest touch is using the old internals, thus much slower than the 3Gs. There should be a new one coming out before long using the new architecture. (this post made from my iPhone – heh) But the £390 pound price difference (over 18 months) between an ipod touch and an iphone 3G with an unlimited net connection is compelling if like me you wouldn’t use all those free minutes and stuff they give you. I love the look of all these iphone things but even the lowest £440 price for the 3GS is just stupidly expensive for me (I’ve got some mild telephobia so although I own a mobile I’ve been on the same £10 worth of PAYG credit for the past two years now) and I don’t want to spend £130 on an ipod touch when it’ll likely be obsolete fairly shortly. The game looks awesome but the platform is so darn expensive for a telephobe like me that I’ll have to give it a miss. If they release an ipod touch with the same specs as the 3GS at a sub £200 price I’d consider it but as it stands I’ll have to give the entire platform a miss. The 3GS gets a lot cheaper with certain phone contracts. I got mine for around the £200 mark, but that’s with a two-year contract (unlimited internet, two hours of phone a month – but I’ve jailbroken it so I can use skype for voice calls – ha!). Wasn’t cheap, but I think I’ll be getting a good bit of use out of it these next two years. @ Dominic White: Cheapest I’ve seen on a contract for the 3GS is £184.98 + £29.38 per month 18 month contract minimum = £713.82 so since I wouldn’t use all those free minutes and texts it looks cheaper to get a PAYG for £440 with 12 months free web access and maybe get the £10 a month web access after the first 12 months for a total of £500 after 18 months and £10 per month after that. @kwyjibo – Given that amount of amazingly terrible sub-flash-game crap that gets onto the appstore, I’d describe it less as a gatekeeper, and more a heavily sloshed doorman at 3am. You may have to queue a bit, but there’s pretty much nothing stopping you from getting in. And how does the PC being an open system make PC gaming great? It’s pretty much the cause of 99% of PC-gaming-related headaches. It’s worth pointing out that the first-generation iPod Touch (identifiable by its lack of external volume buttons and no built-in speaker) is, I believe, the slowest of the lot; I can barely make it off the menu screen in Civ Rev on my 1G Touch. Got a 3G the other day. Far as I can tell it does everything a 3GS does once you’ve updated to the 3.0 software (bar a few meaningless additions like a whole megapixel on the camera — for twice the price). Best purchase in a long time. I’ve spent about a tenner on apps and games already – loving Field Runner and Monkey Island. @Butler – the 3GS is a much, much more powerful piece of kit. Benchmarks so far estimate it as about four times as fast graphically as the 3G, and maybe twice as fast in terms of processor. I think it has twice as much RAM as well. It doesn’t have many more features than the 3G, but it’s roughly equivalent in power to a decent-spec laptop. Oh, and just to blur the line between PC and iPhone a little further, and to pass the time before The Battle For Wesnoth is available, the iPhone port of Tyrian updated today, adding a new control method and some optimizations, and dropping the price down to that coveted 59p It’s the full version of Tyrian (regular edition – it doesn’t have the T2000 fifth episode, sadly), and well worth getting. And yes, the Destruct minigame is present and correct. “I want some good games for my Android phone damnit, ” At least Popcap is still working on Peggle and Bejeweled. I send them an email a few weeks ago and asked. Give the (still very young) mobile PC market some time. Most people who buy phones just pick the cheapest plan and then they pick a cheap phone. That is a 4.1 billion units market, compared to the few hundred million rich/trendy people who now own smartphones. My guess is that in a few years most of these cheap pragmatic phones will be PCs running Android. Simply because it is the open standard that any manufacturer can and wants to put on his phone. Under ‘PC’ I understand a general purpose, open computer system designed to allow software distribution without a regulating third party. For what it’s worth, I’m really enjoying this. You can actually see some thief roots in that you’re exploring an old mansion and have free reign of each level as you plan the most efficient way to take your prize. That and the way secrets are handled as well. Oh, and taking down hornets is damn satisfying too. Th absenc of flywir and the cover of the visibl air unit mai have been a slight turn off. Well it look like thei ar aim to pleas you gui thi time. Nice kick liter ha some nice kicksNik Shox R4 on their shelves. The site made the leap from websit to retail a few month back and in do so becam on of our favorit retailers. [url=http://www.oknike-shox.com/category-3-b0-Nike+Shox+R4.html]Nik Shox R4[/url] Thei recent got in a shipment of thi legendari retro that some of you mai be familiar with. Man let just go ahead and try and lai an earli predict down: 2010 is the year of the Dunk. If ever we felt like aNik Shox R3 resurg wa go on it now and the shoe that virtual spark a lot thi cultur craze is jump up and slap us silli with dope designs. [url=http://www.oknike-shox.com/category-2-b0-Nike+Shox+R3.html]Nik Shox R3[/url] Sampl ar a slipperi slope. Sometim thei pop up and asid from pine over their design we also get to pour over their origin. Nik Shox Each shoe ha a history/reason for be and with sampl it tricki becaus thei don t realli technic exist . Thi sampl pair of Dunk ha becom known as the Airwalk Enigma Dunk SB. | Low | [
0.5,
27.875,
27.875
] |
Drug delivery and therapeutic impact of extended-release acetylsalicylic acid. Current treatment guidelines recommend once-daily, low-dose acetylsalicylic acid (ASA; aspirin) for secondary prevention of cardiovascular events. However, the anti-thrombotic benefits of traditional ASA formulations may not extend over a 24-h period, especially in patients at high risk for a recurrent cardiovascular event. A next-generation, extended-release ASA formulation (ER-ASA) has been developed to provide 24-h anti-thrombotic coverage with once-daily dosing. The pharmacokinetics of ER-ASA indicates slower absorption and prolonged ASA release versus immediate-release ASA, with a favorable safety profile. ER-ASA minimizes systemic ASA absorption and provides sustained antiplatelet effects over a 24-h period. | High | [
0.6915052160953801,
29,
12.9375
] |
# 136.Maximum Depth of Binary Tree ## Description Given a binary tree, find its maximum depth. The maximum depth is the number of nodes along the longest path from the root node down to the farthest leaf node. For example: Given binary tree `[3,9,20,null,null,15,7]`, return its depth = 3. ## From [LeetCode](https://leetcode.com/problems/maximum-depth-of-binary-tree) | Low | [
0.48251748251748205,
25.875,
27.75
] |
Q: Why after login user keeps both roles guest and user in yii2? i'm using rbac in yii2 project. When i print var_dump(\Yii::$app->authManager->getRolesByUser(Yii::$app->user->id)); I get an array with two elements: guest and user? Why "guest" role stays at authorized user? Is it normal behavior or I did something wrong? A: This is expected. If you add some role to defaultRoles, it will be always available, regardless of authentication state. From $defaultRoles docs: A list of role names that are assigned to every user automatically without calling assign(). Note that these roles are applied to users, regardless of their state of authentication. | Mid | [
0.6094182825484761,
27.5,
17.625
] |
Q: RSS Feeds or API to access REIT information? I have a Web application that needs to display up to date information on REITs and tickers like AX.UN, BEI.UN, CAR.UN etc.. For example, I need to automate consumption of information on pages such as http://ca.finance.yahoo.com/q?s=AX-UN.TO Are there rss feeds or apis I can use to import this kind of data? I don't want to copy and paste this information into my website on a daily basis. A: On the very site you link to, there's a small link that says "download data". If you have a database with the symbols you want to track, it would be pretty easy to construct that download URL on the fly, query it, parse the CSV, and load that data into your database for display on your website. ETA: Here's the link: http://ca.finance.yahoo.com/d/quotes.csv?s=AX-UN.TO&f=sl1d1t1c1ohgv&e=.csv Just have your program replace the "AX-UN.TO" with whatever symbol you want, and it should grab the data for that symbol. | High | [
0.6702702702702701,
31,
15.25
] |
Rated 4 out of 5 by toomutsch60 This hotel always makes me feel at home I am always treated like family. When I checked in Erick went throught he check in procedures and verified I was staying for one night. I said I'd like to stay two nights but I didn't hink that was a possibility since Becky squeezed me in for this reservation. Becky noticed me checking in and assured me there was no problem with the additional night. AJ, Enrique and Gary are always cordial and accomodating in your restaurant lounge areas. I saw Durcee and Elizabeth who always have a great big smile when welcoming me. Your staff are second to none!! October 8, 2014 Rated 4 out of 5 by raaron30 Great Service & Staff I was amazed by the outstanding service September 29, 2014 Rated 3 out of 5 by twinbliss Air Unit too loud We only stayed at this hotel overnight before leaving Orlando the next day and it was rainy so we did not get to use the pool although it looked cool. The room was nice and clean but the in room air unit is very loud and I was not able to sleep with it constantly turning on however it was too warm to leave it off September 21, 2014 Rated 4 out of 5 by Bear Great place for families with children This is an an ouitstanding location fro families to stay when visiting the Orlando area attractions. September 15, 2014 Rated 5 out of 5 by Kathy25 Great Staff The staff was very friendly. Was checked in by Kenzo and she went above and beyond my expectations. Any questions that I had she was always willing to assist me and she was very informative.Would definitely recommend this hotel. September 8, 2014 Rated 4 out of 5 by JJGKLH Renovations Great, Ongoing Construction Not So Much I recently spent five nights in this property. Despite being on the older side, the extensive renovations are in process of bringing this property up to a solid value-priced tourist / family class hotel. Our junior suite had been renovated already and it was clean, tastefully decorated, and clearly new all around. Comfortable bed, nice furnishings, etc. That said - my only challenge here was the daily sound of the ongoing renovation work. I understand it has to be done, but some accommodation should be made to guests when there is jackhammering nearly the entire day. My kids needed a break from the theme park scene, but the hotel pool was rendered basically unusable by the brutal construction noise. Perhaps management should offer a free arrangement to use the pool at a nearby hotel (there are hundreds!) on heavy construction days. So I'd recommend the property overall, but it'll be better when renovations are fully done and if you're not sure, check with the hotel before booking. September 7, 2014 Rated 5 out of 5 by RonFish Hotel has great staff The staff is always very attentive to all your needs. September 5, 2014 Rated 5 out of 5 by Monica77 Very happy! Villa room was big, clean and nice! September 2, 2014 Rated 5 out of 5 by papa22 lots of fun enjoyed the pools and spa . beds sleep great stayed in front and heard no traffic nosie August 27, 2014 Rated 5 out of 5 by Aj2210 Good hotel Staff in this hotel are superb very welcoming and try very hard to help you out. Almost everything was perfect for us apart for the games room is no longer available and the very noisy a/c in room. I was very nervous reserving this hotel due to all the negative reviews on tripadvisor. We had a fantastic stay, Brenda and Victor at breakfast were great Eric the security guy helped us out when we had some none hotel related issues, A big thank you to you all. Pool area is noisy at night as everyone keeps saying on these reviews but its a resort in Orlando pretty much next door to Disney most people are on vacation so what do you expect. Fantastic hotel mainly down to the great staff, we will be retuning next year. August 25, 2014 Rated 5 out of 5 by delta We Will Be Back Jonathan checked us into a perfect room.Tao (housekeeping) made sure we didn't need for anything.Eric (valet) made my sister and me feel safe when we walked to the store at night. Although we did not actually use the pool area this time, it was clean and peaceful. The room selected for us was clean and comfortable. August 22, 2014 Rated 4 out of 5 by Susan1753 Disney vacation Hotel is nice. Staff was excellent. Rooms nice but need updates along with elevator. Updates are in progress. August 20, 2014 Rated 4 out of 5 by ale40 Great for kids & adults The staff was very accommodating & generous - very responsive to requests/problems. Kids Suites are very spacious with 2 TVs to keep adults & kids entertained. Pools were also very nice. August 19, 2014 Rated 5 out of 5 by Kim45 Vacation Experience Very clean hotel and great staff. The poolside cabanas were worth every bit of money we spent on them. August 19, 2014 Rated 4 out of 5 by Shelley1965 Great Location This hotel has a great location close to the gates of Downtown Disney. It caters to all ages. We loved that there was both a shallow pool area, a deep pool area with a slide and two hot tubs. The hotel was super clean and the staff were all very friendly and accommodating. The food we purchased pool side was delicious and very reasonably priced. They showed a movie on the pool deck each night and had a fire pit where we roasted marshmallows and made S'mores. I would definitely stay here again. August 18, 2014 Rated 4 out of 5 by rustyload Almost perfect Our stay was excellent from the moment we pulled up to the lobby until the moment we left. the only issue we had was the bathroom had a very strong urine odor August 17, 2014 Rated 3 out of 5 by Bbbbb45 Not as expected Dirty sofa and chair, old building August 15, 2014 Rated 5 out of 5 by Mervin Satisfied customer We are all satisfied of this hotel , well maintained room bed is comfortable compare with the other hotels and outdoor pool is fantastic kids loved it they have fun meeting other kids by the pool, good idea to have slide and play area inside the pool employee is friendly. Just a suggestion pls add disposable shower cap coz sometimes customer is tired and really wants to go straight to bed and don't have time to blow dry the hair,. But over all it's 5 star rating . Marie Maryland resident August 13, 2014 Rated 5 out of 5 by Anthony1313 Outstanding Customer Service My 4 year old daughter and I stayed at this property for a long weekend getaway to Disney. The customer service was outstanding from the moment we arrived until check out. We have stayed at many properties in the Orlando area, including other Starwood properties. The customer service here exceeds those without any comparison. I would like to give particular recognitIon to Kenzo who set the tone for a great stay. Thank you August 13, 2014 Rated 2 out of 5 by Lordsnow not a good stay. The room AC filter was dirty.My wife and son have allergies they did not sleep all night. Could not get in our room. The batteries on the door lock were dead had to wait in the hallway for someone to open the door. We got food from the bar it was the sampler. The pork was old and the chicken was black on outside and raw on the inside. We got a Pina colada from bar, the Well rum they used was horrible, worst drink ever. The wifi is Horrible could not connect at all. Julian the Pool attendant was great. he was very nice. August 12, 2014 Rated 5 out of 5 by Marbala Lake Buena Vista This hotel has the friendliest staff. We arrived late at night and were starving. We asked the Valet if we could just leave our car and find something to eat and park later. He informed us that their restaurant Zest was still open, so we checked in and then we ate there. During our meal, the Valet, Mike Shannon came in , gave us our keys and said he already parked the car and took our bags to our room. How wonderful that was after an exhausting flight from the west coast! The restaurant staff was great, the check in went smoothly and the pool area is fabulous! August 12, 2014 Rated 5 out of 5 by Julie70 great value My family and I always enjoy our stay. The pool area, bar and food are excellent. August 12, 2014 Rated 3 out of 5 by kansasfamily Decent hotel near Disney This is a decent hotel near Disney World. We stayed 4 nights on Universal Studios property and 4 nights on Disney property and then a final night here. It is a fine hotel, nothing special. It is clean enough and has nice beds. Gold SPG recognition was non-existent. Pool temperature was near perfect, but there was not near enough umbrellas around the pool. There are no in room refrigerators. The bell staff was horrible. I asked if they would take my bags and hold them until our room was ready and they acted like it was a huge inconvenience, I ended up leaving everything in my car and dragging it in later. Unfortunately this meant my specialty chocolate I had purchased at the parks melted! Also when we checked out, I pulled around the front to load bags and they just watched instead of offering to help. Since my husband wasn't with us, I would have appreciated the assistance. It is an adequate place to stay though. August 11, 2014 Rated 5 out of 5 by Barbara0849 Very clean This hotel was clean and the staff was very pleasant and professional. August 11, 2014 Rated 5 out of 5 by bmatos121 Great Stay at Sheraton Lake Buena Vista Great stay!! Rooms were clean service was great. Thank you to several employees including Brandy for the upgrade and treats, Jonathan at the front desk for the great checkin and Aniba for his promptness in taking care of my TV issue. August 7, 2014 Rated 5 out of 5 by Lozza28 Very nice hotel Lovely place to stay and welcoming staff. Very helpful and amazing service to get me a room when I had an early check in. Room service was prompt and delicious. Only problem was a very loud aircon did not help me sleep. August 6, 2014 Rated 5 out of 5 by Patrick511 Hotel hospitality Having stayed In this facility previously, I have been fortunate enough to meet multiple office/front desk staff and have been rewarded with fantastic service one would expect as a VIP let alone a working man away from home. Having Derci ,Rebecca , Michelle and others treat my self and others with such kindness and respect , that for myself ,colleagues ,and family there is only one choice when visiting/working in Orlando and It is Sheraton Lake Buena Vista August 5, 2014 Rated 3 out of 5 by Paras Great Pool...but I've feedback about Theme park Transportation I liked my stay at Sheration! Everything was great but the only thing that I've feedback about is the Transportation option to Disney parks...since there's a resort fee that includes transportation option to disney parks, I had assumed that there might be transportation every hour or so but that was not the case. We had to take taxi since the bus times were very inconvenient. August 4, 2014 Rated 4 out of 5 by Trex12345678 Nice Hotel overall... This hotel was nice and the pool area is great, especially for kids!! Kenzo from the front desk staff never stopped smiling from check-in to check-out!! August 4, 2014 | Mid | [
0.629032258064516,
29.25,
17.25
] |
Q: How to create mobile version of my website I am new to mobile application.I worked php, html .. before and created websites using that technologies.Now I have to create mobile version of that sites for example like m.url.com. Please suggest me the easy and best practice. A: If you expect lots of load; and want very good performance its advisable to develop native apps for each mobile type. Otherwise developing in HTML5 should be good enough. You already know jquery-mobile is a very good platform to start developing the mobile version. It is easy too and very fast development. Once it is developed on HTML5; you can use phonegap to deploy it on all mobiles. Regarding automatic conversion of normal website to mobile website: You can create a simple app (10 lines of code ) in which you would just invoke url.com and your app is ready. User can double click on app and internally that app will just show url.com though user would feel as though he is accessing the app. Talking about m.url.com which executes on browser of mobile: your normal website will indeed work on mobile too; only challenge is smaller screen size and lots of possible sizes. So, we just need fluid layout and a new CSS which has dimensions as per smaller screen sizes. If the original website is developed with mobile version in mind as future extension; then all you need to do is create an alternative css. Using Media-queries; it will automatically pick alternative css for mobiles. A: I'd say use Twitter Bootstrap for a quick responsive design, along with a commonly used CSS structure with a vast collection of themeable widgets. | Mid | [
0.596256684491978,
27.875,
18.875
] |
--TEST-- string offset 001 --FILE-- <?php // Test positive or null string offsets function foo($x) { var_dump($x); } $str = "abc"; var_dump($str[0]); var_dump($str[1]); var_dump($str[2]); var_dump($str[3]); var_dump($str[1][0]); var_dump($str[2][1]); foo($str[0]); foo($str[1]); foo($str[2]); foo($str[3]); foo($str[1][0]); foo($str[2][1]); ?> --EXPECTF-- string(1) "a" string(1) "b" string(1) "c" Warning: Uninitialized string offset 3 in %s on line %d string(0) "" string(1) "b" Warning: Uninitialized string offset 1 in %s on line %d string(0) "" string(1) "a" string(1) "b" string(1) "c" Warning: Uninitialized string offset 3 in %s on line %d string(0) "" string(1) "b" Warning: Uninitialized string offset 1 in %s on line %d string(0) "" | Low | [
0.48504273504273504,
28.375,
30.125
] |
Hillington, Norfolk Hillington is a civil parish in the English county of Norfolk. It covers an area of and had a population of 287 in 123 households as of the 2001 census, increasing to 400 at the 2011 Census. For the purposes of local government, it falls within the district of King's Lynn and West Norfolk. The village straddles the A148 King's Lynn to Cromer road. It formerly had a railway station, but this closed in 1959. Notable people Hillington is the traditional home of the ffolkes baronets. Francis ffolkes, 5th Baronet was Rector of Hillington from 1912 until his death. His nephew, the intelligence officer and conservationist Tracy Philipps, was born here in 1888. Notes External links Category:Villages in Norfolk Category:King's Lynn and West Norfolk Category:Civil parishes in Norfolk | Low | [
0.413793103448275,
22.5,
31.875
] |
Isolation of a T-lymphotropic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS). A retrovirus belonging to the family of recently discovered human T-cell leukemia viruses (HTLV), but clearly distinct from each previous isolate, has been isolated from a Caucasian patient with signs and symptoms that often precede the acquired immune deficiency syndrome (AIDS). This virus is a typical type-C RNA tumor virus, buds from the cell membrane, prefers magnesium for reverse transcriptase activity, and has an internal antigen (p25) similar to HTLV p24. Antibodies from serum of this patient react with proteins from viruses of the HTLV-I subgroup, but type-specific antisera to HTLV-I do not precipitate proteins of the new isolate. The virus from this patient has been transmitted into cord blood lymphocytes, and the virus produced by these cells is similar to the original isolate. From these studies it is concluded that this virus as well as the previous HTLV isolates belong to a general family of T-lymphotropic retroviruses that are horizontally transmitted in humans and may be involved in several pathological syndromes, including AIDS. | Mid | [
0.6482939632545931,
30.875,
16.75
] |
{ "name": "Demo", "version": "0.1.0", "private": true, "devDependencies": { "jest-expo": "25.0.0", "react-native-scripts": "1.11.1", "react-test-renderer": "16.2.0" }, "main": "./node_modules/react-native-scripts/build/bin/crna-entry.js", "scripts": { "start": "react-native-scripts start", "eject": "react-native-scripts eject", "android": "react-native-scripts android", "ios": "react-native-scripts ios", "test": "node node_modules/jest/bin/jest.js" }, "jest": { "preset": "jest-expo" }, "dependencies": { "expo": "^25.0.0", "react": "16.2.0", "react-native": "0.52.0", "react-native-tag-select": "^2.0.0" } } | Mid | [
0.593830334190231,
28.875,
19.75
] |
# -*- coding: utf-8 -*- """Parser for bash history files.""" from __future__ import unicode_literals import re import pyparsing from dfdatetime import posix_time as dfdatetime_posix_time from plaso.containers import events from plaso.containers import time_events from plaso.lib import errors from plaso.lib import definitions from plaso.parsers import manager from plaso.parsers import text_parser class BashHistoryEventData(events.EventData): """Bash history log event data. Attributes: command (str): command that was executed. """ DATA_TYPE = 'bash:history:command' def __init__(self): """Initializes event data.""" super(BashHistoryEventData, self).__init__(data_type=self.DATA_TYPE) self.command = None class BashHistoryParser(text_parser.PyparsingMultiLineTextParser): """Parses events from Bash history files.""" NAME = 'bash_history' DATA_FORMAT = 'Bash history file' _ENCODING = 'utf-8' _TIMESTAMP = pyparsing.Suppress('#') + pyparsing.Word( pyparsing.nums, min=9, max=10).setParseAction( text_parser.PyParseIntCast).setResultsName('timestamp') _COMMAND = pyparsing.Regex( r'.*?(?=($|\n#\d{10}))', re.DOTALL).setResultsName('command') _LINE_GRAMMAR = _TIMESTAMP + _COMMAND + pyparsing.lineEnd() _VERIFICATION_GRAMMAR = ( pyparsing.Regex(r'^\s?[^#].*?$', re.MULTILINE) + _TIMESTAMP + pyparsing.NotAny(pyparsing.pythonStyleComment)) LINE_STRUCTURES = [('log_entry', _LINE_GRAMMAR)] def ParseRecord(self, parser_mediator, key, structure): """Parses a record and produces a Bash history event. Args: parser_mediator (ParserMediator): mediates interactions between parsers and other components, such as storage and dfvfs. key (str): name of the parsed structure. structure (pyparsing.ParseResults): elements parsed from the file. Raises: ParseError: when the structure type is unknown. """ if key != 'log_entry': raise errors.ParseError( 'Unable to parse record, unknown structure: {0:s}'.format(key)) event_data = BashHistoryEventData() event_data.command = self._GetValueFromStructure(structure, 'command') timestamp = self._GetValueFromStructure(structure, 'timestamp') date_time = dfdatetime_posix_time.PosixTime(timestamp=timestamp) event = time_events.DateTimeValuesEvent( date_time, definitions.TIME_DESCRIPTION_MODIFICATION) parser_mediator.ProduceEventWithEventData(event, event_data) # pylint: disable=unused-argument def VerifyStructure(self, parser_mediator, lines): """Verifies that this is a bash history file. Args: parser_mediator (ParserMediator): mediates interactions between parsers and other components, such as storage and dfvfs. lines (str): one or more lines from the text file. Returns: bool: True if this is the correct parser, False otherwise. """ match_generator = self._VERIFICATION_GRAMMAR.scanString(lines, maxMatches=1) return bool(list(match_generator)) manager.ParsersManager.RegisterParser(BashHistoryParser) | Mid | [
0.544031311154598,
34.75,
29.125
] |
Saint Philotheos Saint Philotheos (died 5 May 1380) was a Coptic Orthodox martyr and saint. Philotheos was born in Durunka, in the province of Assiut. He was tortured by the Muslims in an attempt to force him to renounce Christianity and embrace Islam. He refused and was eventually martyred on 2 Pashons, 1096 A.M. (5 May 1380) References Category:Coptic Orthodox saints Category:Christians executed for refusing to convert to Islam Category:1380 deaths Category:14th-century Christian saints Category:14th-century Christian martyrs Category:Christian saints killed by Muslims Category:Year of birth unknown Category:Persecution of Oriental Orthodox Christians | Mid | [
0.6262135922330091,
32.25,
19.25
] |
O'Driscoll excited by Fitzgerald partnership The British & Irish Lions Tour to New Zealand 2017 O'Driscoll excited by Fitzgerald partnership 3 June 2008 14:41pm By Brian O'Driscoll There are few surprises in the Ireland starting line-up for Saturday's one-off Test against New Zealand. As expected, interim head coach Michael Bradley picked the bulk of Munster's European Cup-winning pack and selected a back line dominated by Leinster's Celtic League winners, including centre Luke Fitzgerald who has sat out the past two training session with a stiff ankle. Fitzgerald will start alongside Brian O'Driscoll in the midfield, the first time the pair have combined at international level, and it was a prospect the Irish skipper was relishing. "I was looking forward to playing with Lukey against the Baa-baas last week and it didn't materialise," said O'Driscoll, who missed the Barbarians match because of the death of a close friend. "I'm certainly looking forward to it. He's such an exciting talent and for such a young guy he has confidence in abundance and I think that will alleviate any nerves a lot of people in that position may feel. "It's going to be an exciting prospect and we're looking forward to trying to forge some sort of partnership together." The starting XV also includes Eoin Reddan, fresh from Wasps' success in the Guinness Premiership final against Leicester. Reddan, Leicester's Geordan Murphy and O'Driscoll had their first run with the squad on Tuesday. One Munster man missing from the line-up is loose forward Alan Quinlan who was not considered for selection after failing to recover from a dead leg he suffered in the European Cup final win. Jamie Heaslip will start on the blindside in his place. Bradley was under no illusion of the task ahead of Ireland, who have not beaten New Zealand in 20 attempts. "In recent times New Zealand have won 42 of their last 48 matches which is a very good strike rate," he said. "You go back a couple of years and they really put it up to the Lions and won that series very comfortably. So it is very difficult to win matches here." Despite having had less than a week to prepare for the contest, and the disruption of players arriving late, Bradley said that would not be used as an excuse. "Both sides will be prepared well for the match and it's down to performance on the day." | Mid | [
0.6497326203208551,
30.375,
16.375
] |
Comparison of milk output between breasts in pump-dependent mothers. This article reports the naturally occurring pattern of milk output beginning day 6 through day 42 postpartum from each individual breast in 95 pump-dependent mothers of a non-nursing preterm infant. Of the 3488 study days, milk output was greater from the left breast on 51.6% (n = 1800) of the study days, from the right breast 45.8% (n = 1598) of the study days, and equal 2.6% (n = 90) of the study days. Overall, total left and right breast milk output for the entire study (37 days) was 52.6% and 47.4%, respectively. There was no significant relationship between individual breast milk output and maternal handedness, parity, or breastfeeding experience. Clinicians need to assess the total milk output as well as individual breast output in lactating mothers, as there may be significant disparities in milk production. | Mid | [
0.623376623376623,
36,
21.75
] |
Pelican Island National Wildlife Refuge Pelican Island National Wildlife Refuge is a United States National Wildlife Refuge (NWR), and part of the Everglades Headwaters NWR complex, located just off the western coast of Orchid Island in the Indian River Lagoon east of Sebastian, Florida. The refuge consists of a island that includes an additional of surrounding water and is located off the east coast of Florida of the Indian River Lagoon. Established by an executive order of President Theodore Roosevelt on March 14, 1903, Pelican Island was the first National wildlife refuge in the United States. It was created to protect egrets and other birds from extinction through plume hunting. Management Pelican Island is administered as part of the Everglades Headwaters NWR complex along with Archie Carr NWR, Lake Wales Ridge NWR, and the Everglades Headwaters NWR and Conservation Area, created in 2012 (556th unit of the National Wildlife Refuge System) with a donation and other lands covering approximately north of Lake Okeechobee. will be held under "conservation easement"s through the U.S. Department of the Interior and the U.S. Fish and Wildlife Service. This allows landowners the right to retain ownership of the land, with the ability to continue farming or ranching, ensuring that the land can't be subdivided or developed. Pelican Island NWR has been placed on the List of Ramsar wetlands of international importance along with other areas of wetlands in the United States. Early history Pelican Island's bird populations were threatened because of increased American settlement around the area in the mid-19th century. Many of the exotic birds were killed for their feathers, used in the fashion industry. Plumes from the birds were used to adorn ladies' hats of the day and at the time were worth more than their weight in gold. Paul Kroegel, a German immigrant, moved to Florida in 1881 and lived on the west bank of Indian River Lagoon. He was fascinated with the pelicans on the island. Being able to see the island from his home, Paul would watch the pelicans and other water birds. He eventually took an interest in the island and its protection. However, there was not any state or federal law to help him so he took control of the situation himself. Kroegel sailed to the island to stand guard and protect the birds and the island. A few naturalists visited Kroegel at Pelican Island. A curator at the American Museum of Natural History in New York, Frank Chapman, was one of the naturalists showing interest in the island as well. He discovered that Pelican Island was one of the last rookeries of Brown pelicans on the eastern coast of Florida. The American Ornithologists' Union and the Florida Audubon Society led a campaign to pass legislation for protection of non-game birds in 1901. Knowing that the protection of Pelican Island would require more legislation, Chapman and his fellow advocate, William Dutcher went to President Theodore Roosevelt at his home in New York. The two appealed their case to Roosevelt's conservative ethics. President Roosevelt signed an executive order that established Pelican Island as the first federal bird reservation. This was the first time that the federal government put land aside for the sake of wildlife. The area, however, was open for big game hunters. Recent threats During the 1960s, Pelican Island was threatened by attempts to sell the surrounding wetlands and islands to developers. Local citizens led a fight to protect Pelican Island by stopping the sale of the wetlands. The Indian River Area Preservation League, formed by local citrus growers, commercial fishermen, and sportsmen, joined with Florida Audubon Society to convince the State to include the islands as a part of the refuge. "Later in 1963, Pelican Island was designated as a National Historic Landmark by the Secretary of the Interior because of its status as the first federal area set aside specifically to protect wildlife." In 1968, Florida agreed to expand to include nearly 5000 acres (20 km²) of mangrove islands and other submerged lands. And then in 1970, Pelican Island became the smallest wilderness area in the National Wilderness Preservation System. Since, the refuge has gained over 500 acres (2 km²) through purchases, management agreements, and conservation easements to provide a buffer against encroaching development and also to be a link to the Archie Carr National Wildlife Refuge. Pelican Island National Wildlife Refuge was added to the list of wetlands of international importance under the Ramsar Convention signed in 1971. Today, Pelican Island is also threatened by shoreline development. Shoreline development has many negative impacts associated with it. Shoreline development can reduce the water quality by increasing the runoff of sediments, fertilizers, and pesticides. These runoffs will cause decline in water quality, and this can directly affect the food base that sustains the island's nesting bird colonies. Waterfront development will also lead to more boat traffic. This extra boat traffic will also negatively affect the birds on the coast. Not only this, development of the shorelines of Pelican Island will permanently flaw the pristine character of this unique National Historic Landmark. Physical environment The environment of Pelican Island consists of climate, topography, geology, air quality, and waterways. Climate The climate at Pelican Island NWR is subtropical and temperate and experiences an average temperate of . Pelican Island has long, warm, and humid summers and short, mild winters and has an average rainfall of about annually. Pelican Island may experience tropical storms in the period from May to November. Topography The elevation of Pelican Island changes from east to west. It rises sharply from sea level to about and then drops back down more slowly to below sea level in the Indian River Lagoon. The land between the Indian River Lagoon and St. Sebastian River is . Even further west, there is an ancient dune that rises in elevation from to . Geology The landscape of Pelican Island area is made of Pleistocene (glacial) and Holocene (recent) origin. Submerged lands were exposed during the late Pleistocene period, allowing for the spread of flora and fauna from the peninsula. Wetlands, salt marshes, mangroves, and other swampy formations make up the uplands and submerged lands. Soil "The general soils in the Pelican Island Refuge are Canaveral-Captiva-Palm Beach, which is characterized by the gently sloping, somewhat poorly drained to moderately drained sandy soils with shell fragments, and McKee-Quartzipsamments-St. Augustine, which is characterized by level, somewhat poorly drained soils mixed with sand and shell fragments." Other soils include Canaveral Fine Sand, Quartzipsamments, Captiva Fine Sand, McKee Mucky Clay Loam, and Kesson Muck. Air quality Good air quality is vital for the refuge to maintain itself. A few problems dealing with air pollution are carbon monoxide, lead, nitrogen dioxide, ozone, particulate matter, and sulfur dioxide. The primary producers of these pollutants are vehicle emissions, power plants, and industrial activities. The Indian River Lagoon area is said to have good air quality. Sometimes occasional temperate increases can temporarily degrade the air quality below the accepted levels. Waterways The Indian River Lagoon stretches from Ponce de Leon south of Daytona Beach to Jupiter Inlet near West Palm Beach, a distance of about , and contains a number of small rivers, creeks, and canals. The Intracoastal Waterway is the deepest part of the Lagoon. St. Sebastian River and Turkey Creek provide freshwater to the Lagoon. Water quality is also a concern in the refuge: cadmium, lead, mercury, nutrients, selenium, thallium, and dissolved oxygen. The water circulation is affected by the Intracoastal Waterway, winds, inlets, and causeways. Within the refuge boundary, the water quality is generally better compared to portions of the Lagoon. Wildlife Pelican Island National Wildlife Refuge holds hundreds of species of animals including birds, fish, plants, and mammals. The wetlands of Pelican Island are a major ecological system supporting the huge biological diversity. Fifteen federally listed threatened and endangered species live in Pelican Island NWR and around Indian River Lagoon. Of the endangered species, West Indian manatees and sea turtles occupy parts of the lagoon. Around the lagoon in the refuge are two wood stork refuges. These birds along with other wading birds that nest on the island thrive on the tremendous fish population. Pelican Island is home to many nesting birds including brown pelicans, great egrets, snowy egrets, reddish egrets, great blue heron, little blue heron, tricolored heron, black-crowned night heron, American white ibis, glossy ibis, double-crested cormorant, anhinga, and American oystercatcher. Visiting Pelican Island is only accessible by boat or chartered tours. Nesting birds are easily disturbed, so people are not allowed to get too close or to disembark. Visiting during nesting season (late November through late July), one can expect to see brown pelican, wood storks, white ibises, black-crowned night herons, double-crested cormorants, reddish, snowy, and great egrets, and great blue, little blue and tricolored herons. Traveling in the winter, look for lesser scaup, blue-winged teal, mottled ducks, great northern divers, laughing gulls, American white pelicans, and red-breasted mergansers. Summer visitors should watch for roseate spoonbills, magnificent frigatebirds and least terns. Pelican Island also features some marine life in the Indian River including sea turtles, dolphins, and manatees. New public facilities were opened and dedicated on March 14, 2003, in ceremonies marking the centennial of Pelican Island and the National Wildlife Refuge System. A 37¢ US Commemorative Stamp in honor of the NWR Centennial was issued as part of the celebration. The new facilities include a 1/4 mile boardwalk and observation tower to view Pelican Island, two salt marsh impoundment foot trails, interpretive signs, informational kiosks, restrooms and parking areas. The facilities are west of Highway A1A on the north end of Historic Jungle Trail. They were produced through a partnership with Indian River County, St. Johns River Water Management District, Florida Inland Navigation District, Florida Power and Light, ConocoPhillips, Wild Birds Unlimited, the National Fish and Wildlife Foundation, and many others. Future plans include additional boardwalks, an overlook, a photo blind and a wildlife drive. Budget cuts Pelican Island, along with many other wildlife refuges, has been experiencing budget cuts. Many problems arise from the stagnant budget and lack of maintenance in the wildlife refuges. These are vital to preserve the habitat and the wildlife and to provide public education and recreation. This situation worsened further because of the failure of congress to timely pass federal funding bills. Staffing at Pelican Island is made up of U.S. Fish and Wildlife Service. The staff members have recently fallen from six to two which has had many negative consequences. The cuts have led to limiting refuge work and restricting public visitation. Another consequence is the end of 14-year tradition of the wildlife festival. Pelican Island will be losing its only public-use staff and eliminating all active outreach at the nation's first wildlife refuge. Pelican Island Refuge manager and project leader Paul Tritaik said in 2006 that reductions to a full-time staff would lead to the end of some refuge activities and the loss of several trails. See also Florida State Parks Indian River County, Florida List of National Wildlife Refuges History of the National Wildlife Refuge System Notes References Dinnage, Russell J. "WILDLIFE REFUGES: Budgetary downturn for national refuges hits staffers hardest." Land Letter. 16 November 2006. Hem, Brad. "Looking ahead, Pelican Island may be next in line: Port of Houston buys land, could join Galveston in a joint effort." The Houston Chronicle. 4 February 2007. McHugh, Paul. "Wildlife refuges on life support; Flat budgets imperil future of the system." The San Francisco Chronicle. 21 December 2006. "Parks: Pelican Island National Wildlife Refuge." GORP. 2007. 26 April 2007. <http://www.gorp.com/parks-guide/travel-ta-prime-hook-national-wildlife-refuge-pelican-island-national-wildlife-refuge-birdwatching-sidwcmdev_068511.html>. "Pelican Island National Wildlife Refuge: Comprehensive Conservation Plan." U.S. Fish and Wildlife Service. Sept 2006. 9 May 2007. <http://library.fws.gov/CCPs/pelicanisland_final.pdf>. "Pelican Island National Wildlife Refuge." U.S. Fish and Wildlife Service. 2007. 26 April 2007. <http://www.fws.gov/pelicanisland/>. External links Official Pelican Island National Wildlife Refuge website Pelican Island Webcam website Category:National Wildlife Refuges in Florida Category:Indian River Lagoon Category:Wetlands of Florida Category:National Register of Historic Places in Indian River County, Florida Category:National Historic Landmarks in Florida Category:Protected areas established in 1903 Category:Protected areas of Indian River County, Florida Category:Ramsar sites in the United States Category:Landforms of Indian River County, Florida Category:Islands of Florida Category:1903 establishments in Florida | Mid | [
0.609958506224066,
36.75,
23.5
] |
--- abstract: | Functional subnetwork extraction is commonly used to explore the brains modular structure. However, reliable subnetwork extraction from functional magnetic resonance imaging (fMRI) data remains challenging due to the pronounced noise in neuroimaging data. In this paper, we proposed a high order relation informed approach based on hypergraph to combine the information from multi-task data and resting state data to improve subnetwork extraction. Our assumption is that task data can be beneficial for the subnetwork extraction process, since the repeatedly activated nodes involved in diverse tasks might be the canonical network components which comprise pre-existing repertoires of resting state subnetworks [@Park-2014-Graph]. Our proposed high order relation informed subnetwork extraction based on a strength information embedded hypergraph, (1) facilitates the multisource integration for subnetwork extraction, (2) utilizes information on relationships and changes between the nodes across different tasks, and (3) enables the study on higher order relations among brain network nodes. On real data, we demonstrated that fusing task activation, task-induced connectivity and resting state functional connectivity based on hypergraphs improves subnetwork extraction compared to employing a single source from either rest or task data in terms of subnetwork modularity measure, inter-subject reproducibility, along with more biologically meaningful subnetwork assignments. Keywords: Brain Subnetwork Extraction, Multisource Fusion, Functional Connectivity, Hypergraph author: - 'Chendi Wang, Rafeef Abugharbieh' bibliography: - 'biblio.bib' title: Hypergraph based Subnetwork Extraction using Fusion of Task and Rest Functional Connectivity --- Biomedical Signal and Image Computing Lab, UBC, Canada [email protected], [email protected] Introduction ============ The human brain can be regarded as being a network where units, or nodes, represent different specialized regions, and edges represent communication pathways. Brain network analysis methods for connectome studies include an important branch of brain subnetwork identification. Given brain connectivity matrices, brain networks can be quantitatively examined for certain commonly used network measures. The modular structure (community structure) is of particular interest; it is from this structure that we can infer information about brain subnetworks. The modular structure is extracted by subdividing a network into groups of nodes with the maximal possible within-group links and minimal between-group links using community detection methods [@Girvan-2002-Community]. Most existing functional subnetwork extraction methods focus on resting state function connectivity data [@Van-2008-Normalized; @Nicolini-2016-Modular], using functional homogeneity clustering, , or graph community detection. However, resting state functional connectivity is inherently with low and prone to false positive correlations [@Murphy-2013-fMRI]. Such noisy resting state functional connectivity information leads to unreliable subnetwork extraction results. Given the resemblance between resting state and task functional subnetworks [@Smith-2009-Correspondence] and high order nodal relations reflected from multi-task data, we here aim to incorporate information from task data into the subnetwork extraction based on multilayer network. We explore if this integration can improve the subnetwork extraction by exploiting the mechanism of how groups of nodes collaborate together to execute a function and how these groups communicate with each other. Related Work - Relationship between Task and Resting Functional Connectivity {#subsec:task_re} ---------------------------------------------------------------------------- Recent studies indicate that resting state functional activity actually persists during task performance [@Fox-2007-Intrinsic], and similar network architecture is present across task and rest, which is supported by the existence of similar multi-task and resting-state matrices that were averaged across subjects [@Cole-2014-Intrinsic]. Studies have also shown that there is a strong resemblance between rest and task subnetworks [@Smith-2009-Correspondence; @Sporns-2016-Modular]. The spatial overlap between resting-state functional subnetworks and task-evoked activities has been discovered [@Tavor-2016-Task; @Chan-2017-Resting]. Based on the close relationship between the two, resting state data have been used to predict the task activities, by using group to discover repertories of canonical network components that will be recruited in tasks [@Park-2014-Graph]; by applying the graphical connectional topology of brain regions at rest to predict functional activity of them during task [@Chan-2017-Resting]; or based on a voxel-matched regression method to estimate the magnitude of task-induced activity [@Mennes-2010-Inter]. On the other hand, aggregating brain imaging data from thousands of task related studies allowed the construction of ‘co-activation networks’, whose major components and overall network topology strongly resembled functional subnetworks derived from resting-state recordings [@Crossley-2013-Cognitive; @Bertolero-2015-Modular; @Bassett-2017-Network]. It has been suggested that networks involved in cognition are a subset of networks embedded in spontaneous activity [@Smith-2009-Correspondence; @Laird-2011-Behavioral], and a number of canonical network components in the pre-existing repertoires of intrinsic subnetworks are selectively and dynamically recruited for various cognitions [@Mesulam-1998-Sensation; @Park-2014-Graph]. Related Work - Multilayer Brain Network Analysis ------------------------------------------------ Multilayer network has recently been used to model and analyze complex high order data, such as multivariate and multiscale information within the human brain [@De-2017-Multilayer]. Different layers can represent relationships across different temporal variations [@Muldoon-2016-Network], reflect different imaging modalities (such as task and rest) [@De-2017-Multilayer], or different frequency bands [@De-2016-Mapping], etc. Hypergraph is a type of multilayer graphs, in which edges can link any number of nodes [@Zhou-2007-Learning]. Hypergraphs have been used to identify non-random structure in structural connectivity of the cortical microcircuits [@Dotko-2016-Topological], identify high order brain connectome biomarkers for disease prediction [@Zu-2016-Identifying], and study relationships between functional and structural connectome data [@Munsell-2016-Identifying]. High Order Relation Informed Subnetwork Extraction {#subsec:Task_hyper} ================================================== Our assumption is that task data can be beneficial for subnetwork extraction since the repeatedly activated nodes in different tasks could be the canonical network components in the spontaneous resting state subnetworks. At the same time, the multilayer structure of repeatedly activated nodes across multi-task can be elegantly presented as a hypergraph. We propose a high order relation informed subnetwork extraction model, which (1) facilitates multisource integration of task and rest data for subnetwork extraction, (2) utilizes information from the relationship between groups of activated nodes across different tasks, and (3) enables the study on higher order relations among brain network nodes. Framework --------- We propose a high order relation informed approach based on hypergraph to integrate both resting state and task information for brain subnetwork extraction. We firstly construct a brain graph based on a certain parcellation atlas. Secondly, we detect activation of brain nodes from task data to define the nodes for multiple layers in the hypergraph, and define the connection strength between nodes using task-induced connectivity. Thirdly, we construct the multitask hypergraph and incorporate resting state strength information when setting the weights of hyperedges. Fourthly, we fuse task and rest using weighted combination model before performing graphcut on the constructed graph. Notation Overview of Hypergraph ------------------------------- ### Notations {#para:Nota_hyper} We here follow most of the notations presented in [@Zhou-2007-Learning]. Let $V$ denote a set of nodes, and $E$ denote a family of subsets $e$ of $V$ such that $\cup e\in E = V$. Then we define $G = (V;E)$ a hypergraph with the vertex set $V$ and the hyperedge set $E$. A hyperedge containing just two nodes is a simple graph edge. A hyperedge $e$ is said to be incident with a node $v$ when $v \in e$. Two nodes are *connected* if they both belong to the same hyperedge. Two hyperedges are connected if the intersection of them is not an empty set, $e_i\cap e_j \neq \emptyset$. Given an arbitrary set $X$, let $|X|$ denote the cardinality of $X$. A hypergraph $G$ can be represented by a $|V|\times |E|$ *incidence* matrix $\mathbf{H}$ with entries $h(v, e) = 1$ if $v \in e$ and 0 otherwise, see an example in . A weighted hypergraph, $G = (V;E;w)$, is a hypergraph that has a positive number $w(e)$ associated with each hyperedge $e$, called the weight of hyperedge $e$. Next, we define four important measures of hypergraph properties. For a hyperedge $e\in E$: 1\. We follow [@Zhou-2007-Learning] to define its degree as $d\_h(e)=\delta(e):=|e|$, which counts the number of nodes that exist in the hyperedge. If one uses the incidence matrix, $\delta(e): = \sum_{\{v\in V\}}h(v,e)$. Let $\mathbf{D_e}$ denote the diagonal matrices containing the hyperedge degrees. Take as an example, $\delta(e_1) = 3$, and $\delta(e_2) = 2$. 2\. We further define the hyperdegree of a hyperedge as the number of hyperedges connected to it, denoted as $d\_hH(e): = \sum_{\{e_i\in E, e_i\neq e\}} e\cap e_i$. For example, $d\_hH(e_1) = 3$, $d\_hH(e_3) = 2$, and $d\_hH(e_4) = 0$ in . For a node $v \in V$: 3\. We follow [@Zhou-2007-Learning] to define its degree by $d(v) = \sum_{\{e\in E | v \in e\}} w(e)$. If one uses the incidence matrix, $d(v) = \sum_{\{e\in E\}}w(e)h(v,e)$. When all $w(e)$ = 1, $d(v)$ counts the number of hyperedges which include this node: $d(v) = \sum_{\{e\in E | v \in e\}} 1$, or $d(v) = \sum_{\{e\in E\}}h(v,e)$. Let $\mathbf{D_v}$ denote the diagonal matrices containing the node degrees. 4\. We then define the hyperdegree of a node as $d\_H(v): = \sum_{\{v\in e | e\in E\}} \delta(e)$, which counts the number of nodes connected to a particular node across all hyperedges. For example, $d\_H(v_2) = 5$, $d\_H(v_3) = 6$, $d\_H(v_5) = 3$ in . Its weighted version will be estimating the strength between the connected node pairs. Next, let $\mathbf{W}$ denote the diagonal matrix containing the weights $w(e)$ of hyperedges. Correspondingly, the adjacency matrix $\mathbf{A}$ of hypergraph $G$ is defined as: $$\label{eq:hyper_A} \mathbf{A} = \mathbf{HWH}^{T} - \mathbf{D_v},$$ where $\mathbf{H}^{T}$ is the transpose of $\mathbf{H}$. ### Graphcut of the Hypergraph One can group the nodes into subsets using graph partitioning methods, graphcut. The intuition is to find a partition of the graph such that the edges within a subset have high weights (strong intra-class connections), and the edges between different subsets have low weights (weak inter-class connections). Let $S \in V$ denote a subset of nodes and $S^c$ denote the complement of $S$. Follow the notations in [@Von-2007-Tutorial], the adjacency matrix $\mathbf{A}(X,Y):=\sum_{i\in X, j\in Y} a_{ij}$. For a given number $M$ of subnets, the Mincut approach [@Stoer-1997-Simple] implements the graphcut by generating a partition $S_1,\ldots,S_M$ which minimizes $$\label{eq:Mincut} \text{cut}(S_1,\ldots,S_M) :=\frac{1}{2} \sum^M_{i=1}\mathbf{A}(S_i,S^c_i).$$ To solve the problem of separating individual nodes as a subset in Mincut, RatioCut [@Hagen-1992-New] and [@Shi-2000-Normalized] have been proposed to encode the information of the size of a subset. $$\label{eq:Ratiocut} \text{RatioCut}(S_1,\ldots,S_M) :=\frac{1}{2} \sum^M_{i=1}\frac{\mathbf{A}(S_i,S^c_i)}{|S_i|} = \sum^M_{i=1}\frac{\text{cut}(S_i,S^c_i)}{|S_i|},$$ where $|S|$ measures the number of nodes in $S$. $$\label{eq:Ncuts1} \text{Ncut}(S_1,\ldots,S_M) :=\frac{1}{2} \sum^M_{i=1}\frac{\mathbf{A}(S_i,S^c_i)}{\text{vol}(S_i)} = \sum^M_{i=1}\frac{\text{cut}(S_i,S^c_i)}{\text{vol}(S_i)},$$ where $\text{vol}(S)$ measures the volume of $S$ by summing over the weights of all edges attached to the nodes as $\text{vol}(S) :=\sum_{v\in S}ds(v)$, and node strength $ds(v)$ is the weighted version of node degree $d(v)$. has been widely used in image segmentation and brain study community, since it utilizes the weight information. In the following, we show that approach can be generalized from simple graphs to hypergraphs, which has been proven in [@Zhou-2007-Learning]. For a hypergraph $G = (V;E;w)$, a cut is a partition of $V$ into two parts $S$ and $S^c$. A hypergraph $e$ is cut when it is incident with the nodes in $S$ and $S^c$ at the same time. The *hyperedge boundary* of $S$ is defined as $\partial S:=\{e\in E|e\cap S \neq \emptyset, e\in E|e\cap S^c \neq \emptyset\}$, which is a hyperedge set consisting of the hyperedges which are cut [@Zhou-2007-Learning]. The definition of the volume in a hypergraph $\text{vol}(S)$ is the sum of the degrees of the nodes in $S$, $\text{vol}(S) :=\sum_{v\in S}d(v)$. Each hyperedge is essentially a fully connected subgraph, then the edges in a subgraph is called subedges, being assigned with the same weight $w(e)/\delta(e)$. When a hyperdege $e$ is cut, there are $|e\cap S||e\cap S^c|$ subedges are cut. Hence, the volume of $\partial S$ is defined by $$\label{eq:hyperbound} \text{vol}(\partial S) :=\sum_{e\in \partial S}w(e)\frac{|e\cap S||e\cap S^c|}{\delta(e)},$$ which is the sum of weights over the subedges being cut. By this definition, we have $\text{vol}(\partial S) = \text{vol}(\partial S^c)$. Similar to the simple graphs, Normalized hypergraph cut is to keep the high intra-class connection and low inter-class connection with a partition $S_1,\ldots,S_M$ by minimizing the cut as below: $$\label{eq:hypercut} \operatorname*{argmin}_{\emptyset \neq S_1,\ldots,S_M\subset V} \sum_{i=1}^M \frac{\text{vol}(\partial S_i)}{\text{vol}(S_i)}.$$ Task Activation Detection - Node Definition in the Hypergraph {#para:task_activation} ------------------------------------------------------------- In order to construct the multiple layers in the hypergraph, we apply the activation detection technique on the task data to define the nodes that are contained in different hyperedges. The standard way of activation detection is to use a where statistics, such as t-values, reflect the degree of the similarity between the stimulus and voxel time courses. The estimated statistics produce an activation statistics map (t-map), followed by a thresholding of the map to identify the activated voxels [@Friston-1994-Statistical]. Due to the pronounced noise in the data, activation detection at the individual level could be inaccurate [@Ng-2012-Modeling]. In order to derive more reliable task-induced activation, we have chosen a group activation detection over the individual based approach. First, to compute the intra-subject activation patters, a standard is applied as below [@Friston-1994-Statistical]: $$\label{eq:activation} \mathbf{Y}^i = \mathbf{X}^i \beta^i + \mathbf{E}^i,$$ where $\mathbf{Y}^i$ is a $t\times N$ matrix of the task-induced time courses of $N$ brain regions from subject $i$, $\beta^i$ is a $d\times N$ activation matrix to be estimated, $\mathbf{E}^i$ is a $t\times N$ residual matrix, and $\mathbf{X}^i = [\mathbf{X}_{\text{task}}|\mathbf{X}^i_{\text{confounds}}]$ is a $t\times d$ matrix. $\mathbf{X}_{\text{task}}$ is the task regressors and $\mathbf{X}^i_{\text{confounds}}$ is the confound regressors. Next, we combine the activation results across subjects to assemble a group activation map, which is used to define nodes for each layer of the hypergraph. Specifically, we apply a max-t permutation test [@Nichols-2003-Controlling] on $\beta^i$ aggregated from all the subjects, which implicitly accounts for multiple comparisons and control over false detections [@Yoldemir-2016-Multimodal]. Group activation is declared at a p-value threshold of 0.05. Strength Informed Weighted Multi-task Hypergraph ------------------------------------------------ In the beginning of , we argued that multi-task information can be presented as a hypergraph, with the hyperedges being different tasks, and the nodes in each hyperedge being the brain regions activated in a certain task. In the traditional definition of hypergraph, nodes are connected to each other binarily, the edge weights between a node pair are 1 if they are connected, or 0 otherwise. We here propose a strength informed weighted hypergraph model by incorporating the strength information from the connections between nodes. We further determine the hyperedge weight $w(e)$ using the graphical measures defined in . ### Pairwise Nodal Connection Strength Estimation {#para:C_task_comp} In order to estimate the strength of the connections between two nodes, we use the Pearson’s correlations between time courses from pairs of brain regions. We denote the resting state connectivity matrix as $\mathbf{C}^{\text{rest}}$. To produce the task-induced connectivity matrix $\mathbf{C}^{\text{task}}$, we use the task-induced time course information. We follow the strategy in [@Cole-2014-Intrinsic] to remove all inter-block rest periods from all regions’ time courses, before computing the pairwise Pearson’s correlations across all concatenated block/event duration time courses within a task. To keep the consistency when combining information from the nodes across different layers, we keep all the $\mathbf{C}^{\text{task}}$ having the same dimension of $N\times N$ as the $\mathbf{C}^{\text{rest}}$, then set the rows and columns of non-activated nodes to zero. ### Proposed Strength Informed Weighted Hypergraph We present a modified hypergraph cut criteria formulation based on to incorporate pairwise nodal connection strength information from $\mathbf{C}$ as below in . The symbol $\tilde .$ indicates the usage of strength information. $$\label{eq:hyperbound_w} \tilde{\text{vol}}(\partial S) :=\sum_{e\in \partial S}\tilde w(e)\frac{\sum_{i\in \{e\cap S\}, j\in \{e\cap S^c\}} \mathbf{C}^e_{ij}}{\delta(e)}, $$ where $\tilde{\text{vol}}(\partial S)$ is a strength informed version of $\text{vol}(\partial S)$ in , $\mathbf{C}^e$ is the connectivity matrix derived from the task corresponding to the layer $e$, and $\tilde w(e)$ is the modified weight item in the hypergraph. We propose here to incorporate strength information from the connectivity matrix and utilize the four hypergraph measures defined in to determine $\tilde w(e)$, whose nature is the importance of the hyperedge in the hypergraph. Based on the definition of the four hypergraph measures, we exploit their corresponding biological meanings to set $\tilde{\text{vol}}(\partial S)$ and $\tilde w(e)$ as below: 1\. The degree of a hyperedge $\delta(e)$ counts the number of brain regions that are activated in a task. To avoid the bias of the hyperedge size, $\tilde{\text{vol}}(\partial S)$ should be normalized by $\delta(e)$. 2. The hyperdegree of a hyperedge is defined as the number of hyperedges that are connected to it. Higher value indicates that more frequently activated patterns in the brain activities exist in this hyperedge. Thus, $\tilde w(e)$ should be proportional to $d\_hH(e)$, $\tilde w(e) \propto d\_hH(e)$. 3\. The degree of a node counts the number of hyperedges that contain this node, and the biological equivalence is the number of different tasks in which one node is activated. A node with a higher degree is similar to the definition of the connector hubs residing within different subnetworks. Hence, $\tilde w(e)$ should be proportional to some statistics derived from $d(v)$ of the nodes in a hyperedge $e$. We denote the statistics computation method as *stat* here and it can be widely used statistics such as average value (mean), median value (median) and maximum value (max). Thus, $\tilde w(e) \propto stat(d(v))$. 4\. The hyperdegree of a node reflects the number of all other nodes that are connected to it across all layers, which equals the number of connections from other co-activated nodes to it across multiple tasks. The biological meaning of a node with a high value coincides with the definition of hubs. Hence, $\tilde w(e)$ should be proportional to some statistics derived from $d\_ H(v)$ of the nodes in a hyperedge $e$, $\tilde w(e) \propto stat(d\_ H(v))$. Here, in order to incorporate strength information, we apply the weighted version of $d\_ H(v)$, the strength of the node $d\_ Hs(v)$ as defined in , $\tilde w(e) \propto stat(d\_ Hs(v))$. $$\label{eq:node_strength_m} d\_ Hs(v): = \sum_{\{v\in e | e \in E\}} \sum_{u\in e} \mathbf{C}^{e}_{uv}, $$ where $\mathbf{C}^{e}$ is the task-induced connectivity matrix for the $e$th task. In order to utilize strength information and hypergraph measures, we propose the $\tilde w(e)$ formulation as below: $$\label{eq:We_strength} \tilde w(e): = w1\cdot d\_hH(e) + w2\cdot stat(d(v)) + w3\cdot stat(d\_ Hs(v)),$$ where $w1, w2, w3$ are free parameters to control the contributions of each measure to the hyperedge. Multisource Integration of Rest and Task {#sec:multi_hyper_m} ----------------------------------------- Given the close correspondence between task and rest connectivity architecture and subnetworks, we further extend the multi-task hypergraph model to integrate information. To do that, we use $\mathbf{C}^{\text{rest}}$ for the pairwise nodal connection strength computation in as below: $$\label{eq:node_strength_m_rest} d\_ Hs(v): = \sum_{\{v\in e | e \in E\}} \sum_{u\in e} \mathbf{C}^{\text{rest}}_{uv}, $$ Furthermore, we explicitly combine the two sources of task and rest data for subnetwork extraction. We firstly fuse the multiple layers of the multi-task hypergraph into one single layer, and secondly combine it with a resting state connectivity layer. Given that the hypergraph cut criterion () is to evaluate the aggregated sum of the cuts across all the pairwise subedges (nodal connections) in the hypergragh, we propose to aggregate the strength information between node pairs across all the layers. To do that, we transform the multiple pairwise nodal connections across task layers () into one single nodal connection as below: $$\label{eq:multitask_hyper} \bar{\mathbf{C}}^{\text{task}}_{ij} = \frac{1}{T}\sum_{k = 1}^{T} \frac{\tilde w(e^k)}{\delta e^k}\mathbf{C}_{ij}^{e^k},$$ where the subscript $k = 1,\ldots,T$ is the indicator for tasks, $T$ is the total number of tasks available, and $e^k$ is the hyperedge in the $k$th layer of the hypergraph. $\mathbf{C}^{e^k}$ is the connectivity matrix derived using the time courses in the task $k$ using the procedure described in . We next explicitly combine the two sources by a linear weighted combination between the aggregated multi-task connectivity matrix from above () and the resting state connectivity matrix in as below: $$\label{eq:multimodal_hyper} \mathbf{C}^{\text{t-r}}: = \gamma \bar{\mathbf{C}}^{\text{task}} + (1-\gamma) \mathbf{C}^{\text{rest}},$$ where $\gamma$ a free parameter, which can be optimized by cross-validation, or determined by the number of the tasks available. Our linear model for combining two sources, which are both derived from functional modality, was motivated by the study indicating a largely linear superposition of task-evoked signal and resting state modulations in the brain [@Fox-2007-Intrinsic]. We also explore combining the two by applying a multislice community detection approach [@Mucha-2010-Community], which extends modularity quality function based on the stability of communities under Laplacian dynamics with a coupling parameter $\omega$ to control over interslice correspondence of communities. Results ======= We first investigated the similarity of connectivity between resting state and task-general and task-specific connectivity. To evaluate our proposed approaches, we assessed the graphical metric modularity $Q$ value, the inter-subject reproducibility and examined the biological meaning of subnetwork assignments. We applied subnetwork extraction on (1) resting state alone, (2) task-induced alone, (3) multi-task hypergraph, (4) multi-task hypergraph integrated with resting state connectivity strength, (5) weighted combination of (4) and resting state , (6) combination of (4) and resting state using multislice community detection method [@Mucha-2010-Community]. Materials --------- We used the resting state and task scans of 77 unrelated healthy subjects from the dataset [@van-2013-HCP]. Two sessions of resting state with 30 minutes for each session, and 7 sessions of task data were available for multisource integration. The seven tasks are working memory (total time: 10:02), gambling (6:24), motor (7:08), language (7:54), social cognition (6:54), relational processing (5:52) and emotion processing (4:32). Preprocessing already applied to the data includes gradient distortion correction, motion correction, spatial normalization to space with nonlinear registration based on a single spline interpolation, and intensity normalization [@Glasser-2013-Minimal]. Additionally, we regressed out motion artifacts, mean white matter and cerebrospinal fluid confounds, and principal components of high variance voxels using compCor [@Behzadi-2007-Component]. Next, we applied a bandpass filter with cutoff frequencies of 0.01 and 0.1 Hz for resting state data. For task data, we performed similar temporal processing, except a high-pass filter at 1/128 Hz was used. The data were further demeaned and normalized by the standard deviation. We then used the atlas [@Desikan-2006-Automated], which has 112 s, to define the brain region nodes. We chose the well-established atlas because it sampled from every major brain system, and consists of the highest number of subjects with both manual and automatic labelling technique compared to other commonly used anatomical atlases. Voxel time courses within s were averaged to generate region time courses. The region time courses were demeaned, normalized by the standard deviation. Group level time courses were generated by concatenating the time courses across subjects. The Pearson’s correlation values between the region time courses were taken as estimates of matrices. Negative elements in all connectivity matrices were set to zero due to the currently unclear interpretation of negative connectivity [@Skudlarski-2008-Measuring]. For task activation, we applied the activation detection on the seven tasks available following the steps described in . We summarize here the annotation of the graphs for six methods being evaluated for subnetwork extraction. (1) Resting state matrix $\mathbf{C}^{\text{rest}}$ is used. (2) The task general $\mathbf{C}^{\text{task}}$ was generated by concatenating the time courses across all tasks before the Pearson’s correlation. In (3), we use task-specific in and for each hyperedge, denoted as ${\mathbf{C}}^{\text{hyper-task}}$. We implement (4) by using resting state in and as described in , denoted as ${\mathbf{C}}^{\text{hyper-t-r}}$. For (5), we first generate $\bar{\mathbf{C}}^{\text{task}}_{ij}$ by using task-specific as $\mathbf{C}_{ij}^{e^k}$, and resting state $\mathbf{C}^{\text{rest}}$ to compute $\tilde w(e^k)$ based on and . We next applied our proposed local thresholding [@Wang-2016-Modularity] on resting state $\mathbf{C}^{\text{rest}}$ to match with the graph density of $\bar{\mathbf{C}}^{\text{task}}$ at 0.2765, which lies within the normal range of thresholding before subnetwork extraction between \[0.2, 0.3\] [@Van-2008-Normalized]. We then estimate $\mathbf{C}^{\text{t-r}}$ using . We set free parameters $w1, w2, w3$ to one, and the *stat* to median value based on inner cross-validation. For (6), we generated the $\bar{\mathbf{C}}^{\text{task}}_{ij}$ and thresholded $\mathbf{C}^{\text{rest}}$ as the same way as in (5), then the multisource integration is implemented using a multislice approach [@Mucha-2010-Community], denoted as $\mathbf{C}^{\text{t-r-multislice}}$. We set the weighting for multisource integration $\gamma$ or coupling parameter $\omega$ from 0.01 to 1 at an interval of 0.01. In order to perform fair comparison, $\mathbf{C}^{\text{rest}}$ in method (1) and $\mathbf{C}^{\text{task}}$ in method (2) have also been local thresholded at the graph density of 0.2765. Method (1) to (5) used and (6) used generalized Louvain as the graph partitioning approach. The number of subnetworks was set to seven given that there are seven tasks available to examine if subnetwork assignments can be related to tasks. We note that setting the number of subnetworks is non-trivial as discussed in the previous section that we leave as future work. All statistical comparisons are based on the Wilcoxon signed rank test with significance declared at an $\alpha$ of 0.05 with Bonferroni correction. Similarity of between Resting state and Task data ------------------------------------------------- We observed a similarity at = 0.7845 between resting state and task general , which was generated by concatenating the time courses across all different tasks. For seven specific tasks, the corresponding between task-specific and task general are 0.8971 for emotion processing, 0.8557 gambling, 0.8676 for language, 0.9043 for motor, 0.8594 for relational processing, 0.8307 for social cognition, and 0.8751 for working memory. This high similarities confirms the findings in [@Cole-2014-Intrinsic] that a set of small but consistent changes common across tasks suggests the existence of a task-general network architecture distinguishing task states from rest. When resting state is compared to task-specific , the are 0.7193 for emotion processing, 0.7689 for gambling, 0.7390 for language, 0.7067 for motor, 0.7533 for relational processing, 0.7659 for social cognition and 0.7118 for working memory, respectively. The variation of similarities between task-specific and resting state around a relatively high average level further confirms that the brain’s functional network architecture during task is configured primarily by an intrinsic network architecture which can be present during rest, and secondarily by changes in evoked task-general (common across tasks) and task-specific network [@Cole-2014-Intrinsic]. These findings confirms the close relationship between task and rest, and the support for integrating multitask information into resting state based subnetwork extraction. Modularity *Q* Value {#subsec:hyper_Q} -------------------- Modularity $Q$ value has been used to assess a graph partitioning through reflecting the intra- and inter- subnetwork connection structure of a network [@Sporns-2016-Modular]. We observe that $Q$ values of group level subnetwork extraction for method (1)-(6) are 0.1401, 0.1282, 0.1624, 0.1711, 0.2290 and 0.1905 when $\gamma$ and $\omega$ were selected at the highest inter-subject reproducibility. At the subject-wise level, the modularity $Q$ values estimated from the subnetwork extraction using method (1)-(6) are 0.1397$\pm$0.0142, 0.1234$\pm$0.0159, 0.2072 $\pm$ 0.0199, 0.2094$\pm$0.0189, 0.2183$\pm$0.0192, and 0.2089$\pm$0.0165 respectively, . We show that the modularity estimated from subnetworks extracted based on simply concatenating task time courses is lower than using resting state data. Using hypergraph framework (3) ${\mathbf{C}}^{\text{hyper-task}}$ and (4) ${\mathbf{C}}^{\text{hyper-t-r}}$ achieves statistically higher modularity values than using either resting state data or simple concatenation of task data. Moreover, incorporating resting state information into the hypergraph framework (5) ${\mathbf{C}}^{\text{t-r}}$ can increase modularity compared to hypergraph method. Multislice integration (6) ${\mathbf{C}}^{\text{t-r-slice}}$ results in a lower modularity than (5) the linear model; however, it still outperforms all the other uni-source methods. Overall, incorporating resting state information explicitly using a weighted combination strategy, method (5) gives a statistically higher modularity than all contrasted methods at $p<10^{-4}$ based on Wilcoxon signed rank test. ![Subject-wise level modularity $Q$ values using Method (1)-(6). For method (5) and (6), parameter $\gamma$ and $\omega$ were selected at the highest inter-subject reproducibility.[]{data-label="fig:hyper_Q_subj"}](fig/hyper_subj_Q_M6.eps){width="4.8in"} We note that the $Q$ values derived here are around 0.2, when the number of the subnetworks was set to seven, the number of tasks. It is relatively low due to the inherent resolution limit of $Q$, $Q$ decreases when the number of subnetworks increases. We explored this direction by achieving the similar level of $Q$ values around 0.3-0.4 when the number of subnetworks decreases to 4 as in [@Crossley-2013-Cognitive]. Inter-subject Reproducibility of Subnetwork Extraction ------------------------------------------------------ We assessed the inter-subject reproducibility by comparing the subnetwork extraction results using subject-wise data against the group level data. The average between subject-wise and group level subnetworks across 77 subjects based on methods (1)-(6) are 0.6362$\pm$0.0828, 0.5704$\pm$0.0872, 0.7083$\pm$0.1094, 0.7258$\pm$0.1201, 0.7561$\pm$0.1199, and 0.7406$\pm$0.0725, . We noticed that the reproducibility using resting state ${\mathbf{C}}^{\text{rest}}$ is higher than simple concatenation of task time courses data ${\mathbf{C}}^{\text{task}}$. It could be that there exist great differences in reaction to stimuli from different subjects, and simple concatenation is hard to discover the higher order relationship between canonical network components. On the other hand, analyzing multi-task information using hypergraph (3) ${\mathbf{C}}^{\text{hyper-task}}$ achieved much higher stability in subnetwork extraction, and incorporating resting information implicitly within the hypergraph (4) ${\mathbf{C}}^{\text{hyper-t-r}}$, or explicit weighted combination (5) ${\mathbf{C}}^{\text{t-r}}$ can even further enhance reproducibility. We note that the weighted combination outperforms multislice integration (6) ${\mathbf{C}}^{\text{t-r-slice}}$, which is still better than all the other uni-source methods. The reason could be that a simple linear model suffices the fusion of task and rest data. Overall, the inter-subject reproducibility derived by (5) ${\mathbf{C}}^{\text{t-r}}$ is statistically higher than all contrasted methods at $p<10^{-4}$ based on Wilcoxon signed rank test. ![Subject-wise level inter-subject reproducibility of subnetwork extraction using Method (1)-(6). For method (5) and (6), parameter $\gamma$ and $\omega$ were selected at the highest inter-subject reproducibility.[]{data-label="fig:hyper_repro_subj"}](fig/hyper_subj_repro_M6.eps){width="4.8in"} Biological Meaning ------------------ We next examined the biological meaning of the subnetworks extracted from method (1) - (6), where $\gamma$ was set to 0.5 to report the results when resting state and hypergraph based multitask information are equally combined as an example. Seven subnetworks were extracted based on the number of tasks available. Method (1) detects most of the traditional resting state subnetworks with several false positive and negative detection. The results of method (2) oftentimes combined some important regions from different subnetworks, which lacks biological justifications. Method (3) and (4) generate similar results and both improve the results of method (2) greatly when bringing task dynamics into the subnetwork extraction. Overall, method (5) detects brain regions, which are more biologically meaningful, by combining the intrinsic network architecture from resting state data and the task dynamics based on high-order hypergraph. We report our findings in details as the following and the visualization of subnetwork extraction results can be found in . \ \ Using method (1) based on resting state alone, subnetwork 1 and 6 are detected as left and right side of a combination of and frontoparietal network, which include superior frontal gyrus, middle frontal gyrus, inferior frontal gyrus, posterior supramarginal gyrus, angular gyrus, frontal orbital cortex, and frontal operculum cortex. Method (1) mistakenly classified left inferior lateral occipital cortex and left anterior supramarginal gyrus into the . Anterior supramarginal gyrus is part of the somatosensory association cortex, which interprets tactile sensory data and is involved in perception of space and limbs location or language processing, thus it should be included in instead of [@Heinonen-2016-Default]. On the other hand, our proposed method (5) detects both the left and right sides of most of the anterior portion of and posterior supramarginal gyri for subnetwork 1. Using method (5), the left inferior lateral occipital cortex was not include in , which is more accurate. Besides, method (5) clustered anterior supramarginal gyrus symmetrically into subnetwork 6, which includes both sides of , precuneus, and angular gyrus, comprising most of the posterior portion of defined in [@Heinonen-2016-Default]. As for method (2), the simple concatenation of multitask time courses, subnetwork 1 consists of frontal medial cortex and only the left side of frontal orbital cortex, and subnetwork 6 consists of most of the anterior portion of , angular gyrus and only the left posterior supramarginal gyrus, which should be symmetrically included in . Besides, there are two other s, left subcallosal cortex and left caudate, included in subnetwork 6, which lacks biological meaning. Subnetwork 1 derived from method (3) and (4) both consist of most of the anterior portion of , except that method (3) has two more one-sided frontal areas, which makes (4) more biological meaningful (with symmetric results). Subnetwork 6 of method (3) and (4) both consist of one isolate area: left anterior parahippocampal gyrus, which further indicates that there is need to incorporate resting state information into the multitask based on hypergraph framework. Subnetwork 2 of method (1) includes both sides of , caudate, thalamus, putamen and accumbens. Method (5) includes all the same brain regions as method (1) plus one other region, the insula. This subnetwork should be related to the gambling task and emotional processing, which expect to activate [@Charpentier-2015-Emotion; @Koehler-2013-Increased], ventral striatum (such as thalamus [@Koehler-2013-Increased] and accumbens [@Limbrick-2017-Neural]), and insula [@Leong-2016-White]. Usually insula is part of the salience network and has been found to play key roles in emotional processing [@Cauda-2011-Functional]. However, using method (1), the insula was clustered into subnetwork 5 (mostly motor system). Method (2) included right and both sides of , precuneous, left side of supracalcarine cortex, and accumbens inside subnetwork 2, which seems like a mixture of part of , one-sided region from motor system, and one region from gambling system. As for method (3) and (4), they both extracted similar regions for subnetwork 2 as using method (5), except that they missed thalamus and falsely included left frontal medial cortex. Subnetwork 3 derived from method (1) includes superior lateral occipital cortex, frontal medial cortex, left subcallosal cortex, , precuneous, parahippocampal gyrus, temporal fusiform cortex, brain stem, hippocampus and amygdala. This assignment does not make too much sense by clustering regions from visual, auditory, emotion circuit and frontal system together. Meanwhile, the results using method (5) consists mostly of emotion circuit and social processing, which includes brain stem [@Venkatraman-2017-Brainstem], hippocampus and parahippocampal gyrus [@Ohmura-2010-Serotonergic], amygdala [@Zald-2003-Human], and subcallosal cortex [@Laxton-2013-Neuronal]. Method (5) also detected regions related to auditory functions such as temporal pole, which is reasonable since the negative emotion was induced by listening to stories. Subnetwork 3 detected by method (2) includes right anterior parahippocampal gyrus, temporal fusiform cortex and brain stem, which still lacks important brain regions in the emotion circuit. Method (3) detects more biologically meaningful regions than (2), such as hippocampus and amygdala. Using method (4) can even detect more related regions than method (3), such as frontal orbital cortex [@Levens-2011-Role]. Method (1) and (5) detected almost the same brain regions for subnetwork 4, which is the visual system, except that method (5) detected one more region of the inferior lateral occipital cortex, making the results more symmetric. This subnetwork includes inferior lateral occipital cortex, intracalcarine cortex, cuneal cortex, lingual gyrus, occipital fusiform gyrus, temporal occipital fusiform cortex, occipital pole, and supracalcarine cortex. Method (2) detected most of the visual regions except for cuneal cortex and the right supracalcarine cortex. Method (3) and (4) detected extra regions in right and auditory system besides all the regions found using (5) in the visual system. Subnetwork 5 derived from method (1) comprises of the motor system, including precentral gyrus, postcentral gyrus, only the right side of anterior supramarginal gyrus, juxtapositional lobule cortex; and the frontoparietal network including left central opercular cortex, superior parietal lobule, and parietal operculum cortex. Method (5) generated similar results as method (1), only that the results are more symmetric, which include both sides of anterior supramarginal gyrus (part of somatosensory association cortex); and more accurate in terms of frontoparietal network, which includes frontal operculum cortex instead of central opercular cortex. Both method (3) and (4) generated similar regions for subnetwork 5 as well, which includes motor system and frontoparietal network, except that they both included brain stem into this subnetwork. However, method (2) mis-classified insula, putamen and thalamus into the motor and frontal parietal networks. We note that the motor system and frontoparietal network are clustered together, it could be that the working memory tasks recruited both the motor system and frontoparietal network. As for the subnetwork 7, both method (1) and (5) detected brain regions corresponding to language task and related auditory regions, such as anterior superior temporal gyrus, planum temporale, planum polare, and Heschls gyrus (includes H1 and H2) [@Noesselt-2003-Top]. Different from method (1), method (5) included central opercular cortex, which can be explained by how fronto-opercular is related to language [@Meyer-2003-Functional]. Method (2) detected some false positive brain regions in the language system such as parahippocampal gyrus, hippocampus and amygdala. Method (3) and (4) correctly clustered all the brain regions into the language network as method (5). Method (6) generated similar results compared to method (5), only a couple regions in subnetworks 2 and 5 were switched, a couple regions in subnetwork 6 and 7 were switched, and a couple regions in 1 and 6 were switched. Overall, The subnetwork results derived by method (5) ${\mathbf{C}}^{\text{t-r}}$ have more biological meaning than contrasted methods. Discussion ========== Hypergraph encodes higher order nodal relationship -------------------------------------------------- Subnetwork results derived from methods based on hypergraph achieved higher modularity, higher inter-subject reproducibility, and more reasonable biological meaning than traditional connectivity analysis of pairwise correlation between nodes. These results indicate that hypergraph, which is a natural presentation of multitask activation, can be explored to study higher order relations among the network nodes. The proposed strength informed version of automatic weight setting of the hyperedge incorporates connectivity information to reveal more accurate higher order relationship among nodes rather than just using binary information. Multisource Integration Improves Subnetwork Extraction ------------------------------------------------------ We have proved that multisource integration of task and rest information can improve subnetwork extraction compared to using a single source in terms of graphical metrics, inter-subject reproducibility, along with biologically meaningful subnetwork assignments. We note that the implicit integration of rest information into multitask hypergraph achieved less improvements as the explicit integration based on the linear combination. The reason could be that the limited number of tasks available restricts the comprehensive representation of the brain using the hypergraph. Thus, by integrating rest data to compensate possible missing information resulted in overall better outcomes. Another observation is that the linear combination outperforms the multislice community detection, which still performs better than uni-source approaches. Our assumption is that rest and task are both derived from a single functional modality, which complements each other by revealing the two sides of , the resting intrinsic side and the activated evoked side. Thus, a simple linear weighted combination would suffice this situation, which outperforms other alternative combination approach in practice. Limitations and Future Directions --------------------------------- There are several limitations in our present work. First, our study investigated only seven available tasks with high quality data and decent amount of data per task. This sample of seven tasks is not enough. A possible solution is to have access to both task and rest data from previous task studies or co-activation studies, which covers much wider variety of tasks. At the same time, with much more information from a greater amount of task data, we can devise a reliable automatic manner to determine the integration weighting parameter $\gamma$. The underlying rationale is that with more tasks available, we can rely more on the hypergraph based multitask source, hence the higher $\gamma$. Secondly, we set the number of the subnetworks to be seven, which corresponds to the number of tasks available. The reason is simply to see if we can associate the subnetwork results to different tasks and gain insights from the findings based on task-induced functions. In the future, a finer scale of subnetwork extraction using multi-scale hierarchical approach would improve the interpretation of the findings. Conclusion ========== We proposed a high order relation informed approach based on hypergraph to combine the information from multi-task data and resting state data to improve subnetwork extraction. We demonstrated that fusing task activation, task-induced connectivity and resting state functional connectivity based on hypergraphs improves subnetwork extraction compared to employing a single source from either rest or task data in terms of subnetwork modularity measure, inter-subject reproducibility, along with more biologically meaningful subnetwork assignments. List of Acronyms ================ | High | [
0.706948640483383,
29.25,
12.125
] |
Children enjoy toys that can captivate their attention. A toy ball is a particular play item that has endured the test of time and remained a favorite with children of all ages (infants, toddlers, etc.). However, as with any child's toy, some intrinsic dangers must be avoided. According to the U.S. Consumer Product Safety Commission, small objects can easily be lodged in the airway of young children, creating a choking hazard. Thus, it is imperative to create toy balls that are increasingly safe for use by children. Furthermore, a toy ball is often constructed from more than one base component (e.g., two half-spherical (hemispherical) shells that may be attached together to form a substantially spherical shell) in order to form a spherical structure. If these components that are used to construct the toy balls also contain small parts, they may create additional choking hazards to children in the event they come free during use. Thus, the particular construction of the components making up the toy ball must be considered so as to ensure safe use by children. In addition, ancillary entertainment features are often incorporated into toy balls (e.g., figurines, rattling elements, fluids, etc.) in order to further captivate and hold a child's attention. Such ancillary features are intended to be stimulating and aesthetically pleasing so as to maintain the attention span of most children. It should be noted, however, that some of these ancillary entertainment features may be sufficiently small in size so as to pose a potential choking hazard to children. Children sometimes play in rough manner. Thus, toys should generally be constructed so as to minimize the risk of damage during the normal course of play. In the instant case, a toy ball is sometimes subjected to rough play. A toy ball is subject to a plethora of physical activities (e.g., being thrown, rolled, dropped, hit, batted, etc.). Should a toy ball be broken apart in the course of play, the contents within the ball would be exposed/set free and, as such, the freed contents may constitute a risk to the safety of children playing with the toy. Additionally, the broken toy would be rendered unfit for future use. Prior art toy balls typically are constructed from two shell halves mated together to form a seam along an equator of the toy ball. Such prior art toy balls are illustrated in U.S. Design Pat. No. 274,070 to Ma, U.S. Design Pat. No. 190,036 to Lakin, U.S. Design Pat. No. 314,598 to Capper et al. (illustrated in FIG. 1), U.S. Pat. No. 4,272,911 to Strauss, U.S. Pat. No. 2,519,248 to Hulbert, and U.S. Pat. No. 2,351,762 to Hoover. The method of affixing one shell half to another can include but are not limited to cementing, heat-sealing, ultrasonic welding, and dielectric welding. Still other toys have a substantially formed sphere, with an opening to insert an additional entertainment item, and are then capped to encapsulate the item within the sphere. An example of such a prior art toy ball is illustrated in U.S. Pat. No. 4,601,675 to Robinson. During rough play, the toy balls have an increased risk of breaking open. The toy balls found in the prior art are not inherently resistant to forces acting perpendicular to the seam running along the ball's equator. More specifically, the equatorial seam provides little resistance to a shearing force applied at the seam or to tensile forces acting on the two shells perpendicular to the seam. Thus, it would be desirable to provide toy balls with a greater factor of safety for children. In particular, it would be desirable to provide a toy ball that possesses additional strength to withstand shearing forces acting on the seam of the toy ball. Additionally, it would be desirable to provide a toy ball that possesses additional strength to withstand tensile forces acting on the two shells perpendicular to the seam. Such additional strength would enhance the intrinsic value of a toy by providing an additional level of safety for children. Furthermore, while the addition of an element to structurally strengthen the toy ball is desired, any such element should not detract from the aesthetically pleasing nature of the toy ball to a child. Thus, there exists a need for providing a toy ball that has a construction that adds strength to the ball's seam in order to prevent the toy ball from breaking open and exposing its contents to the child playing with the ball. Furthermore, any additional element incorporated into the construction of the toy ball should be generally aesthetically pleasing to a child. Providing such an arrangement that both increases the toy's safety and makes the toy more aesthetically desirable not only increases a child's enjoyment, but also increases the attractiveness of the toy to anyone concerned with the safety of children. This invention is directed generally to a toy ball with additional strength to resist forces in a tensile direction or shearing forces applied to a main seam. More specifically, this invention is directed to a toy ball having two shells (hemispherical or unequal in size) fused together forming a seam, the toy ball also having opposing end caps, each end cap capturing a portion of each shell to resist both shearing and tensile forces acting on the seam. | Mid | [
0.573304157549234,
32.75,
24.375
] |
Personally I do not advocate for my freedom, I only have an urgent need for human rights based society. Maybe being a marginalized person; a lesbian, a black woman and a mother, has taught me to be a survivor. I have been raped and survived it. It has taught me that we must all move on and transform. In order for one to have that 360° change, a paradigm shift has to happen to society en masse. Thus, a new ethos of the amicable freedoms we deserve will step forth and present itself. Close attention has to be paid to the language used at the higher echelons of human rights institutions.What language is being used? Language articulates cultural systems and is a window to the psychology of how society thinks and acts. Whether that mindset is of committing violent crimes or that of systemic injustices which keep us at the helm of non-equality, we find that there is institutional language that protects these acts somehow. I have seen many lesbians passionately picket issues around advocacy for LBGTI rights and they become momentary pop stars. I have protested too and I became despondent with protesting. I remember in my youth after Grade 12, I was in need of education and no one stepped up to help attain it. The boys on the other hand moved on to higher education. It informed me that it was a privilege to be a man I surmised. I had to stay at home and look after my siblings and grandfather. The cultural institution that I found myself in did not articulate education for girl children. Thankfully, in this day and age, all that has taken a turn for the better as every child now has a right to education, regardless of gender. I took it upon myself to get a university education. I worked hard to make it to the University of the Witwatersrand (Wits). I enrolled as an International Relations major but politics and geography did not peak my interest and the following year I switched my major to drama. Sadly I did not get any support from those nearest and dearest – my family. My grandfather opposed my leaving for Wits and vowed never to support me. He died with no knowing of what I had attained. In his view I was breaking culture, whereby a boy is always the heir no matter the ranking. He said something to the tune of I wanted to be better than my brother. Truth be told, I was only trying to better my own life and not competing with my brother. My brother chose a different route and settled for not attending university. He has his career. I was the first person from our lineage to attend university. Even though I had already had a child, I was determined to make it all the way. I had full knowledge of who I wanted to be and I did not like to be boxed. While away on campus I began playing soccer, something I wasn’t allowed to do at home because of the dangers that came with it. When I was a teen I wanted to play but the impeding danger of being raped caused me not to play. I started playing at home, away from campus, as well and they even got soccer cleats for me because I enjoyed it that much. My mum would even get worried if I was not playing! In economics you learn that everything works in cycles. Nothing stays the same. Economies change, governments change and we can look at our own history to see just how twenty years ago were not featured in the world and now we are right at the top. Just like anything, trends come and go. South Africa right now is the trendy shiny toy and all the vultures zone in and get their agendas in motion, NGO’s being one of those vultures.Are you a fad or a trend?If not, then why allow yourself to be used in this manner? What am I talking about and why am I outraged? I am outraged at all of you who picket and shout the loudest for a free t-shirt or beer. What do you get in turn? Do you get some sort of life insurance from these agencies? You see I was raped. I tell you this not to shock you, but to say take your power back.Why are you dwelling in a state of victimhood? Black lesbians being raped and murdered is a very real crisis, one that should never be minimized but also one that should not be used as political dice. I am saying you are being placed in a subtle box of constant strife. I commend NGO’sfor bringing social injustices to the forefront but I am saying how about empowering the people? My challenge to you and the concerned NGO’s is to empower the black LGBTI community with real solutions. Free beers, t-shirts and KFC are fleeting things, dangled in front of you to distract you from the real issues.After you finish picketing do you feel accomplished? Are you more educated, your future more secure and your neighbourhood much safer? I am all for freebies but I am also for education. Education changes communities. Education helps end hunger and brings down crime. Education exposes you to endless possibilities. The greatest outrage right now is to help blacks get out of poverty. On top of polluting your body with these unhealthy foods, have you wondered why you have never been invited to come and get help writing your Curriculum Vitae (CV) to earn employment, how to start a small business etc?Would you put on your CV that “I have protested and toyitoye-d for 10years with so and so organisation”? That is just time well wasted – for who is up for debate. When you are done you are still a statistic. You will still be a victim of a non-equal society you are protesting. What I am saying is learn to see beyond the agenda. You are protesting your right to able to walk hand in hand you’re your partner down the road, but have you protested the lack of education, shelter, food, amenities, health – all which are basic human rights. Protest for your right to walk around with your girlfriend or partner without prejudice or being subjected to homophobic attacks but also have you basic human rights covered. After the protest what are you going to eat, will you drink brown and tea and bread or you are going to have a healthy filling breakfast? Remember that most black lesbians emulate cultural systems that are in place that, for example, if you wear expensive apparel it shows how wealthy one is. What flawed thinking this is. Material things have a shelf life.Are we investing in education that has no expiry date? Education is in many different forms, one just has to choose what works best for them – formal or vocational training. Some people work better sitting at a desk and others work better using their hands. One can be an engineer, artisan, nurse, educator, pilot, the sky is the limit. That is the legacy that we should be investing in, and one that will eventually afford you the creature comforts that you yearn. All is inauthentic living. I am sad because we would rather be known as the best partiers and champion sex machines but are too lazy to attain and create a legacy for ourselves.Who are we without a legacy? We are extinct. Some say they are too butch to work and others say they are too femme to spend time on a diploma or degree. Some drop out of high school with no prospects for the future. It is never too late. We need more Sipho Mabuse’s of this world, who go back to high school to finish their Grade 12. There is already a stereotype out there about us that we are alcoholics and promote debauchery, as per one heterosexual man I once listened to on radio. He vociferously took a stance and his perception on black lesbians. I wanted to call in and challenge his assumptions around what he deemed a morally sound heteronormative system whereby he assumed that everyone anything besides that norm will not do. I also wanted to defend my fellow compatriots.Is there truth to stereotypes? I wanted to ask him if he knew of Simon Nkoli and Phumi Mtetwa, amongst others, who were at the forefront of changing the ANC stance around human rights focusing on LGBTI issues. I wished I could pull up literal works that supported my stance and I just wanted to come out guns blazing and school his ignorant mind. Obviously I could not. I personally work hard and I give back using my talents, to the community at large. I had a performance where I managed to collect tampons that were distributed to girl children irrespective of their sexuality or sexual preference. It was just a response to a need. I say that to say, I am an educated self-respecting, philanthropic citizen of the world. I am none of those ill labels that the hetero world slaps on us collectively. Some of you sure give them the ammunition. Freebies are euphoric – albeit momentarily – but let’s be real, they will not contrite towards buying you a house in the suburbs neither will keep you safe from the township monsters who are prowling our streets and taverns who are waiting to pounce then someone becomes a statistic. After you help an NGO fly their flag high, you get that taxi and face the same homophobic people and institutions that get away with blue murder! They never get caught because they are part of the system that says we are good for nothing except sex and alcohol. Perpetual ignorance in our society is kept going by the assumptions and stereotypes heaped on homosexual individuals. There are lesbians out there who chose to be vocal social champions but also emancipating themselves from mental slavery.Dulcy Stapler Rakumakoewas a protester who also stayed in school until she earned her right to practice as a medical doctor. There are many who have chosen freedom by attaining an education. They are safe in their homes tucked away in the suburbs, they drive themselves around and they feel secure. That is true freedom.Do you not want that kind of freedom? For every freedom there are sacrifices. You can choose to party until the cows come home, or you can study. We should strive to be better than our parents. We should look at working at better jobs and not a supermarket cashier as a career. I am not trying to look down on those that do these jobs, I respect hard working women. I am just saying, let us have a burning desire to reach the glass ceiling and break it while at it. Parents are old and out of options on how to feed grown women who come home empty handed besides a few t-shirts. There is nothing holding a black lesbian from becoming who they want to be in this country. We may live amongst hateful and hurtful people but we are not victims. Come on black lesbians if we can party as hard as heterosexual people, we can study like them too; be part of the economy, and pay tax like normal people. Education is not for the selected few, it is your constitutional right as well as a basic human right. There are many sources of financial help that you may access including bursary schemes, government student loans (NSFAS) to name some. FET colleges do not charge any tuition fees, they are FREE. All you need to do is to fill in your application form and if you cannot, you can always ask someone to help you. It is as good as it sounds!! If you can find time to be on social media all the time then you can make time to fill in the form and secure your future. You may google and submit their online application or you may do it physically. You need to pay an admin fee when submitting your application and that will be all the money you will spend. If you can dress in expensive attire, then you can afford admin fees. Everything comes with time. Time to party will come. When you are educated, you protest with a cause. You learn to read between the lines and place yourself strategically. With time you will be able to align yourself with those same NGOs with whom you share a common cause, only this time you will be paid to do what you believe in. You will be driving to work, living in the suburbs, with a medical aid and afford to vacation. Vuka emacandeni tsoha itsose no one will wake you up if you don’t. Change yourself and watch a paradigm shift of your mind happen. About the author Birth Identity Seipone More Tapuwa Moore, a performing artist, creative writer, playwright, director and prose performer began her career by performing Heineken in Melrose Arch in 2003. She published a poem called coca cola with Behind the Mask (a defunct LGBTI online magazine) in 2006. She has been a performing resident at the Wits Writing Center for many years. Her life with The Writing Center includes many events such as the Jozi Spoken word, the E’skia Mphahlele colloquium, and the Wits Arts Literature Experience (WALE). Tapuwa has graced the stage with renowned poets Mak Manaka and Natalia “The Shelter” Molebatsi for Media Park tours in Soweto commemorating June 1976 in 2006. Her performances have always been about resistance, and articulating the struggles of black women and injustices faced by being black as well as lesbian. Her movement has been encapsulated in human rights advocacy organizations, such as the New Life Centeran advocacy organization that worked to rehabilitate sex workers and advocated on issues of HIV prevention in the inner city. New Life Center provided shelters for abused women, children and sex workers and performed in their events in 2007-2008. She has further pursued her activism as a performer on stage collaborating with FEW, including the Soweto Pride. She has coached both men and women’s soccer teams. However the significant coaching moments were spent as a head coach of the Chosen FEW lesbian soccer team in 2009. At FEW, she learned of the advocacy rhetoric and human rights violations faced by many black lesbian women. She later become a member of the 1 in 9 campaign and served in their Steering Committee as a deputy chairperson. However her need to pursue social change performances took precedence when she became part of The Vagina Monologues in 2010. Her writing focused on changing attitudes against gender based violence, HIV, atrocities faced by black lesbian women and human rights abuses. She has been in solidarity with movements such as Gender Linksand POWA, as a performing artist and activist. She has performed pieces like “lesbian, what would I do with myself if I stopped drinking?” in order to address rape and patriarchal violence, featured in the Jozi Spoken word at Wits Theater in 2009 and the Wits substation in conjunction with the Writing Center. What would I do with myself has become her mantra as she performed it in various spaces, putting the highlight and advocating on rape, sex, sexuality and HIV. Some of her works like Before Funny Things Started were published by The Global Game in commemoration of the World Cup in 2010. She directed The Vagina Monologues in conjunction with WALE in 2012 where she worked with Ntsiki Mazwai, a renowned poetess. She is currently producing and directing The Vagina Monologues to be staged in various spaces in the inner city including Soweto. She has also been featured in the Mail & Guardian book of South African Women 2013 as a playwright, director, performing artist and a rape survivor. 5 Responses to 2014 Jan.29: Education is primal I have had conversations with people who thought i should be excused when discussions about violence towards lesbians were being had. And the reason for this was 1. I’m a degree graduate, with an apartment in a secure complex. ( the ideology that leads to the assumption that i’m paying big bucks for my safety. But my neighbour could be a psychotic homophobe. ) 2. They doubt i’d subject myself to places prone to violence. I brushed this off. Education, fortunately for me, was part of my growing process, in relation to affordability ofcourse. I wanted to be an educated human being, for myself, my social status was not motivated by my sexuality. I know people with phuza faces, who wait for handouts as if the government owes them something as guilt of failing to protect them in their townships. Wanting a better life should not be part of a comparison/ achievement measure between sexuality but rather a human need/ attainment. And that choice is personal. I work for a political organisation, as a black lesbian, i work as a bridge that connects the LBGTI community with governing decision makers. I’m the LBGTI voice that is heard when policy makers try make ignorant statements about us, i rectify. I educate. Normally there’s never a voice because we have let heterosexuals speak for us ( hence all they do is protest) and for them to leave out realities foreign to them. I run workshops to help educate about LBGTI existence in townships. Rural Limpopo. If people can fill up Open Closet events yet they are unemployed, does that mean i should print out forms to hand out? We all need to prioritize. Oh my word!! ‘Party till cows come home’ Not all of us do that, we are graduates n taxpayers of our beloved country though we are maginalized n christians though called devil’s advocates. I agree with you in many ways, thanks for a wake up call | Mid | [
0.561330561330561,
33.75,
26.375
] |
This person is trying to scam you janetwill509 janetwill509 Try to scam me by offering to buy my race truck as soon as it hit the ads. They claim they would pay what I wanted. Then came back and said the tranporter driver need to be paid before he would pickup the truck. So she wanted me to let her pay me 1150.00 above the asking price and then could I please send the 1150 to the driver while the other money is be processed. They even go so far as to send out 3 fake paypal email stating the the money is pending, not a bad copy of paypal emails. This is the name given to send the money to DON"T | Low | [
0.39348370927318205,
19.625,
30.25
] |
Screening newborns for multiple organic acidurias in dried filter paper urine samples: method development. Screening urine for inherited and acquired organic acidurias in newborns has the potential of preventing severe disease, mental retardation, and death. A method for screening dried urine filter paper samples for acidic markers of at least 20 different metabolic conditions has been developed. These conditions include, among others, maple syrup urine disease; methylmalonic, propionic, isovaleric, glutaric, and hydroxymethylglutaric acidurias; methylcrotonylglycinuria; medium-chain acyl-CoA dehydrogenase deficiency; inherited vitamin responsive disorders B12, biotin, B2), and acquired deficiencies of these vitamins. The preparation of the urine extract is identical to the method we use to screen infants for neuroblastoma. Screening is based on a highly sensitive and specific determination of eight organic acid markers by an automated computerized gas chromatography mass spectrometry system using selected ion monitoring. The markers used for screening are methylmalonic acid, 2-hydroxyisocaproic acid, glutaric acid, propionylglycine, isovalerylglycine, 3-methylcrotonylglycine, hexanoylglycine, and 3-phenylpropionylglycine. The extraction efficiencies of these acids from dried filter paper were similar to extraction from water, ranging from about 40% to 80%, except for propionylglycine which showed a low extraction efficiency of 11-13%. The stability of these acids on filter paper exposed to room air and temperature over a period of 15 d was adequate for the use of this collection method for organic aciduria screening. Normal levels, adjusted to urinary creatinine, were established for these acids in 519 urine filter paper samples obtained from 3-wk-old newborns. This screening method was tested on samples obtained from 12 patients with known organic acidurias including stored urine filter paper collected at 3-wk of age from two infants later found to have organic acidurias. | High | [
0.691807542262678,
33.25,
14.8125
] |
###### Strengths and limitations of this study - A large probability sample of people with visual impairments made it possible to address the prevalence of sexual assaults within age groups. - Use of interview-based assessments with validated instruments and detailed information about characteristics of visual impairment. - The representativeness of the study sample is questionable as participants were recruited from a membership organisation of blind and partially sighted. - The findings should be interpreted in light of the possible impact of bias due to non-participation, recall and self-disclosure. Introduction {#s1} ============ Sexual assault, which in this study refers to forms of violence such as rape and forced sexual acts, is shown to be a strong determinant of people's health and well-being.[@R1] Sexual transmittable infections and unwanted pregnancies are common among those who have been sexually assaulted,[@R4] and about half of the reported cases involve physical injury.[@R5] Sexual assault is largely about power and oppression and is being viewed today as a social problem with structural and cultural roots.[@R6] So far, sexual assault research has focused primarily on women,[@R7] while less is known about marginalised groups such as men having sex with men[@R8] and people with specific impairments.[@R9] Visual impairment (VI) is defined as functional restrictions of the visual system.[@R11] According to the WHO categorisation system,[@R12] a diagnosis of VI is set through direct assessments of visual acuity and visual field and classified into moderate to severe VI, blindness and undetermined VI. VI is a heterogeneous condition occurring at any point in life and has a diverse set of causes, severities and progression rates.[@R13] Furthermore, the majority of people with VI have other impairments in addition to their vision loss, being closely connected to conditions such as cerebral paresis, multiple sclerosis, diabetes and hearing impairment.[@R15] A few observational studies from Europe and the USA have been published on the prevalence of sexual assault in people with low vision or blindness.[@R18] In the previous studies, the reported lifetime prevalence of sexual assault or abuse has varied, with estimates ranging between 11% and 30%.[@R18] The varying estimates may be attributed to a number of methodological factors, but it could also be related to the inclusion of samples with different types and degrees of vision loss. However, limited evidence exists on the extent of sexual assault across subgroups of people with various VI characteristics,[@R18] and more research is therefore needed. Given the uncertainty about the prevalence of sexual assaults in people with VI and its possible associations with various VI characteristics, we conducted a cross-sectional study by including a probability sample of adults with VI. The study had the following three main aims: (1) to estimate the prevalence of sexual assaults compared with the general population, (2) to examine the association of sexual assaults with VI-related characteristics and (3) to examine the association between sexual assaults and outcomes of self-efficacy and life satisfaction. Methods {#s2} ======= VI population {#s2a} ------------- This cross-sectional study comprised adult members (≥18 years) of the Norwegian Association of the Blind and Partially Sighted who had a diagnosis of VI. The organisation has about 10 000 members,[@R23] encompassing 0.2% of the Norwegian population. To ensure adequate number of participants in the younger age groups, simple random sampling was performed within each of the following four age strata: 18--35, 36--50, 51--65 and ≥66. Data were collected through structured telephone interviews in the time period between 1 February and 31 May 2017 by a private survey company. A total of 1216 adults were contacted, and 736 (61%) participated by completing the interview. The online supplement includes a flow chart of the sample selection (online [supplementary figure 1](#SP1){ref-type="supplementary-material"}) and a detailed description of characteristics within each degree of VI (online [supplementary table S1](#SP2){ref-type="supplementary-material"}). 10.1136/bmjopen-2018-021602.supp1 10.1136/bmjopen-2018-021602.supp2 General population {#s2b} ------------------ Norm data were based on the Norwegian Population Study, a cross-sectional survey including a representative sample of adults (≥18 years) from the general Norwegian population.[@R24] Simple random sampling was conducted based on names and addresses from the Central National Register of Norway, and efforts were made to ensure that the sample reflected the Norwegian population in terms of age, gender and geographical location. The study data were collected by postal questionnaires in the period between 2014 and 2015. Of the 5500 eligible participants, 9 persons had died, 21 were not able to fill out the questionnaire and 499 envelopes had non-valid addresses. This resulted in a total of 4971 individuals, and 1792 (36%) of those participated by completing and returning the postal questionnaire. Measurements {#s2c} ------------ ### Covariates {#s2c1} In both surveys, sociodemographic data included age (years: 18--35, 36--50, 51--65 and ≥66), gender, urbanicity (inhabitants: \<20 000 and ≥20 000), current education level (years: \<11, 11--13 and ≥14), work status (unemployed, employed/under education and retired) and marital status (single, married/partner, divorced and widowed). Participants with VI were asked to report their corrected degree of VI in the better-seeing eye (blind, severe VI, moderate VI and undetermined), progression rate of vision loss (stable and progressive) and total years lived with VI. An 'age of VI onset' variable was created by substracting the participants' age by their reporting on years lived with VI. The variable was then categorised into: 'since birth (0 years)', 'childhood/youth (1--24 years)' and 'adulthood (≥25 years)'. Furthermore, the participants were asked to describe whether they had other impairments in addition to their VI. The response alternatives were: 'no', 'yes, to some extent' and 'yes, to a great extent'. Participants who reported impairment to some or great extent were included in the 'yes' category, while those who reported having no other impairments were included in the 'no' category. ### Sexual assaults {#s2c2} In both surveys, past experience of sexual assaults was measured by the Life Event Checklist for DSM-5. The questionnaire has demonstrated adequate test--retest reliability and moderate correlation with trauma-related mental disorders.[@R25] In the list of life events, participants were asked to describe whether they had experienced sexual assaults (rape, attempted rape, made to perform any type of sexual act through force or threat of harm). Those who reported 'that happened me' were categorised as 'yes' (1) and those who reported otherwise were categorised as 'no' (0). ### Self-efficacy {#s2c3} The General Self-Efficacy Scale (GSE scale) was included to assess perception of self-efficacy in the VI population. The Norwegian version of the GSE scale has been shown to have a high test--retest reliability (r=0.82) and acceptable correlations with life satisfaction (r=0.26) and positive affect (r=0.40).[@R26] The scale consists of 10 statements about the participant's belief in one's ability to adequately respond to novel or challenging situations and to cope with a variety of stressors and is scored on a 4-point Likert scale from 1 (not at all true) to 4 (exactly true). A sum score was calculated based on all 10 items, with higher scores representing greater self-efficacy. The sum score was treated as an untransformed continuous variable in our main analyses. The GSE scale had a Cronbach's alpha of 0.89. ### Life satisfaction {#s2c4} Cantril's Ladder of Life Satisfaction was used to measure current life satisfaction in the VI population.[@R27] The participants were asked to imagine themselves a ladder with 10 steps, of which the bottom of the ladder represented the worst possible life for them (a score of 0), and the top of the ladder represented the best possible life for them (a score of 10). The scale was treated as an untransformed continuous variable in the regression analyses. Statistical methods {#s2d} ------------------- We assessed the lifetime prevalence of sexual assaults in the VI population and in the general population within strata of age and gender. All stratified proportions were estimated with corresponding 95% exact binomial CIs. Test of statistical significance was performed using Fisher's exact test. We used generalised linear models (GLMs) with binomial distribution and log-link function to estimate relative risks (RRs) and 95% CIs of sexual assaults in its association with each VI-specific factor (VI severity, age of VI onset, VI stability and having other impairments). Model fit was evaluated using residual plots. The models were either unadjusted or age adjusted and gender adjusted. No risk ratio modifications were observed of age or gender with each of the VI-specific factors (p\>0.05). GLM with Gaussian distribution and identity-link function was used to estimate mean scores of self-efficacy and life satisfaction of those who had experienced sexual assaults, compared with the reference of no sexual assaults. Model estimates were presented in terms of RRs and 95% CIs. Model fit was evaluated using residual plots. The GLMs were either unadjusted or adjusted for age (years: 18--35, 36--50, 51--65 and ≥66), gender, education (years: \<11, 11--13 and ≥14) and VI severity (moderate VI, severe VI, blindness and undetermined VI). No risk ratio modifications were found of sexual assault with each of the possible confounding factors (p\>0.05). The significance level was set at p=0.05. The statistical analyses were carried out using Stata V.14. Patient and public involvement {#s2e} ------------------------------ The study was planned by an expert group, consisting of researchers on disability, rehabilitation personnel and board members from the Norwegian Association of the Blind and Partially Sighted. Most participants had personal experiences as they themselves were visually impaired or blind. Dissemination of findings to members of the Norwegian Association of the Blind and Partially Sighted will be arranged via different channels. The work will be published in open-access peer-reviewed journals so that all members have opportunity to read the articles. Furthermore, we will have a direct communication with the organisation to provide results of key relevance to the organisation and holding presentations to members on request. We will also work together with the organisation to reach media through press releases and to reach stakeholders through policy briefs. Ethics {#s2f} ------ All participants gave their informed consent for taking part in the study. Study participation was voluntary, and the participants were informed that they could withdraw from the study at any time. Results {#s3} ======= [Table 1](#T1){ref-type="table"} shows the study characteristics of the VI population and the general population. The age distribution of the VI population (mean: 51.4, range: 18--95) was similar to that of the general population (mean: 53.2, range: 18--94). In both surveys, non-participants were more likely than participants to be of young or old age. ###### Characteristics of the visual impairment population (VI) and the general population (GP), according to gender Characteristics Female VI Female GP Male VI Male GP ----------------------- ------------ ------------ ------------ ------------ Age (years) 18--35 88 (21.8) 189 (20.1) 69 (20.7) 105 (12.7) 36--50 101 (25.1) 273 (28.9) 85 (25.5) 184 (22.2) 51--65 106 (26.3) 267 (28.4) 94 (28.2) 286 (34.5) ≥66 108 (26.8) 212 (22.5) 85 (25.5) 253 (30.6) Urbanicity \<20 000 inhabitants 227 (56.3) 444 (47.3) 172 (51.7) 399 (48.9) ≥20 000 inhabitants 176 (43.7) 494 (52.7) 161 (48.4) 426 (51.1) Education (years) \<11 69 (17.1) 79 (8.4) 46 (13.8) 62 (7.5) 11--13 162 (40.2) 346 (36.7) 124 (37.2) 336 (40.5) ≥14 172 (42.7) 517 (54.9) 163 (49.0) 432 (52.0) Work status Employed/studying 154 (38.2) 641 (68.3) 160 (48.1) 526 (63.1) Unemployed 152 (37.7) 82 (8.7) 73 (21.9) 60 (7.2) Retired 97 (24.1) 216 (23.0) 100 (30.0) 224 (29.3) Marital status Single 131 (32.5) 133 (14.2) 129 (38.7) 96 (11.6) Married/partnership 181 (44.9) 698 (74.3) 166 (49.9) 672 (80.9) Divorced 46 (11.4) 59 (6.2) 25 (7.5) 38 (4.6) Widowed 45 (11.2) 49 (5.2) 13 (3.9) 25 (3.0) A total of 78 (10.6%, 95% CI 8.5 to 13.1) of adults with VI and 109 (6.1%, 95% CI 5.1 to 7.3) of adults from the general population reported having at some time experienced sexual assaults. [Table 2](#T2){ref-type="table"} displays the prevalence rates of sexual assaults across strata of age and gender. For women, a higher prevalence of sexual assaults was observed among individuals with VI than that of the general population, and the largest difference was found among those aged 36--50 years. For men, no significant differences were observed. The female/male ratio was 7.3 for the VI population and 5.9 for the general population. ###### Prevalence of sexual assaults in the visual impairment population (VI) and in the general population (GP), according to age and gender Female VI (n=403)\* Female GP (n=941)\* P values† Male VI (n=333)\* Male GP (n=828)† P values† -------------------- --------------------- --------------------- ----------- -------------------- ------------------ ----------- ------------------- -------- ------------------ ------ Age groups (years) 18--35 15/88 17.1 (10.5 to 26.5) 22/189 11.6 (7.8 to 17.1) 0.26 1/69 1.5 (0.2 to 9.7) 1/105 1.0 (0.1 to 6.5) 1.00 36--50 26/101 25.7 (18.1 to 35.2) 31/273 11.4 (8.1 to 15.7) 0.001 4/85 4.7 (1.8 to 12.0) 3/184 1.6 (0.5 to 5.0) 0.21 51--65 17/106 16.0 (10.2 to 24.4) 28/267 10.5 (7.3 to 14.8) 0.16 2/94 2.1 (0.5 to 8.2) 6/286 2.1 (0.9 to 4.6) 1.00 ≥66 12/108 11.1 (6.4 to 18.6) 13/212 6.1 (3.6 to 10.3) 0.13 1/85 1.2 (0.2 to 8.0) 4/253 1.6 (0.6 to 4.1) 1.00 Total 70/403 17.4 (14.0 to 21.4) 94/941 10.0 (8.3 to 12.1) \<0.001 8/333 2.4 (1.2 to 4.7) 14/828 1.7 (1.0 to 2.8) 0.48 \*No missing data due to non-response for the VI population, while there were 23 participants from the general population who did not respond to questions related to age and/or gender. †P value calculated using Fisher's exact test. tot, total number of participants in that particular subgroup. [Figure 1](#F1){ref-type="fig"} displays the unadjusted and age-adjusted and gender-adjusted risk of sexual assaults for VI-related characteristics in the VI population. Individuals with other impairments in addition to their vision loss had a greater risk of experiencing sexual assaults (RR: 1.71, 95% CI 1.15 to 2.55) than individuals who did not have any other impairments. No significant associations were found with other VI-related factors. {#F1} In individuals with VI who had experienced sexual assaults, the mean scores (SD) were 29.8 (5.7) for self-efficacy and 5.8 (2.3) for life satisfaction. In individuals with VI who had not experience any sexual assaults, the mean scores (SD) were 31.7 (5.0) for self-efficacy and 6.9 (1.9) for life satisfaction. Results from the unadjusted GLMs showed that those who had been exposed to sexual assault had lower levels of self-efficacy (RR: 0.21, 95% CI 0.07 to 0.64) and life satisfaction (RR: 0.31, 95% CI 0.19 to 0.50) compared with those who had not been sexually assaulted. After adjusting for age, gender, education and VI severity, the associations remained statistically significant for both self-efficacy (RR: 0.18, 95% CI 0.05 to 0.61) and life satisfaction (RR: 0.33, 95% CI 0.20 to 0.53). Discussion {#s4} ========== The results from this cross-sectional study showed a higher prevalence of people in the VI population being exposed to sexual assaults such as being raped and forced into sexual acts compared with that in the general population, reaching statistical significance for women only. In the population of people with VI, the risk of sexual assaults was particularly high among individuals having other impairments in addition to their vision loss. Lastly, individuals with VI who had been assaulted sexually had lower levels of self-efficacy and life satisfaction compared with the reference of no sexual assaults. Strengths and limitations {#s4a} ------------------------- This is one of few studies addressing the prevalence and associated factors of sexual assaults by including a probability sample of adults with VI[@R19] and extends previous research by obtaining valid estimates of sexual assaults across a broad array of age groups and including data obtained from the general population. Other study strengths are the detailed description of important VI characteristics and the use of interview-based assessments with validated instruments. The cross-sectional observational study design limited the possibility to address relationships of cause and effect, and although we have controlled for some potentially confounding factors, it is plausible that our analyses are subjected to residual confounding. In addition, there may be differences in what people perceive or define as sexual assault. We believe that the specific examples of violent behaviours included in the study question made it easier for people to grasp what is meant by sexual assaults. Furthermore, the use of self-reports may have affected the accuracy and validity of the estimates, and the prevalence of sexual assaults could be underestimated as a function of response biases like recall bias and self-disclosure bias. Data on sexual assaults were obtained by telephone interviews in the VI population and by postal survey in the general population. Reviews of the literature suggest higher rates of sensitive information when reported by questionnaires than by interviews.[@R28] Thus, the observed difference between people with VI and the general population may be a conservative estimate. As in most studies focusing on sensitive topics,[@R29] the high rates of people declining to participate from the VI population and the general population may have introduced biased estimates. We believe that the bias of sample selection have primarily affected the frequencies of sexual assaults and other covariates and, to a lesser extent, the relationships of interest.[@R30] Lastly, inclusion of participants from a membership organisation of blind and visually impaired people questions the representativeness of our study sample. Our study sample is comparable with 2015 census data of people who had vision difficulties with regard to gender, occupational status and geographical location, while we included a higher percentage of people having higher education and living alone.[@R31] Relation to other studies {#s4b} ------------------------- The lifetime prevalence of sexual assaults in our study population is either equal to or lower than what has been found in comparable studies of blind and visually impaired populations in the USA (12%)[@R19] or in Norway (18%).[@R18] Furthermore, the results from our study are partly in agreement with the hypothesis of VI as a risk factor for experiencing serious forms of sexual violence.[@R18] However, the low number of cases among men makes it difficult to draw inferences for the male population. Our results of higher rates of sexual assaults in those having other functional impairments in addition to their VI illustrate that being markedly different from non-impaired people, and especially visibly different, may put individuals at risk of being exposed to certain forms of violence and abuse. Unlike the study by Kvam,[@R18] we did not observe any significant associations between age of VI onset and sexual assaults. We found a lower lifetime prevalence of sexual assault in adults 51 years or older compared with younger age groups. This deserves to be commented as we expected a cumulative exposure to assaults with increasing age. In addition to the possibility of recall bias and differences across age cohorts in attitudes towards violence,[@R32] our findings may be explained by a high percentage of participants in older age groups who developed their VI in old age.[@R13] Risk of sexual assault {#s4c} ---------------------- Individuals with VI may be at risk of sexual assaults for many reasons, being either specific to VI itself or related to having an impairment in general. First, many people with VI are known to have lower socioeconomic status and to be more prone to social isolation and dependency.[@R33] This makes it easier for a perpetrator to assert power and control over the victim.[@R10] Being dependent on other people in care or service situations, which may be the case especially for some of those having additional impairments, may provide for closeness and intimacy.[@R10] Often, the perpetrator has a close relationship to the victim. It has been found that 9 in 10 victims with VI were abused either by an acquaintance or a close relative.[@R18] Important issues related to sexual violence are differences in power and control. Negative social views towards people with impairments, like stigmatisation and discrimination, may be internalised by the individual, leading to low self-esteem and feelings of self-blame.[@R34] Dependency, fear of being left alone and feelings of unworthiness can make people stay in a relationship that is potentially abusive. Self-efficacy and life satisfaction {#s4d} ----------------------------------- To our knowledge, this is the first study addressing possible consequences of being exposed to sexual violence among individuals with VI. Our findings of an association between sexual assault and lower levels of self-efficacy or life satisfaction in adults with VI are similar to what has been observed in the general population[@R2] and may have similar plausible explanations. Rape and forced sexual acts might cause deep-rooted consequences in various life domains, such as role management and the ability to socialise.[@R37] Moreover, lower levels of self-efficacy and life satisfaction could be due to the fact that traumatic events like rape could affect people's view of themselves, others and the world, as well as resulting in stress reactions like avoidance, low self-esteem, negative cognition and self-blaming.[@R38] Self-efficacy is a key psychological component for restoring functioning and health after experiencing trauma and the ability to handle post-traumatic stress reactions is associated with self-efficacy beliefs in the future.[@R36] Implications {#s4e} ------------ The high prevalence of sexual assault in people with sensory impairments calls for preventive measures. Violence prevention strategies should try to raise public awareness, promote open discussion and upgrade professional education, service support and guidance.[@R39] There is also a need for strategies that provide safe avenues through which people with VI can escape or recover after an assaulting event. Until now, few people with VI have prosecuted the perpetrator,[@R18] and measures to intensify the legal protection of people with VI should be addressed. Violence is largely about power and oppression.[@R6] Impaired individuals' risk of serious forms of sexual violence may be rooted in social isolation and being of a low social position. Thus, social integration of people with impairments should be a main objective to make them more robust towards sexual assaults, which can be achieved through universal design of information and public spaces, reducing stigmatisation and discrimination towards people with impairments and fostering self-reliance and independency of the individual. Possible consequences of sexual assaults for self-efficacy and life satisfaction emphasise the need for professional assistance for those who have been abused. Access to help services are crucial, and adapted information and professionals trained to the needs and challenges of people with VI are recommended. Supplementary Material ====================== ###### Reviewer comments ###### Author\'s manuscript The authors would like to thank Marianne Bang Hansen for her contribution to the study design and data collection. We also want to thank Sverre Fuglerud, Per Fosse and Liv Berit Augestad for valuable insights into the lives of people who are blind and visually impaired. Lastly, we would like to thank the study expert group and all collaborating project partners in the European Network for Psychosocial Crisis Management -- Assisting Disabled in Case of Disaster (EUNAD) for making it possible to conduct this research study. **Contributors:** AB planned the statistical analysis, analysed and interpreted the data and drafted and revised the paper. TH designed the research study, monitored data collection for the whole study, cleaned the data, interpreted the data and drafted and revised the paper. **Funding:** This work received grants from the European Commission, Directorate-General Humanitarian Aid and Civil Protection (grant number: ECHO/SUB/2015/718665/PREP17). **Competing interests:** None declared. **Patient consent:** Not required. **Ethics approval:** The study was carried out anonymously and at request the Regional Committee for Medical and Health Research Ethics required no further formal ethical approval (reference number: 2016/1615A). **Provenance and peer review:** Not commissioned; externally peer reviewed. **Data sharing statement:** Data are from the research project European Network for Psychosocial Crisis Management -- Assisting Disabled in Case of Disaster (EUNAD). Public availability may comprise privacy of the respondents. According to the informed consent given by each respondent, the data are to be stored properly and in line with the Norwegian Law of Privacy Protection. However, anonymised data are available to researchers who provide a methodological sound proposal in accordance with the informed consent of the respondents. Interested researchers can contact project leader Trond Heir (trond.heir\@medisin.uio.no) with request for our study data. | Mid | [
0.630606860158311,
29.875,
17.5
] |
+ u + p*c**3 and give p. -2 Express (0 + 0 - 2)*(0*p**2 + 3*p**2 - 2*p**2) + 0*p**2 - 4*p**2 + 2*p**2 as m*p**2 + w*p + b and give w. 0 Rearrange 0*b + 7*b - 3*b - 3*b + b + 4*b + (2 - 3 + 2)*(-b - 2*b + 4*b) + (0 + 3 - 1)*(-2*b + 2*b - b) to the form s + k*b and give s. 0 Express 4*k**2 - 17*k**2 - 2*k**2 in the form d*k**2 + u + q*k and give d. -15 Express -4*g**3 + 8*g**3 + 3*g**2 - 2*g**3 + 8*g**3 as r*g**2 + z*g**3 + a + d*g and give r. 3 Express 16*u + 2 - 44*u + 14*u - 1 + u**2 in the form v + o*u**2 + f*u and give o. 1 Rearrange 2*s - 2*s + 2*s + 5*s + 2*s - 12*s + (1 + 1 - 1)*(0 + 0 + 2*s) + 3 - 3 + 2*s to the form g*s + p and give g. 1 Rearrange -2 + 4 + 15*m + 0 to the form a*m + x and give x. 2 Rearrange (-2*l + 2*l + l**2)*(-l**2 + 7 - 7) + (-l**3 + 3*l**3 - l**3)*(-3*l + 2*l + 4*l) to the form p + i*l**4 + g*l + r*l**2 + n*l**3 and give r. 0 Express 2*l**4 - l**3 - 1 + 1 + 41*l**2 - 40*l**2 as i*l**4 + b*l**2 + h + s*l + g*l**3 and give g. -1 Express -22 + 7 + f**2 + 35 as z*f**2 + u + h*f and give h. 0 Rearrange -2 - 1 + 3 - 107*w**2 to the form f*w**2 + s + b*w and give f. -107 Rearrange (-2*v - v + 2*v)*(2 + 0 + 0) + (1 + 5 - 5)*(13*v - 3*v + 14*v) to q*v + k and give k. 0 Express (-2 - 3 + 4)*((2 + 7 - 3)*(-c + 5*c - 2*c) - 2*c + c + 2*c)*(-3 + 3 + 3) + c + 2*c - 2*c in the form f + s*c and give s. -38 Express (g - 6*g + 2*g)*(2*g + g - g)*(1 + 2 - 5)*(-g - g + 0*g) as n*g**3 + x*g + o + r*g**2 and give o. 0 Rearrange 0*q**2 - 3*q**2 - 6*q**2 + 0*q**2 to the form n*q + p*q**2 + j and give p. -9 Express 2*j**2 + 3 - 2 - 30*j + 30*j in the form u*j + c*j**2 + z and give u. 0 Rearrange 3*p**3 + p**3 - 2*p**3 - 6 to the form d*p**3 + y + k*p + s*p**2 and give d. 2 Rearrange (y + 4*y - 3*y)*(y**2 + 5*y**2 - 6*y**2 + 273*y**3) to j*y**2 + m*y**4 + h*y**3 + q*y + g and give m. 546 Express -2*n - 3 + 4*n**3 + 5*n**3 + 4 + 9*n**3 as r*n**2 + q*n + g*n**3 + x and give x. 1 Rearrange 3*i + 3*i - 5*i + 7*i to the form y*i + f and give y. 8 Express -2 + 2*l + 4 - 2 in the form a + p*l and give p. 2 Rearrange 7*c**4 + c**4 + c**2 - 3*c**4 - 4*c**4 - 7 to o*c**2 + w + q*c + r*c**4 + g*c**3 and give w. -7 Express -74*t**2 + 58 - 58 as r + s*t**2 + i*t and give s. -74 Rearrange 2*z**2 + 1 + 3*z + z**3 - 3 + 385*z**4 - 387*z**4 to the form a*z**4 + w*z + l + c*z**2 + q*z**3 and give l. -2 Rearrange -22 + 57 - 15 - 19 + 20*w to the form d + q*w and give d. 1 Express (2*i + i - 2*i)*(-i**2 - i**2 + 4*i**2) + 131 + 58*i**3 - 131 as t*i + g + y*i**2 + z*i**3 and give z. 60 Rearrange (2*s + s - 2*s)*((2*s - 3*s + 0*s)*(-1 + 1 - 2) + 22*s + 32 - 32) to d*s + k*s**2 + x and give k. 24 Express 52*f**2 + 2*f - 6*f + 4*f in the form o*f + m + z*f**2 and give z. 52 Rearrange 7*k - 4*k + 0*k + 8*k to the form n*k + c and give n. 11 Express -3 - 3*x**2 + 3 + 13*x**2 as l*x**2 + u + d*x and give u. 0 Express 1 + 2*p - 1 + 15*p in the form c*p + g and give c. 17 Express 5*f + 12*f - 19*f + f**2 - f**2 - f**2 + 3*f**2 + (f + 0 + 0)*(0*f + 2*f - f) in the form m*f**2 + t + a*f and give m. 3 Rearrange -7*q**3 + q**2 - 1 + 4*q**4 - 3*q**2 + 6*q**3 - 2*q to n*q**4 + g*q**2 + x*q**3 + h*q + t and give g. -2 Rearrange -59*k**2 + 13*k**2 - 21*k**2 to the form v + x*k + r*k**2 and give r. -67 Rearrange (2 - 2 - q**2)*(-35 + 2 - 7) to the form k*q**2 + f + v*q and give k. 40 Rearrange (-4*x**2 - 4*x + 4*x)*(3*x + 3*x - 3*x) + 0*x**2 - x**3 + 0*x**2 to the form z*x**3 + h*x + w*x**2 + p and give z. -13 Rearrange -20 + 71*h - 13 + 35 to n*h + c and give n. 71 Rearrange (0*p**2 + 4*p**3 - 2*p**3 + 5*p**2)*(6 - 4 - 9) to the form v*p**3 + n + m*p**2 + r*p and give v. -14 Rearrange (-9 + 12*q**2 + 7 + 5*q**2)*(-2*q - 2 + 2) to the form f + j*q + u*q**2 + n*q**3 and give j. 4 Rearrange -3*s**2 + 3*s + s**2 + 2*s**2 + s**2 to the form u*s**2 + v*s + l and give u. 1 Rearrange -4*p**2 - 2*p + 2*p - 2*p + 2*p**3 - 2*p**2 to the form d + x*p**3 + j*p + g*p**2 and give g. -6 Rearrange 0 + 0 + 55*k - 56*k to n*k + u and give n. -1 Express -2*t + 2*t**2 - 18 - 22 + 40 as n + a*t**2 + z*t and give z. -2 Express 3*n**3 - 3*n**3 + 2*n**2 + 3*n**2 + 2*n**3 in the form t*n**2 + z*n + v*n**3 + a and give v. 2 Rearrange (7*c - 7*c - 7*c)*(-16*c - 3 + 0 + 3) to the form t + d*c + z*c**2 and give z. 112 Express (8 - 1 - 8)*(-2 - 2*f**2 + 2) as j + r*f + a*f**2 and give a. 2 Rearrange -m**3 + 275 - m**4 - 275 - 6*m**2 to the form j*m**2 + r*m + q*m**4 + t*m**3 + n and give q. -1 Express -44*n**2 + n + 2*n**3 + n + 39*n**2 in the form w*n**2 + x*n + j + b*n**3 and give w. -5 Express (4*n**3 + 2 - 2 + n**3 - 3*n**2 + 3*n**2 + (-7*n + 3*n + 3*n)*(-4*n**2 - n**2 + 3*n**2))*(-2 - 5 - 2) in the form b*n**2 + l*n + i*n**3 + g and give b. 0 Express (150 - 10 - 25)*(-w + 0*w + 0*w) as p + x*w and give x. -115 Express 21*z - 55*z + 26*z in the form s + p*z and give p. -8 Rearrange (5*r + r - 4*r)*(5 - 5 + 3)*(2 - 2 + 2) to the form p + b*r and give b. 12 Express -25*z + z + 8*z in the form v + s*z and give s. -16 Rearrange (-w + 0*w + 0*w)*(1451*w - 1451*w + 31*w**2)*(-3*w + 4*w + 0*w) to the form a*w**2 + q*w**4 + r*w**3 + l*w + g and give q. -31 Express 83*g - 49*g + 80*g as f + h*g and give h. 114 Rearrange 31*y + 65 - 14*y - 18*y to f*y + a and give a. 65 Rearrange -8 + 4*u**2 + 12 + u**3 + 5*u**2 - 5 to n*u**3 + z*u**2 + l + i*u and give z. 9 Express -56 + 56 + 17*l as r + d*l and give d. 17 Express -f**3 + 4 + 4*f**3 - f - f**3 - f**3 as q*f**2 + x*f**3 + g*f + n and give n. 4 Rearrange (-3 - 1 + 2)*(2 + x - 2) + (-1 + 0 - 1)*(-6 + 14*x + 6) to the form s*x + a and give s. -30 Express 5*i - 5*i + 60*i**2 - 2 + 15*i**2 as c*i**2 + z*i + p and give z. 0 Express 3*j**4 + 2*j**4 - 7*j**4 + 6 + 4*j**2 - 2*j as q + f*j**3 + r*j + x*j**4 + h*j**2 and give x. -2 Rearrange -6 - 13 + 2*n**2 + 18 + 6*n to the form h*n**2 + r + k*n and give r. -1 Express 5*m + 15*m - 4*m + 16*m in the form z + q*m and give q. 32 Rearrange 568*h - 568*h - 23*h**3 + (-6 + 0 + 4)*(6*h**3 - h**3 - 3*h**3) - 2*h**2 + 2*h**2 + 2*h**3 to the form v + b*h + m*h**2 + k*h**3 and give k. -25 Express (-37*t + 12*t - 19*t)*(1 - 2 - 1) in the form a + l*t and give l. 88 Express 3 + 0*b + 2*b - 3*b**4 + b**4 + 3*b**4 in the form f*b + t + l*b**4 + y*b**2 + g*b**3 and give t. 3 Express (-5*f**4 + 3*f**4 + f**4)*(4 - 9 - 5) + (2 - f - 2)*(3*f**2 + 2*f**3 - 3*f**2) - f**2 + f**4 + f**2 as d*f + m*f**2 + a*f**3 + j + r*f**4 and give r. 9 Rearrange 0*s - s - 4*s + s**2 to p*s + v + u*s**2 and give u. 1 Express 168 - 5*l - 168 + l**3 - 19*l in the form r*l + p*l**2 + f + z*l**3 and give z. 1 Express 25*u**2 + 5*u**2 - 13*u**2 + 51*u**2 in the form g + p*u**2 + k*u and give p. 68 Express 336*i + 6*i**2 - 4*i**2 - 7*i**3 - 334*i in the form s*i**2 + m*i**3 + b + d*i and give d. 2 Express (0*h - 2*h + 3*h)*(-1 + 4 + 1 + (-2 + 0 + 3)*(4 + 2 - 4))*(4*h**3 - 2*h**3 - h**3) as l*h**3 + c*h + i + v*h**2 + r*h**4 and give r. 6 Rearrange 2 - 8 + n - n**3 - 2 to o*n + y*n**2 + m + t*n**3 and give t. -1 Rearrange (14 - 14 - 9*v)*(-4*v + 0*v + 2*v)*(6*v**2 - 5*v**2 + 0*v**2) to the form g*v**2 + f*v**3 + a*v**4 + m*v + u and give a. 18 Express 544 - 544 - 43*b**2 in the form v*b**2 + p*b + a and give v. -43 Rearrange 484 + 8*i - 484 to the form s*i + n and give s. 8 Express 12*q**2 + 25*q**2 + 48*q**2 - 9*q**2 in the form y + n*q + s*q**2 and give s. 76 Rearrange -57 + 58 - 2*d**4 + 2*d - 2*d**3 - d**2 - d**3 to u*d**2 + k + i*d**4 + z*d + v*d**3 and give k. 1 Express -7*t**3 - 11*t**3 + 11*t + 16*t**3 as q*t + y*t**2 + v + l*t**3 and give q. 11 Rearrange 1 - f**2 + 7*f + 1 - 12*f + 4*f to l*f + z*f**2 + q and give q. 2 Rearrange (2*s - 2*s - 2*s)*((8 - 1 - 1)*(1 - 2 + 4) - 1 + 2 - 3) to the form d + b*s and give d. 0 Express 19*i**2 - 4*i**2 + 43*i**2 as c*i + v*i**2 + s and give v. 58 Rearrange -6*t - 12*t - 8*t + 25*t + 2 to q + z*t and give z. -1 Express -5 + 141*u - 141*u - 3*u**2 as t*u**2 + w + z*u and give t. -3 Express 16 + r - 8 + 10 as b + c*r and give c. 1 Express (10*n + 10*n - 16*n)*(-3 - 1 + 2)*(3*n + n - 2*n)*(n**2 + 2*n**2 + 2*n**2)*(1 - 5 + 3) as j*n**3 + u*n + b + v*n**4 + y*n**2 and give v. 80 Express -23*y**2 - 25 + 25 in the form z*y**2 + a + q*y and give z. -23 Rearrange (-5*l**3 + 42*l**3 + 27*l**3)*(-l - l + 0*l) to the form z* | Low | [
0.48456790123456706,
19.625,
20.875
] |
Investing In a Mining Adventure? Consider This First July 21, 2017 You love the idea of eth mining right, well you are not the only one but is it really such a wise investment? A lot of people are worried they are getting the short-end of the stick when it comes to investing in this area and it’s not hard to see why. This is still quite a new concept even though it’s enormously popular but will investing really be the ideal solution for you? Consider a few things first before risking any capital. What Do You Know About This Type Of Mining? First of all, you need to seriously ask yourself what you know about mining ether and the whole process. Sometimes, you cannot risk any money whatsoever if you have no idea what it means for you. Yes, mining might seem like a simple avenue but if you don’t know or aren’t prepared to learn, it can turn into a major crisis. So, what do you actually know about mining ether? If it’s absolutely nothing then you have a really big problem on your hands. The reason why is simply because if you don’t know what you’re getting into, you can’t make a good decision about when to bail! Its all well and good saying you’ll use the eth mining calculator but if you don’t know what it is, it’s complex. Profits Can Turn Into Negatives In all honesty, mining eth can be a fantastic idea and certainly something that offers up a lot of rewards in terms of money. If you are highly successful in mining you could see a nice little profit. However, while there is the potential to make money, there is also the potential to lose money! As we all know, the market could crash and the ether might not be as worthwhile as you might think. What’s more, if you spend too much on mining, you might find any money you make barely covers the overall running costs. That is a possibility with eth mining; it’s not ideal but it happens. Profits can turn into negatives, even when you have been doing well. click this link right here! There Is Always a Risk – Bottom Line When it comes to mining, you are sure to find that there is a real risk to it. Now, while you might think the risks are low, they are still there! You could have serious issues with mining ether, even after you’ve had some practice and experience. Yes, there are real rewards to come from it but there are also some negatives too! That is the bottom line because while we might love to believe all ether mining offers the perfect 100% rewards, it’s not always the case. Even when you use the eth mining calculator you can still see a risk. You have to know these things from http://www.ethermining.com before you invest so that you can be fully aware of everything. Invest With a Wise Head Investing in any adventure will have its ups and downs. There are some who will find investing to be a rather risky venture and one they aren’t willing to follow. However, mining ether can also be an ideal option for those who want to invest in something they can make money from. This is your decision at the end of the day so you must choose wisely to invest or not. Be wary when it comes to investing in eth mining today. | Mid | [
0.545073375262054,
32.5,
27.125
] |
Q: computing the galois group of a polynomial Compute the Galois group of the splitting field of the polynomial $t^4-3t^2+4$ over $\mathbb{Q}$. I don't know how can I do this problem, the roots are very "ugly" maybe if I consider another basis (a more workable basis). The roots of the polynomial are: $$ \pm \sqrt {\frac{1} {2}3 - i\sqrt 7 } ,\qquad \pm \sqrt {\frac{1} {2}3 + i\sqrt 7 } $$ A: There is a standard way to find Galois groups of degree 4 irreducible separable polynomials. Say your polynomial is $f(x) = x^4+bx^3+cx^2+dx+e$ Call $x_1,x_2,x_3,x_4$ its (pairwise distinct) roots. Let $\alpha := x_1x_2 + x_3x_4$ $\beta := x_1x_3 + x_2x_4$ $\gamma := x_1x_4 + x_2x_3$ The polynomial $g(x) := (x-\alpha)(x-\beta)(x-\gamma)$ is called the resolvent cubic of $f(x)$. Computation shows that $g(x) = x^3 - cx^2 + (bd-4e)x - b^2e + 4ce - d^2$. Call $K$ the field $\mathbb{Q}(\alpha,\beta,\gamma)$, the splitting field of $g(x)$ over $\mathbb{Q}$. Call $G$ the Galois group of $f(x)$. The natural action of $G$ on the four roots of $f$ gives an embedding of $G$ inside the symmetric group $S_4$ (identify $G$ with its image in $S_4$). $G$ is transitive in $S_4$ being $f(x)$ irreducible. Call $V$ the Klein subgroup of $S_4$ (i.e. the subgroup consisting of the elements which are product of two disjoint transpositions). Note that the intermediate field $K$ corresponds (through the Galois correspondence) to the subgroup $G \cap V$ of $G$, therefore $G/G \cap V$ is isomorphic to the Galois group of $g(x)$. With this information it is possible to detect $G$ among the transitive subgroups of $S_4$ (provided you can compute Galois groups of cubics, but that's easy: the Galois group of an irreducible separable degree 3 polynomial is $A_3$ if the discriminant is a square in the base field, it is $S_3$ otherwise). In your case the cubic resolvent splits completely as $(x+3)(x+4)(x-4)$, so $K=\mathbb{Q}$ and $G=G \cap V$, in other words $G \subseteq V$. Having $V$ no proper transitive subgroup, it must be that $G=V$. A: The roots are $\pm\sqrt{\frac{3\pm\sqrt{-7}}{2}}$. We can obtain the root field (splitting field) by first adjoining $\sqrt{-7}$ to the rationals $Q$, then take appropriate square roots to get the root field of the polynomial. So the degree of the extension for the splitting field is 4. The root field has degree 4 so the Galois group has 4 elements. Hence the Galois group is either cyclic of order 4 or $Z_2^2$. For the first case there is a unique quadratic subfield and for the second there are 3 quadratic subfields. Consider the conjugate roots $a=\sqrt{(3+\sqrt{-7})/2}$, $b=\sqrt{(3-\sqrt{-7})/2}$; then $a+b=\sqrt{7}$, $a-b=\sqrt{-1}$, $a^2-b^2=\sqrt{-7}$ Since there are 3 quadratic subfields, the galois group is $Z_2^2$. | Mid | [
0.588807785888077,
30.25,
21.125
] |
New honours. More than 30 nurses were recognised in the New Year honours list. Catherine Elcoat (pictured left, top), chief nurse at University Hospital Birmingham NHS Trust is to be made a dame and former RCN chair Debbie Murdock (left) is to receive an OBE. Other nurses to be honoured included. | High | [
0.7128427128427121,
30.875,
12.4375
] |
Q: How to set ariaLabel for toast and Messagebox I have a Ext.toast and Ext.Msg to be displayed on button click. So on click of button the content of toast and messagebox should be read. I have applied ariaLabel but its still not readable, tried setting focus and containsFocus as well but still no luck, when I set defaultFocus:1 on messagebox it works for the first time only. Any hints please. Ext.toast({ html: 'Data Saved', title: 'My Title', width: 200, align: 't', ariaLabel: 'My Title Data Saved' }); Ext.Msg.show({ title: 'Invalid search criteria', msg: 'check', ariaLabel:'Invalid search criteria check', icon: Ext.Msg.ERROR, buttons: Ext.Msg.OK }); Screen reader to be used - NVDA Fiddle can be found here A: The problem is that attribute aria-labelledby is always set automatically. (and has the higher precedence ariaLabelledBy). I did not find a way to avoid automatic substitution, so I created an override that does this for window instances Ext.define('Ext.window.WindowAriaOverride', { override: 'Ext.window.Window', afterShow: function () { this.el.dom.setAttribute('aria-labelledby', null) this.el.dom.setAttribute('aria-label', this.ariaLabel) } }); Fiddle | Mid | [
0.602298850574712,
32.75,
21.625
] |
Post navigation This road dates back to 1700 when Norway’s king would use it to travel the nearly 300 miles (480 km) from Bergen to Oslo. It’s now part of a nature park that’s used for hiking, biking, horseback riding and cross-country skiing. Since it’s minutes from my new home, this hike was the first of what I’m sure will be many such excursions. I’m writing this post as a member of the Netflix Stream Team and have been compensated for it, but as always, all opinions are my own. One of my guilty pleasures is Pretty Little Liars. There’s been enough times where I’ve started watching it alone and my eldest comes along for a snuggle and bam! my 7 year old is watching all sagas involving A. Logan was quite surprised to hear that Pretty Little Liars’ Season 5 was just around the corner. This picture of an old Ford truck in Pacific City, Oregon was picked as a featured photo . I love me some Instagram, and one of my favorite communities is #Rustlord, which is filled with all things rusty. There’s sub-communities, if you will, and one of those is Rustlord_carz. I took this shot, tagged it and surprise of all surprises, it was chosen as one of their featured photos. Are you on Instagram? If so, let’s connect! | Low | [
0.49774774774774705,
27.625,
27.875
] |
Q: Custom View InflateException For Drawing Application in Fragment I am trying to code a touchscreen interactive drawing application inside android studios with a fragment; however, I am receiving an error of but fails to find what it is caused by and how to fix it. I am a beginner to app development and simply was following a tutorial. See the link below and please notify me if you need additional information. Thank you so much in advance! I suspect it is caused by the package name in the xml file or the constructors in the java file! Problems/Errors at com.app2016.alexker.matchplanning.MatchPlanning.onCreateView(MatchPlanning.java:67) java.lang.RuntimeException: Unable to start activity ComponentInfo{com.app2016.alexker.matchplanning/com.app2016.alexker.matchplanning.MainActivity}: android.view.InflateException: Binary XML file line #19: Error inflating class com.codepath.example.simpledrawapp.SimpleDrawingView Java Class package com.app2016.alexker.matchplanning; import android.content.Context; import android.graphics.Canvas; import android.graphics.Color; import android.graphics.Paint; import android.graphics.Path; import android.view.MotionEvent; import android.view.View; import android.util.AttributeSet; /** * Created by AlexKer on 16-02-06. */ public class SimpleDrawingView extends View { //set up initial paint color private final int paintColor = Color.BLACK; //defines paint and canvas private Paint drawPaint; //path private Path path = new Path(); @Override protected void onDraw(Canvas canvas) { canvas.drawPath(path, drawPaint); } public SimpleDrawingView(Context context){ super(context); setFocusable(true); setFocusableInTouchMode(true); setupPaint(); } public SimpleDrawingView(Context context, AttributeSet attrs){ super(context, attrs); /*setFocusable(true); setFocusableInTouchMode(true); setupPaint();*/ } private void setupPaint() { drawPaint = new Paint(); drawPaint.setColor(paintColor); drawPaint.setAntiAlias(true); drawPaint.setStrokeWidth(5); drawPaint.setStyle(Paint.Style.STROKE); drawPaint.setStrokeJoin(Paint.Join.ROUND); drawPaint.setStrokeCap(Paint.Cap.ROUND); } // Get x and y and append them to the path public boolean onTouchEvent(MotionEvent event) { float pointX = event.getX(); float pointY = event.getY(); // Checks for the event that occurs switch (event.getAction()) { case MotionEvent.ACTION_DOWN: // Starts a new line in the path path.moveTo(pointX, pointY); break; case MotionEvent.ACTION_MOVE: // Draws line between last point and this point path.lineTo(pointX, pointY); break; default: return false; } postInvalidate(); // Indicate view should be redrawn return true; // Indicate we've consumed the touch } } Below is the onCreateView @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { // Inflate the layout for this fragment View view = inflater.inflate(R.layout.fragment_match_planning, container, false); return view; } And XML <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" xmlns:tools="http://schemas.android.com/tools" android:layout_width="match_parent" android:layout_height="match_parent" android:id="@+id/fragment_match_plan" android:orientation="vertical" android:gravity="center|top" tools:context="com.app2016.alexker.matchplanning.MatchPlanning" android:background="@drawable/field"> <!-- TODO: Update blank fragment layout --> <RelativeLayout xmlns:android="http://schemas.android.com/apk/res/android" xmlns:tools="http://schemas.android.com/tools" android:layout_width="match_parent" android:layout_height="match_parent" tools:context=".MainActivity" > <com.codepath.example.simpledrawapp.SimpleDrawingView xmlns:android="http://schemas.android.com/apk/res/android" android:id="@+id/SimpleDrawingView" android:layout_width="wrap_content" android:layout_height="wrap_content" android:layout_alignParentBottom="true" android:layout_alignParentLeft="true" android:layout_alignParentRight="true" android:layout_alignParentTop="true" /> </RelativeLayout> A: Actually, the package name is also wrong in XML. Should be com.app2016.alexker.matchplanning. I have no idea what the view is you're trying to use, but this seems super unusual: android:layout_alignParentBottom="true" android:layout_alignParentLeft="true" android:layout_alignParentRight="true" android:layout_alignParentTop="true" Try this: <com.app2016.alexker.matchplanning.SimpleDrawingView xmlns:android="http://schemas.android.com/apk/res/android" android:id="@+id/SimpleDrawingView" android:layout_width="match_parent" android:layout_height="match_parent"/> Also -- currently, the LinearLayout or RelativeLayout is useless. | Low | [
0.503579952267303,
26.375,
26
] |
Q: Find Number of Instances Within GroupBy ASP.NET MVC I have an application that shows a list of errors. Previously it showed every single error within the database but I have now put a GroupBy on it to group all the recurring errors together. It now only shows the FirstOrDefault() for each group by but I am wanting to have column that states how many times each error has occurred. As you can see from the image above, this is the output I currently have. If you take the top record, for example, /LM/W3SVC/7/ROOT has 13 instances of the same error. What I am wanting to do is add another column that shows how many times each error has occurred, which in this case, would be 13. Controller public ActionResult Errors(string sortOrder, int? page) { ViewBag.CurrentSort = sortOrder; ViewBag.DateSortParm = sortOrder == "Date" ? "date_desc" : "Date"; var queryString = RouteData.Values["id"]; var applications = db.ElmahErrors.Where(s => s.Application.Replace("/", "").Replace(".", "") == queryString) .GroupBy(s => s.Type) .Select(grp => grp.FirstOrDefault()); switch (sortOrder) { default: applications = applications.OrderByDescending(s => s.TimeUtc); break; } int pageSize = Int32.Parse(System.Configuration.ConfigurationManager.AppSettings["DefaultPageSize"]); int pageNumber = (page ?? 1); return View(applications.ToPagedList(pageNumber, pageSize)); } View @model PagedList.IPagedList<DataIntelligence.Models.ElmahError> @using PagedList.Mvc; <link href="Content/PagedList.css" rel="stylesheet" type="text/css" /> @{ ViewBag.Title = "Application Error Dashboard"; } <script> function goBack() { window.history.back(); } </script> <div class="jumbotron"> <h2>Application Error Dashboard</h2> </div> <table> <tr> <th> Id </th> <th> Application </th> <th> Host </th> <th> Type </th> <th> Date </th> </tr> @foreach (var item in Model) { <tr> <td> <a href="@Url.Action("Details", new { id=item.ErrorId})"> @Html.DisplayFor(modelItem => item.ErrorId) </a> </td> <td> @Html.DisplayFor(modelItem => item.Application) </td> <td> @Html.DisplayFor(modelItem => item.Host) </td> <td> @Html.DisplayFor(modelItem => item.Type) </td> <td> @Html.DisplayFor(modelItem => item.TimeUtc) </td> </tr> } </table> <br /> Page @(Model.PageCount < Model.PageNumber ? 0 : Model.PageNumber) of @Model.PageCount @Html.PagedListPager(Model, page => Url.Action("Errors", new { page, sortOrder = ViewBag.CurrentSort, currentFilter = ViewBag.CurrentFilter })) <a href="#" onclick="goBack()" style="padding-right: 0px; padding-top: 0px; padding-bottom: 0px; padding-left: 0px;"> Back </a> What would I need to add to my Controller code in order to make this possible? And how would I then go on to display that value in my view? Any help on this would be greatly appreciated. Thanks in advance A: You need Count here:- var applications = db.ElmahErrors.Where(s => s.Application.Replace("/", "") .Replace(".", "") == queryString) .GroupBy(s => s.Type) .Select(grp => new { ErrorCount = grp.Count(), ErrorObj = grp.FirstOrDefault() }); Please note, here I am projecting an anonymous type but since you need to bind it to a View, you need to define a Model with a property say ErrorCount, which can act as your column in View. So suppose you define a class like this:- public class ErrorCountModel { public int ErrorCount { get; set; } public ElmahError ElmahError { get; set; } } Then you can project this model instead of anonymous type like this:- .Select(grp => new ErrorCountModel { ErrorCount = grp.Count(), ElmahError = grp.FirstOrDefault() }); | Mid | [
0.555844155844155,
26.75,
21.375
] |
“None of the other angels really knew why the Lady chose to make David an angel. He was only a child after all, a child who had seen and suffered much horror in his young life. Despite that he was made into an angel who now protects those in the world from Dark Ones and the terror and nightmares they bring with them. Even though he is but an infant in comparison to other angels who have lived for over a millennium, David still uses his connection with his own humanity to serve the Lady in a way that no other angel can…” | Low | [
0.501039501039501,
30.125,
30
] |
Automated fluorescent differential display for cancer gene profiling. Since its invention in 1992, differential display (DD) has become the most commonly used technique for identifying differentially expressed genes because of its many advantages over competing technologies such as DNA microarray, serial analysis of gene expression (SAGE), and subtractive hybridization. A large number of these publications have been in the field of cancer, specifically on p53 target genes. Despite the great impact of the method on biomedical research, there had been a lack of automation of DD technology to increase its throughput and accuracy for systematic gene expression analysis. Many previous DD work has taken a "shotgun" approach of identifying one gene at a time, with a limited number of polymerase chain reactions (PCRs) set up manually, giving DD a low-tech and low-throughput image. We have optimized the DD process with a platform that incorporates fluorescent digital readout, automated liquid handling, and large-format gels capable of running entire 96-well plates. The resulting streamlined fluorescent DD (FDD) technology offers an unprecedented accuracy, sensitivity, and throughput in comprehensive and quantitative analysis of gene expression. These major improvements will allow researchers to find differentially expressed genes of interest, both known and novel, quickly and easily. | High | [
0.6803840877914951,
31,
14.5625
] |
Chapter 17 Chapter 17 Chapter 17 Chapter 17 Chapter 17 Chapter 17 Summary Grief, Didion tells us, is never quite what we expect. Though we know that the people close to us will die, we don’t look beyond the days or weeks immediately following their deaths. We expect to be crazy and inconsolable, but we don’t imagine that we will be “literally crazy,” as Didion terms it, believing that we have the power to bring a lost loved one back. We expect that the funeral will be the greatest test of our strength, when in fact the funeral is soothing, thanks to the comfort of others and the meaningful nature of the event. The test comes in the weeks and months following, when the mourning person must face a profound loneliness and sense of meaninglessness, and must do so alone. As a child, Didion had been fearful of the idea of meaninglessness and found comfort in geology. The shifting and changing patterns of the earth seemed inevitable and permanent, a notion Didion linked to the Episcopal saying, “As it was in the beginning, is now and ever shall be, world without end.” For Didion, the earth’s abiding indifference was a comfort. While the destruction of human life might cause personal sorrow, the world would always continue. After she married and had a child, Didion found further comfort in domestic routines, such as cooking meals and setting the table. People dealing with grief think a great deal about self-pity, Didion asserts. Self- pity, though common, is a practice almost universally condemned by society. Didion had spent nearly all of her time with John after they married, and her frequent impulse to talk to him didn’t go away after he died. With no one to share her thoughts with, she turns into herself, and that intense self-focus leads naturally to self-pity. Though some people who have experienced loss claim to feel the presence of the deceased, Didion never does. On several occasions after John dies, she speaks to him as if he were there, but she knows that, as a writer, imagining their dialogue comes naturally to her. However, as she imagines the responses he might give to her questions, Didion realizes that, while she thought she knew all of John’s thoughts, she really only knew a fraction of them. Before his death, John frequently told her that if something happened to him she should stay in their apartment, keep her friends close, and marry again within the year. But neither John nor Didion really understood the implications of John’s command, as both were incapable of imagining life without the other. Didion says “marriage is time,” referring to the significance of their shared history. It is also, she says, “the denial of time,” because since she was twenty-nine Didion had always seen herself through John’s eyes. Now she must see herself through other people’s eyes, and it makes her feel considerably older. In death, she says, we mourn not only the loss of the loved one but also the loss of ourselves. Analysis Didion has begun to take stock of the past year and now attempts to understand and draw a set of coherent conclusions from her experiences. She realizes that the intensity of the shock she felt at John’s death and her subsequent deranged reactions were not only caused by the suddenness of her intense loss, but also because she was jarred to realize that her expectations about grief had been so misguided. On the surface, she had been able to function without breaking down or becoming hysterical. In reality, she had temporarily been mentally ill, able to press on only because she deluded herself into thinking that she could bring John back. Didion had not only been shocked by grief, but also by her reaction to her own grief. In dealing with John’s absence, Didion realizes how much she communicated with him on a daily basis and how all that energy has now been turned inward. This intense level of self-focus might also be called self-pity, she worries. However, this powerful self-concern is an inevitable consequence of losing someone with whom she shared such a strong, unique bond. Didion is not only coping with the loss of John, but also with the loss of their shared memory. Her sense of self had been largely founded on her relationship—not because she lacked a strong identity of her own, but because their emotional, intellectual, creative, social, domestic, and daily lives were so bound together. The loss of John forces Didion to evaluate who she is without him, a daunting task, since she has not thought of herself in that way for forty years. Didion’s general reluctance to engage in behavior she deems indulgent makes her attempt to understand herself as an individual separate from John feel like an act of “self-pity,” but it is a necessary part of the healing process. When Didion discusses meaninglessness, she isn’t talking about an absence of meaning. Instead, she describes a way of looking at the world with a proper sense of perspective, acknowledging that personal tragedy seems insignificant when compared to massive geological shifts. Changes that can seem huge or overwhelming seem small when viewed within a broader perspective. Didion recalls how the indifference of the natural world served as a comfort to Didion as a child. This might seem like a strange concept, since many people find comfort in exactly the opposite notion: that there is, in fact, a higher consciousness that cares about our personal welfare and benevolently controls our individual lives. However, Didion’s childhood worldview still has religious overtones, as she takes comfort in the idea that the world exists on such a huge scale that she, as a single human being, could never fully comprehend it entirely. For someone who always needs to be right and who fervently believes that research can answer all questions, acknowledging that there are things in the world that cannot be fathomed or understood, even through the most diligent inquisition, is a profound shift in thinking and an important step toward ending the process of magical thinking. | Mid | [
0.633245382585752,
30,
17.375
] |
Category Archives: Britain I am fairly tied up today on the Gold Coast where I presented a Keynote address to an unemployment conference. But I was reading the news on the plane this morning from Melbourne. While in Melbourne for work last week, … Read the rest of this entry » As a followup to Monday’s blog – UK growth not all that it seems – there was an additional issue that is worth exploring about the ONS data publication, given that the financial and economics commentators seem to mislead their … Read the rest of this entry » There was a story in the UK Guardian yesterday (July 29. 2012) – Million jobless may face six months’ unpaid work or have benefits stopped – that described how the failed neo-liberal British government is following the path that the … Read the rest of this entry » The British Office of National Statistics have published two new data releases in the last week which show that the British economy is plunging further into a deepening recession. On July 20, 2012, it published the Public Sector Finances, June … Read the rest of this entry » The British government brought down their 2012 Budget yesterday. I haven’t had time to fully digest all the detail yet and I am not yet fully conversant with all the discussion papers that underpinned the official budget documents. My experience … Read the rest of this entry » The British Office of National Statistics released a new report yesterday (February 29, 2012) – Young people in work – 2012 – which provides a scary view of how austerity is impacting on the future British adults. It shows that … Read the rest of this entry » Last week, the UK Office of National Statistics released their – Second Estimate of GDP Q4 2011 – which updates (once more information is available) the flash estimates that were released recently. The information confirms that the British economy went … Read the rest of this entry » This week I seem to have been obsessed with monetary aggregates, which are are strange thing for a Modern Monetary Theory (MMT) writer to be concerned with given that MMT does not place any particular emphasis on such movements. MMT … Read the rest of this entry » Just as the recent monetary data from the Eurozone has revealed the parlous state of demand there, the money supply data released by the Bank of England yesterday revealed a collapsing borrowing by households and firms in Britain scale not … Read the rest of this entry » Recent data releases suggest that the current economic experience on the two sides of the Atlantic is very different. The latest data shows that the UK economy is now contracting and unemployment is rising as fiscal austerity begins to bite. … Read the rest of this entry » | Low | [
0.529933481152993,
29.875,
26.5
] |
TALLAHASSEE — Florida’s political landscape is being upended by a landmark legal ruling that one legal expert says could influence the way other states draw their congressional districts. A circuit judge ruled late Thursday that the state Legislature illegally drew Florida’s congressional districts to primarily benefit the Republican Party. Judge Terry Lewis ruled that two of the state’s 27 congressional districts were invalid and that the map must be redrawn. Justin Levitt, a law professor at Loyola Law School who tracks redistricting cases, called the decision a “big victory” for Florida’s voters that could be a model for other states to follow. The judge based his decision on the 2010 “Fair Districts” amendment approved by voters that says districts cannot be drawn to favor an incumbent or a member of a political party. “It does right by the voters who said they want a new way of doing business,” Levitt said. But on the day after the ruling, many questions remained, including whether it could alter this fall’s elections. Florida Republicans currently hold a decisive 17-10 edge in the state’s congressional delegation even though the state has gone to President Barack Obama in the last two elections. It appeared initially that any fallout from the decision would not develop until 2016 because the GOP-controlled Legislature would appeal the ruling. But so far, legislative leaders are being cautious about their next steps, especially since the state Supreme Court has decided against the Legislature in other recent redistricting cases. “We just want to make sure we understand the ruling,” said House Speaker Will Weatherford on Friday. But the coalition of groups that challenged the Legislature plans to press forward. David King, a lawyer representing the group that includes the League of Women Voters, said it would be wrong to allow the 2014 elections to go forward with illegally drawn districts. “Our opinion is that you are not supposed to hold elections based on unconstitutional maps,” King said. King said the groups will ask the judge next week how to comply with the decision. But state elections officials would likely oppose any effort to change districts now, since ballots for the Aug. 26 primary are about to start going out. In the immediate aftermath of the decision, one candidate for Congress ended his campaign. Former U.S. Rep. David Rivera, who is seeking a return to his South Florida seat despite ongoing legal issues, complained that “liberal activist judges” were holding candidates hostage because of the ruling. Rivera said he is suspending his congressional campaign and is now focused on returning to the state Legislature. U.S. Rep. Corinne Brown, D-Jacksonville, also blasted the decision as “seriously flawed.” Brown’s sprawling district stretches from Jacksonville to Orlando and was one of the two deemed invalid by Judge Lewis. The groups suing over the districts contended the GOP-controlled Legislature packed Democrats into Brown’s seat in order to help other Republicans. But Brown maintains that the district needs to be drawn that way to ensure minority representation in Congress. Brown’s concerns were not shared by U.S. Rep. Steve Israel. Israel, chair of the Democratic Congressional Campaign Committee, said in a written statement, “we applaud the courts for standing up for fairness by recognizing that the congressional map is partisan and unconstitutional. We will wait to see what the judge says about a new map, but it’s a good day for Florida voters.” | Mid | [
0.636363636363636,
33.25,
19
] |
Under 35 U.S.C. xc2xa7 119, this application claims the benefit of German Application No. 10023158.6, filed May 12, 2000, and entitled xe2x80x9cProcess and Means for the Production of a Radiation Device for Carrying Out an Intensity-Modulated Radiotherapy as well as Radiation Device,xe2x80x9d which is incorporated herein by reference. This invention relates to systems and methods for planning radiation therapy for a patient. Radiation therapy involves delivering a high, curative dose of radiation to a tumor, while minimizing the dose delivered to surrounding healthy tissues and adjacent healthy organs. Therapeutic radiation doses typically are supplied by a charged particle accelerator that is configured to generate a high-energy electron beam. The electron beam may be applied directly to one or more therapy sites on a patient, or it may be used to generate a photon (e.g., X-ray) beam, which is applied to the patient. With a multi-leaf collimator, the shape of the radiation beam at the therapy site may be controlled by multiple leaves (or finger projections) that are positioned to block selected portions of the radiation beam. The multiple leaves may be programmed to contain the radiation beam within the boundaries of the therapy site and, thereby, prevent healthy tissues and organs located beyond the boundaries of the therapy site from being exposed to the radiation beam. A typical radiation therapy plan calls for the delivery of series of radiation treatment fractions to the patient over the course of a several days or weeks. Each treatment fraction consists of a sequence of radiation segments with a prescribed cumulative dose intensity profile. Each segment generally has a different intensity profile and, therefore, requires a different leaf arrangement. The time required to deliver a treatment fraction primarily depends on the prescribed cumulative dose and the number of segments to be delivered to the patient. In order to reduce the discomfort patients experience during the delivery of a treatment fraction, efforts have been made to reduce the time needed to deliver treatment fractions to the patient. For example, U.S. Pat. No. 5,663,999 describes a scheme for optimizing the delivery of an intensity modulated radiation beam by selectively combining segments in a single treatment fraction to reduce the total number of segments in the treatment fraction. The invention features systems and methods of planning a radiation therapy comprising of a series of radiation treatment fractions each comprising a sequence of radiation segments with a prescribed cumulative dose intensity profile to be delivered to a therapy site on a patient. In one aspect of the invention, a pair of consecutive radiation treatment fractions is generated, wherein each treatment fraction comprises a different set of radiation segments. Embodiments may include one or more of the following features. Common radiation segments of two consecutive prescribed radiation treatment fractions may be combined to reduce the total number of radiation segments applied to the patient. The resulting intensity profiles of the two consecutive radiation treatment fractions may be different. The intensity profiles of the two consecutive radiation treatment fractions may be generated from an initial common intensity profile. The common cumulative dose intensity profile may be divided into a series of layers each corresponding to a predetermined dosage level. The layers preferably are re-assigned to a respective one of the two consecutive radiation treatment fractions. The layers may be re-assigned to the consecutive radiation treatment fractions so that the intensity profiles of the two consecutive radiation treatment fractions are approximately the same. Adjacent layers of the series of layers may be assigned to a different one of the two consecutive radiation treatment fractions. The remaining radiation treatment fractions may be grouped into fraction pairs, wherein the fractions of each pair each has a respective intensity profile generated from layers of a common intensity profile. The treatment fractions of each pair may have different intensity profiles. The two consecutive radiation treatment fractions may be normalized. For example, the two consecutive radiation treatment fractions may be normalized by increasing the predetermined dosage level of each layer by the same amount to achieve a cumulative radiation dose for each treatment fraction that is substantially the same as the cumulative radiation dose of the common intensity profile. In one embodiment, the radiation treatment fractions may be normalized by substantially doubling the predetermined dosage level of each layer. In one embodiment, the total number of radiation segments applied to the patient may be reduced further. In this embodiment, the intensity profile of a selected one of the two consecutive radiation treatment fractions may be divided into a plurality of radiation segments. Divided out radiation segments preferably are combined to reduce the total number of radiation segments in the selected treatment fraction. The invention also features a system, a computer program, and a computer-readable medium carrying instructions for planning the application of a series of radiation treatment fractions, each fraction comprising a sequence of radiation segments with a prescribed cumulative dose intensity profile to be delivered to a therapy site on a patient. The system, computer program, and computer-readable medium each are operable to combine common radiation segments of two radiation treatment fractions to reduce the total number of radiation segments applied to the patient. Among the advantages of the invention are the following. The invention combines common radiation segments across the series of the radiation treatment fractions in the overall treatment plan to reduce the total number of segments in each treatment fraction. In accordance with this inventive scheme, the treatment time may be reduced without substantially changing the overall, curative biological effect of the treatment plan. | Mid | [
0.594059405940594,
37.5,
25.625
] |
Click to email this to a friend (Opens in new window) Click to share on Twitter (Opens in new window) Click to share on Facebook (Opens in new window) Hollywood train wreck Charlie Sheen was caught on video smoking crack and performing oral sex on another man in 2011, the same year he was diagnosed with HIV, according to an online report Monday. The former “Two and a Half Men” star smoked a crack pipe before grinning for the camera and then pleasuring his male lover, said the website RadarOnline, claiming it viewed a bootleg copy of the tape. The video had been part of a $20 million lawsuit against Sheen alleging he gave his sex partner herpes, the site said. The lawsuit was eventually settled out of court for millions of dollars, according to Radar. An attorney involved in the lawsuit, Keith Davidson, disputed Radar’s claim that the “alleged video” had anything “to do with the above referenced lawsuit which was filed and subsequently dismissed more than five years ago. “Though there was video evidence involved in the aforementioned case, that video evidence did not come close to portraying what you have described,” Davidson said in a statement. “Furthermore, there was but one copy of that case related video evidence. That sole copy of the video evidence was irretrievably destroyed.” The website quotes from the “J. Roe v. John Doe” lawsuit saying an “A-List celebrity,’’ identified by sources as Sheen, “entered into a nefarious plot designed to lure Plaintiff into his luxurious hotel room to serve his prurient desires.” Sheen allegedly told the man he had “no venereal diseases,’’ and the pair then watched porn and engaged in “mutual oral copulation, mutual self-gratification, rubbing and massaging each other, play-wrestling, licking and (unprotected) intercourse.” Sheen was given the original video and two other sex tapes involving himself as part of the settlement and ordered them destroyed, Radar said. Radar said it saw a bootleg copy made off the original. Sheen had met the man in Vegas in April 2011. The “Wall Street” actor has said he only found out he was HIV-positive sometime after early May of the same year. Sheen speaks out on the “Today” show: | Low | [
0.41760722347629803,
23.125,
32.25
] |
Comments Off on Shandong General Manager to retain dual foreign aid commander, Kaiser still undecided www.xxsy.net Shandong General Manager: to retain double foreign aid coach unsettled Kaiser Qilu net Ji’nan on February 22nd news (reporter intern reporter Xu Kaihua Li Xiaolin) this season for the Shandong men’s basketball team for the high speed CBA has ended. On the team’s Qilu adjustment has received the attention of fans, for Beasley and Jett’s fate, Zhike Li Shandong high-speed basketball general manager told the Qilu network interview when such a statement, "the performance of the two good, if there is no accident, the club to keep Jett and Beasley, let them continue to play in Shandong team." Kaiser needs to study the unsettled meeting 28 – 10 record, column fifth regular season, 10 games better than last season, in this victory in 28 Games, including 18 of the team’s victory, Guangdong, Liaoning, Xinjiang, Beijing, Sichuan, Guangsha and other strong hands on Shandong had been defeated, in this regard, high-speed basketball general manager Li Zhike also said, "the team’s face has changed, coaches, players and club three ningchengyigusheng, also entered the playoffs, but finally 0-3 out some helpless." Shandong high-speed basketball playoffs was the Guangdong tigers easily beat out 3-0, "last year’s season or in some haste, national team training and foreign players to the team late, foreign coaches pay more attention to the players to rest, relax and open management thought, the club also helped put forward some requirements, including the training intensity." Li Zhike expresses. Regular season results are good, playoff results are not satisfactory, in fact, the League played to the end, the players’ physical reserves appeared short board. From the data, the Shandong team in rebounding and defense done in general, physical needs to be strengthened, can be said that there are some problems, the last league hit our tactics have been figured out after all the other teams, Beasley and Jett in our team’s role is clear to everyone, so we are lack of stamina." High basketball coach Kaiser last April began coaching the Shandong men’s basketball team for high-speed, conscientious, original, foreign Kaiser signed with Shandong high-speed team a year, now appeared to be due, "Kaiser is dedicated, his future need collective research decision, I have this purpose or early preparation, early training, preparing for the next season." Li Zhike said. To retain Jeter Beasley who also said that Beasley is a bad boy on the basketball season, Shandong high speed double foreign aid Jeter averaged 27.5 points and 5.6 assists, Beasley averaged 31.9 points and 3.8 assists, but the number of mistakes of Beasley is up to 4 times. For the performance of the two, "before the season, Jeter ready well, Beasley do ideological work well. Beasley left Ji’nan yesterday, we two people communicate, Beasley I think I have made great progress in Shandong play, matured a lot, now has been recognized by the NBA team." Li Zhike even joked that "his contribution has been proved that he is a hero for Shandong fans, the team has a strong sense of responsibility, is now the" good sir, "who will call you a" bad boy" 山东总经理：全力挽留双外援 主帅凯撒去留未定 齐鲁网济南2月22日讯 (记者 徐凯华 实习记者 李晓琳) 本赛季CBA对于山东高速男篮而言已经落下帷幕。关于球队的调整备受齐鲁球迷关注，对于比斯利和杰特的去留，山东高速男篮总经理李志科接受齐鲁网专访时候这样表态，“二人的表现不错，如果没有意外，俱乐部会全力挽留杰特和比斯利，让他们继续在山东队效力。” 凯撒去留未定 还需开会研究 28胜10负的战绩，列常规赛第五，比上个赛季提升了10个胜场，在这28场胜利中，包含了对18支球队的胜利，广东、辽宁、新疆、北京、四川、广厦等实力强劲的对手都曾被山东队击败，对此，高速男篮总经理李志科也表示，“球队的面貌变了，教练员、球员和俱乐部三方面拧成一股绳，也进入了季后赛，只是最后0-3出局有些无奈。” 山东高速男篮季后赛被广东宏远轻松地3-0击败出局，“去年的赛季准备还是有些仓促，国家队集训的球员和外援到队时间晚，外籍教练更重视队员休息、思想放松和开放式管理，俱乐部也协助提出了一些要求，包括训练强度等方面吧。”李志科表示。 常规赛成绩不错，季后赛成绩不尽如人意，其实联赛打到最后，队员的体能储备出现了短板。从数据来看，山东队的篮板球和防守做得一般，“体能需要加强，可以说出现了一些问题，联赛打到最后我们的技战术已经被其它球队摸透了，毕竟比斯利和杰特在我们队中的作用大家都很清楚，所以说我们有些后劲不足。” 高速男篮主帅凯撒去年四月份开始执教山东高速男篮，对于球队尽心尽责，当初，外教凯撒与山东高速男篮签约一年，如今眼看就要到期，“凯撒十分敬业，他的去留还需要集体研究决定，我们今年的宗旨还是提早准备，提早开练，备战好下赛季。”李志科说。 全力挽留杰特比斯利 谁还说比斯利是坏孩子 上赛季，山东高速男篮双外援杰特场均27.5分5.6次助攻，比斯利场均31.9分3.8次助攻，但比斯利的失误数较多达到4次。对于二人的表现，“赛季之前，杰特就准备得很不错，比斯利的思想工作做得很到位。比斯利昨天离开济南，我们两人交流时候，比斯利本人也认为自己这次在山东打球取得了很大进步，成熟了很多，如今已经得到了NBA球队的认可。”李志科甚至开着玩笑说，“他的作用和贡献已经得到证明，他是山东球迷心中的英雄，对于球队的责任心很强，现在已经是‘好先生’，谁还称呼你是‘坏小子’?” 对于杰特和比斯利的去留，“我的意见还是全力挽留，纵观联赛，比斯利是好外援，杰特很了解球队，人品非常好，跟大家关系也很融洽，下赛季好好调整一下，我们的外援配置不差。”李志科表示，“当然，这都需要主教练的最终决定。” 丁彦雨航数据下滑事出有因 陈世念或将离队 本赛季，内线鲨鱼陶汉林常规赛场均登场29.4分钟得到14.7分、7.1个篮板，创下了生涯新高，“陶汉林很刻苦，任劳任怨，这个赛季他的技术成长也很大，自信心方面更足了，和比斯利、杰特的配合很娴熟。”李志科表示。 球队本土核心丁彦雨航受到伤病困扰，本赛季场均只能得到9.7分，“很多时候(小丁)是带病上场，感冒、发烧、脚部海有伤，他很想帮助球队，数据下滑有很多客观原因，可能很多球迷也不是很清楚，小丁是顶着伤病在打球，很不容易。” 上赛季开始前，加盟山东高速男篮的内援杨力，场均2.7分，得到了普遍认可，“他的敬业和人品在队内饱受好评，经常提前一个小时到场地加练，他现在已经融入球队，而且当初签的是两年合同，杨力下赛季会继续留在山东队。” 在山东男篮效力两个赛季的宝岛台湾后卫陈世念昨天也离开了济南，“昨天(陈世念)走的时候，我还跟他说他是非常职业的球员，无论是场下做人还是场上打球，各方面都非常优秀，这两年在山东队起到了表率作用，他是否继续留下由主教练来定夺。”不过从记者目前得到的消息来看，陈世念不会留队。 助威歌曲征集结束 将开始投票环节 上赛季，山东高速男篮俱乐部与山东广播电视台齐鲁网一同举办助威歌曲(音频)征集活动，目前已经落下帷幕。 本次活动截至2月15日共收到110件助威歌曲(音频)，齐鲁网与高速男篮将会从中选出优秀作品进行微信投票，详情关注齐鲁网微信（微信号：qiluwang）。 “助威歌曲征集这件事，我们就是想通过这个桥梁和纽带，让山东球迷和高速男篮更紧密的联系在一起，大家是一家人，一个赛季结束了，感谢大家对于高速男篮的支持。”李志科表示，“下赛季第一场主场的CBA比赛，我们会进行现场颁奖，万元现金也会送出。”相关的主题文章： | Mid | [
0.543417366946778,
24.25,
20.375
] |
How to Help Language Impaired Students Improve their Leisure Skills Do you have students on your caseload who have very limited leisure skill interests? Are these students often left out of group activities at school and in the home environment? When our students do not engage in play/ leisure activities they are missing out on a natural way to work on language instruction. Read the following article, a guest post by Rosemarie Griffin from ABA Speech, to help your students increase their functional language and leisure skills: Leisure skills can be addressed in a variety of ways in clinic or school based settings. If you have a student who receives direct individual therapy, you could work on a specific leisure skill during therapy and generalize it to a larger group, when the student is able to engage in the skill with minimal prompts from an adult. Another way to target leisure skill instruction would be to teach a specific leisure skill (i.e. modified musical chairs) to a small group of students. It is important whether you are teaching the skill in an individual or small group session that the students know exactly how to engage in the skill. There are many evidenced based strategies, but we will focus on the skill of video modeling. Video modeling is a mode of teaching that uses video recording. The video recording acts as a visual model of the targeted skill or behavior. It can take many forms. The video can be of the student engaging in the skill or it can be of another individual engaging in the skill. The learner watches the video and then they perform the skill in the moment or at a later time. For example, if you are teaching students to play UNO® as a modified game; you could make a video of students playing this game the modified way ( i.e. matching just the color cards or playing minus the skip, reverse, wild and draw two). You would show the video to the students learning the game and then have them play the game. There is a lot of research that supports using this strategy to teach skills to individuals with autism and other disabilities. Below I will describe 2 modified leisure activities that I use with my middle school and high school students. A favorite of game of my students happens to be UNO®. There are 2 ways to modify UNO® based on the level of learner you have in your group. For early learners, you can lay out one card of each color on the table ( yellow, red, green, blue) and put the other cards face down. You each take a turn picking a card and matching it to the cards on the table. If your students are ready for more of a challenge you can play uno the regular way but without the skip, reverse, wild and draw two cards. This is such a popular game and one that many families have at home. It would be great to work on this at school and let the parents know about all of the work that you have done. Playing UNO® at home would be a wonderful way for your student to spend quality time with his family, while generalizing this leisure skill to new people and new environments. Another game that many of my students enjoy is playing Scrabble®. We each pick seven tiles and take turns making words on the board. The modification is that the words do not have to be connected in any way. This is what makes Scrabble® so difficult! I allow the students to make a word anywhere that they want on the board. If you have a student in the group who is having difficulty making a word on their own, grab a dry erase board and write down a word for them that they could make with their tiles. They can pick the tiles and match them to the word and transfer to the board. Viola a wonderful way to enjoy a cooperative group activity with students of varying ability levels. Being able to participate in age appropriate leisure skills gives students the opportunity to practice social language skills and helps them to feel more included with peers and their family members. Working on leisure skills can be enjoyable for all; I hope that these strategies will help you incorporate this instruction into your therapeutic practice. Rosemarie Griffin is a speech language pathologist, board certified behavior analyst and product developer. She is the creator of the Action Builder Cards. To learn more about modified leisure skills or to gather information about using applied behavior analysis to help students increase their communication skills, check out her website www.abaspeech.org or like her Facebook page here: ABA SPEECH ON FACEBOOK. Ms. Gardenia on Instagram Notice This website or its third-party tools use cookies, which are necessary to its functioning and required to achieve the purposes illustrated in the cookie policy. If you want to know more or withdraw your consent to all or some of the cookies, please refer to the Cookie Policy. By closing this banner, scrolling this page, clicking a link or continuing to browse otherwise, you agree to the use of cookies. By using our site, you acknowledge that you have read and understand our Cookie Policy, Privacy Policy, and our Terms of Service. Your use of this site's Products and Services are subject to these policies and terms. | High | [
0.7062146892655361,
31.25,
13
] |
Introduction {#s1} ============ *Xist* is a 17 kb long noncoding RNA that acts through specific interactions between its distinct RNA domains and nuclear effector proteins. The *Xist* RNA-associated protein complex was identified in 2015 using both genetic and affinity-based methods, and consists of multiple pleiotropic proteins, many of which are highly conserved throughout evolution and act on chromatin structure and gene regulation in myriad systems ([@bib2]; [@bib7]; [@bib36]; [@bib37]; [@bib40]; [@bib39]). This suggests that *Xist* evolved the ability to bind these proteins in the eutherian mammals, coopting those which evolved initially to perform other epigenetic functions. *Xist* evolved in the eutherian clade through exaptation of a combination of coding genes that were pseudogenized, as well as transposable elements (TEs) that inserted into this locus. *Xist* contains six tandem repeat regions (A-F), all of which show sequence similarity to TEs, suggesting they arose from eutheria-specific TE insertions ([@bib12]). One of these is the A-repeat, which is essential for gene silencing. When this \~500 bp region is deleted, *Xist* RNA coats the X chromosome, but silencing and reorganization of the X does not follow ([@bib54]; [@bib15]). The A-repeat sequence is thought to derive from the insertion and duplication of an endogenous retrovirus (ERV), a class of TEs present in many copies throughout the genome ([@bib12]). In general, lncRNAs are not well-conserved compared to protein-coding genes but are enriched for TE content, suggesting they may be able to rapidly evolve functional domains by exapting protein- and nucleic acid-binding activity from entire TEs that colonize their loci ([@bib20]; [@bib23]). Understanding how the *Xist* RNA sequence was evolutionarily stitched together from these existing building blocks to gain protein-binding potential is of great interest towards understanding dosage compensation and lncRNA-mediated gene regulation genome-wide. Spen (also known as SHARP, MINT) is a \~ 400 kDa *Xist* RNA binding protein (RBP) that contains four canonical RNA binding domains, as well as a SPOC domain to facilitate protein-protein interactions. Spen is a co-repressor that binds to several chromatin remodeling complexes, including histone deacetylases (HDACs), and the NuRD complex ([@bib36]; [@bib46]). Though now recognized for its central role in the eutherian-specific XCI process, Spen is an ancient protein that plays roles in gene repression during development in species including *Drosophila *and *Arabidopsis*, in addition to mice and humans ([@bib46]; [@bib55]; [@bib24]; [@bib53]; [@bib3]). Spen binds directly to the A-repeat of *Xist* RNA and *Spen* inactivation abrogates silencing of multiple X-linked genes, suggesting that the RNA-protein interaction between the A-repeat and Spen is an early and essential step in XCI ([@bib7]; [@bib36]; [@bib40]; [@bib31]). Results {#s2} ======= To test the effect of Spen loss on gene regulation and chromosome accessibility during XCI and genome-wide during development, we performed ATAC-seq ([@bib6]) in haploid mouse embryonic stem cells (mESCs) harboring a doxycycline-inducible *Xist* transgene either in the wild-type (WT) context or with a full deletion of *Spen* (*Spen* KO) ([@bib40]; [Figure 1a](#fig1){ref-type="fig"}). Following 48 hr of *Xist* induction, WT cells demonstrated loss of chromatin accessibility at the majority of loci on the X chromosome ([Figure 1b--c](#fig1){ref-type="fig"}; [Figure 1---figure supplement 1a,b](#fig1s1){ref-type="fig"}). In two independent *Spen* KO mESC clones, we found no X chromosome site that is reproducibly silenced upon *Xist* induction, suggesting that Spen is absolutely required for gene silencing at the level of chromatin accessibility ([Figure 1---figure supplement 1b](#fig1s1){ref-type="fig"}). This complete failure of XCI, combined with Spen's direct binding to the A-repeat region ([@bib7]; [@bib36]; [@bib40]), confirms that Spen's recruitment to the inactivating X chromosome is early and essential for XCI ([@bib10]; [@bib41]). {#fig1} Despite recent focus on Spen's role in XCI, Spen is an ancient protein that is known to act as an important RNA-protein scaffold in developmental processes in many species ([@bib46]; [@bib55]; [@bib24]; [@bib53]; [@bib3]). Thus, how *Xist* evolved the ability to recruit Spen is of great interest. We hypothesized that understanding Spen's role in autosomal gene regulation and its target specificity might lend clues into how Spen was exapted to participate in the Eutherian-specific process of XCI ([Figure 1a](#fig1){ref-type="fig"}). Comparison of ATAC-seq data in WT and *Spen* KO mESCs revealed 288 sites on the autosomes that gain accessibility in two clones of *Spen* KO mESCs, compared to only 147 sites that lose accessibility ([Figure 1d](#fig1){ref-type="fig"}). This observation is consistent with chromatin de-repression in the absence of Spen's repressive function. The DNA elements that were more accessible in *Spen* KO mESCs are almost all distal to transcriptional start sites (TSS), in contrast to unchanging peaks and those that are less accessible, which encompassed both promoters and distal sites ([Figure 1---figure supplement 1c](#fig1s1){ref-type="fig"}). This indicated that DNA elements regulated by Spen on the autosomes are not found at gene promoters, but rather are found in heterochromatic, gene-poor regions. To better understand Spen's autosomal targets, we performed genome ontology enrichment for the sites that are de-repressed in *Spen* KO mESCs using HOMER. While the set of sites confidently gaining accessibility in both *Spen* KO clones is relatively small, it showed a striking enrichment for TE-derived long terminal repeat (LTR) elements ([Figure 1e](#fig1){ref-type="fig"}; [Figure 1---figure supplement 1d](#fig1s1){ref-type="fig"}). When we looked more closely at subsets of these annotations, we found an enrichment specifically for endogenous retrovirus K (ERVK) TEs in these sites, which is reproduced in two independent *Spen* KO clones ([Figure 1f](#fig1){ref-type="fig"}). These ERVKs are enriched specifically for LTR elements in the RLTR13, RLTR9, and early transposon (ETn) families ([Figure 1f](#fig1){ref-type="fig"}). ERV-derived sequences in the genome have recently been shown to play important roles in genome regulation in embryonic cell types, serving as binding sites for transcription factors, indicating that Spen loss may activate ectopic regulatory regions ([@bib4]; [@bib16]; [@bib33]). Because sequencing reads coming from TEs in the genome do not map uniquely, it is difficult to accurately quantify reads coming from a given ERV subfamily while also mapping them to the correct element. We thus mapped ATAC-seq reads to the genome, while either keeping only uniquely mapping reads, or allowing multi-mapping reads to randomly map to one location. Both of these methods revealed the same trend, demonstrating the de-repression of a subset of ERVK elements in *Spen* KO mESCs ([Figure 1g](#fig1){ref-type="fig"}). The observation that TE-derived elements were activated in *Spen* KO mESCs was intriguing, given that the A-repeat region of Xist is itself believed to be derived from an ancient TE insertion ([@bib12]). It has been posited that TEs, upon insertion into pseudogenes or non-coding loci may contribute functional protein-binding domains to noncoding RNAs ([@bib20]). Indeed, noncoding RNAs, including Xist, are enriched for TE content ([@bib23]). Furthermore, it is known that in a very distantly related species, the model plant *Arabidopsis*, the Spen homologs *fca* and *fpa* bind to and regulate transcription of TEs in the genome ([@bib3]). Therefore, Spen's ability to regulate a subset of ERVK families may explain Spen's ability to recognize the A-repeat and interact directly with it. In mESCs, the majority of TEs, including ERVKs, are silenced by histone H3 lysine nine trimethylation (H3K9me3). When members of the TE silencing machinery, such as Kap1 and Setdb1, are inactivated, H3K9me3 is lost, and these TE insertions can be expressed and function as ectopic promoters and enhancers ([@bib34]; [@bib43]; [@bib22]; [@bib29]). We hypothesized that in the absence of Spen and its protein partners, these ERVKs would lose H3K9me3 and gain histone modifications associated with active gene expression ([@bib59]; [@bib36]; [@bib46]). Indeed, ChIP-seq experiments revealed that DNA elements gaining accessibility in *Spen* KO showed a dramatic loss of H3K9me3 and a gain of both histone H3 lysine 27 acetylation (H3K27Ac) and histone H3 lysine four trimethylation (H3K4me3) marks ([Figure 2a,b](#fig2){ref-type="fig"}; [Figure 2---figure supplement 1a--c](#fig2s1){ref-type="fig"}). Conversely, H3K9me3 peaks that are lost in *Spen* KO mESCs are enriched for ERVKs, and sites that gain the enhancer mark H3K27Ac are enriched for ERVKs including ETn elements ([Figure 2c,d](#fig2){ref-type="fig"}; [Figure 2---figure supplement 1d--f](#fig2s1){ref-type="fig"}). This demonstrates that at the level of chromatin modifications, a subset of ERVK elements are de-repressed when Spen is lost in mESCs. To test whether these ERVK elements are upregulated at the level of transcription, we performed RNA-seq in WT and *Spen* KO mESCs ([Figure 2---figure supplement 1a,e](#fig2s1){ref-type="fig"}; [Figure 2---figure supplement 2a--c](#fig2s2){ref-type="fig"}). At the RNA level, the ERVK elements that gain accessibility also have higher expression in *Spen* KO mESCs ([Figure 2b,e](#fig2){ref-type="fig"}; [Figure 2---figure supplement 1a](#fig2s1){ref-type="fig"}). Genome-wide there is a very small increase in expression of all ERVKs, particularly the class of ETnERV2s, indicating that only a subset of these families are affected by the loss of Spen in mESCs ([Figure 2f,g](#fig2){ref-type="fig"}). This is true using our multimapping read assignment strategy, as well as a published method for TE mapping, MMR ([@bib21]; [Figure 2---figure supplement 1g--i](#fig2s1){ref-type="fig"}). {#fig2} Retrotransposons are parasitic elements whose insertion and propagation in cells depletes cellular resources and disrupts endogenous gene expression. In order for the cell to handle these parasitic elements, pathways have evolved to shut down these transposons at the level of the DNA locus and the RNA transcript. ERVK insertions that are more similar to the original TE sequence pose more of a threat to cells, as they are more likely to be mobile and able to replicate. Thus, we compared the sequence diversity of the ERVKs upregulated in S*pen* KO to those not upregulated in *Spen* KO, and found that those repressed by Spen have diverged less than those that are not repressed by Spen ([Figure 2h](#fig2){ref-type="fig"}). The lower diversity indicates that Spen targets more recent ERVK insertions. Furthermore, we found that genes involved in the innate cellular immunity pathway, which responds to retroviral RNA presence, are modestly upregulated in *Spen* KO mESCs ([Figure 2---figure supplement 2d](#fig2s2){ref-type="fig"}). These data suggest that Spen represses young, more intact ERVKs, and when Spen is inactivated, the cell responds to the presence of those RNA transcripts to attempt to silence them. TE insertions are enriched for transcription factor binding motifs, and it has been suggested that insertion of many elements of the same family within the genome may have led to the evolution of transcription factor-based regulatory networks ([@bib4]; [@bib50]; [@bib51]). ERVK, and more specifically ETn, elements are enriched for binding sites for Oct4, one of the most critical transcription factors for regulation of the pluripotent state ([@bib4]; [@bib44]). Oct4 plays a critical role in balancing the expression of pro-self renewal and pro-differentiation genes in mESCs. We find that the Oct4 binding motif is enriched at DNA elements gaining accessibility in *Spen* KO mESCs, and Oct4 occupancy increases at these loci as shown by ChIP-seq ([Figure 2a](#fig2){ref-type="fig"}). The ability of this core stemness factor to bind to these TE elements suggests that their misregulation in *Spen* KO mESCs may affect the self-renewal or differentiation programs within these cells. GO term analysis revealed that genes downregulated in *Spen* KO mESCs are enriched for early developmental terms, indicating that these cells may be deficient in early lineage commitment ([Figure 2---figure supplement 2e--f](#fig2s2){ref-type="fig"}). We found that *Spen* KO mESCs downregulated specific genes associated with early differentiation and upregulated genes associated with self-renewal ([Figure 2---figure supplement 3a](#fig2s3){ref-type="fig"}). Because the balance in the pluripotency transcriptional network is disrupted in *Spen* KO mESCs, we hypothesized that differentiation may be blocked. To test whether *Spen* KO mESCs can spontaneously differentiate when deprived of self-renewal signals, we removed leukemia inhibitory factor (LIF) from the media and allowed cells to grow for 6 days. After 6 days, WT mESCs downregulated pluripotency factors such as Oct4 and expressed early differentiation markers such as Nestin. In contrast, *Spen* KO mESCs maintained Oct4 expression and mESC morphology despite LIF removal ([Figure 2---figure supplement 3b,c](#fig2s3){ref-type="fig"}). We then tested whether *Spen* KO mESCs can be directed to differentiate toward the neurectoderm fate, by driving differentiation toward neural progenitor cells. After 14 days of differentiation, WT cells express Nestin and have NPC morphology while *Spen* KO mESCs do not ([Figure 2---figure supplement 3d](#fig2s3){ref-type="fig"}). Furthermore, we observed massive cell death during *Spen* KO mESC differentiation, finding that by day 10 of directed differentiation, 100% of cells were no longer viable ([Figure 2---figure supplement 3e](#fig2s3){ref-type="fig"}). These results support the results from RNA-seq that suggest that Spen loss leads to a failure to differentiate past the pluripotent state. We next asked whether Spen represses ERVK loci directly or indirectly. Though we observe changes in chromatin accessibility and covalent histone modifications at these loci when Spen is knocked out, Spen is an RBP that does not bind to chromatin directly. We hypothesized that Spen may recognize *ERVK* RNAs transcribed at these TE loci and recruit chromatin silencing machinery to them, performing a surveillance role against aberrant transcription of these parasitic elements. Thus if Spen is regulating these ERVK loci directly, we would expect that regulation to be RNA-dependent ([Figure 3a](#fig3){ref-type="fig"}). {#fig3} To test this, we performed infrared crosslinking immunoprecipitation followed by sequencing (irCLIP-seq), which allows for identification of direct RBP binding sites on RNA ([@bib57]). Because of Spen's large size (\~400 kDa) and the lack of highly specific antibodies to it ([Figure 3---figure supplement 1a,b](#fig3s1){ref-type="fig"}), we expressed a FLAG-tagged version of the Spen RNA binding domains (RRM2-4) for irCLIP-seq. We also compared irCLIP-seq data performed using an antibody against the endogenous, full-length Spen protein, despite the higher level of non-specific signal in those experiments ([Figure 3---figure supplement 1a,b](#fig3s1){ref-type="fig"}; [@bib32]). RRMs 2--4 were shown to be bona fide RNA binding domains, with RRM3 specifically required for binding to known Spen binding partner *SRA* RNA in vitro ([@bib1]). We expressed tagged Spen RRM2-4 in both *Spen* KO mESCs, which express *Xist* upon doxycycline treatment, and in WT male V6.5 mESCs, which do not express *Xist*, but do express *ERVs*. Following UV crosslinking of RNA and protein complexes in vivo, we isolated RRM2-4-bound RNAs using an anti-FLAG antibody and prepared libraries from the isolated RNA. On mRNAs and lncRNAs, we detected Spen RRM2-4 binding at 29,625 sites (irCLIP-seq clusters), on a total of 4732 transcripts ([Figure 3b,c](#fig3){ref-type="fig"}; [Supplementary file 1](#supp1){ref-type="supplementary-material"}). Compared to other RBPs, Spen binds relatively very few RNAs in irCLIP-seq ([Figure 3d](#fig3){ref-type="fig"}). *Xist* was the top bound gene, with much higher binding strength than other RNAs, consistent with its known interaction with the A-repeat region of *Xist* and role in XCI ([@bib7]; [@bib36]; [@bib37]; [@bib40]; [@bib39]; [@bib10]; [@bib41]; [Figure 3d](#fig3){ref-type="fig"}). Spen RRM2-4 binds specifically to the A-repeat monomers as reported for full-length and truncated Spen ([Figure 3e](#fig3){ref-type="fig"}; [Figure 3---figure supplement 1c](#fig3s1){ref-type="fig"}; [@bib31]; [@bib32]; [@bib1]). This confirmed that our FLAG-tagged RRMs bind Spen's RNA targets in vivo. In addition to *Xist*, Spen binds to several mRNAs, one of which is the *Spen* mRNA itself ([Figure 3d,f](#fig3){ref-type="fig"}). This is consistent with our observation that loss of Spen protein leads to upregulation of *Spen* mRNA expression, suggesting that the Spen protein represses its own RNA output in *cis*. To assess whether Spen RRM2-4 binds directly to ERVK-derived RNA, we mapped irCLIP-seq data to TEs in the genome. Because irCLIP-seq reads are short and single ended and thus less likely to map uniquely to these repetitive elements, we mapped reads only to the elements that are expressed in our RNA-seq data. We detected a total of 7812 irCLIP-seq clusters on TE RNAs (20% of total clusters detected), covering 2267 individual TEs ([Figure 3b,c](#fig3){ref-type="fig"}). Of these, we detected RRM2-4 binding at 442 LTRs and 208 ERVKs. The TE subfamily with the greatest number of bound elements is the MMETn-int family, a member of the ETn class ([Figure 3g,h](#fig3){ref-type="fig"}). In addition, RLTR13G and ETnERV-int showed a large number of elements bound as well as a high percentage of total genomic elements bound ([Figure 3g,h](#fig3){ref-type="fig"}). RRM-bound elements within these families show modestly increased RNA expression in Spen KO mESCs, consistent with Spen binding contributing to repression of these sites ([Figure 3i--k](#fig3){ref-type="fig"}). These *ERV* RNAs are bound by RRM2-4 as well as full-length Spen ([Figure 3---figure supplement 1d--f](#fig3s1){ref-type="fig"}; [Figure 3---figure supplement 2a,b](#fig3s2){ref-type="fig"}). The specificity of RBP binding to its RNA targets may have a structural and/or sequence basis. In order to understand whether Spen binds to the A-Repeat and *ERV* RNAs in the same manner, we first investigated the sequence features in Spen-bound mRNAs, lncRNAs, and ERVs. We found that RRM2-4 binding sites on mRNA and lncRNAs, as well as ERVs, are enriched for AU content, but did not find any longer, more complex motifs shared amongst the classes. Furthermore, we did not find sequences that showed strong homology to the highly conserved A-Repeat regions ([Figure 3---figure supplement 3a--c](#fig3s3){ref-type="fig"}). This was perhaps not surprising, as [@bib1] previously showed that Spen's recognition of the *SRA* lncRNA is largely dictated by RNA secondary structure, not sequence, with Spen binding to a flexible, single stranded region adjacent to a double stranded region. We asked whether Spen RRMs bind to a similar structural feature in the A-Repeat and in *ERV* RNAs. Spen has previously been reported to bind to the junction between a single stranded loop and a duplex formed by multiple A-Repeat monomers interacting in three dimensions ([@bib31]), a structure that is similar to Spen's binding site within SRA ([@bib1]). Upon closer examination of icSHAPE data, which determines whether RNAs are single (high icSHAPE reactivity score) or double stranded (low icSHAPE reactivity score) in vivo ([@bib48]), we found that the A Repeat region of *Xist* consists of a hairpin that contains a small bulging single stranded region, flanked by two larger single stranded loops ([Figure 4a--e](#fig4){ref-type="fig"}). Both the Spen RRMs and the full length Spen bind to the conserved single stranded regions directly adjacent to the double-stranded hairpin and to the small bulge within the hairpin ([Figure 4a--e](#fig4){ref-type="fig"}). ![Spen RRMs recognize a common structural feature in A-Repeat and *ERV* RNA.\ (**a**) irCLIP-seq signal from full-length Spen ([@bib21]) across the 8 *Xist* A-repeats. Signal for each repeat is stacked across the conserved repeat region. (**b**) Same as in a for RRM2-4 irCLIP-seq. (**c**) icSHAPE reactivity scores for each of the *Xist* A-repeats performed in vitro. Signal for each repeat is stacked across the conserved repeat region. (**d**) Phylo-P scores across the A-repeats, showing conservation of repeat sequence at the RRM2-4 binding sites. (**e**) Structural model for Xist A-repeats 4 and 5 which form a hairpin structure. Structural prediction is supported by icSHAPE data. At each nucleotide, the RRM2-4 irCLIP-seq signal strength is plotted as a bar for each repeat (in color). (**f**) irCLIP-seq signal (top, black) and icSHAPE reactivity scores (bottom, gray) for the consensus sequence of RLTR13G elements. Included are elements for which we have both confident RRM2-4 binding and icSHAPE data. (**g**) Same as in f for ETnERV. (**h**) Same as in f for MMETn-int. (**i**) Structural model for ETnERV. Structural prediction is supported by icSHAPE data. At each nucleotide, the RRM2-4 irCLIP-seq signal strength is plotted as a bar.](elife-54508-fig4){#fig4} To test whether Spen RRMs bind a similar structural motif in *ERVK* RNAs, we analyzed icSHAPE data within repeat regions of the genome ([@bib49]). For LTR families for which we had enough loci that are both bound by RRMs and have icSHAPE signal, (RLTR13G, ETnERV, MMETn) we found that Spen binding occurs within short single stranded regions adjacent to double stranded regions ([Figure 4f--h](#fig4){ref-type="fig"}). This is consistent with a model where Spen RRMs bind to single-stranded bulges within larger duplexes in *ERVK* RNAs ([Figure 4i](#fig4){ref-type="fig"}; [Figure 4---figure supplement 1a,b](#fig4s1){ref-type="fig"}). Taken together, this demonstrates that Spen RRMs bind to the A-repeat of *Xist* and to *ERVK* RNAs in the same manner, recognizing a specific structural feature in the RNA. Though irCLIP-seq provides a transcriptome-wide map of Spen RRM-RNA binding, we wanted to understand in even more depth the specificity and strength of the interaction between the Spen RRMs and *ERVK* RNAs. We hypothesized that if Spen binds *ERVK*s and the A-Repeat with the same structural recognition mechanism, it should bind with similar affinity and in a competitive manner. We used fluorescence anisotropy experiments to measure the binding affinity of Spen RRMs 2--4 to *ERV* RNA elements as well as the *Xist* A-repeat and the *SRA* RNA H12H13 hairpin, two known interactors of Spen ([@bib7]; [@bib36]; [@bib31]; [@bib1]). We also measured binding of a version of the Spen RRMs that has five point mutations in RRM3 (RRM3 Mt), which was previously shown to diminish binding of Spen to SRA ([Figure 4---figure supplement 2a](#fig4s2){ref-type="fig"}; [@bib1]). Using in vitro irCLIP RNA isolation, we found that the RRM3 Mt binds \~50% less RNA than RRM2-4 confirming these residues are essential for Spen RNA binding ([Figure 4---figure supplement 2b--f](#fig4s2){ref-type="fig"}). Using fluorescence anisotropy, we found that the binding affinity of Spen RRM2-4 for our *ERV* transcripts and the *Xist* A-Repeat are similar (dissociation constant *K~D~* = 53 nM\~140 nM), and higher than the affinity of Spen RRM2-4 for the *SRA* hairpin (K~D~ = 450 nM) ([Figure 5a,b](#fig5){ref-type="fig"}). The binding affinity of the RRM3 Mt is about half that of the RRM2-4 for both *Xist* A-repeat and the *ERV* RNAs, suggesting that the same residues of Spen's RRM3 domain are binding both *Xist* A-repeat and *ERV* RNAs ([Figure 5b](#fig5){ref-type="fig"}; [Figure 4---figure supplement 2g](#fig4s2){ref-type="fig"}). Finally, we found that an unlabeled *ERV* RNA competed with a labeled *Xist* A-repeat for binding to Spen RRM2-4, further demonstrating that Spen recognizes these two RNAs, in part, through the same binding domain and in a very similar manner ([Figure 5c](#fig5){ref-type="fig"}). These data, taken with our irCLIP-seq data, show that Spen binds to ERVK-derived RNA in the nucleus and does so via the same binding mechanism and with the same strength as it binds the A-Repeat of *Xist*. This supports a model in which Spen directly represses ERVK loci in the genome by recognizing their RNA transcripts through their secondary structures. {#fig5} Collectively, these results show that Spen's RNA binding domains bind TE-derived RNA in mESCs and do so via the same mechanism that they bind *Xist* RNA, with a significant contribution from the RRM3 domain. The observation that the A-repeat may be derived from an ancient ERV insertion ([@bib12]), which shows structural similarity to the ERV elements bound by Spen, suggests that *Xist* evolved its ability to recruit Spen via Spen's recognition of ERV sequence and subsequent recruitment of repressive complexes. Spen itself has evolved relatively little throughout evolution from fish to humans, and Spen's RNA binding domains show no evidence of branch-specific evolution in the eutherian clade ([Figure 6---figure supplement 1](#fig6s1){ref-type="fig"}). Thus a mechanism in which the *Xist* RNA itself evolved toward Spen's functionality is fitting. We reasoned that if the *Xist* A-repeat region evolved via the insertion of a TE that had affinity for Spen into the proto-*Xist* locus, then the insertion of an ERV element into *Xist* may be able to complement the A-repeat deletion of *Xist*. We would expect that this chimeric *Xist-ERV* would be able to 1) recruit and bind to Spen and 2) silence X-linked genes in cis ([Figure 6a](#fig6){ref-type="fig"}). To test this hypothesis, we utilized a male (XY) mESC line that harbors both a doxycycline inducible *Xist* gene on the X as well as a deletion of the A-repeat region (Xist-ΔA) ([@bib54]). While induction of *Xist* by doxycycline treatment in the WT male mESCs (Xist-WT) leads to silencing of the single X chromosome, *Xist* expression in Xist-ΔA mESCs has no effect on X chromosome gene expression or accessibility ([@bib54]; [@bib15]). We used CRISPR-Cas9 genome editing to insert a 9x array of a 154 bp ERV-derived Spen binding site from chromosome 16 into the X chromosome where the A-repeat has been deleted in Xist-ΔA mESCs (Xist-ERV) ([Figure 6---figure supplement 2a--c](#fig6s2){ref-type="fig"}). We chose a 9x array of binding sites because the A-repeat region of *Xist* consists of 8.5 repeats in human and 7.5 repeats in mouse, which fold into a complex secondary structure with multiple Spen binding sites ([@bib31]; [@bib38]). Furthermore, the addition of monomers of the A-repeat up to nine repeats in an A-repeat knockout background leads to a linear increase in chromosome silencing capacity ([@bib54]; [@bib38]). {#fig6} We first asked whether *Xist-ERV* is able to bind directly to and recruit Spen. To do this, we expressed the FLAG-tagged Spen RRM2-4 in our cell lines containing Xist-WT, Xist-ΔA, or Xist-ERV transgenes (two independent clones), and measured *Xist*-RRM binding under optimized expression conditions (more below), by RIP-qPCR. We found that *Xist-ERV* is bound by Spen RRM2-4, similar to *Xist-WT* and in contrast to *Xist-ΔA* which could not bind Spen ([Figure 6b](#fig6){ref-type="fig"}). Next, when we quantified the ability to induce *Xist-ERV* expression with the addition of doxycycline, we were surprised to find that expression of *Xist-ERV* could not be induced, in comparison to *Xist-WT* and *Xist-ΔA* ([Figure 6c](#fig6){ref-type="fig"}). Genetic analysis confirmed that the Tet operator and CMV promoter were intact in all of our *Xist-ERV* clones ([Figure 6---figure supplement 2d](#fig6s2){ref-type="fig"}), suggesting that the lack of gene induction may be due to epigenetic silencing recruited by Spen. To test whether the inability to induce *Xist-ERV* expression was due to silencing in cis, we treated cells with an HDAC1/2 inhibitor (HDAC1/2i) or an HDAC3 inhibitor (HDAC3i) for 24 hr before *Xist* induction. We found that both HDAC1/2i and HDAC3i de-repressed the transgene and *Xist-ERV* was expressed ([Figure 6c](#fig6){ref-type="fig"}; [Figure 6---figure supplement 2e--h](#fig6s2){ref-type="fig"}). To test whether this *Xist-ERV* silencing was Spen-dependent, we used siRNAs to knockdown Spen 24 hr prior to induction of *Xist* with doxycycline. We found that *Xist-ERV* expression was elevated in Xist-ERV clones 1 and 2 after Spen knockdown ([Figure 6d](#fig6){ref-type="fig"}). The rescue of *Xist-ERV* expression by Spen depletion was quite variable from experiment to experiment; addition of an inhibitor of HDAC3, which is recruited by Spen ([@bib59]; [@bib36]), made the Xist-ERV induction substantially more consistent and up to 20-fold in at least one clone ([Figure 6d](#fig6){ref-type="fig"}). This suggested that *Xist-ERV* recruits Spen, leading to local silencing of the *Xist* transgene in cis. Therefore, the insertion of an ERV-derived RNA motif into *Xist* is sufficient to partially substitute for the A-repeat, recruit Spen to the chimeric RNA, and mediate strictly local gene silencing in cis. This is the first demonstration of how a TE insertion during evolution could confer new functionality on a noncoding RNA, by introducing a new protein recruitment domain ([@bib20]). Finally, we tested whether this Spen recruitment by the *Xist-ERV* RNA is sufficient to lead to chromosome-wide silencing. We conducted these experiments in the presence of HDAC1/2 inhibition, which increases *Xist* induction but was previously shown not to affect silencing during XCI ([@bib59]). While expression of X-linked genes *Pgk1*, *Gpc4*, *Mecp2*, and *Rnf12* was reduced after *Xist* induction in Xist-WT cells, expression was unchanged upon expression of *Xist-ΔA* or *Xist-ERV* ([Figure 6---figure supplement 3a](#fig6s3){ref-type="fig"}). Thus, while the addition of the ETn array to an A-repeat-deficient *Xist* was sufficient to recruit Spen, it was not sufficient to carry out XCI. These experiments were conducted in the presence of HDAC1/2i, necessary to overcome Xist-ERV silencing of its own locus, but may also inhibit the chimeric RNA's silencing of distal loci. Furthermore, this could be due to the differences in levels of *Xist* that we are able to induce in this system, which are lower in the Xist-ERV cells than the Xist WT or Xist ΔA cells, even in the presence of HDAC1/2i. Nevertheless, our results are consistent with the hypothesis that insertion of an ERV element into the proto-*Xist* locus was an *early* evolutionary step in the functionalization of the A-repeat, but that additional rounds of evolution may have subsequently acted on this region of the genome in order to evolve *Xist*'s full functionality for silencing the entire chromosome over long genomic distance ([@bib12]; [@bib5]). Discussion {#s3} ========== Here we show that Spen, a highly conserved and pleiotropic RNA binding protein, binds to and regulates specific classes of ERVK loci in mouse embryonic stem cells. Spen represses these ERVK loci via a direct mechanism where it binds transcripts derived from these parasitic elements, and can then recruit its chromatin silencing protein partners. In the absence of Spen, these elements become derepressed, showing loss of repressive H3K9me3 and gain of active chromatin modifications. Sensing transposon silencing at the RNA level is attractive, as it provides a mechanism for the cell to identify the 'leaky' locus and target the silencing machinery to the locus in *cis*. These observations are striking when taken with the observation that the *Xist* RNA, which is also robustly bound by Spen, is derived from a number of ancient retroviral insertions ([@bib12]). We show direct evidence, for the first time, that an *Xist* binding protein can bind to ERV-derived RNA in vivo, and thus may have been recruited to *Xist* via the insertion of an ERV element into the proto-*Xist* locus ([Figure 6e](#fig6){ref-type="fig"}). This evidence supports the hypothesis that lncRNAs, which are evolutionarily young, may exapt TE-protein interactions in order to form functional protein binding domains ([@bib20]; [@bib23]; [@bib17]; [@bib19]). In effect, *Xist* lncRNA 'tricks' the female cell to perceive the inactive X chromosome as being coated by dangerous transposon RNAs. The cell can then deploy Spen, a transposon-silencing protein, to carry out X chromosome dosage compensation. One of the major mysteries of X inactivation is the *cis*-restriction of *Xist*, which only silences the chromosome from which it is expressed, a property critical for dosage compensation of two X chromosomes in females to one X in males. Our discovery of the link between Spen and transposon silencing suggests an ancient evolutionary origin for *cis* silencing. Spen sensing of *ERV* RNA and Spen-mediated silencing are *cis* restricted, and indeed grafting ERV into the *Xist* locus caused *cis* silencing of *Xist* RNA expression itself. Hence, these data suggest that the invasion of an ERV-like sequence into proto-*Xist* led first to RNA-based silencing in *cis*. Subsequent mutations in this proto-*Xist* may then have allowed this RNA to localize to and silence distal sites on the X chromosome. The transition from short to long range silencing in *cis* may be a fruitful topic in future studies. Materials and methods {#s4} ===================== ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Reagent type\ Designation Source or reference Identifiers Additional information (species) or resource ------------------------- ------------------------------------ --------------------- --------------------------------------------------------------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------------------------------- Gene (mouse) Spen RefSeq [NM_019763.2](https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Search&db=Nucleotide&term=NM_019763&doptcmdl=GenBank&tool=genome.ucsc.edu) Cell line (mouse) TXY WT and TXY deltaA Dr. Edith Heard Xist-WT and Xist-deltaA Cell lines have a doxycycline inducible Xist gene + / - the A repeat region Cell line (mouse) HATX WT and HATX Spen KO Dr. Anton Wutz WT, *Spen* KO KO cells have a deletion\ of the majority of the Spen gene. They also have a doxycycline inducible Xist transgene on the X chromosome Antibody Goat polyclonal\ Santa Cruz Sc-8629 7.5 ug/ChIP Anti-Oct4 Antibody Rabbit polyclonal\ Active Motif 39133 5 ug/ChIP Anti-H3K27Ac Antibody Rabbit polyclonal Anti-SHARP(Spen) Bethyl A301-119A Antibody to endogenous Spen Antibody Mouse monoclonal Anti-FLAG M2 Sigma F3165 Antibody against FLAG tag on Spen RRM2-4 Antibody Rabbit polyclonal Anti-H3K9me3 abcam AB8898 5 ug/ChIP Antibody Rabbit polyclonal Anti-H3K4me3 Active Motif 39159 5 ug/ChIP Sequence-baed reagent mXist 570 RNA FISH probe set Stellaris SMF-3011--1 125 nM concentration Commercial assay or kit Nextera DNA prep kit Illumina FC-131--1002 Used for ATAC-seq and for ChIP-seq library preparation. Chemical compound, drug HDAC1/2 inhibitor, BRD6688 Cayman Chemical 1404562-17-9 Inhibitor of\ HDAC1 and 2. Used at 10 uM. Chemical compound, drug HDAC3 inhibitor, RGFP966 Sigma SML1652 Inhibitor of HDAC3. Used at 10 uM. Sequence-based reagent Xist Primers Dr. Edith Heard 5'GCTGGTTCGTCTATCTTGTGGG3'\ 5'CAGAGTAGCGAGGACTTGAAGAG3' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cell lines and culture {#s4-1} ---------------------- HATX WT and Spen KO clone 2 and clone 3 cell lines were gift of A. Wutz and are described in detail in [@bib40]. TXY WT (Xist-WT) and TXY deltaA (Xist-ΔA) cell lines were gift of E. Heard. mESCs were cultured in serum/LIF conditions (Knockout DMEM (GIBCO 10829018), 1% Penicillin/streptomycin, 1% GlutaMax, 1%non-essential amino acids, beta-mercaptoethanol, Hyclone fetal bovine serum (Fisher SH3007103), and 0.01% LIF (ESGRO ESG1107). Cells were cultured on 0.2% gelatin-covered plates and passaged every 2--3 days with trypsin as needed. All cell lines tested negative for mycoplasma. *Xist* induction {#s4-2} ---------------- For *Xist* induction experiments, mESCs were plated at a density of 75,000 cells/well in a 6-well plate. 24 hr after plating, cells were treated with 2 ug/mL doxycycline for 48 hr (unless shorter or longer time is indicated in figure legend). Induction of *Xist* was confirmed using qPCR and *Xist* RNA FISH. qPCR primers used for Xist have the following sequences: Forward 5'GCTGGTTCGTCTATCTTGTGGG3' and Reverse 5'CAGAGTAGCGAGGACTTGAAGAG3'. HDAC inhibition experiments {#s4-3} --------------------------- For HDAC inhibition experiments, cells were treated with either HDAC1/2i (BRD6688, Cayman Chemical Company, 1404562-17-9) or HDAC3i (RGFP966, Sigma SML1652) at 10 uM final concentration. HDAC inhibition was initiated 24 hr prior to induction of *Xist* with doxycycline and continued for 24 hr during *Xist* induction (48 hr total). --HDACi samples were treated with DMSO as a control. *Xist* RNA FISH {#s4-4} --------------- Following *Xist* induction, adherent cells on coverslips were fixed using 4% paraformaldehyde for 10 min. Cells were permeablized in 0.5% triton for 10 min on ice and then stored in 70% EtOH. After dehydration in EtOH, cells were rehydrated in wash buffer (2xSSC + 10% formamide) for 5 min. Probe (Stellaris mXist 570, SMF-3011--1) was then added at a concentration of 125 nM (in wash buffer + 10% Dextran Sulfate) and incubated overnight at 37'C. Following washes in wash buffer + formamide, coverslips were mounted on slides with Vectashield + DAPI. NPC differentiation {#s4-5} ------------------- NPC differentiation from mESCs was performed as previously described ([@bib8]). Briefly, mESCs were plated on gelatin-coated plates in N2B27 medium for 7 days. On day 7, cells were dissociated with Accutase and cultured in suspension in N2B27 medium with FGF and EGF (10 ng/ml, each). On day 10, embryoid bodies were plated onto 0.2% gelatin-coated plates and allowed to grow until 14 days. At 14 days, cells were stained with anti-Nestin (Millipore, MAB353) antibody to confirm NPC identity. For qRT-PCR RNA was extracted from Trizol using the RNEasy Mini kit (Qiagen). RNA was then used directly for qRT-PCR using the following primers. Oct4-F: 5' TTGGGCTAGAGAAGGATGTGGTT3', Oct4-R: 5' GGAAAAGGGACTGAGTAGAGTGTGG3' ActB-F: 5'TCCTAGCACCATGAAGATCAAGATC3', ActB-R: 5'CTGCTTGCTGATCCACATCTG3'. Immunofluorescence {#s4-6} ------------------ Immunofluorescence for Oct4 and Nestin was performed on adherent cells fixed with 4% paraformaldehyde. After fixation, cells were permeablized with 0.5% PBS/Triton for 10 min on ice. Following permeablization, cells were blocked in 10% FBS in 0.1% PBS/Tween for 1 hr at room temperature. After blocking, cells were incubated for 2 hr in primary antibody (Nestin: Millipore, MAB353, Oct4: Santa Cruz sc-8629), washed in 0.1% PBS/Tween and then incubated for 2 hr in secondary antibody (Goat anti-mouse 488 Life Technologies ab150113, Rabbit anti-goat 488 Life Technologies A27012). After washing, cells were stained with DAPI and imaged at 40x magnification. Chromatin immunoprecipitation {#s4-7} ----------------------------- Cells were fixed with 1% formaldehyde for 10 min at room temperature and subsequently quenched with 0.125M glycine. Cells were then snap frozen and stored at −80'C. Cells were then lysed (50 mM HEPES-KOH, 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton X-100) for 10 min at 4'C. Nuclei were lysed (100 mM Tris pH 8.0, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA) for 10 min at room temperature. Chromatin was resuspended in sonication buffer (10 mM Tris pH 8.0, 1 mM EDTA, 0.1% SDS) and sonicated using a Covaris Ultrasonicator to an average length of 220 bp. For all ChIPs, 5 million cells per replicate were incubated with 5 ug (Histone) or 7.5 ug (Oct4) antibody overnight at 4'C (antibodies: H3K9me3: abcam AB8898; H3K27Ac: Active Motif 39133; H3K4me3: Active Motif 39159; Oct4: Santa Cruz sc-8629). Antibody-bound chromatin was incubated with Protein G Dynabeads (Invitrogen, 10004D) for 4 hr at 4'C and eluted in Tris buffer (10 mM Tris pH 8.0, 10 mM EDTA, 1% SDS). Crosslinks were reversed by incubation overnight at 65'C followed by treatment with 0.2 mg/mL proteinase K (Life Technologies, AM2548) and 0.2 mg/mL RNAse A (Qiagen). DNA was purified using Qiagen Minelute Columns (Qiagen, 28006). For library preparation, 4 ng ChIP DNA was incubated with transposase (Illumina, Fc-121--1030) for 10' at 55'C. DNA was then amplified using Nextera barcoding adapters and sequenced on an Illumina Nextseq (2 × 75 bp reads). ChIP-seq analysis {#s4-8} ----------------- ChIP-seq libraries for histone modifications were sequenced on an Illumina NextSeq with paired-end 75 bp reads. Reads were mapped to the mm9 genome build using Bowtie2 ([@bib26]). Unique and coordinated mapped paired reads were kept and duplicate reads were then removed using Picard Tools. Peaks were called using MACS2 with a q-value cutoff of 0.01 with input as background ([@bib58]). Peaks called from two technical replicates were compared by IDR package and further filtered by the Irreproducible Discovery Rate(\<0.05) ([@bib27]). Reproducible peaks from WT and KO conditions were merged and reads in these peaks were counted across all libraries. Differential peaks were called using reads counts from reproducible peaks with DESeq2(fold change \>= 2 and Padjust \<0.01) ([@bib30]). Bigwig files were generated from deduplicated bam files using bedtools for visualization ([@bib42]). ATAC-seq {#s4-9} -------- ATAC-seq library preparation was performed exactly as described in [@bib6]. Briefly, ESCs were dissociated using Accutase (SCR005,Millipore). 50,000 cells per replicate (two replicates per clone) were incubated with 0.1% NP-40 to isolate nuclei. Nuclei were then transposed for 30' at 37'C with adapter-loaded Nextera Tn5 (Illumina, Fc-121--1030). Transposed fragments were directly PCR amplified and sequenced on an Illumina NextSeq 500 to generate 2 × 75 bp paired-end reads. ATAC-seq analysis {#s4-10} ----------------- Reads were trimmed using CutAdapt ([@bib35]) and mapped to the mm9 genome build using Bowtie2 ([@bib26]). Unique and coordinated mapped paired reads were kept and duplicate reads were then removed using Picard Tools. Peaks were called using MACS2 with a q-value cutoff of 0.01 and no shifting model ([@bib58]). Peaks called from two technical replicates were compared by IDR package and further filtered by the Irreproducible Discovery Rate(\<0.05) ([@bib27]). Reproducible peaks from WT and KO conditions were merged and reads in these peaks were counted across all libraries. Differential peaks were called using reads counts from reproducible peaks with DESeq2(fold change \>= 2 and P-adjusted \<0.01) ([@bib30]). To calculate *P* values in DESEq2, for each gene the counts were modelled using a generalized linear model (GLM) of negative binomial distribution among samples. The two-sided Wald statistics test was processed for significance of the GLM coefficients. The Benjamini-Hochberg correction was applied to all p-values to account for multiple tests performed. This gives the final adjusted p-values used for assessing significance. ATAC-seq analysis for X chromosome silencing {#s4-11} -------------------------------------------- ATAC-seq reads were trimmed and mapped as described above. Peaks were called in all samples (+ and -- doxycycline) and bedtools multicov was used to count the number of reads falling within each peak in each sample. In order to avoid bias in normalization in the case of a global loss of accessibility on the X chromosome, we first normalized count data using all peaks genome-wide. We then calculated the ratio of average normalized reads in +dox / -dox samples at each peak on the X chromosome. RNA-seq {#s4-12} ------- RNA-seq library preparation was performed using the TruSeq Stranded mRNA Library Prep Kit (Illumina, RS-122--2102). In place of poly-A selection, we performed Ribosomal RNA depletion using the RiboMinus Eukaryote System v2 (Life Tech. A15026). Each library was prepared from 200 ng starting RNA, and two replicates were made for each cell line. RNA-seq libraries were sequenced on an Illumina HiSeq 4000 with paired 2 × 75 bp reads. RNA-seq analysis {#s4-13} ---------------- RNA-seq reads were mapped to the mm9 genome using STAR ([@bib9]). Following read alignment, reads were assigned to transcripts using FeatureCounts in R (RSubread) ([@bib28]). GTF file from gencode was used for feature assignment (<https://www.gencodegenes.org/mouse_releases/1.html>). Differential genes were called using DESeq2 (fold change \>= 2, P-adjusted \<0.001) ([@bib30]). For GO term analysis of RNA-seq data, GOrilla was used ([@bib11]). Enrichment of genomic loci in ATAC-seq and ChIP-seq data {#s4-14} -------------------------------------------------------- HOMER was used for enrichment of genomic locations in ATAC-seq and ChIP-seq data ([@bib18]). Specifically, we used the annotatePeaks.pl script with the --genomeOntology option. In vivo irCLIP-seq {#s4-15} ------------------ For in vivo irCLIP-seq experiments, V6.5 male mESCs, or *Spen* KO Clone 2 mESCs were transduced with a lentivirus carrying Spen RRMs 2--4 with the SV40 nuclear localization signal, 2x HA tags, and 3x FLAG tag ('SpenRRM-FLAG'; pLVX-EF1a-SV40NLS-SpenRRM234-2xHA-3xFLAG-IRES-zsGreen). Following transduction, GFP+ cells were FACS sorted and single colonies were picked. Western blotting was used to confirm the expression of SpenRRM-FLAG at 37 kDa. irCLIP was performed exactly as described ([@bib57]). Briefly, 2 million mESCs were UV-crosslinked (254 nM UV-C) at 0.3 J/cm^2^, and then lysed (1% SDS, 50 mM Tris pH7.5, 500 mM NaCl) and sonicated using a Bioruptor (Diagenode) (six cycles 30' on 45' off). Clarified lysates were incubated overnight with Protein A dynabeads conjugated to mouse anti-FLAG (Sigma Aldrich F3165) or anti-IgG antibody overnight at 4C. Following IP, beads were washed in high stringency buffer (15 mM Tris-HCl, pH 7.5; 5 mM EDTA; 1% Triton X-100; 1% Na-deoxycholate; 0.001% SDS; 120 mM NaCl; 25 mM KCl), high salt buffer (15 mM Tris-HCl, pH 7.5; 5 mM EDTA; 1 mM Triton X-100; 1% Na-deoxycholate; 0.001% SDS; 1000 mM NaCl), and low salt buffer (15 mM Trish-HCl, pH 7.5; 5 mM EDTA). After washing, RNA was digested using RNase I at 1:2000. RNA ends were then dephosphorylated and IR-conjugated linker (/5Phos/AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzideN/AAAAAAAAAAAA/3Bio/) was ligated overnight. Following ligation, samples were run on a 4--12% Bis-Tris gel, transferred to nitrocellulose and imaged using an Odyssey LiCOR scanner. RNA-protein complexes were eluted from nitrocellulose and treated with proteinase K to eliminate protein. Following RNA elution, Oligo(dT) Dynabeads were added to capture the polyadenylated irCLIP adapter. Next, the TruAmp sequencing adapter was added and RNA was reverse transcribed using SuperScript IV. Following reverse transcription, DNA was captured with streptavidin beads, circularized on the bead, and then PCR amplified. irCLIP libraries were then purified using PAGE gel purification and sequenced on an Illumina NextSeq using single-end 75 bp reads. Expression and purification of wild-type and mutant spen RRMs 2--4 for in vitro irCLIP RNA binding {#s4-16} -------------------------------------------------------------------------------------------------- The following constructs for SPEN (Split Ends protein), SHARP (human homolog, SMRT/HDAC1 Associated Repressor Protein), were designed and cloned into pET28a for *E. coli* expression. 1. SPEN-1=6 His-GST-TEV- RRM 2,3,4-SG-Flag 2. SPEN-4=6 His-GST-TEV- RRM 2,3,4-RRM3mutant-SG-Flag DNA for each was transformed into BL21 (DE3) Star competent cells, the transformation mix plated on LB-Kan agar and single colonies obtained the following day. 4 × 50 ml overnight pre-cultures were setup with single colonies for each construct in Terrific Broth (Teknova) + Kanamycin (50 ug/ml) (TB-Kan), at 37C, 250 rpm. Pre-cultures were used to inoculate 1li volumes of TB-Kan expression media at 10 ml/li (gives a starting OD600 = 0.15). Expression cultures were incubated at 37C, shaken at 250 rpm, for 4 hr then chilled to 18C for 1 hr and induced overnight with 0.25 mM IPTG at 18C. Cultures were harvested and resulting cell pellets were stored frozen at −80C. Frozen cell pellets were resuspended in 5 ml/g of Lysis Buffer(50 mM HEPES;pH 7.5, 300 mM NaCl, 20 mM Imidazole, 0.1% Triton X-100, DNase I (1 ug/ml), Lysozyme (1 ug/ml), 5 mM 2-ME, 2 x Roche protease Inhibitor tablet/50 ml and 1 mM PMSF). Resuspended pellets (in suspensions) were homogenized by Polytron and lysed by two rounds through a Microfluidizer (18000 psi). Lysates were clarified by centrifugation at 33000 x g for 60mins, the supernatant extracted and subjected to batch binding with 5 ml of NiNTA (Qiagen) for 2 hr, 4C with end-to-end rotation. Resin was washed with 20Cv's of Lysis Buffer containing 20 mM Imidazole, followed by elution of bound protein with 3 × 1 CV of Elution Buffer (Lysis Buffer + 250 mM Imidazole). Eluted fractions were pooled and dialysed overnight against 4li of 50 mM Hepes;pH 7.5, 300 mM NaCl, 1 mM TCEP with the addition of TEV protease to effect in-situ cleavage of the N-terminal 6His-GST tag. TEV cleaved solution was passed through a 0.5 ml NiNTA and the flow-through collected and concentrated 3--5 fold to give 4--10 mg/ml samples which were aliquotted and stored frozen at −80C. In vitro irCLIP RNA binding {#s4-17} --------------------------- In vitro irCLIP-seq was performed similarly to in vivo irCLIP with the following modifications. First, nuclear RNA was isolated as previously described ([@bib14]). Briefly, cells were pelleted and resuspended in Hypotonic Lysis Buffer (10 mM Tris pH 7.5, 10 mM NaCl, 3 mM MgCl~2~, 0.3% NP-40 and 10% glycerol) with 100 Units SUPERase-In. Cells were incubated on ice for 10 min, vortexes, and centrifuged for 3 min at 1000xg at 4C. The pelleted nuclei were then washed 3x in hypotonic lysis buffer and centrifuged for 2 min at 200xg at 4C. Pellet was then resuspended in TRIzol and RNA extraction was carried out per the manufacturer's instructions. 20 μg nuclear RNA was then fragmented (Ambion, AM8740), and incubated with 5 μg recombinant Spen RRMproteins (RRM2-4 WT or RRM2-4:RRM3 Mt) at 4C for 2 hr. RNA-protein complexes were then transferred to a 3 cm cell culture dish on ice and crosslinked (254 nM UV-C) at 0.3 J/cm^2^. Following crosslinking, RNA-protein complexes were incubated with antibody-bound Protein A Dynabeads (anti-FLAG \[Sigma Aldrich F3165\] or anti-IgG) at 4C for 2 hr. Following IP, beads were washed with IPP buffer (50 mM Tris-HCl pH 7.4, 100 mM NaCl, 0.05% NP-40, 5 mM EDTA), low salt buffer (10 mM Tris-HCl pH7.4, 50 mM NaCl, 1 mM EDTA, 0.1% NP-40), and high salt buffer (10 mM Tris-HCl pH7.4, 500 mM NaCl, 1 mM EDTA, 0.1% NP-40, 0.1%SDS). After washes, the protocol was performed exactly as in in vivo irCLIP from dephosphorylation to membrane imaging(above). irCLIP quality control analysis of endogenous SPEN {#s4-18} -------------------------------------------------- irCLIP was performed as previously described ([@bib57]). In brief, 50% confluent WT and KO mESCs were UV-C crosslinked on ice with 0.3 J/cm2 and then lysed on-plate with 1 ml of lysis buffer (20 mM Tris, pH 7.5, 100 mM NaCl, 1% Igepal CA-630, 0.5% NaDeoxycholate, 1 mM EDTA). Lysates were sonicated for 10 s (1 s on 1 s off) at 10% power with a Branson Digital Sonifier and clarified for 10 min at 13,500 rpm. Protein concentrations were quantified with the Pierce BCA assay. For RNAse digests, ice cold lysates were adjusted to 2 mg/ml and incubated with RNAse1 at a final concentration of 0.025 u/ml for 7.5 min at 37C. Reactions were stopped by addition of 1 ml of ice cold lysis buffer. For all immunoprecipitations, 3 ug of control IgG or anti-SPEN antibody were incubated overnight with 500 ug of lysates containing 30 ul of Protein G Dynabeads. Following irCLIP washes, immunoprecipitations were 3' dephosphorylated for 30 min and then ligated overnight with 1 pmole of irCLIP adapter. Immunoprecipitations were then rinsed once with ice cold PBS and then resuspended in 1 x LDS buffer containing 10 mM DTT and heated at 75C for 15 min prior to SDS-PAGE. Analysis of expressed repeats in RNA-seq data {#s4-19} --------------------------------------------- To identify expressed transposable elements in RNA-seq data, we counted all unique reads mapping to the database of repeat element loci from RepeatMasker for the mm9 genome. Bedtools multicov was used to count the number of reads per sample in each element. Read counts were then converted to fpkm. All elements with an FPKM \>= 1 in all samples were considered expressed and used for downstream analysis. ERV knock-in at the *Xist* A repeat {#s4-20} ----------------------------------- For Xist rescue experiments with ETn elements, we utilized the TXY ΔA cells which harbor a doxycycline inducible Xist transgene with the A Repeat region deleted. We designed donor plasmids for homology directed repair containing homology arms to the transgenic Xist present in TXY ΔA cells that contain a 154 bp portion of an ETn that binds to Spen, repeated 9x. Homology arms flanking the ETn insertions were cloned into the PCR4-Blunt TOPO vector (Thermo Fisher K287520). Cells were then nucleofected with a Cas9 RNP complex directed to the A Repeat region. 10 ug Cas9 protein (PNA Bio CP01-20) was mixed with 10 ug modified guideRNA (Synthego, GCGGGATTCGCCTTGATTTG) and 20 ug HDR donor vector. Cells were nucleofected with RNP complex and donor vector using the Amaxa Nucleofector (Lonza VPH-1001). Clonal colonies were picked and genotyped by PCR followed by Sanger sequencing. PCR of the Tet operator array was done using the following primers: TetO-F: 5'CCTACCTCGACCCGGGTACC3', TetO-R: 5'GGCCACTCCTCTTCTGGTCT3'. RIP-qPCR {#s4-21} -------- TXY WT, TXY ΔA, and TXY-ERV Clones 1 and 2 were transduced with a lentivirus carrying Spen RRMs 2--4 with the SV40 nuclear localization signal, 2x HA tags, and 3x FLAG tag ('SpenRRM-FLAG'; pLVX-EF1a-SV40NLS-SpenRRM234-2xHA-3xFLAG-IRES-zsGreen). Following transduction, GFP+ cells were FACS sorted and expression of the RRM-FLAG construct was confirmed by Western Blot using an anti-FLAG antibody (Sigma F3165). SpenRRM-FLAG expressing cells were treated with 10 mM HDAC1/2 inhibitor (Cayman Chemical Company, BRD6688, 1404562-17-9) for 24 hr, followed by treatment with HDAC1/2i + 2 mg/mL doxycycline for 24 hr. 5 million cells were then washed in PBS and lysed in RIP lysis buffer (50 mM Tris pH 8.0, 100 mM NaCl, 5 mM EDTA, 0.5% NP-40, 1 cOmplete Protease inhibitor tablet) in the presence of RNAse inhibitor (Thermo Scientific, RiboLock RNAse Inhibitor, EO0382). Cells were sonicated on a Covaris (Fill level 10, Duty Cycle 5%, PIP 140 Watts, 200 cycles/burst, 5 × 1 min/sample), and debris was pelleted for 15 min at 21,000xg at 4'C. Cleared supernatant was then added to 100 uL FLAG magnetic beads (Sigma, anti-FLAG M2 Magnetic Beads, M8823). After 2 hr incubation at room temperature, beads were washed three times in cell lysis buffer and resuspended in Trizol. RNA was extracted using the RNEasy mini kit (Qiagen, 74106). qRT-PCR was run on a Roche Lightcycler 480 using the Brilliant II SYBR Green qPCR Master Mix (Stratagene, 600804) using the following primers: Xist-F: 5'GCTGGTTCGTCTATCTTGTGGG3', Xist-R: 5'CAGAGTAGCGAGGACTTGAAGAG3', ActB-F: 5'TCCTAGCACCATGAAGATCAAGATC3', ActB-R: 5'CTGCTTGCTGATCCACATCTG3'. Multimapping for repeat-derived reads in ChIP-seq and ATAC-seq data {#s4-22} ------------------------------------------------------------------- After finding that SPEN regulates repeat regions, we re-analyzed the ChIP-seq and ATAC-seq data to include repetitive regions, which are usually removed in the standard analysis. We allowed each multimapping read to randomly assign to one place in the genome, without filter reads by mapping quality. The differential peaks is consistent to the results from unique mapped reads. We used the alignment files with multiple mapped reads for all the meta-analysis to avoid losing information. Evolutionary analysis of spen {#s4-23} ----------------------------- Multiple alignments of the SPEN CDS sequence were download from UCSC, including human, chimpanzee, rhesus, mouse, dog, opossum, platypus, chicken, zebrafish. We separated the CDS of SPEN into three domain regions (RID, SPOC and RRM). We estimated the number of nonsynonymous substitutions per nonsynonymous site (*dN*), the number of synonymous substitutions per synony- mous site (*dS*), and the *dN*/*dS* ratio, for each region using maximum likelihood as implemented in the codeml program of the PAML software package ([@bib56]; [@bib25]). Model 0 were used to estimate the global evolution rate and model one were used to estimate branch specific evolution rate. Integrated analysis of ChIP-seq, RNA-seq, and ATAC-seq data {#s4-24} ----------------------------------------------------------- Differentially expressed genes were identified from RNA-seq data. The 1 kb region around the promoter of differentially expressed genes were used to count the signal from ChIP-seq and ATAC-seq data. The fold change of gene expression, histone modification and chromatin accessibility between WT and *Spen* KO were compared using a R package, named tableplot ([@bib52]). The average plots and heatmap from histone modification, RNA expression, accessibility for interested regions were made using R package ngsplot ([@bib45]). Repeat divergence analysis {#s4-25} -------------------------- The divergence scores were download from repeatMasker through UCSC genome browser. We separated the ETn family by repeats with binding sites detected from irCLIP or not and the divergence score from mismatches (as a percentage) were compared. icSHAPE data analysis. The icSHAPE data from Sun et al. were downloaded from GEO under accession GSE117840. The sequence data reads were collapsed to remove PCR duplicates and trimmed to remove 3' adapters following the icSHAPE computational pipeline ([@bib13]). The processed reads were mapped to the expressed repeat sequence using bowtie2 with parameters suggested by [@bib13]. The icSHAPE score were then calculated following the previous description. Repeat sequence with read depth more than 75 were kept for the following analysis. The icSHAPE score of SPEN binding sites and their flanking region(+ / - 20 bp) were extracted, The aggregated icSHAPE activity score were plotted for each base across non-overlapped binding locations on the Ent repeats. irCLIP sequencing data processing {#s4-26} --------------------------------- Sequencing output reads were processed by bbmap to remove the duplication on fastq level ([@bib47]). Remained reads were trimmed off the 3' solexa adapter and against the sequencing quality q20 by cutadapt (version 2.4). Trimmed reads were mapped first to the RNA biotypes with high repetitiveness by bowtie2 (version 2.2.9) to our custom built indexes: rRNAs (rRNAs downloaded from Ensembl NCBI37/mm9 and a full, non-repeat masked mouse rDNA repeat from GenBank accession No.BK000964), snRNAs (from Ensembl NCBI37/mm9), miscRNAs (from Ensembl NCBI37/mm9), tRNAs (from UCSC table browser NCBI37/mm9), retroposed genes (RetroGenes V6) and RepeatMasker (from UCSC table browser NCBI37/mm9). Remained reads were mapped to the mouse genome NCBI37/mm9 by STAR (version 2.7.1a) with junction file generated from mRNAs and lncRNAs of the Genocode NCBI37/mm9 GTF file. Only reads uniquely mapped to the mouse genome were included in the down-stream analysis. Mapping output files were transformed into bam files (samtools/1.9) and bed files (bedtools/2.27.1) for downstream analysis ([@bib47]). SPEN binding cluster identification {#s4-27} ----------------------------------- The RBP binding loci as suggested by the irCLIP method, was defined as one nucleotide shift to the 5' end of each mapped read. Each loci was extended five nucleotides both up and downstream into a 11-nt-long local interval. Only intervals overlapped between two biological replicates were considered reliably detected and were included in the downstream analysis. Overlapping intervals were merged into one cluster. Five nucleotides were trimmed from each side of the cluster to shape the final cluster boundary. Cluster length is required to be longer than one nucleotide for downstream analysis. SPEN binding clusters on mouse genome and on repeat-regions were identified respectively. Cluster annotations were processed against the Genocode NCBI37/mm9 GTF file and RepeatMasker. For each experiment condition of each cell type, only clusters with quantification tenfold higher than the observation in its corresponding IgG samples, would be included for the downstream analysis. Gene/repeat element level quantification of SPEN binding {#s4-28} -------------------------------------------------------- Quantification of SPEN binding on each expressed gene or expressed repeat element was calculated as the total amount of read in all binding clusters covering the gene/repeat element. The quantifications were then normalized by gene/repeat expression level. SPEN binding RNA motif analysis {#s4-29} ------------------------------- RNA motif enrichment analysis were process on SPEN binding clusters on mouse genome and on repeat-regions respectively (Homer version 4.10). Strand-specific sequences defined by SPEN irCLIP clusters were searched for short sequences elements 5-mer, 6-mer, 7-mer and 8-mer in each analysis of hypergeometric enrichment calculations. The searching background was set as expressed transcriptome and expressed repeat regions. RNA 2D-structure {#s4-30} ---------------- 2D-structures were predicted by the RNAstructure tool (version 6.0.1) with the maximum free energy model and according the icSHAPE results. 2D-structures of MMETn repeat1125276, ETnERV repeat355428 and RLTR13G_2D were process by algorithm AllSub. 2D-structure of Xist repeat A region \#4 and \#5 were processed with algorithm DuplexFold. Cloning of wild-type and mutant spen RRMs 2--4 for in vitro biochemistry {#s4-31} ------------------------------------------------------------------------ Wild type mouse Spen cDNA was kindly provided in a D-TOPO vector from the Guttman lab (Caltech). Mutant Spen cDNA corresponding to RRMs 2--4 (F442A, K471A, Y479A, F481A, K513A) was ordered as a gBlock from IDT (Coralville, IA). Primers containing SalI and XhoI restriction enzyme cut sites on the 5'-end and 3'-end respectively of the cDNA corresponding to RRMs 2--4 (aa 336--644) were used to PCR amplify both wild type and RRM3 Mt cDNA inserts for ligation into a pET28b vector containing an N-terminal 10xHis-SUMO tag using the Quick Ligation kit (NEB, Ipswich, MA). Plasmids containing the cDNA of interest were verified by Sanger sequencing prior to expression (Quintara Biosciences, San Francisco, CA). Expression and purification of wild-type and mutant spen RRMs 2--4 for in vitro biochemistry {#s4-32} -------------------------------------------------------------------------------------------- BL21(DE3) expression cells were transformed with pET28b vector containing the cDNA of the protein of interest. 1 L cultures of 2XYT media were grown at 37°C for 3 hr to an OD~600~ between 0.6--1.2. Cells were flash-cooled on ice for 10 min, then 1 mM IPTG was added to induce protein expression overnight at 20°C. Cells were harvested, and pellets were frozen and stored at −20°C until purification. All proteins were subject to a 3-column purification protocol; the wild-type buffers were pH 7.5, while the mutant buffers were pH 8.3 due to differences in predicted pI and anticipated solubility requirements. Specifically, one cOmplete EDTA-free EASYpack protease inhibitor tablet (Roche, Basel, Switzerland) was added to each cell pellet corresponding to 1 L of growth. The tablet and frozen cell pellet were resuspended in 80 mL of lysis buffer (750 mM KCl, 750 mM NaCl, 1 M urea, 50 mM Tris, 10% glycerol, 10 mM imidazole, 1% triton X-100). The cell slurry was sonicated on ice with a Misonix Sonicator 3000 (Misonix, Farmingdale, NY) for 4--6 total minutes in pulses of 15 s followed by 35 s of rest. Membranes and other cellular debris were sedimented away from soluble protein on a Beckman J2-21 large floor centrifuge (Beckman Coulter, Brea, CA). Supernatant containing the recombinant protein was incubated with 10 mL of precleared Ni-NTA beads for 10 min at 4°C. Unbound cellular proteins were cleared by gravity flow. Beads were washed twice; once with 150 mL of lysis buffer, and once with 100 mL of modified lysis buffer containing 20 mM imidazole. Protein was then eluted with 50 mL of similar buffer containing 300 mM imidazole. For the washes and elution, beads were resuspended and incubated with the buffer for 10 min prior to gravity flow through. The elution was dialyzed in 4 L of size exclusion column buffer (500 mM urea, 270 mM KCl, 30 mM NaCl, 50 mM Tris, 7% glycerol, 1--2 mM DTT) for about 2 hr at 4°C. 1--2 mL of 1 mg/mL in-house His-ULP1 \[Mossessova and Lima, Mol. Cell (2000), 865--876\] was then added, and SUMO tag cleavage of recombinant Spen protein and further dialysis continued overnight at 4°C. Protein precipitate, when present, was pelleted or filtered prior to flowing over the second Ni-NTA column (11 mL beads precleared in column buffer). The Spen fragment flowed through the second Ni column while the His tagged protease and SUMO expression tag were retained on the resin. Flowthrough containing the cleaved Spen construct was concentrated to 2 mL for injection onto the Superdex 200 size exclusion column. Size exclusion fractions are checked for the presence of purified protein by SDS-PAGE. Fractions containing purified protein are combined, concentrated to between 100 µM - 1 mM, aliquoted, flash frozen in liquid nitrogen, and stored at −70°C until binding assays are performed. RNA generation cDNAs of RNAs of interest with a 5' T7 promoter were ordered as gBlocks from IDT (Coralville, IA). Primers flanking the cDNA containing the EcoRI and BamHI cut sites on the 5' and 3' ends respectively were used to PCR amplify the cDNA for restriction enzyme cloning into a pUC19 vector for cDNA amplification. Ligated plasmids were verified using Sanger sequencing (Quintara Biosciences, San Francisco, CA) and utilized for transcription template generation. Standard PCR using a 3' transcription primer was used to generate in vitro transcription template for run-off transcription. For in vitro transcription, 300 nM PCR template was incubated at 37°C for 2--4 hr with 4 mM each rNTP in 24 mM Mg^2+^, 40 mM Tris pH 8.0, 10 mM DTT, 2 mM spermidine, 0.01% Triton X-100, IPPase (\>0.01 U/µL), and in-house T7 polymerase (Batey Lab, CU Boulder). Transcription reactions were gel purified on a 5--12% acrylamide 8M urea 1X TBE slab gel. Reaction products were UV shadowed, appropriate sized bands were excised, and RNA was extracted through a 0.5X TE crush and soak (4°C, 1 hr). Gel bits were filtered and RNA was buffer exchanged in 0.5X TE until the calculated residual urea was less than 10 µM. RNA was concentrated prior to use; purity and concentration were assessed by the A~260~ and the A~260~/A~280~ ratio. Concentrations were calculated using the extinction coefficient provided for each RNA sequence by the Scripps extinction coefficient calculator (<https://www.scripps.edu/researchservices/old/corefac/biopolymercalc2.html>). FTSC 3'-end labeling of RNA {#s4-33} --------------------------- 350 pmol of purified RNA were treated with 20 mM NaIO~4~ for 20 min in the dark at room temperature. Excess NaIO~4~ was precipitated using 26 mM KCl (10 min on ice followed by a hard spin). Supernatant containing the RNA was then ethanol precipitated with the aid of 1 µg glycogen. The RNA pellet was washed 1x with 70% ethanol, and then resuspended in 100 µL of freshly made labeling solution (1.5 mM FTSC, 10% DMF, 100 mM NaOAc pH 5.2) and reacted at 37°C in the dark for 1--2 hr. 280 µL of cold 100% ethanol was then added to precipitate the RNA (ice for ≥30 min). The labeled RNA pellet was then washed thoroughly at least 4X with 400 µL of 70% ethanol, resuspended in 30 µL of water, and run through a Sephadex MicroSpin G-25 column (GE Healthcare) to remove excess FTSC. Labeled products were qualitatively assessed for purity and labeling efficiency via denaturing gel analysis; the Cy2 filter on the Typhoon imager (GE Healthcare) was used to visualize the attached fluorophore. A~260~ measurements post-labeling were used to determine RNA concentration. Labeling efficiencies typically allowed for the use of RNA in binding assays between 1--3 nM. FTSC-labeled RNA was stored in dark amber tubes at −20°C until use. Fluorescence anisotropy (FA) binding assays {#s4-34} ------------------------------------------- Wild-type and mutant Spen binding were performed at pH 7.5 and 8.3 respectively. RNA concentrations were held as low as possible while still obtaining enough fluorescent signal (1--3 nM). Briefly, purified labeled RNA was snap cooled in 1X binding buffer (45 mM KCl, 5 mM NaCl, 50 mM Tris, 5% glycerol) at 2X the final concentration, and likewise protein titrations were performed separately in 1X binding buffer at 2X final concentration. Protein and RNA were then mixed in a 1:1 vol ratio in a 20 µL reaction and were allowed to come to equilibrium at room temperature in the dark for 40--60 min. Flat bottom low flange 384-well black polystyrene plates (Corning, Corning, NY) were used. Perpendicular and parallel fluorescence intensities (I~⊥,~I~‖~) were measured using a ClarioStar Plus FP plate reader (BMG Labtech). Anisotropy values were calculated for each protein titration point where anisotropy = (I~‖~ - I~⊥~)/(I~‖~ + 2\*I~⊥~). Protein concentration was plotted versus associated anisotropy, and data were fit to the simplified binding isotherm (anisotropy \~fraction bound=S\*(P/(K~D~+P))+O with KaleidaGraph where S and O were saturation and offset respectively, and P was the protein concentration. ^32^P 5'-end labeling of RNA {#s4-35} ---------------------------- 50 pmol of RNA were treated with calf intestine phosphatase (NEB) for 1 hr at 37°C. RNA was purified via phenol chloroform extraction followed by ethanol precipitation. RNA was resuspended and γ-ATP was added to the 5' end of the RNA with T4 polynucleotide kinase (NEB) for 30 min at 37°C. Water was added to dilute the RNA to 1 µM, and the reaction was then run through a Sephadex MicroSpin G-25 column (GE Healthcare) to remove excess γ-ATP. ^32^P-labeled RNA was stored at −20°C. Competition assay {#s4-36} ----------------- Wild-type Spen and ^32^P-labeled A repeat concentrations were kept constant at 10 µM and 1 µM respectively, and the competition was done at 50 mM Tris (pH 7.5), 45 mM KCl, 5 mM NaCl, and 2.5% glycerol. Different amounts of unlabeled competitor RNA were added, and the amounts were relative to the amount of labeled RNA. Briefly, RNAs were snap cooled in RNA buffer (50 mM Tris (pH 7.5), 45 mM KCl, 5 mM NaCl). Labeled RNA was snap cooled at 4X the final concentration, while competitor RNA was snap cooled at 2X the final concentration. Protein was diluted in protein buffer (50 mM Tris (pH 7.5), 45 mM KCl, 5 mM NaCl, 10% glycerol) to 4X the final concentration. 2.5 µL of 4X protein, 2.5 µL of 4X labeled RNA, and 5 µL of 2X competitor RNA were allowed to come to equilibrium at room temperature for 40--60 min. The reactions were then loaded onto a pre-run 5% acrylamide 0.25X TBE mini native gel at 200V. The gel was run at room temperature at 200V for 10--15 min, dried, then exposed overnight to a phosphoscreen. Phosphoscreen images were taken on the Typhoon (GE Healthcare) at 50 µm resolution. List of RNA sequences used in direct binding and competition {#s4-37} ------------------------------------------------------------ 1. A-repeat from Xist (85 nt): GGAACTCGTTCCTTCTCCTTAGCCCATCGGGGCCATGGATACCTGCTTTTAACCTTTCTCGGTCCATCGGGACCTCGGATACCTG 2. SRA RNA (82 nt): GGAGCAGGTATGTGATGACATCAGCCGACGCCTGGCACTGCTGCAGGAACAGTGGGCTGGAGGAAAGTTGTCAATACCTGTA 3. ERV 205 (86 nt): 4. GAUUCCAGGCAGAACUGUUGAGCAUAGAUAAUUUUCCCCCCUCAGGCCAGCUUUUUCUUUUUUUAAAUUUUGUUAAUAAAAGGGAG 5. ERV 509 (114 nt): 6. GGUUAAAACUGCUAUUGUUCCAUUGACUGCAGCUUGCAGUUUGAUUUCAAAUUUAAGAUCUUUAAUUCACCUGUAUACUGUAAUUAAGAUAAUUACAAGAGUAAUCAUCUUAUG 7. ERV 495 (113 nt): 8. GAAAUUUCUCUCUGGGCCUUAUAGCAGGAGUACUCUGUUCCCUUUUGUGUCUUGUCUAAUGUCCGGUGCACCAAUCUGUUCUCGUGUUCAAUUCAUGUAUGUUCGUGUCCAGU 9. ERV 411 (109 nt): 10. GGUACCUUAAAUCCUUGCUCUCACCCAAAAGAUUCAGAGACAAUAUCCUUUUAUUACUUAGGGUUUUAGUUUACUACAAAAGUUUCUACAAAAAAUAAAGCUUUUAUAA 11. ERV 302 (111 nt): 12. GAUCAGAGUAACUGUCUUGGCUACAUUCUUUUCUCUCGCCACCUAGCCCCUCUUCUCUUCCAGGUUUCCAAAAUGCCUUUCCAGGCUAGAACCCAGGUUGUGGUCUGCUGG Code availability statement {#s4-38} --------------------------- Analysis methods used for next generation sequencing data in this paper are described in the appropriate sections of the methods. No new software packages were generated for the analysis of data in this paper. Funding Information =================== This paper was supported by the following grants: - http://dx.doi.org/10.13039/100000051National Human Genome Research Institute HG007735 to Howard Y Chang. - http://dx.doi.org/10.13039/100000051National Human Genome Research Institute HG004361 to Howard Y Chang. - http://dx.doi.org/10.13039/100001845Scleroderma Research Foundation to Howard Y Chang. - http://dx.doi.org/10.13039/100000011Howard Hughes Medical Institute to Howard Y Chang. - http://dx.doi.org/10.13039/100000057National Institute of General Medical Sciences GM120347 to Robert T Batey, Deborah S Wuttke. - http://dx.doi.org/10.13039/100000072National Institute of Dental and Craniofacial Research DEO26730 to Michael T Longaker. - Hagey Laboratory for Pediatric Regenerative Medicine to Michael T Longaker. We thank E Heard and A Wutz for reagents and for helpful discussions. We thank F Fazal, MR Corces and members of the Chang lab for assistance and feedback. Supported by NIH RM1-HG007735, R01-HG004361, and Scleroderma Research Foundation (to HYC), R01-GM120347 (to DSW, RTB), and the Hagey Laboratory for Pediatric Regenerative Medicine and R01DEO26730 (to MTL). HYC is an Investigator of the Howard Hughes Medical Institute. Additional information {#s5} ====================== Reviewing editor, *eLife,* co-founder of Accent Therapeutics, Boundless Bio, and an advisor of 10x Genomics, Arsenal Therapeutics, and Spring Discovery. No competing interests declared. is an employee of Novartis. Conceptualization, Investigation, Methodology, Writing - original draft, Writing - review and editing. Data curation, Formal analysis. Investigation, Methodology. Software, Formal analysis, Visualization. Formal analysis, Validation. Investigation. Methodology. Investigation. Investigation. Methodology. Investigation. Investigation. Investigation. Investigation, Methodology. Investigation. Resources, Supervision. Resources, Writing - review and editing. Supervision, Funding acquisition, Visualization. Supervision, Funding acquisition, Visualization. Conceptualization, Supervision, Funding acquisition, Investigation, Writing - original draft, Project administration, Writing - review and editing. Additional files {#s6} ================ ###### irCLIP-seq clusters identified on mRNA, lncRNA, and TEs. Data availability {#s7} ================= All raw and processed sequencing data have been deposited in GEO under accession number GSE131413. The following dataset was generated: CarterACXuJChangHY2020Spen links RNA-mediated endogenous retrovirus silencing and X chromosome inactivationNCBI Gene Expression OmnibusGSE131413 10.7554/eLife.54508.sa1 Decision letter Yeo Gene W Reviewing Editor University of California, San Diego United States Yeo Gene W Reviewer University of California, San Diego United States Hammell Molly Reviewer Cold Spring Harbor Laboratory United States In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses. Thank you for submitting your article \"Spen links RNA-mediated endogenous retrovirus silencing and X chromosome inactivation\" for consideration by *eLife*. Your article has been reviewed by three peer reviewers, including Gene W Yeo as the Reviewing Editor and Reviewer \#1, and the evaluation has been overseen by James Manley as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Molly Hammell (Reviewer \#3). The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. Summary: Carter et al. demonstrates that SPEN, an RNA binding protein involved in *Xist* interaction, also binds to ERV elements embedded in transcripts. Structurally, ERV elements appear to be similar to the SPEN binding site in *Xist*. The authors provide data that indicate SPEN represses ERV elements in mouse ES cells. Inactivation of SPEN leads to increase in chromatin accessibility, active histone marks and RNA transcription of ERV element-encoded transcripts. The authors identify that RRM3 domain of SPEN is responsible for binding to ERV and insertion of ERV into an A-repeat deficient *Xist* can rescue binding of *Xist* RNA to SPEN, which result in local gene silencing. Overall the paper is an interesting observation that has for the most part rigorous assays that contribute to our understanding of how *Xist* evolved new domains to recruit protein interactors for gene expression control. There are, however, major concerns that need to be addressed. Major concerns: 1\) Can the authors clarify how the chromatin changes observed at ERV genomic loci change upon SPEN depletion in mESCs as there are some inconsistencies. The high expression of the ERV elements in WT ESCs would be expected to reflect open chromatin at these loci. But are these ERVs then repressed normally? The model of RNA recruitment of SPEN to the ERVs can be better explained to account for these inconsistencies. Also, what fraction of the ERVs with altered chromatin marks have associated expressed transcripts and which ones are differentially expressed in SPEN KO cells? Can the authors present the data as standard DEseq-like scatter/volcano plots? 2\) The preference for ERVs, and especially ERV-K\'s is still unclear. The only thing that links ERVK type TEs to each other is the presence of a lysine-tRNA in the primer binding site (PBS) of those ERV internal sequences. So, given that SPEN is not looking for a specific sequence, but a structure. And, given that SPEN doesn\'t seem to care about the ERV PBS region, it is difficult to understand why it prefers ERVK elements. Can the authors show that these are structurally different than the other TEs that are not bound? Eg., do they lack the single stranded bubbles associated with SPEN preferred shapes? Or, are these really just following what\'s expressed at this stage? 3\) The results from the experiments replacing the A-repeat in *Xist* with the ERV sequence needs more clarification. The RIP-PCR data does not appear to demonstrate significant binding of SPEN to ERV-XIST for clone 1 and the CLIP-PCR data in the supplement does not show significance testing and have differing data between the two *Xist* primer pairs. The results regarding the repression of ERV-XIST needs to be clarified. It seems that HDAC1/2 inhibition has the largest effect on derepression, even though SPEN is thought to function through HDAC3 in XCI. Which HDACs might be involved in SPEN recruitment to ERV-XIST? In that same line of inquiry, the authors should explain some inconsistencies. They report SPEN induces silencing of the *Xist* RNA instead of silencing the *Xist*-bound chromosome. This suggests that there is some information that could be useful in the comparisons between which TEs were directly bound in the Clip-seq data, which of them had chromatin-based alterations, and which induced changes at the RNA level. There should have been one summary figure of the genomics data that shows how consistent these are with each other. Perhaps what happens at a locus depends on where SPEN binds (on the LTR promoter elements vs. internally)? Perhaps the number of SPEN binding sites on the locus influences how those transcripts are regulated (as they seem to be hinting at in Figure 6E)? Even if this can\'t explain why SPEN seems to regulate TEs differently from how it contributes to XCI, these comparisons should be explored. 10.7554/eLife.54508.sa2 Author response > Major concerns: > > 1\) Can the authors clarify how the chromatin changes observed at ERV genomic loci change upon SPEN depletion in mESCs as there are some inconsistencies. The high expression of the ERV elements in WT ESCs would be expected to reflect open chromatin at these loci. But are these ERVs then repressed normally? The model of RNA recruitment of SPEN to the ERVs can be better explained to account for these inconsistencies. Also, what fraction of the ERVs with altered chromatin marks have associated expressed transcripts and which ones are differentially expressed in SPEN KO cells? Can the authors present the data as standard DEseq-like scatter/volcano plots? The reviewers make a great point, that the relationship between changes in chromatin accessibility or modifications and RNA expression can be better presented. In general, there is low but detectable level of ERV RNA expression in wild type cells. In *Spen* KO cells, some ERV loci gain chromatin access, lose heterochromatic marks, and have elevated RNA expression. These results are consistent with a Spen-mediated surveillance of ERV loci via RNA. We now present this data in Figure 2---figure supplement 1A-F. In panels a-c, we show that there are family-specific changes in chromatin accessibility, H2K9me3 modification, and expression of specific subfamilies of transposable element as determined by DESeq2 in *Spen* KO mESCs. In panels d-f, we show the changes in RNA expression and chromatin modification at the sites that gain accessibility in *Spen* KO mESCs. Consistent with the data presented in Figure 2, we demonstrate that sites gaining accessibility in *Spen* KO mESCs show increased RNA expression, increased enhancer-associated marks (H3K27Ac), and decreased repressive marks (H3K9me3). > 2\) The preference for ERVs, and especially ERV-K\'s is still unclear. The only thing that links ERVK type TEs to each other is the presence of a lysine-tRNA in the primer binding site (PBS) of those ERV internal sequences. So, given that SPEN is not looking for a specific sequence, but a structure. And, given that SPEN doesn\'t seem to care about the ERV PBS region, it is difficult to understand why it prefers ERVK elements. Can the authors show that these are structurally different than the other TEs that are not bound? Eg., do they lack the single stranded bubbles associated with SPEN preferred shapes? Or, are these really just following what\'s expressed at this stage? The reviewers raise a good point, that Spen's apparent preference for ERVKs cannot be explained entirely by their belonging to the ERVK family of TEs. We believe that Spen's specificity for this subset of ERVK subfamilies has at least two components: (i) the developmental stage during ES cell differentiation, and (ii) the structure of the recognition site on the RNA. First, we observed that Spen does not bind to nor repress all ERVKs. Rather, only specific subsets of ERVK families are targeted, notably the ETn family and RLTR9 and 13 (Figure 2C and Figure 2---figure supplement 1). These subsets of ERVKs have the potential to be expressed in the mESC state, and thus are not as heavily repressed by DNA methylation and other chromatin modifications as other TE families. Thus, they may display some aberrant transcription in mESCs, leading Spen to recognize their RNA products and recruit silencing machinery to silence the locus. Consistent with this idea, we see ectopic occupancy of Oct4, the pluripotency transcription factor on these subsets of ERVKs (Figure 2A, 2B). Second, within each of these TE subfamilies we find that the elements with the strongest RRM binding in *Spen* KO mESCs show the highest expression level ([Author response image 1A, B](#respfig1){ref-type="fig"}). Despite these TE families being highly expressed, there are other TE families that show high expression but low Spen binding, suggesting that structural features in TE RNAs also contribute to Spen's ability to recognize them ([Author response image 1C](#respfig1){ref-type="fig"}). It is difficult to assess the structural features of TEs that are not bound by Spen. For Spen-bound TEs, we know the specific Spen binding site from our irCLIP-seq data and can use the sequence in that specific region to assess RNA structure from icSHAPE and RNA folding models. For unbound TEs, the entire length of the ERVK RNA contains many secondary structures (predicted), so it is difficult to assess which regions are appropriate to compare to the Spen binding sites on bound RNAs. Nonetheless, the Spen irCLIP-seq data show that the RRM binding is highly focal within ETnERV and Xist RNAs (Figure 4), which correspond to specific RNA secondary structures with a GC-rich dsRNA regions interspersed with single-stranded RNA bases. This specificity is consistent with the known RNA binding specificity of Spen RRM (Arieti et al., 2014; Lu et al., 2016). {#respfig1} > 3\) The results from the experiments replacing the A-repeat in Xist with the ERV sequence needs more clarification. The RIP-PCR data does not appear to demonstrate significant binding of SPEN to ERV-XIST for clone 1 and the CLIP-PCR data in the supplement does not show significance testing and have differing data between the two Xist primer pairs. The results regarding the repression of ERV-XIST needs to be clarified. It seems that HDAC1/2 inhibition has the largest effect on derepression, even though SPEN is thought to function through HDAC3 in XCI. Which HDACs might be involved in SPEN recruitment to ERV-XIST? In that same line of inquiry, the authors should explain some inconsistencies. They report SPEN induces silencing of the Xist RNA instead of silencing the Xist-bound chromosome. This suggests that there is some information that could be useful in the comparisons between which TEs were directly bound in the Clip-seq data, which of them had chromatin-based alterations, and which induced changes at the RNA level. There should have been one summary figure of the genomics data that shows how consistent these are with each other. Perhaps what happens at a locus depends on where SPEN binds (on the LTR promoter elements vs. internally)? Perhaps the number of SPEN binding sites on the locus influences how those transcripts are regulated (as they seem to be hinting at in Figure 6E)? Even if this can\'t explain why SPEN seems to regulate TEs differently from how it contributes to XCI, these comparisons should be explored. We apologize for the confusion regarding the Xist-ERV experiments and hope to clarify here and in the main manuscript text. First, we observed that expression of *Xist-ERV* was significantly reduced compared to *Xist-WT* or *Xist-*△*A* upon doxycycline treatment and we found that this failure to induce the chimeric *Xist* RNA was due to epigenetic silencing and not genetic changes in the Tet operator in our cells (Figure 6---figure supplement 2D-G). Recent work from Edith Heard's lab (Zylicz et al., 2019) showed that HDAC3 inhibition partially blocks X chromosome inactivation. Interestingly, they also found that HDAC1/2 inhibition leads to upregulation of transgenic *Xist* through epigenetic derepression. Thus, we tested whether HDAC1/2i or HDAC3i could relieve Spen-mediated silencing of *Xist-ERV*. We found that both HDAC1/2 and HDAC3 relieved Spen-mediated *Xist* repression, and chose to perform functional experiments in the presence of HDAC1/2i, since we knew this would allow expression of our chimeric *Xist* presumably without affecting the ability of this lncRNA to silence the X chromosome which we wished to test. Our data also indicate that Spen and HDAC3 are responsible for *Xist-ERV* mediated gene repression, as the repression is relieved by knock down of Spen and inhibition of HDAC3 (Figure 6D). We also wish to clarify the results of the Spen RRM RIP experiments with Xist-ERV clone 1. Even in the presence of HDACi, *Xist-ERV* expression was significantly lower than the expression of *Xist-WT*, making the RIP-qPCR results for this cell line significantly noisier than those obtained with Xist-WT. The results are plotted as the percent of input RNA, and in the case where the input RNA is lowly expressed, this value is inherently noisier. While the result is not statistically significant, this is driven in large part by two outliers (one high and one low, of 6 total). Thus the results for Xist-ERV clone 1 suggest that Spen RRM binds to Xist-ERV and the results from clone 2 show that Spen RRM binding to Xist-ERV is significant. In [Author response image 2](#respfig2){ref-type="fig"} and in Figure 6B, we now present the results of the Spen RRM RIP-qPCR experiments excluding the highest and lowest replicates for each sample, including all controls. Due to the low levels of *Xist* expression, the noise in the assay warrants the removal of these outliers, as the experiment is operating at the lower bound of dynamic range. From this analysis, we conclude that the results in Xist-ERV clones 1 and 2 show that the Spen RRMs bind to *Xist-WT* and *Xist-ERV*, but not to *Xist-ΔA*. {#respfig2} We also understand the confusion regarding the CLIP-qPCR presented in the supplemental figure. The reason that these panels did not have significance indicated is that they were performed with technical but not biological replicates. We opted to perform more experiments (n=6 biological replicates) for the RIP-qPCR instead of the CLIP-qPCR, so we have chosen to remove the CLIP-qPCR results from the manuscript. We don't believe this affects the results presented in Figure 6. Regarding the mechanism by which Spen silences target loci, we believe that our results are consistent with a model in which Spen recognizes and binds certain transcripts, including ERV-derived transcripts, recruits silencing machinery, including HDACs, and silences the promoter. We provide the list of altered loci with each assay in Figure 2---figure supplement 1. This model is consistent with our results at ERVs as well as our results in the context of the *Xist-ERV* chimeric RNA. The matter of the overlap between ERVKs bound by Spen RRMs (irCLIP-seq) and the ERVKs that become de-repressed at the level of chromatin modifications and RNA expression is complex. We find consistently that the sites that change at the chromatin and RNA level belong to specific subsets of ERVKs including ETns, and we found that these ERVK subfamilies are also bound by Spen RRMs in multiple cell lines and conditions (Spen FL and RRM-FLAG). However, we find very little overlap between the specific genomic loci that change in accessibility and produce RRM-bound transcripts (1/288 sites that gain accessibility). We believe that this is likely due to differences in when these experiments were performed and the passage of the cells used. For the irCLIP-seq experiments, cells had to be expanded, infected with RRM-FLAG viruses and subcloned. Thus, if Spen's recognition of ETns and other ERVKs is consistent, but the source of these aberrant expressed ETns in the genome is dynamic, the results are consistent with what we observe. Unfortunately, for technical reasons, these experiments were performed multiple passages apart. A fascinating mystery of the X inactivation field is how *Xist* itself can be expressed from the inactive X chromosome when this lncRNA is recruiting multiple powerful gene silencing complexes. This duality of potent expression on the inactive X while silencing the remainder of the chromosome is an evolved function of the modern lncRNA. In the context of wild type *Xist*, Spen is able to bind to *Xist* and spread across the chromosome in order to silence distal gene promoters. We found that *Xist-ERV*, our model of a proto-Xist lncRNA, mainly executes cis silencing of its own locus. This implies that additional features are missing in *Xist-ERV*. We agree with the reviewer that the number or quality of RNASpen interaction may determine the difference between local vs. distant gene silencing. It is also worth recalling that *Xist* A-repeat interacts with m6A modification machinery (WTAP, RBM15) as well as RNF20 (Chu et al., 2015; Patil et al., 2016). Some of these interactions are likely missing in *Xist-ERV*. Very recently it was suggested that *Xist* A-repeat has transcriptional anti-terminator activity (Lee et al., 2020), that allows *Xist* RNA to be transcribed in the face of regulatory factors that normally terminate transcription. We believe that solving this longstanding mystery in the field is beyond the scope of the present work, and respectfully suggest our work has clarified the distinct functions that may be gained by a lncRNA when it exapts an endogenous retroviral element. [^1]: These authors contributed equally to this work. [^2]: These authors also contributed equally to this work. | High | [
0.687415426251691,
31.75,
14.4375
] |
Designating Beneficiaries Of Life Insurance Owned By A Trust If you own life insurance on your life, when you die the value of your life insurance proceeds will be part of your estate. Even though your life insurance beneficiaries will receive their proceeds income tax free, what they receive may be reduce by your estate tax obligations. Letting a trust own the life insurance on your life, removes its proceeds from your estate tax obligations, but how best to designate the beneficiary(s) of the trust-owned life insurance? First of all, for the life insurance proceeds of a trust to remain outside of your estate, you can’t control the trust. So the trust must be irrevocable. It’s ruled only by the its trustee according to the trust document. A typical (revocable) living trust won’t do; it’s treated an extension of you and is part of your estate when you die. If the purpose of the trust is to own life insurance for the benefit of its trust beneficiaries, then it’s generally called an irrevocable life insurance trust – an ILIT for short. You (grantor of the ILIT) can transfer your life insurance policies to it or have the ILIT buy a brand new life insurance policy on you. If you transfer your policies to the trust you must do so at least 3 years before you die; or else their death proceeds will remain in your estate. Federal estate tax laws don’t permit ‘deathbed’ gifting. Transferring your policies may be the only way to go if you can’t qualify for a new life insurance policy on you. If you can qualify, then have the ILIT purchase a policy on your life. Be sure that the ILIT is in existence before the policy comes into existence. Otherwise you’re back to the 3-year wait policy. *Who should be designated the beneficiary of your ILIT-owned life insurance? In most cases, it makes better sense to name your beneficiaries individually on life insurance policies versus naming a trust as beneficiary. But, if your beneficiaries have creditor issues, mental health problems, can’t be trusted with large sums of cash or their primary beneficiaries are minors or have drug issues, or there other special scenarios, then naming the trust as beneficiary might be a better route. If an individual is named a beneficiary life insurance proceeds he can receive the amount free of income tax. But trusts are not considered individuals, so life insurance proceeds paid to trusts are generally taxable. Also, the proceeds payable to a trust may not qualify for the inheritance tax provided by some states for insurance payable to a named beneficiary. In such states, a higher tax may be owed. Realize that purchasing life insurance involves costs, fees, expenses and potential surrender charges and depends on the health of the applicant. Not all applicants are insurable. If you own life insurance on your life, when you die the value of your life insurance proceeds will be part of your estate. Even though your life insurance beneficiaries will receive their proceeds income tax free, what they receive may be reduce by your estate tax obligations. Letting... | High | [
0.658008658008658,
38,
19.75
] |
Welcome to the Orioles Nation Forums! Like most online communities, you must register to post on our message board. However, posting is free--it always will be--and registration is a simple process. Become part of the growing Orioles Nation community and register now! Multiple teams have aggressively pursued De La Rosa, including the Pirates, Nationals and Orioles. The Rangers and Yankees could also enter the mix depending on what transpires with ace Cliff Lee, which could slow the process. Last season with the Rockies, De La Rosa was 8-7 with a 4.22 ERA in 121.2 IP (20 starts), along with a K:BB of 113:55. I'm curious why folks think he's not a fit for the AL East. Nice up-tick in GB rate last year (50+%), purportedly due to an improving change-up. He's got TOR stuff (he's a lefty who sits around 93 but can touch 95-96), w/ some command issues. Depending on what they're asking for, I'd be very tempted. His xFIP his last two years (in Colorado, remember) has been sub-3.80. Last year he was actually a little better at home than away, while the year before he had the expected extreme home/away splits (5.20 ERA v. 3.30 ERA H/A) - key here is determining whether the difference is due to the change-induced GB% improvement or whether it's just an anomaly. Lefties, who sit in the near-to-mid 90s, w/ 50+% GB rates and 8+ K/9 are rare. In 120 innings last year, he was still worth nearly two wins. I'd gamble on a two year contract, maybe three, depending on $$$. Word is the A's are offering 5 years. I don't go that long on him (and, truly, it seems foolish for the As to). Jim - I agree that Jorge is worth an offer, but I differ in the sense that I would offer more years and $$ than the A's. The fact is that the O's are going to have to over spend to attract 2nd tier free agents so the top tier free agents that are available next year will want to come to Baltimore. The guy can pitch, has plus velo, and is getting better at keeping the ball on the ground. He is an upgrade over what they have - I am not high on Bergesen or Tillman (Tillman certainly having a higher ceiling and I would hold on to if possible). Forgive me for not going into stat details - I tend to focus on what I see - stats do not show the full picture. Certainly no disrespect intended - I just evaluate from a different perspective. I think he's not a fit because I've seen the "NL guy with 4 plus era come to the AL East" movie before and Im not interested in buyin another ticket to that flop. I think it's better then 2 to 1 odds that his era would be over 5 and he wouldnt top 9 wins next year if he was on the O's and I cant see how that would help lure free agents next year. Offering 5 years WOULD be foolish, none the less offering more No disrespect felt. I think analyzing from a single perspective is generally a mistake. We all suffer from incomplete information and bounded rationality, and every approach suffers limitations along that line. Stats, traditional scouting, biomechanics. Everything should be thrown at these questions. You'll note, though, that much of my statistical analysis is less about traditional statistics, and more about describing - in the absence of a ton of first-hand viewing experience - the type of pitcher he is. And that type - at least last year - is a high-K, high-GB pitcher. Very rare. And very valuable. There are issues of command, and questions about the sustainability of last years trends, but the point is: live arm, good movement, misses bats and gets grounders. Those are the kinds of pitchers who succeed anywhere, AL East or not. As to the second post: any approach that takes into account only his ERA and claims failure in the NL East is severely limited, however. First, it casts aside the fact that he is still young. Second, it doesn't take into account the fact that he played in Coors Field, which had a 118 hitting/park factor last year and is at 115 over the last few years. It matters. Probably more than pitching in the AL East. He's not all that young, no free agent that isn't a non tender is. He's listed at 29 so he may be pitching at 30 next year. Few athletes get better when they move into their 30's, Cliff Lee one exception. Coors Field is not vastly different then OPACY yet the lineups of the Rays, Yanks, Red Sox, and Jays certainly are different then the NL West lineups. I respectfully think that ignoring how many runs a guy routinely lets score and looking at fringe stats is the limited view. Runs, or lack thereof for a pitcher, is what wins ballgames, not all that other stuff. We're not evaluating a 21 y.o. in Double A here You're absolutely right - I was thinking he was 26, and was clearly wrong (*must* have been thinking about someone else). So, yeah, his command may not develop any more. Baltimore's three-year hitting/park factor is 102, so the difference is quite large. As for my "limited" view, you misunderstand the stats. Which is fine as far as it goes. But "letting in runs" is always a combination of controllable things and uncontrollable things. That's why separating the two, and controlling for the uncontrollable (xFIP) is important for perspective. I didn't disregard any statistics. I just looked beyond them. You don't pay De La Rosa as if he were a 2.50 ERA pitcher (i.e., disregard ERA completely). On the other hand, if he's likely to get paid like a 4.50 guy, but could very well be a 4.00 guy, that's a substantial discount, and one worth pursuing. Clearly, looking beyond the single statistic you rely on isn't a more limited approach than glancing at ERA and assuming you've got a handle on things. I mean, that's clear to me, at least. | Mid | [
0.55188679245283,
29.25,
23.75
] |
Q: Mutating table on Oracle SQL trigger I'm trying to do a trigger but I get a mutating table error. The SQL code is something like this: CREATE OR REPLACE TRIGGER CHK_Apartado_D BEFORE INSERT OR UPDATE ON CONTRACTS FOR EACH ROW DECLARE errorvisualizacion EXCEPTION; local_enddate DATE; BEGIN SELECT enddate INTO local_enddate FROM CONTRACTS WHERE clientid=:new.clientid; IF local_enddate > SYSDATE OR local_enddate IS NULL THEN UPDATE CONTRACTS SET enddate = SYSDATE - 1 WHERE clientid=:new.clientid; END IF; END CHK_Apartado_B; / And the error that I get is this: Informe de error - Error SQL: ORA-04091: table HR.CONTRACTS is mutating, trigger/function may not see it ORA-06512: at "HR.CHK_APARTADO_D", line 5 ORA-04088: error during execution of trigger 'HR.CHK_APARTADO_D' ORA-06512: at "HR.CHK_APARTADO_D", line 8 ORA-04088: error during execution of trigger 'HR.CHK_APARTADO_D' 04091. 00000 - "table %s.%s is mutating, trigger/function may not see it" *Cause: A trigger (or a user defined plsql function that is referenced in this statement) attempted to look at (or modify) a table that was in the middle of being modified by the statement which fired it. *Action: Rewrite the trigger (or function) so it does not read that table. When I INSERT a new contract I have to check if that client have an other contract in actual date, and if he have I must update de end date contracte to yesterday and let the new INSERT. So, how can I do to prevent the mutating table? A: Your trigger fires on update or insert of CONTRACTS and then tries to update CONTRACTS, which fires the trigger.... See the problem? You need to work out the enddate and then actually do the insert / update. | Mid | [
0.631578947368421,
34.5,
20.125
] |
Q: How to insert a table in ms excel using apache java poi I am trying to insert a table in Excel using Java Apache Poi. But when I am opening the xlsx file it is throwing the following error and I could not solve it: Removed Part: /xl/tables/table1.xml part with XML error. (Table) Load error. Line 2 repaired records: table from /xl/tables/table1.xml part (table) My code is the following: import java.io.FileNotFoundException; import java.io.FileOutputStream; import java.io.IOException; import org.apache.poi.xssf.usermodel.XSSFSheet; import org.apache.poi.xssf.usermodel.XSSFTable; import org.apache.poi.xssf.usermodel.XSSFWorkbook; import org.openxmlformats.schemas.spreadsheetml.x2006.main.CTTable; import org.openxmlformats.schemas.spreadsheetml.x2006.main.CTTableColumn; import org.openxmlformats.schemas.spreadsheetml.x2006.main.CTTableColumns; import org.openxmlformats.schemas.spreadsheetml.x2006.main.CTTableStyleInfo; public class Test { public static void main(String[] args) throws FileNotFoundException, IOException { XSSFWorkbook workbook = new XSSFWorkbook(); XSSFSheet sheet = workbook.createSheet("Architecture"); XSSFTable table = sheet.createTable(); CTTable cttable = table.getCTTable(); cttable.setDisplayName("Table1"); cttable.setId(1); cttable.setName("Test"); cttable.setRef("A1:C11"); cttable.setTotalsRowShown(false); CTTableStyleInfo styleInfo = cttable.addNewTableStyleInfo(); styleInfo.setShowColumnStripes(false); styleInfo.setShowRowStripes(true); CTTableColumns columns = cttable.addNewTableColumns(); columns.setCount(3); for (int i = 1; i <= 3; i++) { CTTableColumn column = columns.addNewTableColumn(); column.setId(i); column.setName("Column" + i); } try (FileOutputStream outputStream = new FileOutputStream("C:\\Office\\TimeSheet\\JavaBooks.xlsx")) { workbook.write(outputStream); } } } How can I insert a table in Microsft Excel using Apache Java Poi? A: There must be at least content in sheet cells for table column names. In your case cells A1:C1 in sheet Architecture must have content. In former versions of apache poi this content had must match the table column names. In current version now the setting the cell content updates the table column names. Your code extended to work: import java.io.FileNotFoundException; import java.io.FileOutputStream; import java.io.IOException; import org.apache.poi.xssf.usermodel.XSSFSheet; import org.apache.poi.xssf.usermodel.XSSFTable; import org.apache.poi.xssf.usermodel.XSSFWorkbook; import org.apache.poi.xssf.usermodel.XSSFRow; import org.apache.poi.xssf.usermodel.XSSFCell; import org.openxmlformats.schemas.spreadsheetml.x2006.main.CTTable; import org.openxmlformats.schemas.spreadsheetml.x2006.main.CTTableColumn; import org.openxmlformats.schemas.spreadsheetml.x2006.main.CTTableColumns; import org.openxmlformats.schemas.spreadsheetml.x2006.main.CTTableStyleInfo; public class ExcelTableTest { public static void main(String[] args) throws FileNotFoundException, IOException { XSSFWorkbook workbook = new XSSFWorkbook(); XSSFSheet sheet = workbook.createSheet("Architecture"); XSSFTable table = sheet.createTable(); //XSSFTable table = sheet.createTable(null); //since apache poi 4.0.0 CTTable cttable = table.getCTTable(); cttable.setDisplayName("Table1"); cttable.setId(1); cttable.setName("Test"); cttable.setRef("A1:C11"); cttable.setTotalsRowShown(false); CTTableStyleInfo styleInfo = cttable.addNewTableStyleInfo(); styleInfo.setName("TableStyleMedium2"); styleInfo.setShowColumnStripes(false); styleInfo.setShowRowStripes(true); CTTableColumns columns = cttable.addNewTableColumns(); columns.setCount(3); for (int i = 1; i <= 3; i++) { CTTableColumn column = columns.addNewTableColumn(); column.setId(i); column.setName("Column" + i); } for (int r = 0; r < 2; r++) { XSSFRow row = sheet.createRow(r); for(int c = 0; c < 3; c++) { XSSFCell cell = row.createCell(c); if(r == 0) { //first row is for column headers cell.setCellValue("Column"+ (c+1)); //content **must** be here for table column names } else { //cell.setCellValue("Data R"+ (r+1) + "C" + (c+1)); } } } try (FileOutputStream outputStream = new FileOutputStream("ExcelTableTest.xlsx")) { workbook.write(outputStream); } } } | Mid | [
0.567164179104477,
28.5,
21.75
] |
[An active part of female mice in sexual interaction]. Proceptive behavior, according to Beach (1976), maintains and accelerates sexual interactions toward the end goal. Such distinctive type of proceptive behavior as darting or hopping of female rats is not apparent in mice. Nevertheless, it seems more reasonable that females may take an active part as much as their male partners also in this species. Twenty sexually experienced females in estrus were paired with 20 naive males of the same strain (ICR/JCL) and the pairs were observed for 6 hours. Eleven males of the 20 pairs successfully ejaculated. Females exhibited lordosis more frequently when they actively approached the male partners than when they were approached and mounted by males. This indicated that the rate of mating success was higher in the case of female's approach. Female's approaching behavior thus possibly plays a role as a proceptive behavior in mice. | Mid | [
0.615763546798029,
31.25,
19.5
] |
Q: Excluding super script when extracting text from pdf I have extracted text from pdf line by line using pdfbox, to process it with my algorithm by sentences. I am recognizing the sentences by using period(.) followed by a word whose first letter is capital. Here the issue is, when a sentence ends with a word which has superscript, extractor treats it as a normal character and places it next to period(.) For example: expression "2 power 22" when appeared as a last word in a sentence i.e. with a period, it has been extracted as 2.22 which makes it difficult to identify the end of sentence. Please suggest a solution to get rid of super script or a different logic to identify the end of sentence. Thanks. A: I am answering my own questions, as some may get directed here. I had solved this according to @mkl suggestion. After observing the result of getYScale() in PDFStreamEngine.java, I have come to a conclusion that the size of superscript was less than 8.9663. so I had kept a condition in the PDFStreamEngine.java before creating a TextPosition, which will be processed by PDFTextStripper.java. The code is below: if(textXctm.getYScale()>=8.9663) { processTextPosition( new TextPosition( pageRotation, pageWidth, pageHeight, textMatrixStart, endXPosition, endYPosition, totalVerticalDisplacementDisp, widthText, spaceWidthDisp, c, codePoints, font, fontSizeText, (int)(fontSizeText * textMatrix.getXScale()) )); } Let me know if my approach has any flaws in eliminating only the superscripts. Thanks. | Mid | [
0.5915492957746471,
26.25,
18.125
] |
/* * File: DBoW2.h * Date: November 2011 * Author: Dorian Galvez-Lopez * Description: Generic include file for the DBoW2 classes and * the specialized vocabularies and databases * License: see the LICENSE.txt file * */ /*! \mainpage DBoW3 Library * * DBoW3 library for C++: * Bag-of-word image database for image retrieval. * * Written by Rafael Muñoz Salinas, * University of Cordoba (Spain) * * * \section requirements Requirements * This library requires the OpenCV libraries, * as well as the boost::dynamic_bitset class. * * \section citation Citation * If you use this software in academic works, please cite: <pre> @@ARTICLE{GalvezTRO12, author={Galvez-Lopez, Dorian and Tardos, J. D.}, journal={IEEE Transactions on Robotics}, title={Bags of Binary Words for Fast Place Recognition in Image Sequences}, year={2012}, month={October}, volume={28}, number={5}, pages={1188--1197}, doi={10.1109/TRO.2012.2197158}, ISSN={1552-3098} } </pre> * * \section license License * This file is licensed under a Creative Commons * Attribution-NonCommercial-ShareAlike 3.0 license. * This file can be freely used and users can use, download and edit this file * provided that credit is attributed to the original author. No users are * permitted to use this file for commercial purposes unless explicit permission * is given by the original author. Derivative works must be licensed using the * same or similar license. * Check http://creativecommons.org/licenses/by-nc-sa/3.0/ to obtain further * details. * */ #ifndef __D_T_DBOW3__ #define __D_T_DBOW3__ /// Includes all the data structures to manage vocabularies and image databases #include "../src/Vocabulary.h" #include "../src/Database.h" #include "../src/BowVector.h" #include "../src/FeatureVector.h" #include "../src/QueryResults.h" #endif | Mid | [
0.654627539503386,
36.25,
19.125
] |
VANCOUVER British Columbia, Aug. 08, 2019 (GLOBE NEWSWIRE) -- AZINCOURT ENERGY CORP. (“Azincourt” or the “Company”) (TSX.V: AAZ, OTC: AZURF), is pleased to provide an update on its operational plans at the East Preston uranium project, located in the western Athabasca Basin, northern Saskatchewan, Canada. Drill targeting and permitting are already underway and ahead of schedule. The proposed winter 2019-2020 drill program will comprise 2,000-2,500 meters of land-based diamond drilling with a budget of approximately $1.2M CDN. Drilling will consist of up to 15 holes in several high priority target zones. “I am pleased that planning for the next drill program at East Preston has commenced and the Company is fully funded to complete a substantial campaign this winter. We have started prioritizing targets from the substantial, quality target inventory on the project,” said Ted O’Connor, director and Technical Advisor for East Preston. The East Preston uranium project targets basement-hosted unconformity related uranium deposits similar to NexGen’s Arrow deposit and Cameco’s Eagle Point mine. East Preston is located near the southern edge of the western Athabasca Basin, where the relatively shallow exploration targets have no Athabasca sandstone cover, but this deposit style can have great depth extent when discovered. The project ground is located along a parallel conductive trend between the PLS-Arrow trend and Cameco’s Centennial deposit (Virgin River-Dufferin Lake trend). The property-wide helicopter-borne Versatile Time-Domain Electromagnetic (VTEM™ Max) and Magnetic survey was completed in early 2019 and forms the primary dataset for target prioritization, combined with the knowledge gained from 2018 ground Electromagnetic and Gravity geophysical surveys and the 2019 drill program. The A Conductor Corridor now extends across the entire central project area. This complex, linear, multi-conductor system hosts geologically prospective graphitic basement rocks with apparent structural upgrading and this system alone has approximately 15 km strike length to test. This conductor system shows multiple long linear conductors with flexural changes in orientation and offset breaks in the vicinity of interpreted fault lineaments – classic targets for basement-hosted unconformity uranium deposits. These are not just simple basement conductors; they are clearly upgraded/enhanced prospectivity targets due to the interpreted structural complexity. The B/C conductor system also traverses the project area, with marked changes in orientation from NE to NW. The abrupt changes in orientation appear to occur at the intersection of a long NE trending structures interpreted from the airborne data. Figure 1: https://www.globenewswire.com/NewsRoom/AttachmentNg/422439e1-ab33-49e4-a885-d1311dcff8da Azincourt’s initial drill campaign completed in March 2019 confirmed the prospectivity of the East Preston project. Basement lithologies and graphitic structures intersected in drilling are very similar and appear analogous to the Patterson Lake South-Arrow-Hook Lake/Spitfire uranium deposit host rocks and setting. Trace element geochemistry from East Preston drill core sampling shows anomalous results for basement-hosted unconformity uranium deposit pathfinder elements: Ni, Co, Cu, Zn and As associated with graphitic intervals. Graphitic rocks hosting uranium mineralization are often associated with Ni-Co-As; Cu and Zn sulphides in anomalous, to substantial quantities. The presence of these pathfinder elements adds additional information and will enhance vectoring towards the most prospective areas of the conductor systems. “All the work done to date, including multiple geophysical and geochemical programs, and even some minimal drill testing we completed last spring, has provided us with significant data on the prospectivity of East Preston,” said president & CEO, Alex Klenman. “The data emphatically says we are in the right place for discovery. The next step is to systematically drill some of the many priority targets we have uncovered. We are looking forward to the next step, and we believe there is significant growth ahead for Azincourt,” continued Mr. Klenman. Figure 2: https://www.globenewswire.com/NewsRoom/AttachmentNg/d3d8b7b6-b273-4a29-b391-d4ef2bcf25da About East Preston Azincourt is currently earning towards 70% interest in the 25,000+ hectare East Preston project as part of a joint venture agreement with Skyharbour Resources (TSX.V: SYH), and Clean Commodities Corp (TSX.V: CLE). Extensive regional exploration work at East Preston was completed in 2013-14, including airborne electromagnetic (VTEM), magnetic and radiometric surveys. Three prospective conductive, low magnetic signature corridors have been discovered on the property. The three distinct corridors have a total strike length of over 25 km, each with multiple EM conductor trends identified. Ground prospecting and sampling work completed to date has identified outcrop, soil, biogeochemical and radon anomalies, which are key pathfinder elements for unconformity uranium deposit discovery. The Company completed a winter geophysical exploration program in January-February 2018 that generated a significant amount of new drill targets within the previously untested corridors while refining additional targets near previous drilling along the Swoosh corridor. Ground-truthing work confirmed the airborne conductive trends and more accurately located the conductor axes for future drill testing. The gravity survey identified areas along the conductors with a gravity low signature, which is often associated with alteration, fault/structural disruption and potentially, uranium mineralization. The combination/stacking of positive features has assisted in prioritizing targets. The Main Grid shows multiple long linear conductors with flexural changes in orientation and offset breaks in the vicinity of interpreted fault lineaments – classic targets for basement-hosted unconformity uranium deposits. These are not just simple basement conductors; they are clearly upgraded/enhanced prospectivity targets because of the structural complexity. The targets are basement-hosted unconformity related uranium deposits similar to NexGen’s Arrow deposit and Cameco’s Eagle Point mine. East Preston is near the southern edge of the western Athabasca Basin, where targets are in a near surface environment without Athabasca sandstone cover – therefore they are relatively shallow targets but can have great depth extent when discovered. The project ground is located along a parallel conductive trend between the PLS-Arrow trend and Cameco’s Centennial deposit (Virgin River-Dufferin Lake trend). Qualified Person The technical information in this news release has been prepared in accordance with the Canadian regulatory requirements set out in National Instrument 43- 101 and reviewed on behalf of the company by Ted O’Connor, P.Geo. a director of the Company, as well as a qualified person. About Azincourt Energy Corp. Azincourt Energy is a Canadian-based resource company specializing in the strategic acquisition, exploration and development of alternative energy/fuel projects, including uranium, lithium, and other critical clean energy elements. The Company is currently active at its joint venture East Preston uranium project in the Athabasca Basin, Saskatchewan, Canada, and the Escalera Group uranium-lithium project located on the Picotani Plateau in southeastern Peru. ON BEHALF OF THE BOARD OF AZINCOURT ENERGY CORP. “Alex Klenman” Alex Klenman, President & CEO Neither the TSX Venture Exchange nor its regulation services provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. This press release includes “forward-looking statements”, including forecasts, estimates, expectations and objectives for future operations that are subject to a number of assumptions, risks and uncertainties, many of which are beyond the control of Azincourt. Investors are cautioned that any such statements are not guarantees of future performance and that actual results or developments may differ materially from those projected in the forward-looking statements. Such forward-looking information represents management’s best judgment based on information currently available. No forward-looking statement can be guaranteed, and actual future results may vary materially. For further information please contact: Alex Klenman, President & CEO Tel: 604-638-8063 [email protected] Azincourt Energy Corp. 1430 – 800 West Pender Street Vancouver, BC V6C 2V6 | Mid | [
0.6535626535626531,
33.25,
17.625
] |
Even if she drops a truth bomb in the process. I think we can all agree, everyone has a little Monica in them. | Low | [
0.410752688172043,
23.875,
34.25
] |
version https://git-lfs.github.com/spec/v1 oid sha256:2df4f28d7417fdc38ffdf07214f85ce81959ff4459276c6f97e09b2a8cd379a9 size 14309 | Low | [
0.32939438700147705,
13.9375,
28.375
] |
Q: How to perform multiple operations with JSch I am new to SSH and JSch. When I connect from my client to the server I want to do two tasks: Upload a file (using ChannelSFTP) Perform commands, like creating a directory, and searching through a MySQL database At the moment I am using two separate shell logins to perform each task (actually I haven't started programming the MySQL queries yet). For the upload the relevant code is session.connect(); Channel channel=session.openChannel("sftp"); channel.connect(); ChannelSftp c=(ChannelSftp)channel; c.put(source, destination); And for the command I have String command = "ls -l";//just an example Channel channel=session.openChannel("exec"); ((ChannelExec)channel).setCommand(command); Should I disconnect the session after the first channel and then open the second channel? Or close the session entirely and open a new session? As I said, I'm new to this. A: One SSH session can support any number of channels - both in parallel and sequentially. (There is some theoretical limit in the channel identifier size, but you won't hit it in practice.) This is also valid for JSch. This saves redoing the costly key exchange operations. So, there is normally no need to close the session and reconnect before opening a new channel. The only reason I can think about would be when you need to login with different credentials for both actions. To safe some memory, you might want to close the SFTP channel before opening the exec channel, though. A: To give multiple commands through Jsch use shell instead of exec. Shell only support native commands of the connecting system. For example, when you are connecting windows system you can't give commands like dir using the exec channel. So it is better to use shell. The following code can be used to send multiple commands through Jsch Channel channel = session.openChannel("shell"); OutputStream ops = channel.getOutputStream(); PrintStream ps = new PrintStream(ops, true); channel.connect(); ps.println("mkdir folder"); ps.println("dir"); //give commands to be executed inside println.and can have any no of commands sent. ps.close(); InputStream in = channel.getInputStream(); byte[] bt = new byte[1024]; while (true) { while (in.available() > 0) { int i = in.read(bt, 0, 1024); if (i < 0) { break; } String str = new String(bt, 0, i); //displays the output of the command executed. System.out.print(str); } if (channel.isClosed()) { break; } Thread.sleep(1000); channel.disconnect(); session.disconnect(); } | High | [
0.693548387096774,
26.875,
11.875
] |
VUF-6002 VUF-6002 (JNJ-10191584) is a drug which acts as a potent and selective antagonist at the histamine H4 receptor. It has antiinflammatory and analgesic effects in animal studies of inflammatory diseases. See also JNJ-7777120 (same molecule but where one nitrogen has been exchanged for a carbon) References Category:Benzimidazoles Category:Piperazines Category:Anti-inflammatory agents Category:Johnson & Johnson brands Category:H4 receptor antagonists Category:Carboxamides Category:Chloroarenes | High | [
0.6693440428380181,
31.25,
15.4375
] |
/* * Copyright 2016 LinkedIn Corp. * * Licensed under the Apache License, Version 2.0 (the "License"); you may not * use this file except in compliance with the License. You may obtain a copy of * the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, WITHOUT * WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the * License for the specific language governing permissions and limitations under * the License. */ package com.linkedin.drelephant.spark.fetchers import java.util import java.util.concurrent.TimeoutException import scala.concurrent.{Await, ExecutionContext, Future} import scala.concurrent.duration.{Duration, SECONDS} import scala.util.{Failure, Success, Try} import com.linkedin.drelephant.analysis.{AnalyticJob, ElephantBackfillFetcher, ElephantFetcher} import com.linkedin.drelephant.configurations.fetcher.FetcherConfigurationData import com.linkedin.drelephant.spark.data.{SparkApplicationData, SparkRestDerivedData} import com.linkedin.drelephant.spark.fetchers.statusapiv1.ApplicationAttemptInfo import com.linkedin.drelephant.util.SparkUtils import org.apache.hadoop.conf.Configuration import org.apache.log4j.Logger import org.apache.spark.SparkConf /** * A fetcher that gets Spark-related data from a combination of the Spark monitoring REST API and Spark event logs. */ class SparkFetcher(fetcherConfigurationData: FetcherConfigurationData) extends ElephantFetcher[SparkApplicationData] with ElephantBackfillFetcher { import SparkFetcher._ import ExecutionContext.Implicits.global private val logger: Logger = Logger.getLogger(classOf[SparkFetcher]) val eventLogUri = Option(fetcherConfigurationData.getParamMap.get(LOG_LOCATION_URI_XML_FIELD)) logger.info("The event log location of Spark application is set to " + eventLogUri) private[fetchers] lazy val hadoopConfiguration: Configuration = new Configuration() private[fetchers] lazy val sparkUtils: SparkUtils = SparkUtils private[fetchers] lazy val sparkConf: SparkConf = { val sparkConf = new SparkConf() sparkUtils.getDefaultPropertiesFile() match { case Some(filename) => sparkConf.setAll(sparkUtils.getPropertiesFromFile(filename)) case None => throw new IllegalStateException("can't find Spark conf; please set SPARK_HOME or SPARK_CONF_DIR") } sparkConf } private[fetchers] lazy val eventLogSource: EventLogSource = { val eventLogEnabled = sparkConf.getBoolean(SPARK_EVENT_LOG_ENABLED_KEY, false) val useRestForLogs = Option(fetcherConfigurationData.getParamMap.get("use_rest_for_eventlogs")) .exists(_.toBoolean) if (!eventLogEnabled) { EventLogSource.None } else if (useRestForLogs) EventLogSource.Rest else EventLogSource.WebHdfs } private[fetchers] lazy val shouldProcessLogsLocally = (eventLogSource == EventLogSource.Rest) && Option(fetcherConfigurationData.getParamMap.get("should_process_logs_locally")).exists(_.toLowerCase == "true") private[fetchers] lazy val sparkRestClient: SparkRestClient = new SparkRestClient(sparkConf) private[fetchers] lazy val sparkLogClient: SparkLogClient = { new SparkLogClient(hadoopConfiguration, sparkConf, eventLogUri) } override def fetchData(analyticJob: AnalyticJob): SparkApplicationData = { doFetchData(analyticJob) match { case Success(data) => data case Failure(e) => throw new TimeoutException() } } private def doFetchData(analyticJob: AnalyticJob): Try[SparkApplicationData] = { val appId = analyticJob.getAppId logger.info(s"Fetching data for ${appId}") Try { Await.result(doFetchSparkApplicationData(analyticJob), DEFAULT_TIMEOUT) }.transform( data => { logger.info(s"Succeeded fetching data for ${appId}") Success(data) }, e => { logger.warn(s"Failed fetching data for ${appId}." + " I will retry after some time! " + "Exception Message is: " + e.getMessage) Failure(e) } ) } private def doFetchSparkApplicationData(analyticJob: AnalyticJob): Future[SparkApplicationData] = { if (shouldProcessLogsLocally) { Future { sparkRestClient.fetchEventLogAndParse(analyticJob) } } else { doFetchDataUsingRestAndLogClients(analyticJob) } } private def doFetchDataUsingRestAndLogClients(analyticJob: AnalyticJob): Future[SparkApplicationData] = Future { val appId = analyticJob.getAppId val restDerivedData = Await.result(sparkRestClient.fetchData(appId, eventLogSource == EventLogSource.Rest), DEFAULT_TIMEOUT) val lastAttemptInfo = restDerivedData.applicationInfo.attempts.maxBy { _.startTime } val logDerivedData = eventLogSource match { case EventLogSource.None => None case EventLogSource.Rest => restDerivedData.logDerivedData case EventLogSource.WebHdfs => val lastAttemptId = lastAttemptInfo.attemptId Some(Await.result(sparkLogClient.fetchData(appId, lastAttemptId), DEFAULT_TIMEOUT)) } val sparkApplicationData = SparkApplicationData(appId, restDerivedData, logDerivedData) // Augment missing fields. Typically such fields may be missing for backfilled jobs. augmentAnalyticJob(analyticJob, sparkApplicationData, restDerivedData, lastAttemptInfo) sparkApplicationData } private def augmentAnalyticJob(analyticJob: AnalyticJob, sparkApplicationData: SparkApplicationData, restDerivedData: SparkRestDerivedData, lastAttemptInfo: ApplicationAttemptInfo): Unit = { if (analyticJob.getQueueName == null && sparkApplicationData != null) { analyticJob.setQueueName(sparkApplicationData.appConfigurationProperties.getOrElse("spark.yarn.queue", "")) } if (analyticJob.getName == null || analyticJob.getName.isEmpty) { analyticJob.setName(restDerivedData.applicationInfo.name) } if (analyticJob.getUser == null || analyticJob.getUser.isEmpty) { analyticJob.setUser(lastAttemptInfo.sparkUser) } if (analyticJob.getStartTime <= 0) { analyticJob.setStartTime(restDerivedData.applicationInfo.attempts.minBy(_.startTime).startTime.getTime) } if (analyticJob.getFinishTime <= 0) { analyticJob.setFinishTime(lastAttemptInfo.endTime.getTime) } } /** * Fetches a list of jobs to be backfilled for analysis by Dr. Elephant. * * @param startTime Start time from when jobs have to be backfilled. * @param endTime End time upto which jobs can be backfilled. * @return list of jobs to be backfilled for analysis. * @throws Exception */ override def fetchJobsForBackfill(startTime: Long, endTime: Long): util.List[AnalyticJob] = { val list = new util.ArrayList[AnalyticJob]() sparkRestClient.fetchCompletedApplicationsData(startTime, endTime).foreach( appInfo => { val lastAttemptInfo = appInfo.attempts.maxBy { _.endTime } list.add(new AnalyticJob().setAppId(appInfo.id).setFinishTime(lastAttemptInfo.endTime.getTime). setUser(lastAttemptInfo.sparkUser).setName(appInfo.name)) }) list } } object SparkFetcher { sealed trait EventLogSource object EventLogSource { /** Fetch event logs through REST API. */ case object Rest extends EventLogSource /** Fetch event logs through WebHDFS. */ case object WebHdfs extends EventLogSource /** Event logs are not available. */ case object None extends EventLogSource } val SPARK_EVENT_LOG_ENABLED_KEY = "spark.eventLog.enabled" val DEFAULT_TIMEOUT = Duration(5, SECONDS) val LOG_LOCATION_URI_XML_FIELD = "event_log_location_uri" } | Mid | [
0.580357142857142,
32.5,
23.5
] |
Mild Cognitive Impairment in Parkinson's Disease: Clustering and Switching Analyses in Verbal Fluency Test. Mild cognitive impairment is common in non-demented Parkinson disease patients (PD-MCI) and is considered as a risk factor for dementia. Executive dysfunction has been widely described in PD and the Verbal Fluency Tests (VFT) are often used for executive function assessment in this pathology. The Movement Disorder Society (MDS) published guidelines for PD-MCI diagnosis in 2012. However, no investigation has focused on the qualitative analysis of VFT in PD-MCI. The aim of this work was to study the clustering and switching strategies in VFT in PD-MCI patients. Moreover, these variables are considered as predictors for PD-MCI diagnosis. Forty-three PD patients and twenty normal controls were evaluated with a neuropsychological protocol and the MDS criteria for PD-MCI were applied. Clustering and switching analysis were conducted for VFT. The percentage of patients diagnosed with PD-MCI was 37.2%. The Mann-Whitney U test analysis showed that PD-MCI performed poorly in different cognitive measures (digit span, Wisconsin Card Sorting Test, judgment of line orientation, and comprehension test), compared to PD patients without mild cognitive impairment (PD-nMCI). Phonemic fluency analyses showed that PD-MCI patients produced fewer words and switched significantly less, compared to controls and PD-nMCI. Concerning semantic fluency, the PD-MCI group differed significantly, compared to controls and PD-nMCI, in switches. Discriminant function analyses and logistic regression analyses revealed that switches predicted PD-MCI. PD-MCI patients showed poor performance in VFT related to the deficient use of production strategies. The number of switches is a useful predictor for incident PD-MCI. (JINS, 2017, 23, 511-520). | High | [
0.678426051560379,
31.25,
14.8125
] |
Cancer knowledge and misconceptions: a survey of immigrant Salvadorean women. This study assessed cancer knowledge, beliefs, and awareness of signs, symptoms, and early detection methods in immigrant Salvadorean women in the Washington, D.C. metropolitan area (DCMA). A face-to-face survey sampled 843 females aged 20 and above. Descriptive statistics were used to compute frequency of response for sociodemographic characteristics, beliefs, and awareness of signs, symptoms, and early detection methods. The sample's mean age was 34.5 years; 10% had no schooling, and 7.4% had more than a high school education. Sixty-six percent of the women worked full- or part-time; 16% had an annual income of $20,000 or more; and 26% reported having medical insurance. Thirty percent of the sample lacked knowledge of the etiology and spread of cancer. The statement, "Bumps on your body can cause cancer" was endorsed by 61.6%. Beliefs that "destiny cannot be changed" or "just about anything can cause cancer" were prevalent among 18.5%. "Cancer is a punishment from God" was believed by 10.9%. A general physical examination was the most frequent (82%) early detection method mentioned. The Pap test was identified by 24.2%, and mammography by 14%; 5.6% mentioned breast self examination. Similar to other Hispanics, immigrant Salvadorean women in DCMA demonstrated a lack of knowledge of cancer's signs and symptoms, and early detection methods of and beliefs about cancer. Educational programs designed specifically for immigrant Salvadorean women to increase their knowledge of cancer and prevention methods are essential. | High | [
0.67579908675799,
37,
17.75
] |
/* * Copyright (C) 2011 Red Hat, Inc. and/or its affiliates. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package org.jboss.errai.codegen.exception; /** * @author Christian Sadilek <[email protected]> */ public class OutOfScopeException extends GenerationException { private static final long serialVersionUID = 1L; public OutOfScopeException() { super(); } public OutOfScopeException(String msg) { super(msg); } } | Low | [
0.5183823529411761,
35.25,
32.75
] |
Egypt On Edge Amid Clashes, Islamist Pushback Cairo’s emblematic Tahrir Square and nearby approaches to the River Nile are largely empty and debris-strewn today and Egypt remains on edge after deadly slashes between supporters and opponents of ousted Islamist President Mohammed Morsi. Spencer Platt, Getty Images The two sides fought overnight street battles that left at least 30 dead across the increasingly divided country. Islamists are enraged at Morsi’s overthrow by millions of protesters backed by the country’s powerful military. The chaotic scenes ended only after the army rushed in with armored vehicles to separate the warring groups. The clashes had accelerated after the supreme leader of Morsi’s Muslim Brotherhood defiantly proclaimed his followers would not give up. An Associated Press reporter at the scene reported one man was stabbed and thrown from the roof of a building by Morsi supporters. Militants killed five policemen in shootings around the Sinai city of el-Arish, according to security officials. AP VIDEOS Welcome back to New Jersey Insiders It appears that you already have an account created within our VIP network of sites on . To keep your personal information safe, we need to verify that it's really you. To activate your account, please confirm your password. When you have confirmed your password, you will be able to log in through Facebook on both sites. *Please note that your prizes and activities will not be shared between programs within our VIP network. Welcome back to New Jersey Insiders It appears that you already have an account on this site associated with . To connect your existing account just click on the account activation button below. You will maintain your existing VIP profile. After you do this, you will be able to always log in to http://nj1015.com using your original account information. | Low | [
0.5055762081784381,
34,
33.25
] |
1. Introduction {#sec1} =============== NMDARs are a subtype of the ionotropic glutamate receptor family and are tetrameric assemblies, the majority of which contain two GluN1 subunits and two GluN2 subunits ([@bib12]; [@bib40]). It is thought that these subunits assemble in a 'dimer of dimers' configuration ([@bib35]) forming a central non-selective cation-conducting ion channel pore that is permeable to Na^+^, K^+^ and Ca^2+^ ions but which is blocked by Mg^2+^ ions in a voltage-dependent manner ([@bib40]). Alternative splicing of exons 5, 21 and 22 gives rise to eight GluN1 subunit isoforms ([@bib39]) while 4 separate genes encode GluN2A-D subunits. These GluN2 subunits are spatially and temporally regulated ([@bib27], [@bib26]) and give rise to the majority of the distinct pharmacological and biophysical properties exhibited by NMDAR subtypes ([@bib8]; [@bib14]; [@bib40]). *In vivo* glutamate binds to the ligand-binding domain (LBD) of GluN2 subunits, while glycine (or [d]{.smallcaps}-serine) binds to the homologous structure in GluN1 subunits and activation of NMDARs has an absolute requirement that these sites are occupied by their respective ligands ([@bib21]; [@bib22]). Conversely, antagonism of NMDARs can be achieved by blocking agonist function at either GluN1 or GluN2 LBDs. Relatively few NMDAR subtype-selective antagonists exist ([@bib30]) and until recently only the non-competitive allosteric inhibitors ifenprodil ([@bib41]), CP 101,606 ([@bib28]) and Ro 256981 ([@bib16]) are sufficiently selective for GluN2B-containing NMDARs to be identified unambiguously. For GluN2A-containing NMDARs the competitive antagonist NVP-AAM077 ([@bib3]) can be used to isolate GluN2A-containing NMDAR-mediated responses but care must be taken to use this antagonist at concentration that has minimal action at GluN2B-containing NMDARs since it only weakly discriminates between these two NMDAR subtypes ([@bib18]; [@bib29]; [@bib43]). More promisingly, two compounds have recently been identified ([@bib5]), now referred to as TCN 201 (originally called Compound 1) and TCN 213 (originally Compound 13), that appear to be selective for GluN1/GluN2A over GluN1/GluN2B NMDARs. In a recent study we have characterized the nature of TCN 213 antagonism and have demonstrated that this compound displays a high selectivity for GluN2A-containing NMDARs and can be used to monitor, pharmacologically, the switch in NMDAR expression in developing cortical neurones ([@bib25]). The mechanism of TCN 213 appears to be paradoxical in nature; whilst the compound selects for GluN2A-containing NMDARs, the potency of TCN 213 block is dependent on the concentration of glycine and not that of glutamate. Using Schild analysis, TCN 213 was found to possess an equilibrium constant (*K*~B~) of 2 μM. Although estimates of the concentration of glycine (or [d]{.smallcaps}-serine) *in vivo* have not been determined, unequivocally, they are likely to be in the micromolar range, while typically concentrations of at least 30 μM are contained in artificial cerebro-spinal fluid solutions when performing assays of NMDAR function to ensure saturation of the GluN1 binding site. Use of glycine (or [d]{.smallcaps}-serine) at this concentration, which is equal to 20 × its EC~50~ value at GluN1/GluN2A NMDARs ([@bib10]), limits the effectiveness of TCN 213 due to this antagonist\'s comparatively low affinity. Therefore relatively high concentrations of TCN 213 need to be used to achieve substantial block of GluN2A NMDAR-mediated responses ([@bib25]). The present study reports the pharmacological characterization of TCN 201 -- an antagonist suggested to be more potent than TCN 213 ([@bib5]) while still discriminating between GluN1/GluN2A and GluN1/GluN2B NMDARs. Our data show that TCN 201 is indeed more potent than TCN 213, but like TCN 213, its antagonism is also GluN1 co-agonist dependent. Furthermore the nature of its antagonism is not competitive and our results are consistent with it having an allosteric modulatory effect on glycine (or [d]{.smallcaps}-serine) binding. Complementary to our recent genetic approach to elucidate the GluN2 subunit dependency of NMDAR excitotoxicity ([@bib24]), TCN 201 can also be used to assess the contribution of GluN2A subunits and adds to the list of new GluN2A-selective ligands in the pharmacological toolbox that can be used to elucidate NMDAR subunit composition and function. 2. Materials and methods {#sec2} ======================== 2.1. Plasmid constructs, cRNA synthesis and receptor expression in oocytes {#sec2.1} -------------------------------------------------------------------------- Nomenclature of NMDA receptor subunits follows [@bib12] and [@bib1]. pSP64T-based plasmid constructs containing cDNA coding for rat GluN1-1a (i.e. the splice variant that lacks exon 5, but contains exons 21 and 22), hereafter termed GluN1 and wild-type rat GluN2A receptor subunits were prepared as described by ([@bib9]). The rat GluN2B-containing cDNA expression vector was a gift by Stephen Traynelis (Emory University, Atlanta, GA). cRNA was synthesized as runoff transcripts as previously detailed ([@bib9], [@bib10]; [@bib15]). Fluorescence intensity in ethidium bromide-stained agarose gels was employed to confirm the fidelity and yield of synthesized cRNAs. For recombinant receptor expression, GluN1 and GluN2 cRNAs were mixed at a nominal ratio of 1:1 and diluted with nuclease-free water to 5 ng μl^−1^. Oocytes (Stage V--VI) were removed from *Xenopus laevis* that had been killed in accordance with current UK Home Office protocols and defolliculated by initial collagenase treatment, then manually using forceps. 23--37 nl of cRNA mix was injected into oocytes which were subsequently maintained in Barth\'s solution (composition in mM: NaCl 88, KCl 1, NaHCO~3~ 2.4, MgCl~2~ 0.82, CaCl~2~ 0.77, Tris-Cl 15, adjusted to pH 7.35 with NaOH and supplemented with 50 IU ml^−1^ penicillin, 50 μg ml^−1^ streptomycin, 50 μg ml^−1^ tetracycline) for 24--48 h at 19 °C to allow for receptor expression and then stored at 4 °C until required for electrophysiological measurements. 2.2. Culture of rat cortical neurones {#sec2.2} ------------------------------------- Cortical neurones from E21 Sprague--Dawley rat embryos were cultured as described previously ([@bib4]; [@bib23]; [@bib32]) except that the Neurobasal-A growth medium contained B27 (Invitrogen, Paisley, UK), 1% rat serum (Harlan UK Ltd, Oxon, UK) and 1 mM glutamine. At days *in vitro* (DIV) 4, 1 ml growth medium containing 9.6 μM cytosine β-[d]{.smallcaps}-arabinofuranoside hydrochloride (AraC) was added to each well to inhibit glial cell proliferation. Culture media were replenished every 2 days after DIV 9 by replacing 1 ml of the conditioned media with 1 ml of fresh growth medium that lacked rat serum but was supplemented with glucose (10 mM). 2.3. Transfection of cortical neurones {#sec2.3} -------------------------------------- Neurones were transfected on DIV 7 using Lipofectamine 2000 (Invitrogen) according to the manufacturer\'s suggested protocol. Briefly, pCis-GluN2A (0.4 μg) ([@bib34]) together with eGFP (0.2 μg) in a volume of 333 μl was added per well of a 24-well plate. After 5 h this transfection solution was removed and replaced with Neurobasal-A growth medium (2 ml per well). Transfected neurones were incubated to enable GluN2A expression for a further 2--3 days (DIV 9--10). We have previously demonstrated that co-transfection of β-globin and eGFP did not significantly alter ifenprodil sensitivity of DIV 7--11 neurones ([@bib25]) and in the present study non-transfected DIV 9--10 cells were used as 'controls' in sister cultures. Transfection efficiency was approximately 5% with \>99% of eGFP-expressing cells being identified as NeuN-positive while \<1% were GFAP positive ([@bib37]). Electrophysiological recordings were made from transfected neurones 48--72 h post-transfection. 2.4. Electrophysiological recordings {#sec2.4} ------------------------------------ Two-electrode voltage-clamp (TEVC) recordings were made using a GeneClamp 500 amplifier (Molecular Devices, Sunnyvale, CA) at room temperature (18--21 °C) from oocytes placed in a bath that was perfused with a solution comprising (in mM): NaCl 115, KCl 2.5, HEPES 10, BaCl~2~ 1.8, EDTA 0.01; pH 7.4 with NaOH. Note EDTA was included to chelate contaminating low nanomolar levels of Zn^2+^ that potently block of GluN2A-containing NMDARs in a voltage-independent manner. Current and voltage electrodes were made from thin-walled borosilicate glass (GC150TF-7.5, Harvard Apparatus, Kent, UK) using a PP-830 electrode puller (Narishige Instruments, Tokyo, Japan) and when filled with 0.3 M KCl possessed resistances of between 1 and 2 MΩ. TEVC recordings were performed at −30 or −40 mV. Currents were filtered at 10 Hz and digitized online at 100 Hz, *via* a Digidata 1200 A/D interface (Molecular Devices, Union City, CA, USA), using WinEDR 3.1.9 software (Strathclyde Electrophysiology Software, Strathclyde University, UK). Whole-cell NMDA-evoked currents in rat cultured cortical neurones were recorded using an Axopatch 200B amplifier (Molecular Devices) using patch-pipettes made from thick-walled borosilicate glass with a tip resistance of 4--8 MΩ that were filled with an 'internal' solution that contained (in mM): K-gluconate 141, NaCl 2.5, HEPES 10, EGTA 11; pH 7.3 with KOH. Experiments were conducted at room temperature (18--21 °C) in an 'external' solution containing (in mM): NaCl 150, KCl 2.8, HEPES 10, CaCl~2~ 2, glucose 10, EDTA 0.01; pH to 7.3 with NaOH. Picrotoxin (50 μM) and tetrodotoxin (300 nM) were included to block GABA~A~ receptor-mediated responses and action potential driven excitatory/inhibitory postsynaptic events, respectively. Access resistances were monitored and recordings where this changed by \>20% were discarded. Currents were filtered at 2 kHz and digitized online at 5 kHz *via* a BNC-2090A/PCI-6251 DAQ board interface (National Instruments, Austin, TX, USA) and analyzed using WinEDR 3.1.9 software (Dr John Dempster, University of Strathclyde, Glasgow, UK). 2.5. Assessment of antagonist potencies {#sec2.5} --------------------------------------- The concentration of TCN 201 required to inhibit 50% (IC~50~) of agonist-evoked responses were determined by fitting data to the equation:$$I = I_{{\lbrack B\rbrack}_{\infty}} + \left( {\left( {I_{{\lbrack B\rbrack}_{0}} - I_{{\lbrack B\rbrack}_{\infty}}} \right)/\left( {1 + \left( {\left\lbrack B \right\rbrack/\text{IC}_{50}} \right)^{n_{\text{H}}}} \right)} \right),$$where *I* is current response, $I_{{\lbrack B\rbrack}_{0}}$ is predicted maximum current in the absence of antagonist, $I_{{\lbrack B\rbrack}_{\infty}}$ is the predicted minimum current in the presence of an infinite concentration of antagonist,\[*B*\] is the concentration of the antagonist and *n*~H~ represents the Hill coefficient. To obtain an overall mean IC~50~ value, data points were normalised to the predicted maximum, pooled and refitted with the equation, with the maximum of each curve being constrained to asymptote to 1 but with the minimum fitted as a free parameter ([@bib31]; [@bib42]). In addition we fitted data points where both the maximum and minimum were constrained (to 1 and 0, respectively). The *F* ratio was calculated from the following equation:$$F = \frac{\left( {\text{SSR}_{1} - \text{SSR}_{2}} \right)/\left( {\text{DF}_{1} - \text{DF}_{2}} \right)}{\text{SSR}_{2}/\text{DF}_{2}},$$where SSR~1~ and SSR~2~ are the sum of squared residuals of the constrained and unconstrained fits respectively and DF~1~ and DF~2~ are the degrees of freedom associated with each of the two fits. 2.6. Schild analysis {#sec2.6} -------------------- TCN 201 antagonism at the GluN1/GluN2A NMDAR was examined by the Schild method ([@bib2]; [@bib43]). Dose-ratios (*r*) were defined as the ratio of the concentration of agonist, in the presence of a fixed concentration of antagonist, required to evoke the same response that was obtained in the absence of the antagonist. Dose-ratios from individual oocytes were determined at low agonist concentrations by constructing a partial concentration-response curve generated in the absence of antagonist and in the presence of a series of increasing antagonist concentrations. Due to the lack of sufficient perfusion lines, the dose-ratio estimate for the higher concentrations of TCN 201 (3 and 10 μM) was determined in a separate series of experiments from those carried out for the lower two concentrations (0.3 and 1 μM). Each series of two-point concentration-response curves were plotted on a log--log scale and the slope of the line used to fit the initial (antagonist-free) two-point concentration-response curve was used to fit the remaining curves. These parallel fits were used to calculate an overall mean *r* value for each antagonist concentration \[*B*\], which were then used to construct a Schild plot. On a log--log scale the gradient of the line used to fit such data is predicted by the Schild equation to be unity for a competitive antagonist. Thus, if the slope of a 'free' fit was not significantly different from 1, then the results were taken to be consistent with the Schild equation, and the data were refitted with the slope fixed at 1, i.e. they were refitted with the Schild equation,$$r - 1 = \frac{\left\lbrack B \right\rbrack}{K_{\text{B}}},$$in which the only free parameter is the intercept on the *x*-axis and which gives the equilibrium constant for antagonist binding, *K*~B~. For 'allosteric' antagonism at equilibrium, the Schild plot deviates from unity at higher concentrations of antagonist ([@bib11]). Such data can be fitted with the following modified equation:$$r - 1 = \frac{\left\lbrack B \right\rbrack\left( {1 - \alpha} \right)}{\alpha\left\lbrack B \right\rbrack + K_{\text{B}}^{\text{\#}}},$$where *α* is the allosteric constant and *K*~B~^\#^ is the estimated allosteric antagonist dissociation constant. Note that if *α* = 0, this equation simply reduces to the Schild equation. In addition, and unlike the Schild equation, *K*~B~^\#^ does not give an *r* value equal to 2 when *K*~B~^\#^ equals \[*B*\] but rather will give an *r* value \< 2 for 0 \< *α* \< 1 and thus *K*~B~^\#^ should not be interpreted in the same way as the *K*~B~ of a competitive antagonist. 2.7. Chemicals {#sec2.7} -------------- Glutamate, glycine and [d]{.smallcaps}-serine were purchased from Sigma--Aldrich (Poole, UK). TCN 201, TCN 213, NMDA, ifenprodil, picrotoxin and tetrodotoxin were purchased from Tocris Bioscience (Bristol, UK). Stock solutions (3 mM) of TCN 201 were made by dissolving the antagonist in DMSO. Due to the limited solubility of TCN 201 the maximum concentration used in our experiments was 10 μM -- at higher concentrations a noticeable precipitate was observed in the external recording solutions used in either the TEVC experiments or whole-cell patch-clamp experiments. 2.8. Statistical analysis {#sec2.8} ------------------------- Results are presented as mean ± standard error of the mean and statistical comparison between datasets was assessed using either Student\'s *t-*test (paired where appropriate) or analysis of variance (ANOVA) tests to determine whether differences between mean values were significant (*p* \< 0.05). Analysis of the fitting inhibition curves to unconstrained or constrained minima was assessed using an *F*-test. Microcal Origin v8.0 software was used for graphical presentation. 3. Results {#sec3} ========== 3.1. TCN 201 demonstrates potent but GluN1 co-agonist concentration-dependent inhibition of GluN1/GluN2A NMDAR-mediated responses {#sec3.1} --------------------------------------------------------------------------------------------------------------------------------- [Fig. 1](#fig1){ref-type="fig"}ai shows two representative TEVC current traces recorded from a *X. laevis* oocyte and mediated by recombinantly expressed GluN1/GluN2A NMDARs. The extent of the antagonism exhibited by TCN 201 is dependent on the glycine concentration present in the external recording solution and noticeably less inhibition is present in the righthand trace (\[glycine\] = 30 μM; 20 × its EC~50~ value). [Fig. 1](#fig1){ref-type="fig"}aii illustrates a comparable experiment where TCN 213, rather than TCN 201, was used -- again note the decrease in the level of inhibition when glycine is present at the higher concentration. [Fig. 1](#fig1){ref-type="fig"}aiii shows the mean inhibition observed in a series of experiments for both TCN 201 and TCN 213 antagonism of GluN1/GluN2A NMDAR-mediated currents recorded in the presence of the lower (10 μM) or higher (30 μM) external glycine concentration. On average, and with glycine at 10 μM, TCN 201 produced 82.4 ± 1.1% (*n* = 12) inhibition whereas TCN 213 gave significantly less block (44.0 ± 2.2%; *n* = 11) of GluN1/GluN2A NMDAR-mediated currents (*p* \< 0.001). Although both TCN 201 and TCN 213 gave less inhibition of currents evoked in the presence of the higher glycine concentration (50.7 ± 1.1%; *n* = 8 and 17.3 ± 1.4%; *n* = 9, respectively) the difference in potency between the two antagonists is still clearly evident (*p* \< 0.001). In contrast to the observed glycine dependency, the potency of block of TCN 201 (10 μM) was not dependent on the glutamate concentration used to evoke GluN1/GluN2A NMDAR-mediated currents ([Fig. 1](#fig1){ref-type="fig"}b). In these experiments glutamate was applied at either 3, 10 or 30 μM, while the glycine concentration was fixed at 30 μM. For each of the glutamate concentrations tested, the extent of block by TCN 201 was not significantly different (*F*~(2,14)~ = 1.839, *p* = 0.19, one-way ANOVA), with the mean values for the percentage inhibition being 54.5 ± 3.4% (*n* = 5; 3 μM), 52.2 ± 3.7% (*n* = 6; 10 μM) and 45.8 ± 2.8% (*n* = 6; 30 μM). To assess TCN 201\'s selectivity for GluN1/GluN2A NMDARs a similar series of experiments to those illustrated in [Fig. 1](#fig1){ref-type="fig"}ai were performed but in oocytes that expressed GluN1/GluN2B NMDARs. As shown in [Fig. 1](#fig1){ref-type="fig"}c TCN 201 (10 μM) produced only slight inhibition of GluN1/GluN2B NMDAR-mediated currents. For glycine concentrations of 3, 10 and 30 μM the extent of block by TCN 201 was not significantly different (*F*~(2,15)~ = 0.8116, *p* = 0.46, one-way ANOVA), with the mean values for the percentage inhibition being 1.8 ± 0.6% (*n* = 6; 3 μM), 3.1 ± 1.0% (*n* = 6; 10 μM) and 3.1 ± 0.8% (*n* = 6; 30 μM). Thus our data demonstrate that TCN 201 selectively block GluN1/GluN2A NMDARs but in a manner that is dependent on the concentration of the GluN1-site agonist. 3.2. Inhibition curves for TCN 201 acting at GluN1/GluN2A NMDARs activated by glutamate and glycine or [d]{.smallcaps}-serine {#sec3.2} ----------------------------------------------------------------------------------------------------------------------------- We quantified the potency of TCN 201 by determining its IC~50~ value at GluN1/GluN2A NMDARs under conditions where either glycine or [d]{.smallcaps}-serine was used as the GluN1-site agonist. Additionally, since IC~50~ values are dependent on the concentration of the agonist used to evoke responses ([@bib43]) three concentrations of each agonist were examined. As glycine and [d]{.smallcaps}-serine display the same potency at GluN1/GluN2A NMDARs ([@bib10]) we were able to use the same concentrations of each agonist in this series of experiments. [Fig. 2](#fig2){ref-type="fig"}ai shows a representative TEVC current trace where the NMDAR-mediated current was evoked by a saturating concentration of glutamate (30 μM; ([@bib15])) and glycine (3 μM; 2 × its EC~50~ value). Increasing concentrations (0.03--10 μM) of TCN 201 were applied cumulatively to inhibit the current. [Fig. 2](#fig2){ref-type="fig"}aii illustrates a similar experiment but under conditions where the glycine concentration was increased (30 μM; 20 × its EC~50~ value). It is evident that TCN 201 causes substantially less inhibition of the TEVC current trace illustrated in [Fig. 2](#fig2){ref-type="fig"}aii. The mean data obtained from a series of such experiments are shown in [Fig. 2](#fig2){ref-type="fig"}b. As described in Materials and Methods these data were fitted in two ways -- either the predicted minimum value of the fit was left unconstrained (solid lines) or constrained to asymptote to zero (dashed lines). For each of the glycine concentrations examined fitting the data points with curves with an unconstrained minima led to significantly improved the fits (*F*~(4,3)~ = 10.34, *p* = 0.0422; 3 μM; *F*~(4,3)~ = 17.43, *p* = 0.0204; 10 μM; *F*~(4,3)~ = 36.28, *p* = 0.0071; 30 μM) which leads to the prediction that TCN 201 will not completely inhibit responses mediated by GluN1/GluN2A NMDARs. The calculated IC~50~ values (which in this context is the concentration of antagonist that gives 50% of the *maximal* amount of inhibition that can be achieved) and Hill slopes were 0.446 ± 0.026 μM, 1.42 ± 0.061 (*n* = 15, \[glycine\] = 3 μM), 0.746 ± 0.133 μM, 1.49 ± 0.21 (*n* = 5, \[glycine\] = 10 μM) and 3.89 ± 1.06 μM, 1.17 ± 0.11 (*n* = 10, \[glycine\] = 30 μM). We carried out a similar series of experiments and analyses using [d]{.smallcaps}-serine as the GluN1-site agonist ([Fig. 2](#fig2){ref-type="fig"}c, d) and again found that fitting the datasets with curves where the minima were left unconstrained produced significantly better fits than those where the minima were constrained to asymptote to zero (*F*~(4,3)~ = 106.95, *p* = 0.0014; 3 μM; *F*~(4,3)~ = 18.74, *p* = 0.0184; 10 μM; *F*~(4,3)~ = 38.63, *p* = 0.0065; 30 μM). The respective calculated IC~50~ values and Hill slopes obtained from these fits were 0.326 ± 0.018 μM, 1.57 ± 0.078 (*n* = 6, \[[d]{.smallcaps}-serine\] = 3 μM), 0.816 ± 0.231 μM, 1.33 ± 0.21 (*n* = 6, \[[d]{.smallcaps}-serine\] = 10 μM) and 1.92 ± 0.25 μM, 1.17 ± 0.07 (*n* = 6, \[[d]{.smallcaps}-serine\] = 30 μM). Thus each of the datasets obtained at either the lower, intermediate or higher GluN1-site agonist concentration were better fitted with curves in which their minima were unconstrained. This indicates that TCN 201 will not produce complete block of NMDAR-mediated responses and is consistent with the notion that the antagonism is non-competitive in nature. Furthermore, the mean values for TCN 201 inhibition of GluN1/GluN2A NMDAR-mediated currents were significantly different (*p* = 0.0119, two-tailed *t*-test) when [d]{.smallcaps}-serine, rather than glycine was used as the GluN1-site agonist at the lowest concentration examined (3 μM). This 'agonist-dependency' of IC~50~ values is not unexpected given that IC~50~ values are dependent on agonist affinity and efficacy. Thus, we therefore decided to investigate further the nature of TCN 201\'s antagonism by carrying out Schild analysis which does not suffer from such limitations ([@bib43]). 3.3. Schild analysis of TCN 201 antagonism of GluN1/GluN2A NMDAR-mediated currents {#sec3.3} ---------------------------------------------------------------------------------- Schild analysis ([@bib2]; [@bib43]) allows the unambiguous determination of the equilibrium constant (*K*~B~) for a competitive antagonist and is independent of the nature and concentration of agonist. [Fig. 3](#fig3){ref-type="fig"}a, b shows TEVC current traces that exemplify experiments carried out to determine the dose ratio (*r*) for shifts in glycine potency in the presence of increasing (0.3--10 μM) concentrations of TCN 201. Specifically, [Fig. 3](#fig3){ref-type="fig"}a depicts a series of recordings from a single oocyte where two concentrations of glycine (in the presence of glutamate (30 μM)) are applied in the absence (upper trace) or presence (middle and lower traces) of TCN 201 (0.3 and 1 μM). [Fig. 3](#fig3){ref-type="fig"}b shows a similar experiment but when the TCN 201 concentration was increased (3 and 10 μM). From these we constructed two-point concentration-response curves ([Fig. 3](#fig3){ref-type="fig"}c, d) and estimated *r* for each concentration of antagonist (*n* = 7). The mean *r* values obtained were 5.19 ± 0.4, 16.7 ± 2.1, 41.1 ± 1.5 and 49.0 ± 2.0 for 0.3, 1, 3 and 10 μM TCN 201, respectively. Note that the shift in the concentration-response curve in the presence of the highest concentration of TCN 201 (10 μM) is considerably less than would be predicted for competitive antagonism. Indeed this smaller than predicted shift is clearly observed in the Schild plot ([Fig. 3](#fig3){ref-type="fig"}e). However the first three data points (0.3, 1 and 3 μM TCN 201) appear to give a straight line. A linear regression fit of these data gives a line with a slope of 0.98 (95% confidence interval: 0.85--1.14). The fit of the data (solid line) illustrated in [Fig. 3](#fig3){ref-type="fig"}e shows a line whose slope has been constrained to unity and allows the derivation of the *K*~B~ for TCN 201 (70 nM). For comparison, data obtained from our study of TCN 213 antagonism ([@bib25]) is illustrated -- note the lower potency of this antagonist (*K*~B~ = 2 μM). Clearly however, the *entire* dataset for TCN 201 antagonism is not satisfactorily described by the Schild equation and this can be taken to indicate that TCN 201 is not acting in a competitive manner at the GluN1 agonist binding site (as indeed is also suggested by the data presented in [Fig. 2](#fig2){ref-type="fig"}). Thus, the dotted line ([Fig. 3](#fig3){ref-type="fig"}e) shows the complete dataset fitted with a modified equation ([@bib11]) which has previously been used to described agonist-surmountable 'allosteric' non-competitive antagonism at G-protein coupled receptors. This fit better describes the data and gives an allosteric *K*~B~^\#^ of 56 nM and an allosteric constant (*α*) of 0.0123. This indicates that the maximum shift in the dose ratio that can be obtained with TCN 201 is around 80-fold (= 1/α). However such a shift would only be achieved with a TCN 201 concentration of approximately 275 μM which is well above its limit of solubility. In addition we carried out Schild analysis using [d]{.smallcaps}-serine, rather than glycine, as the GluN1-site agonist ([Fig. 3](#fig3){ref-type="fig"}f). A linear regression fit of the data points obtained with 0.3, 1 and 3 μM TCN 201 gives a line with a slope of 0.87 (95% confidence interval: 0.71--1.03). The fit of the data (solid line) illustrated in [Fig. 3](#fig3){ref-type="fig"}e shows a line whose slope has been constrained to unity and gives a *K*~B~ for TCN 201 of 81 nM -- comparable to the value obtained when glycine was used as the GluN1-site agonist. Similar to our findings when glycine was used as the GluN1-site agonist, the data point at the highest concentration of TCN 201 (10 μM) gives an *r* value that deviates considerably from the linearity. Again using the modified equation we estimated an allosteric *K*~B~^\#^ of 66 nM and an allosteric constant of 0.0106. Given the good agreement between these values with those obtained when glycine was used as the GluN1-site agonist and data reported in a recent study which has also examined the mechanism of action of TCN 201 ([@bib19]) it would seem unlikely that the deviation from linearity of the Schild plot arises from the limitation of TCN 201\'s solubility. 3.4. Antagonism by TCN 201 of NMDAR-mediated responses in rat cortical neurones {#sec3.4} ------------------------------------------------------------------------------- In a final series of experiments we assessed the ability of TCN 201 to antagonize NMDAR-mediated currents in rat cortical neurones to assess the utility of this compound in identifying NMDAR subunit populations. It should be noted that as we used NMDA (rather than glutamate) in these experiments we determined whether TCN 201 (10 μM) blocked, to the same extent, GluN1/GluN2A NMDAR-mediated currents elicited by NMDA/glycine compared with currents elicited by glutamate/glycine. We observed significantly less inhibition of NMDA/glycine-evoked currents (69.9 ± 4.1%; *n* = 12, *p* \< 0.001, data not shown) compared to glutamate/glycine-evoked currents (91.2 ± 1.1%; [Fig. 2](#fig2){ref-type="fig"}b). This emphasizes the importance of considering the nature of the agonist used to evoke responses but establishes the maximum inhibition expected for TCN 201 block of NMDA/glycine-evoked currents for a population of NMDARs comprised *solely* of GluN1 and GluN2A NMDAR subunits. [Fig. 4](#fig4){ref-type="fig"}a shows a series of NMDAR-mediated currents recorded from rat cortical neurones under three separate conditions. [Fig. 4](#fig4){ref-type="fig"}ai shows a representative recording from a neurone (DIV 9--10) where the predominantly expressed GluN2 subunit is anticipated to be GluN2B. As is illustrated in the righthand trace and quantified in [Fig. 4](#fig4){ref-type="fig"}b, ifenprodil (3 μM) produces substantial block (80 ± 3%, *n* = 7) of this current -- as would be anticipated for a NMDAR population that contains a high proportion of GluN1/GluN2B NMDARs. Importantly, TCN 201 gives only a modest block of this current (5 ± 2%) which is comparable to the extent of TCN 201 block seen at recombinant GluN1/GluN2B NMDARs ([Fig. 1](#fig1){ref-type="fig"}c). To increase the number of GluN2A-containing NMDARs we transfected neurones with pCis-GluN2A plasmids ([@bib34]). NMDAR-mediated currents recorded from these neurones ([Fig. 4](#fig4){ref-type="fig"}aii) now displayed a reduced sensitivity to ifenprodil (24 ± 3% block, *n* = 6; [Fig. 4](#fig4){ref-type="fig"}b) but increased sensitivity to TCN 201 (47 ± 4% block, *n* = 6; [Fig. 4](#fig4){ref-type="fig"}b). Finally, the developmental increase in GluN2A expression was confirmed by recording NMDAR-mediated currents from neurones that had been cultured for longer time periods ([Fig. 4](#fig4){ref-type="fig"}aiii). In these neurones we observed that currents were less sensitive to ifenprodil (57 ± 5% block, *n* = 9; [Fig. 4](#fig4){ref-type="fig"}b) compared to those from DIV 9--10 cultures. This reduction in ifenprodil sensitivity was accompanied by an increase in the extent of the block produced by TCN 201 compared to that observed for currents in DIV 9--10 (non-transfected) cultures (16 ± 3% block, *n* = 9; [Fig. 4](#fig4){ref-type="fig"}b, *p* \< 0.01). Furthermore, while the range of ifenprodil and TCN 201 block of currents showed considerable variation within each of these groups there was a strong inverse correlation (*R*^2^ = 0.91) in the sensitivities of currents to these two NMDAR subtype-selective antagonists ([Fig. 4](#fig4){ref-type="fig"}c). A similar observation has been documented for ifenprodil and TCN 213 block of NMDAR-mediated currents in cortical neurones ([@bib25]). 4. Discussion {#sec4} ============= Three main points in regard to antagonism of NMDARs by TCN 201 are made in this study. Firstly, TCN 201 is a selective GluN1/GluN2A NMDAR antagonist showing little antagonism at GluN1/GluN2B NMDARs. Secondly, TCN 201 acts in a non-competitive manner with the extent of its block being dependent on the concentration of the GluN1-site agonist (glycine or [d]{.smallcaps}-serine) present in the external salt solution. Thirdly, TCN 201 antagonism of NMDAR-mediated currents shows a negative correlation with their ifenprodil sensitivity and therefore, in combination with ifenprodil, can be used to monitor, pharmacologically, the expression levels of GluN2A and GluN2B NMDAR subunits in neuronal populations. 4.1. GluN1-site agonist-dependency of TCN 201 antagonism {#sec4.1} -------------------------------------------------------- TCN 201 antagonism of GluN1/GluN2A NMDAR-mediated currents is glycine ([d]{.smallcaps}-serine) dependent. In this respect TCN 201 antagonism resembles that produced by the chemically-related compound TCN 213 ([@bib5]; [@bib25]). When compared with our recent study of TCN 213 antagonism of NMDARs, the data presented here show that TCN 201 is a more potent antagonist (as was predicted in binding assays performed by ([@bib5])). Furthermore, our data also suggest that TCN 201 is unable to block completely NMDAR-mediated responses under conditions where the GluN1-site agonist is present at concentrations that may reflect those found in cerebro-spinal fluid *in vivo* ([Fig. 2](#fig2){ref-type="fig"}b, d). The data obtained were fitted with curves whose minima were unconstrained predicted a maximal inhibition, in the presence of saturating glycine (or [d]{.smallcaps}-serine), of around 40%. Due to the limited solubility of TCN 201 in our solutions we were unable to verify the precise level of maximum inhibition experimentally but the predicted incomplete block of NMDARs when glycine (or [d]{.smallcaps}-serine) is present at ≥30 μM needs to be borne in mind when using this novel GluN2A-selective antagonist. 4.2. TCN 201 antagonism is not competitive {#sec4.2} ------------------------------------------ Quantitative analysis of antagonist action is best carried out using Schild analysis ([@bib2]) to determine the nature of the antagonism and (if appropriate) the *K*~B~ of the antagonist. Our analysis reveals that TCN 201 does not act in a competitive manner at GluN1/GluN2A NMDARs since the Schild plots for TCN 201 when either glycine or [d]{.smallcaps}-serine was used as the GluN1-site agonist deviated from linearity at the highest antagonist concentration used in this study (10 μM). While we were able to fit a line with unity slope to the first three data points of the TCN 201 Schild plots ([Fig. 3](#fig3){ref-type="fig"}e, f) the intercept on the *abscissa* perhaps more properly describes the concentration of TCN 201 that gives a *dose ratio* of 2 (the negative logarithm of which will equal the pA~2~ for TCN 201) rather than strictly its *K*~B~ value which should be reserved for purely competitive antagonists ([@bib43]). Comparison of pA~2~ values for TCN 201 and TCN 213 (7.15 *versus* 5.69) shows that TCN 201 is approximately 30-times more potent at GluN1/GluN2A NMDARs. The hyperbolic nature of the TCN 201 Schild plot is indicative of an allosteric non-competitive antagonism and the data points were better fitted by an alternative equation that has previously been associated with the description of action of agonist-surmountable non-competitive inhibitors acting at G-protein coupled receptors ([@bib11]). In the case of these surmountable non-competitive inhibitors, deviations away from unity at higher concentrations of antagonist are due to the saturable nature of the antagonism. Since saturable behaviour can be achieved, allosteric antagonists will shift the agonist concentration-response curve to the right, in a manner similar to competitive antagonism, but according to a defined limit ([@bib11]). Our estimates of an allosteric *K*~B~^\#^ of 56 nM (66 nM) and an allosteric constant of 0.0123 (0.0106), when glycine ([d]{.smallcaps}-serine) is used as the GluN1-site agonist, are in excellent agreement with a recent study that has employed a similar analysis of TCN 201 antagonism at recombinant NMDARs ([@bib19]). In their study, [@bib19] propose that TCN 201 binds to a site located at the dimer interface between the GluN1 and GluN2 agonist binding domains which leads to an acceleration of glycine ([d]{.smallcaps}-serine) unbinding from the GluN1 subunit. The data we present here are entirely consistent with such a mechanism of action. Although the allosteric constant is close to zero for TCN 201 (when either glycine or [d]{.smallcaps}-serine is used as the GluN1-site agonist) and therefore the Schild plot only begins to deviate from unity at antagonist concentrations above about 3 μM this places a limit on the maximum shift in the dose ratio that can be achieved of about 80--90-fold (=1/*α*). Our previous study with TCN 213 ([@bib25]) generated a Schild plot with a unity slope suggesting a competitive form of antagonism for this compound. It should, however, be noted that relative to its *K*~B~ (2 μM) the highest antagonist concentration used (30 μM) would not have allowed us to observe a deviation from a unity slope if TCN 213 possesses a similar allosteric constant to that of TCN 201. 4.3. Utility of TCN 201 in identifying neuronal NMDAR subtypes {#sec4.3} -------------------------------------------------------------- There are relatively few antagonists that block GluN2A-containing NMDARs in a manner that allows them to be used to identify unequivocally the subunit composition of native NMDARs ([@bib30]). The *K*~B~ values for NVP-AAM077 ([@bib3]) acting at GluN1/GluN2A and GluN1/GluN2B NMDARs are only different by a factor of 5 ([@bib18]) therefore limiting the use of this antagonist. TCN 213 ([@bib5]) although possessing lower potency than NVP-AAM077 at GluN1/GluN2A exhibits little activity at either recombinant or native GluN2B-containing NMDARs ([@bib25]) allowing it to be used to distinguish, pharmacologically, responses mediated by these two NMDAR subtypes. Our data ([Fig. 4](#fig4){ref-type="fig"}) shows that TCN 201, like TCN 213, blocks NMDAR-mediated currents in cortical neurones in a manner that is negatively correlated with the extent of block produced by the GluN2B NMDAR antagonist, ifenprodil ([@bib25]). In primary cultures of 'young' neurones, TCN 201 produced little block of NMDA-evoked currents consistent with the notion that such populations are predominantly GluN2B-containing NMDARs ([@bib6]; [@bib13]; [@bib17]; [@bib20]; [@bib36]; [@bib38]). Overexpression of GluN2A NMDAR subunits in such cultures gave rise to responses that showed increased sensitivity to TCN 201. Indeed in those cells which showed the greatest block by TCN 201 (and least sensitivity to ifenprodil) the extent of this block indicated that the ifenprodil-insensitive current component was mediated by populations of NMDARs mainly comprised of *only* GluN1 and GluN2A subunits since the amount of block obtained was similar to that seen when TCN 201 antagonized NMDA-evoked responses in oocytes expressing GluN1/GluN2A NMDARs. Finally in older cultures the extent of TCN 201 block was variable but always (negatively) correlated with that of ifenprodil and indicated an increased expression of GluN2A-containing NMDARs, as is to be expected with this stage of development. What remains to be determined is the relative contribution of heterodimeric (GluN1/GluN2A) and heterotrimeric (GluN1/GluN2A/GluN2B) NMDAR combinations in this population. Related to this is the fact that we do not know the potency of TCN 201 when it acts at GluN2A/B-containing heterotrimeric NMDARs -- a combination thought to represent a substantial proportion of NMDARs in the adult forebrain ([@bib7]; [@bib33]). 5. Conclusion {#sec5} ============= TCN 201 is a potent selective inhibitor of GluN1/GluN2A NMDARs that displays only minimal activity at GluN1/GluN2B NMDARs. The potency of its antagonism is dependent on the concentration of the GluN1-site agonist and not that of the GluN2-site agonist. Schild analysis demonstrates that the nature of its antagonism is not competitive but rather is consistent with the notion that TCN 201 acts by an allosteric non-competitive mechanism. TCN 201, like TCN 213 ([@bib25]), can be used to monitor, pharmacologically, the change in GluN2 NMDAR subunit expression levels in developing central neurones. Nevertheless, while TCN 201 offers the opportunity to block selectively GluN2A-containing NMDARs care must be taken in experimental designs to take account of (1) TCN 201 block is strongly-dependent on the GluN1-site agonist concentration and (2) TCN 201 possesses a comparatively low solubility in salt solutions that are commonly used when assessing NMDAR function. Conflict of interest {#sec6} ==================== The authors state no conflict of interest. This work was supported by the funds from The Wellcome Trust, the Biotechnology and Biological Sciences Research Council (BBSRC) and the Honours Programme in Pharmacology at The University of Edinburgh. We thank Kasper Hansen, Kevin Ogden and Stephen Traynelis for sharing unpublished data on TCN 201\'s mechanism of action. {#fig1} ![Inhibition curves for TCN 201 antagonism of GluN1/GluN2A NMDAR-mediated responses activated by co-agonists glycine or [d]{.smallcaps}-serine. (ai), TEVC trace recorded from an oocyte expressing GluN1/GluN2A NMDARs and voltage-clamped at −30 mV. The upper bar in this trace and in panels (aii), (ci) and (cii) indicates the duration of the bath application of glutamate/glycine, while the shaded bar in this panel (and in (ai), (ci) and (cii)) indicates the co-application TCN 201. Increasing concentrations of TCN 201 were applied, cumulatively, as indicated by the arrowheads. (aii), as in (ai), but currents are evoked using a higher concentration of glycine (30 μM). Note that TCN 201-mediated inhibition is less at this higher glycine concentration. (b), mean normalised inhibition curves for TCN 201 block of GluN1/GluN2A NMDAR-mediated currents evoked by glutamate (30 μM) and either 3 μM (*n* = 15; ■), 10 μM (*n* = 5; ) or 30 μM (*n* = 10; ) glycine. The solid curves show the fit with the minimum fitted as a free parameter, whereas the dashed curves show the fit of the data points when the minimum valued was constrained to 0 (see [Materials and methods](#sec2){ref-type="sec"}). (ci), as in (ai) but where currents were evoked by glutamate (30 μM) and [d]{.smallcaps}-serine (3 μM), again increasing concentrations of TCN 201 (0.03--10 μM) were applied, cumulatively, as indicated by the arrowheads. (cii), as in (ci), but where currents were the [d]{.smallcaps}-serine was 30 μM. (d), mean normalised inhibition curves for TCN 201 block of GluN1/GluN2A NMDAR-mediated currents activated by glutamate (30 μM) and either 3 μM (*n* = 6; ■), 10 μM (*n* = 6; ) or 30 μM (*n* = 6; ) [d]{.smallcaps}-serine.](gr2){#fig2} ), 1 μM (), 3 μM () and 10 μM (). (e), Schild plot for antagonism by TCN 201 of GluN1/GluN2A NMDARs using dose-ratios estimated from a series experiments such as that illustrated in (c) and (d). A 'free' fit of the 0.3, 1 and 3 μM TCN 201 data points gave has a slope of 0.98 which was considered not to be significantly different from 1 (95% confidence interval: 0.85--1.14). Thus the *solid line* is the fit of the respective data points to the Schild equation (i.e. the slope of this line is unity). The intercept on the *abscissa* (where the log~10~ value of the dose-ratio -- 1 equals zero) gives an equilibrium constant (*K*~B~) value for TCN 201 of 70 nM. Data from [@bib25] where the *K*~B~ value for TCN 213 was determined, is illustrated in *grey* for reference. The dotted line shows the fit of all data points with a modified equation (see [Material and methods](#sec2){ref-type="sec"}; [@bib11]) that takes into account allosteric modulation of glycine binding by TCN 201. The fit predicts an allosteric *K*~B~^\#^ value of 56 nM and an allosteric constant (*α*) of 0.0123. (f), Schild plot for antagonism by TCN 201 of GluN1/GluN2A NMDARs but using [d]{.smallcaps}-serine, rather than glycine, as the GluN1-site agonist. Again the *solid line* is the fit of the data to the Schild equation and gives a *K*~B~ value for TCN 201 in these experiments of 81 nM. The dotted line shows the fit of all data points to the modified equation and predicts an allosteric *K*~B~^\#^ value of 66 nM and an allosteric constant of 0.0106.](gr3){#fig3} {#fig4} | Mid | [
0.6409638554216861,
33.25,
18.625
] |
Design, synthesis, and biological evaluation of cyclic and acyclic nitrobenzylphosphoramide mustards for E. coli nitroreductase activation. In efforts to obtain anticancer prodrugs for antibody-directed or gene-directed enzyme prodrug therapy using E. coli nitroreductase, a series of nitrobenzylphosphoramide mustards were designed and synthesized incorporating a strategically placed nitro group in a position para to the benzylic carbon for reductive activation. All analogues were good substrates of E. coli nitroreductase with half-lives between 2.9 and 11.9 min at pH 7.0 and 37 degrees C. Isomers of the 4-nitrophenylcyclophosphamide analogues 3 and 5 with a benzylic oxygen para to the nitro group showed potent selective cytotoxicity in nitroreductase (NTR) expressing cells, while analogues 4 and 6 with a benzylic nitrogen para to the nitro group showed little selective cytotoxicity despite their good substrate activity. These results suggest that good substrate activity and the benzylic oxygen are both required for reductive activation of 4-nitrophenylcyclophosphamide analogues by E. coli nitroreductase. Isomers of analogue 3 showed 23,000-29,000x selective cytotoxicity toward NTR-expressing V79 cells with an IC(50) as low as 27 nM. They are about as active as and 3-4x more selective than 5-aziridinyl-2,4-dinitrobenzamide (CB1954). The acyclic 4-nitrobenzylphosphoramide mustard ((+/-)-7) was found to be the most active and most selective compound for activation by NTR with 170,000x selective cytotoxicity toward NTR-expressing V79 cells and an IC(50) of 0.4 nM. Compound (+/-)-7also exhibited good bystander effect compared to 5-aziridinyl-2,4-dinitrobenzamide. The low IC(50), high selectivity, and good bystander effects of nitrobenzylphosphoramide mustards in NTR-expressing cells suggest that they could be used in combination with E. coli nitroreductase in enzyme prodrug therapy. | High | [
0.692934782608695,
31.875,
14.125
] |
Explaining the reasoning behind the delay, Patrick Soderlund, executive vice president of EA Studios, said in a post: In these last few weeks before launch, Respawn is in the final stages of polishing the Xbox One and PC versions of the game. Bluepoint is doing the same with the Xbox 360 version. To give them the time they need to put the finishing touches on the current-gen version of the game, we are moving the Xbox 360 ship date to March 25 in North America and March 28 in Europe. The extra two weeks will ensure the full world of Xbox gamers has an awesome experience. Our Take:As my colleague Matt Miller pointed out, if Respawn is likely crunching just to finish the game in time for the Xbox One date – which surely has priority – it only makes sense that it's going to take some extra time for Xbox 360 developer Bluepoint to deal with the assets Respawn gives them. Hhhhhhh... When, oh when, will people stop referring to the 360 and PS3 as "current gen"? They're not. Sorry if you own one, and you don't like hearing it, but those are no longer current gen systems. They are last gen. | Mid | [
0.539301310043668,
30.875,
26.375
] |
Update: Romanian prosecutors raid Austrian timber producer’s local factories Prosecutors from the Directorate for Combatting Organized Crime and Terrorism (DIICOT) raided on Wednesday morning, May 30, Austrian group Schweighofer Holzindustrie’s factories in Radauti and Sebes. The prosecutors are investigating illegal timber transactions which damaged the state budget by EUR 25 million, according to judicial sources quoted by local Mediafax. Update: In a statement, Holzindustrie Schweighofer said it is cooperating with the Romanian authorities "and fully supports their efforts in the investigation started on May 30, 2018." "The company is offering all available information that might help the ongoing investigation and is assisting the authorities in all matters that might lead to a correct investigation based on fully transparent data. Holzindustrie Schweighofer is the first interested to bring light into this situation. The company has not been yet notified of the scope of the investigation." A total of 23 searches were taking place on Wednesday morning in Alba, Suceava, Hunedoara, Brasov and Bihor counties as well as in Bucharest. Some of the searches also targeted the offices of the Forestry Directions and Forest Guard. According to an official press release of the Romanian Police, managers of a local company have coordinated the acquisition of wood sourced from illegal logging activities, starting 2011. The same people were also involved in rigging timber auctions. The company was not named. Schweighofer Holzindustrie has been accused of processing wood from illegal logging activities in the past but denied the allegations. Romania’s Competition Council to finalize investigation on timber market this year Austrian timber “baron” sells his forests in Romania to Swedish group [email protected] | Mid | [
0.587234042553191,
34.5,
24.25
] |
IN THE COURT OF COMMON PLEAS FOR THE STATE OF DELAWARE IN AND FOR NEW CASTLE COUNTY STATE OF DELAWARE V. Cr.A. No.: 1611018155 DARTANYA M. MURRAY, Defendant. V\./\/\/\/VVVV MEMORANDUM OPINION AND ORDER ON DEFENDANT’S MOTION TO SUPPRESS Nathan D. Barillo, Esquire A. Dale Bowers, Esquire Off`lce of the Attorney General Caren L. Sydnor, Esquire 820 N. French Street, 7th Floor 203 North Maryland Avenue Wilmington, DE 19801 Wilmington, DE 19804 Attorney for the State of Delaware Attorneysfor the Defendant WELCH, J. I. PROCEDURAL POSTURE On November 27, 2016, Defendant Dartanya Murray (“Defendant”) was arrested and charged with Driving Under the Influence (“DUI”), in violation of 21 Del. C. § 4177; Leaving the Scene of a Property Collision Accident, in violation of 21 Del. C. § 4201(a); Driving While Suspended or Revoked, in violation of 21 Del. C. §2756(a); Failure to Provide lnformation at Collision Scene Resulting in Property Damage, in violation of 21 Del. C. § 4201(b); Out-of-State Vehicle - F ailure to Have Minimum Insurance, in Violation of 21 Del. C. § 2118(b); Driving in Improper Lane and Direction, in violation of 21 Del. C. § 4126(a)(3); Failure to Have Two Lighted Lamps Displayed, in violation of 21 Del. C. § 43 52(a); and Failure to Report a Collision Involving Alcohol or Drugs, in violation of 21 Del. C. § 4203(a)(3). On December 28, 2016, Defendant entered a plea of not guilty. On March 24, 2017, Defendant moved to suppress the results of her blood alcohol reading and statements she made to police officers while in the hospital. The Defendant raised three grounds for suppression: l) the officer failed to establish probable cause within the four-corners of the search warrant affidavit; 2) there are insufficient facts to establish probable cause to support the issuance of the search warrant when certain lines are stricken from the affidavit as required under F ranks v. Delaware;1 and 3) her statements to police officers while she Was in the hospital were not knowingly and intelligently made.2 On July 18, 2017, the Court heard the Motion to Suppress (“Motion”). Following the hearing, the Court reserved its decision on the Motion and ordered supplemental briefing. On August 8, 2017, the State filed its Response to Defendant’s Motion to Suppress (“State’s l See generally Franks v. Delaware, 438 U.S. 154 (1978). 2 Defendant’s Motion to Suppress (hereinafter “Defendant’s Motion”) at 4, 7, 10. 2 Response”).3 And, on September 27, 2017, Defendant filed her Reply Brief on Defendant ’s Motion to Suppress (“Defendant’s Reply”).4 This is the Court’s Final Decision and Order on the Defendant’s Motion to Suppress. II. w On November 27, 2016, at approximately 1131 a.m., Trooper First Class Daniel B. Galiani (“Trooper Galiani”),5 Trooper First Class Chase A. Lawson (“Trooper Lawson”),6 and Trooper First Class Earl Marchione (“Trooper Marchione”),7 of the Delaware State Police Troop One, responded to a call regarding a motor vehicle accident on I-495 southbound, near the Edgemoor Road exit. A. Testimony of Trooper First Class Galiani When Trooper Galiani arrived on the scene at approximately 1:40 a.m., he saw three vehicles that had sustained extensive front-end damage. Trooper Galiani testified that one of the vehicles was stationary, facing northbound in an I-495 southbound lane.8 Trooper Galiani testified that this vehicle (“the stationary vehicle”) was owned by Defendant and he believed it had been “hit multiple times.”9 When the State asked Trooper Galiani if he knew “how that Vehicle ended 3 State’s Response to Defendant’s Motion to Suppress (hereinafter “State’s Response”). 4 Defendant’s Reply Brief on Defendant’s Motion to Suppress (hereinafter “Defendant’s Reply”). 5 Trooper Galiani has been employed as a police officer for over two-and-a-half years, working at Troop One for over one-year. Trooper Galiani was certified iii Driving under the influence (“DUI”) enforcement during police academy, which began in December 2014. 6 Trooper Lawson has been employed as a police officer for approximately two-and-a-half years at Troop One. He is certified by the National Highway Traffic Safety Administration in DUI enforcement 7 Trooper Marchione has been employed as a police officer for approximately two-and-a-half years with the Delaware State Police. His testimony Was brief. He testified that he did not interview Defendant, Mr. Triplett, or medical personnel, but he testified that he observed injuries on Defendant_specifically a laceration to her left shoulder_that in his general training and experience as a police officer are consistent with a “high velocity” seatbelt injury that could only occur to the driver of a vehicle. Defendant objected to his testimony as regarding facts not provided to defense counsel. The State noted that Trooper Marchione was not testifying as an expert. 8 Trooper Galiani testified on cross-examination that this vehicle was not running when he arrived at the accident scene. ° On cross-examination, Trooper Galiani could not recall how he determined that Defendant owned the vehicle, beyond the annotation iii his report. Trooper Galiani agreed that the stationary vehicle was registered in Pennsylvania and Defendant is a resident of Delaware, admitting that this appeared inconsistent 3 up facing the wrong way,” he testified that he did not know. He further testified that Defendant was not at the scene when he arrived. Trooper Galiani spoke with the operators of the vehicles who were present at the accident scene. One operator stated that while he was driving he came upon a stationary vehicle without lights on and, in attempting to avoid the stationary vehicle, he hit his brakes, swerving into a vehicle in another lane which then forced his vehicle to collide with the stationary vehicle. After drafting an accident exchange report, Trooper Galiani investigated the stationary vehicle and found blood on the seat, dashboard, and windshield of the passenger side of the vehicle. He also observed a large crack in the windshield on the passenger side of the vehicle; he did not observe a crack in the driver side window. Trooper Galiani “could not recall” whether he found a registration card or insurance in the stationary vehicle.10 While at the scene of the accident, the Troopers were advised by dispatch that two individuals were dropped off earlier at Wilmington Hospital Emergency Room for treatment of “serious injuries” sustained from a motor vehicle accident. These individuals were identified as Defendant and Edmond Triplett (“Mr. Triplett”). Trooper Galiani testified that he believed an innocent bystander transported Defendant and Mr. Triplett to the emergency room, but he Was unsure exactly how they had arrived at the hospital. He further testified that neither Defendant nor Mr. Triplett reported the accident. Troopers Lawson and Marchioni responded to the hospital, while Trooper Galiani remained at the scene. Trooper Galiani testified that Trooper Lawson informed him that when Trooper Lawson arrived at the hospital and spoke with Mr. Triplett, Mr. Triplett’s head was bleeding, and he told Trooper Lawson that Defendant had been driving. Trooper Lawson then 10 Trooper Galiani also admitted on cross-examination that he was not “one-hundred percent sure” he had seen the stationary vehicle’s registration. interviewed Defendant, who was suffering from an ankle injury and chest pain, who informed him that she was traveling home from her sister’s birthday party in Philadelphia Where she had been drinking. Trooper Lawson further informed Trooper Galiani that Defendant admitted to driving the stationary vehicle, Trooper Lawson could smell the “faint amount of alcohol on her breath,” and described her eyes as glassy and bloodshot. After speaking with Trooper Lawson, Trooper Galiani traveled to Troop One to prepare a Blood Search Warrant Affidavit (the “affidavit”); Trooper Galiani testified that he included all of Trooper Lawson’s statements to him in the affidavit, including the odor of alcohol.ll A search Warrant Was signed by a magistrate of the Justice of the Peace Court and the Troop One phlebotomist traveled with Trooper Galiani to the hospital to draw Defendant’s blood. At approximately 3:5() a.m., Trooper Galiani testified that he smelled a “very faint smell of alcohol” in Defendant’s hospital room. And, at approximately 3:55 a.m., Defendant’s blood was drawn.12 Defendant’s blood draw registered a Blood Alcohol Content of 0.05. Following the test, Defendant was arrested and charged B. Testimony of Trooper First Class Lawson Trooper Lawson testified that he was dispatched to a possible motor vehicle collision. Upon arriving at the scene, he observed several vehicles and individuals on I-495 southbound. He testified that he observed a large amount of blood in the stationary vehicle, which he described as resting in the far-left-hand I-495 southbound lane. While investigating the collision, Trooper Lawson was informed by Wilmington Hospital that two individuals had arrived with severe l l Trooper Galiani admitted on cross-examination that he failed to include Trooper Lawson’s odor of alcohol statement in the affidavit. The affidavit’s exact language is reproduced in the Discussion section below. 12 Trooper Galiani testified that he was prevented from interviewing her because she was incoherent and he had difficulty understanding her. He also testified that Defendant said, “I didn’t drive; I didn’t drive” during the blood withdraW. He commented at the hearing that he Was “pretty sure” medical personnel had given Defendant medication for pain. injuries which could be consistent with a motor vehicle collision. When Trooper Lawson arrived, hospital personnel informed him that the two individuals had admitted to being involved in a motor vehicle accident on I-495. Trooper Lawson also testified that the innocent bystander who transported them to the hospital confirmed that he had picked up two individuals who had been involved in a motor vehicle collision on I-495, as one of the individuals had severe head injuries. Trooper Lawson testified that the individuals transported to Wilmington Hospital were Mr. Triplett and Defendant. At approximately 2:15 a.m., Trooper Lawson testified that he interviewed Defendant and Mr. Triplett.13 Trooper Lawson testified that Mr. Triplett suffered severe injuries to his head_ multiple lacerations and severe bleeding. He stated that Mr. Triplett informed him that Mr. Triplett was the front seat passenger of a vehicle involved in a motor vehicle collision.14 Trooper Lawson testified that Mr. Triplett never told him who was driving the vehicle. During Trooper Lawson’s interview of Defendant, Defendant informed him that she and Mr. Triplett were traveling home from her sister’s birthday party in the Philadelphia area, where Defendant had been drinking. Trooper Lawson described Defendant as uncooperative, noticed that Defendant’s eyes were “glassy and bloodshot,” and stated that he could smell alcohol in Defendant’s hospital room approximately two to three feet away from her. Trooper Lawson testified that Defendant did not inform him who was driving the stationary vehicle. He also testified that the medical personnel informed him that Defendant was complaining of ankle pain and had injuries to one of her shoulders consistent with wearing a seatbelt. Trooper Lawson did not perform any field sobriety tests on Defendant due to her injuries. 13 Trooper Lawson testified that he could not remember who he interviewed first, but that he interviewed them separately within approximately fifteen minutes of each other. 14 Trooper Lawson believed Mr. Triplett’s injuries were consistent with the cracked glass in the stationary vehicle. 6 III. DISCUSSION ln Defendant’s Motion, she moves to suppress the results of the blood test on two grounds: (1) that Trooper Galiani’s affidavit did not establish probable cause within its four-corners; and (2) that Trooper Galiani’s affidavit contained statements that recklessly disregarded the truth.15 Additionally, in Defendant’s Motion, she moved to suppress some of her statements to Trooper Lawson at Wilmington Hospital because no Mirana'a warnings were given; however, in Defendant’s Reply brief, she deems her Miranda argument moot.16 Based on the following analysis, the Court finds that the evidentiary results obtained from the blood draw should be excluded. 1 7 15 Defendant’s Motion focuses only on suppression related to her DUI charge. See State v. Shutak, 2017 WL 4339690, at *3 n. 13 (Del. Com. Pl. Sept. 29, 2017) (“Arguments are deemed waived When not raised in the motion to suppress.”). Yet, at the suppression hearing, Defense counsel stated that because whether Defendant was driving was in contention, Defendant Was arguing the State also did not have probable cause to charge Defendant with the remaining charges. The State stated it believed the hearing would focus on the DUI charge and that the testimony would not support a probable cause finding for the other charges; however, it stated that it could elicit testimony at the hearing that was sufficient to support probable cause. The Court finds that the State has provided sufficient information to support charging Defendant with: Leaving the Scene of a Property Collision Accident, in violation of 21 Del. C. § 4201(a); Failure to Provide Information at Collision Scene Resulting in Property Damage, in violation of 21 Del. C. § 4201(b); F ailure to Report a Collision Involving Alcohol or Drugs, iii violation of 21 Del. C. § 4203(a)(3); and Failure to Have Two Lighted Lamps Displayed, in violation of 21 Del. C. § 43 52(a). However, the State has failed to provide sufficient evidence to support charging Defendant With: Out-of-State Vehicle _ Failure to Have Minimum Insurance, in violation of 21 Del. C. § 2118(b); Driving in Improper Lane and Direction, in violation of 21 Del. C. § 4126(a)(3); and Driving While Suspended or Revoked, in violation of 21 Del. C. §2756(a). Based on the testimony provided at the hearing, Trooper Galiani could “not recall” whether he found insurance in the stationary vehicle, there was no testimony that the stationary vehicle was driven improperly_only that it became stationary in the wrong direction, and no testimony that Defendant’s license Was suspended or revoked. 16 Defendant’s Reply at 11. Defendant avers that her argument is moot because Trooper Lawson testified at the suppression hearing that neither Defendant nor Mr. Triplett stated that Defendant was driving. Moreover, Defendant asserts that an affidavit signed by Mr. Triplett on December 28, 2016, in which Mr. Triplett asserts he was the driver of the vehicle on November 27, 2016, mitigates any residual Miranda concerns. Defendant’s Reply at 11 & Exhibit 5. Because a magistrate’s determination is not dependent upon facts “developed at some later time,” the Court Will not address this facet of Defendant’s argument Jackson v. State, 643 A.2d 1360, 1367 (Del. 1994). To the extent Defendant did not waive her Miranda argument by stating that the argument was “moot,” the Couit finds that, under the facts of this case, any “physical incapacity” of Defendant in the hospital does not trigger Miranda. State v. Maulk, 2014 WL 4942177, at *4(De1. Super. Sept. 29, 2014). 17 Because Defendant seeks to show that the affidavit lacks probable cause under its reverse-F ranks and Franks’ arguments, the Court’s decision in this case renders a Franks’ analysis moot. See F ranks v. Delaware, 438 U.S. 154 (1978). The Court does observe that the State is correct_a separate Franks’ hearing is the proper vehicle, See In re O'Connor, 2010 WL 5551922, at *l (Del. Super. Mar. 16, 2010) (“I decline to go past the “four comers” of the affidavit for purposes of a discovery hearing because F ranks and Backus require the Defendant to make a preliminary showing by an offer of proof that the affidavit contains a deliberate falsehood or a reckless disregard for the truth.”); State v. Hackendorn, 2016 WL 266360, at *4 (Del. Super. Jan. 13, 2016) (“The State is correct in that a Franks[’] or 7 Trooper Galiani’s affidavit fails to establish probable cause. The “intrusive” nature of a blood draw requires a search warrant in order to extract the blood, unless a recognized exception to the warrant requirement applies.18 Both the United States Constitution and Delaware Constitution requires a showing of probable cause for the issuance of a search warrant.19 Further, the General Assembly has codified “statutory requirements” in support of the Delaware Constitution’s probable cause provision.20 11 Del. C. § 2306 states: The application or complaint for a search warrant shall be in writing, signed by the complainant and verified by oath or affirmation. It shall designate the house, place, conveyance or person to be searched and the owner or occupant thereof (if any), and shall describe the things or persons sought as particularly as may be, and shall substantially allege the cause for which the search is made or the offense committed by or in relation to the persons or things searched for, and shall state that the complainant suspects that such persons or things are concealed in the house, place, conveyance or person designated and shall recite the facts upon which such suspicion is founded.21 Likewise, 11 Del. C. § 2307 states: If the judge, justice of the peace or other magistrate finds that the facts recited in the complaint constitute probable cause for the search, that person may direct a warrant to any proper officer or to any other person by name for service. The warrant shall designate the house, place, conveyance or person to be searched, and shall describe the things or persons sought as particularly as possible.22 reverse-Franks[’] hearing is not automatically granted upon request.”); see also State v. Backus, 2002 WL 31814777, at *6 (Del. Super. Nov. 18, 2002) (noting Defendant filed a “Supplemental motion”). At the Franks’ hearing, Defendants Would be required to prove by a preponderance of the evidence that the officer knowingly, intentionally, or with reckless disregard for the truth made statements in, or omitted facts from, the affidavit that were material to finding probable cause. See Ridgeway v. State, 67 A.3d 1023, 2013 WL 2297078, at *3 (Del. May 23, 2013) (TABLE); Jensen v. State, 482 A.2d 105, 113-114 (Del. 1984). Nevertheless, the Court takes a moment to mention that a reviewing court does not have the leisure of “hindsight” when questioning an officer’s inclusions or omissions, State v. Smith, 2016 WL 3610242, at *3 (Del. Super. June 27, 2016). Further, the “affidavit need not contain ‘the entire history of events leading up to a warrant application with every potentially evocative detail that would interest a novelist or gossip,’ and the police must exercise a degree of selectivity in deciding what facts to include in a Warrant application.” Rivera v. State, 7 A.3d 961, 970 (Del. 2010) (quoting Wilson v. Russo, 212 F.3d 781, 787 (3d Cir. 2000)). 18 Flonnory v. State, 109 A.3d 1060, 1062 (Del. 2015) (citing Skinner v. Railway Labor Executives’ Ass’n, 489 U.S. 602, 625 (1989)). 19 Fink v. State, 817 A.2d 781, 786 (Del. 2003) (citing U.S. CoNsT. AMEND. IV, DEL. CoNsT. ART. 1, § 6). 20 Dorsey v. State, 761 A.2d 807, 811 (Del. 2000). 21 11 Del. C. §2306. 22 11 Del. C. §2307. The Delaware Supreme Court has held that sections 2306 and 2307 “contemplate a ‘four- comers’ test for probable cause.”23 Hence, an “affidavit in support of a search warrant must set forth facts adequate for a judicial officer to form a reasonable belief that an offense has been committed. . . .”24 Regarding a charge of driving under the influence, the magistrate must find “probable cause to believe that Defendant’ s blood would yield evidence of consumption of alcohol beyond the legal limit, or sufficient alcohol content to support a charge of driving while under the influence of alcohol.”25 Recently, the Delaware Supreme Court re-articulated a magistrate’s duties in evaluating the affidavit: The magistrate may only consider the information contained within the four corners of the affidavit. “[A] neutral and detached magistrate may draw reasonable inferences f`rom the factual allegations in the affidavit.” . . . The officer is “only required to present facts which suggest, when those facts are viewed under the totality of the circumstances, that there is a fair probability that the defendant has committed a crime.” The affidavit need not rule out potentially innocent explanations for a fact. Probable cause may be found so long as the facts presented in the affidavit are “su]j’icient in themselves to warrant a [person] of reasonable caution in the belief that an offense has been or is being committed.”26 In determining whether probable cause exists to obtain a search warrant, Delaware courts apply a “totality of the circumstances” test.27 When reviewing the magistrate’s decision, the Superior has cautioned: [T]his Court is required to give “great deference” to a magistrate’s determination of probable cause and the review should not “take the form of a de novo review.” The reviewing court, however, must determine Whether the magistrate’s decision “reflects a proper analysis of the totality of the circumstances.” Affidavits of probable cause are subject to “much less rigorous standards than those governing the admissibility of evidence at trial ...” Our Supreme Court has “eschewed a ‘hypertechnical’ approach to reviewing a search Warrant affidavit.”28 23 Dorsey, 761 A.2d at 811. 24 Fink, 817 A.2d at 787. 25 Rybicki v. s¢aze, 2014 wL 637004, at *2 (Del. super. Jan. 14, 2014), aff’d, 119 A.3d 663 (Del. 2015), 26 Rybicki v. State, 119 A.3d 663, 668_69 (Del. 2015), reargument denied (Aug. 5, 2015) (footnotes omitted). 27 Fink, 817 A.2d 31787. 28 State v. Dopirak, 2017 WL 3129234, at *1 (Del. Super. July 24, 2017) (footnotes omitted). 9 While the Delaware Supreme Court has emphasized the deference afforded to the magistrate, it has also advised that there must be a “logical deductive basis” for the neutral magistrate’s decision.29 Importantly, “[u]nlike in a challenge of a warrantless seizure, in a motion to suppress challenging the validity of a search warrant, the defendant bears the burden of proving that the challenged search or seizure was unlawful.”30 The affidavit that Trooper Galiani submitted to the Justice of the Peace Court magistrate, in its entirety, states: On 11/27/2016 at approximately 0131 hrs I responded to 1-495 in the area of Edgemoor Rd. in reference to a Motor vehicle collision Involving 3 vehicles. Upon arriving the driver and it’s [sic] occupants fled the scene of the collision. Troop l units responded to Wilmington ER in reference to 2 subjects walking into the emergency room with injuries from a motor vehicle collision. Tpr. Lawson [badge number omitted] made contact with the driver of the vehicle S/Dartanya Murray [date of birth omitted]. S/Murray stated to Tpr. Lawson that she [sic] driving the vehicle and was coming home from her sister’s Birthday in the Philadelphia area and that she had been drinking alcohol there. Tpr. Lawson stated that S/Murray [sic] eyes were glassy and bloodshot. Tpr. Lawson also made contact with the passenger of the vehicle PC/Edmund Triplett [date of birth omitted]. PC/Triplett stated to Tpr. Lawson that he was in the front passenger seat of the vehicle and S/Murray was driving at the time of the collision. S/Murray was unable to perform any field tests due to her injuries. In her Motion, Defendant argues that the affidavit is insufficient on its face to support a finding of probable cause.31 Particularly, Defendant notes that the affidavit does not state that there was an odor of alcohol on her person or at the scene.32 Since this case does not concern field test results or results from a portable breathalyzer test (“PBT”), Defendant relies on State v. Mulholland and State v. Sharp to support her position.33 In the State’s Response, the State relies on the deference 29 Dorsey, 761 A.2d at 812. 30 Dopirak, 2017 WL 3129234, at *1. 31 Defendant’s Motion at 5. 32 See id. at 4. 33 Defendant’s Motion at 5-6 (citing State v. Mulholland, 2013 WL 3131642, at *6 (Del. Com. Pl. June 14, 2013); State v. Sharp, 2014 WL 3534945, at *4 (Del. Com. Pl. May 5, 2014)). 10 afforded the magistrate’s decision and its belief that “the following indices of intoxication: (1) a motor vehicle accident from which the Defendant fled; (2) statements indicating that the Defendant was driving the vehicle in question; (3) admissions to drinking by the Defendant; and (4) that the Defendant had bloodshot, glassy eyes” support a finding of probable cause.34 The State_ mischaracterizing Defendant’s position-continues by noting that a lack of field test results or the 35 Referencing administering of a PBT are not required for a Court to find probable cause. Defendant’s reliance on case law, the State argues that State v. Aldossary limited State v. Mulholland to the latter’s facts of a cold and snowy night.36 Instead, the State analogizes to State v. Gilbert, Bease v. State, and State v. Maxwell as dispositive.37 In Defendant’s Reply, she asserts that the State’s reliance on these cases is misplaced, as no odor of alcohol was denoted in Trooper Galiani’s affidavit.38 Based on a comprehensive analysis of the caselaw and the Court’s balancing of the strong deference afforded the magistrate’s determination with the facts as presented in the affidavit, the Court finds that the four-corners of the affidavit do not support a finding of probable cause sufficient to issue a warrant to draw Defendant’s blood. The State is correct that this Court limited Mulholland to its facts in Aldossary.39 However, this Court found probable cause in Aldossary based on an unique accident, bloodshot and glassy 34 State’s Response at 7. Based on Trooper Galiani and Trooper Lawson’s testimony, Defendant only made one admission to drinking 33 See id. at 7-8. Defendant is not arguing that the lack of results dooms the finding of probable cause, but that there are no supporting results in this case. See Defendant’s Motion at 5 . 30 State’s Response at 8 (citing State v. Aldossary, 2014 WL 12684303, at *4 (Del. Com. Pl. Apr. 10, 2014)). 37 State’s Response at 7-8 (citing State v. Gilbert, 2017 WL 2256624, at *2 (Del. Com. Pl. May 15, 2017); Bease v. State, 884 A.2d 495 (Del. 2005); State v. Maxwell, 624 A.2d 926 (Del. 1993)). 33 Defendant’s Reply at 10. 30 State v. Aldossary, 2014 WL 12684303, at *4 (Del. Com. Pl. Apr. 10, 2014) (“Conversely, in State v. Mulholland, [2013 WL 3131642] this Court found: 1) a traffic violation; 2) admission to drinking; 3) odor of alcohol; 4) bloodshot eyes; and 5) failed one-leg stand test did not establish, under the totality of the circumstances, probable cause for an arrest. The Court in [Mulholland] took note that the events surrounding the matter occurred on an extremely cold night With snow on the roadway. Such conditions were not present in this matter, and this Court thus contains the Mulholland decision to its facts.” (footnotes omitted) (emphasis added)). 11 eyes, slurred speech, and an odor of alcohol; emphasizing the fact that Defendant “had bloodshot, glassy eyes and smelled of alcohol” and her speech “was noticeably slurred.”40 lf such facts existed in the present case to support a temporal inference that Defendant Was under the influence when driving, then this Court would agree with the State’s position.41 Nevertheless, the State has presented no example, and the Court has found no case, where the affiant relied on such limited facts as in the case sub judice.42 While the affidavit states that Defendant admits to driving the vehicle and accuses Defendant of fleeing the scene, the only facts listed in the affidavit supporting a claim of driving under the influence are: (1) her admission to consuming alcohol at her sister’s birthday party in the Philadelphia area, which occurred at some unspecified time prior to the accident, and (2) her bloodshot and glassy eyes at approximately 1:40 a.m. in the morning. The affidavit does not even contain sufficient information to ascribe liability to Defendant for the accident,43 which can be utilized by the magistrate in finding probable cause.44 40 See id. at *5 (emphasis added). 41 See Bease v. State, 884 A.2d 495, 499-500 (Del. 2005) (holding probable cause to arrest was present when the defendant “spoke in a rapid manner to Trooper Penrod, smelled of alcohol [from “ ‘approximately two feet’ away”], admitted that he consumed [“ ‘some chardonnay or beer’ ”] the night before, had bloodshot and glassy eyes, and had just committed a traffic violation by making an improper lane change in an abrupt manner”); Miller v. State, 4 A.3d 371, 374-75 (Del. 2010) (“Excluding the results from the PBT and HGN tests, the alcoholic odor from two or three feet away, glassy watery eyes, failed walk-and-turn and one-logged standing tests, and Miller’s admission of having consumed two beers about two hours before sufficiently supported probable cause that Miller drove under the influence of alcohol.”); State v. Maxwell, 624 A.2d 926, 930-31 (Del. 1993) (reversing the trial court’s failure to find probable cause when the defendant lost control of the vehicle during a tum, admitted to drinking at the scene, “appeared dazed,” a “strong odor of alcohol” emanated from the overturned vehicle, and “several empty and full containers of beer” were present in the vehicle). 42 See infra footnotes 43-58. 43 See Lambert v. State, 110 A.3d 1253, 1256 (Del. 2015) (“Lambert also argues that ‘the four corners of the Affidavit do not suggest that he was the motorist at fault for causing the accident’ . . . . The Affidavit states that there was damage to the rear of the Trailblazer and that Lambert admitted hitting the Trailblazer. The only reasonable inference from those facts is that Lambert's motorcycle struck the rear of the Trailblazer.”). 44 See id. at 1256-57 (“When viewed in the totality of the circumstances, the facts in the Affidavit and the reasonable inferences drawn therefrom provided the magistrate With sufficient information to support a finding that there was probable cause to believe Lambert had operated his motorcycle while under the influence of alcohol. First, Lambert collided with the rear-end of the Trailblazer. Second, Lambert had watery, bloodshot eyes. Third, Cpl. Lowman detected the odor of alcohol on Lambert's breath.” (footnote omitted)). 12 Based on the totality of the circumstances, the affidavit in this case is incomplete to support a finding of probable cause. First, the Delaware Superior Court has stated that irritated eyes do 45 not support an inference that the driver was under the influence. Second, when a defendant admits to drinking before an accident, Delaware precedent expressly or implicitly tethers the statement to temporal evidence.46 Indeed, an admission unconnected to a point in time can create a temporal inference if the speaker admits to current intoxication.47 Even an admission that the speaker “had a lot to drink” conceivably creates such a temporal inference.48 Conversely, the Court is struck by what facts are not contained in the affidavit: no statement ,,49 of “egregious erratic driving, no facts regarding when Defendant had consumed alcohol,50 no reference to how many drinks Defendant had consumed,51 no evidence of any alcoholic beverages 45 See State v. Heath, 929 A.2d 390, 409 (Del. Super. 2006) (“The Court does not believe that this Defendant’s bloodshot eyes can be a basis for reasonable suspicion. This is not to say that bloodshot eyes can never be probative of criminal activity. For example, if the Defendant’s bloodshot eyes were combined with an odor of drugs or alcohol, a more persuasive argument might exist. However, bloodshot eyes can “result from a variety of non-criminal circumstances, such as tiredness, allergies, or just rubbing of the eyes.” When this stop occurred, it Was night, and there was no evidence that the Defendant was under the influence of drugs or alcohol.” (footnote omitted)). For reasons unrelated to the present case, the Superior Court has declined to follow certain facets of Heath’s analysis. See, e.g., State v. Turner, 2016 WL 105668, at *3 (Del. Super. Jan. 5, 2016) (refusing to follow Heath’s analysis in deeming the stop pretextual and unconstitutional). 46 See, e.g., Lefebvre v. State, 19 A.3d 287, 291 (Del. 2011) (defendant “admitted drinking an hour and a half before the stop”); State v. Otto, 1993 WL 488979, at *1 (Del. Super. Nov. 12, 1993) (facts indicate an odor of alcohol on the defendant’s breath, bloodshot eyes, slurred speech, and the defendant’s statement that “he had been at a bar, the Oasis Tavern, prior to the accident”). Courts generally do not require a temporal inference if the defendant refuses to submit to field sobriety tests. See State v. Gilbert, 2017 WL 2256624, at *3 n.l9 (Del. Com. Pl. May 15, 2017) (quoting Church v. State, 2010 WL 5342963, at *2 (Del. Dec. 22, 2010)) (noting that “refusal of field sobriety tests ‘may be used for any relevant purpose, including to show consciousness of guilt’ ”). 47 See, e.g., State v. Ford, 2013 WL 2245006, at *4 (Del. Com. Pl. May 22, 2013) (defendant admits to being “too drunk to operate the vehicle”). 43 See State v. Ori, 2016 WL 3568356, at *2 (Del. Super. June 22, 2016) (“Defendant admitted to the Affiant that he had ‘had a lot to drink.’ ”). This Court uses the word “conceivably” because the facts in Ori also included visible and audible signs at the time of the defendant’s statement that he was presently intoxicated»pne of Which included public urination. See id. at *l. 49 See Dopirak, 2017 WL 3129234, at *2 (“Namely, Mr. Dopirak was not merely changing lanes while failing to signal or following another vehicle too closely. He was stopped by the officer driving in [the] wrong direction on Route 13, a divided highway. This rather egregious erratic driving, combined with a strong odor of alcohol and a refusal to submit to an intoxilyzer test or a blood draw, are sufficient facts for a magistrate to have found probable cause under the totality of the circumstances.”); see also Rybicki, 119 A.3d at 671. 50 See Miller, 4 A.3d at 375 (“Miller’s admission of having consumed two beers about two hours before . . . .”). 31 See id. 13 in the vehicle,32 no statements regarding slurred speech,33 no facts evidencing trouble walking or odd behavior,34 no facts regarding a disheveled appearance or disoriented demeanor,55 no 9756 statement that defendant was “slumped” or “passed out, no comments regarding a “flushed face,”37 and no odor of alcohol.38 The addition of one or more of the above likely would have resulted in a different outcome.59 IV. CONCLUSION For the reasons articulated above, the Court finds that Defendant has met her burden of proving by a preponderance of the evidence that the warrant should not have been issued based on 32 See State v. Bennefiela', 2016 WL 5816987, at *2 (Del. Super. Sept. 30, 2016) (“Within the four corners of the affidavit, there are ample facts to show that Defendant was intoxicated Defendant smelled of alcohol, his eyes were bloodshot, and he Was acting aggressively. He also failed the HGN test and refused to take the PBT. Moreover, several alcoholic drinks were found in the vehicle.” (footnotes omitted)). 33 See State v. Williams, 2012 WL 6738546, at ’1‘2 (Del. Com. Pl. Oct. 25, 2012) (“Similarly, the circumstances here provided the officer with sufficient showing of probable cause, even without field sobriety tests, given that the defendant failed to follow the orders of the police officer, was erratic in her driving actions, smelled of alcohol, slouched over her steering wheel, slurred her speech, and Walked unsteadily from her car, requiring assistance.”). 34 See id.; see also Ori, 2016 WL 3568356, at *2 (“In spite of all of that, though, there undisputedly exists the accident, the odor of alcohol on Defendant's breath, and Defendant's having urinated While seated in Affiant's police vehicle.”). 33 See Glass v. State, 1988 WL 61582, at *1 (Del. Super. June 13, 1988) (“[T]he single vehicle accident, the odor of alcohol on the defendant’s breath on two occasions and the defendant’s confused and disoriented state, provided a sufficient basis for the police officer to conclude that probable cause existed to arrest the defendant and take the blood sample.”). 30 See State v. Green, 2015 WL 4603829, at *2 (Del. Com. Pl. May 4, 2015) (“The affidavit of probable cause also indicates that Green slurred her words and appeared to be unaware of who she Was or what had happened Additionally, Green failed the walk-and-tum test and the finger-to-nose test. The Court takes note of Green's performance on the field tests combined with her glassy eyes and slurred speech, as Well as the fact that she was slumped behind the wheel and appeared to be passed out.”). 37 See Lefebvre, 19 A.3d at 291 (agreeing with the defendant’s concession that probable cause to arrest existed prior to his performance of field tests: “Lefebvre committed a traffic offense, exhibited a strong odor of alcohol, had a flushed face and bloodshot, glassy eyes, admitted drinking an hour and a half before the stop, was somewhat flustered and argumentative with the officer, and stated prior to the one-leg stand ‘I'm not that good at this sober.’ ” (quoting Lefebvre’s Opening Brief at 19)); see also Ford, 2013 WL 2245006, at *4 (finding probable cause to extract blood based on a strong smell of alcohol while interviewing the defendant, glassy and red eyes, flushed face, and admission that the defendant “Was too drunk to operate the vehicle”). 38 See State v. Zanda, 2016 WL 5660303, at *3 (Del. Com. Pl. Aug. 25, 2016) (“The evidence shows that at some time after 3 200 a.m., the defendant was driving erratically by ping-ponging within her lane of travel, driving off the roadway twice, and braking for no apparent reason. Additionally, an odor of alcohol emanated from the defendant’s person. She had red and glassy eyes and constricted pupils. She failed the walk-and-turn test and one-leg stand test, along with the alphabet and counting tests.”). 39 See Lefebvre, 19 A.3d at 293 (noting “no precise formula exists”); see also Esham v. Voshell, 1987 WL 8277, at *2 (Del. Super. Mar. 2, 1987) (“Other circumstances are usually present in situations of this kind to support the finding of probable cause.”). 14 the affidavit of probable cause. Because the Delaware Supreme Court has held that the “good faith” exception to the exclusionary rule is not applicable to a warrant issued without probable cause under the Delaware Constitution,00 and a defendant cannot lean on the exception when a Delaware statute has been violated,61 the blood results must be excluded.02 Additionally, the Court finds that the State has proven by a preponderance of the evidence that probable cause existed to charge Defendant under 21 Del. C. § 4201(a), 21 Del. C. § 4201(b), 21 Del. C. § 4203(3)(3), and 21 Del. C. § 4352(@1).63 The clerk Shaii set this case for trial at the earliest convenience of counsel. IT IS SO ORDERED this 20th day of November, 2017. M[(w`lIA John K. Welch, Judge cc.' Ms. Diane Healey, Judicial Case Manager Supervisor cc.' Ms. Michelle Jackson, Judicial Operations Manager 00 See Dorsey v. State, 761 A.2d 807, 820-21 (Del. 2000) (“We remain convinced that there are constitutional dimensions to the remedy for a violation of the Delaware Constitution's Declaration of Rights. Accordingly, We adhere to our prior holdings in Rickards and its progeny, including our most recent holding in Jones: exclusion is the constitutional remedy for a violation of the search and seizure protections set forth in Article 1 Section 6 of the Delaware Constitution.”). 01 See State v. Lambert, 2015 WL 3897810, at *6 (Del. Super. June 22, 2015), aff'd, 149 A.3d 227, 2016 WL 5874837 (Del. Oct. 7, 2016) (TABLE). 02 See State v. Felton, 1991 WL 113337, at *6 (Del. Super. June 18, 1991). 03 See supra note 15. 15 | Low | [
0.507211538461538,
26.375,
25.625
] |
A BUBBLING CAULDRON Wednesday, May 04, 2016 Righeimer's Bond Scheme Fails And More EXPECTING ANOTHER RIOT? The Costa Mesa, apparently expecting big trouble because there were four (4) officers in the auditorium plus Chief Rob Sharpnack, made it through the meeting without incident. Maybe it was because I watched the proceedings at home.. MAYOR'S AWARD Mayor Steve Mensinger opened things up with a presentation of his Mayor's Award to yet another local business - the Chick-Fil-A store on Harbor Blvd. Operator Tammy Guadagno was praised for outstanding community support. PUBLIC COMMENTS We had some new rules last night. A big sign behind the City Clerk advised that speaker cards must be given to the staff member in the lobby. Also, Mensinger imposed a rule where you MUST come to the speaker podium promptly or you cannot speak. A couple speakers missed their turns. Nina Reich praised the signature-gatherers and those who turned out for the Trump demonstrations. She also expressed concern for the lack of affordable housing. Ashley Collins and David Twiss again expressed concern about a recent vote made by the Vector Control District to authorize aerial spraying for mosquitos. Mary Spadoni attended the Trump rally and was concerned about the lack of a Nixle alert by the CMPD to advise residents of traffic issues in the area. She did praise all the law enforcement officers and command staff present for doing an excellent job. Another individual showed samples of T-shirts with catchy phrases on them and provided a primer on good government. Beth Refakes expressed concern about the apparent wheeling and dealing going on with the Attic Theater/Costa Mesa Women's Club. She was concerned that the women were being taken advantage of and explained the terms of the deal as she understood them. Kristine Bogner expressed concern about speaking at the meetings for fear that her photo might appear in "a blog". Well, she's right... here she is! She encouraged folks to come and speak up. Ralph Taboada asked for more bike racks at parks and commercial areas, expressing concern that bicyclers were being cited for chaining their bikes to sign posts when racks were not available. This fella, I've heard him referred to as Iggy, spoke again and once again complained about the incomplete 55 Freeway through town. This time he used the term "bat guano" instead of his previous epithet. Barrie Fisher provided statistics on how sober living organizations were circumventing the new ordinances. Kim Hendricks thanked the Fairview Park Initiative volunteers. Greg Thunnel blamed the Trump riots on the council members. Jay Humphrey praised the Fairview Park petition gatherers and criticized the management of the Fair and event center for not being good neighbors, referring to the Trump rally. Nine more speakers were trailed to the end of the meeting. AERIAL SPRAYING RESPONSE During Council Member Comments Sandy Genis explained in great detail why the decision was made by the Vector Control District to do aerial spraying, citing the very serious public health threat of the West Nile virus. She also expressed concern about the minimal communication about the Trump event from city staff. She also expressed extreme concern about language that was added to the Draft General Plan regarding the "repurposing of Fairview Park" and included the mention of playing fields. MORE MOSQUITO QUESTIONSGary Monahan had nothing of his own to say, but asked Genis about "mosquito fish" as a solution to the mosquito problem. He also asked CEO Tom Hatch to investigate a system used by the Mesa Water District to circulate water to keep mosquito breeding down. FULL SPEED AHEAD ON SOBER LIVING ENFORCEMENT Mayor Pro Tem Jim Righeimer asked City Attorney Tom Duarte if the sober living lawsuit with Solid Landings had been signed, and if so, may we now enforce the two sober living ordinances? The answer was yes. He addressed the Trump event and was concerned about the short notice received, but praised the CMPD for their response to the issue. He said he was "proud of the culture in our department." What a great irony, since his minions have, for a couple years, vilified the CMPD for what they called the "culture of corruption." What a hypocrite! TRUMP AND HELPING NEIGHBORS Mensinger praised the CMPD for their performance during the Trump event and mentioned that "people think I run the police department so I got many messages about not enough use of force, too much use of force." I could only but smile... He told us of the Neighbors Helping Neighbors event that he, Monahan and Righeimer participated in recently, and mentioned that one of the houses they spruced up was the home of local Pop Warner football icon, Ed Baume - recently deceased. He told us he promised Ed he would fix up his house. Sorry, but that seems just a little peculiar to me. MAYOR'S CELEBRATION Mensinger also told us his Mayor's Celebration is coming up next week and his former employer, George Argyros and wife Julia, would be feted, as would Hank Panian. And he thanked Director of Public Services Ernesto Munoz for the great job being done sprucing up Harbor Boulevard, and mentioned the monument signage denoting "College Park" near the recently-remodeled GMC dealership. TRUMP EVENT AND CRONEY ORDINANCEKatrina Foley addressed the Trump event, too, saying you can't blame the Fair Board because they had no say whatosever in that event. She praised our public safety folks. She suggested we should bill the Trump campaign for damage to municipal property and the costs involved in keeping order. She asked Hatch about the "Croney" ordinance, required to be implemented by any city with a COIN ordinance and was told the staff is implementing it. It involves any contract over $250,000. BETTER BRANDING She told us of a recent conference by the Orange County Visitors Bureau at which municipal branding was emphasized. She offered a long opinion on how we could be doing a better job of branding our city. A NEW PIANO She had left the chambers briefly and explained that she was at Costa Mesa High School for the unveiling of a recently acquired - through significant donations - of a concert grand piano. BUDGET MEETINGS COMING UP Mensinger almost overlooked Hatch again, but given the chance he reported on several things. He advised that we should NOT be ticketing bike riders when racks are not available. He told us the budget process is underway, and that a budget study session will be held next Tuesday at 5:00 p.m. - but didn't say where. He said there will be a community meeting on May 19th at 5:30, but didn't say where. He said the budget will be adopted at the meeting of June 21st. NO AGREEMENT ON THE THEATER Regarding the Women's Club/Attic Theater, he said he only knew of informal discussions and that the City has NOT entered into any agreement. MEETING THE EXPERT ON DISTRICTS Assistant CEO Rick Francis spoke briefly about the upcoming Voting By District meetings, stating that there would be a series of meetings with small groups - 2-3 people at a time - with the expert demographer hired for this process. This image gives you the dates and the number to call to be included. Larger, community meetings will be held in June. He indicated we really had NO choice in how this process plays out because the issue WILL be on the ballot in November. CHIEF GOT A STANDING "O" Police Chief Rob Sharpnack spent the next 20 minutes giving us a briefing on the Trump event. His report was thorough and professional. I cannot begin to cover all his points, except to note that the patience and control exhibited by the members of the CMPD and other agencies involved kept the chaos to a minumum. The crowd clapped when he finished. Three items were pulled from the Consent Calendar for discussion at the end of the meeting. CDBG PASSED WITH TINKERING Public Hearing #1 dealt with the use of CDBG and HOME funds. Consultant Mike Linares provided the staff report. Members of some of the groups being granted funds spoke. Representatives of California Elwyn, which was receiving no funds, expressed concern and advised that it would mean a shortage of staff to help manage their programs. Andy Smith, the spokesman for the city committee charged with assessing the groups using criteria created by the council, advised how the process was conducted and why Elwyn came up short. Eventually, Katrina Foley moved that eight of the recipients would have their stipend reduced by $500 and the resultant $4000 would be given to Elwyn. It passed, 3-2, with Mensinger and Monahan voting NO. COULD HAVE BEEN RESOLVED IN 5 MINUTES For the next 90 minutes Jim Righeimer's vindictive Affordable Housing Bond was the subject of discussion. For this issue to move forward four of the five council members were required to vote in the affirmative. Celeste Brady, representing the law firm coordinating this activity, gave the staff presentation. In response to a question by Foley it was acknowledge that we have already spent $25,000 on this issue to this point. It was clear early-on that Foley was NOT in favor of this issue. To capsulize some of her thoughts - she thought there had NOT been enough thought given to this. This is precisely the kind of issue that called for a study session so the council could talk among themselves to flesh out concerns. We have not had a study session in a long, long time - apparently because Righeimer and Mensinger know they've got the votes to do whatever they want, so things like this just happen. RIGHEIMER'S VINDICTIVE SCHEME You will recall that in an earlier meeting Righeimer warned affordable housing advocates that he was going to put a $20 million bond on the ballot and if it didn't pass - it takes a 2/3 vote - or the people don't even give it more than 50%, then they should never come back complaining about no affordable housing. A MATTER OF TRUST Although Brady did a very professional job, Foley was tenacious and the fact that we had NO idea how this money might be spent really stuck in her craw. Same with Genis. At one point Foley said, "It's a matter of trust." She went on to say that trust had not been developed on the dais. Righeimer retorted it was a matter of "Brown Rules" - we assume he meant "Brown Act Rules", but one never knows with him. Foley barked back that it's why there should have been a study session. NOBODY SUPPORTED IT! Eight people spoke to this issue during the public hearing. None supported it - including Affordable Housing advocates! They, too, were concerned about the lack of a plan. Cindy Brenneman told the council that she wasn't going to vote for the bond, but that she'd give them $25.00 right now if it would help with housing right now. That amount was presumed to be what each property owner would see on their property tax bill to pay for the bond. Tamar Goldmann said she couldn't believe that a man who swore "no new taxes" was advocating exactly that. She told them to "butt out of housing issues." Kathy Esfahani, the most vocal advocate for affordable housing, was leary of this plan and said they would have all their eggs in one basket. Jay Humphrey told the council this reminded him of the Charter debacles - where one person decided to move forward without any kind of study session, and he reminded Righeimer of that mess. Wendy Leece reminded Righeimer of his "no new taxes" pledge. Mary Spadoni observed that "we just can't trust this group". WHAT? Righeimer voted to move the issue forward and Monahan seconded it. He said, "I seconded it, but I don't know if I agree with it. I don't know if I'll vote for it in November." Now, isn't that a crock?! NOT ENOUGH ANSWERS Genis continued to harp on the language of the item which describes it being used for "low and moderate" housing. She got into a discussion of what earnings level constituted "moderate" - turns out it's over $100,000 per year. She and Foley seemed concerned that this money would be used to facilitate developers building luxury housing with a tiny piece devoted to affordable housing. Again, a matter of trust. YET ANOTHER RIGHEIMER FAILURE Righeimer continued to try to massage this thing to approval, even "offering" control of the commitee that would be put together to manage it to Foley/Genis. Evenutally the vote was taken and it failed, 2-3, with Genis, Foley and Mensinger voting NO. Keep in mind, it would have taken four of the five to approve it. BIA RE-AUTHORIZED The final agenda item was the re-authorization of the Business Improvement Area for the Conference and Visitor Bureau. We had a good presentation from Paulette Lobardi Fries, saw a nice video and heard about how our money is being spent. Foley had many ideas about how it might be spent in the future. During the discussion, as Foley proposed a couple ideas, Righeimer spit back at her that he "wanted something actionable" - he was upset that she didn't have a plan. Is it just me, or is that a great irony - him asking for a plan when he was just trying to bamboozle the voters into handing him $20 million with out a plan! The council voted, 5-0, to approve the program again. WARRANT QUESTIONS Quick work was made of the three items pulled from the Consent Calendar. Greg Thunnel pulled the Warrant and spent a couple minutes pointing out specific items he didn't understand. It passed 4-0 - Genis took a break. I.T. ITEM CONTINUED Foley asked item #6 to be continued until the next meeting - it dealt with a revamp of the city internet infrastructure. KOKEN EXPLAINED HIS SITUATION Two people hung around to be heard in the trailed Public Comments. One was Terry Koken, who used his three minutes to address the events of his recent visit by a police officer because of his song at the last meeting. He said it was political harrassment and suggested Mensinger had filed the complaint. He said it was pure intimidation - all the things we discussed in my blog post about the event. He demanded Mensinger come out from behind the facade and admit he did it. A DIFFERENT VIEW OF THE RIOTJeff Cohen took exception to the description earlier of the way the CMPD handled the Trump event. He was there and had a different viewpoint - indicating they didn't know what they were doing. The meeting abruptly ended at 10:40. ON SIMMER FOR AWHILE That's it for awhile, loyal readers. I'm turning the Caulderon down to simmer for awhile, so local politicians can get a little breather. We'll be back soon. Monday, May 02, 2016 Intimidation As An Art Form In Costa Mesa THE LATEST - AND MOST ONEROUS - SITUATIONQuashing public opinion through intimidation has become an art form in the City of Costa Mesa. We've talked about this many, many times in the past, but let me tell you about the most recent, but probably not the last, attempt to discourage members of the public from criticizing members of the power elite in our city through the abuse of their official power to direct police activity against a resident. TERRY KOKEN'S PARODYDuring the City Council meeting on April 19, 2016 Terry Koken - who fancies himself somewhat of a minstrel/bard - stepped up as speaker #7 during Public Comments and used his three minutes to address the city council. His was a fairly benign comment and included an offer to make the Fairview Park Initiative petition available to the council members to sign. And, part of that time was used to sing a little ditty - a parody of an old Woody Guthrie tune,"This land is my land". If you click HERE and scroll down to comment #7 you can hear Koken's tune for yourself. Based on what I saw live, and later on streaming video, it seemed to me that his little tune was accepted as it was intended - a light-hearted bit of fluff for the council during a completely non-confrontational comment by Koken. Mayor Steve Mensinger apparently thought the same, since he thanked Koken and offered a light-hearted response about "Lynyrd Skynyrd". And the meeting moved on. PARODIES ABOUND Parody lyrics to that classic tune have been sung in one form or another by many people over the years, including Pete Seegar singing them to an elementary school group four decades ago. In fact, this song has so many parodies that it's hard to keep track of them. For example, this 17 second parody by someone named Richard Chang sounds VERY much like Koken's version. AN ESTABLISHED CROONERKeep in mind that Koken has crooned to the council many times over the years. One time then-mayor Gary Monahan attempted to have him silenced, but City Attorney Tom Duarte reminded him that singing is protected free speech. Here are the parody lyrics that Koken sang on April 19th: This land is my land,It is not your land,I've got a shotgun,And you ain't got one,If you don't get off,I'll shoot your head off, This land is private property. NO BIG DEAL, BUT... Now, I must admit that, sitting in the rear of the auditorium, that "shotgun" reference got my attention, but I thought no more of it because nobody on the dais appeared to take offense to it. The mayor's light-hearted response seemed to affirm that. However, there apparently WAS more to it based on subsequent events. ...A WARNING A WEEK LATERA week later, on April 26th, Koken attended the Jim Righeimer/Jay Humphrey debate of the Smart Growth Initiative at the Halecrest Community Center- a packed-house event also attended by Mensinger. After the debate was over Koken passed by Mensinger - who was a hulking presence near the exit - and shook his hand. According to Koken, Mensinger pulled him close and made a remark about consequences of the ditty he had sung. Another man, a political operative and known associate of the power elite, was nearby when this occurred and made a comment that Koken could expect to be contacted by the California Highway Patrol... a strange comment, indeed, so Koken just shrugged it off. AN "INTERVIEW" BY THE POLICEHowever, early the next morning, April 27th, Koken received a telephone call from Costa Mesa Police Sergeant Scott Stafford, a member of the Professional Standards Bureau, requesting to interview him. Stafford showed up at the Koken residence a half-hour later and spent the best part of the next hour talking with Koken about the "ditty" while recording the conversation. At one point Koken asked who generated the complaint and Stafford declined to say, even though Koken indicated the evidence suggested it was Mensinger. Stafford declined to confirm or deny. A VERY CONCILIATORY DISCUSSION Following the interview, during which Stafford was very professional, Koken showed him around and discussed his woodworking projects. It was all very conciliatory and after the tour Stafford left. OH, YES... ANY GUNS?An hour or so later Stafford called Koken and said, "I forgot to ask you one question. Do you have any firearms in the house?" Koken answered, "I don't publish that information." ENTER THE LAWYERBased on that last conversation Koken suspected there may be a search warrant in the offing, so he contacted an attorney and briefed him on the situation. He was told that no judge would issue such a warrant.INTIMIDATING SIGNATURE-GATHERERSKoken subsequently told me of an attempt to intimidate Koken and compatriots as they sat behind a table in a booth at Fairview Park, collecting signatures on petitions for the Fairview Park Preservation Alliance. A Code Enforcement officer observed their signs from a distance, then drove into the park and stopped near the booth. She was observed photographing the signage, then approached the booth. She offered no criticism, nor did she cite them for any irregularity. When she was asked why she was there she told Koken and his associates that "the mayor had requested her to investigate them." As you might expect, this had a chilling effect on them and might have had an even more chilling effect on folks who might be inclined to sign the petition. And this is certainly another abuse of the mayor's power.CONVERSATION WITH THE COPSI've had a conversation with Koken and he also provided me with written details of these encounters. Subsequently I contacted members of the Costa Mesa Police Department to, 1) understand the process by which an officer would be dispatched to interview a resident and, 2) to find out who made the request. Following those conversations, including a very cordial, helpful and professional conversation with Chief Rob Sharpnack, I'm comfortable that the members of the CMPD involved simply followed the proper protocols. They received a complaint, investigated and, once the report is complete, it will be discussed with the District Attorney. And nobody is talking about who initiated the request. Apparently this information is only available after there is a resolution to the situation. Based on the circumstances portrayed to me by Koken, I suspect it was Mensinger, who has a long-established record of attempting to intimidate folks with opposing views - but don't know for sure. At some point in the near future a Public Records Request may be submitted to fully flesh-out this situation. STEVEN WHITEDo you recall the now-infamous Steven White case? White, an employee of The City, was accused of stealing campaign signs during an election in which Mensinger was running for City Council. That bogus claim cost White his job, but he was found not guilty of the alleged crime in court later. At the time Mensinger was apparently on a stakeout with a private detective observing whomever it was doing the sign theft. White has occasionally showed up at recent council meetings and is clearly not a happy man because of that situation. TRYING TO SHUT ME UPSome of you may recall the attempts by Mensinger and his pal, Mayor Pro Tem Jim Righeimer, to intimidate me a few years ago. Each of them, individually, had an attorney - a guy who was married to Righeimer's sister-in-law at the time - write to me telling me I couldn't write about either of them in certain circumstances. Well, I understand a little about SLAPP suits and told him as much. I never heard from him again, but it's another good example of their attempts to intimidate opposing views. DISCOURAGING PUBLIC COMMENTSIn fact, they have institutionalized the process in City Council meetings by bifurcating Public Comments - restricting the time during which folks can exercise their rights to air grievances to a short span at the beginning of meetings. Those remaining would be required to stay to the VERY end of the meetings - sometimes well after midnight - to express their views. Most do not, so that practice has been effective in quashing critics. RIGHEIMER'S ANTICSAnd, of course, there is the persistent practice by Righeimer, in particular, of interrupting speakers in the middle of their comments, spitting back jibes at them as they depart the speaker's podium and calling them out by name. They also use valuable time to rant on and on during Councilmember Comments to rebut critics. This kind of intimidation discourages some speakers from taking the time - and risk of ridicule - to address issues they feel are important in the community. THEIR OWN PRIVATE MUSCLEYou may recall how Righeimer and Mensinger formed a special Code Enforcement unit to work on their own pet projects - like adding enforcement muscle to encourage owners of "problem motels" to "reassess the value of their properties" - which would make them available to their developer-buddies at a price that could guarantee a healthy profit. That Code Enforcement group has now been combined with the main group, but Mensinger apparently continues to use it as his own little private enforcement group.WILLING TO ABUSE THEIR POWERRigheimer and Mensinger have demonstrated throughout their political careers that they are more than willing to abuse their power, bend the rules and to intimidate folks who oppose them. Righeimer, in particular, will leap upon any pulpit he can find - radio, television or in the print media - to burnish his position. And, some of recall his very attempt to throw his weight around when, as a planning commissioner, he barged into the middle of a DUI Checkpoint, demanding answers. A DELICIOUS IRONYHere we have a situation where a member of the CMPD was dispatched based on "somebody's" claim that a misdeed - a threat - was done by Koken. Contrast this to the bogus lawsuit filed by Mensinger and Righeimer - a lawsuit that still lingers like a dark cloud over the city to this day - in which Righeimer was reported to be driving in a manner suggesting he was impaired - he did come from a bar, after all - and a member of the CMPD was dispatched to interview HIM. During that 90 second interview, Kha Bao, our most distinguished DUI officer, quickly determined that he was NOT impaired, apologized for the inconvenience and left. However, Righeimer and his wife still filed a lawsuit against the men and women of the CMPD. LEGAL ACTION PENDING?I find myself wondering if Koken is considering any kind of legal action against those responsible for this situation. It's my understanding that he's awaiting a return call from the American Civil Liberties Union (ACLU) VOTERS BE ADVISED...It is clear that powerful members of the elected leadership of this city continue to be ready, willing and able to throw their weight around to intimidate residents who choose to speak out or otherwise show disagreement with them. So, good people of Costa Mesa, be advised... as long as you elect folks like this to your city council you can expect intimidation and rule-bending. | Low | [
0.492239467849223,
27.75,
28.625
] |
Q: Android EditText InputType, numeric keyboard + append text I have this EditText where the user enter a credit card number. I add a blank space every 4 characters by appending to the EditText like so: cardNumberEditText.append(" "); I only want to show the numeric keyboard. Therefore I add this attribute to my EditText in XML: android:inputType="number" However this doesn't allow me to append anything to the EditText apart from numbers. I could change the XML attribute to: android:inputType="number|text" but this would change the keyboard layout thus allowing the user to also enter text which I don't want. The "add new payment method" in the Play Store app does what I'm after but I just can't figure out how they do it. A: When you use inputType="number" it disables " " and "-" chars. You can keep using this type and specify that the " " char should be counted as a digit by specifying digits="0123456789 " in the layout xml as well. | Mid | [
0.606741573033707,
27,
17.5
] |
Metro Manila, Valenzuela ₱73,000 Cebu, Cebu City ₱100,000 Take some time to write down what you want from a car: How many people does it need to sit? Would you like it to be small or large? Are there certain features that you feel you can’t live without? How to get approved for a car loan in the Philippines? Owning one's very own four-wheeled vehicle is everyone's dream, and for a lot of people who aren't financially free, it remains a dream. However, thanks to the rising economy and intelligent solutions that businessmen make, we are now able to get the vehicle of our dreams without paying a six-digit amount of money upfront. So whether you're a minimum wage earner, the middle of the tier or one rich dude who just doesn't want to pay upfront for a used car for sale, you can take advantage of the flexible payment terms that lenders offer. Car loan's terms and conditions vary from country to country, state to state and even one company from another. This is why you should do your research first before you jump into contract signing and end up in an abyss of problems down the road. To find out how to get your car loan approved locally, Philkotse.com will guide you with useful tips and tricks. Do You Meet the Requirements? With a minimum monthly household (or family income) of Php 30,000 to Php 50,000. If the applicant is an OFW, the beneficiary should be residing in the Philippines. Should be a regular employee for a minimum of 2 years. Make Sure Your Credit History is Clean It can be hard for lenders to trust you if you have ongoing payments. Also, if you have a record of bad credit history and being unable to pay off your debts in time, this may also be a basis for the company to turn you down. If you have ongoing debts, try and solve them first before jumping in to a new payment scheme. This won't only make it easier for you to get that car, but it will also be lighter for you once the payment reminders start to kick in. Get Yourself Pre-Approved It's a good decision to get yourself pre-approved first before you start the actual car shopping. This way, you'll avoid picking a car that's way above your pay grade. You'll also be able to gauge and compare the pre-owned Mazda 323 that you like without stressing over whether you'll be approved or not. Research the Requirements of Different Lenders The requirements listed in the first part of this article are merely a general assumption of what most lending companies will ask from you. You can still do your own research and compare what competing companies have to offer and which is the most flexible that can cater to your invest in the Mazda 323. Some companies may require that you have a longer stay with your current workplace. Be Honest with Your Financial Information Most lenders will go through haystacks if they have to search for a needle when it comes to investigating their clients. This is especially when the lender finds the applicant dishonest or shady. Make sure you proclaim your assets and financial background to increase the chances of the lenders trusting you and approving your loan. You are now currently browsing our page for Mazda 323 2015 for sale in the Philippines. Aside from the current listing, you can also view other models from other major car manufacturers here in the Philippines. Thank you for using Philkotse.com and may you find your dream car the soonest! | Low | [
0.5260869565217391,
30.25,
27.25
] |
Turnover of skeletal muscle contractile proteins in glucocorticoid myopathy. Muscle weakness in glucocorticoid myopathy results mainly from muscle atrophy, the reason for which is the accelerated catabolism of muscle proteins. As the content of lysosomes in skeletal muscle, particularly in fast-twitch glycolytic fibers, is relatively low the non-lysosomal pathway makes a particularly significant contribution and has special importance in the initial rate-limiting steps in the catabolism of contractile proteins and in the regulation of their turnover rate. The turnover rate of actin and the myosin heavy chain is decreased in all types of muscle fibers, and more rapid turnover of the myosin light chain is registered in the fast-twitch glycolytic and oxidative-glycolytic fibers. Exercise and simultaneous glucocorticoid treatment is an effective measure in retarding skeletal muscle atrophy and provides protection against muscle wasting. | Mid | [
0.63231850117096,
33.75,
19.625
] |
<!DOCTYPE html> <html> <head> <title>测试</title> <script type="text/JavaScript"> // 初始化 WebViewJavascriptBridge function setupWebViewJavascriptBridge(callback) { // 只在第一次调用时不执行，为了防止重复加载 WebViewJavascriptBridge_JS.m if (window.WebViewJavascriptBridge) { return callback(WebViewJavascriptBridge); } // 保存 callback if (window.WVJBCallbacks) { return window.WVJBCallbacks.push(callback); } window.WVJBCallbacks = [callback]; // 开启一个 iframe，加载这段 URL 'wvjbscheme://__BRIDGE_LOADED__' // 其目的是为了触发 WebViewJavascriptBridge_JS.m 文件内容的加载 var WVJBIframe = document.createElement('iframe'); WVJBIframe.style.display = 'none'; WVJBIframe.src = 'wvjbscheme://__BRIDGE_LOADED__'; document.documentElement.appendChild(WVJBIframe); setTimeout( function() { document.documentElement.removeChild(WVJBIframe); }, 0); } var SCApp = {}; // 手动调用 setupWebViewJavascriptBridge 方法，触发 WebViewJavascriptBridge 的初始化 setupWebViewJavascriptBridge( function(bridge) { /* Initialize your app here */ var handlerNames = new Array("share", "requestLocation"); for (var i in handlerNames) { var handlerName = handlerNames[i]; SCApp[handlerName] = function (tempHandlerName) { return function(data, callback) { if (typeof data == "function") { // 意味着没有参数 data，只有一个参数 callback bridge.callHandler(tempHandlerName, null, data); } else if (callback == null) { // 第二个参数 callback 为 null 或者只有第一个参数 data bridge.callHandler(tempHandlerName, data); } else { // 两个参数都有 bridge.callHandler(tempHandlerName, data, callback); } } }(handlerName); }; bridge.registerHandler("share", function(data, responseCallback) { var params = {'title':'测试分享的标题','content':'测试分享的内容','url':'http://www.baidu.com'}; responseCallback(params); }); } ); </script> <meta charset="utf-8"> <meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=0, minimum-scale=1.0, maximum-scale=1.0"> <link rel="stylesheet" href="css/default.css" /> <style> .ulrs { margin-bottom: 10px; } .ulrs button { display: block; height: 45px; width: 90%; margin: auto; text-align: center; background-color: lightseagreen; border-radius: 5px; } </style> </head> <body> <ul class="ulrs"> <li><button onclick="requestLocation();">Get Location Info</button></li> <li><button onclick="share();">Share</button></li> </ul> <script> function requestLocation() { SCApp.requestLocation(function(response) { alert(response); }); } function share() { var params = {'title':'测试分享的标题','content':'测试分享的内容','url':'http://www.baidu.com', 'user':{'name':'Jack', 'age':'23'}}; SCApp.share(params); } </script> </body> </html> | Low | [
0.48349056603773505,
25.625,
27.375
] |
Vivica A. Fox: Jessica Simpson 'Diva' Rumors Are 'Lies' Vivica A. Fox is shooting down talk of Jessica Simpson's alleged diva-like behavior on the set of their new film together, Major Movie Star – labeling recent reports nothing but "vicious lies." Fox, a favorite on Dancing with the Stars, tells PEOPLE she was "shocked" when a story surfaced from Major Movie Star's Louisiana location accusing Simpson of being a "spoiled brat" by supposedly refusing to walk from one place to the next without a driver, eating alone in her trailer and barely speaking to her costars, especially Fox. "Those vicious lies they put out were just that – lies," Fox, 43, said Saturday during an event for the fashion label Young, Fabulous & Broke at the LG House in Malibu. In fact, Fox said that Simpson was anything but a diva. "She was so much of a team player. She was gracious and so down to earth." In the comedy, which also stars Cheri Oteri and Steve Guttenberg, Simpson plays a movie star who suddenly falls from grace and finds herself broke. She then enlists in the U.S. Army with the hope the service will change her life. Fox plays a tough sergeant who whips Simpson's character into shape. Speaking of Simpson, Fox said, "She showed a lot of physicality, like 90 percent of all her own stunts, and she sacrificed so much of her body for this movie" Literally. While filming last week, Simpson accidentally injured her nose with a prop gun. "During the scene," remembers Fox, "she looked really intense when I looked in her eyes, and I just thought she was really into it. But when the director [Steve Miner] yelled, 'Cut,' Jessica came over to me and said, 'Vivica I hit my nose with the gun.' " Explains Fox, "We got ice immediately ... Most girls would've stopped right then and there, but she was ready to do another take. She's wonderful." | Mid | [
0.554585152838427,
31.75,
25.5
] |
Costume Photos Costume Information General Cost : £0 Time Taken : 4-5 hours Description I chose to make a Master Chief costume after playing the very first game but have never had the confidence to or any reason to, but seeing as I would like to do an anonymous style cosplay for my first as a way to easy in with confidence building and helps any first time embarrassing moments! Also seeing as he is a fairly recognisable character it means no matter the general opinion people will understand who I am. I think the hardest part will be making the initial clay casts as I have never done anything such as that before also the detailing on the paint will be tedious as there is a lot to do and it must all be to the same standard. The easiest part will be the manufacture of the shell based armour, as it is a quick and simple process. OK so currently moving to uni has resulted in low cash flow so for now cosplay has been put on hold, at home I do have a possible cast but I am not sure how I would come out yet and seeing as I have no money I cannot try. So in Progress but on hold. More to come! Comments 405th.com ;D Go do some Pepakura mate, much easier than clay. Or, try a real challenge and design your own and build it from cardboard! | Mid | [
0.553097345132743,
31.25,
25.25
] |
An Undersea Pyramid has just been discovered in the Azores archipelago! Heavy Synchronicity with AM47!! Image collected by discoverer Diocleciano Silva using GPS technology. On 19 SEP 2013, a Subaquatic Pyrimidal Structure was identified at a depth of 40 meters off the coast of Terceira Island, Azores. The perfectly squared structure was sighted by a private yacht owner, Diocleciano Silva, during a recreational trip. pico-mountain-azores Mt. Pico, the tallest point in the Atlantic Ocean. The pyramid is etimated to be approximately 60 meters high, the enigmatic structure was recorded through CPS digital technology. “The pyramid is perfectly shaped and apparently oriented by the cardinal directions,” Silva told Diário Insular, the local newspaper. Within the past 2 years, archeologists from the Portuguese Association of Archeological Research (APIA) have identified archeological evidence on the Azorean archipelago that supports their belief that human occupation of the Azores predates the arrival of the Portuguese by many thousands of years, possibly even of a Carthaginian or even Atlantean civilization! Project AM47 has been writing to this effect since 2007, with the Azores being the Point of Alchemical EARTH in a globally psycho-cosmic structure of sacred geometry… and now it’s a reality!! Foreign News video with a few more GPS sonar images… Share this: Tweet Email WhatsApp Like this: Like Loading... Related Tags: ancient, atlantis, azores, discovery, evidence, proof, pyramid, underwater | Mid | [
0.618947368421052,
36.75,
22.625
] |
Synthesis of two storage proteins during larval development of the tobacco hornworm, Manduca sexta. Studies of synthesis and accumulation of the two storage proteins arylphorin and female-specific protein (FSP) during the final two larval instars of the tobacco hornworm showed both stage and temporal specificity. Arylphorin was present in both stages, but its synthesis ceased during the molt, during starvation, and at the wandering stage, and then resumed about 24 hr after the onset of feeding. During the larval molt about 25% of injected iodinated arylphorin was incorporated into the newly forming fifth instar cuticle. The cessation of arylphorin synthesis was mimicked by exposure of the fat body to 1 microgram/ml 20-hydroxyecdysone (20HE) in complete Grace's medium or to dilutions of Grace's medium greater than 50%. Lower concentrations of 20HE were ineffective, indicating that the cessation of synthesis in vivo was likely due to a combination of lack of excess nutrients and the hormonal milieu. The female-specific protein was not synthesized until the final larval instar, appearing first in females on Day 2 and later in males at the time of wandering, with synthesis continuing throughout the prepupal period. In vitro studies showed that this protein was synthesized as a 620-kDa protein, and then during secretion a 730-kDa immunoreactive form also appeared. Synthesis of FSP was inhibited by exposure of Day 2 fat body to 1 microgram/ml 20HE for 24 hr. Ligation followed by 20HE infusion showed that the disappearance of FSP from the hemolymph during the prepupal period was controlled by the rising ecdysteroid titer. | High | [
0.7073791348600501,
34.75,
14.375
] |
looking for a tennis partner Hi, just moved to san mateo this year. i used to play tennis in high school ~10 years ago, but haven't played much since. i live near beresford and always see open courts there. would really like to meet some new people and get some regular practice / matches going. | Mid | [
0.6224256292906171,
34,
20.625
] |
Gun violence is one of the major public issues for a sustainable society. In the United States, the number of suicide deaths by gun is larger than that of homicide by gun. More than 60 percent of gun deaths are suicides. Accidental use of gun by children is also a significant concern. Minimization of these problems is therefore desirable. To date, no system has proven to be entirely satisfactory. Therefore, an improved system is desirable that addresses at least some of these concerns. The discussion above is merely provided for general background information and is not intended to be used as an aid in determining the scope of the claimed subject matter. | Mid | [
0.557768924302788,
35,
27.75
] |
Sens. Ben Sasse (R-Neb.) and Richard Blumenthal (D-Conn.) doubled down on claims that Supreme Court nominee Neil Gorsuch was incensed by President Donald Trump’s recent efforts to undermine the judiciary system. The lawmakers discussed personal conversations with Gorsuch during separate appearances Thursday on MSNBC’s “Morning Joe” hours after Trump lashed out at Blumenthal on Twitter. Sen.Richard Blumenthal, who never fought in Vietnam when he said for years he had (major lie),now misrepresents what Judge Gorsuch told him? — Donald J. Trump (@realDonaldTrump) February 9, 2017 It’s unclear what Trump’s particular objection is to the remarks made by Blumenthal. The senator was the first person to reveal Gorsuch’s condemnation of Trump’s “so-called judge” tweet that attacked a federal judge who blocked the president’s travel ban of visitors from seven majority-Muslim countries entering the United States. During a meeting with senators at the White House on Thursday, Trump stood up for his Supreme Court nominee and his qualifications, but once again hammered that the judge’s comments were misrepresented by the Connecticut senator. “His comments were misrepresented and what you should do is ask Sen. Blumenthal about his Vietnam record which didn’t exist,” Trump said, according to a White House press pool report. Ron Bonjean, a spokesman for Gorsuch, confirmed to CNN Wednesday that the U.S. Circuit judge had described Trump’s controversial tweet as “disheartening” and “demoralizing” in a conversation with Blumenthal. Former New Hampshire Sen. Kelly Ayotte, who Trump tapped to shepherd Gorsuch through the nomination process, released a statement Thursday confirming the judge’s comments: Judge Gorsuch has made it very clear in all of his discussions with senators, including Senator Blumenthal, that he could not comment on any specific cases and that judicial ethics prevent him from commenting on political matters. He has also emphasized the importance of an independent judiciary, and while he made clear that he was not referring to any specific case, he said that he finds any criticism of a judge’s integrity and independence disheartening and demoralizing. Sasse also called the president’s tweet “disheartening” Thursday and shed light on his conversation with Gorsuch. “Frankly, [Gorsuch] got pretty passionate about it,” Sasse said. “He said, ‘Any attack on ... brothers or sisters of the robe is an attack on all judges.’” Sasse later took to the Senate floor to say his and Gorsuch’s comments were being overblown by all sides, and that what they really show is Gorsuch is exactly the kind of judge senators should embrace. “I hear some people saying Gorsuch, because he’s been nominated by this president ― and a bunch of people don’t like this president ― therefore he couldn’t possibly be independent, he’d be a puppet,” Sasse said, waving around a copy of the notes he took in his meeting. “And there are other people saying in these private meetings, allegedly, Gorsuch has rented a plane and taken out a sky-writing script and he’s out there saying ‘I hate Donald Trump, I hate Donald Trump.’ That’s nonsense. Neither of those things are true.” Sasse said the judge’s comments were simply a defense of his branch of government, and that Gorsuch pointed to instances in history of past presidents criticizing rulings ― but not the judges ― that were entirely legitimate. “He is not a puppet and he’s not out there attacking the president of the United States,” Sasse said. “He’s meeting with us trying to explain his view of an independent judiciary.” Though Gorsuch appears to be fired up about the president’s actions behind closed doors, he hasn’t spoken out against Trump publicly ― something Blumenthal is urging the Supreme Court nominee to do. “[Gorsuch] should condemn these attacks publicly, unequivocally and clearly,” Blumenthal said. “We’re careening toward a constitutional crisis way bigger than me or even Judge Gorsuch. These attacks on the judiciary are abhorrent and extraordinarily dangerous for our constitutional democracy.” Despite Gorsuch’s confirmed criticism of Trump, White House counselor Kellyanne Conway said Thursday on “Fox & Friends” that the president is “fully confident in the nominee.” This post has been updated with comments made Thursday by Trump during a meeting with senators and by Sasse on the Senate floor. How will Trump’s first 100 days impact you? Sign up for our weekly newsletter and get breaking updates on Trump’s presidency by messaging us here. | Mid | [
0.554166666666666,
33.25,
26.75
] |
medifast: let’s do this thing. Exactly a month ago, I threw in the towel. I was less than a week from hopping on a plane bound for the literal opposite side of the world to see things my heart couldn’t fathom and my head couldn’t compute. Stress compounded upon stress and I felt like the proverbial camel must feel as he watches the straws pile up on his back, wondering which will be the one. I made a decision for myself that I would have the month off of following my Medifast plan. There are 8 million reasons why this isn’t the best plan of action in general, but for me it was the temporary grace I needed to feel like I was going to survive the crazy that mid-August to mid-September held for me. Naturally, Not Being On Plan quickly became Eating All The Emotions which shows me that I still have a long way to grow in the area of my relationship with food. The reality is, stressful seasons of life are not an excuse to eat and live in a way that makes me gain 6 lbs. Yea, you heard me. Six pounds in not as many weeks. I threw up my hands at the pressure of it all and as a result I have lost a precious amount of ground on my journey to a healthy weight. To be fair, I don’t know what the alternative would have looked like for me emotionally. At the time it sure seemed like what I needed to do for myself and my family – not the resultant over eating, just the freedom of not being on plan. This time off has taught me a very important lesson: eating healthy is not for a season, it is for a lifetime. I will not always be on Medifast, but by the time I reach my goal weight and maintain it for at least a year, I sure as hell better have my self-control act together. I’ve understood that in theory before, but now I know the reality of it. I have some serious work to do emotionally, mentally, and physically. In a completely different context, a wise woman told me recently to start where you are. I can’t go back and make myself find the balance between eating Medifast and over-eating for the last month, but I can take a stand right here and say let’s do this thing. How am I losing that weight, you ask? Medifast! If you use the coupon code, OFAMILY56, and sign up for Medifast Advantage, when you order $250+, you’ll receive 56 free Medifast Meals and free shipping! (More details at the bottom of this post.) Disclosure: I receive free product in order to evaluate and comment on my experiences on the Medifast Nursing Mothers Program. I will only ever tell you how I actually feel about this experience and the Medifast products. Pinky swearsies. I am supposed to tell you that the Medifast Program is not intended to diagnose, treat, cure, or prevent any disease or illness and that any medical improvements noted while on the program are related to weight loss in general, and not to Medifast products or programs. K, you got that? Good. There will be a quiz later. I think you look great. I had a twinge of jealousy yesterday when I saw the amazing picture of you sitting on the floor with your boys. You motivate me to lose the last twenty that I have been holding on to since my son was born. Don’t be so hard on yourself. You are an inspiration. I meant to ask you how all this was going. Give yourself grace, friend. I think you made the best decision you could at the time and now it’s something to learn from. AND I thought you looked great this weekend! ;) Love you! I totally get you, girl. I’m finally coming off a 2-month long plateau and re-motivated to put down the sweet “treats” and finish this thing. It took me 2 years to lose my baby weight from Baby 1; I’m nearly 5 months into post-Baby 2, and I am determined to finish these last 13 lbs (to pre baby 2…. 20 to pre baby 1 weight). But you still look adorable — where is that sweater from, by the way? Gorgeous texture around the top! And great color with your hair! I love her! It was so funny seeing you two on the world vision trip and then together last weekend. It felt like watching two friends from different parts of my life becoming friends :) This is random- I’ve read your blog for a while, and never commented, but I’m friends with your college roommate Allison. I came across your blog randomly and died laughing when I came across your post about her and your first year of college! You have inspired me to go back on Medifast to lose my baby weight. Glad to hear of their nursing mothers program as I am nursing my little one as well. I gave a shout out to you on my weight loss blog (a work in progress as I just started it). How did you go about getting the free products to write about your experience? I would like to do that as well. Thanks Allison! this is my first comment here, so first I’d like to say how much I love your blog! I am humbled about all the adventures and projects you are taking on with two small children, it seems like your life is so exciting! And congratulations on your new pregnancy – I think you never wrote a formal post about it (maybe I missed it?), but you just mentioned it in your post about tearing down your roof – so congrats! Now I’m just wondering, are you on a diet while pregnant? So i guess you’re not trying to lose weight but just trying to eat healthy? Anyway, I wish you all the best for your pregnancy and I’m looking forward to reading about how your life evolves and about the third baby:-) Best, Katrin (from Germany) Ah! O, friend! I am not pregnant. :) I did mention climbing a ladder when I was pregnant in that post, but I was referring to back when we tore off our roof in 2010. I am not expecting a third baby anytime soon – but I’m glad to know you’d be excited and not just think I am the crazy. ;) Oops, how embarrassing! So I totally misunderstood – that’s what happens when you don’t read carefully enough. I must admit, I was wondering how you managed to fly all the way to Sri Lanka while pregnant ;-) By way of getting to know each other, just so as to not be such an anonymous reader, I found your website through the Outta Jo, Onto You-Blog, I’m 33 (oh well, basically 34, from tomorrow on), and I live in Berlin w/ my husband and 20 month old daughter. I loved your post about nursing after your trip to Sri Lanka, by the way, especially because I’m also still nursing (not really that this was my goal, but my daughter just doesn’t want to let it go and I don’t want weaning to be a terrible experience for her and me). So it was interesting to read how you handled it – I had a similar situation when I went away for 3 days a while ago. You were lucky the pumping and hand extracting worked, I had no success with the pump nor with extracting by hand, and man, did it hurt on the last day! So anyway, I’m always glad to read from other long time nursing moms, it makes me feel less alone in it:-). | Low | [
0.5127118644067791,
30.25,
28.75
] |
<div class="box box-primary"> <%= form_for @changeset, @path, [class: "form-horizontal"], fn (f) -> %> <div class="box-body"> <h4>Basics</h4> <hr /> <%= FormView.text_field(f, :name) %> <%= FormView.textarea_field(f, :description, rows: 5) do %> <span class="help-block">Available template replacements: <code>room</code>, <code>zone</code></span> <span class="help-block"><%= Help.get("format.resources") %></span> <% end %> <%= FormView.textarea_field(f, :listen, rows: 5) %> <%= FormView.number_field(f, :currency, label: String.capitalize(currency())) %> <h4>Map</h4> <hr /> <%= FormView.number_field(f, :x) %> <%= FormView.number_field(f, :y) %> <%= FormView.number_field(f, :map_layer) %> <div class="form-group"> <%= label f, :ecology, class: "col-md-4" %> <div class="col-md-8"> <%= select f, :ecology, Room.ecologies(), class: "form-control" %> <%= error_tag f, :ecology %> <span class="help-block"><%= Help.get("room.ecology") %></span> </div> </div> <%= FormView.checkbox_field(f, :is_zone_exit, label: "Is a Zone Exit?") do %> <span class="help-block"><%= Help.get("room.zone_exit") %></span> <% end %> <%= FormView.checkbox_field(f, :is_graveyard, label: "Is a Graveyard?") do %> <span class="help-block"><%= Help.get("room.graveyard") %></span> <% end %> <h4>Miscellaneous</h4> <hr /> <%= FormView.textarea_field(f, :notes, rows: 10) %> </div> <div class="box-footer"> <%= submit @submit, class: "btn btn-primary pull-right" %> </div> <% end %> </div> | Mid | [
0.6225895316804401,
28.25,
17.125
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.