text
stringlengths 2
1.05M
| repo_name
stringlengths 5
101
| path
stringlengths 4
991
| language
stringclasses 3
values | license
stringclasses 5
values | size
int64 2
1.05M
|
|---|---|---|---|---|---|
---
abstract: |
The tangential YORP effect (TYORP) plays a significant role in the dynamical evolution of asteroids, and up to now has only been studied numerically. This paper describes the first analytic model of the TYORP effect. Although the model rests on numerous physical and mathematical simplifications, the final analytic expression for TYORP is found to be in agreement with the results of rigorous numeric simulations to the accuracy of several tens per cent.
The obtained analytic expression is used to estimate the TYORP produced by the non-flat surface of regolith, – a contribution to TYORP that has never been considered. It is found that the contribution to TYORP arising from regolith can be comparable to the conventional TYORP produced by boulders.
Then, the analytic expression is fitted with a log-normal function and used to integrate TYORP over all boulder sizes. The general trend of TYORP for multiple boulders appears qualitatively similar to the trend of one boulder, and also demonstrates a maximal TYORP at some particular rotation rate. The obtained expression for integrated TYORP may be instrumental for simulations of evolution of asteroids subject to TYORP.
To conclude, the physical origin of TYORP is discussed in light of the constructed analytic model.
author:
- Oleksiy Golubov
title: Analytic model for tangential YORP
---
Introduction
============
The tangential YORP effect, or TYORP, appears when stones on the surface of an asteroid emit different amounts of infrared light eastward and westward, thus experiencing a net recoil force tangential to the asteroid’s surface. Until now, this effect has only been studied in numeric simulations [@golubov12; @golubov14; @sevecek15; @sevecek16]. Although it was generally understood that the effect was due to the non-linearity of the heat emission law, the detailed physics of the effect remained obscure. Moreover, the question remained whether the whole effect could be attributed to numeric artifacts.
In this article I propose a minimalistic analytic model of the effect, which is based on the following simplifying assumptions:
1\. Instead of solving partial differential equation for the heat conduction in a boulder, the boulder is split into two parts, the eastern part and the western part, and the mean temperature of each part is introduced. Then the mathematical description of the model boils down to a system of two ordinary differential equations for the mean temperatures.
2\. The incoming solar energy as a function of time is approximated by the sum of its zeroth and first order Fourier terms; all higher-order terms are neglected.
3\. The first order Fourier term is treated perturbatively, as if it were small compared to the zeroth order term.
After these simplifications the problem can be easily solved analytically, and the TYORP drag can be calculated. The result fits the numeric simulations surprisingly well.
In Section \[sec-theory\], I provide a derivation of the analytic expression for TYORP. In Section \[sec-shapes\], the derived analytic expression is applied to different geometries, to test it and to make some new predictions. In Section \[sec-multiple\], I simplify the analytic expression and integrate it over different boulder sizes, to evaluate the total TYORP experienced by an asteroid. In Section \[sec-discussion\], I discuss how the derived analytic expression helps to better understand the physics of TYORP.
General theory\[sec-theory\]
============================
Derivation of the heat conduction equations
-------------------------------------------
Heat balance within any volume part $V$ of a boulder is governed by the following heat conduction equation in the integral form, $$\begin{aligned}
C\rho\int\limits_V\frac{\partial T}{\partial t}\mathrm{d}V=
\kappa\int\limits_{S_\mathrm{st}}\frac{\partial T}{\partial X_i}\mathrm{d}S_i+ \nonumber\\
+(1-A)\int\limits_{S_\mathrm{sp}}I_i\mathrm{d}S_i-
\epsilon\sigma \int\limits_{S_\mathrm{sp}}T^4\mathrm{d}S\,.
\label{dimensional_heat_balance}\end{aligned}$$ Here $T$ stands for the temperature. The left-hand side describes the total heat energy increase in the volume $V$, while the right-hand side is the sum of the heat conduction into this volume, the direct solar heat absorbed by its open surface, and the negative heat emitted by the open surface. The surface areas $S_\mathrm{st}$, $S_\mathrm{sp}$, and $S_\mathrm{reg}$ are parts of the volume’s boundary bordering respectively stone, space, and regolith, so that $S_\mathrm{st}+S_\mathrm{sp}+S_\mathrm{reg}=\partial V$ is the full boundary of the volume $V$ (see the left-hand panel of Figure \[fig:vs\]). The heat conductivity of the stone is $\kappa$, its heat capacity is $C$, the density is $\rho$, the hemispherical albedo is $A$, and the emissivity is $\epsilon$. The heat conductivity of the regolith is assumed to be zero. $\sigma$ is Stefan–Boltzmann’s constant, and $\mathbf{I}$ is the vector of the incoming solar energy flux.
(-6,0)–(-2,0)–(-2,-1.5)–(-6,-1.5)–cycle; (-6,0) – (-2,0);
(-6,1.5)–(-2,1.5)–(-2,-1.5)–(-6,-1.5)–cycle; (-4,0) ellipse (1.5 and 1); (-4,0) ellipse (1.5 and 1); (-4.5,-1) arc(270:90:1) – (-4.5,-1) –(-4,-1)–(-4,1)–(-4.5,1)–cycle;
(-5.5,0) arc (180:90:1) ; (-4.5,1)–(-4,1); (-5.5,0) arc (180:270:1) ; (-4.5,-1)–(-4,-1); (-4,-1) – (-4,1);
at (-5.4,1) [$S_\mathrm{sp}$]{}; at (-5.3,-1) [$S_\mathrm{reg}$]{}; at (-3.7,0.5) [$S_\mathrm{st}$]{}; at (-4.7,0) [$V$]{}; at (-3.5,-0.5) [stone]{}; at (-3.9,-1.3) [regolith]{}; at (-3.5,1.2) [space]{};
(-1.5,0)–(1.5,0)–(1.5,-1.5)–(-1.5,-1.5)–cycle; (-1.5,0) – (1.5,0);
(0,-1) arc(270:90:1) – (0,-1) –cycle; (0,-1) arc(-90:90:1) – (0,-1) –cycle;
(0,-1) – (0,1); (1,0) arc (0:90:1) ; (1,0) arc (0:-90:1) ; (-1,0) arc (180:90:1) ; (-1,0) arc (180:270:1) ;
at (-1,1) [$s_\mathrm{sp\ w}$]{}; at (-1,-1) [$s_\mathrm{reg\ w}$]{}; at (1,1) [$s_\mathrm{sp\ e}$]{}; at (1,-1) [$s_\mathrm{reg\ e}$]{}; at (0.3,0.5) [$s_\mathrm{st}$]{}; at (-0.5,0) [$v_\mathrm{w}$]{}; at (0.5,0) [$v_\mathrm{e}$]{};
Now I nondimensionalize the variables. Instead of time $t$, I use the rotation phase $\phi=\omega t$, with $\omega$ being the angular velocity of the asteroid. By definition, $\phi=0$ at noon. The characteristic scales of length and temperature are $$L_\mathrm{cond}=\frac{\kappa}{\left((1-A)\Phi\right)^{3/4}\left(\epsilon \sigma \right)^{1/4}}\,,$$ $$T_0=\sqrt[4]{\frac{(1-A)\Phi}{\epsilon\sigma}}\,,$$ with $\Phi$ being the solar constant. Here $T_0$ is the equilibrium temperature at the subsolar point, while $L_\mathrm{cond}$ is the distance at which the temperature difference $T_0$ creates heat flux equal to $A\Phi$. I use these two scales to introduce the dimensionless variables $x_i=X_i/L_\mathrm{cond}$ and $\tau=T/T_0$. The relative importance of heat conduction with respect to heat absorption and emission is characterized by the thermal parameter $$\theta=\frac{\left(C\rho\kappa\omega\right)^{1/2}}{\left((1-A)\Phi\right)^{3/4}\left(\epsilon \sigma \right)^{1/4}}.$$
With these definitions, Eqn. (\[dimensional\_heat\_balance\]) transforms into $$\begin{aligned}
\theta^2\int\limits_v\frac{\partial \tau}{\partial \phi}\mathrm{d}v=
\int\limits_{s_\mathrm{st}}\frac{\partial \tau}{\partial x_i}\mathrm{d}s_i+
\int\limits_{s_\mathrm{sp}}\frac{I_i}{\Phi}\mathrm{d}s_i-
\int\limits_{s_\mathrm{sp}}\tau^4\mathrm{d}s\,.
\label{heat_balance1}\end{aligned}$$ Here $v$ and $s$ correspond to the same volumes and areas as before, but measured in the dimensionless variables $x_i$ instead of the dimensional variables $X_i$.
Now I separate the boulder into the western and the eastern parts and apply Eqn. (\[dimensional\_heat\_balance\]) to each part separately. I assume that the boulder is symmetric, with the western and the eastern parts being mirror reflections of each other. Let $v$ henceforth denote the dimensionless volume of each half of the boulder (either $v_\mathrm{w}$ or $v_\mathrm{e}$, see the right-hand panel of Figure \[fig:vs\]), and $s_\mathrm{sp}$ denote their equal dimensionless surface areas bordering space (either $s_\mathrm{sp\ e}$ or $s_\mathrm{sp\ w}$ in the right-hand panel of Figure \[fig:vs\]). I denote the mean dimensionless temperatures of the western and the eastern parts of the boulder via $\tau_\mathrm{w}$ and $\tau_\mathrm{e}$ correspondingly, $$\begin{aligned}
\tau_\mathrm{w}&=& \frac{1}{v}\int\limits_{v_\mathrm{w}} \tau \, dv \,, \nonumber \\
\tau_\mathrm{e}&=& \frac{1}{v}\int\limits_{v_\mathrm{e}} \tau \, dv\,.\end{aligned}$$ The temperature gradient at the border between the two parts of the boulder can be estimated as the temperature difference divided by the distance, $(\tau_\mathrm{w}-\tau_\mathrm{e})/l_\mathrm{ew}$, with $l_\mathrm{ew}$ being the typical distance between the eastern and western parts of the boulder, i.e. roughly the distance between the centers of the two parts. To estimate the last term in the right-hand side of Eqn. (\[heat\_balance1\]), $\tau$ can be substituted by its mean value, i.e. $\tau_\mathrm{w}$ and $\tau_\mathrm{e}$ for the western and the eastern parts of the boulder respectively.[^1] Therefore, with these simplifications in place, Eqn. (\[heat\_balance1\]) for the two parts of the boulder assumes the following form: $$\begin{aligned}
\theta^2 v \tau_\mathrm{w}'&=& \frac{s_\mathrm{st}}{l_\mathrm{ew}}(\tau_\mathrm{e}-\tau_\mathrm{w})+s_\mathrm{sp}i_\mathrm{w}-s_\mathrm{sp}\tau_\mathrm{w}^4\,, \nonumber \\
\theta^2 v \tau_\mathrm{e}'&=& \frac{s_\mathrm{st}}{l_\mathrm{ew}}(\tau_\mathrm{w}-\tau_\mathrm{e})+s_\mathrm{sp}i_\mathrm{e}-s_\mathrm{sp}\tau_\mathrm{e}^4\,.
\label{heat_balance2}\end{aligned}$$ Here $i_\mathrm{w}$ and $i_\mathrm{e}$ denote the dimensionless solar energy fluxes, defined as $$\begin{aligned}
i_\mathrm{w}&=& \frac{1}{\Phi s_\mathrm{sp}}\int\limits_{s_\mathrm{sp\ w}}I_i\mathrm{d}s_i\,, \nonumber \\
i_\mathrm{e}&=& \frac{1}{\Phi s_\mathrm{sp}}\int\limits_{s_\mathrm{sp\ e}}I_i\mathrm{d}s_i\,.\end{aligned}$$
I decompose $i_\mathrm{w}(\phi)$ and $i_\mathrm{e}(\phi)$ into a Fourier series, and disregard all of the terms except for the zeroth and first order ones. This simplification can alter the final result, but still can serve as an estimate. Even with a modified illumination function, it is still a valid physical problem, whose solution must still bear the basic properties of the tangential YORP. Thus, for insolation I substitute $$\begin{aligned}
i_\mathrm{w}=C\cos{\phi}+S\sin{\phi}+\tau_0^4 \,, \nonumber \\
i_\mathrm{e}=C\cos{\phi}-S\sin{\phi}+\tau_0^4 \,,
\label{insolation}\end{aligned}$$ where $C$, $S$, and $\tau_0$ are constants. Here, $\tau_0$ has a physical meaning of the dimensionless temperature of the boulder, for which the emitted power equals the time-averaged absorbed power. Usually $\tau_0$ is close to the mean temperature of the boulder. When writing the same $\tau_0$ in both equations, the same coefficients for cosine and opposite coefficients for sine, I took into account that in the morning the eastern part of a symmetric boulder is illuminated in exactly the same manner as the western part is in the evening, so that $i_\mathrm{w}(\phi)=i_\mathrm{e}(-\phi)$.
Next, I introduce the coefficients $$a=\frac{v}{s_\mathrm{sp}l}\,,\,\,\, b=\frac{s_\mathrm{st}l}{s_\mathrm{sp}l_\mathrm{ew}} \,,
\label{ab}$$ where $l$ is some typical boulder size. Both coefficients $a$ and $b$ depend solely on the boulder shape, while the dependence on size only enters through $l$.
Finally, substituting Eqs. (\[insolation\]) and (\[ab\]) into Eqn. (\[heat\_balance2\]), I obtain $$\begin{aligned}
\theta^2 al \tau_\mathrm{w}'&=& \frac{b}{l} (\tau_\mathrm{e}-\tau_\mathrm{w})+C\cos{\phi}+S\sin{\phi}+\tau_0^4-\tau_\mathrm{w}^4\,,\nonumber \\
\theta^2 al \tau_\mathrm{e}'&=& \frac{b}{l} (\tau_\mathrm{w}-\tau_\mathrm{e})+C\cos{\phi}-S\sin{\phi}+\tau_0^4-\tau_\mathrm{e}^4\,.
\label{heat_balance}\end{aligned}$$ Although this system is much simpler than the exact partial differential equation describing the heat conduction, it still cannot be exactly solved analytically because of the nonlinearity $\tau^4$. Therefore, I aim to construct its approximate analytic solution, which I do in the following subsection.
Approximate solution of the heat conduction equations
-----------------------------------------------------
I am looking for the solution of Eqs. (\[heat\_balance\]) in the form of a series in terms of $C$ and $S$, $$\begin{aligned}
\tau_\mathrm{w}&=& \tau_\mathrm{w0}+\tau_\mathrm{w1}+\tau_\mathrm{w2}+...\,, \nonumber \\
\tau_\mathrm{e}&=& \tau_\mathrm{e0}+\tau_\mathrm{e1}+\tau_\mathrm{e2}+...\,,
\label{decomposition}\end{aligned}$$ where $\tau_\mathrm{w0}$ and $\tau_\mathrm{e0}$ are independent of $C$ and $S$, $\tau_\mathrm{w1}$ and $\tau_\mathrm{e1}$ are proportional to the first powers of $C$ and $S$, $\tau_\mathrm{w2}$ and $\tau_\mathrm{e2}$ are proportional to their second powers, and so on. As I am looking for a relaxed periodic solution, all the terms have to be periodic in $\phi$ with a period of $2\pi$. I am going to account for the contribution to TYORP of only the first three terms, and to disregard higher-order terms. This is perfectly justified if $C,S\ll\tau_0^4$, but usually $C$ and $S$ are only slightly less than $\tau_0$ (compare with Table \[tab:geometry\]). It implies that the decomposition in the form of Eqn. (\[decomposition\]) converges slowly, if at all. Still, making $C$ and $S$ a factor of few smaller would make for a good convergence, and all the further analysis would be justified. Then I can assume that the extrapolation of the approximate formulas into the domain $C\sim S\sim \tau_0^4$ must give a reasonable order-of-magnitude estimate for TYORP.
Note, that Eqn. (\[decomposition\]) is a Taylor series in terms of $C$ and $S$, in contrast to Eqn. (\[insolation\]), which is a Fourier series in terms $\phi$. I hold Fourier terms in Eqn. (\[insolation\]) up to the first order and Taylor terms in Eqn. (\[decomposition\]) up to the second order, in order to construct the minimal model for TYORP. With merely zeroth-order terms in either Eqn. (\[insolation\]) or Eqn. (\[decomposition\]), TYORP would vanish. Therefore, retaining first-order terms in both expansions is absolutely necessary. Retaining also the second-order Taylor term in Eqn. (\[decomposition\]) is motivated by the fact that its contribution is of the same order as the contribution of the first-order Taylor term (as we will see later from Eqs. (\[2nd\_2\]) and (\[p\_series\])). Taking more terms in either the Fourier decomposition Eqn. (\[insolation\]) or the Taylor decomposition Eqn. (\[decomposition\]) can make the solution more precise, but at the cost of increasing complexity of the problem and of the final expression. Moreover, treating even an infinite number of terms in both the decompositions will not make the solution exact, because the initial Equation (\[heat\_balance\]) is already an approximation. This can turn any attempt to go beyond the minimalistic model in Eqs. (\[insolation\]) and (\[decomposition\]) into an overkill.
Thus I substitute Eqn. (\[decomposition\]) into Eqn. (\[heat\_balance\]), and equate the terms of the same order. In the highest (zeroth) order I get $$\begin{aligned}
\theta^2 al \tau_\mathrm{w0}'&=& \frac{b}{l} (\tau_\mathrm{e0}-\tau_\mathrm{w0})+\tau_0^4-\tau_\mathrm{w0}^4\,, \nonumber \\
\theta^2 al \tau_\mathrm{e0}'&=& \frac{b}{l} (\tau_\mathrm{w0}-\tau_\mathrm{e0})+\tau_0^4-\tau_\mathrm{e0}^4\,.
\label{0th}\end{aligned}$$ The periodic solution of this equation is $\tau_\mathrm{w0}=\tau_\mathrm{e0}=\tau_0$.
I substitute the obtained $\tau_\mathrm{w0}$ and $\tau_\mathrm{e0}$ back into Eqs. (\[heat\_balance\]) and write the terms of the first order, which are linear in terms of $C$ and $S$: $$\begin{aligned}
\theta^2 al \tau_\mathrm{w1}'&=& \frac{b}{l} (\tau_\mathrm{e1}-\tau_\mathrm{w1})+C\cos{\phi}+S\sin{\phi}-4\tau_0^3 \tau_\mathrm{w1} \,,\nonumber \\
\theta^2 al \tau_\mathrm{e1}'&=& \frac{b}{l} (\tau_\mathrm{w1}-\tau_\mathrm{e1})+C\cos{\phi}-S\sin{\phi}-4\tau_0^3 \tau_\mathrm{e1} \,.
\label{1st}\end{aligned}$$ This is a system of linear differential equations with a sinusoidal inhomogeneity, whose periodic solution can be found in the form $$\begin{aligned}
\tau_\mathrm{w1}&=&C_\mathrm{w1}\cos{\phi}+S_\mathrm{w1}\sin{\phi} \,,\nonumber \\
\tau_\mathrm{e1}&=&C_\mathrm{e1}\cos{\phi}+S_\mathrm{e1}\sin{\phi} \,.
\label{sinusoidal_solution}\end{aligned}$$ By substituting Eqn. (\[sinusoidal\_solution\]) into Eqn. (\[1st\]) and equating the coefficients in front of the sines and cosines, I get $$\begin{aligned}
C_\mathrm{w1}&=&\frac{4\tau_0^3C}{16\tau_0^6+a^2l^2\theta^4}-\frac{al^3\theta^2S}{4(b+2l\tau_0^3)^2+a^2l^4\theta^4}\,,\nonumber \\
S_\mathrm{w1}&=&\frac{al\theta^2C}{16\tau_0^6+a^2l^2\theta^4}+\frac{2l(b+2l\tau_0^3)S}{4(b+2l\tau_0^3)^2+a^2l^4\theta^4}\,,\nonumber \\
C_\mathrm{e1}&=&\frac{4\tau_0^3C}{16\tau_0^6+a^2l^2\theta^4}+\frac{al^3\theta^2S}{4(b+2l\tau_0^3)^2+a^2l^4\theta^4}\,,\nonumber \\
S_\mathrm{e1}&=&\frac{al\theta^2C}{16\tau_0^6+a^2l^2\theta^4}-\frac{2l(b+2l\tau_0^3)S}{4(b+2l\tau_0^3)^2+a^2l^4\theta^4}\,.
\label{CS_coefficients}\end{aligned}$$
Finally, I write down the second order terms of Eqs. (\[heat\_balance\]), which are quadratic in terms of $C$ and $S$: $$\begin{aligned}
\theta^2 al \tau_\mathrm{w2}'&=& \frac{b}{l} (\tau_\mathrm{e2}-\tau_\mathrm{w2})-6\tau_0^2 \tau_\mathrm{w1}^2-4\tau_0^3 \tau_\mathrm{w2}\,, \nonumber \\
\theta^2 al \tau_\mathrm{e2}'&=& \frac{b}{l} (\tau_\mathrm{w2}-\tau_\mathrm{e2})-6\tau_0^2 \tau_\mathrm{e1}^2-4\tau_0^3 \tau_\mathrm{e2}\,.
\label{2nd}\end{aligned}$$ I subtract Eqs. (\[2nd\]) from each other, and average the result. The left-hand side averages to 0, as $\tau_\mathrm{w2}$ and $\tau_\mathrm{e2}$ are periodic, and I am left with $$\langle\tau_\mathrm{w2}\rangle-\langle\tau_\mathrm{e2}\rangle
=-\frac{3l\tau_0^2}{b+2l\tau_0^3} (\langle\tau_\mathrm{w1}^2\rangle-\langle\tau_\mathrm{e1}^2\rangle)\,.
\label{2nd_2}$$ One does not need to find the exact expressions for $\tau_\mathrm{w2}$ and $\tau_\mathrm{e2}$: as will be seen in the next subsection, Eqn. (\[2nd\_2\]) suffices to compute TYORP in the second order in terms of $C$ and $S$.
Computation of TYORP
--------------------
A heated surface emits light and experiences the recoil pressure $$P=\frac{2}{3c}\epsilon\sigma T^4=\frac{(1-A)\Phi}{c}\frac{2}{3}\tau^4\,.
\label{pressure}$$ Here $c$ is the speed of light, and the coefficient 2/3 corresponds to the light emission in accordance with Lambert’s law.
To get the force experienced by the boulder in the eastward direction, I integrate this pressure over the boulder’s surface, and take the $F_1$ component of the total force, assuming that the $x_1$ axis is directed from west to east: $$F_1=-\int\limits_{S_\mathrm{sp}}P\,\mathrm{d}S_1\,.
\label{force}$$
I average this force over time and nondimensionalize it by dividing it by $(1-A)\Phi S_\mathrm{proj}/c$, where $S_\mathrm{proj}$ is the horizontal projected area of the boulder. Thus I get the dimensionless TYORP pressure, $$p=-\frac{2}{3}\frac{1}{s_\mathrm{proj}}\int\limits_{s_\mathrm{sp}}\langle\tau^4\rangle\,\mathrm{d}s_1\,.
\label{p_def}$$ Now let us recall the assumption that the boulder is separated into two parts, with the dimensionless temperatures $\tau_\mathrm{w}$ and $\tau_\mathrm{e}$, and the two parts are symmetric, with the same surface area of the western and eastern parts, $s_{\mathrm{sp}\,\mathrm{w}}=s_{\mathrm{sp}\,\mathrm{e}}$. Assuming $\mathrm{d}s_1$ to always be negative at $s_{\mathrm{sp}\,\mathrm{w}}$ and always positive at $s_{\mathrm{sp}\,\mathrm{e}}$, I get $$\begin{aligned}
p&=&-\frac{2}{3}\frac{1}{s_\mathrm{proj}}\left(
\langle\tau_\mathrm{w}^4\rangle\int\limits_{s_{\mathrm{sp}\,\mathrm{w}}}\mathrm{d}s_1
+\langle\tau_\mathrm{e}^4 \rangle\int\limits_{s_{\mathrm{sp}\,\mathrm{e}}}\mathrm{d}s_1\right)\nonumber \\
&=& \frac{2}{3}\frac{1}{s_\mathrm{proj}}\left(
\langle\tau_\mathrm{w}^4\rangle\int\limits_{s_{\mathrm{sp}\,\mathrm{w}}}\mathrm{d}|s_1|
-\langle\tau_\mathrm{e}^4 \rangle\int\limits_{s_{\mathrm{sp}\,\mathrm{e}}}\mathrm{d}|s_1|\right)\nonumber \\
&=&\frac{2}{3}\langle \tau_\mathrm{w}^4-\tau_\mathrm{e}^4\rangle\frac{1}{s_\mathrm{proj}}
\int\limits_{s_{\mathrm{sp}\,\mathrm{w}}}\mathrm{d}|s_1|\nonumber \\
&=&\frac{2}{3}\frac{s_\mathrm{ew}}{s_\mathrm{proj}}\langle \tau_\mathrm{w}^4-\tau_\mathrm{e}^4\rangle\,.
\label{p_transformation}\end{aligned}$$ Here $s_\mathrm{ew}=\int_{s_{\mathrm{sp}\,\mathrm{w}}}\mathrm{d}|s_1|$ denotes the area of the boulder projected onto the vertical meridianal plane. It is convenient to introduce a new coefficient, $$n=\frac{2s_\mathrm{ew}}{s_\mathrm{proj}}\,.
\label{n}$$ This coefficient $n$ characterizes steepness of the surface. If $s_\mathrm{proj}$ is understood as the horizontal projected area of the boulder, then $n=\langle\tan{\alpha_\mathrm{ew}}\rangle$ is the mean tangent of the slope of the surface in the east-west direction. It is zero for a flat surface, unity for a surface with 45$^\circ$ slopes, and bigger for even steeper slopes. Now, substituting Eqn. (\[n\]) into Eqn. (\[p\_transformation\]) and using the decomposition of $\tau$ from Eqn. (\[decomposition\]), results into $$\begin{aligned}
p&=&\frac{1}{3}n\langle \tau_\mathrm{w}^4-\tau_\mathrm{e}^4 \rangle \nonumber \\
&=&\frac{1}{3}n\langle \tau_0^4+4\tau_0^3\tau_\mathrm{w1}+4\tau_0^3\tau_\mathrm{w2}+6\tau_0^2\tau_\mathrm{w1}^2+... \nonumber \\
&&-\tau_0^4-4\tau_0^3\tau_\mathrm{e1}-4\tau_0^3\tau_\mathrm{e2}-6\tau_0^2\tau_\mathrm{e1}^2-... \rangle\,.
\label{p_series}\end{aligned}$$ As $\tau_\mathrm{w1}$ and $\tau_\mathrm{e1}$ are sinusoidal, their means are 0. The means of $\tau_\mathrm{w2}$ and $\tau_\mathrm{e2}$ are obtained from Eqn. (\[2nd\_2\]). Thus Eqn. (\[p\_series\]) results in $$\begin{aligned}
p=\frac{2nb\tau_0^2}{b+2l\tau_0^3} (\langle\tau_\mathrm{w1}^2\rangle-\langle\tau_\mathrm{e1}^2\rangle)\,.
\label{p_tau1}\end{aligned}$$ Using Eqs. (\[sinusoidal\_solution\]) for $\tau_\mathrm{w1}$ and $\tau_\mathrm{e1}$ leads to $$\begin{aligned}
\langle\tau_\mathrm{w1}^2\rangle-\langle\tau_\mathrm{e1}^2\rangle=\frac{1}{2}(C_\mathrm{w1}^2+S_\mathrm{w1}^2-C_\mathrm{e1}^2-S_\mathrm{e1}^2)\,.\end{aligned}$$ Finally, substituting this expression into Eqn. (\[p\_tau1\]) and using Eqn. (\[CS\_coefficients\]), I obtain $$\begin{aligned}
p=\frac{8nab^2\tau_0^2l^2\theta^2CS}{(b+2l\tau_0^3)(16\tau_0^6+a^2l^2\theta^4)(4(b+2l\tau_0^3)^2+a^2l^4\theta^4)}\,.
\label{p_general}\end{aligned}$$
This is the analytic expression of TYORP that I was looking for. It allows one to approximately estimate TYORP using the shape and thermal properties of the boulder. In the following section, I apply it to several different boulder shapes.
Application of analytic TYORP expression to boulders of different shapes\[sec-shapes\]
======================================================================================
One-dimensional wall
--------------------
Let us start testing this analytic expression with the simplest and historically first model of TYORP: one-dimensional heat conductivity in a wall by [@golubov12]. The high long wall stands on regolith, going from the north to the south, and is illuminated by the sun alternatively from the east or the west (panel (a) in Figure \[fig:geometries\]). Given that the dimensionless thickness of the wall is $d$ and considering its patch of dimensionless surface area $s$, I separate the wall into the eastern and the western slabs with the thicknesses $\frac{d}{2}$. Then the volume of each slab is $v=\frac{sd}{2}$ and the typical distance between the slabs is $l_\mathrm{ew}=\frac{d}{2}$. Thus I go on, filling in the geometric properties in the first row of Table \[tab:geometry\], until I get $a$, $b$ and $n$. (Note though, that for $s_\mathrm{proj}$ I take not a horizontal projected surface area, but a vertical one, which is the only meaningful definition for a very high vertical wall. It also renders $n$ different from its conventional meaning of $\langle\tan{\alpha_\mathrm{ew}}\rangle$.)
To compute the last three columns in Table \[tab:geometry\], I need the insolation function, for which I take $$i_w(\phi)=2\mathrm{sin}\phi,\, 0<\phi<\frac{\pi}{2}.
\label{i_wall}$$ The coefficient 2 is due to the assumed mirror reflection of light by the regolith. Decomposing $i_w(\phi)$ into the Fourier series, I finish filling in the first row of Table \[tab:geometry\].
(-4,1)–(-1,1)–(-1,-0.5)–(-4,-0.5)–cycle; (4,1)–(0,1)–(0,-0.5)–(4,-0.5)–cycle; (-4,-2)–(-3,-2.5)–(-1,-1.5)–(1,-2.5)–(3,-1.5)–(4,-2.)–(4,-3.5)–(-4,-3.5)–cycle; (-3,1)–(-2,1)–(-2,3)–(-3,3)–cycle;
(-4,1) – (-1,1); (0,1) – (4,1); (-4,-2.) – (-3,-2.5); (-3,-2.5) – (-1,-1.5); (-1,-1.5) – (1,-2.5); (1,-2.5) – (3,-1.5); (3,-1.5) – (4,-2.);
(-1,-1.5)–(3,-1.5); (1,-2.5)–(2.5,-2.5);
(-2,1)–(-2,3); (-2,3)–(-3,3); (-3,1)–(-3,3);
(2,1) circle \[radius=1.\]; (2,1) circle \[radius=1.\]; (2,1)–(1.295,0.295);
(-2.5,1)–(-2.5,3); (2,0)–(2,2); (-3,-2.5)–(-3,-3); (-1,-1.5)–(-1,-3); (1,-2.5)–(1,-3); (3,-1.5)–(3,-3); (-4,-3)–(4,-3); (4,-2)–(4,-3);
at (-2.5,0.7) [$d$]{}; at (-3.2,2) [$s$]{}; at (1.5,0.8) [$r$]{}; at (1,-1.3) [$\lambda$]{}; at (1.7,-2.35) [$\alpha$]{}; at (3.8,-2.5) [$\frac{\lambda}{2\pi}$]{}; at (-2,-2.7) [$\frac{\lambda}{2}$]{};
at (-3.7,2.7) [(a)]{}; at (0.3,2.7) [(b)]{}; at (-3.7,-1.3) [(c)]{};
Shape $l$ $v$ $s_\mathrm{st}$ $s_\mathrm{sp}$ $s_\mathrm{proj}$ $s_\mathrm{ew}$ $l_\mathrm{ew}$ $a=\frac{v}{s_\mathrm{sp}l}$ $b=\frac{s_\mathrm{st}l}{s_\mathrm{sp}l_\mathrm{ew}}$ $n=\frac{2s_\mathrm{ew}}{s_\mathrm{proj}}$ $\tau_0$ $C$ $S$
-------------------- ----------- -------------------------- ----------------- ----------------- ------------------- ---------------------- --------------------- ------------------------------ ------------------------------------------------------- -------------------------------------------- -------------------------------- ---------------------- ----------------------
Wall $d$ $\frac{sd}{2}$ $s$ $s$ $s$ $s$ $\frac{d}{2}$ $\frac{1}{2}$ 2 2 $\frac{1}{\sqrt[4]{\pi}}$ $\frac{1}{\pi}$ $\frac{1}{2}$
Sphere (mirror) $r$ $\frac{2}{3}\pi r^3$ $\pi r^2$ $\pi r^2$ $\pi r^2$ $\frac{1}{2}\pi r^2$ $r$ $\frac{2}{3}$ 1 1 $\frac{1}{\sqrt{2}}$ $\frac{1}{\pi}$ $\frac{1}{4}$
Sphere (absorbing) $r$ $\frac{2}{3}\pi r^3$ $\pi r^2$ $\pi r^2$ $\pi r^2$ $\frac{1}{2}\pi r^2$ $r$ $\frac{2}{3}$ 1 1 $\sqrt[4]{\frac{\pi+2}{8\pi}}$ $\frac{\pi+4}{8\pi}$ $\frac{\pi-1}{4\pi}$
Wave $\lambda$ $\frac{\lambda s}{2\pi}$ $\frac{s}{\pi}$ $\frac{s}{2}$ $s$ $\frac{s\alpha}{2}$ $\frac{\lambda}{2}$ $\frac{1}{2\pi}$ $\frac{4}{\pi}$ $\alpha$ $\frac{1}{\sqrt[4]{\pi}}$ $\frac{1}{2}$ $\frac{\alpha}{2}$
\[tab:geometry\]
{width="45.00000%"} {width="45.00000%"}
{width="45.00000%"} {width="45.00000%"}
Now I substitute the obtained coefficients $a$, $b$, $n$, $\tau_0$, $C$ and $S$ into Eqn. \[p\_general\], and in Figures \[fig:wall\_plots\] and \[fig:wall\_maps\] compare the resulting analytic expression for TYORP pressure $p$ with the numeric simulations by [@golubov11] and [@golubov12]. The agreement is almost too good, given the approximations made while constructing the theory. For the values of $l$ and $\theta$ that correspond to big $p$, the value of $p$ is predicted with an accuracy of a few tens per cent (Figure \[fig:wall\_plots\]), although far from the maximal $p$ the accuracy is worse. The area where $p$ is big, is very similar in the analytic theory and in the simulations (Figure \[fig:wall\_plots\]). The qualitative behavior of $p$ as a function of $l$ and $\theta$ is also reproduced correctly. This is as good as one could expect from a simple estimate done by such an approximate theory.
A few warnings are still to be made. In Figure \[fig:wall\_plots\], I disregard negative simulated values of $p$, observed by [@golubov12] for big $l$ and $\theta$. [@golubov12] suggested that these negative values could be numeric artifacts, and this was later confirmed by [@sevecek15], who only obtained positive $p$ in all their simulations. Furthermore, [@sevecek15] proved that mirror reflection of light by the regolith is a bad approximation (worse, in fact, than disregarding reflected light completely). Still, this approximation enters both the theory and the simulations, so they should be wrong in the same way, and thus agree with each other, which they do.
Spherical boulder
-----------------
The second model I want to study is a particular case from [@golubov14]: a spherical boulder of radius $r$ lying half buried in the regolith on the equator of an asteroid (panel (b) in Figure \[fig:geometries\]). I separate the boulder into the eastern and the western hemispheres, and list all the necessary geometric properties in Table \[tab:geometry\]. For the typical distance between the hemispheres $l_\mathrm{ew}$ I take $r$, which is half the distance between their most remote points. Measuring the distance between their centers of mass instead would result into $\frac{3}{4}r$, and an argument could be also made for using this value instead, although the difference should not matter much given the crudeness of all the previously made assumptions. For $s_\mathrm{proj}$ I take the horizontal projection of the boulder, $\pi r^2$. This is different from [@golubov14], who considered a regular array of boulders and used for $s_\mathrm{proj}$ the surface area per boulder. Therefore, I re-normalize their results. Note that the choice of $s_\mathrm{proj}$ does not influence the observable physical values: $s_\mathrm{proj}$ enters the definition of $p$ inversely, but also enters the transformation factor from $p$ to $F$ directly, and thus cancels out.
For the insolation I try two possibilities. First, assuming mirror reflection of light by the regolith, I get (see Figure \[fig:sphere-illumination\] for explanation) $$i_w(\phi)=\frac{1}{2}(1+\mathrm{sin}\phi),\, -\frac{\pi}{2}<\phi<\frac{\pi}{2}.
\label{i_ball1}$$ Second, assuming full absorption of light by the regolith, and thus accounting for only the direct solar irradiation, I get $$\begin{aligned}
i_w(\phi)=\frac{1}{2}(1+\mathrm{sin}\phi),\,\,\mathrm{if}\,\, -\frac{\pi}{2}<\phi<0, \nonumber\\
i_w(\phi)=\frac{1}{2}(\mathrm{cos}\phi+\mathrm{sin}\phi),\,\,\mathrm{if}\,\, 0<\phi<\frac{\pi}{2}.
\label{i_ball2}\end{aligned}$$ I treat the two cases separately in the second and third rows of Table \[tab:geometry\].
(-4,0)–(0,0)–(0,-2)–(-4,-2)–cycle; (-2,-1.5) arc(270:90:1.5) –cycle; (-2,-1.5) arc(-90:90:1.5) –cycle; (-2,0) circle \[radius=1.5\]; (-4,0)–(0,0); (-2,-1.5)–(-2,2); (-2.75,-1.3)–(-1.25,1.3);
(-3.5,0)–(-2.374,-0.65); (-4, 0.29)–(-3.5,0); (-3.25,0.75)–(-2,0); (-4,1.15)–(-3.25,0.75); (-4, 2.02)–(-2.75,1.3); (-2,1.5)–(-1.35,1.125); (-2.9,2.02)–(-2,1.5); (-2.5,2.02)–(-1.25,1.3);
at (-2.15,0.3) [$\phi$]{}; at (-3.7,-0.2) [W]{}; at (-0.3,-0.2) [E]{}; at (-1.07,1.43) [$A'$]{}; at (-2.88,-1.43) [$A$]{}; at (-2.3,-0.7) [$B$]{}; at (-1.85,-0.13) [$O$]{}; at (-1.25,1.05) [$C$]{};
(2,0) circle \[radius=1.5\]; (2,0) ellipse (1.1 and 1.5); (2,1.5) arc(90:270:1.5) –cycle; (2,0) ellipse (0.75 and 1.5); (2,0) circle \[radius=1.5\]; (0.5, 0)–(3.5,0); (2,-1.5)–(2,1.5); at (2.6,-0.5) [$r\sin\phi$]{}; at (1.63,-0.5) [$r\cos\phi$]{}; at (3.3,-0.8) [$r(1-\sin\phi)$]{}; at (0.875,-0.8) [$r(1-\cos\phi)$]{}; at (2.12,0.75) [$r$]{}; at (2,1.7) [N]{}; at (2,-1.7) [S]{}; at (3.7,0) [$A$]{}; at (0.3,0) [$A'$]{}; at (3.1,0.15) [$B$]{}; at (2.13,0.15) [$O$]{}; at (1.25,0.15) [$C$]{};
In Figure \[fig:sphere\_plots\], I compare the numeric simulations of [@golubov14] (solid lines) with the two analytic models. Qualitatively both of them work well, but the model including only the direct light has a better quantitative agreement with the simulations than the model with mirror reflection (similarly to findings of [@sevecek15] for a wall). In Figure \[fig:wall\_maps\], I compare the better analytical model with the numeric simulation. One must also keep in mind that the simulations of [@golubov14] were conducted for an array of boulders partially shadowing each other. Subtracting the shadowing should increase TYORP by a few tens per cent, as seen in the middle right panel of Figure 4 in [@golubov14]. This could somewhat improve the agreement between the presented analytical model and the simulations.
{width="45.00000%"} {width="45.00000%"}
{width="45.00000%"} {width="45.00000%"}
Wave in the regolith
--------------------
Now, having tested the model for already studied cases, let us move to an as-yet unknown terrain. Consider a regular array of hills and dales, with flat slopes angled at $\alpha$, with a dimensionless wavelength $\lambda$, all positioned on the equator in the north-south direction (panel (c) in Figure \[fig:geometries\]). The model is intended as a proxy for small bumps and pits on the regolith, whose contribution to TYORP has never yet been considered. What I am going to do here is but a crude estimate, yet to be tested by thorough numeric simulations. Unlike for a boulder with a well-specified volume, now the volume in which heat conduction occurs has no well-defined borders, and estimating geometric properties for Table \[tab:geometry\] gets more complicated. Obviously, considering an infinitely deep volume below the surface is unsatisfactory, as an infinitely large volume will have infinite heat capacity, zero temperature oscillations, and thus zero TYORP.
Differently directed slopes cause uneven heating of the surface, and thus temperature variations in the east-west direction. The principal Fourier harmonics of this horizontal temperature oscillation has the wavelength $\lambda$, and the corresponding wave vector $k=\frac{2\pi}{\lambda}$. The temperature oscillation will dampen with depth, and one can estimate the penetration depth of these temperature oscillations to be of the order of $\frac{1}{k}=\frac{\lambda}{2\pi}$. Thus I consider heat conduction in a slab of depth $\frac{\lambda}{2\pi}$ and surface area $s$. Although for $\lambda$ or $\theta$ very different from unity the typical depth can be different and determined by other physical processes, and thus the model can produce a bigger error than in the previous two cases, even now it must at least give a reasonable order-of-magnitude estimate of TYORP for $\lambda\sim\theta\sim 1$. The slab under consideration borders two other slabs, to the east and to the west. These two slabs have the same temperature, and one can account for having two of them by just doubling their area of contact, $s_\mathrm{st}$.
Having said all this, I fill in the last row in Table \[tab:geometry\]. I assume that $\alpha$ is small, thus substituting $\mathrm{cos}\alpha\approx 1$, $\mathrm{tan}\alpha\approx\mathrm{sin}\alpha\approx\alpha$. For the illumination function I take $$i_w(\phi)=\mathrm{cos}(\phi-\alpha),\, -\frac{\pi}{2}+\alpha<\phi<\frac{\pi}{2}-\alpha.
\label{i_wall}$$ When Fourier-decomposing $i_w(\phi)$, I also keep only the principal terms in terms of $\alpha$.
Substituting the last row from Table \[tab:geometry\] into Eqn. \[p\_general\], I get Figure \[fig:wave\_plots\]. The figure was produced assuming slope angles $\alpha=0.1$. For other slope angles the TYORP pressure will scale as $\alpha^2$. The maximal TYORP for regolith in Figure \[fig:wave\_plots\] is about 30 times smaller than the maximal TYORP for spherical boulders in Figure \[fig:wave\_plots\]. Therefore, at first sight, it may seem that regolith is unimportant. Still, one must bear in mind several reservations. Firstly, non-cracked boulders have big thermal parameters, $\theta=10\rightarrow 100$, while for regolith $\theta\sim 1$ [@golubov12]. This will substantially suppress TYORP for boulders, while leaving TYORP for regolith close to its maximum. Secondly, a much bigger fraction of surface is covered by regolith than is by boulders. Lastly, the typical slopes $\alpha$ for asteroids are utterly unknown, and altering $\alpha$ can drastically decrease or increase TYORP. The length scales I am referring to are millimeters to centimeters, which is far below the resolution of even *in situ* observations of asteroids.
Summing up, one should acknowledge that regolith may have a substantial contribution to TYORP, which deserves a more detailed analysis than this rough estimate. Still, such an analysis would greatly divert us from the main focus of this paper.
{width="45.00000%"} {width="45.00000%"}
Integration of TYORP over all boulder sizes\[sec-multiple\]
===========================================================
Derivation of the integral for the overall TYORP
------------------------------------------------
All the previous analysis was done for boulders of only one particular size. Let us now integrate TYORP over all sizes of boulders on the asteroid, thus generalizing the numeric results obtained by [@sevecek15] for 25143 Itokawa. For the size distribution of boulders, I take a power law: it is simple, reasonably precise, and the most widely used distribution. The interested reader is referred to [@asteroids4] for an excellent review of the available measurements of the boulder size distribution for different asteroids.
Consider a power-law distribution of boulder sizes, $$\frac{\mathrm{d}N}{\mathrm{d}l}=N_0 l^{-\gamma}\,,
\label{power-law0}$$ where $\mathrm{d}N$ is the number of boulders with sizes between $l$ and $l+\mathrm{d}l$ lying on the entire surface area of the asteroid $s_\mathrm{ast}$, while $N_0$ and $\gamma$ are constant. For us it is more convenient to re-write this distribution not in terms of the number of boulders, but in terms of the area covered by them: $$\frac{\mathrm{d}n}{\mathrm{d}l}=n_0 l^{2-\gamma}\,.
\label{power-law}$$ Here $\mathrm{d}n=\mathrm{d}S/S_\mathrm{ast}$ is the fraction of the surface area covered by boulders with sizes between $l$ and $l+\mathrm{d}l$, while $n_0=\frac{N_0 s_\mathrm{proj}}{s_\mathrm{ast}l^2}$ is a new constant. (Remember that for geometrically similar boulders of different sizes $s_\mathrm{proj}\propto l^2$.)
Of course, a power law in the form of Eqs. (\[power-law0\]) or (\[power-law\]) can only be an approximation. This distribution would necessarily diverge for either small or big boulders, and would necessarily eventually start disagreeing with the data for both small and big boulders. Still, I assume that deviations from the power law happen only for such small and such big boulders that their contribution to TYORP is negligible anyway.
Let us determine the total dimensionless TYORP drag $p_\mathrm{tot}$ experienced by the surface as the dimensional TYORP drag force divided by $(1-A)\Phi S/c$. Then $p_\mathrm{tot}$ can be obtained from $p(l)$ by integrating it over fractions of the surface area $\mathrm{d}n$ covered by boulders of each size: $$p_\mathrm{tot}=\int p(l)\,\mathrm{d}n=\int_{0}^{\infty} n_0 p(l)l^{2-\gamma}\,\mathrm{d}l
\label{definition-of-p}$$ Given asymptotics of Eqn. (\[p\_general\]) $p\propto l^2$ for $l\rightarrow 0$ and $p\propto l^{-5}$ for $l\rightarrow \infty$, this integral converges for $\gamma\in(-2;5)$. Typical power indices for small boulders indeed lie in this range [@asteroids4; @sevecek15]. For $\gamma$ outside this interval, finiteness of the integral has to be provided by setting the minimal or the maximal size of boulders, starting from which the power-law size distribution breaks.
From Eqn. (\[definition-of-p\]) one can see the problem: the rational expression for $p$ provided by Eqn. (\[p\_general\]) does not look frightening only up until the moment one tries to integrate it over $l$. Having spent many pleasant hours doing contour integration in the complex plane, I must acknowledge that the final result is too complicated to be of any practical use despite it being a closed form algebraic expression. Moreover, when written in terms of real variables, it is far too lengthy to be accommodated into this subsection.
To get a more practical result from Eqn. (\[definition-of-p\]), $p$ should be transformed into a simpler form. Still, one can not neglect either term in Eqn. (\[p\_general\]): $a$, $b$, $\tau_0$, $l$ and $\theta$ are all of the order of unity, and thus all comparable with each other. Therefore, I choose not to simplify the equation, but to brute-forcedly interpolate it. This will cause some loss of accuracy, but as we will see, this loss is not much bigger than the errors already caused by the previous simplifications.
Approximate expression for TYORP
--------------------------------
In this subsection I do a detour to find the best fit for $p$ as a function of $l$ and $\theta$ as given by Eqn. (\[p\_general\]). In Figures \[fig:wall\_maps\] and \[fig:sphere\_maps\] one can see the three-dimensional surface $p(l,\theta)$ from above, and notice that in the $\lg{l}-\lg{\theta}$ plane lines of constant $p$ are roughly elliptical and roughly similar to each other. In Figures \[fig:wall\_plots\] and \[fig:sphere\_plots\] one can see that vertical cross-sections of this three-dimensional surface look similar to Gaussian functions of the same width. These observations allow us to guess that a decent approximation to $p(l,\theta)$ will be given by a two-dimensional log-normal function, $$p=p_0\mathrm{e}^{A_l\ln{l}+A_{\theta}\ln{\theta}+\frac{1}{2}A_{ll}\ln^2{l}+A_{l\theta}\ln{l}\ln{\theta}+\frac{1}{2}A_{\theta\theta}\ln^2{\theta}}.
\label{log-normal}$$
There are several ways to choose the coefficients in this fitting function, and in Figure \[fig:sphere\_fit\] I explore different ways of fitting. The least squares fit to the numeric solution is presented with the orange lines, the least squares fit to the approximate solution Eqn. \[p\_general\] is plotted in blue. Both fits are constructed for the same range of $r$ and $\theta$ as presented in Figure \[fig:sphere\_maps\]. The purple lines are constructed by requiring Eqs. (\[p\_general\]) and (\[log-normal\]) to have the same values in the point $l=\theta=1$, as well as the same first and second partial derivatives. For brevity, I call this approach the *Taylor fit*, as I have indeed requested equality of the zeroth, first and second order terms in the Taylor series for $p(l,\theta)$ and its fit. The analytically computed coefficients of the Taylor fit are presented in Table \[tab:taylor\]. Although cumbersome, they can still be instrumental to estimations of TYORP for complex-shaped bodies.
The exact numeric solution is overplotted with a red line, and the approximate solution given by Eqn. \[p\_general\] with a green line. One can see that the least squares fit to the numeric result agrees with them very well, as do the two other fits agree with the approximate solution Eqn. \[p\_general\]. The Taylor fit to Eqn. \[p\_general\] is by construction perfect in the vicinity of the point $l=\theta=1$, but far away from this point it also works quite well.
Coefficients of the three considered fittings are given in Table \[tab:fitting\].
As a minor side result, in the same table I present $\alpha_0=\tan\left(\frac{1}{2}\arctan\frac{2A_{l\theta}}{A_{ll}-A_{\theta\theta}}\right)$, which determines orientation of the ellipsis with constant $p$ for the log-normal distribution. In the $\lg{l}-\lg{\theta}$ plane decrease of $p$ is slowest along the line $\theta\propto l^{\alpha_0}$. We see, that $\alpha_0$ obtained from different models are consistent with each other, and roughly consistent with the elongation of the red and yellow areas in Figure \[fig:sphere\_maps\].
Now, having obtained the coefficients of the log-normal fit, I am ready to finish computing the integral for the overall TYORP.
Model $p_0$ $A_l$ $A_\theta$ $A_{ll}$ $A_{\theta\theta}$ $A_{l\theta}$ $\mu$ $\nu$ $\mathrm{ln}\theta_0$ $\alpha_0$
-------------------------------- --------- -------- ------------ ---------- -------------------- --------------- --------- ------- ----------------------- ------------
Taylor fit to analytics 0.00350 0.270 0.912 -1.81 -3.47 -1.93 0.00763 1.191 0.442 -0.659
Least squares fit to analytics 0.00342 -0.020 0.475 -1.81 -3.69 -2.13 0.00709 1.304 0.424 -0.653
Least squares fit to numerics 0.00234 -0.540 -0.047 -1.37 -2.30 -1.40 0.00644 1.518 0.580 -0.723
\[tab:fitting\]
Coefficient Expression
-------------------- ------------------------------------------------------------------------------------------------------------------------------
$p_0$ $\frac{8nab^2\tau_0^2CS}{(b+2\tau_0^3)(16\tau_0^6+a^2)(4(b+2\tau_0^3)^2+a^2)}$
$A_l$ $2-\frac{2\tau_0^3}{b+2\tau_0^3}-\frac{2a^2}{16\tau_0^6+a^2}-\frac{16(b+2\tau_0^3)\tau_0^3+4a^2}{4(b+2\tau_0^3)^2+a^2}$
$A_\theta$ $2-\frac{4a^2}{16\tau_0^6+a^2}-\frac{4a^2}{4(b+2\tau_0^3)^2+a^2}$
$A_{ll}$ $-\frac{2b\tau_0^3}{(b+2\tau_0^3)^2}-\frac{64a^2\tau_0^6}{(16\tau_0^6+a^2)^2}$
$-\frac{16\left(4a^2b^2+4b^3\tau_0^3+9a^2b\tau_0^3+16b^2\tau_0^6+4a^2\tau_0^6+16b\tau_0^9\right)}{(4(b+2\tau_0^3)^2+a^2)^2}$
$A_{l\theta}$ $-\frac{128a^2\tau_0^6}{(16\tau_0^6+a^2)^2}-\frac{64a^2(b+2\tau_0^3)(b+\tau_0^3)}{(4(b+2\tau_0^3)^2+a^2)^2}$
$A_{\theta\theta}$ $-\frac{256a^2\tau_0^6}{(16\tau_0^6+a^2)^2}-\frac{64a^2(b+2\tau_0^3)^2}{(4(b+2\tau_0^3)^2+a^2)^2}$
: Fitting coefficients in the Taylor fit
\[tab:taylor\]
![The comparison between different approximations for TYORP experienced by a spherical boulder. Three different types of lines (short dashed, long dashed and solid) show different values of the thermal parameter $\theta$. Different colors show different approximations: the exact numeric solution (*red*), the log-normal function constructed by the least squares fit to the numeric solution (*orange*), the approximate solution given by Eqn. \[p\_general\] (*green*), the log-normal function constructed by the least squares fit to the approximate solution (*blue*), and the log-normal function constructed by the Taylor decomposition of the approximate solution (*purple*).[]{data-label="fig:sphere_fit"}](sphere_fit){width="45.00000%"}
![The normalized dimensionless pressure for an assembly of boulders with $\gamma=3$. Different colors show different approximations: the exact numeric solution (*red*), the log-normal function constructed by the least squares fit to the numeric solution (*orange*), the approximate solution given by Eqn. \[p\_general\] (*green*), the log-normal function constructed by the least squares fit to the approximate solution (*blue*), and the log-normal function constructed by the Taylor decomposition of the approximate solution (*purple*). As the exact solution was calculated only for $r\in[0.03;10]$, $\theta\in[0.3;10]$, points with $\theta$ outside the interval \[0.3;10\] were not plotted. On the other hand, $r$ outside the interval \[0.03;10\] were not discarded, but approximated using the least squares fit to the numeric solution, to make the integration more precize.[]{data-label="fig:sphere_integral"}](sphere_integral){width="45.00000%"}
Computing the integral for the overall TYORP {#sec:integral}
--------------------------------------------
Returning to the main focus of this section, I still need to integrate the simplified expression for TYORP over all boulder sizes. Substituting Eqn. (\[log-normal\]) into Eqn. (\[definition-of-p\]) and computing the Gaussian integral, I get $$p_\mathrm{tot}=n_0\mu\mathrm{e}^{-\frac{\left(\ln{\theta}-ln{\theta_0}\right)^2}{\nu^2}},
\label{log-normal-integral}$$ where three new constants have been introduced: $$\begin{aligned}
\label{log-normal-coef}
\mu&=&p_0\sqrt{\frac{2\pi}{-A_{ll}}}\mathrm{e}^{\frac{2A_\theta A_{l\theta}(A_l-\gamma+3)-A_{\theta\theta}(A_l-\gamma+3)^2-A_{\theta}^2A_{ll}}{2(A_{\theta\theta}A_{ll}-A_{l\theta}^2)}}, \\ \nonumber
\nu&=&\sqrt{\frac{-2A_{ll}}{A_{\theta\theta}A_{ll}-A_{l\theta}^2}}, \\ \nonumber
\ln\theta_0&=&\frac{A_{l\theta}(A_l-\gamma+3)-A_\theta A_{ll}}{A_{\theta\theta}A_{ll}-A_{l\theta}^2}. \end{aligned}$$
The mathematical expressions are again somewhat lengthy, but they are worth the agreement between the different estimates of $p_\mathrm{tot}$ we see in Figure \[fig:sphere\_integral\]. Even the substantial discrepancies between the numeric and the analytic solutions observed in Figure \[fig:sphere\_fit\] are mostly eliminated by integration in Figure \[fig:sphere\_integral\]. The resulting discrepancies between the exact results and the different approximations lie within about 20% of the maximal value on the plot, thus certifying that both of our approximations are good for estimating the TYORP effect. The constants Eqn. (\[log-normal-coef\]) are also listed in Table \[tab:fitting\], and one can see that they are close to each other.
I now apply these results to asteroid 25 143 Itokawa, both to estimate the TYORP and to appease myself by certifying the uncertainties in physical properties of even such a well-studied asteroid cause a much bigger error in the TYORP acceleration than the simplifications underlying my analytic model. The assumed physical properties of boulders taken from [@sevecek15] are listed in Table \[tab:itokawa\]. Following [@sevecek15], I use two different values of the heat conductivity of rock: bigger $\kappa_1$ presumably corresponds to solid rock, while smaller $\kappa_2$ could correspond to cracked rock, which is assumed to be widely present on atmosphereless bodies [@delbo14]. Respectively, I get two different thermal parameters $\theta_1=13$ and $\theta_2=4.1$. I use the size distribution of boulders from [@sevecek15], $dN=(14\pm 9)\cdot 10^3 L^{-3.0\pm 0.2}dL$, where $dL$ is in meters. For simplicity, I choose the power index $\gamma=3$. In this case $n_0$ is independent of $L_\mathrm{cond}$. Nondimensionalizing $L$, transforming from the number of boulders $dN$ into their relative surface area $dn$, assuming roughly circular projections of boulders, and taking for the surface area of Itokawa $3.93\cdot 10^5$ m$^2$ [@demura06], I get $n_0=0.028\pm 0.018$. From Figure \[fig:sphere\_integral\], I find corresponding pressures $P(\theta_1)\approx 0.001$ and $P(\theta_2)\approx 0.005$. Estimating the dimensionless TYORP of the whole asteroid as $\tau_z\approx 9sT(\theta)$ [@golubov14], I get for solid rocks $\tau_{z1}=0.00025\pm 0.00015$ and for cracked rocks $\tau_{z2}=0.0013\pm 0.0007$. This value should be compared to the difference $\Delta\tau_z= 0.003\pm 0.002$ [@golubov14] between the observed accelerating torque acting on Itokawa and the predicted normal YORP torque, as one may expect $\Delta\tau_z$ to be equal to Itokawa’s TYORP. One can see that the cracked rock gives a value consistent with $\Delta\tau_z$, while the solid rock gives a value an order of magnitude smaller than $\Delta\tau_z$. As a side remark, I note that the tens-of-per-cent uncertainty of the theoretical model is much smaller than an order of magnitude uncertainty caused by the uncertainty of the physical properties of the asteroid. The most important takeaway message from this estimate for 25 143 Itokawa is that for realistic properties of boulders and their realistic shape distribution, Eqn. (\[log-normal-integral\]) predicts a significant effect, comparable to the normal YORP.
Physical quantity Notation Value
------------------------ ------------ -----------------------------------
Heat conductivity $\kappa_1$ 2.65 W m$^{-1}$ K$^{-1}$
$\kappa_2$ 0.26 W m$^{-1}$ K$^{-1}$
Specific heat capacity $C$ 680 J kg$^{-1}$ K$^{-1}$
Density $\rho$ 2700 kg m$^{-3}$
Albedo $A$ 0.1
Emissivity $\epsilon$ 0.9
Angular velocity $\omega$ $\frac{2\pi}{12.132\,\mathrm{h}}$
Solar constant $\Phi$ $\frac{1361}{1.324^2}$ W m$^{-2}$
: Parameters used in the TYORP estimation for 25 143 Itokawa
\[tab:itokawa\]
Discussion\[sec-discussion\]
============================
Reviewing the derivation of the analytic expression of TYORP (Eqn. (\[p\_general\])), one can single out three major ingredients sufficient for TYORP to appear:
1\. Heating pattern with a day–night asymmetry ($C\neq 0$) and an east–west asymmetry ($S\neq 0$).
2\. Thermal inertia ($0<\theta<\infty$, $0<a<\infty$) and thermal conduction ($0<b<\infty$).
3\. Non-linearity of the heat emission law.
The non-linearity enters the equations for TYORP in two related ways: through the boundary condition of the heat conduction equation (Eqn. (\[heat\_balance\])) and through the definition of TYORP pressure (Eqn. (\[p\_def\])). The former’s contribution is negative, the latter’s contribution is positive, and the latter wins, as can be seen from the substitution of Eqn. (\[2nd\_2\]) into Eqn. (\[p\_series\]).
Acknowledging the generality of conditions 1–3, one must conclude that TYORP is a very general feature, which is not bound to any particular boulder shape or illumination pattern. More or less any boulder shapes can be substituted into Eqn. (\[heat\_balance1\]), while Eqn. (\[insolation\]) presents a most generic illumination function, which is still capable of causing TYORP of a realistic magnitude, although boulders with steeper slopes (bigger $n$) and illuminated in a more asymmetric way (bigger $S$) are subject to systematically bigger TYORP, as can be seen from Eqn. (\[p\_general\]).
In my model, $C$ is always positive, as the boulder is illuminated in the day, not at night. $S$ is usually positive, as all realistic boulders are more illuminated from the east before noon, and more illuminated from the west after noon. Thus all terms in Eqn. (\[p\_general\]) are positive, and the resulting TYORP derived from the analytic model should accelerate the rotation of the asteroid under any realistic conditions, not decelerate it. This fact has already been observed for different geometries of boulders by [@golubov14] and [@sevecek15] in their numerical simulations.
This holds not only for convex structures like boulders or mounds, but also for concave structures, like grooves or pits on the surface of the asteroid. In the latter case the mechanism is the same as usual: east-facing slopes are better illuminated in the morning, west-facing slopes in the afternoon, and the heat conduction occurs between them. The problem is again approximately described by Eqs. (\[heat\_balance1\]) and (\[insolation\]) with all constants being positive, and the solution again leads to Eqn. (\[p\_general\]). It means that the west-facing slopes again emit on average more light, push the surface more in the eastern direction, and again accelerate the rotation of the asteroid.
Thus most imaginable surface structures should be to a certain extent subject to positive TYORP: crater rims, crater pits, grooves and cracks on the surface, small mounds and summits, or just wavy patterns of regolith, rough surfaces of stones, lone boulders and boulder fields... A heap of pebbles can contribute to TYORP either as a single body, or via individual pebbles, or via individual pocks and wedges of individual pebbles, and which of these descriptions is the most appropriate depends on the rotation rate of the asteroid, the heat conductivity of rock, as well as other parameters. Singling out the most important contributors to TYORP and accounting for them all is an important task for future research.
Conclusions\[sec-conclusions\]
==============================
I have constructed an approximate fully analytic model of TYORP, in which I used an averaging procedure to transform a partial differential equation into an ordinary differential equation, then used perturbation theory to transform the latter into algebraic equations, and finally arrived at an algebraic expression for TYORP. Along the way the shape of the boulder was boiled down to just a few geometric coefficients, and the illumination pattern – to its few Fourier harmonics. Despite the simplicity, the analytic expression for TYORP was found to be in good agreement with numeric simulations for a stone wall [@golubov12] and a spherical boulder [@golubov14].
I used the analytic model to estimate the TYORP produced by the non-smoothness of regolith on an asteroid. On the one hand, regolith should be much flatter than boulders, which diminishes its TYORP. On the other hand, it has a more favorable thermal parameter $\theta$ and presumably covers a bigger fraction of the surface, which increases its TYORP contribution. Given the utter uncertainty of the unevenness of regolith on different scales, it is hard to say whether or not its contribution is significant, but neglecting it now seems unsafe.
I then have integrated TYORP over boulders of all different sizes, assuming a power-law size distribution for boulders, and doing a two-dimensional log-normal fit to the analytic TYORP drag. The additional error introduced by this fit was generally not bigger than the error already caused by the assumptions underlying the analytical model. Moreover, the error substantially diminished after integration over the boulder sizes. The resulting TYORP drag of the entire assembly of boulders appeared log-normal in terms of the thermal parameter $\theta$, and concurrently in terms of rotation rate of the asteroid. It means that even for a broad distribution of boulders over sizes, TYORP still has a relatively narrow peak, a corresponding rotation rate with the biggest TYORP, and a relatively fast decrease of TYORP for faster or slower rotation. The integrated TYORP drags for the log-normal approximation, for the full analytic solution and for the numeric simulation were found to be in good agreement with each other.
The proposed analytic model demonstrates that TYORP should appear for most realistic shapes of boulders or regolith, and should be positive in most realistic cases.
Acknowledgements {#acknowledgements .unnumbered}
================
I am very grateful to Daniel J. Scheeres for discussing with me the astronomical content of the problem, to Uliana Pyrohova for counseling me with mathematical issues, to Vlad Unukovych for reviewing the physics of the paper, and to Alexander Kostenko for improving the language style. Without the help of either of them the paper would have been stuck at a certain point.
[99]{} Delbo M., Libourel G., Wilkerson J., et al., 2014, Nature 508, 233 Demura H., Kobayashi S., Nemoto E., et al., 2006, Science 312, 1347 Golubov O., Krugly Yu. N., 2011, Planetary Defence Conference, From Threat to Action, held 09-12 May 2011, in Bucharest, Romania Golubov O., Krugly Yu. N., Tangential component of the YORP effect, 2012, ApJL 752, L11 Golubov O., Scheeres D. J., Krugly Yu. N., A three-dimensional model of tangential YORP, 2014, ApJ 794, 22 Murdoch N., S[á]{}nchez P., Schwartz S. R., Miyamoto H., 2015, Asteroids IV, 767 Ševeček P., Bro[ž]{} M., [Č]{}apek D., & [Ď]{}urech, J., The thermal emission from boulders on (25143) Itokawa and general implications for the YORP effect, 2015, MNRAS 450, 2104 Ševeček, Golubov O., Scheeres D.J., Krugly Yu. N., Obliquity dependence of the tangential YORP, 2016, A&A 592, 115
\[lastpage\]
[^1]: When interpreted literally, the assumptions of a constant temperature gradient in the body of the boulder and of a constant temperature on the two parts of its surface might seem to contradict each other. Still, these assumptions should provide an acceptable estimate for the corresponding terms in Eqn. (\[heat\_balance1\]), and thus finally lead to a reasonable estimate for TYORP. It is possible to construct a more sophisticated model for the temperature distribution inside the boulder, but it will lead to a more complicated mathematics and a more obscure physics, while its accuracy will be anyway largely negated by the assumptions I am going to make below.
| null | minipile | NaturalLanguage | mit | null |
Former Missouri DE Michael Sam revealed he was gay to his Tigers teammates prior to the 2013 season. / Jamie Squire, Getty Images
by Tom Pelissero, USA TODAY Sports
by Tom Pelissero, USA TODAY Sports
Every NFL rookie gets teased by teammates, who usually aim for the easiest target - his hometown, his alma mater, his weight, his clothes, his haircut. It's a rite of passage, a bonding experience, and most veterans know how not to cross the line.
Sometimes a player can feel things go too far, such as Jonathan Martin, the offensive lineman who left the Miami Dolphins after a cafeteria prank in October and leveled allegations of long-running abuse by teammate Richie Incognito and others.
"One hundred percent, and Michael welcomes that," former NFL defensive back Wade Davis, who came out as gay after his playing career ended, told USA TODAY Sports on Monday.
"I think what people don't realize is that with being out (of the closet) for an entire year, he's already gone through that with the exact same guys who are going to be in the NFL. It's not like he hasn't experienced it."
Davis is the executive director of the LGBT sports organization You Can Play and was at Sam's coming out party Saturday night.
So was former NFL punter Chris Kluwe, who is not gay and agreed with Davis that Sam's success on a Mizzou team that played in the SEC championship game last season is proof that potential locker room problems are overblown.
"All his teammates knew he was gay," Kluwe said of Sam, who projects as a fourth- to seventh-round draft pick. "He came out to the team, and they had a phenomenal year. The players by and large don't care, because they're there to play football."
How to respond?
Yet, they know, some NFL teammate is bound to crack wise about Sam's sexual orientation, whether from a place of disapproval or just trying to get the rookie's goat. It might happen to Sam's face or make its way through the media.
It'll be up to Sam how he chooses to respond, knowing his actions might have an impact on every other athlete thinking about following his lead as the NFL's first openly gay player.
"The thing that we're missing is that Michael's going to protect those players. He's not going to go out and say, 'Oh, someone called me something offensive,'" said Davis, who began mentoring Sam at the behest of his friend, NFL executive and former player Troy Vincent.
"He understands he not only has to protect himself, but protect his teammates, protect them so when one of them does say something that the world may deem inappropriate, he knows that it's just something a brother would say.
"There are ultimately things that my sister or my cousin say to me that the rest of the world would be like, 'Wow, that's really awful.' But there's a camaraderie and a fellowship that you have amongst teams, and Michael understands that."
In other words, Sam is not likely to respond similarly to Martin, which might ease the minds of the veterans who end up dealing with an unprecedented situation in their locker room - but want to make sure every rookie, including Sam, is put in his place nonetheless.
"You're going to joke on them. You're going to make them do little things. And the more they're accepting and the more they roll with the punches is the better, because you fit right in better," Minnesota Vikings defensive tackle Kevin Williams told USA TODAY Sports.
"I don't see (being openly gay) being a problem. Guys are going to joke with you, and if you're able to take a joke, play around, mess around, the better it'll be."
Last month, Kluwe wrote a scathing post for Deadspin accusing the Vikings of cutting him over his public stance in support of gay marriage and calling for the firing of special teams coordinator Mike Priefer, whom Kluwe accused of making homophobic remarks.
That triggered a team-requested investigation that remains ongoing, less than a year after the NFL issued a sexual orientation anti-discrimination and harassment policy - not that it'll stop teams from pushing Sam to open up about his lifestyle at next week's NFL scouting combine.
"That's one of the things I talked to Mike about was, this is going to be something that teams are going to look at," Kluwe said. "They're going to press you. They're going to try to put you in uncomfortable situations, because they want to see, will you hold up under this pressure?"
Lots of scrutiny
That pressure will only grow now, given that Sam has set up his career as a litmus test for openly gay athletes' ability to assimilate into major American pro sports.
"There has been a lot of talk about the locker room, and I think that's a reliance on an outdated stereotype," said Sarah Kate Ellis, president of the advocacy organization GLAAD.
"I remember hearing that argument when 'Don't Ask, Don't Tell' was being debated, and we can see now first-hand that gay service members who can serve openly are only helping the military and it hasn't been an issue."
Sam's publicist, Howard Bragman, said the plan from now until the NFL draft in May is to keep media exposure to a minimum and focus on football. Discussions with the league about how to manage the inevitable media crunch at the combine are ongoing.
The NFL issued a statement Sunday night in support of Sam, and numerous owners and general managers followed suit Monday, all saying he'll be evaluated only for his skill set.
"Our sport, our game, is the ultimate meritocracy," New York Giants president and chief executive officer John Mara said. "You earn your way with your ability."
Several other prospects in this year's draft offered their support.
"Personally, if I'm an NFL veteran and we draft a guy, regardless of his sexuality, my biggest thing is: 'Can you play football?' And I've never been a person in my life who has judged someone on whether they liked men or women," said Michigan offensive tackle Taylor Lewan, projected as a first-round pick.
To Davis, Sam going through a typical experience within the locker room is the only way to prepare everyone for the reality that he is surely just the first of many openly gay players to come.
"He's going to have to go through his trials, only because he's a rookie and veterans cannot stand rookies," Davis said. "But as far as his sexuality, no one's really going to care because he can play."
"One or two players may say something stupid. But players' fears are real, and if we don't talk about them open and honestly, how can we ever grow from it and move forward? There are real reasons why these players aren't out. If we can't talk about those reasons, how can we make any type of substantive growth?" | null | minipile | NaturalLanguage | mit | null |
We’ve encountered Michael Voris before: the painfully dogmatic and fervent Catholic Dominionist kook. He has a ridiculous video in which he asserts that theology is the queen of all the sciences because everything reduces to god, ultimately — which does leave one wondering why theology never produces any ideas that are actually useful to all of those scientific disciplines. I mean, take math for example: mathematicians are constantly coming up with tools and ideas that chemists and physicists and biologists and geologists all find awesomely useful. But what has theology given us? Nothing.
Michael drones on, going through the motions — he really seems dead-eyed and robotic in this video, doesn’t he? — and you probably got bored 30 seconds into the 5 minute clip. So I want to focus on just one point that Voris made, and mentioned in the caption, and which actually isn’t unique to Catholic nutjobs at all.
The fields of science can offer all kinds of information in answer to the question how… through the observance of the human intellect. But when asking the question why, man MUST turn to the divinity of the Creator.
How many times have you heard that claim: science can answer “how” questions, but it can never answer “why” questions, therefore we have to leave those kinds of questions to a non-scientific domain, which must be religion, therefore god. And that’s wrong at every step!
There’s no reason the interpreter of “why” questions has to be religion…why not philosophy? That seems a more sensible objective source than a religion burdened with a dogma and a holy book and wedded to revelation rather than reason. Voris assumes there has to be a divine creator, but that’s one of the questions, and you don’t get to just let it go begging like that.
The more fundamental question, though, is this oft-repeated distinction that science can’t answer “why” questions. Of course it can, if there’s a “why” in the first place! We are perfectly capable of asking whether there is agency behind a phenomenon, and if there is, of exploring further and identifying purpose. Why should we think otherwise?
Imagine you came home, as I did the other day, and saw this on the edge of your yard.
You’d immediately assume it was artificial, as I did — the perfectly circular outline suggests that a machine came by, and someone lowered some auger-like device and drilled a large hole in the yard. You could also look up and down the street and see that the hole-driller had struck several other places, all in a line parallel to the road and exactly the same distance from the curb. They are almost certainly the product of intent.
Does that in any way imply that I’m now done, that asking why these holes were dug is beyond the scope of all rational inquiry? That I ought to drop to my knees and praise ineffable Jesus, who caused holes to manifest in the ground for reasons that I, as a mere mortal man, cannot possibly question? Oh, Lord, mine is not to question why, I must accept what is!
Of course not. I can speculate reasonably; it looks like a hole for planting something in. I can check into the city offices, and learn that there’s concern about emerald ash borers killing trees in our community. I can see the next day that a city crew came by and put new saplings in place all up and down the street. Even without actually talking to anyone directly, I can figure out from the evidence why there is a hole in my yard.
Similarly, if there was a god busily poofing the entirety of the cosmos into existence, that’s an awful lot of evidence that can be examined for motive…are we to instead believe it is so incoherent that we can discern no possible purpose behind all this data?
And what if instead, I’d come home and found one hole in the neighborhood, it was a rough-edged and asymmetrical crater, and in the center of it was a small rocky meteorite? Then I could ask how it came to be there (it fell out of the sky and smacked into my yard), and I could try to ask why, but the answer would be that there was no agency behind it, there was no purpose, and it was simply a chance event of a kind that happens all the time.
When people try to argue that science can’t answer “why” questions, what they’re actually saying is that they don’t like the answer they get — there is no why! There is no purpose or intent! — and are actually trying to say that the only valid answer they’ll accept is one that names an intelligence and gives it a motive. That is, they want an answer that names a god as an ultimate cause, and a description that doesn’t include agency doesn’t meet their presuppositions. | null | minipile | NaturalLanguage | mit | null |
The Career Development Research Program (CDP) of the University of Texas SPORE in Lung Cancer is an integral part of the overall Lung Cancer SPORE research. This Program provides, after selection by external review and applicant discussion with senior SPORE investigators, a flexible and nimble platform for seed funding to stimulate the careers of young investigators in lung cancer translational research. It is designed to fund promising young investigators that address important translational objectives in early detection, prevention, and therapy of lung cancer. Through institutional commitments at both UTSW and UTMDACC there are $300,000 in funds (that can be used for CDP or DRP Projects) matched to the $50,000 provided by the grant for the CDP. The CDP program has evolved into a highly structured process for solicitation, evaluation and mentorship, to attract new investigators to lung cancer translational research who have novel approaches and techniques that address significant barriers in lung cancer and who could benefit from SPORE Core Resources, interaction and mentorship, and that have potential to synergize with our existing Projects. The CDP has resulted in a large number of publications, new lung cancer translational scientists, and new peer reviewed grants. The Specific Aims of this competing renewal Lung Cancer SPORE CDP application are to build on the current and past exemplary SPORE progress of training the next generation of lung cancer leaders to fuel discovery and innovation. They are summarized as follows: 1. To enhance the translational lung cancer research capability at UTSW and MDACC via recruitment of highly innovative and talented entry-level and junior scientists; 2. To attract candidates with prior experience in cancer at other disease sites who want to acquire expertise in Lung cancer translational research; 3. To transition CDP awardees from mentored to successful independent lung cancer translational research scientists; 4. To promote the development of clinical oncologists and basic scientists who can rapidly translate basic observations in cell and molecular biology/genetics into clinically applicable utility. We are particularly interested in recruiting applied and basic clinicians, scientists, and physician-scientist candidates who: 1. Have the potential to bring new and innovative ideas and approaches to lung cancer research. 2. Are trained in biomedical concepts and technologies, data gathering, evaluation and interpretation. 3. Are expert or can be trained to use new approaches and techniques to detect and resolve weaknesses and gaps in our understanding of lung cancer biology, pathogenesis, and treatment. | null | minipile | NaturalLanguage | mit | null |
Maternal serum concentration of soluble fms-like tyrosine kinase 1 and vascular endothelial growth factor in women with abnormal uterine artery Doppler and in those with fetal growth restriction.
This study was undertaken to determine whether maternal serum concentration of the angiogenic factor vascular endothelial growth factor (VEGF) and its circulating antagonist, soluble fms-like tyrosine kinase 1 (sFlt-1), which have been implicated in the pathogenesis of preeclampsia (PE), are altered in pregnancies that subsequently develop PE and in those with established fetal growth restriction (FGR). Three groups of healthy pregnant women at 23 to 25 weeks of gestation were examined: group A (n = 42) with normal uterine artery Doppler waveforms, group B (n = 49) with abnormal uterine artery Doppler waveforms, and group C (n = 15) with abnormal Doppler results and established FGR. Comparisons between multiple groups were performed by using 1-way analysis of variance or Kruskal-Wallis test. In group C, compared with group A, the median sFlt-1 was significantly higher (P < .0001) and VEGF was lower (P < .001). Group C included 3 women who had PE develop. In group B, 19 women had a normal outcome, 13 had PE develop, and 17 had FGR develop. There were no significant differences in sFlt-1 levels between any of the subgroups of group B and group A. Maternal serum concentration of sFlt-1 in pregnancies with FGR is increased but this increase is not evident in pregnancies with impaired placentation that subsequently had either FGR or PE develop. | null | minipile | NaturalLanguage | mit | null |
Have you ever noticed that during extreme economic cycles, when trends are roaring on the upside, or conversely crashing back down to earth, there often appears an air of extremism in news headlines? Take America's most recent shale oil boom, and bust, for example. On the way up, you may have seen Why OPEC Could Be Dead in 10 Years. Conversely, now you may have read, Why It Might Be 'Game Over For The Fracking Boom.'
In the end, the answer lies somewhere in-between. OPEC, although often plagued with internal discord, will still remain the global de facto 900-pound gorilla of crude, and US producers will continue to find ways to crack shale rock cheaper and more efficiently, immunizing themselves to nail-biting commodity roller coaster dips like what was just experienced. And in 2008 (-55%). And in 2001 (-32%). And in 1998 (-38%).
BP (BP), in its recently released "Energy Outlook 2035," predicts OPEC's market share will return to approximately 40% of global demand within 15 years, up from 33% today, which is what all this fuss is about anyway.
Here are three reasons why America's shale will continue to produce going forward:
1. Oil companies, both large and small, have seen what is possible.
In 2004, Texas oilman George Mitchell made hydraulic fracture stimulation commercially viable by unlocking the right combination of water pressure and lubricants to allow oil and gas to predictably flow from dense shale to the wellbore. A decade ago, producers believed shale held vast oil and gas resources, but to what extent they could be developed had not been determined. Until now.
Last year for example, the Energy Information Administration (EIA) announced there could be up to 75 billion additional barrels of oil in the Permian Basin, a field believed to be mostly dried up. The EIA also forecast over 100 years of natural gas supply from shale resources, mostly flowing from the vast Marcellus and Utica formations in the Northeast.
One of the biggest reasons America's shale revolution will continue is producers have seen the potential. As with any industry, technology should drive cost down, and drillers and producers are both mutually highly incentivized to find cheaper, faster, better ways of extraction.
2. Eventually, politicians might "Get It."
The shale oil revolution that peaked in 2014 occurred mostly in spite of Washington, D.C., not because of it. With Capitol Hill and the White House mired in political gridlock for most of the last 6 years, oil and gas producers were thus free to explore, develop, and prove the concept that shale development was indeed commercially viable.
In a perfect scenario, the next phase would involve political leadership who comprehends the benefit of an alliance between Canada, Mexico and the U.S., creating a formidable energy superpower, ultimately likely leading to North American energy independence from any imported oil.
3. In spite of the current dip, global demand points up.
BP and Exxon Mobil (XOM), in their long-range forecasts, both allude to the same conclusion -- the macro trend for oil consumption worldwide is up. BP predicts a 41% increase in demand over the next 20 years, with China and India accounting for half the growth.
Exxon Mobil concurs. Basing their forecast on a continued population explosion to 9 billion people by 2040, Exxon theorizes GDP will grow parabolically, and in spite of energy efficiencies that will certainly be realized along the way, demand for all forms of energy will continue to increase. In their "Outlook for Energy: A View to 2040," Exxon confirms the "all of the above" theory to meet global demand.
Thomas Hood, English poet, author and humorist was quoted to say, "Extremes meet, as the whiting said, with its tail in its mouth." Oil producers have work to do. They must reduce costs, continue to solve environmental concerns over extraction techniques, and scale efficiencies. This bust has offered plenty of incentive to accelerate that. But there is still an abundance of oil and gas to be extracted, with ample incentive to figure out the most efficient ways to develop it.
By Thomas Miller for Oilprice.com | null | minipile | NaturalLanguage | mit | null |
RugbyD wrote:My info comes from the mouth of an ex-teammate, but I will not go further than that.
This is funny.
I heard that 98% of Americans are favorable to the idea of Puppies and Rainbows, and that comes from a former member of the Puppy and Rainbow community, but that's as far as I'll go. I heard that Piazza and um, let's see, ok, Ty Wiggington were lovers. My buddy's best friend's sister's, step cousin sells beer at Shea, but that's as far as I'll go.
Hilarious? yes. Misguided in this particular instance? yes, but still funny. And no all this razzing is not going to make me break confidence of source. Believe what you want, I have no reason to blurt random conjecture.
CrimeDog, pitchers don't take roids to bulk up. The likely accelerator/decelerator imbalance is very bad and leads to torn labrums. Apparently it can contribute to velocity, but I haven't seen anything 100% on that.
yea gotta say no on this one. This guy doesn't look bulked up at all, and let's remember it's not like his fastball was his bread and butter, his curveball was what dominated.
...Boston papers now and then suffer a sharp flurry of arithmetic on this score; indeed, for Williams to have distributed all his hits so they did nobody else any good would constitute a feat of placement unparalleled in the annals of selfishness. -Updike
Alot of people don't understand what steroids do to people. If you take steriods it doesn't mean you get big, you still have to work out to get big. Steroids just help muscles recover quicker so you can get back at pounding the weights sooner, less recovery time. Steroids helps you recover from injury or muscle sorness etc, just because you take steroids it doesn't mean your going to be big!
RugbyD wrote:all this razzing is not going to make me break confidence of source. Believe what you want, I have no reason to blurt random conjecture
I'm sure you understand why nobody here believes you; can you blame us? If we don't believe actual players like Jose Canseco, why would we believe somebody we know nothing about? Without even having a source? I hope you didn't expect us to take your word for it. | null | minipile | NaturalLanguage | mit | null |
Our product picks are editor-tested, expert-approved. We may earn a commission through links on our site.
We Know Football Is Dangerous. So Why Are We Still Letting Our Sons Play It?
The latest research reveals how dangerous football is for kids, whose brains are being damaged even without concussions. Parents explain why they're letting their sons play anyway.
Andrew Lawrence
Jul 10, 2018
Benedict Evans
Brody Silva is a typical 10-year-old boy: bright-eyed, curious, and restless. He wrestles; he runs track and cross-country; and he plays baseball, basketball, and football, which is the center of his life. He loves the Dallas Cowboys, worships All-Pro cornerback Richard Sherman, and figures he, too, might go pro one day. But he also has aspirations beyond the game. When he retires from football, he says, “I want to be a doctor or a brain surgeon.”
For now, he alternates between playing running back and linebacker for the Alaska Steelers, an 11-and-under “Mitey Mite” team coached by a husband-and-wife duo of Army veterans who often hold practice inside gyms to escape the frigid cold. Over Thanksgiving week last fall, as the Steelers took the field in warm Daytona Beach, Florida, Silva was in the middle of every defensive play—”I get to truck people,” he gushes—even though some of his teammates were physically overmatched at the 2017 National Youth Football Championships.
Ryder Rego, a defensive lineman playing alongside Silva, was leveled three times while pursuing the ball, each time bringing about a stoppage in play. On the third such knockdown, Rego stayed down for what seemed like an eternity. Coaches and game officials stood over his body like cops at a crime scene, while players took a knee. “Your heart skips a beat, but then you see him get up,” says Lacey Rego, Ryder’s mom, who watched the scene unfold from the Steelers’ sideline. “I was super proud of him. He just kept moving forward and was there for his team.”
The 4'6", 80-pound third-grader wasn’t diagnosed with a concussion or removed from the game. After all, these weren’t NFL-caliber hits. These were just boys whose helmets made them look more like bobblehead dolls than warriors, and injuries have always been part of the game.
Benedict Evans
From the peewees to the pros, we’ve long accepted the toll that football exacts on the body—the sore muscles, the broken bones, the torn ligaments, the lost teeth, the risk of paralysis, and, especially in recent years, the dangers of concussions. The risks are worth it, the thinking goes, because the sport demands toughness and forges character. But recent research is painting an even grimmer picture of America’s Game and revealing how destructive football can be to children’s brains. If Silva indeed grows up to become a brain surgeon, he may look back on his childhood and wonder why he and his friends were ever allowed to play tackle football.
“We do everything possible to keep our kids healthy, to keep them free from injury, to help them realize their full potential,” says Robert Stern, Ph.D., a professor of neurology and neurosurgery at Boston University. “Then we drop them off in a field and put a big helmet on them and say, ‘Go hit your head as many times as you want and play hard.’ Regardless of where we are with the science, does it make sense to do that?”
Soft-spoken but exacting, the bearded and bespectacled Stern is the director of clinical research at BU’s CTE Center, where he studies the effects of repetitive brain trauma on athletes and military personnel. (CTE is shorthand for chronic traumatic encephalopathy, the neurodegenerative disease that has cast a black cloud over football since entering the national conversation in 1997.)
Because of the game’s violence, the 59-year-old calls himself a “former football fan.” He once flew to Arizona to see his beloved Patriots play in the Super Bowl, but now he avoids games on TV, sometimes at the expense of his social life when friends get together on Sundays. In 2016, he was named the seventh-most-important person in the NFL by USA Today, one of the “biggest game changers” even though he’s not part of the league. “It’s not because of my throwing arm,” he says. “It’s because of the potential impact of my research on the future of football.”
About 3 million boys play tackle football in America, according to the National Sporting Goods Association—that’s roughly 2,000 players for every NFL pro. About 40 percent of these kids fall between the ages of 7 and 11. Nine years ago, before the concussion crisis, the participation number was closer to 4 million. The drop-off has been largely attributed to fears over CTE from concussions, which Stern says is a legitimate concern but also the wrong thing to focus on. “It’s concussion this, concussion that,” he says in his paper-strewn office. “With the focus on concussions, it takes everyone in a different direction from what the real problem is.”
That would be “subconcussive” hits, the repeated blows to the head that occur on every play without knocking anyone out of the game. In some people, those repetitive hits can lead to changes in the brain’s structural integrity, Stern says, making CTE an important risk factor for players long before they ever get close to the NFL.
“With the focus on concussions, it takes everyone in a different direction from what the real problem is.”
“With the focus on concussions, it takes everyone in a different direction from what the real problem is."
The brain sits in the skull the way salmon is stored in a can. It’s protected, sure, but with sudden accelerations and decelerations, it jounces around inside and can be damaged. Your brain cells stretch, twist, and undergo chemical changes. After a single injury, the cells’ default response is to clean up toxic proteins and chemicals. But when the head is hit time and again, that recovery sequence becomes overwhelmed. One consequence is a buildup of tau, an abnormal protein that clumps together and creates tangles that eventually choke brain cells to death. It can also spread to other cells and propagate, leading to CTE.
Typically, CTE can only be diagnosed posthumously, but its symptoms in the living range from the temperamental (anxiety, depression) to the behavioral (aggression, lack of self-control) to the cognitive (poor memory and memory loss, confusion). CTE has been found in deceased players at every level of the game, from the pros down to high school. The longer you play, the worse the likely brain damage. “Around 3,000 hits,” says Julie Stamm, Ph.D., a former BU researcher and now an associate lecturer of kinesiology at the University of Wisconsin-Madison, “is the threshold where you start to see increased risk of having cognitive difficulties later in life.” For a player who starts tackle football at age 7, that threshold can be reached by age 18 if he averages 250 hits a season—a number that research shows can be easily doubled by some players.
A recent BU study, published in Brain, established the strongest link yet between repetitive hits to the head and CTE. It focused on a postmortem examination of four teenage football players who had suffered sports-related head injuries: One had already developed early-stage CTE, and two others had started producing the frayed tau protein. To test their hypothesis—that early CTE may result from damaged blood vessels within the brain—researchers subjected lab mice to a series of football-like repetitive head impacts. What they found is that they could induce CTE in the mice without putting them through the equivalent of a concussion.
Playing youth tackle football may be exposing kids’ brains to that same risk. A 2017 study coauthored by Stamm and Stern in Translational Psychiatry found that people who started playing tackle football before age 12 doubled their risk of having behavioral problems and cognitive impairment, and tripled their risk of suffering from depression later in life. The increased risks did not change based on how many years they had played, the number of concussions they had, or whether they played through high school, college, or the pros.
People who started playing tackle football before age 12 doubled their risk of having behavioral problems and cognitive impairment, and tripled their risk of suffering from depression later in life."
The findings were in lockstep with a growing body of evidence that shows youth football may be doing more harm than good. A 2015 study led by BU’s CTE Center ran 42 former NFL players (ages 40 to 69) through a battery of cognitive tests and divided them into two groups: those who started playing football before age 12 and those who started later. Why 12? “Because of the neurodevelopmental literature showing there’s a lot happening in the brain around that age,” Stamm says.
Between the ages of 8 and 12, the brain works overtime to make myelin, a coating that grows around, and protects, fragile brain-cell connections called axons. The heaviest construction occurs in the branchlike pathways that connect the right frontal lobe of the brain to the left frontal lobe. Ultimately, the study found that the pre-12 group performed “significantly worse”; their tests revealed evidence of “executive dysfunction, memory impairment, and lower estimated verbal IQ.”
Benedict Evans
A young child’s head-to-body-size ratio is roughly four times larger than that of an adult. And that, combined with a child’s thinner, weaker neck, means impacts cause more rapid head movements. All of this seems to put kids who play tackle football well behind kids who don’t, from a developmental standpoint. (Your brain doesn’t fully mature until your early 20s.) Another BU study found that cognitive, behavioral, and mood problems may affect former football players an average of 13 years earlier if they played before age 12. But, Stern warns, “there’s no right age. It’s not like 12 is magic. It’s not like starting at 14 makes it safe.”
A recent Wake Forest study revealed exactly how young brains are being rewired by the game. Researchers followed a group of 25 boys ages 8 through 13 over a season of tackle football and placed sensors inside their helmets to measure impacts. (A typical hit registers between 20 and 25g—the equivalent of a 30 mph car crash—and players can pile up anywhere from 250 to 580 crashes a season.) The MRIs of the kids’ brains taken before and after the season showed that those “who experienced more cumulative head impact exposure had more changes in brain white matter.” The stunning part: Not one had suffered a concussion.
Football is already facing a reckoning. Lawmakers in New York, New Jersey, Maryland, Illinois, and California recently proposed legislation that would prohibit tackling in their states below the ages of 12, 13, and 14. In Pittsburgh, a father’s attempt to prevent the youngest of his three sons from playing, spurred by the latest scientific research, became the focus of a family court dispute.
Last season, the NFL’s TV ratings fell 9.7 percent; the year before that, the decline was 8 percent. The league’s thrilling championship between the Philadelphia Eagles and New England Patriots drew the smallest Super Bowl TV audience in the past nine years (103.4 million viewers). Just before the title game kicked off, a Wall Street Journal/NBC News poll revealed that interest in watching the pro game among close followers had dropped 9 percent since 2014. Beyond viewing habits, the risk of traumatic brain injuries was a concern at home; 53 percent of mothers polled said they would steer their kids away from playing football “due to concerns about concussions”—a 13 percent spike over 2014 poll data.
But not everyone is swayed by the emerging science. Last November, at the youth-football championships in Florida, it was hard to find an adult who expressed a deep understanding of the game’s health risks to the brain. Nearly all of the parents interviewed by Men’s Health said they trusted coaches to teach proper hitting techniques, believing good form takes the head out of the game. Concussion awareness was a concern, many said, but they overwhelmingly believed USA Football when it said that its Heads Up program had reduced practice injuries by 76 percent and concussions by about 30 percent. (A 2016 New York Times investigation revealed that those claims, which had been used in online marketing campaigns and congressional testimony, were overblown and misleading.)
“What it boils down to, honestly, is we’re just risking that chance.”
“You can’t convince me anywhere—anywhere—that these kids are hitting each other to that degree, improperly, to where they’re getting CTE when they’re older in life,” says Leonard Rhein, the coach of a 12- and 13-year-old team from Illinois whose 10- and 12-year-old sons have played football since they were 6. “Attacking [football] at the 12-and-under level is wrong and it’s unfounded. CTE is a real thing, there’s no question, but that’s at the highest level when you basically have two freight trains running into each other.”
Anita Smith’s son, Jacobi Eatman, is a tight end and defensive lineman on Rhein’s team. He started playing football at age 5 but was pulled out by his mom at age 9 because of her concerns about concussions. When Jacobi turned 11, he was allowed to play again because Anita felt he “was bigger and could understand the game more.” But she still has her reservations.
“Every time he takes that field, I have to ask myself, ‘Am I doing the right thing?’” she says. “Ultimately, the love that he has for the game, the camaraderie, the teamwork, the unity—all that has allowed me to allow him to do what he loves. And I do know that it comes at a risk. I pray every time he takes that field that I never have to be one of those parents who has to realize that fear.”
Benedict Evans
Vanessa Silva, whose son Brody wants to be a brain surgeon, says it would be hard to take him out of football because of his “deep love for the game . . . it would devastate him to not play.” But she might do it once he suffers his first concussion. “I do actually know parents that don’t have their kids play because of that specific reason,” she says. “What it boils down to, honestly, is we’re just risking that chance.”
Attempts are being made to make football safer. The NFL instituted a stricter concussion protocol in 2009 and players will be subject to ejection this season if they initiate contact with their helmets, Pop Warner has limited the amount of tackling in practices since 2012, and the Ivy League has banned tackling during regular-season practices since 2016. But no helmet can make it a safe game by preventing concussions or sub-concussive hits.
“When folks say that football has never been safer, on a continuum, I don’t deny that,” says Carol Sente, the state rep who sponsored the Illinois bill to ban tackling for 12-and-under players. “But to me, it’s like putting a longer filter on a cigarette. The public-safety issue is significant.”
“Every time he takes that field, I have to ask myself, ‘Am I doing the right thing?’”
America's pediatricians seem out of the loop. In the 1950s, the American Academy of Pediatrics drew a line in the sand between its patients and contact sports, including football and boxing. It said they “have no place in programs for children” 12 and younger. In the 1960s, though, the AAP’s stance softened. It made exceptions for the majority of contact sports. (Stay away “unless a school or community can provide exemplary supervision.”) And hockey was given the green light in 2000. (Okay, as long as body checking is “limited” for players 15 and under.) But those advisories read like stiff rejections compared with the change of heart the AAP expressed in its 2015 policy statement on the full-contact aspects of youth football.
While it acknowledged that eliminating tackling would reduce injuries, concussions especially, it nonetheless recognized “that the removal of tackling from football would lead to a fundamental change in the way the game is played. Participants in football must decide whether the potential health risks of sustaining these injuries are outweighed by the recreational benefits associated with proper tackling.”
"There’s absolutely nothing that could make it good for kids to hit their heads over and over again.”
It appears America’s pediatricians, who swore an oath to do no harm to children, are punting. “We really feel strongly that there’s a lot of data out there that says a sedentary lifestyle is much more risky to your long-term health than the risk is for injury while you’re playing a sport or doing an activity,” says Cynthia LaBella, M.D., AAP’s Council on Sports and Fitness chairwoman. “We don’t have any longitudinal studies, unfortunately, that follow these kids 30 or 40 years down the road.”
Stern, for one, is beyond mystified by the AAP’s position. “Is there a medical reason why it would be good for someone to play tackle football? There couldn’t possibly be one,” he says. “If kids are obese or have poor self-esteem, they need to exercise, and there are plenty of other activities or team sports . . . but there’s absolutely nothing that could make it good for kids to hit their heads over and over again.”
Benedict Evans
A longitudinal study is a fine idea and, yes, it could deepen our understanding of youth football’s true dangers. But it’s also time-consuming, expensive, and logistically ponderous. More to the point: Longitudinal studies weren’t the only catalysts that shifted public opinion on lead exposure (which is bad) or smoking (which is worse) or seat belts (which are now the rule of the road). Eventually, enough evidence was enough evidence for common sense to start changing public opinion.
In a 2017 study published in TheJournal of the American Medical Association, Stern’s colleague Ann McKee, M.D., a Boston University neuropathologist and the world’s preeminent expert on CTE, analyzed the donated brains of 202 players from all levels and found CTE in a whopping 88 percent of them. And while CTE at the high school level (21 percent) was far lower than at the college level (91 percent) or in the pros (99 percent), a one-in-five chance of brain damage at the high school level still means 10 potential heads a season on a typical 50-man JV/varsity squad.
“I used to think it was a numbers game,” Dr. McKee says of all the damaged brains that have come through her lab, “and that if we have enough, people would pay attention. But I actually don’t know what tips the scales for people who don’t want to acknowledge that football is dangerous. There’s something to the play of football that damages the brain. That, to me, is irrefutable.”
A version of this article appeared in the July/August 2018 issue of Men's Health Magazine.
This content is created and maintained by a third party, and imported onto this page to help users provide their email addresses. You may be able to find more information about this and similar content at piano.io
This commenting section is created and maintained by a third party, and imported onto this page. You may be able to find more information on their web site.
A Part of Hearst Digital Media
Men's Health participates in various affiliate marketing programs, which means we may get paid commissions on editorially chosen products purchased through our links to retailer sites. | null | minipile | NaturalLanguage | mit | null |
If it's in the News, it's in our Polls. Public opinion polling since 2003.
Winners and Losers in the Game of Political Life
One reason why people are attracted to politics is because, like sports, there are usually clear winners and losers. Moral ambiguity and shades of gray may overwhelm other sectors of life, but not the bottom-line of elections.
Only finality on November 2 really matters. Raising more money or winning a primary or seeing your opponent sink into a scandal is a kind of victory, but it’s transient. Still, you savor what you can on your way to Judgment Day.
Here’s a sampling of winners and losers from the last week. We could do a list like this every week, and in a way, we do. This time, we’re making it explicit.
JAN BREWER—WINNER
. The interim unelected Republican governor of Arizona, who succeeded Janet Napolitano when she joined the Obama Cabinet in early 2009, was regarded as weak from the start. Democrats were aghast at her social conservatism, and ambitious Republicans saw her as an easy mark in the 2010 primary. Then she sponsored a sales tax increase of one cent for the next three years to plug the state’s budget holes, and much of the anti-tax GOP base started looking for other candidates. Several pols obliged, and state Treasurer Dean Martin led Brewer in poll after poll. The prospective Democratic nominee for governor, Attorney General Terry Goddard, also led Brewer handily in some trial heats. Then came the immigration controversy. Brewer wasn’t at the forefront, since the bill emerged from the legislature as a force of nature. In fact, she didn’t even take a firm position on it until April 23, after it had already passed the state legislature. Brewer’s backing may have been late but it was emphatic, and overnight she became a hero to her party’s conservative base and looked like a leader—willing to stand up to pressure from President Obama and angry Latino groups in and out of Arizona. Brewer made some factually inaccurate statements about immigrants being the source of drugs, crime, and all manner of mayhem, but if anything, the gaffes made her more popular. So did the Obama Justice Department’s decision to sue Arizona to stop the new law. A Sagebrush Rebellion against federal authority is usually a winner, and the West likes a good high-noon, gun-totin’ showdown with the feds on main street in front of the saloon. Bang-bang. Brewer’s GOP opponents dropped out or suspended their campaigns in light of polls showing the primary was a runaway for the Governor. And Brewer is now a substantial favorite against Goddard in November. We’re changing our rating from Leans Republican to Likely Republican. And the Republican’s name is Jan Brewer.
SCOTT McINNIS—LOSER
. The Colorado gubernatorial battle was nip and tuck between likely GOP primary winner Scott McInnis, a former congressman, and Denver Mayor John Hickenlooper, the Democratic nominee. If anything, McInnis might have had the edge because of the unpopularity of incumbent Gov. Bill Ritter (D), who saw the handwriting on the wall and retired after a single term. Swing-state Colorado was experiencing a swing of the pendulum back to the GOP after having voted solidly for Barack Obama in 2008. And then came the McInnis plagiarism scandal. A family foundation had paid McInnis $300,000 for a series of original papers on water issues, but the essays contain no citations and appear to be lifted from twenty year-old writings. McInnis has blamed a researcher he hired for the error and has pledged to repay the six-figure fee, but the damage is done and Republicans are stuck. They realize that McInnis is badly damaged, yet his only primary opponent, businessman Dan Maes, lacks credibility and would likely lose badly in the general election. The filing deadline has passed, and Republican voters may have to vote for McInnis in the primary and then hope he can be persuaded to withdraw in favor of another ,stronger candidate—identity unknown at the moment. This has happened before in other states. In 2002, for example, New Jersey Democrats re-nominated incumbent U.S. Sen. Robert Torricelli, whose corruption problems were leading inexorably to the election of the GOP nominee, Doug Forrester. Just weeks before the election, Torricelli bowed to reality, resigned his nomination, and permitted Democrats to substitute former U.S. Sen. Frank Lautenberg, who had retired in 2000. Lautenberg easily won the election and is still serving. However, Torricelli’s case suggests why McInnis has little incentive to play ball. Torricelli has never again been heard from politically. McInnis may calculate that a big GOP wave in November will elect him anyway—and in an era drenched in candidate scandals, who’s to say the voters might not overlook McInnis’s transgressions? It’s up or out for McInnis anyway. For now, at least, the big winner from this is Mayor Hickenlooper, and if the cards continue to fall right, he could be the acknowledged favorite for the fall.
KAREN HANDEL—WINNER
. It wasn’t long ago that GOP Secretary of State Karen Handel’s candidacy for governor of Georgia appeared stuck in neutral. Despite a belief that she was the private favorite of Governor Sonny Perdue (R), Handel couldn’t get traction against long-time frontrunner John Oxendine, the state insurance commissioner—partly because the field was crowded with other strong contenders such as former Congressman Nathan Deal (endorsed by Newt Gingrich) and an up-and-comer, state Rep. Eric Johnson. Handel was also mired in controversy about whether she was insufficiently anti-gay rights (this is a Southern Republican primary, mind you). But as is often the case in summer primaries, events were late-breaking and voters started paying attention as Election Day approached. News reports of Oxendine’s alleged conflicts of interest—including soliciting PAC money from insurance companies he was charged with regulating—rekindled doubts about the controversial candidate who has often stirred passionate opposition. He began to sink rapidly, and Handel stood to benefit disproportionately, partly because of her gender—women are frequently perceived by the electorate as less corrupt than male politicians. Sarah Palin’s endorsement of Handel helped to ease the doubts of grassroots party conservatives, much as Palin’s nod had done one state to the north, for South Carolina’s Nikki Haley, the winner of the Republican gubernatorial nomination in the Palmetto State. As a bonus, Handel received the backing of Arizona Gov. Jan Brewer (another designated winner, as noted above). Brewer is riding high as the national hero of the anti-immigration movement, so this was another boost among conservatives for Handel. With four strong Republican candidates, it is no surprise that there will be a runoff between Handel and the second-place winner, ex-Rep. Deal, on August 10. But Deal had ethics problems while in the U.S. House of Representatives, and it may be that Handel can leverage the same advantages against Deal that she used to undermine Oxendine. The final percentages in the first primary were: Handel (34.1%), Deal (22.9%), Johnson (20.1%), with Oxendine, once the frontrunner, in fourth place (16.9%). Meanwhile, on the Democratic side, it was a landslide for former Gov. Roy Barnes, who gained 65.9% to crush four opponents. Democrats had privately hoped that Oxendine would be the GOP nominee since he was seen as the weakest Republican in November. Unless the GOP runoff turns particularly nasty, Barnes will have his hands full getting the second term that eluded him in 2002, when he was beaten (to universal amazement) by Sonny Perdue, once a long-shot. After all, 2010 is a GOP-tilting year nationally, and the Peach State is Red well beyond its famed clay and the skin of its delicious fruit. For the Republicans, Handel starts out as the runoff favorite, though this should be a spirited race. Some may view it as a proxy 2012 presidential battle between Palin (Handel) and Gingrich (Deal), though voters are unlikely to cast their ballots on that basis.
ROB PORTMAN—WINNER
. Every quarter, political analysts scan the fundraising numbers for clues about the political health of candidates. Yes, perhaps too much emphasis is placed on the amounts of money raised, since quite a few underfunded politicians manage to win despite the handicap. But campaign money yields hard data that are probably more revealing than transient polling results. Across the nation there were many money winners and losers, with perceptions changed in scores of Senate, Governor, and House contests. But for our, ahem, money, no totals were more eye-popping than in the Senate match-up in the great swing state of Ohio. This is one of the Crystal Ball’s toss-up races, and it is in precisely this kind of election where a giant cash advantage can matter. That is exactly what we see. Republican Rob Portman, a former congressman and Bush administration official, is sitting on $8,879,000, while his Democratic opponent, Lt. Gov. Lee Fisher, has a cash-on-hand total of $1,294,000. No adjectives are necessary to describe this gap. Perhaps Fisher intends to grab hold of the coattails of Gov. Ted Strickland (D), assuming he wins his reelection bid, or maybe Fisher plans on being rescued by the Democratic Senatorial Campaign Committee. Yet plenty of states elect a Governor of one party and a Senator of another simultaneously, so a win by Strickland wouldn’t necessarily help. Also, the DSCC has a lot of endangered Senate seats around the country to worry about. (If Fisher won, of course, this would be a noteworthy flip from R to D, since the seat is currently held by retiring GOP Sen. George Voinovich.) Basically, if Fisher can’t show significant, speedy progress in closing the dollar chasm with Portman, the Buckeye Senate seat will likely move from Toss-Up to Leans Republican in the fall.
DAVID VITTER—LOSER
. If we had to bet today, the Crystal Ball would still wager that Louisiana Sen. David Vitter (R) would win a second term. He has had the good fortune to run, first, in a solid GOP presidential year (2004), and now in a strongly Republican-trending midterm year. The Bayou State gave Barack Obama just 39.9% of the vote in 2008, and Obama’s fortunes have declined further since. Capitalizing on this anti-Obama sentiment, Vitter has been one of the president’s most unrelenting critics, finding fault and issuing press releases about even minor matters. Over the weekend, for instance, when Obama took his family to Maine for a vacation, Vitter denounced the president for not choosing the BP-soiled Gulf Coast instead. All this has paid off for Vitter, at least until recently. His seedy prostitution scandal that stretched from D.C. to New Orleans had receded into the background. Then ABC News revealed that a Vitter aide, Brent Furer, had been assigned to women’s issues despite a conviction for assaulting his girlfriend and an open warrant for his arrest relating to a drunk driving charge. Vitter compounded his dilemma by denying that the aide had been working on women’s issues—a claim clearly contradicted by information supplied by Vitter’s own Senate office to various staff directories. The new revelations spurred the entry of a respectable (though not pure—it’s Louisiana) Republican primary challenger, former state Supreme Court Justice Chet Traylor. Fundamentalist Christians are a big part of the Louisiana GOP base, and it will be interesting to see whether they continue to give David Vitter a pass on transgressions that would never be overlooked for a Democratic officeholder. There is also the chance that Congressman Charles Melancon, the Democratic Senate nominee, can capitalize on Vitter’s scandals and GOP division, though 2010 could not present a worse environment for any Democrat in the state. In any event, Vitter will now have to worry about the GOP primary, when he had thought he was home free.
CARTE GOODWIN—WINNER
. The new U.S. senator from West Virginia has lived a charmed existence, as befits a scion of a wealthy, well-connected family in a small state. With his appointment from Democratic Gov. Joe Manchin, whom he had once served as general counsel, Goodwin has become the youngest member of the U.S. Senate at age 36. True, the handsome, mediagenic Goodwin is a short-termer, only in office until a November special election is held at which his benefactor, Gov. Manchin, will probably take the seat. But how can you lose when you become an ex-senator in one’s mid-30s? Goodwin will be a logical candidate to succeed Sen. Jay Rockefeller (D) when he retires, or serve as Governor of West Virginia, on his way to, well, who knows? And in the meantime he can soak up the privileges of incumbency (and former incumbency) as a prince awaiting his next throne. Let’s face it: Some people are born winners, guarded by Fortuna, shielded from failure, guaranteed fame. Goodwin is one of them; “win” is even part of his surname.
Rasmussen Reports is a media company specializing in the collection,
publication and distribution of public opinion information.
We conduct public opinion polls on a variety of topics to inform our audience on events
in the news and other topics of interest. To ensure editorial control and independence,
we pay for the polls ourselves and generate revenue through the sale of subscriptions,
sponsorships, and advertising. Nightly polling on politics, business and lifestyle topics
provides the content to update the Rasmussen Reports web site many times each day.
If it's in the news, it's in our polls. Additionally, the data drives a
daily update newsletter and various media outlets
across the country. | null | minipile | NaturalLanguage | mit | null |
Versatile design
Viking Yacht's announcement of the new 38 Billfish and 38 Open models present new and exciting options that attract the interested vessel owner/operator. The 38 models serve as well versatile boats that are tournament ready fishing machines.
Viking 38 OPEN
The Viking Yachts 38 Open shares the same hull, cockpit and similar mechanical arrangement to the 38 Billfish, however she differs in the command deck and bridge designs. The command deck provides seating with port and starboard L-shaped lounges and storage below. For great visibility, a raised centerline command station is a key feature on the 38 Open. | null | minipile | NaturalLanguage | mit | null |
HMS Eastbourne
Two ships of the Royal Navy have borne the name HMS Eastbourne, after the East Sussex seaside town of Eastbourne:
was a launched in 1940 and sold in 1948.
was a launched in 1955 and sold for scrapping in 1985.
Category:Royal Navy ship names | null | minipile | NaturalLanguage | mit | null |
Some customers ask about the differences between Japan Edition and Normal Edition of Champion.
The main difference basically is Champion Japan own their design and product team which can produce their own line. They aim for quality and original retro style for the trend nowadays , so they use better quality and wider choices of fabric like Reverse Weave...etc. That’s is why the price is higher than normal but Worth.
TO BE HONESTLY, the Japan Edition can wear long lastbecause of the quality also the design, like the One in PHOTO, it is few years ago but still look very good in shape.
We do have some Champion Japan Big C on sale now, not much left but it is good for AW!
Info
Support
Our Story
Established in 2003, KIX-FILES started off as a sneaker website providing sneaker-related news and information. Then came KIX-FILES online store in 2005 and it quickly emerged as one of the best online shops in the world. | null | minipile | NaturalLanguage | mit | null |
Thousands of young American LGBT people will undergo conversion therapy from a licensed healthcare professional before they turn 18, a study has found.
An estimated 20,000 Teenagers aged 13 to 17 will go through an attempt to change their sexual orientation according to researchers at the Williams Institute at the UCLA School of Law.
Sometimes referred to as "reparative" therapy, counselling, prayer are used to try and "cure" people.
It has been widely discredited by health experts for risking causing emotional and psychological damage.
It is legal in the UK, but in January 14 health organisations - including NHS England and the Royal College of Psychiatrists - signed an agreement that described the treatment as "potentially harmful and unethical".
Conversion therapy is still legal in 41 states across the US, including Massachusetts and New York. Some state bans also apply to anyone who performs the practice in exchange for money.
The new study suggests an estimated 57,000 young people will receive the treatment from a religious or spiritual advisor.
World news in pictures Show all 50 1 /50 World news in pictures World news in pictures 14 September 2020 Japan's Prime Minister Shinzo Abe, Chief Cabinet Secretary Yoshihide Suga, former Defense Minister Shigeru Ishiba and former Foreign Minister Fumio Kishida celebrate after Suga was elected as new head of the ruling party at the Liberal Democratic Party's leadership election in Tokyo Reuters World news in pictures 13 September 2020 A man stands behind a burning barricade during the fifth straight day of protests against police brutality in Bogota AFP via Getty World news in pictures 12 September 2020 Police officers block and detain protesters during an opposition rally to protest the official presidential election results in Minsk, Belarus. Daily protests calling for the authoritarian president's resignation are now in their second month AP World news in pictures 11 September 2020 Members of 'Omnium Cultural' celebrate the 20th 'Festa per la llibertat' ('Fiesta for the freedom') to mark the Day of Catalonia in Barcelona. Omnion Cultural fights for the independence of Catalonia EPA World news in pictures 10 September 2020 The Moria refugee camp, two days after Greece's biggest migrant camp, was destroyed by fire. Thousands of asylum seekers on the island of Lesbos are now homeless AFP via Getty World news in pictures 9 September 2020 Pope Francis takes off his face mask as he arrives by car to hold a limited public audience at the San Damaso courtyard in The Vatican AFP via Getty World news in pictures 8 September 2020 A home is engulfed in flames during the "Creek Fire" in the Tollhouse area of California AFP via Getty World news in pictures 7 September 2020 A couple take photos along a sea wall of the waves brought by Typhoon Haishen in the eastern port city of Sokcho AFP via Getty World news in pictures 6 September 2020 Novak Djokovic and a tournament official tends to a linesperson who was struck with a ball by Djokovic during his match against Pablo Carreno Busta at the US Open USA Today Sports/Reuters World news in pictures 5 September 2020 Protesters confront police at the Shrine of Remembrance in Melbourne, Australia, during an anti-lockdown rally AFP via Getty World news in pictures 4 September 2020 A woman looks on from a rooftop as rescue workers dig through the rubble of a damaged building in Beirut. A search began for possible survivors after a scanner detected a pulse one month after the mega-blast at the adjacent port AFP via Getty World news in pictures 3 September 2020 A full moon next to the Virgen del Panecillo statue in Quito, Ecuador EPA World news in pictures 2 September 2020 A Palestinian woman reacts as Israeli forces demolish her animal shed near Hebron in the Israeli-occupied West Bank Reuters World news in pictures 1 September 2020 Students protest against presidential elections results in Minsk TUT.BY/AFP via Getty World news in pictures 31 August 2020 The pack rides during the 3rd stage of the Tour de France between Nice and Sisteron AFP via Getty World news in pictures 30 August 2020 Law enforcement officers block a street during a rally of opposition supporters protesting against presidential election results in Minsk, Belarus Reuters World news in pictures 29 August 2020 A woman holding a placard reading "Stop Censorship - Yes to the Freedom of Expression" shouts in a megaphone during a protest against the mandatory wearing of face masks in Paris. Masks, which were already compulsory on public transport, in enclosed public spaces, and outdoors in Paris in certain high-congestion areas around tourist sites, were made mandatory outdoors citywide on August 28 to fight the rising coronavirus infections AFP via Getty World news in pictures 28 August 2020 Japanese Prime Minister Shinzo Abe bows to the national flag at the start of a press conference at the prime minister official residence in Tokyo. Abe announced he will resign over health problems, in a bombshell development that kicks off a leadership contest in the world's third-largest economy AFP via Getty World news in pictures 27 August 2020 Residents take cover behind a tree trunk from rubber bullets fired by South African Police Service (SAPS) in Eldorado Park, near Johannesburg, during a protest by community members after a 16-year old boy was reported dead AFP via Getty World news in pictures 26 August 2020 People scatter rose petals on a statue of Mother Teresa marking her 110th birth anniversary in Ahmedabad AFP via Getty World news in pictures 25 August 2020 An aerial view shows beach-goers standing on salt formations in the Dead Sea near Ein Bokeq, Israel Reuters World news in pictures 24 August 2020 Health workers use a fingertip pulse oximeter and check the body temperature of a fisherwoman inside the Dharavi slum during a door-to-door Covid-19 coronavirus screening in Mumbai AFP via Getty World news in pictures 23 August 2020 People carry an idol of the Hindu god Ganesh, the deity of prosperity, to immerse it off the coast of the Arabian sea during the Ganesh Chaturthi festival in Mumbai, India Reuters World news in pictures 22 August 2020 Firefighters watch as flames from the LNU Lightning Complex fires approach a home in Napa County, California AP World news in pictures 21 August 2020 Members of the Israeli security forces arrest a Palestinian demonstrator during a rally to protest against Israel's plan to annex parts of the occupied West Bank AFP via Getty World news in pictures 20 August 2020 A man pushes his bicycle through a deserted road after prohibitory orders were imposed by district officials for a week to contain the spread of the Covid-19 in Kathmandu AFP via Getty World news in pictures 19 August 2020 A car burns while parked at a residence in Vacaville, California. Dozens of fires are burning out of control throughout Northern California as fire resources are spread thin AFP via Getty World news in pictures 18 August 2020 Students use their mobile phones as flashlights at an anti-government rally at Mahidol University in Nakhon Pathom. Thailand has seen near-daily protests in recent weeks by students demanding the resignation of Prime Minister Prayut Chan-O-Cha AFP via Getty World news in pictures 17 August 2020 Members of the Kayapo tribe block the BR163 highway during a protest outside Novo Progresso in Para state, Brazil. Indigenous protesters blocked a major transamazonian highway to protest against the lack of governmental support during the COVID-19 novel coronavirus pandemic and illegal deforestation in and around their territories AFP via Getty World news in pictures 16 August 2020 Lightning forks over the San Francisco-Oakland Bay Bridge as a storm passes over Oakland AP World news in pictures 15 August 2020 Belarus opposition supporters gather near the Pushkinskaya metro station where Alexander Taraikovsky, a 34-year-old protester died on August 10, during their protest rally in central Minsk AFP via Getty World news in pictures 14 August 2020 AlphaTauri's driver Daniil Kvyat takes part in the second practice session at the Circuit de Catalunya in Montmelo near Barcelona ahead of the Spanish F1 Grand Prix AFP via Getty World news in pictures 13 August 2020 Soldiers of the Brazilian Armed Forces during a disinfection of the Christ The Redeemer statue at the Corcovado mountain prior to the opening of the touristic attraction in Rio AFP via Getty World news in pictures 12 August 2020 Young elephant bulls tussle playfully on World Elephant Day at the Amboseli National Park in Kenya AFP via Getty World news in pictures 11 August 2020 French Prime Minister Jean Castex is helped by a member of staff to put a protective suit on prior to his visit at the CHU hospital in Montpellier AFP via Getty World news in pictures 10 August 2020 Locals harvest their potatoes as Mount Sinabung spews volcanic ash in Karo, North Sumatra province, Indonesia Antara Foto/Reuters World news in pictures 9 August 2020 Doves fly over the Peace Statue at Nagasaki Peace Park during the memorial ceremony held for the 75th anniversary of the atomic bombing EPA World news in pictures 8 August 2020 Anti-government protesters try to remove concrete wall that installed by security forces to prevent protesters reaching the Parliament square, during a protest against the political elites and the government after this week's deadly explosion in Beirut AP World news in pictures 7 August 2020 A protester throws a stone towards Israeli forces in the village of Turmus Aya, north of Ramallah in the occupied West Bank, following a march by Palestinians against the building of Israeli settlements AFP via Getty World news in pictures 6 August 2020 A woman yells as soldiers block a road for French President Emmanuel Macron's visit the Gemmayzeh neighborhood. The area in Beirut suffered extensive damage from the explosion at the seaport AP World news in pictures 5 August 2020 Damage at the site of Tuesday's blast in Beirut's port area, Lebanon Reuters World news in pictures 4 August 2020 A large explosion in the Lebanese capital Beirut. The blast, which rattled entire buildings and broke glass, was felt in several parts of the city AFP via Getty World news in pictures 3 August 2020 A general view shows the new road bridge in Genoa, Italy ahead of its official inauguration, after it was rebuilt following its collapse on August 14, 2018 which killed 43 people Reuters World news in pictures 2 August 2020 Empty stall spaces are seen hours before a citywide curfew is introduced in Melbourne, Australia EPA World news in pictures 1 August 2020 People take part in a demonstration by the initiative "Querdenken-711" with the slogan "the end of the pandemic - the day of freedom" to protest against the current measurements to curb the spread of COVID-19 in Berlin, Germany AFP via Getty World news in pictures 31 July 2020 Pilgrims circumambulating around the Kaaba, the holiest shrine in the Grand mosque in Mecca. Muslim pilgrims converged today on Saudi Arabia's Mount Arafat for the climax of this year's hajj, the smallest in modern times and a sharp contrast to the massive crowds of previous years Saudi Ministry of Media/AFP World news in pictures 30 July 2020 The Mars 2020 Perseverance mission lifts off at the Kennedy Space Centre in Florida. The mission is part of the USA's largest moon to Mars exploration. Nasa will attempt to establish a sustained human presence on and around the moon by 2028 through their Artemis programme EPA World news in pictures 29 July 2020 A woman refreshes herself in a outdoor pool in summer temperatures in Ehingen, Germany dpa via AP World news in pictures 28 July 2020 Malaysia's former prime minister Najib Razak speaks to the media after he was found guilty in his corruption trial in Kuala Lumpur AFP via Getty World news in pictures 27 July 2020 North Korean leader Kim Jong Un poses for a photograph after conferring commemorative pistols to leading commanding officers of the armed forces on the 67th anniversary of the "Day of Victory in the Great Fatherland Liberation War". Which marks the signing of the Korean War armistice KCNA via Reuters
Researchers also found nearly 700,000 LGBT adults in the US have already received conversion therapy at some point in their lives, including 350,000 who were subjected to the practice as adolescents.
Lead study author Christy Mallory, state and local policy director at the Williams Institute, said many professional health associations and the public support ending the use of conversion therapy on LGBT youth.
“Our research shows that laws banning conversion therapy could protect tens of thousands of teens from what medical experts say is a harmful and ineffective practice,” she said.
According to the study, 6,000 youth ages 13 to 17 would have received conversion therapy before they reached adulthood if their state had not banned the practice.
None of them prevent religious or spiritual advisors from providing conversion therapy as long as they are acting solely in a spiritual capacity.
Several prominent professional health associations in the US, including the American Medical Association, the American Psychological Association and the American Academy of Pediatrics, have publicly opposed the use of conversion therapy.
Although talk therapy is a common technique, some practitioners have used “aversion treatments” such as inducing nausea, vomiting or applying electric shocks. | null | minipile | NaturalLanguage | mit | null |
Q:
Unicode-correct title case in Java
I've been looking through all StackOverflow in the bazillion of questions about capitalizing a word in Java, and none of them seem to care the least about internationalization and as a matter of fact none really seem to work in an international context. So here is my question.
I have a String in Java, which represents a word - all isLetter() characters, no whitespace. I want to make the first character upper case and the rest lower case. I do have the locale of my word in handy.
It's easy enough to call .substring(1).toLowerCase(Locale) for the last part of my string.
I have no idea how to get the correct first character, though.
The first problem I have is with Dutch, where "ij" being a digraph should be capitalized together. I could special-case this by hand, because I know about it; now there may be other languages with this kind of thing that I don't know about, and I'm sure Unicode will tell me if I ask nicely. But I don't know how to ask.
Even if the above problem is solved, I'm still stuck with no proper way to handle English, Turkish and Greek, because Character supports titlecase but no locale, and String supports locales but not titlecase.
If I take the code point, and pass it to Character.toTitleCase(), this will fail because there is no way to pass the locale to this method. So if the system locale is in English but the word is Turkish, and the first char of the word is "i", I'll get "I" instead of "İ" and this is wrong.
Now if I take a substring and use .toUpperCase(Locale), this will fail because it's upper and not title case. So if the word is Greek, I'll still get the wrong character.
If anyone has useful pointers, I'd be happy to hear them.
A:
Like you, I was unable to find a suitable method in the core Java API.
However, there does seem to be a locale-sensitive string-title-case method (UCharacter#toTitleCase) in the ICU library.
Looking at the source for the relevant ICU methods (UCharacter#toTitleCase and UCaseProps#toUpperOrTitle), there don't seem to be many locale-specific special cases for title-casing, so you might be able to get away with the following:
Find the first cased character in the string.
If it has a title-case form distinct from its upper-case form, use that.
Otherwise, perform a locale-sensitive upper-case on that first character and its combining characters.
Perform a locale-sensitive lower-case on the rest of the string.
If the locale is Dutch and the first cased character is an "I" followed by a "j", upper-case the "j".
A:
The only two character digraph in which both characters are capitalized at once and that you probably will encounter in a real life program is the Dutch IJ. Just handle it if the locale is Dutch. In the worst improbable scenario, there will be 1-2 cases that you'll need to add later, it is not that you'll encounter new capitalization digraph every day so it is not worth focusing on generalization here.
Note, in general, it is not possible to use character to character conversion to get either title or upper case for an arbitrary language. Some lower case characters translate to more than one upper case characters. So you have to use String in a generic case.
But there is no any problem with title case locale. There is probably a small misunderstanding about how toTitleCase() method works. It will convert to title case any character, including one that is already in the upper case.
For example, consider the dž character. It's upper case form is DŽ and the title case form is Dž:
System.out.println(Character.toUpperCase('\u01C4'));
DŽ
and
System.out.println(Character.toTitleCase('\u01C4'));
Dž
however, the following will also give title case
System.out.println(Character.toTitleCase(Character.toUpperCase('\u01C4')));
Dž
So, if you convert with locale to upper case before title case, you get the correct code point and there is no problem to use title case on the result, including Turkish, etc.:
System.out.println(Character.toTitleCase("dž".toUpperCase().charAt(0)));
System.out.println(Character.toTitleCase("i".toUpperCase(Locale.forLanguageTag("tr")).charAt(0)));
Dž
İ
Note, just using title case of a single character if there is a difference from its upper case is not correct in a generic case.
To summarize:
Handle Dutch digraph (or other digraphs if you encounter them, I highly doubt that and at worst it will be 1-2 cases for program lifetime).
Convert the required characters as String using locale and toUpperCase()
Convert all characters of the toUpperCase result using Character toTitleCase.
Note, there are still some capitalization cases that are context aware, like Irish prefix, English ff names, etc. which require more than just a character/string processing, but I doubt you need to handle them for title generation in a program.
A:
The problem is that the differentiation of upper and lower case letters is very language specific. So many, maybe most languages, do not have such.
Anyway, there is a Unicode faq:
http://www.unicode.org/faq/casemap_charprop.html
..and I guess there is a Unicode specific mapping table somewhere (something like that ftp://ftp.unicode.org/Public/UNIDATA/UnicodeData.txt). So its probably best to use your own conversion method.
| null | minipile | NaturalLanguage | mit | null |
Nationally-known assessment expert Trudy Banta is the keynote speaker for Grand Valley's first University-wide Assessment Conference, planned for January 7, 2011, at the Pew Grand Rapids Campus' Eberhard Center. The purpose of the Effective Assessment: Practicing Excellence, Excellent Practice conference is to showcase assessment practices in use throughout the university and to give faculty and administrators the opportunity to consult with Dr. Banta. Registration for the day-long conference is free to GVSU faculty, staff and students thanks to a sponsorship from all Colleges and several offices within Academic and Student Affairs.
The Office of Undergraduate Research and Scholarship (OURS) has launched a new website for students and faculty interested in undergraduate research and scholarship. www.gvsu.edu/ours
The site provides information for students about how to get started on research and scholarship, funding opportunities, scholarship opportunities, venues for dissemination, research and scholar support services, and information about Student Scholars Day and Student Summer Scholars. Similar information is provided for faculty, as well as resources for faculty interested in working with undergraduate students.
This site is intended to be user friendly for faculty and for students. If there is additional information we can provide, please do not hesitate contacting the OURS staff via email ([email protected]) or via phone 1-8100.
Warm regards,
Susan Mendoza
3. More ways to highlight Student Work – Mary Schutten
In addition to the university's new registry, here's another way to highlight student work:
Please forward the information below to anyone participating in undergraduate research that you feel might be interested in pursuing graduate study. There is no cost to the student or the student's institution to participate in this program.
Dear Students:
The Council on Undergraduate Research hosts a Registry of Undergraduate Researchers. The purpose of this registry is to facilitate matchmaking between undergraduates who have research experience and a desire to pursue an advanced degree, with graduate schools seeking high quality students who are well prepared for research. The Registry is open to students and graduate schools in the fields of Anthropology/Archaeology, Arts/Humanities, Biology/Biochemistry, Business, Chemistry/Biochemistry, Economics, Education, Engineering, English and Linguistics, Environmental Studies, Geosciences, Health Professions, History, Journalism and Communications, Mathematics/Computer Science, Physics/ Astronomy, Political Science, Psychology, Social Work and Sociology.
Any undergraduate may go to www.cur.org/ugreg/to fill out a simple curriculum vitae form. There is no charge to the student and records will be made available to bona fide Graduate Schools that contract with CUR for this service. Organizations or companies seeking the students’ information for other marketing purposes will not be granted access. Graduate School representatives may contact students to invite applications or visits to the campus and laboratory, or to share information about their research programs and financial support opportunities.
Graduate schools may provide a link to their websites, and may provide a short description of opportunities, such as research fields and fellowships. It will also be possible for institutions to place an ad on the database website if the content is related to the mission of CUR and the Undergraduate Registry.
For graduate schools that wish to review the student information, there is an access fee of $1,500 for the entire database, or $300 for one specific discipline. Again, there is no cost to you as a student to create a profile.
We hope that students who are currently in their junior year will register now, but anyone with undergraduate research experience may register at any time. You will be able to update your listing as appropriate, to include any summer research experience or information about Senior Theses and test scores. We also welcome submissions by students who are engaged in Masters' Degree programs now but who plan on going on to a PhD program. Just fill out the information on the form including the date you intend to enter a PhD program and your date of completion of your undergraduate degree. Upload a link to your CV that contains complete information about your MS/MA degree activity (school, subject, thesis topic (if applicable), and advisor).
CUR believes that this service will be a great benefit for both students and graduate schools by narrowing the search for the right match. So if you are interested in graduate school, please take a moment to register now. Be sure to include a statement of your research interests, as this will be important for making the match.
As faculty prepare their syllabi for the winter semester, it may be helpful to encourage them to include, if not already included, a statement related to disability accommodations. This type of clear statement was suggested by Jeanne Kirkpatrick in her presentation on the new changes to the American with Disabilities Act. Two samples are provided below.
Statement on Disability Accommodations:
Any student who requires accommodation because of a physical or learning disability must contact Disability Support Services (http://www.gvsu.edu/dss) at 616-331-2490 as soon as possible. After you have documented your disability, please make an appointment or see me during office hours to discuss your specific needs.
Any student needing academic accommodations beyond those given to the entire class, please be advised that the University’s Office of Disability Support Services (DSS, ext. 12490) is available to all GVSU students. It is the student’s responsibility to request assistance from DSS.
5. Prerequisite Error Reports –from Jerry Montag
On Thursday, December 23rd, I will electronically send to the Dean’s Office the final list of students who are not meeting a prerequisite for one or more of their Winter 2011 registered courses. Since there is a very short window of opportunity to follow-up with these students before the winter 2011 semester begins, I am asking for your cooperation in distributing the list to unit heads as soon as possible and with a reminder of the following:
1 – An e-mail AND letter needs to be sent to these students immediately after you receive this report on Thursday, December 23. This will allow maximum time for the students to receive and follow-up on this urgent issue.
2 – Phone call follow-ups should be done for these students on January 5 and 6.
3 – If you request these students to be dropped from their Winter 2011 course(s), please send the packet of e-mails, letters and notation of telephone calls to me no later than Friday, January 7 with your authorization.
4 – IMPORTANT: Please be aware that if you are requesting to drop a student’s course(s) and it causes him or her to fall below 12 credits, it may affect his or her financial aid. Please make extra efforts on these students to ensure they maintain full time status. | null | minipile | NaturalLanguage | mit | null |
Democratic state legislators are proposing a new college grant program that would cover the cost of tuition, books and housing at state schools for any resident who signs a pledge to work in Wisconsin for three years after graduation.
Authors of the proposal call it the "Wisconsin Promise." State Rep. Melissa Sargent, D-Madison, said it would cover all college costs for in-state students as long as they keep a 3.0 GPA and are able to find a job within three months of graduation. She said the plan would allow students to graduate debt-free from any University of Wisconsin System or state technical college.
"If you are committed, if you roll up your sleeves, if you work hard and you commit to the state of Wisconsin, we're gonna take care of you because you're taking care of us," Sargent said. "You're going to become part of our tax base."
For students who leave the state or fail to maintain their grades, the grant would become a loan they would have to pay back.
Sign up for daily news! Stay informed with WPR's email newsletter.
Sargent said there's no estimate yet on how much it would cost the state to provide the grants to the thousands of students who would be eligible.
Gov. Scott Walker is backing package of Republican proposals to help students avoid going into debt to get a college education, but Sargent said her bill goes much further.
She said similar grant programs have been adopted in Oregon and Tennessee. The Tennessee Promise program costs the state $34 million every year and is only available to cover tuition at community colleges.
The Oregon program also provides tuition grants only for community colleges. It has a yearly price tag of $10 million with between 4,000 and 6,000 students eligible to get a two-year degree. | null | minipile | NaturalLanguage | mit | null |
Send this page to someone via email
There are no new cases of COVID-19, the disease caused by the novel coronavirus, in the province.
About 400 people were tested Sunday, and none of the results came back with a presumptive positive, said Dr. Brent Roussin, chief public health officer for Manitoba.
Those who do not have symptoms should not be tested, nor should they present themselves at testing centres, said Roussin.
“We have not seen community-based transmission,” Dr. Roussin says, reiterating all cases in Manitoba so far have been travel-related. Classes in K to 12 schools will be suspended effective next Monday for a three week period. #glbwpg — Diana Foxall (@CJOBdiana) March 16, 2020
Story continues below advertisement
Seven people have been diagnosed with a presumptive or confirmed case of COVID-19 in Manitoba.
Three more presumptive cases were identified on Sunday, including one person in the Interlake.
All three people had recently travelled internationally, Manitoba Health said late Sunday afternoon.
All seven cases in Manitoba are now confirmed — with all infected people traveling internationally prior to their diagnoses. Destinations include Asia (South Korea, the Philippines), Europe and Egypt. #glbwpg — Diana Foxall (@CJOBdiana) March 16, 2020
Roussin said scams are now showing up online, and people are being warned that scammers are pretending to be calling from Manitoba Public Health.
Winnipeg police confirmed on Monday that they’ve received reports of an email scam related to the COVID-19 outbreak.
Story continues below advertisement
0:45 Manitoba’s Chief Public Health Officer warns of phishing scams during COVID-19 scare Manitoba’s Chief Public Health Officer warns of phishing scams during COVID-19 scare
They say scammers are sending unsolicited emails to potential victims, telling them they’ve likely been contaminated by the virus causing COVID-19.
[ Sign up for our Health IQ newsletter for the latest coronavirus updates ]
The scammers then ask for a credit card number to begin a shipment of medication related to the contamination.
Anyone who receives an email or other communication, including a phone call or text, should delete the email or text without responding or hang up on the caller, police advise.
Dr. Roussin says these times bring out the best and the worst in people. They have seen multiple phishing scams pop up amid the pandemic — Brittany Greenslade (@BrittAtGlobal) March 16, 2020
Story continues below advertisement
“I cannot stress enough… now is not the time to travel outside Canada” – Dr. Brent Roussin — Brittany Greenslade (@BrittAtGlobal) March 16, 2020
As for daycares, they are remaining open at this time, said Roussin, although he reiterated again that talks are ongoing.
Roussin also cautioned against joining large gatherings, especially with St. Patrick’s Day happening on Tuesday.
“Can’t stress enough — wash your hands frequently, cough into the sleeve, sneeze into the sleeve, stay home when you’re ill,” Dr. Roussin says. He’s encouraging businesses not to require sick notes for ill staff as the health system needs to handle the pandemic — not write notes. — Diana Foxall (@CJOBdiana) March 16, 2020
Story continues below advertisement
A new, dedicated testing site opened in Thompson on Monday at the Plaza Mall in the Thompson Clinic.
Flin Flon and The Pas will open sites as soon as tomorrow, said Lanette Siragusa, chief nursing officer for Manitoba Shared Health.
Over the last four days, those Winnipeg screening centres have seen 1200 patients. Siragusa says 140 medical students are currently helping at the Access centres, and a group of nursing students are helping out at Health Links — Which saw 1700 calls yesterday. #glbwpg — Diana Foxall (@CJOBdiana) March 16, 2020
Health Links saw 1,700 calls Sunday, with an average wait time of one hour and 43 minutes, she added.
“We are continuing to add staff, including those University of Manitoba nursing students.”
Province also looking at virtual care in some areas for specific issues — Brittany Greenslade (@BrittAtGlobal) March 16, 2020
Story continues below advertisement
The province is testing a new online self-assessment tool, said Siragusa.
Health-care facilities, including long-term care homes, are now under elevated visitor restrictions.
Questions about COVID-19? Here are some things you need to know:
Health officials say the risk is low for Canadians but warn this could change quickly. They caution against all international travel. Returning travellers are asked to self-isolate for 14 days in case they develop symptoms and to prevent spreading the virus to others.
Symptoms can include fever, cough and difficulty breathing — very similar to a cold or flu. Some people can develop a more severe illness. People most at risk of this include older adults and people with severe chronic medical conditions like heart, lung or kidney disease. If you develop symptoms, contact public health authorities.
Story continues below advertisement
To prevent the virus from spreading, experts recommend frequent handwashing and coughing into your sleeve. And if you get sick, stay at home.
For full COVID-19 coverage from Global News, click here. | null | minipile | NaturalLanguage | mit | null |
Ikki began life as an arcade game about a group of peasants being led by one particular farmer in an uprising against the feudal lords of Japan. You control the lead farmer as you battle for control over your farm and home against the clans of ninjas that the lords have employed to quell the insurgency. Your primary weapon against the ninjas is a sickle. The game was converted for play on the Famicom, where you can collect various weapon upgrades, such as the ability to throw gold coins at the ninjas. The stage clearing goal differs slightly between the Famicom and arcade editions. In 2001, a reproduction of the Famicom game was packaged along with Super Arabian in Memorial Series: Sunsoft Vol. 1 for the PlayStation. | null | minipile | NaturalLanguage | mit | null |
Maple syrup might make you think of fall. Or pancakes. But sugaring season—that's when maple trees are tapped for their sap—begins right around now. And despite its breakfast-y nature, this amber-colored goodness has been used to sweeten cocktails since the olden days. Like simple syrup (sugar dissolved in water), maple balances out the sour elements of a drink that contains citrus. Unlike simple syrup, it also delivers a caramel-like depth and flavor.
It blends well with brown... | null | minipile | NaturalLanguage | mit | null |
Q:
LINQ: I have 3 tables and I want to make 2 join tables
I have three tables, Question, SubjectType and CoreValue.
Question table has many to many association to SubjectType table and CoreValue table.
I want to make 2 join tables: one between Question and SubjectType and one between Question and CoreValue.
How do I make sure that the Association tables with CoreValue FK and Question FK gets filled without inserting any values in Corevalue? CoreValue Table already have the values that is needed. I just need to be able to have FK on Question and Corevalue in same association table without inserting any data same goes to Question and SubjectType.
Thanks for advice!
Best Regards!
A:
Just create the tables as pure join tables in the database.
EF will generate a model with navigation properties (Question - SubjectTypes, and so on). You probably want to remove the associations SubjectType.Questions and CoreValue.Questions.
See also this tutorial (the Class-Student part).
| null | minipile | NaturalLanguage | mit | null |
Q:
SQL conditional update query
I have:
Table with columns A int, B int, C int
I need to build query like:
UPDATE
Table
SET
A -= B -- and then if A < 0 do A = C
Is it possible to do without cursor? If it is useful, I use MS SQL Server 2008.
A:
If I understood correctly this is what you're looking for
UPDATE
Table
SET
A = CASE
WHEN (A - B) < 0 THEN
C
ELSE
(A - B)
END
| null | minipile | NaturalLanguage | mit | null |
John --
I have escalated
Paige
-----Original Message-----
From: Griffith, John
Sent: Wednesday, February 06, 2002 10:39 AM
To: UBSW Energy Storage Security
Cc: Cox, Paige; Quigley, Dutch
Subject: New Folder to be set up
I need to have a new folder set up under the new O drive, it is as follows:
O:\Financial_Trading
I should be listed as owner. Also, please give the following people read and write access to these folders:
Mike Maggi
John Lavarato
Dutch Quigley
Larry May
Jeb Ligums
Andy Zipper
Thanks for you help. I need these set up as soon as possible. Please call with any questions or concerns.
John Griffith
(713) 853-6247 | null | minipile | NaturalLanguage | mit | null |
Patriots fans and Rams fans weren’t joking when they told us Chris Long is a pretty funny guy. The new Philadelphia Eagles defensive end already has a plan to show off his humor this season. Check out what Long had to say in an appearance on Barstool’s “Pardon My Take” podcast.
Q: You’re a big fan of standing next to people on sidelines, and then having your name and there last name mean something. You’ve got kind of you pick of the litter on the Eagles. I was looking at the roster, you can either go …
Long: Smallwood, Cox, yep.
Q: Long Smallwood, Long Cox, or Long Johnson. Which one are you going to go with?
Long: I forgot about Lane Johnson. I would think you wanna, you wanna always be sitting next to your d-line buddy. I think me and Fletcher will make a lot of plays together, so hopefully, we’re probably going to be in the d-line huddle a lot. You can figure that one out. […] I will always be sitting to the left of Fletch on the bench. | null | minipile | NaturalLanguage | mit | null |
No. 2--03--0019
______________________________________________________________________________
IN THE
APPELLATE COURT OF ILLINOIS
SECOND DISTRICT
______________________________________________________________________________
In re
ROLANDIS G., ) Appeal from the Circuit Court
) of Winnebago County.
a Minor )
) No. 02--JD--249
)
(The People of the State of Illinois, ) Honorable
Petitioner-Appellee, v. Rolandis G., ) Steven M. Nash,
Respondent-Appellant). ) Judge, Presiding.
______________________________________________________________________________
JUSTICE GROMETER delivered the opinion of the court:
Respondent, Rolandis G., was adjudicated a delinquent juvenile after the trial court found that he committed aggravated criminal sexual assault (720 ILCS 5/12--14(b)(i) (West 2002)). Respondent appeals, contending that the trial court erred by admitting, pursuant to section 115--10 of the Code of Criminal Procedure of 1963 (725 ILCS 5/115--10 (West 2002)), out-of-court statements the seven-year-old victim made to his mother, a police detective, and a child abuse investigator. Respondent contends that (1) the court erred in finding that the victim was "available to testify" where he answered a few preliminary questions but refused to talk about the alleged offense; (2) the State failed to introduce evidence to corroborate the out-of-court statements; and (3) under
Crawford v. Washington
, 541 U.S. ___, 158 L. Ed. 2d 177, 124 S. Ct. 1354 (2004), section 115--10 violates the confrontation clause of the United States Constitution (U.S. const., amend. VI) to the extent that it permits introduction of a "testimonial" out-of-court statement where the accused did not have an opportunity to cross-examine the declarant. We agree with respondent's third argument and hold that the victim's statements to the officer and the child abuse investigator were inadmissible under
Crawford
. However, we hold that the victim's statements to his mother were not testimonial and that the State introduced sufficient corroborating evidence to make them admissible even though the victim was unavailable to testify. Accordingly, we reverse the delinquency adjudication and remand the cause for a new hearing.
Before the adjudicatory hearing, the State moved to admit, pursuant to section 115--10, three out-of-court statements by the victim. The trial court stated that it would not hold a separate hearing to decide if the statements were reliable, but would consider that issue during the trial.
The State's first witness was the alleged victim, V.J. V.J. testified that he was seven years old, lived with his mother and two siblings in Rockford, attended school, and sometimes played outside with his neighborhood friends. He indicated that he knew respondent, but did not respond when asked how he knew respondent or whether he played with him during the summer of 2002. He refused to answer any more questions.
V.J.'s mother, Jacqueline M., testified that respondent used to live in her neighborhood and often visited her home. Respondent was with V.J. on June 25, 2002, the date of the alleged assault. On that day, V.J. left home at about 11 a.m. to play with friends. He returned about an hour later with respondent. Respondent left after V.J. told him he was going to stay home. Jacqueline thought it was unusual for V.J. to stay in the house on a summer day.
After respondent left, V.J. went to the bathroom, where he was "spitting in the sink" and rinsing his mouth with water. Jacqueline thought this was unusual, so she asked V.J. whether he was thirsty. He responded that he was not, but that his throat was hot. V.J. then left the bathroom, walked around the house for awhile, then returned to the bathroom and again tried to rinse out his mouth. Jacqueline continued questioning V.J. about his unusual behavior, but he said only that his mouth was "hot." In response to further questioning, he said that he was not going back outside. Finally, about a minute later, V.J. said that respondent made him "suck his dick" in the woods near their home. V.J. said that respondent threatened him with a stick but never hit him with it. Jacqueline called the police.
Officer Robert Cure testified that he responded to Jacqueline's call and spoke to V.J. According to Cure, V.J. told him that respondent made him perform fellatio near some bushes outside his home. He said that respondent carried a stick, that V.J. "choked on [respondent's] dick," that some type of yellow fluid came out, and that he immediately went home to wash his mouth out.
One week after the incident, Jackie Weber from the Carrie Lynn Center, a child advocacy center, interviewed V.J. Detective Paul Swanberg watched the interview through a two-way mirror. Swanberg testified that V.J. told Weber that respondent had threatened him with a stick into performing fellatio while they were in the woods and that a "little pee" entered V.J.'s mouth. According to Swanberg, V.J. told Weber that respondent made him perform fellatio twice, that respondent made V.J. "suck his nuts," and that respondent touched V.J.'s penis and buttocks. V.J. also told Weber that he had previously engaged in similar conduct with a friend named Junior.
After a short recess, V.J. again refused to testify about the incident. The State rested its case. The parties then argued whether V.J.'s out-of-court statements to Jacqueline, Cure, and Weber were admissible. Respondent argued that section 115--10 requires that, for statements to be admissible, either the declarant must be unavailable to testify or the State must introduce corroborating evidence. Respondent contended that V.J. was unavailable because he did not testify about the alleged abuse. The State argued that V.J. was available because he took the witness stand and gave some testimony. The court agreed with the State and, after considering other factors affecting their reliability, ruled that all of V.J.'s out-of-court statements were admissible. Respondent testified and denied sexually assaulting V.J.
The court found that respondent had committed aggravated criminal sexual assault, declared him a delinquent minor, and sentenced him to five years' probation. Respondent timely appeals.
Respondent contends that the trial court erred in finding the victim was available to testify where he gave some basic background information but did not talk about the alleged sexual assault. He further argues that, because the victim was unavailable, the State had to introduce evidence corroborating the out-of-court statements, but did not do so. In a supplemental brief, respondent argues that under
Crawford
, "testimonial" out-of-court statements by an unavailable declarant may not be admitted in a criminal trial unless the declarant was subject to cross-examination when he gave the statements. Respondent argues that section 115--10 is unconstitutional to the extent that it allows such statements to be admitted. Because this argument is potentially dispositive, we discuss it first.
Section 115--10 provides that in a prosecution for a physical or sexual act committed against a child less than 13 years old, testimony about an out-of-court statement made by the victim concerning the offense is admissible if:
"(1) The court finds in a hearing conducted outside the presence of the jury that the time, content, and circumstances of the statement provide sufficient safeguards of reliability; and
(2) The child *** either:
(A) testifies at the proceeding; or
(B) is unavailable as a witness and there is corroborative evidence of the act
which is the subject of the statement[.]" 725 ILCS 5/115--10(b) (West 2002).
The sixth amendment provides that "[i]n all criminal prosecutions, the accused shall enjoy the right *** to be confronted with the witnesses against him." U.S. Const., amend. VI. In
Crawford
, the Court held that the confrontation clause contemplates nothing less than an opportunity for cross-examination. Accordingly, "testimonial" hearsay is inadmissible unless the declarant is shown to be unavailable and the accused had a prior opportunity for cross-examination.
Crawford
, 541 U.S. at ___, ___, 158 L. Ed. 2d at 193, 203, 124 S. Ct. at 1364, 1374 (2004). In so holding, the Court abrogated the holding in
Ohio v. Roberts
, 448 U.S. 56, 65 L. Ed. 2d 597, 100 S. Ct. 2531 (1980), that an unavailable witness's statement may be admitted as long as it bears adequate indicia of reliability.
Crawford
, 541 U.S. at ___, 158 L. Ed. 2d at 199, 124 S. Ct. at 1370.
The Court did not provide an all-inclusive definition of "testimonial," but stated that "[s]tatements taken by police officers in the course of interrogations are also testimonial under even a narrow standard."
Crawford
, 541 U.S. at ___, 158 L. Ed. 2d at 193, 124 L. Ed. 2d at 1364. Later, the Court stated as follows:
"We leave for another day any effort to spell out a comprehensive definition of 'testimonial.' Whatever else the term covers, it applies at a minimum to prior testimony at a preliminary hearing, before a grand jury, or at a former trial; and to police interrogations."
Crawford
, 541 U.S. at ___, 158 L. Ed. 2d at 203, 124 S. Ct. at 1374.
The Court also did not define "interrogation." The statement at issue was taken from the defendant's wife at a time when she was a suspect in the case as well. Thus, it could be argued that "interrogation" refers only to formal questioning of a suspect in custody. See
Miranda v. Arizona
,
384 U.S. 436, 16 L. Ed. 2d 694, 86 S. Ct. 1602
(1966)
. However,
Crawford
made clear that it used "the term 'interrogation' in its colloquial, rather than any technical legal, sense."
Crawford
, 541 U.S. at ___ n.4, 158 L. Ed. 2d at 194 n.4, 124 S. Ct. at 1365 n.4. The common definition of "interrogate" is "to question formally and systematically." Merriam-Webster's Collegiate Dictionary 611 (10th ed. 2001).
The First District recently applied
Crawford
in a case with nearly identical facts. In
In re T.T.
, No. 1--03--0551 (August 20, 2004), the nine-year-old sexual abuse victim testified about some background information, but refused to answer specific questions about the abuse. The trial court declared her unavailable. The court admitted, pursuant to section 115--10, the victim's statements to a police officer and a Department of Children and Family Services (DCFS) investigator.
On appeal, the court affirmed the trial court's ruling that the witness was unavailable (
T.T.
, slip op. at 9-10), but held that, under
Crawford
, the majority of the victim's out-of-court statements should not have been admitted (
T.T.
, slip op. at 14-15). On the latter issue, the court noted that although
Crawford
did not define "testimonial," it held that the term applied " 'at a minimum to *** police interrogations.' "
T.T.
, slip op. at 11, quoting
Crawford
, 541 U.S. at ___, 158 L. Ed. 2d at 203, 124 S. Ct. at 1374. Thus, the witness's statement knowingly given in response to structured police questioning in
Crawford
was testimonial under any conceivable definition.
T.T.
, slip op. at 13, citing
Crawford
, 541 U.S. at ___ n.4, 158 L. Ed. 2d at 194 n.4, 124 S. Ct. at 1365 n.4. In light of these definitions, the
T.T.
court concluded that the victim's accusatory statements to the officer naming the respondent as the perpetrator qualified as testimonial.
T.T.
, slip op. at 13.
The court also held that the victim's statements to a DCFS investigator were testimonial. The investigator interviewed the victim, who accused the respondent of abusing her. The court recognized that child abuse has both criminal and "social welfare" implications, so that DCFS and the State's Attorney's office may share involvement in a given case.
T.T.
, slip op. at 14. The court held that in the context of the confrontation clause, "where the focus is on whether the declarant is bearing witness against a criminal defendant when making a formal statement to a government officer with an eye toward prosecution," the victim's statements are testimonial.
T.T.
, slip op. at 15.
We agree with
T.T.
's analysis of the confrontation clause issues. Accordingly, we are constrained to hold that V.J.'s statements to Officer Cure were testimonial. They were the result of formal and systematic questioning by Cure, who was investigating a report of a sexual assault. Similarly, the statements to Weber, a child advocacy worker, were testimonial. They also came in response to formal questioning, with a police officer watching through a two-way mirror. Needless to say, respondent did not have the opportunity to cross-examine the declarant when he gave these statements. Accordingly, under
Crawford
, they should not have been admitted. To the extent section 115--10 permits the introduction of such statements, it is unconstitutional. We note that section 115--10 tracks closely the "indicia of reliability" language from
Ohio v. Roberts
that
Crawford
repudiated.
The State contends that V.J.'s statements to Cure and Weber were not testimonial under
Crawford
. The State cites the Court's reference to the historical definition of "testimony" as " '[a] solemn declaration or affirmation made for the purpose of establishing or proving some fact.' "
Crawford
, 541 U.S. at ___, 158 L. Ed. 2d at 193, 124 S. Ct. at 1364, quoting 1 N. Webster, An American Dictionary of the English Language (1828). The State also cites the Court's statement that testimonial statements are those " 'that were made under circumstances which would lead an objective witness reasonably to believe that the statement would be available for use at a later trial.' "
Crawford
, 541 U.S. at ___, 158 L. Ed. 2d at 193, 124 S. Ct. at 1364, quoting Brief for National Association of Criminal Defense Lawyers as
Amici Curiae
3. Noting the victim's young age, the State argues that these definitions "impl[y] a thought process and level of intent that is not consistent with the statements of very young children." We disagree.
As the State acknowledges,
Crawford
concludes its discussion of the definition of "testimonial" by stating that "[w]hatever else the term covers, it applies at a minimum to *** police interrogations."
Crawford
,
541 U.S. at ___, 158 L. Ed. 2d at 203, 124 S. Ct. at 1374. It is apparent that the Court's further attempts at defining the term are meant to expand the definition of what is a testimonial statement, not to limit or qualify the specific examples given. The phrasing of the statement the State quotes, referring to "circumstances that would lead an objective witness reasonably to believe" that the statement would later be used at a trial, show that the Court's focus was on the objective circumstances surrounding the statement, not on the declarant's subjective understanding.
Moreover, the focus of the opinion is on a defendant's right to confront the witnesses against him. Accordingly, a defendant's confrontation right should not depend on whether the maker of an out-of-court statement subjectively understood that the statement might be used at a later trial.
(footnote: 1) A definition of "testimonial" that turned solely on the subjective knowledge or intent of the declarant would be both unfair and unworkable. Given that the declarant must be unavailable for the confrontation clause issue to come into play, how would the speaker's subjective understanding be determined? Indeed, the State does not point to any specific facts to show what V.J. understood about the purpose of the interviews. The State merely speculates about the "thought process" of young children generally. The objective circumstances surrounding V.J.'s statements to Cure and Weber show that they were testimonial.
This does not end our inquiry, however. Although the victim's statements to Cure and Weber should have been excluded, his statements to his mother were not testimonial. These statements were more in the nature of a "casual remark to an acquaintance" that the Court implied would not be testimonial.
Crawford
, 541 U.S. at ___, 158 L. Ed. 2d at 192, 124 S. Ct. at 1364. Jacqueline merely noticed that her son was behaving strangely and attempted to ascertain what was wrong. There is no indication that she suspected he had been the victim of a crime and that she was attempting to elicit evidence for a future prosecution.
Respondent concedes that the victim's statements to his mother were not testimonial. He nonetheless maintains that they should have been excluded under section 115--10 because the declarant was unavailable and the State did not present corroborating evidence. A
decision to admit evidence under section
115--10 will
not be reversed unless the trial court abused its discretion.
People v. Williams
, 193 Ill. 2d 306, 342-43 (2000).
We agree with respondent that the declarant was unavailable, even though he gave some preliminary testimony. In
People v. Coleman
, 205 Ill. App. 3d 567, 583 (1990), the court held that a child witness became unavailable for purposes of section 115--10 when she testified that the defendant had given her a "bad touch" but then she "froze up" and refused to discuss details of the incident. The court stated, "Once a child witness is unable to proceed with his or her testimony, whether that point occurred prior to taking the stand or subsequently, he or she is properly considered unavailable."
Coleman
, 205 Ill. App. 3d at 583. A similar situation occurred in
People v. Embry
, 249 Ill. App. 3d 750 (1993), where a young victim took the stand and answered some preliminary questions before he froze up. The court implicitly found that the young witness was unavailable, but found that the State had introduced sufficient corroborating evidence.
Embry
, 249 Ill. App. 3d at 760-61.
We agree with these cases. The obvious purpose of the distinction between an available and an unavailable witness is that in the former case the defendant is able to cross-examine the witness, which is sufficient to test the reliability of the statements. In the latter case, the defendant has no chance to cross-examine, so the State must introduce evidence to corroborate the statements in order to enhance their reliability. From the standpoint of the defendant's ability to cross-examine the witness, it makes no difference whether he becomes "unavailable" before or after he takes the witness stand. See
Coleman
, 205 Ill. App. 3d at 583. Therefore, V.J. should have been found to be unavailable after he was unable to continue his testimony.
Although V.J. was unavailable, his out-of-court statements to his mother were still admissible if the State introduced corroborating evidence. 725 ILCS 5/115--10(b) (West 2002). We agree with the State that it did so here.
As respondent concedes, to corroborate means only " 'to add weight or credibility to a thing by additional and confirming facts or evidence' " (
People v. Alba
, 185 Ill. App. 3d 286, 290 (1989), quoting
In re Custody of Brunken
, 139 Ill. App. 3d 232, 239 (1985)). Thus, corroborating evidence need not prove the commission of the crime beyond a reasonable doubt or make it overwhelmingly probable; it need only "add weight or credibility" to the out-of-court statements. Here, Jacqueline's testimony corroborated her son's account of the incident.
Initially, Jacqueline corroborated the fact that V.J. was with respondent on the day in question. (Respondent's testimony confirmed as much.) Further, Jacqueline testified that immediately after parting company with respondent, V.J. behaved strangely. He did not want to go back outside on a summer day, which was unusual. He tried several times to rinse out his mouth and was evasive when asked to explain this conduct. Thus, Jacqueline's testimony about her own observations corroborated V.J.'s account that respondent forced him to perform fellatio.
Respondent's argument that other possible explanations exist for Jacqueline's observations is beside the point. The question is whether the evidence tends to corroborate V.J.'s statements. Respondent cites no authority for the premise that the corroborating evidence must be inconsistent with any other explanation.
We find that the victim's statements to his mother were properly admitted under section 115--10 and do not raise any confrontation clause issues. Moreover, the properly admitted evidence was sufficient to prove beyond a reasonable doubt that respondent committed the offense. See
People v. Taylor
, 76 Ill. 2d 289, 309 (1979). Therefore, we reverse the delinquency adjudication and remand the cause to the circuit court of Winnebago County for a new hearing.
Reversed and remanded.
O'MALLEY, P.J., and CALLUM, J., concur.
FOOTNOTES
1:1
Of course, a declarant's subjective understanding might be relevant in some cases, such as where the circumstances surrounding the statement are ambiguous. A statement made during an informal conversation with a police officer might be such a case. However, the State does not suggest that this case presents such a situation.
| null | minipile | NaturalLanguage | mit | null |
Morphological adaptations of benthic invertebrates to stream flow - An old question studied by means of a new technique (Laser Doppler Anemometry).
The generally accepted concept that dorsoventral flatness and/or small size of benthic stream invertebrates staying on the surface of the bottom substratum allows a current-sheltered life in the boundary layer (Ambühl 1959) is checked by means of the new technique of Laser Doppler Anemometry (LDA). With LDA measurement of flow can be done nearly punctually without any mechanical disturbance. Mapping the current velocities around the body of Ecdyonurus cf. venosus (Insecta, Ephemeroptera) and Ancylus fluviatilis (Gastropoda) gives evidence that boundary layer separation occurs above the animals' bodies. Our results indicate that the velocities around the body of benthic stream invertebrates and probably the forces acting on them are much more complicate than is suggested by the currently accepted boundary layer concept. | null | minipile | NaturalLanguage | mit | null |
Rotary printing machines which have cylinders with axial grooves are subjects to shocks and vibration. When two cylinder grooves of printing cylinders, for example rubber blanket cylinders of an offset machine run off against each other, a shock or impact results which, on the printed subject matter, may be noticed as a strip of different intensity of inking. This problem arises particularly in modern high-speed rotary printing machines. It has been proposed to cover the cylinder groove--see the referenced U.S. Pat. No. 4,403,549, Matuschke. Other proposals have been made to dampen impacts and shocks which impair the quality of the printed subject matter. Fillers as known heretofore usually extended over the entire length of the cylinder groove. This causes difficulty in handling the machine or machine set-up; in manufacture, also, difficulties arise and such fillers may become expensive, particularly with long cylinders. Some improvement was obtained, although further improvement still is desirable. | null | minipile | NaturalLanguage | mit | null |
Incidence of operative endoscopy findings in recurrent croup.
Develop an evidence-based model for predicting operative endoscopy findings in patients with recurrent croup. Case series with chart review. Tertiary care children's hospital. Retrospective chart review was performed on 124 patients who received consultation for recurrent croup between 2000 and 2009. Direct laryngoscopy and bronchoscopy findings were categorized as normal, mildly abnormal (incidental findings or grade I subglottic stenosis), moderately abnormal (grade II subglottic stenosis), or severely abnormal (grade III-IV subglottic stenosis). Of 124 consultations for recurrent croup, 81 patients (average age 3.5 years) underwent operative endoscopy. Normal examinations occurred in 33 of 81 (41%). Abnormal findings were encountered with the following frequency: mildly abnormal, 40 of 81 (49%); moderately abnormal, 6 of 81 (7.5%); and severely abnormal, 2 of 81 (2.5%). Relative risk (RR) of either moderately abnormal or severely abnormal findings was increased for patients who had a history of previous intubation (RR = 9.8; P = .002), prematurity (RR = 6.4; P = .01), or inpatient consultation (RR = 5.3; P = .028). The rate of moderately or severely abnormal findings in patients without the risk factors of intubation and age younger than 1 year was 0 of 48 (0%; confidence interval, 0%-7.4%). Mild abnormalities in this group were encountered in 27 of 48 (56%). Mild airway abnormalities are common in children with recurrent croup and cannot be ruled out based on history. In the absence the risk factors of previous intubation, age younger than 1 year, or inpatient consultation, the incidence of a significantly abnormal finding is quite low. A predictive model based on this evidence is discussed. | null | minipile | NaturalLanguage | mit | null |
Libya conflict: Niger border 'cannot be closed' Published duration 7 September 2011
image caption Mohamed Bazoum said Niger did not have the means to close the border
Niger's foreign minister says his country is unable to close its border with Libya to prevent fugitive Libyan leader Muammar Gaddafi fleeing south.
Foreign Minister Mohamed Bazoum told the BBC that Col Gaddafi had not crossed the border or asked to cross.
He said Gaddafi loyalists who have arrived in Niger's capital, Niamey, would be free to stay or move on.
Libya's transitional authorities have said they are seeking Niger's help to stop Col Gaddafi from fleeing.
Political Affairs head Fathi Baja said the National Transitional Council (NTC) had sent a delegation to Niger to discuss "securing our borders to stop any kind of infiltration of Gaddafi troops to Niger, to stop any attempt by Gaddafi or his family to escape to Niger".
Asked if Niger might close its border, Mr Bazoum said: "We have no means to close the border... It is too big and we have very, very small means for that."
He said he hoped that Col Gaddafi would not try to cross the border, but that Niger had not yet taken any decision on whether it would accept him - or whether it would hand him over to the International Criminal Court (ICC) - if he did attempt to enter Niger.
Niger recognises the ICC, which is seeking the arrest of Col Gaddafi, his son Saif al-Islam, and his former intelligence chief Abdullah Sanussi.
'Humanitarian' gesture
Mr Bazoum said at least three convoys had crossed from Libya into Niger, and that none of Col Gaddafi's sons was travelling in them.
Officials in Niger have said Col Gaddafi's security chief, Mansour Daw, was among those who entered the country in the convoys over the weekend or on Monday.
"We told them that we can accept them to stay for humanitarian reasons, but they have to respect what the international law allows them to do or [does] not allow them to do," said Mr Bazoum.
He added that those who had arrived from Libya - of whom there were fewer than 20 - were free to stay in Niamey, or to continue to Burkina Faso.
Burkina Faso - which borders Niger to the south-west - has denied reports that it had offered to welcome Col Gaddafi.
Mr Baji said the NTC would ask Niger to send any Gaddafi aides back to Libya. He also said people in the area had reported seeing gold and money in the convoys that drove to Niger.
"If that happened, we want that money back," AFP news agency quoted him as saying.
A US state department spokeswoman, Victoria Nuland, called on countries bordering Libya to the south to "make every effort to control their borders".
"We have strongly urged the Nigerien officials to detain those members of the regime who may be subject to prosecution, to ensure that they confiscate any weapons that are found, and to ensure that any state property of the government of Libya - money, jewels, etc - also be impounded so that it can be returned to the Libyan people," she said.
On Wednesday, a teenaged girl detained in Tripoli after accusations that she executed 11 people claimed that Mansour Daw had raped her.
She told the BBC she had been forced to shoot prisoners with a rifle.
Loyalist strongholds
Col Gaddafi's wife, two of his sons and his daughter fled to Algeria last week.
His own whereabouts remain the subject of speculation - though rebels say they believe he is still in Libya.
Senior Western officials say they have no information about where Col Gaddafi may be, but have no indication he has left the country.
A Nato spokesman, Col Roland Lavoie, told the BBC that Col Gaddafi was not a target, but Nato would continue to strike "command and control centres".
"If we have intelligence revealing that from a specific location attacks are being co-ordinated or communications are being received or sent to conduct attacks or the threat of attacks, we would take action," he said.
The NTC has been trying to negotiate a peaceful resolution to stand-offs in a handful of Libyan towns or cities still controlled by Gaddafi loyalists.
These include Bani Walid, Jufra, Sabha and Col Gaddafi's birthplace of Sirte. | null | minipile | NaturalLanguage | mit | null |
Preterm neonates are vulnerable to changes in blood gases. This e-learning course focuses on transcutaneous monitoring (TCM) and blood gases in the NICU and PICU and demonstrates how TCM is a valuable part of a personalised patient monitoring approach.
This multi-media and interactive medical education online e-learning will take neonatal, paediatric specialists, nurses and respiratory therapists on a journey demonstrating;
• How TCM fits in the wider picture of blood gas monitoring, • The added value of TCM parameters • Indications for TCM as well as its practical application • How to interpret TCM results and act upon them
Developed by a recognised group of international neonatologists and pediatricians.
Accredited by the European Accreditation Council for Continuing Medical Education (EACCME®) whose system of credits are recognised by AMA and the Royal College of Physicians and Surgeons of Canada.
Downloadable slides are available for your own purposes on the COR2ED e-learning portal, checkpoint.cor2ed.com. | null | minipile | NaturalLanguage | mit | null |
New inhibitors of dihydroorotate dehydrogenase (DHODH) based on the 4-hydroxy-1,2,5-oxadiazol-3-yl (hydroxyfurazanyl) scaffold.
Based on some structural analogies with leflunomide and brequinar, two well-known inhibitors of dihydroorotate dehydrogenase (DHODH), a new series of products was designed, by joining the substituted biphenyl moiety to the 4-hydroxy-1,2,5-oxadiazol-3-yl scaffold through an amide bridge. The compounds were studied for their DHODH inhibitory activity on rat liver mitochondrial/microsomal membranes. The activity was found to be closely dependent on the substitution pattern at the biphenyl system; the most potent products were those bearing two or four fluorine atoms at the phenyl adjacent to the oxadiazole ring. A molecular modeling study suggested that these structures might have a brequinar-like binding mode. The greater potency of fluorinated analogs may depend partly on enhanced interactions with the hydrophobic ubiquinone channel, and partly on the role of fluorine in stabilizing the putative bioactive conformation. | null | minipile | NaturalLanguage | mit | null |
If it's wired to the house system it's on any time we're underway.. Back when we had a handheld, we'd sometimes spot-check it to preserve batteries.
Truth is, most of our navigation here is piloting visually amongst islands and channels and really the plotter is rarely 'necessary'.. but it's nice to have, and I find the record of progress made/distance remaining useful and more informative than 'I think that island looks closer now'.
With their recent advances like tidal predictions and current info they are more helpful still.
But in the end, as many say, ultimately rely on the 'mark I eyeball'. Goes without saying, too, that proper paper charts are on board as well.
Mine is a portable Garmin GPSMAP 478. It is on whenever I am under way - provided that I remember to bring it with me to the boat. Like Faster, I use it to show my SOG, review where I went, and where I found that uncharted rock...
While cruising for extended periods how often is your chartplotter powered up? Do you leave it on all of the time or do you turn it on to check your position and then turn it back off?
I leave it on all the time. Mine is integrated to AIS and Sirius weather with weather alerts so there's a constant stream of chatter and warnings popping up. Extended periods for our cruising in the Great Lakes mean segments of 12 to 48 hours, not more than a couple days. Might be different if the rhumb line was 6 days.
As a Raymarine product, it has the curious feature of sometimes rebooting itself at arbitrary times, on average about once every 36 hours. After returning to Raymarine several times and being replaced once, I've resigned myself to acknowledging this as an inescapable attribute of the product.
On most all the time. It is my second source for depth(sonar) and also has AIS and radar. I frequently scan for AIS sigs and that the spot sounding agree with my depth instruments. That being said, I also always have a chart book next to me.
Ours goes on before the anchor is pulled and off about an hour after the anchor is set, to check for any dragging. If the wind is above 25 or 30 knots, or we are unsure of the anchor, it goes on, with the anchor drag alarm set. We have a second one in the aft cabin which also doubles to monitor the boat and the helmsman, and an anchor alarm (or proximity alarm with the networked radar under way) while sleeping.
It not only supplies a very accurate chart (at least for everywhere we've been), it supplies speed, X-track error, course made good and several other things I like to know while sailing and especially in areas where the currents are irregular. Why in the world would anyone turn such a handy piece of expensive equipment off, while underway?
Ours goes on before the anchor is pulled and off about an hour after the anchor is set, to check for any dragging. If the wind is above 25 or 30 knots, or we are unsure of the anchor, it goes on, with the anchor drag alarm set. We have a second one in the aft cabin which also doubles to monitor the boat and the helmsman, and an anchor alarm (or proximity alarm with the networked radar under way) while sleeping.
It not only supplies a very accurate chart (at least for everywhere we've been), it supplies speed, X-track error, course made good and several other things I like to know while sailing and especially in areas where the currents are irregular. Why in the world would anyone turn such a handy piece of expensive equipment off, while underway?
Well, to conserve power, perhaps? :-)
As usual, the answer for me is "It depends"... Primarily upon where I happen to be sailing at the moment, and of course whether I'm under sail, or under power...
I have 2 plotters on board, a smaller Simrad below, and a larger plotter/radar in the cockpit. The latter consumes a fair bit of power when running, so I'll usually only run it if I feel I really need it, when under sail...
The smaller one stays on most of the time underway. It is an older model, and is pretty slow to start up and acquire a fix, so whenever I'm anchored in a tricky spot, if there's any possibility I might have to bug out in a jiffy or in the middle of the night, it will stay on...
But on any passage of any real length, unless I need to be running radar, I'll try to use this stuff as little as possible... One advantage for me of having AIS integrated to the VHF, I don't have to be running a more power-hungry plotter to enjoy the benefits of AIS...
We have two. One at nav station one in cockpit. Cockpit only ever gets turned on when outside harbour. If I cannot sail around Sydney Harbour without a bloody plotter then its time for me to give it away.
On passage we'll have both running at night, cockpit only during the day.
If anchored in an uncomfortable spot then we'll leave one running overnight for anchor alarm.
The plotter, one of three, will be on in congested waters with the AIS integrated.
Off shore on passage the plotter is off unless I am asleep (to allow the AIS alarm). Before AIS the plotter was on a couple of times per day, or when my ex was onboard at the end of each watch to not position.
I dont use paper charts as I think they are obsolete, unsafe and will be outlawed within some period of years.
By choosing to post the reply above you agree to the rules you agreed to when joining Sailnet.
Click Here to view those rules.
Register Now
In order to be able to post messages on the SailNet Community forums, you must first register. Please enter your desired user name, your email address and other required details in the form below.Please note: After entering 3 characters a list of Usernames already in use will appear and the list will disappear once a valid Username is entered.
User Name:
Password
Please enter a password for your user account. Note that passwords are case-sensitive.
Password:
Confirm Password:
Email Address
Please enter a valid email address for yourself.
Email Address:
Log-in
User Name
Remember Me?
Password
Human Verification
In order to verify that you are a human and not a spam bot, please enter the answer into the following box below based on the instructions contained in the graphic. | null | minipile | NaturalLanguage | mit | null |
"Filed out from Dolphin Smalltalk 7"!
RegularPolygon subclass: #Triangle
instanceVariableNames: ''
classVariableNames: ''
poolDictionaries: ''
classInstanceVariableNames: ''!
Triangle guid: (GUID fromString: '{87b4c683-026e-11d3-9fd7-00a0cc3e4a32}')!
Triangle comment: 'A Triangle is a particular type of <PlayShape> that may be added to a <Playground>. It is part of the Playground sample package used as a Smalltalk learning aid. See this package''s comment for more details.'!
!Triangle categoriesForClass!Samples! !
!Triangle methodsFor!
defaultColor
"Answer a default background color for the receiver.
Let's make Trangles yellow to start with."
^Color yellow!
defaultPosition
"Answer a default position for the centre of the receiver."
^200 @ 200!
defaultSides
"Answer a default number of sides for the receiver.
Triangles have 3 sides"
^3! !
!Triangle categoriesFor: #defaultColor!constants!public! !
!Triangle categoriesFor: #defaultPosition!constants!public! !
!Triangle categoriesFor: #defaultSides!constants!public! !
| null | minipile | NaturalLanguage | mit | null |
Bioshock Infinite - Burial at Sea First 5 Minutes
by Couchpotato, 2013-10-09 00:47:25
Irrational Gameshas released a new video showing off the first five minutes of it's next DLC Burial at Sea for Bioshock Infinite.
Watch the first 5 minutes of BioShock Infinite: Burial at Sea - Episode One. Come back to Rapture in a story that finds Booker and Elizabeth on the eve of the underwater city's fall from grace. Get a taste of Rapture in its full glory, almost entirely built from scratch in the BioShock Infinite engine. | null | minipile | NaturalLanguage | mit | null |
Anaphylaxis associated with the vaccine against measles, mumps and rubella.
A case-control study was carried out aiming to describe the cases and causes of anaphylaxis associated with the vaccine against measles, mumps and rubella. A total of 22 reported cases in children who showed mucocutaneous manifestations, during the Campanha Nacional de Vacinação (Brazilian Vaccination Campaign), conducted in the city of Curitiba, Southern Brazil, in 2004, were studied. In addition, 66 children, who were next to these cases and did not show a symptomatology after the vaccine was applied, were selected. Serum measurements of antibodies for vaccine antigens and total IgE, specific IgE antibody measurements for several allergens, and skin tests were performed. Vaccine response was adequate, specific IgE measurement and skin tests showed that potential allergens in vaccines and atopy were not associated with anaphylactic reactions. Skin tests with the vaccine and dextran were positive in the cases exclusively, suggesting sensitization to certain residual components of the vaccine and possible cross-reaction with dextran. | null | minipile | NaturalLanguage | mit | null |
Q:
How to configure JAXB so it trims whitespaces by default
I would like to configure JAXB so that it trims whitespaces on all string fields
I saw the following answer : How to configure JAXB so it trims whitespaces when unmarshalling tag value?
But I do not want to have to annotate all string fields as per the suggested answer
@XmlElement(required=true)
@XmlJavaTypeAdapter(MyNormalizedStringAdapter.class)
String name;
Thanks!
A:
Create a XmlAdapter.
package com.foo.bar;
public class StringTrimAdapter extends XmlAdapter<String, String> {
@Override
public String unmarshal(String v) throws Exception {
if (v == null)
return null;
return v.trim();
}
@Override
public String marshal(String v) throws Exception {
if (v == null)
return null;
return v.trim();
}
}
Create a package-info.java file in com.foo.bar.
Add the following to the package-info.java file
@XmlJavaTypeAdapter(value=StringTrimAdapter.class,type=String.class)
package com.foo.bar;
import javax.xml.bind.annotation.adapters.XmlJavaTypeAdapter;
This will apply StringTrimAdapter to all String fields in com.foo.bar without any extra annotations.
EDIT
Do note that if the package level annotation is too expansive for you, you could always apply a @XmlJavaTypeAdapter annotation to classes.
A:
It might be worth mentioning, that in addition to writing an XmlAdapter, which performs the trimming, you can configure XJC to actually use this adapter in generated code. An example of how to do it:
<jaxb:globalBindings>
<xjc:javaType
name="java.lang.String"
xmlType="xs:string"
adapter="com.foo.bar.StringTrimAdapter"/>
</jaxb:globalBindings>
The above example uses the XmlAdapter given in Sahil's answer
| null | minipile | NaturalLanguage | mit | null |
More than 90 per cent of young Afghan men in southern provinces home to sustained fighting between U.S. and Taliban forces do not know about "this event which the foreigners call 9/11," The Wall Street Journal reported Thursday.
According to a survey of 1,000 15 to 30-year-old men in Kandahar and Helmand -- where U.S. President Barack Obama sent the bulk of American surge troops -- 92 percent of respondents said they were unaware of 9/11 after being read a three-paragraph description of the attacks.
"Nobody explained to them the 9/11 story -- and it's hard to win the hearts and minds of the fighting-age males in Helmand if they don't even know why the foreigners are here," said Norine MacDonald, president of the International Council on Security and Development, which conducted the survey.
"There is a vacuum -- and it's being filled by Al Qaeda and Taliban propaganda claiming that we are here to destroy Islam."
The events of September 11, 2001, are known to educated Afghans, but elsewhere in a predominantly rural country where 42 percent of the population is under the age of 14 and 72 percent of adults are illiterate, many people have never been told about the atrocity.
Even in the capital of Afghanistan, Kabul -- near the country's eastern border with Pakistan -- there are people who have never heard of the terror attack that led to their nation being invaded by Western armies, the Journal reported.
Teacher Mullah Said Nabi Agha, 22, was vaguely aware that some kind of explosion had occurred in America. "I was a child when it happened, and now I am an adult, and the Americans are still here," Agha said. "I think the Americans did it themselves, so they could invade Afghanistan."
Abdul Hakim Mujahid, the deputy chairman of the Afghan government's High Peace Council, a body created to negotiate a peaceful solution to the war, was in New York when the two jets struck the Twin Towers -- in his capacity as the Taliban regime's semi-official envoy to the U.S. and the United Nations.
While Mujahid said he was saddened by the attacks, he said he still does not believe Al Qaeda was responsible for "the unfortunate incident" -- and he added that after high hopes for change and prosperity when "the whole world rushed to Afghanistan," expectations have died and "the people are asking: When will the foreigners finally leave?" | null | minipile | NaturalLanguage | mit | null |
Lights, camera, infection: HACKERS get Bollywood makeover
Virus comedy-thriller but no sign of Angelina Jolie, boo
Common Topics
Bollywood producers have announced plans to make a malware-themed movie.
The comedy-thriller titled Mickey Virus is set in Delhi and the plot revolves around hackers and computer virus infections. The film, due out later this year, will reportedly star local TV anchorman Manish Paul in his big screen debut.
It's unclear how the song-and-dance numbers that are a hallmark of Bollywood will be woven into the flick. The actual business of computer security research involves poring over pages of disassembledcode and hexadecimal, fiddling with debuggers, late nights and many other activities that aren't particularly telegenic nor cinematic. Western TV and film about cybercrime are often off-base, preferring to summarise malware attacks with rapid bursts of typing followed by 3D animations indicating success.
Real-world computer crimes have inspired films: for example Subject: I love you was loosely based on the Love Bug worm outbreak. Instead of featuring global email server meltdown, as in real life, the film depicted the malware as a means for two young lovers to reunite.
"Let's hope that Mickey Virus does not glamourise or trivialise hacking and malware creation too much," said Graham Cluley, senior security consultant at Sophos, in a blog post about the upcoming flick. ® | null | minipile | NaturalLanguage | mit | null |
Overview
Litecoin (LTC) is a decentralized cryptocurrency used as a mode of payment. LTC transactions complete in an instant and incur almost zero transactions fees, which makes them faster and cheaper than Bitcoin (BTC) transactions. | null | minipile | NaturalLanguage | mit | null |
Imperial, Nebraska
Imperial is a city in Chase County, Nebraska, United States. The population was 2,071 at the 2010 census. It is the county seat of Chase County.
History
The original town of Imperial was built on land homesteaded by Thomas Mercier and M.J. Goodrich. These men gave a town lot to anyone who would put up a building and help to start the town. Mercier was the first postmaster and took office on December 14, 1885.
The railroad right of way was graded to Imperial in 1888. The railroad reached Imperial on August 15, 1892. It was built by a division of the Chicago, Burlington and Quincy Railroad. This line left the main line near Culbertson and terminated in Imperial.
When the grade was completed, the Lincoln Land Company gave lots to all those who would move their buildings to the "Railroad Addition". Nearly all of the buildings were moved south to the future railroad line and the present location of the business district of the town was established.
National Register of Historic Places listings
Balcony House (listed 2000), at the corner of 10th and Court Streets. One block west of Broadway on 10th Street
Chase County Court House (listed 1990), on Broadway between 9th and 10th Streets
Geography
According to the United States Census Bureau, the city has a total area of , all of it land.
Climate
Demographics
2010 census
As of the census of 2010, there were 2,071 people, 860 households, and 553 families residing in the city. The population density was . There were 948 housing units at an average density of . The racial makeup of the city was 88.3% White, 0.1% Native American, 0.1% Asian, 9.6% from other races, and 1.9% from two or more races. Hispanic or Latino of any race were 15.4% of the population.
There were 860 households of which 30.3% had children under the age of 18 living with them, 52.0% were married couples living together, 8.1% had a female householder with no husband present, 4.2% had a male householder with no wife present, and 35.7% were non-families. 31.4% of all households were made up of individuals and 16% had someone living alone who was 65 years of age or older. The average household size was 2.37 and the average family size was 2.97.
The median age in the city was 41 years. 25.2% of residents were under the age of 18; 7.3% were between the ages of 18 and 24; 22.4% were from 25 to 44; 26% were from 45 to 64; and 19.2% were 65 years of age or older. The gender makeup of the city was 48.9% male and 51.1% female.
2000 census
As of the census of 2000, there were 1,982 people, 807 households, and 547 families residing in the city. The population density was 787.2 people per square mile (303.7/km²). There were 887 housing units at an average density of 352.3 per square mile (135.9/km²). The racial makeup of the city was 97.88% White, 0.05% African American, 0.10% Native American, 0.15% Asian, 1.61% from other races, and 0.20% from two or more races. Hispanic or Latino of any race were 5.15% of the population.
There were 807 households out of which 32.1% had children under the age of 18 living with them, 57.9% were married couples living together, 6.9% had a female householder with no husband present, and 32.2% were non-families. 29.6% of all households were made up of individuals and 16.1% had someone living alone who was 65 years of age or older. The average household size was 2.38 and the average family size was 2.94.
In the city, the population was spread out with 26.0% under the age of 18, 6.6% from 18 to 24, 24.1% from 25 to 44, 21.6% from 45 to 64, and 21.6% who were 65 years of age or older. The median age was 41 years. For every 100 females, there were 93.4 males. For every 100 females age 18 and over, there were 89.2 males.
As of 2000 the median income for a household in the city was $33,833, and the median income for a family was $42,414. Males had a median income of $28,063 versus $19,405 for females. The per capita income for the city was $19,888. About 5.7% of families and 7.7% of the population were below the poverty line, including 5.0% of those under age 18 and 9.6% of those age 65 or over.
Notable people
Warren Prall Watters, founding archbishop of the Free Church of Antioch, was born in Imperial.
References
External links
City of Imperial
Category:Cities in Chase County, Nebraska
Category:Cities in Nebraska
Category:County seats in Nebraska | null | minipile | NaturalLanguage | mit | null |
rep • a • ra • tions
noun
1. The act of making amends
2. A policy to compensate an oppressed people for historic wrongs
“For two centuries the Negro was enslaved, and robbed of any wages — potential accrued wealth which would have been the legacy of his descendants.” —Martin Luther King Jr., in a 1965 Playboy interview with Alex Haley
Who are reparations for?
Many U.S. acts of violence have spurred calls for reparations, from the colonization of the Americas to the invasion of Iraq. In 1988, the U.S. government gave Japanese-American survivors of World War II internment camps a check for $20,000 each. But here we’ll focus on Black Americans, for whom reparations are most often discussed, for centuries of enslavement, Jim Crow, segregation, redlining and mass incarceration, among other wrongs.
So would all Black Americans just get a check?
Maybe. But many leading reparations scholars think the process should be more complex. Duke professor William A. Darity Jr., for instance, points out that, given most businesses are white-owned, the checks may just further increase wealth disparities. He thinks reparations money could instead fund institution building that supports “economic improvement within the black community.” The Southern Reparations Loan Fund (SRLF) puts that theory into practice by investing in cooperative businesses owned by Black and other marginalized groups.
The Movement for Black Lives (M4BL) platform has a broader vision: free college for all, a guaranteed minimum income for Black people, comprehensive Black history in school curricula and more. Black Lives Matter co-founder Patrisse Khan-Cullors is fond of saying any reparations package should also include a therapist.
But, c’mon, America’s way too racist for this, right?
Well, yes, there’s been some foot-dragging. Former U.S. Rep. John Conyers Jr. introduced a bill each year for almost 30 years simply calling for a commission to look into the idea. It’s never reached a vote. In the meantime, SRLF and other groups are moving forward on a smaller scale. Many of M4BL’s proposals require only local or state action.
On the Left, some reparations skeptics believe a race-blind economic platform can best boost the poor of all races. Many reparations advocates support a similar plan, and some of their demands (e.g., free college) would help everyone. But many also believe the playing field cannot be leveled — and the past cannot be reconciled— without addressing the specific harms to Black communities. “What I’m talking about is more than recompense,” wrote Ta-Nehisi Coates in his blockbuster 2014 Atlantic piece on reparations. “What is needed is a healing of the American psyche.”
This is part of “The Big Idea,” a monthly series offering brief introductions to progressive theories, policies, tools and strategies that can help us envision a world beyond capitalism. For recent In These Times coverage of reparations, see, “This Could Be Reparations’ Best Chance Since 1865,” “In No Uncertain Terms, U.N. Calls Out U.S. for Lack of Reparations to African Americans” and “How Activists Won Reparations for the Survivors of Chicago Police Department Torture.” | null | minipile | NaturalLanguage | mit | null |
Vasoconstriction in the renal vascular bed during exercise: studies in control and heart failure rabbits.
1. The effects of graded treadmill exercise on renal blood flow (RBF) were examined in seven rabbits, in which congestive heart failure (CHF) was produced by the administration of doxorubicin, 1 mg/kg, twice weekly for 8 weeks, and in seven controls. A third group of five rabbits underwent doxorubicin treatment with the addition of surgical section of the left renal sympathetic nerve. 2. During submaximal exercise, there was a small reduction in RBF in controls, which was greatly exaggerated in CHF. 3. In both control and heart failure rabbits, there was a precipitous fall in RBF as exercise fatigue developed. 4. Renal sympathectomy ablated these changes in RBF during exercise. 5. It is concluded that in heart failure there is an exaggerated, sympathetically mediated, diversion of blood flow away from the kidney. The onset of exercise fatigue in both normal and heart failure rabbits is accompanied by a marked intensification of this process. | null | minipile | NaturalLanguage | mit | null |
What happens when you go off creatine?
I asked this question before with another question and did not get a response. I am wondering what happens when you go off creatine. I'm taking it right now, but I'm not completely sure what happens after I quit taking it. A lot of people say that they lose all the weight they gained when they were on because it's just water weight. But people are always telling beginners how important it is to just stick to creatine and protein. Someone wanna help me out here?
I asked this question before with another question and did not get a response. I am wondering what happens when you go off creatine. I'm taking it right now, but I'm not completely sure what happens after I quit taking it. A lot of people say that they lose all the weight they gained when they were on because it's just water weight. But people are always telling beginners how important it is to just stick to creatine and protein. Someone wanna help me out here?
The main things that I notice when I cycle off is loss of muscular torque and loss of fullness in the muscle.
Stick to Kre-Alkaline.. There isn't much if any water retention.. When I cycled off I didn't notice anything (might have been a 3 lb loss of water at most but I'm not sure if it was from cycling off or something else)..
i think its all a bunch of bs, and ive never seen nething but a bunch of 1st time takin 115-280 lb benchers who say creatine works, no offense.
ull lose ur pride after u get off it, ull lose size, ull lose a lil strength, and ull waste ur damn time cuz its just a psychological booster, nothing more, nothing less, i betcha u train with me ill put 30 lbs on a newbies bench in a month.
and as far as cee, ive taken every legal supp in the book and thast got to be the biggest scam on the market, science wutever...i dont think or see it any diffrent than mono, and i think u dont get the blaot just cuz ur not taking an excessive amount of creatine or goign thru a ridiculous loading phase
i think the whole market is a scam and creatine mono is the only good REASONABLE form that is worth buying
ull just be like every other lifter who walks around wearing shirts to small for them with that fat bloated watery look thinking they put on ten lbs in a week, only to cut weight and still be 172
then ull come here and post on the forums saying it works ****ign up some other unlucky losers wallet, n convince them into buying a propietary blend of 1.5 grams of cee, and some glutamine, oh and 2 grams of bcaas when in fact u should be getting about 30-40g of bcaa and 50-80 grams of glutamine a f'n day
I'm just basically wondering if anything that you put on is real muscle and will stick around. If it's nothing but water and it will all go away, I don't wanna waste my time. I'll just stick to food and training.
There's always going to be some people that don't like a supp for more reasons than one. However, imo and I believe in many others as well, creatine can really benefit somone.(with proper use) I don't believe you "piss it" all away. I've had great results, and kept most of the gains, some does get taken away from water weight.
Anyway, I think it would be worth giving it a shot. Not very expensive, if bought in bulk. But this is just my opinion.
WOW 50g of glutamine, thats intense. Thats defiently something I've never heard before. Do you ususally take that much?
I just read a study showing the initial gain from creatine is NOT water weight, but actual muscle from increased protein synthesis.
When I go off, I lose no strength, but I do lose the ability to pump out an extra rep or two. In other words, I lift the same weight, for a rep or two less.
It takes a month to fully saturate creatine stores, and it takes about the same to bring them down to normal levels after cessation of supplementation. So you won't notice an immediate difference the day you stop.
The only thing is there is evidence that creatine taken pre-workout is circulating in the blood, and may have a greater effect than creatine taken at any other time. This may be responsible for the awesome effects of the 'loading phase' so popular a couple years ago: people were taking 4gr 5 times a day, so there was creatine in circulation pre-workout. Because loading doesn't increase muscular stores more, it's common to say loading isn't necessary. Indeed it's not, but it may be beneficial to take your single daily dose pre-workout.
basically you will lose the ability to knock out those last few reps. creatine stores in your muscles get depleted as a training session goes on, supplementing with creatine before/during/after, workout, you will see a difference.
When I go off, I lose no strength, but I do lose the ability to pump out an extra rep or two. In other words, I lift the same weight, for a rep or two less.
Poison I agree with most of what you said but hope you see that this statement is backwards. Losing reps is one defintion of losing strenght, your muscles can do less work and lift a weight less time which is losing strength.
As far as creatine goes, a lot of stuff suggests that you do need time off because your body will down regulate creatine transportation.
Personally I don't take it, no real reason why eccept that I bloat if I do ANYTHING. Eat a piece of bread and bloat, have a alchohol beverage and blot... anything... so won't do creatine normally. Looking to try cre-02 though.
Really not much happens when you quit using it, except that your body starts to manufacture your own. There is slight strength decrease, any muscle shrinkage you perceive probably isnt noticeable to others. Micronized with whey and glutamine is probably best to avoid any gastro problems, its still mono, whatever sides you get are worth it. Just find the right mixture or brand that is compatible. There are other benefits besides muscle growth. I hope that helps you, stay with it and you will see muscle growth. JMO
It has the hugest bucketload of scientific evidence behind it. It isn't some miracle supp that will blow your mind but it helps with those last few reps and imho that gives you that extra bit of hypertrophy to stimulate that little bit extra muscle growth.
The bloat is negligible in MOST people. It is a bit of water weight but what is wrong with hydrated muscles? Nothing. And it's not like its much. I don't really notice it.
It's cheap as borscht. Its like 20 bucks for a bucket that will last months.
I don't know about you all but when I stopped taking it, I lost a couple reps and like 5 pounds on my minor lifts and 5-10 off my big ones. Not a big deal, but out of every supp I've taken, it has given me the second best results (cissus-drol being #1 on my lifts).
Like all this ****e we pump into our bodies, it is in fact subjective, but people who argue science because they are athletic are idiots.
EDIT: Dosing is like the rest of these supps, find your sweet spot. I take a heaping teaspoon (about 7g) with my post workout shake (30g protein, 35 carbs). Oh yeah, mono needs to be taken with carbs to absorb properly)
Thanks for all the advice guys. Positive and negative for creatine is really appreciated. I know it sounds dumb asking about a supp like this one that has been talked about so much. But I just always hear people tell guys new to lifting (which I'm not) to try it out. I'm just trying to keep off PH's for a while. I've tried everything under the sun including creatine when I was younger. Just wanted to try and get some insight as to why it's always pushed for the new guys when I always heard so much negative stuff about it.
I have gotten very good results on Mono. Heres some good advice though, make SURE you drink plenty of water when you take it. I started to have some minor kidney problems about 6 months into it. Now i cycle 2 months on, 1 month off, with at least a gallon of water or more per day. It may be legal, but you have to use it right. Anyone who takes 20grams or more per day is wasting there time, and there organs. | null | minipile | NaturalLanguage | mit | null |
Carlyle Road Topo Map
Carlyle Road is a hiking, biking, and horse trail in Nevada County, California. It is within Tahoe National Forest. It is 2.2 miles long and begins at 5,464 feet altitude. Traveling the entire trail is 4.4 miles with a total elevation gain of 659 feet. Near the trailhead there are restrooms. Along the trail there is a meadow.
Tahoe National Forest, California
Get Carlyle Road Topo maps on Trails.com. One of California's best walks, Carlyle Road is located near Tahoe National Forest, CA. Trails' printable online topo maps offer shaded and un-shaded reliefs, and aerial photos too! Use topographic map functionality to find elevation, print high resolution maps, save a PNG, or just learn the topography around Carlyle Road. You can also get free latitude and longitude coordinates from the topographical map and set your GPS. Subscribers with access to our maps can download or print any topo, and cover more terrain when you map your Carlyle Road route ahead of time. | null | minipile | NaturalLanguage | mit | null |
Two stations on Metro’s Red Line will likely be hotter than normal again this summer.
The Dupont Circle and Farragut North stations will begin the hot season without air conditioning thanks to broken pieces of equipment known as “chillers,” WMATA said earlier this month.
“Both Dupont Circle and Farragut North stations are cooled by a common chiller plant that is located in the median of Connecticut Avenue opposite the Farragut North L Street entrance,” read a press release. “Delivery of chilled air to the stations has been disrupted by a leak in the underground line that runs between the chiller plant and the stations.”
In order to fix the problem, Metro will dig up a portion of Connecticut Avenue and repair that leaky line. Though the transit agency has said the chillers could come back online as soon as July, we all know Metro has an issue with unexpected delays.
So, we want to know: do you think Metro will actually fix these chillers by July, or are we in for a red hot summer on the Red Line? | null | minipile | NaturalLanguage | mit | null |
Chancellor Fariña calls BSA "inspiring" in recent speech
April 17, 2014
Chancellor Fariña and Dr. McKeon
In a recent speech held on April 17th at Cooper Union, Chancellor Fariña again mentioned Broome Street Academy, stating we were an "inspiring" school. Read the full article below and find the original release at Capital.
Chancellor Carmen Fariña gave her most comprehensive feedback yet on this year's controversial state English Language Arts tests during a speech at Cooper Union, addressing the "opt-out" movement and saying she has been in frequent contact with the state education department about ways to improve the test.
Delivering a variation on her 100 days speech from Saturday at a St. John's University event on Wednesday evening, Fariña told the group of education students that the Department of Education has convened a meeting of principals to give recommendations to the state about the tests. She acknowledged that the tests has spurred protest from "some parents with the support of some principals" and said the concerns were focused mostly on the 3rd grade tests.
"We are in constant dialogue with the state education department," she said, adding that "for parents to buy in they must be part of the process."
Fariña glanced at index cards as she spoke, and only briefly read directly from prepared remarks, as she begins to strike a balance from her preferred (but risky) method of speaking without remarks and the monotony, which she clearly disdains, and of reading from a speech written by someone else. She reiterated her support for the Common Core curriculum standards and repeated her key pillars of respect for teachers and collaboration between schools.She also gave some insight into her activity in recent weeks, mentioning a meeting with business leader Kathryn Wylde and the Partnership for NYC to help expand career and technical schools, a legacy of the Bloomberg administration.
Fariña also mentioned a recent visit to the Broome Street Academy, a charter school, which focuses on helping homeless students, which she called one of her most "inspiring" school visits.
She spoke in detail about her experience as an educator, recalling times she had comforted a crying teacher or held 21 parent meetings in a single year.
She also briefly mentioned that she has created a new internal D.O.E. office for guidance counselors as of the last several weeks, and that she is working on a "dream initiative" program to help get students from Title I schools into the city's specialized high schools.
When asked by one student what the greatest accomplishments were of her tenure as chancellor, Fariña said she was most proud of raising morale among teachers.
When asked about her challenges, she said, "Making sure there are no more snow days." | null | minipile | NaturalLanguage | mit | null |
Effect of potassium-induced cardioplegia in hypothermia on myocardial energy, ammonium, and intermediary metabolism in man.
Cardiac muscle biopsy specimens were obtained from 33 patients undergoing open-heart surgery under K+-induced ischemic arrest in hypothermia (cardioplegic right atrial and right ventricular muscles) or under hypothermic ischemic arrest without K+-cardioplegia (noncardioplegia right atrial muscle), and sequential patterns of changes in the myocardial metabolism were studied by standard enzymatic techniques. The concentrations of the high energy phosphates were not only adequately preserved but actually exceeded the initial values in the cardioplegic muscles during the 40-min period of the ischemic arrest. In addition, elevated ammonia levels were neutralized by these muscles, and excessive variations in the myocardial intermediary metabolism were prevented. The levels of ATP were also adequately preserved by the noncardioplegic right atrial muscle during the 12-min period of ischemic arrest. But this protection was achieved at the expense of a 20% reduction in the myocardial creatine phosphate levels and other associated severe intracellular metabolic derangements. Changes in the myocardial intermediary metabolism, at the end of 12 min of ischemic arrest and at the end of 40 min of K+-cardioplegic arrest, were almost identical. The results of these studies suggest that, in contrast to the hypothermic arrest alone, K+-cardioplegia in hypothermia offers a superior myocardial metabolic preservation over an extended period of time. | null | minipile | NaturalLanguage | mit | null |
[Effects of Shenfu injection on prostacyclin, thromboxane A2 and activities of ATPases in rats exposed to hepatic ischemia-reperfusion injury].
To explore the effects of Shenfu Injection on prostacyclin, thromboxane A2 and the activities of ATPases in rats exposed to hepatic ischemia-reperfusion injury. Twenty-four male Wistar rats weighing 200-250 g were randomly divided into two groups: Shenfu Injection (SF)-treated group (rats were treated with Shenfu Injection of 10 ml/kg through intraperitoneal injection) and untreated group (rats were administered with normal saline at the same dose and served as a control group). Hepatic ischemia was caused by Pringle's maneuver and lasted for fifteen minutes, and then one-hour or three-hour reperfusion was performed. Venous blood samples for the measurement of thromboxane B(2) (TXB(2)) and 6-keto-prostaglandin F(1 alpha)(6-keto-PGF(1 alpha)) were collected three hours after reperfusion. Liver tissue samples were collected one hour or three hours after reperfusion for the measurement of Na(+)-K(+)-ATPase and Ca(+)-Mg(+)-ATPase and for morphological studies. Plasma TXB(2) was lower in the SF-treated group than that in the untreated group after three-hour reperfusion (P>0.05), while 6-keto-PGF(1 alpha) was higher in the SF-treated group than that in the untreated group (P>0.05). The ratio of TXB(2) and 6-keto-PGF(1 alpha) was significantly lower in the SF-treated group than that in the untreated group (P<0.05). The activities of Na(+)-K(+)-ATPase and Ca(+)-Mg(+)-ATPase in the SF-treated group were improved obviously. A three-hour reperfusion after fifteen-minute ischemia caused important hepatic histological alterations. Marked structural abnormalities were observed in the untreated group, such as massive hepatocyte swelling, necrosis, mitochondria edema and vacuolar changes. In the SF-treated group, hepatic tissue injury was reduced significantly. Shenfu Injection protects hepatic tissue from ischemia-reperfusion injury, and such protective effects are achieved by decreasing the ratio of thromboxane A(2) and prostacyclin, and increasing the activities of Na(+)-K(+)-ATPase and Ca(+)-Mg(+)- ATPase. | null | minipile | NaturalLanguage | mit | null |
The Malta is fully supported by Linux 2.4 and Linux 2.6. Since generally the main GIT tree on linux-mips.org is more geared towards development a separate [[Malta Linux Repository]] that's geared towards absolute stability on Malta is being maintained by MIPS Technologies Inc.
+
The Malta is fully supported by Linux 2.4 and Linux 2.6. Since generally the main [[Git|GIT]] tree on linux-mips.org is more geared towards development a separate [[Malta Linux Repository]] that's geared towards absolute stability on Malta is being maintained by MIPS Technologies Inc.
[[OVPsim]] supports the Mips Malta Platform booting Linux
[[OVPsim]] supports the Mips Malta Platform booting Linux
Revision as of 23:31, 7 January 2009
Malta with 20Kc core card
The MIPS Malta is an ATX formfactor evaluation board made by MIPS Technologies. It supports a large variety of processor options; common processor types are 4Kc, 4KEc, 5Kc or a 24Kc core.
Linux support
The Malta is fully supported by Linux 2.4 and Linux 2.6. Since generally the main GIT tree on linux-mips.org is more geared towards development a separate Malta Linux Repository that's geared towards absolute stability on Malta is being maintained by MIPS Technologies Inc. | null | minipile | NaturalLanguage | mit | null |
HomeAway is the world leader in vacation rentals. We offer the largest selection of properties for any travel occasion and every budget. We're committed to helping families and friends find a perfect vacation rental to create unforgettable travel experiences together.
Perfect Location 2bedroom Balconies
Nice apartment with two bedrooms, each with a balcony overlooking the street to the Plaza of Spain. Perfect situation thoroughly to discover Madrid!.
This totally renovated apartment has been tastefully decorated in a fun and modern Mediterranean style. Bright colours prevail in the small details of this space: lamps, pillows, curtains make this place special. Bright sun bathes the apartment in natural light streaming in from the balconied windows.
There are 2 bedrooms, each one with a balcony to the street. One of them have 2 single beds and the other one has a double sofa bed.
The living/dining room has a comfortable sofa, a table and chairs, TV.
From the computer desk, take advantage of the free high speed ADSL WiFi internet connection.
The small kitchen includes a washing machine, fridge, electric stove top, microwave and a full set of dishware. The bathroom comes with shower. Heat and air conditioning.
Important to know: the Gran Via Plaza de Spain 1 apartment is next to the Gran Via Plaza de Spain 2 apartment, an excellent choice for bigger groups of both family, friends or businesses.
The apartment is located in the prestigious Gran Via area of central Madrid, with an easy walk to Gran Vias beautiful shopping avenue or the trendy Chueca and Malasaa areas.
Malasaa has art galleries and vintage shopping as well as the best of Madrids social scene, while Chuecas crowd is more alternative, with an array of colourful plazas and bars.
You are a short journey from Plaza Mayor or Kilometro Cro at Puerta del Sol, with cultural spots such as the Prado and the Reina Sofia gallery, easily reached in about 15 minutes.
Perfect Location 2bedroom Balconies
Nice apartment with two bedrooms, each with a balcony overlooking the street to the Plaza of Spain. Perfect situation thoroughly to discover Madrid!.
This totally renovated apartment has been tastefully decorated in a fun and modern Mediterranean style. Bright colours prevail in the small details of this space: lamps, pillows, curtains make this place special. Bright sun bathes the apartment in natural light streaming in from the balconied windows.
There are 2 bedrooms, each one with a balcony to the street. One of them have 2 single beds and the other one has a double sofa bed.
The living/dining room has a comfortable sofa, a table and chairs, TV.
From the computer desk, take advantage of the free high speed ADSL WiFi internet connection.
The small kitchen includes a washing machine, fridge, electric stove top, microwave and a full set of dishware. The bathroom comes with shower. Heat and air conditioning.
Important to know: the Gran Via Plaza de Spain 1 apartment is next to the Gran Via Plaza de Spain 2 apartment, an excellent choice for bigger groups of both family, friends or businesses.
The apartment is located in the prestigious Gran Via area of central Madrid, with an easy walk to Gran Vias beautiful shopping avenue or the trendy Chueca and Malasaa areas.
Malasaa has art galleries and vintage shopping as well as the best of Madrids social scene, while Chuecas crowd is more alternative, with an array of colourful plazas and bars.
You are a short journey from Plaza Mayor or Kilometro Cro at Puerta del Sol, with cultural spots such as the Prado and the Reina Sofia gallery, easily reached in about 15 minutes.
Perfect Location 2bedroom Balconies
Perfect Location 2bedroom Balconies
Perfect Location 2bedroom Balconies
Nice apartment with two bedrooms, each with a balcony overlooking the street to the Plaza of Spain. Perfect situation thoroughly to discover Madrid!.
This totally renovated apartment has been tastefully decorated in a fun and modern Mediterranean style. Bright colours prevail in the small details of this space: lamps, pillows, curtains make this place special. Bright sun bathes the apartment in natural light streaming in from the balconied windows.
There are 2 bedrooms, each one with a balcony to the street. One of them have 2 single beds and the other one has a double sofa bed.
The living/dining room has a comfortable sofa, a table and chairs, TV.
From the computer desk, take advantage of the free high speed ADSL WiFi internet connection.
The small kitchen includes a washing machine, fridge, electric stove top, microwave and a full set of dishware. The bathroom comes with shower. Heat and air conditioning.
Important to know: the Gran Via Plaza de Spain 1 apartment is next to the Gran Via Plaza de Spain 2 apartment, an excellent choice for bigger groups of both family, friends or businesses.
The apartment is located in the prestigious Gran Via area of central Madrid, with an easy walk to Gran Vias beautiful shopping avenue or the trendy Chueca and Malasaa areas.
Malasaa has art galleries and vintage shopping as well as the best of Madrids social scene, while Chuecas crowd is more alternative, with an array of colourful plazas and bars.
You are a short journey from Plaza Mayor or Kilometro Cro at Puerta del Sol, with cultural spots such as the Prado and the Reina Sofia gallery, easily reached in about 15 minutes.
Overview
Apartment in Madrid, 2 bedrooms, 1 bathroom, sleeps 4
Nice apartment with two bedrooms, each with a balcony overlooking the street to the Plaza of Spain. Perfect situation thoroughly to discover Madrid!.
This totally renovated apartment has been tastefully decorated in a fun and modern Mediterranean style. Bright colours prevail in the small details of this space: lamps, pillows, curtains make this place special. Bright sun bathes the apartment in natural light streaming in from the balconied windows.
There are 2 bedrooms, each one with a balcony to the street. One of them have 2 single beds and the other one has a double sofa bed.
The living/dining room has a comfortable sofa, a table and chairs, TV.
From the computer desk, take advantage of the free high speed ADSL WiFi internet connection.
The small kitchen includes a washing machine, fridge, electric stove top, microwave and a full set of dishware. The bathroom comes with shower. Heat and air conditioning.
Important to know: the Gran Via Plaza de Spain 1 apartment is next to the Gran Via Plaza de Spain 2 apartment, an excellent choice for bigger groups of both family, friends or businesses.
The apartment is located in the prestigious Gran Via area of central Madrid, with an easy walk to Gran Vias beautiful shopping avenue or the trendy Chueca and Malasaa areas.
Malasaa has art galleries and vintage shopping as well as the best of Madrids social scene, while Chuecas crowd is more alternative, with an array of colourful plazas and bars.
You are a short journey from Plaza Mayor or Kilometro Cro at Puerta del Sol, with cultural spots such as the Prado and the Reina Sofia gallery, easily reached in about 15 minutes. | null | minipile | NaturalLanguage | mit | null |
Q:
If $x^2+kx+1$ is a factor of $px^5+qx^2+r$ prove that $(p^2-r^2)(p^2-r^2+qr)=q^2p^2$
if $x^2+kx+1$ is a factor of $px^5+qx^2+r$ prove that $(p^2-r^2)(p^2-r^2+qr)=q^2p^2$
My try
Since this is a factor I tired finding A, B, C & D such that,
$(x^2+kx+1)(Ax^3+Bx^2+cx+D)$ =$px^5+qx^2+r$
if I can find k in terms of p, q & r I can try to get the given condition, But when I tried this equating coefficients, I ended up with quadratic expression for k? Is there a better way to approach this question? Please Help! thanks
A:
$\mathrm{px^5+qx^2+r\\if~x^2+kx+1~is ~a ~factor\\ [x^2+kx+1][Ax^3+Bx^2+Cx+D]\equiv px^5+qx^2+r\\
by~expansion:\\x^5:Ax^5=px^5 ~\underbrace{A=p} \cdots(i) \\x^4: Bx^4+kAx^4=0,~\underbrace{B=-kA} \cdots(ii) \\x^3: Cx^3+kBx^3+Ax^3=0; \underbrace{C+kB+A=0} \cdots(iii) \\x^2:~Dx^2+kCx^2+Bx^2=qx^2;~\underbrace{D+kC+B=q} \cdots(iv)\\x:kDx+Cx=0;\underbrace{kD+C=0} \cdots(v)\\\underbrace{D=r} \cdots(vi) \\A=p, B=-kp, C=-kD, D=r~~\Biggr |C=-kr ~considering ~eqn(iii)~and~eqn(iv)~respectively \\kB=-A-C\cdots*;~kC=q+D-B\cdots**\\divide~ eqn(*)~ by~(**)\\\frac{kB} {kC} =\frac{-A-C} {q-D-B};~~\frac{B} {C} =\frac{A+C} {D+B-q};\frac{-kp} {-kr} =\frac{p-kr} {r-kp-q} ; \frac{p} {r}=\frac{p-kr} {r-kp-q}\\p(r-kp-q) =r(p-kr) \\pr-kp^2-pq=rp-kr^2\Biggr|k=\frac{pr-rp-pq}{p^2-r^2}\\(x^2+kx+1)(Ax^3+Bx^2+Cx+D)=\Biggr[x^2+\frac{pr-rp-rq}{p^2-r^2}x+1\Biggr] \cdots\\
} $
$substituting~the~value~of~k~back$
$\\\Biggr\{x^2+\frac{pq}{r^2-p^2}x+1\Biggr\}\Biggr\{px^3-\frac{p^2q}{r^2-p^2}x^2-\frac{pqr}{r^2-p^2}x+r\Biggr\} \equiv{px^5+qx^2+r} \\consider~x^3:\\\frac{-pqr}{r^2-p^2}+\frac{pq}{r^2-p^2}\biggr(\frac{-p^2q}{r^2-p^2}\biggr)+p=0\\-pqr+\frac{pq(-p^2q)}{r^2-p^2}
+p(r^2-p^2)=0$
$-p^2q^2+(r^2-p^2)^2=qr(r^2-p^2)\\(r^2-p^2)^2 -qr (r^2-p^2)=p^2 q^2 \\ (r^2-p^2)(r^2-p^2-qr)= p^2q^2 \\\underbrace{p^2q^2=(p^2-r^2)(p^2-r^2+qr)} $
| null | minipile | NaturalLanguage | mit | null |
The JFF League Commissioner has officially announced that the league will have a Spring 2015 season. This will be the second time in three years that The JFF Madden NFL Online League has sponsored a Spring season, and fourth time overall since 2003. The last season that started in the Spring was in 2013, which was the eighth season of The JFF and the first season in six-and-a-half years.
All of the league games during the Spring 2015 season will be played on the All-Madden level of difficulty. This will mark the seventh season of The JFF that will compete on All-Madden (other seasons were Fall / Winter 2002-03, Spring 2003, Spring 2004, Fall 2004, Fall 2005, and Fall 2006). All of the games during the Fall 2003 season, Spring / Summer 2013 season, Fall 2013 season, and Fall 2014 season were played on the All-Pro level of difficulty.
Also, since the implementation of the EA Sports ‘Connected Franchise Mode’ (CFM), this will be the first season that will offer a continuation and progression of the current CFM rosters. Both the current Fall 2014 team owners as well as any new team owners and league members will be able to participate in the various off-season activities, such as the re-signing of players who have expiring contracts, the signing of Free Agents who failed to re-sign with their former team, and the drafting of new rookies.
The Spring 2015 Regular Season will officially begin on Monday, February 2, 2015, which is the day after the NFL Super Bowl. The Regular Season will conclude on Friday, April 3, 2015.
JFF league members who participated in the Fall 2014 season will have until Friday, December 19, 2014 to submit their Spring 2015 Team Ownership Rights Fees. If a team’s Ownership Rights are not paid for by that date, then the new league members and/or former league members will have the opportunity to purchase the Ownership Rights to that particular team.
CLICK HERE to be redirected to a list of all of the Team Ownership Rights Fees for the Spring 2015 season.
Click on the photo below if you are interested in purchasing the Ownership Rights to a JFF league team for the Spring 2015 season: | null | minipile | NaturalLanguage | mit | null |
Vein stripping is the traditional treatment for primary varicose veins of the lower extremity.^[@R1]^ However, this procedure is associated with a risk of nerve damage.^[@R1]^ Postoperative sensory deficit has been reported in 7%--11% of patients after greater saphenous vein stripping.^[@R2],[@R3]^ It was reported that postoperative pain usually spontaneously resolves within 3 months,^[@R4]^ but some patients have persistent pain, paresthesia, and discomfort.^[@R5]^ The pathophysiology of these refractory symptoms has not been determined.
We report a patient who had persistent pain after varicose vein stripping. Nerve entrapment with a mass adjacent to the saphenous nerve was found and effectively treated with ultrasound-guided hydrodissection. The patient has provided written consent to publish this case report.
CASE DESCRIPTION
================
A 78-year-old woman with lower extremity varicose underwent bilateral greater saphenous vein stripping under general anesthesia. She had no remarkable medical history. Postoperatively she complained of numbness, tingling, and pain in the left leg. This was initially diagnosed as neuropathy and treated with pregabalin 300 mg/d. The symptoms continued 6 months postoperatively. The patient was referred to the pain clinic for evaluation and treatment of intractable neuropathy. Physical examination showed that the numbness and spontaneous pain were in the saphenous nerve distribution, starting in the vicinity of the operative scar on the medial side of the left leg. Ultrasound examination showed a 0.5-cm mass adjacent to the saphenous nerve (Figure [1](#F1){ref-type="fig"}). Tinel sign was elicited by applying pressure over the mass with the ultrasound probe. The symptoms were suspected to be due to saphenous nerve entrapment by the mass. Magnetic resonance imaging suggested that the mass was related to the varicose vein stripping (Figure [2](#F2){ref-type="fig"}). The mass was in the path of the vein stripping wire. The mass was adjacent to the saphenous nerve beneath the surgical scar.
{#F1}
{#F2}
Ultrasound-guided nerve hydrodissection with 10 mL of saline and 4 mg of betamethasone was performed using a 25-gauge needle (1.5-inch, Terumo Hypodermic Needle, Terumo Medical Co, Tokyo, Japan) (Figure [3](#F3){ref-type="fig"}). The pain immediately resolved, which lasted for 3 days. The visual analog pain scale decreased from 80 (before treatment) to 60 three days after hydrodissection. Repeat ultrasound-guided hydrodissection was planned weekly.
{#F3}
After each session of hydrodissection, the pain resolved for 3 days, and the overall severity and distribution of the pain decreased gradually. The visual analog pain scale decreased to 30 three weeks later. Pregabalin was continued, and the herbal Kampo medicine Keishikajutsubuto was prescribed by the clinician to alleviate the discomfort associated with numbness. Hydrodissection was performed with saline only, and pregabalin was decreased to 150 mg/d from the third week onward. Hydrodissection stopped after 8 weeks, at which time the patient had no further
pain, but mild numbness remained. There were 8 hydrodissection sessions in total. Four months after starting treatment, numbness was limited to the medial ankle, and pregabalin was reduced to 75 mg/d. Ten months after starting treatment, the numbness resolved completely.
DISCUSSION
==========
Saphenous vein stripping for varicose veins of the lower extremity is associated with a risk of saphenous nerve injury. Therapeutic strategies other than surgical stripping have been considered and are generally less invasive, such as radiofrequency or laser ablation, cryosurgery, bipolar coagulation, and foam sclerotherapy.^[@R1]^ However, the efficacy of these less invasive procedures has not been conclusively shown.
Below the knee, especially in the lower third of the leg, there is an increased risk of saphenous nerve injury with saphenous vein procedures, because the vein and nerve are adjacent to each other. Branches of the nerve lie along the vein.^[@R6]^ Saphenous nerve injury may be caused by ablation of these complexes of neighboring vein and nerve tissue with the stripping wire. Lower extremity varicose vein stripping frequently results in saphenous neuropathy, but it is usually self-limited.^[@R4]^ However, long-term unrelenting pain has been reported. In the present patient, we found a small mass adjacent to the saphenous nerve. Ultrasound-guided hydrodissection relieved the pain immediately. The pain was believed to be due to saphenous nerve entrapment by the mass. Magnetic resonance imaging showed that the mass may have been related to the stripping wire. This is the first report of refractory pain after lower extremity varicose vein stripping diagnosed as saphenous nerve entrapment. This suggests that other patients with continued pain after vein stripping may also have saphenous nerve entrapment. We recommend ultrasound examination for patients with refractory pain after varicose vein stripping.
Ultrasound-guided nerve hydrodissection is a minimally invasive treatment for various neuropathies, including carpal tunnel syndrome, scleroderma hand, meralgia paresthetica, mastitis, and sural neuroma.^[@R7]--[@R11]^ The mechanism of hydrodissection therapy has not been elucidated but may lyze the adhesion between the mass and the nerve. Supporting this idea, Fader et al^[@R7]^ reported that symptoms disappeared with 1 hydrodissection therapy performed for neuroma. Depending on the density of the adhesions, there may be situations where it can be cured with 1 hydrodissection session, and others may not resolve no matter how many times hydrodissection is performed. The present patient had resolution of pain with 8 hydrodissection sessions. The density of the adhesion may not have been so severe in this patient. Further studies are needed to elucidate the efficacy of ultrasound-guided hydrodissection for nerve entrapment syndrome.^[@R12]^
Keishikajutsubuto has been used to treat neuropathic pain.^[@R13]^ We felt that Keishikajutsubuto may relieve the numbness in this patient and has been reported to have an anti-inflammatory effect.^[@R14]^ Physical peeling from hydrodissection may induce inflammation at the procedure site, which can lead to scar formation at the site. Hence, an anti-inflammatory drug may prevent future scar formation.
Ultrasound diagnosis and ultrasound-guided hydrodissection may be effective for the diagnosis and treatment of saphenous nerve entrapment after lower extremity varicose vein stripping.
DISCLOSURES
===========
**Name:** Kunitaro Watanabe, MD, PhD.
**Contribution:** This author helped write the original draft and methodology.
**Name:** Joho Tokumine, MD, PhD.
**Contribution:** This author helped write the draft.
**Name:** Alan Kawarai Lefor, MD, MPH, PhD.
**Contribution:** This author helped edit the draft and with conceptualization.
**Name:** Kumi Moriyama, MD, PhD.
**Contribution:** This author helped with validation and data curation.
**Name:** Tomoko Yorozu, MD, PhD.
**Contribution:** This author helped validate and supervise.
**This manuscript was handled by:** BobbieJean Sweitzer, MD, FACP.
Funding: None.
The authors declare no conflicts of interest.
| null | minipile | NaturalLanguage | mit | null |
Tuesday, March 12, 2013
Dayang Enterprise Holdings Bhd (DAYANG, 5141), an oil & gas company specilized in offshore topside maintenance services (TMS), offshore hook-up and comissioning (HUC) services, etc. is considered to be one of the largest offshore platform services providers in Malaysia.
Just like most other East Malaysia companies listed in KLSE, most of the time DAYANG remained undetected from the radar screen of most investors. It gained attention since Q4 2012, especially after announcing a superb quarterly report on 19 November 2012 with single quarter EPS of 7.52 sen, and its share price hitting historical record one after another from then onwards.
DAYANG share price hit RM2.72 on 21 January 2013 with high volume of 5.07 million shares transacted. After that, its share price dropped gradually to as low as RM2.34 on 25 February 2013, probably due to the sell down from Lembaga Tabung Haji.
It announced a poorer quarterly result on 26 February 2013 with lower revenue, but net profit is not affected too badly due to higher margin. A 5 sen tax-exempt dividend was announced, going to ex on 15 March 2013. Its share price moved up again, testing the previous high of RM2.72 on 3 March and 6 March 2013. Then, its price corrected to RM2.6x before regained momentum and hit its new record high of RM2.98 today morning and closed at RM2.85 at high volume of 6.58 million shares transacted.
Its intraday chart for 12 March 2013 is as below:
DAYANG is an associate company of Naim Holdings Bhd (NAIM, 5073) and the financial performance of NAIM is currently pretty much depends on its 33.6% holdings of DAYANG. NAIM share price rose 10 sen from RM2.23 to RM2.33 today (12 March 2013).
DAYANG is financially healthy with strong cash position of about RM300 million. It recently acquired about 26.1% shares of its new associate company Perdana Petroleum Bhd (PERDANA, 7108). PERDANA and PERDANA-WA prices also rose in tandem with DAYANG and NAIM today (12 March 2013).
PERDANA was not doing well financially before DAYANG's acquisition, and is currently on its way making a turnaround. Recently, it disposed 7 old vessels with average age of approximately 30 years to PT Ninda Pratama Vriesindo from Indonesia, for a total consideration of US$3.45m. This move is expected to save about RM10-12 million annually in maintenance cost for PERDANA, and is viewed as an important move in its financial restructuring exercise.
DAYANG is teaming up with PERDANA to bid for a contract potentially worth RM3 billion from Shell, involving the Pan Malaysia Umbrella HUC project. Both DAYANG and Petra Energy Bhd (PENERGY, 5133) are shortlisted and the contract is predicted to be announced soon. Interestingly, PENERGY is an associate company of PERDANA, as PERDANA holds about 29.6% shares in PENERGY.
DAYANG has outstanding contracts worth some RM1.2 billion that could keep it busy until 2016.
The oil and gas activities in Malaysia is very active now. In 2012, Petronas has made 22 domestic discoveries, signed 9 Production Sharing Contract (PSC) agreements, awarded more contracts for marginal field Risk Service Contract (RSC), etc.
Today (12 March 2013), Lundin Petroleum, a Swedish-based independent oil and gas explorer, announced that it found more oil trapped in sand offshore Pahang, Malaysia after drilling in Block PM308A, as an extension to its discovery of oil sands in the same area in 2011.
Malaysia's deepwater reserves potential is estimated to be 10 billion barrels of
oil equivalent (BBOE), and only 3 BBOE have been discovered so far, leaving another 7 BBOE yet to be discovered.
All these new oil and gas development in the region are expected to bring benefit and money to the Malaysian O&G companies. This is the catalyst that will bring analysts' attention to O&G counters in KLSE.
DAYANG is currently covered by HwangDBS, OSK, Public Bank, HLG, RHB, BIMB, etc. All are making "buy" call. HwangDBS and HLG both set its target price to RM3.36 as of today.
Disclaimer: This article is intended for sharing of point of view only. It is not an advice or recommendation to buy or sell any of the mentioned stock counters. You should do your own homework before trading in Bursa Malaysia. | null | minipile | NaturalLanguage | mit | null |
What if you held an election and nobody showed up? That basically just happened in Roanoke City when only 6% of the population determined the city council members for the rest of the 94% of the voting population. This may lead to some clucking and outraged opinions about the lack of civic responsibility amongst the populace.
But is that really the issue anymore? Perhaps 94% Roanoke City has figured out something the other 6% may not have: that their vote doesn’t matter. And since it doesn’t matter, the 94% has withdrawn their consent to be governed by the city council. That sounds odd, but hear me out. The American political experience is predicated on the concept that legitimate government has to have the consent of the governed. We just assume that elections are the process that allows this to occur.
Does it?
In Roanoke City, the Democrat leaning, sold out to special interest, Roanoke Times approved political machine churns out candidates selected by a small number of party elites that vary little in any substantive way.
In Roanoke County, the Republican leaning, sold out to special interest, Roanoke Times approved political machine churns out candidates selected by a small number of party elites that vary little in any substantive way.
Any suggestion to break the cycle is viewed as heresy; despite of the problems inherent in both localities. Unless you think that the Roanoke city government should feel good when over 30% of children in the city are living below the poverty level.
If anyone happens to get elected outside of the political machine (unlikely but possible) they are quickly demonized by the Roanoke Times, isolated like a virus by the political machine and eliminated as quickly as possible. (Al Bedrosian being the last example)
So why bother to vote? Conventional wisdom pins this on apathy. But is it? Or is it rather just a sad realization that a vote in this narrow choice of candidates is as useful as bucket of warm spit. I have a friend in Roanoke City. He has an issue with the city regarding a fence in his backyard. The city’s position is nonsensical. He didn’t vote. He is a likely Democrat voter. His rationale for not voting? “What difference would it make?” Has he not withdrawn his consent for this government? He will continue to pay taxes and abide by the city laws? Why? Because if he doesn’t he will face fines and actions that could throw him in jail and continuing to resist those actions will get him killed.
He is no longer giving his consent to be governed but resigning himself to avoiding deadly force. Look up the definition of CONSENT. Consent can not be legitimate if it is forced at gunpoint.
If the process is rigged, and no alternatives are reasonably possible, not voting is a reasonable way to communicate the withdrawal of consent.
At some point, the 94% of the population, if they don’t want to just be a slave to the status quo, need to find a more effective way to withdraw their consent than just passively not voting. At some point, if change is going to occur, the 94% are going to have to throw off the shackles of government force.
Until then, be prepared to be called a slacker who doesn’t care, instead of what you really are; a realist that sees the futility and corruption of the current system. And it makes perfect sense. If I just don’t get involved in politics, and instead, binge watch Stranger Things; I’ll have a much better time, with a lot less frustration and the political results will be the same. I have no confidence in the system. By not participating, I have effectively withdrawn my consent.
Unfortunately the future belongs to those who show up, and based on performance, the 6% are doing a pretty cruddy job of it. But the 6% do control the taxation, the regulation, and the police who will be asked to use force. So while you are withholding consent; your consent is being coerced by the 6% who showed up. At some point, a lot of the 94% will need to do more than passively withdraw consent. But the first real step in this journey is realizing the current political system is just not worth your participation. And if the latest elections are any judge, we are well on our way there.
When 94% of Roanoke City voters did not support a single person elected to government, does that government have legitimate authority to govern and use deadly force against peaceful people to compel them to comply with its decisions? | null | minipile | NaturalLanguage | mit | null |
Posts Tagged ‘ABC network’
More than $1 million of a thirty-second spot, with steadily declining ratings?
Given its impressive sales growth last year, ongoing through February of this year, (from an admittedly small base of 30,000 units a month) Hyundai’s vehicles are resonating with consumers. Its aggressive advertising campaigns, based on a “Big Voices in Big Places” strategy, which includes high-profile advertising in sporting events, entertainment awards shows and outdoor video boards placement tactics, is working very well thank you.
After taking over from long-time Oscar sponsor General Motors last year as the biggest Oscar advertiser, Hyundai will continue as the exclusive automotive advertiser on this year’s Academy Award ABC network broadcasts and has bought time for eight 0:30-second commercials during the annual homage to movies broadcast.
This could be a title of somewhat dubious distinction unless Oscar’s ratings are on the upswing. Broadcasts of the annual Academy Awards show are down, according to Nielsen, from a high of 55 million homes in 1997, when Titanic won Best Picture, to last year’s 36.3 million homes when … ah, hmm what was that movie … won?
Adding up the cost of $1.2 to $1.5 million per 0:30, Hyundai’s buy of eight spots – seven featuring the new Sonata and one for the award winning Genesis sedan – is impressive. However, there was some not so good news.
Not during our broadcast you don't.
Jeff Bridges, Hyundai’s voiceover since 2007, is nominated for the Best Actor award for his role in Crazy Heart; thus his mellifluous voice could not be used on the commercials.
The logical solution could have been get another, non-Oscar-nominee to rerecord Bridges voiceover, right? Yes, but not this time. The answer was to get not one but several actors to substitute their voice for that of Bridges.
“Praise for this idea,” Joel Ewanick vice president of marketing of Hyundai America, said, “Should go to Chris Perry, Hyundai’s director-marketing communications, for suggesting the idea.” On a conference call with Hyundai, Perry said, “My team working with Special Artists Agency, Jeff Bridges talent management firm, got an enviable package of seven very well known, recognizable, famous actors to substitute in our commercials, record their voiceovers, edit them into our old and new commercials, get them approved and shipped them to ABC just in time.”
Oscar Who?
In addition, they did it in about a week and half, which is an incredible achievement in Lalaland where it often takes that long to decide where to have lunch. | null | minipile | NaturalLanguage | mit | null |
Birthday?
Okay, since I do not have a real sub (falconer) I am not allowed to use the search engine.....FUBAR. The girl in the 'Success!" thread's birthday is this coming Tuesday, the 9th. Now i've met the girl on the 25th of february, and while we're not official, and are 'trying' to take things slowly, she does act very much into me, and I see us definitely turning this into a boyfriend/girlfriend (I put the boyfriend first cause I wear the pants! BAM).
Anyway, Birthday is in 3 days, WTF do I even begin thinking about to get her...she likes everything, but seafood. help please!
nothing she can have for a keepsake like a watch or something. give her a good time,
i just say that because i have been the tool (i say tool because it was unnatural for me to act the way i did) that just met a girl and was stupid about getting her something for her birthday-and she split,
anyways, if you really think this will last, then you have plenty of birthdays to get "something"
just be nice, wish her a happy day once and go about your daily business.
i mean that is just my perspective based on how things went wrong for me in the past by acting in the way i acted. If i had acted naturally the way i should have, she probably could have still been a part of my life
she can expect you to get her something and split if you dont or she can expect you not to get her anything since you just met and split if you do get her something.
so either way, you have to do what you think is the thing to do. if it turns out that you did what you thought was the right thing and she splits, then why would you want her around? to force yourself to act unnaturally for some reason?
nothing she can have for a keepsake like a watch or something. give her a good time,
i just say that because i have been the tool (i say tool because it was unnatural for me to act the way i did) that just met a girl and was stupid about getting her something for her birthday-and she split,
anyways, if you really think this will last, then you have plenty of birthdays to get "something"
just be nice, wish her a happy day once and go about your daily business.
i mean that is just my perspective based on how things went wrong for me in the past by acting in the way i acted.
she can expect you to get her something and split if you dont or she can expect you not to get her anything since you just met and split if you do get her something.
so either way, you have to do what you think is the thing to do. if it turns out that you did what you thought was the right thing and she splits, then why would you want her around? to force yourself to act unnaturally for some reason?
Click to expand...
Well I think the right thing to do is get her something small, we're already going to do dinner Tuesday night, but I would feel bad not getting her anything, even if I haven't known her that long.
well that is cool by me. i say do it then. we are all different dude. I am obviously not like you. i read the update in your other thread. it sounds like win and if you what you say is accurate of the actual situation, i don't see how acting like you naturally feel would cause you any worry.
i met this girl just today and it was the first time in ages that i "knew" there would be no doubts or uncertainties and having that knowing is so cool
I am feeling great about the situation....its one of those few times were no matter what we do, we're having fun.....most of the day friday, we literally just sat on her couch and watched tv, and we ended up discussing UFO's....and were having a blast doing it.....and then we went out and just kinda walked around since it was nice.....theres a definite connection going on that I think we both feel.....I just don't know what to do for her birthday.....
See, if you are really feeling this girl, and she is feeling you, I would suggest some sort of a small keepsake, so if it works out, years later she will have it to remember your first special occasion by.
Go to that shop in the mall, called Things Remembered, and get her a keyring with her initials and birthdate monogrammed on it. It's not very expensive, but thoughtful, and she'll be able to put her keys on it and be reminded of you every day and smile. We're talking a $15 dollar gift that will be very special to her, without being overbearing.
Then take her out to a nice dinner...some little hole-in-the-wall restaurant that serves really good food...no chain restaurants. Then maybe a walk after dinner, and you give her the gift. I guarantee this will melt her heart.
Be sweet, tell her how beautiful she looks, that you like her hair, her dress...women really do love to hear all those sweet nothings from a man we are interested in. Make the date as romantic as possible, and she will be putty in your hands! | null | minipile | NaturalLanguage | mit | null |
A team of researchers has for the first time found a side effect of a common drug combination by looking at search queries.
Andy Piatt/Shutterstock/Rebecca J. Rosen
For doctors or patients who notice side effect to a prescription drug (or a combination of several), there's one place to go: the FDA's Adverse Events Reporting System. This is where, once a drug is already on the market, the government can monitor side effects that for one reason or another did not turn up in trials.
The problem is that many patients aren't so forthcoming, and may not report -- to their doctors or the FDA -- minor side effects they notice.
But they will tell someone something: Google (or Bing or Yahoo).
According to a new study in the Journal of the American Medical Informatics Association, more than one in 250 people (0.43 percent) searched for one of the 100 best-selling drugs at some point in 2010. And if a whole bunch of those people searching for two of those drugs also search for, say, blurry vision, well, you might have just found out that that particular combination of drugs can cause hyperglycemia.
And that's just what researchers from Microsoft, Columbia, and Stanford found. Digging into a huge mountain of data harnessed from the search bars of consenting users, they found that people who searched for *both* paroxetine (a common antidepressant) and pravastatin (for those with high cholesterol) were more likely to also look for a list of some 80 terms describing symptoms associated with hyperglycemia (pdf) than those taking just one of the medications, who in turn were more likely than those taking neither.
Journal of the American Medical Informatics Association | null | minipile | NaturalLanguage | mit | null |
'Complementary ENT': a systematic review of commonly used supplements.
To assess the evidence surrounding the use of certain complementary supplements in otolaryngology. We specifically focussed on four commonly used supplements: spirulina, Ginkgo biloba, Vertigoheel and nutritional supplements (cod liver oil, multivitamins and pineapple enzyme). A systematic review of the English and foreign language literature. in vivo human studies. animal trials, in vitro studies and case reports. We also excluded other forms of 'alternative medicine' such as reflexology, acupuncture and other homeopathic remedies. Lack of common outcome measures prevented a formal meta-analysis. Three studies on the effects of spirulina in allergy, rhinitis and immunomodulation were found. One was a double-blind, placebo, randomised, controlled trial (RCT) of patients with allergic rhinitis, demonstrating positive effects in patients fed spirulina for 12 weeks. The other two studies, although non-randomised, also reported a positive role for spirulina in mucosal immunity. Regarding the use of Ginkgo biloba in tinnitus, a Cochrane review published in 2004 showed no evidence for this. The one double-blind, placebo-controlled trial that followed confirmed this finding. Regarding the use of Vertigoheel in vertigo, two double-blind RCTs and a meta-analysis were identified. The first RCT suggested that Vertigoheel was equally effective in reducing the severity, duration and frequency of vertigo compared with betahistine. The second RCT suggested that Vertigoheel was a suitable alternative to G. biloba in the treatment of atherosclerosis-related vertigo. A meta-analysis of only four clinical trials confirms that Vertigoheel was equally effective compared with betahistine, G. biloba and dimenhydrinate. Regarding multivitamins and sinusitis, two small paediatric pilot studies reported a positive response for chronic sinusitis and otitis media following a course of multivitamins and cod liver oil. Regarding bromelain (pineapple enzyme) and sinusitis, one randomised, multicentre trial including 116 children compared bromelain monotherapy to bromelain with standard therapy and standard therapy alone, for the treatment of acute sinusitis. The bromelain monotherapy group showed a faster recovery compared with the other groups. The positive effects of spirulina in allergic rhinitis and of Vertigoheel in vertigo are based on good levels of evidence, but larger trials are required. There is overwhelming evidence that G. biloba may play no role in tinnitus. There is limited evidence for the use of multivitamins in sinus symptoms, and larger randomised trials are required. | null | minipile | NaturalLanguage | mit | null |
Image copyright Reuters
US bank Citigroup has reported a 27% fall in first quarter profits compared with a year earlier.
It came as Citi said it had set aside more cash to cover losses on energy loans, and as the cost of shrinking some of its businesses increased.
Citi, which is restructuring to focus on more profitable businesses, saw net income fall to $3.5bn (£2.5bn) from $4.8bn the time a year earlier.
However, the results were better than analysts had been expecting.
Chief executive Michael Corbat said Citi was making progress "in becoming a simpler, smaller, safer and stronger institution".
The bank's profit decline, in the three months to the end of March, is the largest among big US banks that have reported first quarter results so far.
Citi recently slipped from third to fourth biggest US bank by assets, after being overtaken by Wells Fargo.
The bank's revenue from fixed income markets dropped by 11.5% to $3.09bn, while investment banking revenue plunged by 27.2% to $875m.
"While our market-sensitive products clearly suffered from weak investor sentiment during the quarter, we continued to make progress in several key areas," said Mr Corbat.
Energy protection
Earnings per share were $1.10. Analysts had expected Citi's per share earnings to be closer to $1.03.
The global banking industry has struggled since the start of year due to uncertainty surrounding the world's economic outlook, with a slowdown in China and the continued fall of oil prices.
Citi was not alone in reporting lower year-over-year profit for the first quarter. Earlier in the week JP Morgan reported a 6.7% drop in profit. On Thursday, Bank of America reported that profits fell 13% in the first quarter and Wells Fargo reported a 7% drop.
Like Citi, all three set aside cash to cover bad loans to the energy sector.
Shrinking
Citigroup has had a larger drop in profit is in part because it has greater exposure to emerging markets, where the economies have been slowing.
The bank has been selling assets and leaving less profitable markets. Mr Corbat said the first quarter earnings included "a significant repositioning charge" of $491m.
On Wednesday, Citi was one of the few large US banks to receive regulatory approval for its "living will" - that is the bank's plan to shut down operations in the event of another financial crisis. | null | minipile | NaturalLanguage | mit | null |
Q:
Can we change status of jira ticket on bamboo deploy. Not on bamboo build
There is this following link:
https://confluence.atlassian.com/bamboo/integrating-builds-with-your-issues-workflow-750396089.html
But this seems specific to when the build happens. We would like to do this when the deploy happens. But this seems very specific to the build. Is there some way to accomplish updating jira tickets on deploy?
A:
Yes, you can.
Short answer:
Install 'Pre-Post Build Command Runner' on Bamboo (https://marketplace.atlassian.com/plugins/com.sysbliss.bamboo.plugins.prepost-build-command/server/overview)
Add two stages to your build: a 'build stage and a 'deployment' stage
Add a job to the 'build' stage with tasks that package the files you want to deploy to an artifact
Add a job to the 'deployment' stage with tasks that send the artifact to your server of choice and unpack it there
Open JIRA, go to your workflows, open the desired workflow in text mode and note/write down the respective transition id (you can find it in brackets to the right of the transition name)
Assuming that your build is triggered by a commit to your repository with a respective JIRA issue key in commit message (e.g. JIRA-123):
Write a script that polls your repository, gets the message of the last commit in a desired branch, extracts the respective JIRA issue key from it and writes it down in a .txt file. Save it on your Bamboo server with a distinct name.
Write a script that reads your .txt file, extracts issue key from there, sends a POST request to JIRA API with respective transition id and issue key. Save it on your Bamboo server with a distinct name.
Go to your Bamboo build configuration, open the 'build' stage, open the 'miscellaneous' tab, enter the location of the first script in the 'Command' line of the 'Pre Build Commands' section, tick 'Run on Bamboo Server' and press 'Save'.
Go to your Bamboo build configuration, open the 'deployment' stage, open the 'miscellaneous' tab, enter the location of the second script in the 'Success Command' line of the 'Post Build Commands' section, tick 'Run on Bamboo Server' and press 'Save'.
Make sure both Bamboo and JIRA are authenticated to mess with one another. You can set up the credentials in JIRA and Bamboo settings under 'Application links'.
It took me about 15 hours to figure it out. The in-built 'Builds workflow' didn't transition my issue statuses and the answer to my question to Atlassian support is still pending.
Some hints (assuming your Bamboo runs on Linux):
Installing 'Pre-Post Build Command Runner'
a. Log onto your Bamboo server and navigate to Bamboo plugins directory:
cd ~/atlassian-bamboo-X.X.X/atlassian-bamboo/WEB-INF/lib
b. Download 'Pre-Post Build Command Runner':
wget https://marketplace-cdn.atlassian.com/files/artifact/3f77baa2-8624-4a80-9b5d-1f6029fc1133/prepost-build-command-5.6.3.jar
c. Restart Bamboo
cd ~/atlassian-bamboo-5.9.7/bin
./stop-bamboo.sh
./start-bamboo.sh
d. Go to 'Bamboo Administration/Add-ons' and click 'Pre-Post Build Command Runner' under 'User-installed add-ons'
e. Check that all its modules are enabled (it should say 'X of X modules enabled')
Configuring scripts
a. Install jq
sudo apt-get install jq
b. Script for polling your repository (assuming it's Bitbucket)
#!/bin/bash
message=$(curl --user <bitbucket-username>:<bitbucket-password> https://bitbucket.org/api/1.0/repositories/<bitbucket-username>/<bitbucket-repository>/branches/ | jq '.<branch-name>.message')
message="${message%\"}"
message="${message#\"}"
IFS=' ' read -a array <<< $message
issue=${array[0]}
echo $issue > issue.txt
c. Script for JIRA issue transition
#!/bin/bash
issue=$(<issue.txt)
curl -D- -u <jira-username>:<jira-password> -X POST --data '{"transition":{"id":"<transition-id>"}}' -H "Content-Type: application/json" https://<jira-base-url>/rest/api/latest/issue/$issue/transitions?expand=transitions.fields
rm issue.txt
Things to keep in mind:
a. Make sure both scripts are in the same location
b. Make sure to run 'chmod +X ' on both scripts
c. Make sure that JIRA issue key is included first in the commit message, e.g. 'JIRA-123 added some stuff'
d. Make sure to disable concurrent builds in Bamboo in case there's a chance another developer might push a commit to repository when your build is running
P.S. I intentionally included two stages, 'Build' and 'Deployment', in a build plan so that you can build on top of the two scripts and add intermediary scripts (e.g. post a comment to respective JIRA issue when the 'Build' stage passes or fails)
P.P.S I had to strip down my scripts to make this answer shorter, so there might be some mistakes. In case the scripts do not work, please, feel free to tell me about that in comments and I'll see what's broken.
UPDATE: Atlassian did answer my question of why Bamboo won't transition my JIRA ussue statuses in the following way:
I'm afraid the functionality, to autotransition an issue based on the Bamboo build result, is only available if you have Bamboo Cloud + JIRA Cloud.
We do have requests open to have this feature with Bamboo server
https://jira.atlassian.com/browse/BAM-1362
and
https://jira.atlassian.com/browse/BAM-14044
I encourage you to vote or comment on these requests to increase their visibility.
| null | minipile | NaturalLanguage | mit | null |
Brief Synopsis – True story of how the newly elected President of South Africa tried to unite his country through the use of the Rugby World Cup.
My Take on it – I have never been a fan of the sport of RUgby and really have no idea how the game is played.
I loved the way tho that this film was able to show how the use of sport can help affect people with differing views and opinions and try and unite them.
We all know in general how much of a grand figure Nelson Mandela was but to watch how this story unfolds shows how his vision of a unified South Africa which went against the mainstream thinking at the time was able to be spring boarded by the National Pride of sport.
Morgan Freeman and Matt Damon are both great here as the tow most influential people of the story and they both show their character’s convictions quite well.
The accents used by them (mostly Damon) seem a bit too much and started getting annoying part of the way through.
I’m aware of the fact that this is a film about sport, yet they show the game of Rugby a bit too much without finding a way to give those unfamiliar with sport a bit of a tutorial along the way.
Clint Eastwood once again shows with this movie that he will foreve be remembered as a great Director before actor.
He was able to put all the pieces together here in such a way that it looks and feels so great to wtach.
The story, cienamtograpy, character’s and of course music all work so well together that these elements make the film even more enjoyable to watch.
I especially love the two main theme songs used for this film: Colorblind and 9,000 Days.
Listen to them here:
Bottom Line – This story shows how sport can be used in more ways than just to have fun. The ideas shown here by Mandela are quite amazing to watch because we can see how much opposition he received while on his quest to unifying his country. Freeman and Damon are both great here, but the accents were a bit off kilting to listen to. They showed a bit too much of the games played which was a bit disconcerting since I don’t quite understand the rules of the game of Rugby. Another Eastwood directorial masterpiece that puts all the pieces together quite well. Great story, cinematography, characters and most of all music make this even more enjoyable to watch. Recommended!
Like this:
Related
Search MovieRob
7 thoughts on “Play To the Whistle Blogathon – Invictus (2009)”
You should have experienced the atmosphere here in South Africa during that final match. It was quite something amazing. During the match, it was amazingly quiet as pretty much every single person was watching this match. | null | minipile | NaturalLanguage | mit | null |
I like MLA Derek Mombourquette and it will be very difficult for you to convince me that he isn't sincere when he says "Home Matters". But you'll be even more hardpressed to convince me that he's willing to depart from the messages Premier McNeil authorizes from Halifax.
If McNeil isn't going to offer any increased resources (by way of provincial Equalization), Mombourquette tells us that the leading experts in Equalization (NSEF) don't know what it is. Then he defies and directly contradicts Senator Dan Christmas as he stays on party message in Halifax and proclaims: "Cape Breton is not dying".
If McNeil says our healthcare is not in crisis, then Mombourquette and his sole remaining Liberal MLA colleague in Cape Breton - Geoff MacLellan - stay on message. They promote the new model that was rushed out at a press conference to the surprise of many doctors who didn't know it was coming.
And now Mombourquette is on a very smart branding campaign. He wants to be synonymous with the idea of the plight of Cape Breton being important. If he drops off enough small cheques (that any other party would have also delivered), if he takes photos to share on social media with smiling recipients, and if he continually reinforces "Home Matters" everywhere... he'll solidify his partisan Liberal base, and alleviate the anxieties brewing among citizens who don't feel like we're doing so well - either economically or within our healthcare system.
The Derek Mombourquette I'd like to reelect is the one who demonstrates that Home Matters by bringing his allegiance back home to Cape Breton where it belongs.
Over the weekend, a post from a young family physician, Megan Keating, went viral. My initial intention was to just share and allow Dr. Keating's statement to speak loud and clear on its own, as it does so remarkably well. However, upon seeing MLA Mombourquette's post, I felt it would be valuable to showcase a direct contrast between the focus of the two - a Cape Breton politician and a Cape Breton doctor.
Both of them believe "home matters", but they seem to be demonstrating very different perspectives on the state of our healthcare at home:
Who are we to believe?
Is MLA Mombourquette and Premier McNeil right in their relaxed tone and insistence that there's no crisis? Are they correct that we just have to hang in there, and they're going to take care of the problematic (but non-crisis) conditions of healthcare in Cape Breton and the rest of the province without cause for further worry?
Or is a medical professional, Dr. Megan Keating, correct when she says that conditions she's experiencing firsthand in her workplace (our healthcare system) are "nothing short of a crisis"?
When it comes to the MLA launching a polished new branding campaign, and a doctor breaking her silence, I'm entirely inclined to take the doctor's word for it for now.
NOTE: The views expressed above are my own and do not represent lokol (goCapeBreton.com). Read more
| null | minipile | NaturalLanguage | mit | null |
So when all the fuss over Latisse wouldn't quiet down, I knew I had to play guinea pig once more. I accepted an offer from the company to try a complimentary bottle of the lash grower.
Originally a drug to treat glaucoma, Latisse's main ingredient, bimatoprost, was accidentally found to grow thicker and longer lashes as a (surprisingly pleasant) side effect in glaucoma patients. Beauty giant Allergan -- the pharmaceutical company behind Botox -- instantly saw a potential goldmine, and created the first FDA-approved lash growth drug. It costs a pretty-penny -- $120 for a 30-day supply that's not covered by insurance -- and requires a prescription from a doctor. Most women ask their opthalmologist or dermatologist.
I have to admit something off the bat here. I didn't exactly use it the way it's prescribed. The liquid comes in a dropper that you're supposed to apply to a disposable brush, and then glide the tip over your lash line, as you would eyeliner, once every night. The instructions specify to use one drop per eye, and to toss the brush after you use it, as each bottle of Latisse comes with 30 little brushes (one for each night).
The first night I tried Latisse, I dutifully applied a drop to one of these brushes and it almost completely absorbed the first drop. It took a fat second drop to coat the brush in enough product to be able to start lining my lash lines.
Questions popped into my penny-pinching head. Would two drops per eye mean one bottle of Latisse would only last me 15 days, versus one month? And now I was supposed to throw this little brush away? It seemed so wasteful.
(No, the truth is, I'm just really cheap.)
So I rang one of my equally lash-obsessed makeup artist friends in Los Angeles for advice, who -- not surprisingly -- was already using Latisse, and turned out to be feeling as frugal as me.
"Too much product goes to waste with those brushes. I use a skinny eyeliner brush with it, and just disinfect it afterward," she told me.
Now there's an idea.
So using an ultra fine eyeliner brush every night, I carefully applied a full coating of product to both lash lines with just one drop of liquid. Seven weeks later, my bottle is still going strong - and those little brushes are coming in handy as ideal smudge erasers when dipped in eye makeup remover.
In clinical tests, 4% of users reported eye itchiness and/or redness. A rare side effect is increased brown pigmentation of blue and green eyes, which is likely to be permanent. Some users have also noticed hyper-pigmentation on the eye lid, which is temporary. And, on consumer review sites like Makeup Alley, some have complained about lashes growing where they shouldn't, like in the inner corner of the eye.
I've noticed a palpable difference in the thickness and density of my lashes too. One coat of my favorite Dior Diorshow Mascara in the morning, and my lashes make me feel like a sexy, flirty Betty Boop all day.
Length-wise, my results rival that of my lash extension days - which were delicate, difficult and expensive to maintain with touch-ups needed every three weeks. (Really, what was I thinking?)
My outer lashes have grown lusher than my inner lashes, as I tend to concentrate the product on the mid to outer corners where I have more control over the liquid. If you go too far in, the drop slides more easily into the eye - which can mean a greater chance of side effects.
The final verdict?
While my results are addictively lush and long, I can't imagine going through the fuss of refilling an expensive prescription every month (or, ahem - every other month) to maintain the regime. Natural lash conditioning alternatives like Rapid Lash don't quite match the results of Latisse in my experience, but they're priced at a fraction of the cost, require no prescription and do increase lash growth quite nicely.
So if you want longer lashes without breaking the bank or using a prescription drug, go with a natural alternative like Rapid Lash.
But if you're a vixen in search of a serious lash fix, Latisse will help you get it on like no other. | null | minipile | NaturalLanguage | mit | null |
Sen.(R-Texas), a member of the Senate Intelligence Committee, said Thursday that he would raise the subpoena ofwith Chairman(R-N.C.), warning the the panel needs to stay out of politics.
ADVERTISEMENT
Cornyn, speaking to reporters outside of the Judiciary Committee, said that he could "understand [Trump Jr.'s] frustration" and warned that 'at some point … this smacks of politics."
"At some point this is not about finding facts, this smacks of politics and I think we have an important job to do to try to keep the Intelligence Committee out of politics and just keep ourselves focused on our mission, which is oversight of the Intelligence Community," said Cornyn, who is an advisor to Majority Leader Mitch McConnell Addison (Mitch) Mitchell McConnellFEC flags McConnell campaign over suspected accounting errors Poll: 59 percent think president elected in November should name next Supreme Court justice Mark Kelly: Arizona Senate race winner should be sworn in 'promptly' MORE (R-Ky.).
Pressed if he was saying he thought Burr's actions were "more about politics and not about following up on leads," Cornyn added that he "didn't say that."
"I think the committee’s been doing important work that’s been done on a bipartisan basis, and it really is about finding out what the facts are and what we need to do to prevent foreign interference in the future. I can understand Mr. Trump’s frustration now that the Mueller report has gone public and finding no evidence of collusion. I can understand his frustration at being requested to come back," Cornyn continued.
Cornyn: My understanding is @DonaldJTrumpJr has cooperated extensively with the committee, I can understand his frustration...At some pt this is not about finding facts. This smacks of politics and I think we have an impt job to do to try to keep the intel cmte out of politics. pic.twitter.com/WRasaDYzes — Alan He (@alanhe) May 9, 2019
Reports surfaced on Wednesday that the GOP-led Senate Intelligence Committee had subpoenaed Trump Jr. in connection with the panel’s Russia investigation, the first known congressional subpoena to one of President Trump Donald John TrumpBiden on Trump's refusal to commit to peaceful transfer of power: 'What country are we in?' Romney: 'Unthinkable and unacceptable' to not commit to peaceful transition of power Two Louisville police officers shot amid Breonna Taylor grand jury protests MORE’s children.
Trump Jr. previously testified before the Senate Judiciary Committee in 2017. But his comments have fallen under scrutiny after the president’s former personal attorney Michael Cohen Michael Dean CohenJudge orders Eric Trump to comply with New York AG's subpoena before Election Day A huge deal for campaign disclosure: Trump's tax records for Biden's medical records Our Constitution is under attack by Attorney General William Barr MORE claimed in his February testimony to the House Oversight and Reform Committee that Trump Jr. was far more involved in the Moscow Trump Tower project and that he briefed both Trump Jr. and Ivanka Trump Ivana (Ivanka) Marie TrumpSpecial counsel investigating DeVos for potential Hatch Act violation: report Trump, Biden vie for Minnesota Trump luxury properties have charged US government .1M since inauguration: report MORE on the project about 10 times.
The decision to subpoena Trump Jr. has sparked GOP criticism of Burr, who as chairman has been leading the committee's investigation. The panel has been running a years-long investigation into the 2016 election and Russian meddling.
Cornyn said on Thursday that he would talk with Burr about "what we need to do to wrap up our investigation."
"I wasn’t aware the subpoena was issued, it was really something done by committee staff, so I’m going to talk to the chairman and the other committee members and find out exactly where we are and what else we need to do to wrap up this investigation and report our findings to the public," he said.
Republicans argue the move is out of line with McConnell's proclamation earlier this week from the Senate floor that the Mueller investigation is "case closed," though the subpoena was issued at least a week before McConnell's speech.
Sen. Thom Tillis Thomas (Thom) Roland TillisThe Hill's Campaign Report: GOP set to ask SCOTUS to limit mail-in voting OVERNIGHT ENERGY: EPA head questions connection of climate change to natural disasters | Pebble Mine executives eye future expansion in recorded conversations | EPA questions science linking widely used pesticide to brain damage in children Liberal super PAC launches ads targeting vulnerable GOP senators over SCOTUS fight MORE (R-N.C.), who like Cornyn is up for reelection next year, said in a tweet that "I agree with Leader McConnell: this case is closed."
Sen. Rand Paul Randal (Rand) Howard PaulRand Paul says he can't judge 'guilt or innocence' in Breonna Taylor case Overnight Health Care: Health officials tell public to trust in science | Despair at CDC under Trump influence | A new vaccine phase 3 trial starts Health officials tell public to trust in science MORE (R-Ky.), who is an ally of Trump's, was the first GOP senator to publicly criticize Burr.
"Apparently the Republican chair of the Senate Intel Committee didn’t get the memo from the Majority Leader that this case was closed," Paul said in a tweet. | null | minipile | NaturalLanguage | mit | null |
Introduction
============
Even though non-immediate type allergic reactions with beta-lactam antibiotics occur more frequently than immediate reactions little is known about the actual prevalence of non-immediate beta-lactam allergy in childhood.
Objective
=========
To determine the rate and risk factors for non-immediate type beta-lactam allergy in children with a history of allergic reaction occurring at least 1 hour after the drug intake.
Material and method
===================
A prospective study was performed using ENDA questionnaire in 103 children \[4.8 (2.7-7.9) years, 60% male\] with 124 non-immediate type hypersensitivity reactions. Prick and intradermal skin testing with major/minor determinant mixture, penicilin G, ampicillin, amoxicillin-clavulanate and the culprit drug were done. In patients with negative skin tests, patch and intradermal tests with late readings were done with the culprit drug. Drug provocation was performed in case of negative interventional tests.
Results
=======
Fifteen children (14.6%) with 16 non-immediate reactions (12.9%) was diagnosed as beta-lactam allergic. The drugs responsible for non-immediate type beta-lactam allergy were amoxicillin-clavulanate (75%), sulbactam-ampicillin (6.3%), penicillin (6.3%), ceftriaxone (6.3%), cefaclor (6.3%).
The diagnosis of non-immediate type beta-lactam allergy was determined by provocation tests (n=11) prick/epidermal tests (n=3), patch tests (n=2). Only angioedema was found to increase the risk for diagnosis of non-immediate type beta-lactam allergy (OR:3.8, 95%CI:1.2-11.4, p=0.009).
Conclusion
==========
Diagnosis of drug allergy is also common in children with a history of nonimmediate reactions to beta-lactams. Classification due to timing of the reaction might not be appropriate to define the underlying pathogenesis of beta-lactam hypersensitivity since three patients had a positive skin test indicating IgE mediated beta-lactam allergy.Intradermal tests with late readings might not be practical in the diagnosis of non-immediate type beta-lactam allergy.
| null | minipile | NaturalLanguage | mit | null |
Background {#Sec1}
==========
Crises and health system performance: where do we stand in the debate? {#Sec2}
----------------------------------------------------------------------
How health services are planned, purchased, and delivered has a direct impact on the key dimensions of health system performance, i.e., efficiency, quality, and access \[[@CR1]\]. In the aftermath of the economic and financial crisis that hit most member countries of the European Union, the question is raised of whether the impact of cuts in public funding and other austerity measures had neutral effects or have undermined the performance of health services \[[@CR2]\].
As the crisis grew in intensity, the WHO Regional Office for Europe \[[@CR3]\] recommended that member states monitor the effects of their policy responses on health indicators. Few countries did so, and existing assessments have focused mainly on measuring changes in access and efficiency, thus the need for further evidence on the dimension of quality of care delivery \[[@CR4]\].
The analysis of health services delivery needs to take into account that the operation of provider organizations is more complex than assumed by political decision-makers \[[@CR5]\]. This premise is based on the neo-institutional literature that argues that macro-level policies are affected by workplace-level contingencies that produce "perverse or non-expected" effects \[[@CR6], [@CR7]\].
This has received little attention in the debates on the effects on the quality of health services of political responses to the crisis. This paper is a contribution to the debate through a deeper look at how different levels of care, e.g., hospital and primary care, and the internal stratification of the medical profession, e.g., by specialty and years of service, constitute such contingencies \[[@CR8]--[@CR10]\]. That may explain why various categories of physicians, working in different environments, have reacted differently to the pressures generated by policy responses to the crisis.
Additionally, although public services have been the main target of austerity measures, complementarity with the private sector and growing pressure for marketization in many countries \[[@CR11]\] raises the issue of understanding better how private providers have adapted to the economic crisis. There has not yet been systematic research into this matter even though some authors suggest that public regulation can be less effective in monitoring and penalizing for-profit investors for patient selection \[[@CR12]\].
The situation in Portugal {#Sec3}
-------------------------
In 2011, a Memorandum of Understanding (MoU) between the Portuguese Government and the International Monetary Fund, The European Central Bank, and the European Commission designed a €78 billion, 3-year financial adjustment program with specific timelines and policy targets to reduce the budget deficit from 9.8 to 3% of GDP in 2013. Cost containment in the health sector was considered feasible without undermining the quality of services \[[@CR13]\]. Direct cuts in the health sector were initially estimated at €550 million. However, they doubled after 1 year and reached €1.3 billion in 2013 \[[@CR14]\].
Specific health-related policies were aimed at different targets: more cost-sharing, better drug-market regulation, tighter control over physicians' prescribing and of the management of public provider organizations, more transparent public-private partnership, expansion of primary health care services, and savings on workforce costs. Table [1](#Tab1){ref-type="table"} shows the extent to which these objectives were achieved.Table 1Implementation of the MoU in Portugal 2011--2014Policy outcomeAccomplishedPartially accomplishedNot accomplishedWithdrawn/omittedCost sharingReview and increase patient feesxReduction of exemption categoriesxIncrease inflation-indexed feesxCut tax allowances for healthcare, including private insurancexReduce the cost of health benefits schemes for public servantsxReduce costs for patient transportationxRegulation of the drug marketControl retail pricexMove the responsibility of pricing to the Ministry of HealthxRevise the international reference-pricing systemxMonitor expenditure monthly and limit public spendingxRemove barriers to generic medicinesxChange the calculation of pharmacies' profit marginxGradually increase the share of generic medicinesxImplement existing legislation on the regulation of pharmaciesxSpeed up the reimbursement of genericsxIntroduce a contribution paid by pharmaciesxControl of doctors' prescriptionMake electronic prescription of medicines and diagnostic tests covered by public reimbursement fully compulsory for physicians (public and private sectors)xEncourage physicians to prescribe generic medicines and less costly branded products (public and private sectors)xIntroduce international prescription guidelines for drugs, exams and treatmentxImprove monitoring of prescription of medicines and diagnostic services and impose systematic assessments by each doctor of quantity and cost. Introduce sanctions and penaltiesxControl of operating costs and performance in the NHSLegislative and administrative framework for a centralized procurement system for the purchase of medical goodsxChange in the existing accounting framework in hospitals SOEs to that of private companies and other SOEsxConcentration and rationalization of non-hospital care provisionxConcentration and rationalization of the hospital networkxContinued publication of clinical guidelines and introduction of an auditing systemxBenchmarking of hospital performancexInteroperability of IT systems in hospitalsxFinalization and regular updates of uniform coding system for medical suppliesxImplement the centralized purchasing of medical goods using the uniform coding systemxClearing of existing arrears in the hospital sector and prevention of accumulation of new arrearsxCompletion of patient electronic medical recordsxPublic-private relationshipIncrease in competition between private providers and reduction in NHS payment of exams and treatmentsxCentralized monitoring of public-private partnership contractsxRegular revision of fees paid by the NHS for exams and treatment by private providersxAssessment of compliance with European competition rules for the provision of services in the private healthcare sectorxAccess to healthcareReinforce primary health careIncrease the number of patients per primary care unit/family doctorxIncrease the number of primary care units using salary and performance-related paymentsxSeparate HR from hospitals and reconsider the role of nurses and other professionalsxReview geographical distribution of GPsxMove hospital outpatient services to primary care unitsxWorkforceUpdate working time, increase mobility, adopt flexible time arrangements and review payment mechanismsxConduct an annual inventory of doctorsxMake human resource allocation plansxIncrease mobility of healthcare staff within and between regionsxEnsure transparent selection of the chairs and members of hospital boardsxLegend: Own elaboration from \[[@CR26], [@CR27]\]
Overall, the massive reduction in public expenditure came more from cost-sharing, tighter drug-market regulation, control over prescribing, and of the management of provider organizations. Improvements in public-private partnership, better access to primary healthcare, and workforce changes contributed to a lesser extent. Available studies of the effects of those reductions have focused mainly on efficiency and access \[[@CR15]\] and planning and purchasing of services \[[@CR16], [@CR17]\].
Objectives of the study {#Sec4}
-----------------------
The aim of this research is to provide more evidence about the effects of an adjustment program on the quality of healthcare. Its contribution to the debate is threefold. First, quality needs to be considered as important as efficiency and access. Second, it highlights to what extent an analysis of delivery of healthcare requires looking at different sources of information than those on planning and purchasing of services. Health workers' daily experiences are a rich source of information in this regard \[[@CR18]\]. Third, it presents comparisons between and within the public and private sectors, a neglected aspect in research on policy responses to economic crises in Europe.
Methods {#Sec5}
=======
Study design and participants {#Sec6}
-----------------------------
A two-step model (Fig. [1](#Fig1){ref-type="fig"}) was designed to describe the experiences of physicians working in public and private services (main-effect model) and analyze variations between the two groups based on years of experience and specialty (model with moderated effects). All types of public providers were included in the public sector, as were for-profit and professional-based insurers in the private sector.Fig. 1Analytical model
Data was collected in a national survey asking physicians about their experiences after 2011, when the financial adjustment program began. A structured, self-administered questionnaire was sent by post from May 2013 to January 2014 to all physicians registered with the Portuguese Medical Council (*N* = 43,874). The key aim was to reach as many physicians as possible with no previous criteria underpinning the selection of cases. A total of 3442 questionnaires from physicians practicing in Portugal at that time were returned and validated through consistency and readability analysis. Even though it is one of the largest national-level databases of physicians in Europe, it was not possible to define a probabilistic sample of practicing physicians in Portugal because (i) there are no standardized data on the number of doctors who have retired or emigrated or on their distribution by sector or type of medical services and (ii) confidentiality criteria imposed by the Medical Council's ethics committee prevented us from collecting the respondents' age or geographical location.
Measures {#Sec7}
--------
### Dependent variables {#Sec8}
Quality of care is analyzed in different ways depending on disciplinary backgrounds \[[@CR19]\]. The analysis adopted here lay in a structure-process link, as it was intended to ascertain whether reforms changed how care was actually delivered \[[@CR20]\]. Given that the questionnaire was sent to all registered physicians, we had to find suitable ways of comparing people in different positions and workplace settings. Therefore, the structure-process analysis was empirically driven according to the implementation of the MoU in Portugal from 2011 to 2014. Quality of care was addressed in terms of changes physicians said they had experienced in three key aspects of their daily practice: control of prescriptions, operating costs, and performance, as detailed in Table [1](#Tab1){ref-type="table"}. Six dependent variables (DVs) were defined as follows:-Administrative interference in decision making, i.e., less autonomy in physicians' decision-making in favor of organizational control: more rejections of innovative treatments (DV1), pressure to choose cheaper treatments exerted by the administration (DV4), and pressure not to prescribe certain drugs exerted by the administration (DV5)-Insufficient resources, i.e., possible limitation of material resources for the provision of care: regular shortages of supplies (gloves, masks, needles, etc.) (DV2) and regular shortages of drugs (DV3)-Deterioration in medical residency, i.e., organizational changes that directly affected physicians' advanced training: less favorable conditions for medical residencies (DV6) (e.g., overworked residents and less time for tutors' work)
The list of questions was preceded by: "Based on your personal experience and in comparison to 2011", and dichotomous dummy variables were defined with the answer "no" as a reference category (0). The proportion of "yes" answers was also used to make group comparisons.
### Independent variables {#Sec9}
The sector was analyzed at two levels: physicians working exclusively for the National Health Service (NHS) or exclusively in the private sector. The NHS included hospitals and primary health care and the private sector included small offices, clinics, and private hospitals.
### Moderator variables {#Sec10}
Years of practice meant the length of time physicians had been registered with the Medical Council (a compulsory requirement after post-graduate medical training). They were measured in months as a quantitative variable.
The 21 selected medical specialties (of a total of 41) were those of physicians working exclusively in the NHS or exclusively in the private sector. These were combined as follows: anesthesiology, cardiology, dermatology, gastroenterology, general practice/family medicine, general surgery, internal medicine, neurology, obstetrics and gynecology, oncology (medical and radiation oncology), ophthalmology, orthopedics, other surgical specialties (angiology and vascular, cardiothoracic, maxillofacial, pediatric surgery and plastic and reconstructive surgery, neurosurgery, and urology), ENT, pediatrics, physical medicine and rehabilitation, psychiatry, public health, pulmonology, radiology (nuclear medicine, neuroradiology, and radiology), and stomatology.
Data analysis {#Sec11}
-------------
Descriptive statistical analysis was used to examine the distribution of the variables, including non-answers. The independent *t* test and analysis of variance (ANOVA) were used to examine group differences on the basis of the proportion of "yes" answers for each dependent variable. A multivariate logistic regression was conducted to evaluate the moderator effect of years of practice and medical specialty in the relationship between sector of activity and quality of care using the Process Macro \[[@CR21]\]. A General Linear Model (GLM) Univariate Analysis was conducted to assess the moderator effect of medical specialty testing interaction effects. Since some of the combinations of the factorial design showed a small number of cases, a non-parametric method (bootstrap) was also used to validate the results obtained by the parametric procedure. Some of the initial medical specialties had to be excluded in order to avoid empty combinations in the factorial design. Post hoc probing was conducted to interpret significant interactions utilizing estimates obtained from the fitted models \[[@CR22]\] and also to achieve plotting interactions. All analyses were conducted using SPSS (version 23).
Results {#Sec12}
=======
Descriptive statistics {#Sec13}
----------------------
The final sample comprised 2063 physicians who had valid data according to the main inclusion criteria, working exclusively in the public or private sector (Table [2](#Tab2){ref-type="table"}). Most respondents were general practitioners and working exclusively in the public sector. The percentage of younger doctors was slightly higher. As regards dependent variables, results were as follows: 17.3% reported more refusals of innovative treatments, 64.9% regular shortages of supplies, 30.6% regular shortages of drugs, 23.8% greater pressure to choose less costly treatments, 15.6% greater pressure to limit the prescription of certain drugs, and 48.9% less favorable conditions for medical residencies (Table [2](#Tab2){ref-type="table"}).Table 2Descriptive statisticsAnalyses variables and categories*N*%Independent variableSector of activityExclusive in public120958.6Exclusive in private85441.4Total2063100.0Exclusive in publicPrimary healthcare50942.1Public hospitals63452.4Non answer665.5Total1209100.0Exclusive in privateSmall-size offices27432.1Clinics23026.9Hospital799.3Non answer27131.7Total854100.0Moderator variablesYears of practiceUp to 12 years64431.213--25 years47322.926--39 years52025.2Over 40 years42620.0Total2063100.0Medical specialtyAnesthesiology592.9Cardiology281.4Dermatology17.8Gastroenterology231.1General practice/family medicine49824.1General surgery1105.3Internal medicine1326.4Neurology16.8Obstetrics and gynecology783.8Oncology381.8Ophthalmology412.0Orthopedics492.4Other surgical specialties542.6Otorhinolaryngology291.4Pediatrics1095.3Physical medicine and rehabilitation261.3Psychiatry643.1Public Health281.4Pulmonology311.5Radiology361.7Stomatology301.5Non answer56727.5Total2063100.0Dependent variables---quality of careDV1No146582.7Yes30717.3Total1772100.0DV2No63935.1Yes118464.9Total1823100.0DV3No114969.4Yes50630.6Total1655100.0DV4No138476.2Yes43223.8Total1816100.0DV5No181984.4Yes33615.6Total2155100.0DV6No74751.1Yes71648.9Total1463100.0Notes: (1) Sums of subject numbers for the dependent variables are not always equal because of missing data; percentages are based on number of subjects for whom data were available; (2) DV1---refusal of innovative treatments; DV2---regular shortage of work supplies; DV3---shortage of drugs; DV4---pressure to choose less-expensive treatments; DV5---pressure not to prescribe specific drugs; DV6---inferior medical training
Group comparisons {#Sec14}
-----------------
A comparison of means between sectors showed that they significantly affected physicians' evaluation of quality of care in several indicators: usual shortage of supplies (*t* (1054) = 14.379, *p* \< .001) (DV2), shortage of drugs (*t* (938) = 4.809, *p* \< .001) (DV3), pressure to choose cheaper treatments (*t* (1049) = 3.001, *p* = .003) (DV4), pressure to limit the prescription of certain drugs (*t* (1276) = 6.044, *p* \< .001) (DV5), and less favorable conditions for medical residencies (*t* (684) = − 2.439, *p* = .015) (DV6). Except for the latter, there were more "yes" answers among physicians working exclusively in the public sector (see 1st step, Table [3](#Tab3){ref-type="table"}).Table 3Comparisons of quality of care between groups (t-test and one-way ANOVA)Sector of activityDV1DV2DV3DV4DV5DV6Mean^a^MeanMeanMeanMeanMean1st step Public0.1530.7310.3000.2620.2000.435 Private0.1340.2280.1100.1580.0580.571 Model test*t* (1026) = 0.683*t* (1054) = 14.379\*\*\**t* (938) = 4.809\*\*\**t* (1049) = 3.001\*\**t* (1276) = 6.044\*\*\**t* (684) = − 2.436\*2nd step PublicPrimary healthcare0.0650.8470.0910.3510.2670.385Public hospitals0.2340.6370.4370.2010.1430.471 Model test*t* (786) = − 6.663\*\*\**t* (815) = 6.893\*\*\**t* (751) = − 10.914\*\*\**t* (820) = 4.869\*\*\**t* (910) = 4.741\*\*\**t* (554) = − 1.996\* PrivateSmall-size offices0.2860.1250.1000.1610.0560.636Clinics0.0740.3330.1290.2390.0610.308Hospital0.1670.1880.1330.1940.1000.750 Model test*F* (2, 116) = 3.682\**F* (2, 115) = 2.768*F* (2, 78) = 0.0660*F* (2, 105) = 1.609*F* (2, 201) = 0.514*F* (2, 48) = 3.299\*^a^Mean = proportion of answer "yes"\**p* \< .05; \*\**p* \< .01; \*\*\**p* \< .001
Significant differences were found among physicians working exclusively at public hospitals and in primary care in all dependent variables (*p* \< .05). Physicians working exclusively in public hospitals mentioned refusal of innovative treatments (*t* (786) = − 6.663, *p* \< .001) (DV1), drug shortages (*t* (751) = − 10.914, *p* \< .001) (DV3) and, with a smaller difference, less favorable conditions for medical residencies (*t* (554) = − 1.996, *p* = .023) (DV6). Physicians working in primary care services mentioned shortages of equipment (*t* (815) = 6.893, *p* \< .001) (DV2), pressure to choose cheaper treatments (*t* (820) = 4.869, *p* \< .001) (DV4), and pressure not to prescribe certain drugs (*t* (910) = 4.741, *p* \< .001) (DV5).
Significant differences were found among physicians working in the private sector only regarding refusal of innovative treatments (*F* (2, 116) = 3.682, *p* = .028) (DV1) and, to a lesser extent, less favorable conditions for medical residencies (*F* (2, 48) = 3.299, *p* = .045) (DV6). There were fewer "yes" answers in both indicators among physicians working in clinics (see 1nd step, Table [3](#Tab3){ref-type="table"}).
Moderator analysis {#Sec15}
------------------
A moderator effect of years of practice was tested to provide a more detailed understanding of the differences between working in the public or private sector (Fig. [1](#Fig1){ref-type="fig"}). The interaction effect between sector and years of practice had a significant effect on refusal of innovative treatments (*B =* − 0.005, *Z =* − 2.396, *p* = .017, 95% CI = − 0.008, − 0.001) (DV1), pressure not to prescribe certain drugs (*B =* 0.005, *Z =* 2.884, *p* = .004, 95% CI = 0.002, 0.009) (DV5) and less favorable conditions for medical residencies (*B =* − 0.004, *Z =* − 2.075, *p* = .038, 95% CI = − 0.007, − 0.001) (DV6) (Table [4](#Tab4){ref-type="table"}).Table 4Multivariate logistic regression model with the moderator effect of years of practice on quality of careDV1DV2DV3DV4DV5DV6Exclusive in public^a^1.5561.160^\*^− 0.104− 0.115− 0.8140.571(0.857)(0.580)(0.714)(0.640)(0.710)(0.692)Years of practice (exclusive in private)0.002− 0.003^\*\*^− 0.005^\*\*^− 0.002− 0.006^\*\*^0.001(0.002)(0.001)(0.002)(0.002)(0.002)(0.002)Exclusive in public \* Years of practice^b^− 0.005^\*^0.0020.0020.0020.005^\*\*^− 0.004^\*^(0.002)0.001(0.002)(0.002)(0.002)(0.002)Constant− 2.742^\*\*^0.212− 0.229− 0.775− 0.5220.172(0.843)(0.563)(0.703)(0.626)(0.694)(0.645)Model LL =18.316^\*\*\*^186.426^\*\*\*^57.636^\*\*\*^13.628^\*\*^52.207^\*\*\*^24.265^\*\*\*^Post hoc testsYears of practice (exclusive in public)− 0.003^\*\*\*^− 0.002^\*\*^− 0.003^\*\*\*^− 0.002^\*\*^− 0.0020.000(0.001)(0.001)(0.002)(0.001)(0.001)(0.002)Non-standardized coefficients and standard errors (in brackets) are reported^a^Exclusive private (baseline)^b^Interaction effect\**p* \< .05; \*\**p* \< .01; \*\*\**p* \< .001
Figure [2](#Fig2){ref-type="fig"} shows that refusal of innovative treatments tended to be reported more by older physicians in the private sector and younger physicians in the public sector. Post hoc tests revealed a significant effect of years of practice only in the public sector (*B =* − 0.003, *Z =* − 3.941, *p* = .000, 95% CI = − 0.004, − 0.001).Fig. 2Interaction between sector and years of practice in refusal of innovative treatments
As presented in Fig. [3](#Fig3){ref-type="fig"}, the pressure not to prescribe certain drugs was not affected by years of practice in the public sector (*p* \> .05). A significant negative effect was found in the private sector and was less likely to occur among older physicians (*B =* − 0.006, *Z =* − 3.121, *p* = .002, 95% CI = − 0.009, − 0.002) (Fig. [3](#Fig3){ref-type="fig"}).Fig. 3Interaction between sector and years of practice in pressure not to prescribe certain drugs
In contrast, less favorable conditions for medical residencies were not affected by years of practice in the private sector (*p* \> .05), while a significant negative effect was observed in the public sector (*B =* − 0.003, *Z =* − 4.219, *p* \< .001, 95% CI = − 0.005, − 0.002) (Fig. [4](#Fig4){ref-type="fig"}).Fig. 4Interaction between sector and years of practice in deterioration in medical training
Regarding regular shortages of supplies and drugs, only the main effect was significant, as years of practice did not have a moderating effect (*p* \< .05) (Table [4](#Tab4){ref-type="table"}). Older physicians made less mention of regular shortages of supplies in both the private and public sectors (*B =* − 0.003, *Z =* − 2.594, *p* = .01, 95% CI = − 0.006, − 0.001 and *B =* − 0.002, *Z =* − 3.238, *p* = .001, 95% CI = − 0.003, − 0.001, respectively). Drug shortages also produced fewer "yes" answers from older physicians and this significant effect occurred in both sectors (*B =* − 0.005, *Z =* − 2.622, *p* = .009, 95% CI = − 0.008, − 0.001 and *B =* − 0.003, *Z =* − 4.821, *p* \< .001, 95% CI = − 0.004, − 0.002, private and public respectively).
Moderation by medical specialty was also tested (Fig. [1](#Fig1){ref-type="fig"}). The interaction between sector and medical specialty had a significant effect on refusal of innovative treatments (*F* (11, 595) = 1.988, *p* = .035) (DV1) and shortages of drugs (*F* (11, 520) = 4.206, *p* \< .001) (DV3) (Table [5](#Tab5){ref-type="table"}).Table 5GLM Univariate Analysis with the moderator effect on the relationship between medical specialty and quality of careDV1DV2DV3DV4DV5DV6Sector*F* (1, 595) = 0.842*F* (1, 609) = 68.809\*\*\**F* (1, 520) = 23.010\*\*\**F* (1, 606) = 0.006*F* (1, 764) = 0.571*F* (1, 382) = 2.038Medical specialty*F* (11, 595) = 2.701\*\**F* (11, 609) = 3.447\*\*\**F* (11, 520) = 0.898*F* (11, 606) = 1.130*F* (11, 764) = 1.143*F* (11, 382) = 0.927Interaction between sector and medical specialty*F* (11, 595) = 1.988\**F* (11, 609) = 1.370*F* (11, 520) = 4.206\*\*\**F* (11, 606) = 0.993*F* (11, 764) = 0.822*F* (11, 382) = 1.353*GLM* General Linear Model\**p* \< .05; \*\**p* \< .01; \*\*\**p* \< .001
There was a significant difference between the two sectors for refusal of innovative treatments in stomatology (*p* = .024) and radiology (*p* = .004). On the other hand, the answer "yes" was more frequent for oral medicine in the private sector and radiology in the public sector (Fig. [5](#Fig5){ref-type="fig"}). Shortages of drugs were significantly different between the sectors in various specialties: physical medicine and rehabilitation (*p* = .001), internal medicine (*p* = .020), general practice/family medicine (*p* = .020), general surgery (*p* = .006), ophthalmology (*p* = .038), and psychiatry (*p* \< .001). With the exception of general practice/family medicine, the answer "yes" was more frequent in the public sector for all the other medical specialties (Fig. [6](#Fig6){ref-type="fig"}).Fig. 5Interaction between sector and medical specialty in refusal of innovative treatments Fig. 6Interaction between sector activity and medical specialty on shortage of drugs
Discussion {#Sec16}
==========
The understanding of the effects of adjustment programs like those of Greece, Portugal, Ireland, and Cyprus fills an important gap in the literature on policy responses in Europe to the recent economic crisis. Conclusions result in non-convergent evidence and therefore further analysis is required. The framework for this study was built on two overlooked assumptions. First, the understanding of the effects of the crisis on health systems performance is still limited given that few analyses have been conducted on quality of care as compared to efficiency and access. Second, looking at healthcare delivery is likely to reveal differences in relation to the analysis of planning or purchasing due to workplace-level contingencies. This led us to assess, based on the experience of those who provide care, whether structural reforms impacted the care delivery process and the quality of services.
Accordingly, we suggest that the reforms made under the Portuguese adjustment program had negative effects on the quality of care, namely in terms of shortages of work resources, less favorable conditions for medical residencies, and to a lesser extent, more administrative interference in clinical decisions. Reports of negative effects were consistently higher among physicians working exclusively for the NHS, which illustrates that the public sector was the main target of health-related austerity measures, even though these were expected to apply to all types of providers without exception.
Our findings show also that the austerity measures were felt differently in the public and private sectors. Results in the NHS suggest insufficient resources and greater constraints on physicians' individual decision-making (e.g., equipment shortages and administrative interference in clinical decisions). In the private sector, the main outcome of reforms was the negative impact on medical residencies due to overworked residents and to less time for tutors to provide training. Constraints in both sectors require further studies for a better understanding of its effects on clinical autonomy and training and ultimately on health outcomes.
Looking at public and private services, physicians in public hospitals reported more denials of innovative treatments, more drug shortages, and less favorable conditions for medical residencies. Primary care physicians reported more equipment shortages and administrative interference in medical decisions. In the private sector, physicians in small offices reported more refusals of innovative treatments than those in clinics and private hospitals, while the latter complained more deterioration in medical residency.
The argument that physicians' experiences depend on the sector of activity is reinforced when we analyzed the moderating effects of two key factors in medical hierarchy (years of practice and specialty). The reporting of denial of innovative treatments decreases with seniority in the public sector, while it increases in the private sector. Administrative interference was perceived as higher by less-experienced physicians in the private sector, while in the public sector years of service made no difference as to the pressure to limit the prescription of certain drugs. More less-experienced physicians in the public sector mentioned less favorable conditions for medical residencies, while this trend was not found in the private sector. As to differences between medical specialties, refusal of innovative treatments was more reported by stomatologists in the private sector than those in the public sector and by radiologists in the public sector than those in the private sector. Shortage of drugs was more reported by public-sector physiologists, internists, surgeons, ophthalmologists, and psychiatrists than by these specialists in the private sector, while general practitioners in the private sector reported it more than their colleagues in the NHS.
Our study shows that physicians in public and private sectors and within each sector have different perceptions, depending on their specific characteristics, of the impact of the same policy responses.
A number of potential long-term effects that this empirical study cannot address are associated with these results. One in particular is here uncovered to highlight possible directions for research. Lower quality healthcare services presumably affect health professionals' and patients' individual choices. Given that the influence of trust in individuals' decisions is well understood \[[@CR23], [@CR24]\], the understudied link is the effects of lower quality on the undermining of trust relationships in health. The issue is to know how lower quality affect professionals' and patients' individual choices and whether these choices can affect health systems structurally.
As to the NHS, the quality-trust link builds on the moral contract between authorities, citizens, and professionals. Professionals feeling that they are not being given the conditions they need for their work and patients questioning the need for higher taxation to fund access to services that are less trustworthy can translate into the growth of the private market in parallel to the public sector. As to the private sector, the quality-trust link is a key element in market competition. Greater pressure is put on the supply side in investment in communication strategies and patient-centered care approaches. Consequently, it is relevant to discuss possible increases in households' spending and growing exposure to deregulation of the health labor market.
Limitations {#Sec17}
-----------
We were unable to establish the representativeness of the respondents, even though the total number of over 3000 is high. Also, the instrument does not permit a clear assessment of the moderating effect of physicians' years of practice and specialties, selected as proxy of internal stratification of the medical profession. More empirical in-depth research into this issue is needed. Lastly, the measurements of quality of care delivery reflect physicians' personal experiences and views and are therefore not comparable to those of health workers.
Conclusion {#Sec18}
==========
The aim of this article was to add to the understanding of the effects of policy responses to the 2008 crisis on health system performance in Europe. In Portugal, there is an institutional discourse that the health system adapted well to cost containment \[[@CR25]\]. By focusing on the perceptions of professionals of the effects of the crisis on their work and on the quality of care, we offer a complementary contribution. Also, our findings show that the outcomes of policy responses may not have been the same in all national health care systems, therefore requiring context-sensitive analyses.
The added value of an analysis built on a macro (political)-micro (organizational) link is likely to reveal a different reality from that showed by general statistics, which do not reflect concrete experiences. It also shows the non-linearity between policy setting and expected outcomes, which is particularly relevant in assessing the effects of austerity measures. The fact that only physicians were surveyed and the lack of standardized data on physicians in Portugal are limitations that further research can help mitigate.
DV
: Dependent variable
MoU
: Memorandum of Understanding
NHS
: National Health Service
This article is a partial outcome of broad scientific collaboration between a research team at the University Institute of Lisbon, coordinated by Dr. Tiago Correia, and the Portuguese Medical Council, with the aim of studying the effects of the adjustment program on physicians. We are very grateful to all the physicians who agreed to participate in the study and to Joana Vieira for helping collect some institutional information.
Funding {#FPar1}
=======
TC holds a research grant funded by FCT \[SFRH/BPD/84175/2012\]. No additional funding was received for this study.
Availability of data and materials {#FPar2}
==================================
The datasets generated and/or analyzed during the current study are not publicly available due to the ethics approval by the Portuguese Medical Council's ethics committee.
TC had the idea for the paper, developed the conceptual approach, wrote the first draft, and revised the manuscript. GC participated in the development of the conceptual approach and revised the first draft of the manuscript. HC developed the data analysis and co-wrote parts of the manuscript. JMS created the tool of data collection and coordinated the process of data gathering. GD participated in the development of the conceptual approach and revised the second draft of the manuscript. All authors read and approved the final manuscript.
Ethics approval and consent to participate {#FPar3}
==========================================
The authors hereby declare that (1) the content of the questionnaire, (2) the storage in paper format and digital records, and (3) data analysis received the approval by the Portuguese Medical Council's ethics committee.
Consent for publication {#FPar4}
=======================
Not applicable.
Competing interests {#FPar5}
===================
TC, GC, HC, and GD declare that they have no competing interests. JMS was at the time of the study President of the Portuguese Medical Council.
Publisher's Note {#FPar6}
================
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
| null | minipile | NaturalLanguage | mit | null |
Q:
Adding Panels to a Form in C# during execution
I've been diving into C# for the first time by trying to recreate a screensaver that I made in Java comprised of a grid of panels which change color randomly. So far, I've gotten the code for the panels to work, and now I'm trying to add them to a Form to prototype the layout. I plan to determine the number of panels to be displayed at runtime (so that 16:9, 4:3, 16:10, etc. can all make the screensaver look good), but the only ways that I've found from searching the internet to add elements to a Form involve using Visual Studio's design tools. Therefore, I have a few questions:
How can I set up the layout of the Form in something akin to Java's GridLayout?
What's the code needed to add elements to a Form?
Is there a better thing for me to be using instead of a Form?
A:
You can add panels to a form at runtime the same way the designer does - construct the Panel, and add it to the form (via this.Controls.Add(thePanel);).
The easiest way to see the appropriate code is to add a panel to the form using the designer, then open up the "YourForm.designer.cs" file. The designer just generates the required code for you - but you can see the exact code required to duplicate what the designer would create.
As for the layout, I'd recommend watching the Layout Techniques for Windows Forms Developers video. It may give you some good clues as to the various options available for layout. There is nothing exactly like Java's GridLayout, though there are some open source projects that attempt to duplicate this functionality.
A:
You definitely are gong to need to create a form application to get this to work. In addition, every control you see in the designer, can be added programmatically.
You could have a method that cranks out new panels as needed....
Here is the code that will create a new panel:
Panel panel1 = new Panel();
Once it is declared, you can access all the properties.
To add the panel to the form you would do something like this....
myform.controls.add(panel1);
So knowing that, you can create a method that will format your panel and return or add it tor the form....
| null | minipile | NaturalLanguage | mit | null |
Pregnancy outcomes among women with panic disorder - do panic attacks during pregnancy matter?
To assess the risks that maternal panic disorder (PD) during pregnancy contribute to adverse pregnancy outcomes, with the effects further specifically differentiated into mothers who experienced a panic attack during pregnancy and those who did not. This study linked two nationwide population-based datasets: the birth certificate registry and the Taiwan National Health Insurance Research Dataset. We identified a total of 371 women who gave birth from 2001 to 2003, who had been diagnosed with PD within 2 years prior to the index delivery, together with 1585 matched women without this chronic disease as a comparison cohort. Multivariate logistic regression analyses were performed to estimate odds ratios. Results indicated that compared to women without chronic disease, PD mothers who experienced panic manifestations during pregnancy and those who did not were independently associated with respective 2.29- (95% confidence interval (CI)=1.14-4.60) and 1.45-fold (95% CI=1.03-2.04) increased risks of having small-for-gestational-age infants. Further, for PD mothers who experienced a panic attack during gestation, the adjusted odds ratio for having a preterm delivery was 2.54 (95% CI=1.09-5.93), whereas no significant difference was identified between PD women who did not have a panic attack during pregnancy and women without PD. Our study was unable to investigate the effects of such risk factors as dietary habits, cigarette smoking, and alcohol use in the regression model. We conclude that prenatal PD, particularly the occurrence of panic attacks during pregnancy, was associated with adverse birth outcomes. | null | minipile | NaturalLanguage | mit | null |
Chevron and Transocean given 30 days to suspend drilling pending probes into two oil spills off coast of Rio de Janeiro.
Gallons of oil crude began seeping from cracks in the ocean floor at a Chevron appraisal well in November 2011 [EPA]
A federal court has given Chevron and Transocean 30 days to suspend all petroleum drilling and transportation operations in Brazil until investigations are completed into two oil spills off the coast of Rio de Janeiro.
The court said in a statement posted on Wednesday on its website that each company will be fined 500 million reals, or about $244m, for each day they fail to comply with the suspension.
About 155,000 gallons of oil crude began seeping from cracks in the ocean floor at the site of a Chevron appraisal well in November. Chevron has placed the amount of oil that leaked at 110,000 gallons.
Two weeks later, the National Petroleum Agency said the seepage was under control. But in March, oil again started leaking and Chevron voluntarily suspended production in the field.
"Two environmental accidents in the space of just four months and the lack of equipment needed to identify the origin of the leaks and contain them, shows that the two companies do not have the conditions necessary to operate the wells in an environmentally safe manner," Judge Ricardo Perlingeiro said in his ruling.
Chevron said in an emailed statement it planned to appeal the court's decision.
"Chevron Brasil is confident that at all times it acted diligently and appropriately," the statement said, adding that the company's "response to the incident was implemented according to the law, industry standards and in a timely manner. The source of the leak was contained in four days".
Transocean said in a statement: "We maintain that this case is without merit and reiterate that Transocean crews acted responsibly and quickly, following the highest industry standards."
Safety infractions
Petroleum agency head Magda Chambriard said last month that the November spill involved about 25 safety infractions for which Chevron will be fined up to 50 million reals, or about $25m, the maximum allowed under Brazilian law.
Chevron has said that it underestimated the pressure in an underwater reservoir, causing crude oil to rush up a bore hole and eventually escape into the surrounding seabed about 370km off Rio de Janeiro's coast.
The oil seeped from at least seven narrow fissures on the ocean floor, all within 50 metres of the wellhead. No oil reached Brazilian shores.
According to the petroleum agency, Chevron "was not able to correctly interpret the geology and local fluid dynamics" of the reservoir when the leak occurred. It blamed Chevron's water-injection practices for the reservoir pressure.
Earlier this year, Brazilian authorities banned Chevron from any new drilling or water-injection activities at working wells in the country.
In April, a Brazilian prosecutor filed an $11bn lawsuit against Chevron and Switzerland-based Transocean for both the leak in November and the one in March, alleging they caused environmental damage.
Prosecutors also asked that Chevron be temporarily prohibited from sending any profits made in Brazil outside the country.
A month before that lawsuit, federal prosecutors filed criminal charges against 17 Chevron and Transocean executives accusing them of environmental crimes, of misleading the petroleum agency about safety plans and of not providing accurate information after the spill.
The charges carry a maximum penalty of 31 years in prison.
Judges must still decide if the cases will go to trial, which would be a lengthy process given the number of defendants, the case's complexity and the Brazilian legal system's room for numerous appeals. | null | minipile | NaturalLanguage | mit | null |
Q:
Managing MySQL SET datatype in PHP
I have a column 'Ambience' of the following datatype in a MySQL database:
set('Funny', 'Sad', 'Scary')
I am querying the data through PHP with:
$result = mysqli_query($con,"SELECT * FROM Films");
I am wondering how to deal with this data type on the client-side. For example, I want to find a film that is scary and print it. Should I treat the whole SET datatype as a string?
A:
This is bad design as you need to search for specific values of Ambience filed. You can use FIND_IN_SET, but your query will be slow. Turn to atomic values for Ambience
| null | minipile | NaturalLanguage | mit | null |
Wordplay
Further Example
So far we have learnt that a cryptic clue is almost always split into two parts - the definition and the subsidiary indication - and seen an example of a clue where the subsidiary indication is another definition:
Capital city in Georgia (6)
However, in the majority of clues the subsidiary indication will come in the form of wordplay, rather than a second definition.
Wordplay involves the solver finding synonyms of words, performing actions on words (such as finding an anagram or reversing the letters), and finding abbreviations. Once these are found, they need to be put together as the clue instructs to make the answer word.
To illustrate how wordplay works, let's remind ourselves of the example diagram from the previous page:
Here we can see that the clue's wordplay consists of the words RAILWAY FOLLOWING DEPRESSION.
To get to the answer word, the solver must (in this case) find the abbreviation of RAILWAY (RY), a synonym of DEPRESSION (LOW), and take heed of the instruction FOLLOWING to put RY after LOW to create the painter LOWRY.
These are the basics of wordplay - finding synonyms and abbreviations of words and putting them together to form the answer word.
Here we can see that the wordplay consists of the words CAREER and KNOCK. When the solver finds the correct synonym for each, SPEED and BUMP, they make the answer word which is confirmed by the definition. Again, this is the fundamental nature of wordplay - building the answer word by putting words or parts of words together.
These examples should start to give an insight into another fundamental part of cryptic crosswords. The words in the surface reading of the clue (the clue as read on the page) have a different meaning in what is known as the cryptic reading of the clue.
It is this contrast between surface and cryptic reading that will be further explained in the next section of the guide. | null | minipile | NaturalLanguage | mit | null |
Realizing that I was witnessing something completely weird, I threw a tape into my VCR and recorded about 70% of the film. It became one of the most cherished gifts I ever gave my stoner buddy Ken. But I can’t even play the ‘dude, I was so wasted’ card, because I was stone cold sober at the time | null | minipile | NaturalLanguage | mit | null |
Austin, a liberal college town and the state capital, is perhaps best known for its hip counterculture, live music and string of successful high-tech companies.
Fast cars? Not so much.
But in a couple of weeks, Austin will become the epicenter of the auto racing world when its gleaming new $400 million track, the Circuit of the Americas, hosts the first Formula One race in the United States since 2007.
For top drivers like Sebastian Vettel of Germany and Fernando Alonso of Spain, the Nov. 18 race offers the penultimate chance to improve their standing in the coveted F1 championship — arguably the most prestigious prize in motor sports — on a track with one of the most challenging turns in the world.
But for the host city, it will be an opportunity to prove that screaming-fast race cars and the well-heeled clientele that follows them around the globe will be welcome in a town that made a homeless transvestite a local celebrity and whose most famous bumper sticker is “Keep Austin Weird.” | null | minipile | NaturalLanguage | mit | null |
All relevant data are within the paper and its Supporting Information files.
Introduction {#sec004}
============
Visceral leishmaniasis (VL) caused by the species *Leishmania donovani*, is the most severe form of leishmaniasis and is endemic in the region of Indian subcontinent. Due to its digenic nature, parasites multiply as an amastigote form within the phagolysosome of macrophages in the liver and spleen of the host \[[@pntd.0004904.ref001]\]. Thus, entry and survival inside the macrophage is an imperative factor for the fulfillment of pathogenesis.
Sialic acids (Sias) are acidic sugars containing nine carbon backbones predominantly present in the terminal residue of the cell surface as well as secreted glycoproteins and glycolipids \[[@pntd.0004904.ref002]\]. Sias participate in an array of cellular functions such as ligand for sialic acids binding immunoglobulins like lectins (siglecs), shielding element for many receptors, negatively charged barrier for various cells even pathogens, regulation of immune cell activation and leukocyte extravasations \[[@pntd.0004904.ref003]\]. An array of human pathogens such as *Haemophilus influenza*, *Pseudomonas aeruginosa*, *Escherichia coli*, *Neisseria meningitides*, *Campylobacter jejuni and Trypanosoma cruzi* either acquire or synthesize Sias for successful infection by dampening the host immune system \[[@pntd.0004904.ref004], [@pntd.0004904.ref005]\].
Siglecs come under the group of immunoglobulin-type (I-type) lectins present mainly on haemotopoetic cell lineages with a vast structural diversity in recognition of their ligands. Fourteen human and nine murine siglecs have been reported so far \[[@pntd.0004904.ref006]\]. Siglec-3/CD33 group is the major group of siglecs with a high degree of interspecies sequence homology. Most of the siglecs contain immunoreceptor tyrosine-based inhibitory motif (ITIM) in the cytoplasmic domain. One of the exceptions is siglec-1 (CD169/sialoadhesin), which has an extended extracellular structure with no ITIM bearing motif in cytosolic region \[[@pntd.0004904.ref007]\]. ITIM motif gets activated upon ligand binding to the siglec and recruits SH2-domain containing protein tyrosine phosphatase 1/2 (SHP-1/2) to carry out various signaling pathways \[[@pntd.0004904.ref008]\].
We have previously reported the presence of sialoglycans, especially 9-*O*-acetylated form of Sias both on promastigote and amastigote of *Leishmania donovani* \[[@pntd.0004904.ref009]--[@pntd.0004904.ref016]\]. Although the function of 9-*O*-acetylated Sias in entry and virulence of parasite was reported earlier, no systemic investigation on the role of sialic acids on dampening of host innate immune response by modulation of signaling pathways has been addressed properly. Macrophages are the safe house of this parasite. Sialic acids recognizing receptors (siglec-1 and siglec-5) are present in this immune cell. Hence the detailed study of the involvement of these siglecs in binding, phagocytosis, modulation of SHP-1 and downstream signaling pathways during *Leishmania* infection became worthwhile.
Our current findings established the involvement of sialic acids of *L*. *donovani* in siglec-1 mediated binding and phagocytosis in macrophages. Furthermore, we demonstrated altered downstream signaling pathways leading to suppression of effector functions of innate immune response specifically due to this Sias-siglec-5 interaction. Such in-depth comparative study between high Sias containing virulent strain AG83 (AG83^+Sias^) and sialidase treated AG83 (AG83^-Sias^) along with low Sias containing avirulent strain UR6 conclusively ascertain the important role of sialic acids in siglec-mediated interaction and altered immune regulation for establishment of successful infection.
Materials and Methods {#sec005}
=====================
Ethics statement {#sec006}
----------------
All the animal-related experiments were performed according to the National Regulatory Guidelines issued by Committee for the Purpose of Control And Supervision of Experiments on Animals (CPCSEA), Ministry of Environment and Forest, Govt. of India. Use of Balb/c mice was approved by the Institutional Animal Ethics Committee of CSIR-Indian Institute of Chemical Biology, Kolkata, India with license number 147/1999/CPCSEA. Animals were housed under standard condition such as temperature (25 ± 1°C), relative humidity (55 ± 10%) and 12 hr/12 hr light/dark cycles and fed with standard diet.
Materials {#sec007}
---------
Fluorescein isothiocyanate (FITC), bovine serum albumin (BSA), 4\',6-diamidino-2-phenylindole (DAPI) and Giemsa stain were obtained from Sigma (St. Louis, MO). Sialidase was from Roche Applied Science (Mannheim, Germany); Mounting medium was from Amersham Biosciences (Uppsala, Sweden); *Sambucus Nigra* lectin (SNA) and *Maackia amurensis* lectin (MAL) were from Vector Labs; 2\'7\'- dichloro dihydro fluorescein diacetate acetyl ester (H~2~DCFDA) was from Molecular probes (OR, USA); siglec-E siRNA was from santa cruz Biotechnology and DyNAmo ColorFlash SYBR Green qPCR kit was from Thermo Scientific (USA). All the cytokine ELISA kits, PE-rat anti-mouse CD14 and SHP-1 antibody were obtained from BD pharmingen and BD Biosciences (USA). Anti-Siglec-E antibody was from R&D systems (MN, USA); RNeasy Mini Kit was from Qiagen (Limburg, Netherlands); Reverse Transcriptase Kit was from Promega (WI, USA) and PCR reagent system was from Invitrogen (CA, USA). All other antibodies were from Cell Signaling Technologies (MA, USA), unless indicated otherwise.
Parasite culture {#sec008}
----------------
*L*. *donovani* sodium antimony gluconate (SAG) sensitive strain AG83 (MHOM/IN/1983/AG83) was originally isolated from an Indian patient with Kala-azar at Calcutta National Medical College, Kolkata. Recently this has been deposited to American type culture collection (ATCC) by Dr. Nahid Ali from this Institute. Parasite was maintained in M-199 medium supplemented with 10% heat inactivated fetal calf serum (FCS,v/v) and gentamycin sulphate (200 μg/ml) at 22°C. These parasites are designated as parasite^+Sias^. To ensure the virulence, parasites were routinely passage through hamster. Additionally, SAG sensitive Dd8 (MHOM/IN/80/Dd8) and untyped 2001; SAG resistant GE1 (MHOM/IN/90/GE1) and untyped 39 along with an avirulent strain UR6 (MHOM/IN/78/UR6) were obtained from CSIR-Central Drug Research Institute (CDRI), Lucknow and maintained similarly \[[@pntd.0004904.ref017], [@pntd.0004904.ref018]\]. UR6 failed to establish *in vivo* infection when injected through intracardiac route in hamster. Macrophages are capable of producing superoxide even upon UR6 infection and thereby give protection \[[@pntd.0004904.ref018]--[@pntd.0004904.ref020]\].
Cell culture {#sec009}
------------
Murine macrophage cell line J774A.1, Human monocytic cell line THP-1 and Chinese hamster ovary (CHO)-wild type (WT) cell line were obtained from ATCC. J774A.1 was cultured in IMDM supplemented with 10% heat-inactivated FCS and antibiotic antimycotic solutions at 37°C with 5% CO~2~ \[[@pntd.0004904.ref021]\]. THP-1 and CHO-WT cells were maintained similarly in RPMI medium. Different siglec-transfected CHO cells namely CHO-siglec-1, CHO-siglec-3, CHO-siglec-5, CHO-siglec-7, CHO-siglec-9, and CHO-siglec-10 were routinely cultured in F-12 medium. Many of these siglecs are reported to be present on macrophages and monocytes.
Dot blot {#sec010}
--------
Dot blot was performed as described previously with some modifications \[[@pntd.0004904.ref022]\]. Briefly, log phase AG83^+Sias^ promastigotes (1×10^7^) were suspended in phosphate buffer saline (PBS) and blotted onto the nitrocellulose membrane. After air drying, blots were blocked in PBS-BSA (3%), overlaid with soluble human siglec-Fc chimeras, washed and incubated with horseradish peroxidase (HRP)- protein-A for 2 hr at 25°C. After washing, blots were developed by di-amino benzidine (DAB) in H~2~O~2~ solution and quantified by densitometric analysis using Master Totallab Software, version 1.11.
Sialidase treatment and FITC labeling of parasites {#sec011}
--------------------------------------------------
*L*. *donovani* promastigotes grown in FCS-containing medium is designated as parasite^+Sias^. They were treated with sialidase as described previously with some modifications \[[@pntd.0004904.ref009]\]. Briefly, promastigotes were initially incubated with 9-*O*-acetyl haemagglutinin esterase of Influenza C virus (100 U/ml, 100 μl/tube) for 1 hr at 37°C to remove *O*-acetyl group. Subsequently, esterase-treated cells were washed and incubated with *Arthrobacter ureafaciens* sialidase (100 mU/ml, 10 mU/100 μl/tube) for 30 min for removal of Sias from the surface. Parasites were washed and designated as parasite^-Sias^. Parasite^+Sias^ and parasite^-Sias^ were labeled with FITC as stated earlier \[[@pntd.0004904.ref021]\]. Log phase promastigotes were suspended in 0.1% FITC containing carbonate buffer (pH 8.0) and incubated for 1 hr at 22°C \[[@pntd.0004904.ref019]\]. Parasites were washed and suspended in medium supplemented with FCS (2%).
Binding of *Sambucus nigra lectin* (SNA) and *Maackia amurensis lectin* (MAL) with parasites {#sec012}
--------------------------------------------------------------------------------------------
Presence of linkage-specific Sias on different *L*. *donovani* strains was explored as described earlier \[[@pntd.0004904.ref009], [@pntd.0004904.ref023]\]. Parasite^+Sias^ and parasite^-Sias^ (1×10^7^/ml) were incubated with FITC conjugated SNA and MAA (5.0 μl, 5.0 μg/ml) for 1 hr at 4°C. Cells were washed in PBS and FITC positivity was acquired in flow cytometry (BD Biosciences) and by analyzing 10000 cells in CellQuestPro software.
Binding of FITC-parasites with mammalian cells {#sec013}
----------------------------------------------
Binding of FITC-parasite^+Sias^ with CHO cells was tested as described before \[[@pntd.0004904.ref022]\]. CHO-siglec-1, CHO-siglec-3, CHO-siglec-5, CHO-siglec-7, CHO-siglec-9 and CHO-siglec-10 along with CHO-WT cells were either left untreated or blocked with specific anti-siglec-antibodies for 1 hr at 4°C. Cells were washed and incubated with parasite^+Sias^ and sialidase treated parasite^+Sias^ separately at 1:10 (CHO cells: parasite) ratio for 1 hr at 4°C. Unbound parasites were removed by washing and binding was measured by flow cytometry. Comparative binding of AG83^+Sias^, AG83^-Sias^ and UR6 with J774A.1 and THP-1 cells were evaluated similarly.
Confocal microscopy {#sec014}
-------------------
Sias-siglec interaction-mediated adhesion of FITC-parasite with J774A.1 was visualized by confocal microscopy \[[@pntd.0004904.ref021]\]. Briefly, J774A.1 cells (2×10^4^) seeded on a glass coverslip grown for 48 hr in IMDM medium. One set of J774A.1 cells were prior blocked with anti-siglec-antibodies (anti-siglec-1, E and F) for 1 hr at 4°C. FITC-AG83/UR6 (sialidase-treated and untreated) was incubated with J774A.1 cells (anti-siglec antibody-treated/ untreated, 1:10 ratio) for 30 min at 4°C. Unbound parasites were washed with PBS. Subsequently, these macrophages were labeled with phycoerythrin (PE) conjugated anti-CD14 antibody for 30 min at 4°C. Cells were washed, fixed in paraformaldehyde and mounted in mounting media containing DAPI to stain nucleus. Images were acquired by Andor Spinning Disc Confocal microscope (Belfast, U.K.) with a 60×/1.42 NA oil immersion objective.
Flow cytometric analysis of phagocytosis {#sec015}
----------------------------------------
Phagocytosis was performed as stated earlier with modifications \[[@pntd.0004904.ref024]\]. J774A.1 cells (1×10^6^) were preincubated with anti-murine-siglec-1(anti-Sn) for 1 hr at 4°C in PBS-BSA (2%) or left untreated. These cells were infected with FITC-AG83^+Sias^ and AG83^-Sias^ (1: 10 ratio) for 2 hr at 37°C, which is the physiological temperature for phagocytosis. Unbound parasites were removed and the fluorescence intensity coming from extracellular non-phagocytosed FITC-AG83 was quenched by trypan blue treatment. Trypan blue quench the fluorescence of FITC by shifting the fluorescence from Fl1 channel to Fl3 channel. So, no signal from the surface of the cell will be detected in Fl1. Only the intracellular FITC signal will be detected in the Fl1. Therefore, visible intracellular fluorescence intensity was only due to phagocytosed parasites. This fluorescence was determined by flow cytometry.
Measurement of extracellular phagocytosis {#sec016}
-----------------------------------------
Siglec1-dependent phagocytosis of AG83^+Sias^ promastigote was also visualized by confocal microscopy \[[@pntd.0004904.ref021]\]. J774A.1 cells were left untreated or treated with anti-murine-siglec-1, were infected with FITC-AG83^+Sias^ (sialidase-treated/untreated) for 2 hr at 37°C. Unbound parasites were washed; extracellular fluorescence was quenched by trypan blue and processed similarly as described in the previous section of confocal microscopy.
Quantitation of nitric oxide (NO) {#sec017}
---------------------------------
Nitric oxide was measured in cultured supernatant by Griess reaction as stated earlier \[[@pntd.0004904.ref025]\]. Briefly, J774A.1 cells (1×10^6^/well) were infected with AG83^+Sias^ or AG83^-Sias^ or UR6 at 1:10 ratio for 4 hr in a six well plate. After the infection, unbound parasites were washed out and the cells were kept in desialylated FCS-containing medium for additional 20 hr. FCS was desialylated by treating with 2M propionic acid at 80°C for 2.5 hr followed by extensive dialysis. Culture supernatant was collected and accessed the accumulated nitrite.
Detection of reactive oxygen species (ROS) {#sec018}
------------------------------------------
ROS generation was measured as described earlier \[[@pntd.0004904.ref026]\]. Briefly, J774A.1 cells (1×10^6^) were either left uninfected or infected with AG83^+Sias^ or AG83^-Sias^ or UR6 for 1 hr. Unbound parasites were removed, macrophages were washed and stained with H~2~DCFDA (10 μM) for 30 min at 37°C. Cells were acquired in FACS similarly.
Measurement of intracellular parasites by Giemsa staining {#sec019}
---------------------------------------------------------
J774A.1 cells (2×10^4^) were grown on glass coverslip and left untreated or blocked with anti-murine siglec antibodies (anti-siglec-1,-E,-F) for 1 hr. They were infected with AG83^+Sias^ or AG83^-Sias^ or UR6 at 1: 10 ratio for 4 hr. Unbound parasites were removed. Infection was continued for additional 20 hr in desialylated serum-containing IMDM medium. The coverslip was methanol fixed and stained with Giemsa. Intracellular parasites were counted manually in light microscope (Ziess) at oil immersion (100×). The value was represented by amastigote number per 100 macrophages \[[@pntd.0004904.ref027]\].
Determination of secreted cytokines {#sec020}
-----------------------------------
Bone marrow derived macrophages (BMDM) were isolated as stated earlier \[[@pntd.0004904.ref028]\]. BMDM (1×10^6^) were left either uninfected or infected with AG83^+Sias^ or AG83^-Sias^ or UR6 for 4 hr. Unbound parasites were removed and infection was allowed for additional 20 hr in desialylated serum containing medium in presence of lipopolysaccharides (LPS) (2.5 μg/ml) for secretion of Th2 or phorbol-12-myristate 13-acetate (PMA) (25 ng/ml)-ionomycin (1.0 μg/ml) for Th1 cytokines. Cell-free suspension was used for cytokines measurement by ELISA kit \[[@pntd.0004904.ref029], [@pntd.0004904.ref030]\].
Genetic expression profiling by reverse transcriptase (RT) and real time PCR {#sec021}
----------------------------------------------------------------------------
J774A.1 cells were infected and stimulated similarly as stated in previous section and total mRNA was isolated by RNeasy Mini Kit as per manufacturer's instructions. RNA (1.0 μg) was reverse transcribed to cDNA by Reverse Transcriptase kit. For RT-PCR analysis, the cDNA was amplified using specific primers targeting genes encoding for the cytokines namely IL-2, IL-4, IL-10, IFNγ, TGFβ, GAPDH and *iNOS* in a perkin-Elmer DNA thermal cycler. Primer sequences were listed in [Table 1](#pntd.0004904.t001){ref-type="table"}. The reaction product was separated in 1% agarose gel stained with ethidium bromide and image captured in BioRad Gel Documentation system \[[@pntd.0004904.ref023]\]. Densitometric score was measured by ImageJ software.
10.1371/journal.pntd.0004904.t001
###### Primer sequences.
{#pntd.0004904.t001g}
Primer Primer sequence (5\'-3\') Primer Length Tm(°C)
------------------ --------------------------- ------------------------ -------- ------
IFNγ Sense Primer CAAGTGGCATAGATGTGGAAGA 22 54.7
Antisense Primer GTGGGTTGTTGACCTCAAACTT 22 55.7
IL-2 Sense Primer CAGGATGGAGAATTACAGGA 20 51.2
Antisense Primer GTTATTGAGGGCTTGTTGAG 20 51.2
IL-4 Sense Primer CAACGAAGAACACCACAGAGAG 22 55.6
Antisense Primer GATGTGGACTTGGACTCATTCA 22 54.6
IL-10 Sense Primer CTAACGGAAACAACTCCTTG 20 51.0
Antisense Primer GAAAGGACACCATAGCAAAG 20 51.2
TGFβ Sense Primer CCCTAGATTTTGACTTGCAC 20 51.2
Antisense Primer GCCCAGTCACTAAGACTCTG 20 54.7
*iNOS* Sense Primer ACCTGAAAGAGGAAAAGGAC 20 52.2
Antisense Primer GGAGCCATAATACTGGTTGA 20 51.7
GAPDH Sense Primer GGAAGGACTCATGACCACAG 20 55.0
Antisense Primer GTCAGGTCCACCACTGACAC 20 57.7
18s rRNA Sense Primer GCTCATTAAATCAGTTATGG 20 46.0
Antisense Primer ACTACCATCGAAAGTTGATA 20 46.0
β-actin Sense Primer TGCTATGTTGCTCTAGACTT 20 48.0
Antisense Primer ATAGAGGTCTTTACGGATGT 20 48.0
Real time PCR analysis was performed by mixing cDNA with 2× SYBR green master mix on Roche Applied Science light cycler 480.0 instrument using software version 1.5.0. Relative quantification of each target gene were normalized to two housekeeping genes (18s rRNA and α β-actin) and expressed as a fold change compared with uninfected control using the comparative cycle threshold (CT) method \[[@pntd.0004904.ref031]\].
Immunoblot and immunoprecipitation analysis {#sec022}
-------------------------------------------
J774A.1 (1×10^6^) were left either uninfected or infected with AG83^+Sias^ or AG83^-Sias^ or UR6 at 1:10 ratio (macrophage: parasite) for 4 hr, washed and cell lysate was prepared. Equal amount of protein from each sample was separated in SDS-PAGE (10%) and transferred into nitrocellulose membrane. Membrane was blocked with tris buffer saline (TBS)- BSA (2%) and incubated with specific primary antibody (1:1000 dilutions) overnight at 4°C followed by adding species specific HRP-conjugated secondary antibody (1:1000 dilutions). The signal was detected by West-pico ECL system (Pierce, Thermo Scientific, USA) as described earlier \[[@pntd.0004904.ref032]\].
For the immunoprecipitation assay, J774A.1 cells were infected with AG83^+Sias^ and AG83^-Sias^ for 2 hr at 37°C. They were processed similarly as stated in the above paragraph. Cell lysate was incubated with anti-SHP-1 antibody (1:100) overnight at 4°C. SHP-1 bound complex was pulled down with Sepharose-4B-protein-A. After washing, the complex was resolved by SDS-PAGE (10%), transferred to nitrocellulose membrane, incubated with anti-SHP-1 and anti-siglec-E antibodies and processed for ECL \[[@pntd.0004904.ref032]\]. Densitometric score was measured by ImageJ software.
Subcellular fractionation {#sec023}
-------------------------
J774A.1 cells (2×10^6^/well) were left uninfected or infected with AG83^+Sias^ or AG83^-Sias^ or UR6 for 12 hr in 1:10 ratio in a six well plate. After infection, unbound parasites were removed. Cells were washed and fractionated into cytosol and nuclear portion by NE-PER kit according to manufacturer's protocol. Briefly, cell pellet was suspended in cytosolic extraction reagent, vortexed, spin down and the supernatant was collected as cytosolic fraction. The residual mass was suspended in nuclear extraction reagent, vortexed rigorously, spin down and the supernatant was used as nuclear fraction \[[@pntd.0004904.ref032]\]. Both the fractions were separated in SDS-PAGE gel, transferred and processed for western blot as described in previous section and developed similarly.
Knockdown of siglec-E by siRNA treatment {#sec024}
----------------------------------------
Short interfering RNA (siRNA) was designed against murine siglec-E and transiently transfected in pre-seeded J774A.1 (1×10^6^) cells using lipofectamine and plus reagent according to the manufacturer's instructions. Cells were incubated with siRNA for 6 hr. Transfection reagent was removed and further cultured in complete medium for 18 hr. Confirmation of siRNA-mediated knockdown of target gene was evaluated by western blotting \[[@pntd.0004904.ref026]\].
Transfected and untransfected cells (absence of siRNA) were infected with AG83^+Sias^. Status of several effector molecules such as ROS, NO, cytokines and various signaling molecules were determined similarly as stated in the previous sections.
Statistical analysis {#sec025}
--------------------
The data were the mean value derived from at least three independent experiments. Statistical analysis was performed using the two-tailed Student's t test. Error-bars represent mean ± SD from three independent experiments. Significant differences were set at \* p≤ 0.05, \*\* p≤ 0.01, \*\*\* p ≤ 0.001 and analyzed by GraphPad Prism version 5.01.
Results {#sec026}
=======
Sialic acids containing promastigotes exhibited enhanced siglec-1 and -5-mediated binding with macrophages {#sec027}
----------------------------------------------------------------------------------------------------------
Although the differential distribution of Sias along with 9-*O*-acetylated Sias in virulent (AG83 and GE1) and avirulent (UR6) promastigotes of *L*. *donovani* were earlier reported \[[@pntd.0004904.ref011]\], the presence of α2--3 and α2--6 linked Sias was further evaluated on the surface of different virulent SAG sensitive (AG83 Dd8 and 2001) and SAG resistant (39 and GE1) typed/untyped strains along with an avirulent UR6 promastigotes. The comparative bindings of FITC-SNA and FITC-MAL were tested in all the strains by flow cytometry. Promastigotes (parasite^+Sias^) except the strain 39 showed significantly higher (p≤ 0.05) SNA binding than MAL suggesting the predominance of α2--6 linkage on the surface of *L*. *donovani*. Sialidase-treated promastigotes (parasite^-Sias^) exhibited minimal binding ([S1 Fig](#pntd.0004904.s001){ref-type="supplementary-material"}).
As virulent strain (AG83^+Sias^) showed higher linkage-specific Sias on the surface, here we selected this strain for the interaction with different siglecs. Initially, we compared the binding of different soluble siglecs (siglec-1,-3,-5,-7,-9,-10)-Fc chimera with AG83^+Sias^ by overlay dot blot ([Fig 1A](#pntd.0004904.g001){ref-type="fig"}). Siglec-1-Fc chimera protein exhibited significantly (p ≤ 0.001) higher binding with the AG83^+Sias^; intensities being 21,450 ± 1130 followed by siglec-5-Fc (15,710 ± 790), than the control (3280 ± 265) containing only air-dried promastigotes. Other siglec-Fc chimera (siglec-3,-7,-9,-10) exhibited lower binding with AG83^+Sias^.
{#pntd.0004904.g001}
Binding of AG83^+Sias^ towards siglec-1 and-5 was further confirmed by using specific full length siglec-transfected CHO cell lines. Virulent strain (FITC-AG83^+Sias^) showed significantly enhanced binding with both CHO-siglec-1 (p ≤ 0.001) and CHO-siglec-5 (p ≤ 0.01) compared to CHO-WT as indicated by higher mean fluorescence intensity (MFI) value ([Fig 1B](#pntd.0004904.g001){ref-type="fig"}). However blocking of siglec with specific anti-siglec antibody significantly (p ≤ 0.01) reduced the FITC-AG83^+Sias^ binding with CHO-siglec-1 and CHO-siglec-5 compared to untreated siglec-transfected CHO cells. In contrast, FITC-AG83^-Sias^ exhibited the significant reduction in binding with CHO-siglec-1 (p ≤ 0.001) and CHO-siglec-5 (p ≤ 0.01) compared to AG83^+Sias^. Conversely there was no significant enhancement in binding of FITC-AG83^+Sias^ with CHO- siglec-3, -7,-9,-10 cells compared to CHO-WT cells ([Fig 1C](#pntd.0004904.g001){ref-type="fig"}).
Additionally, CHO-siglec-5 cells were treated with exogenous sialic acids (1.0 mM) prior to binding with parasite. There was significant (p ≤ 0.01) reduction in the binding of AG83^+Sias^ with pre-treated CHO-siglec-5 with MFI value being 2982 ± 378 compared to unblocked CHO-siglec 5 (4927 ± 422). However exogenous Sias treated CHO-siglec-1 cells showed no significant change in MFI value (8336 ± 680) compared to untreated control (9024 ± 805) under identical condition. This may be due to the elongated structure of siglec-1 that protruded way out from the cell surface and affinity towards linkage-specific sialic acids.
To confirm whether affinity of AG83^+Sias^ towards siglec-1 and -5 was a generalized phenomenon for *L*. *donovani*, this binding was further examined in other *L*. *donovani* strains also. Different *L*. *donovani* strains (except low Sias containing avirulent UR6) showed significantly (p≤ 0.01 & p≤ 0.001) enhanced binding with CHO-siglec-1 and CHO-siglec-5 compared to CHO-WT ([S2 Fig](#pntd.0004904.s002){ref-type="supplementary-material"}).
Sias-siglec interaction played a crucial role in binding of promastigotes with the macrophages {#sec028}
----------------------------------------------------------------------------------------------
As AG83^+Sias^ promastigotes exhibited preferentially higher binding towards CHO-siglec-1 and CHO-siglec-5, next we examined such interaction using both murine macrophage (J774A.1) and human monocytic cells (THP-1) as they are the natural host of *Leishmania* parasite. Accordingly, the comparative binding of AG83^+Sias^/AG83^-Sias^ and UR6 with J774A.1/THP-1 cells was evaluated in the light of Sias-siglec interaction.
FITC-AG83^+Sias^ exhibited significantly (p ≤ 0.001) enhanced binding with J774A.1 compared to UR6 as indicated by the higher MFI values ([Fig 2A](#pntd.0004904.g002){ref-type="fig"}). In contrast, pretreated J774A.1 cells with cocktail anti-siglec antibodies against siglec-1,-E,-F followed by infection with AG83^+Sias^ exhibited extensively reduced (p ≤ 0.01) binding compared to untreated J774A.1 cells. Additionally, infection of J774A.1 with AG83^-Sias^ also showed decreased (p ≤ 0.001) binding compared to AG83^+Sias^. Interestingly binding of UR6 with macrophages remained unaltered in all these conditions. Similar trend of binding was observed when human monocytic cell line THP-1 was used ([Fig 2B](#pntd.0004904.g002){ref-type="fig"}).
{#pntd.0004904.g002}
Sias-siglec-mediated interaction of FITC-AG83^+Sias^ promastigotes with J774A.1 was further visualized by confocal microscopy and shown as a representative image. Higher number of parasites attached to the macrophage surface was observed as indicated by green dots of FITC-AG83^+Sias^ on the PE-CD14 stained red colored periphery of the J774A.1 cells ([Fig 2C](#pntd.0004904.g002){ref-type="fig"}). DAPI stained nucleus indicating intactness of the cell. Blocking of siglecs present on macrophages by specific anti-siglecs antibodies or removing sialic acids from parasites by sialidase treatment exhibited a fewer number of FITC-AG83 attached on the macrophage surface. As Sias present on UR6 are generally low, there were no apparent changes in their association with J774A.1 cells before and after inhibition of Sias-siglec interaction ([Fig 2D](#pntd.0004904.g002){ref-type="fig"}).
AG83^+\ Sias^ exhibited enhanced siglec-1 mediated phagocytosis {#sec029}
---------------------------------------------------------------
Phagocytosis is a physiological process by which cell uptake the extracellular component. Intracellular pathogens enter inside the cell through receptor-mediated phagocytosis. Here we quantitatively measured Sias-siglec-1 dependent uptake of promastigotes by flow cytometry ([Fig 3A](#pntd.0004904.g003){ref-type="fig"}). This was also shown by confocal microscopy as a representative image ([Fig 3B](#pntd.0004904.g003){ref-type="fig"}).
{#pntd.0004904.g003}
Sias-siglec mediated phagocytosis of AG83^+Sias^ showed higher MFI value which was significantly reduced (p ≤ 0.05 and ≤ 0.01) when this interaction was inhibited either by blocking of siglec-1 with specific antibody or removal of sialic acids from AG83^+Sias^ (AG83^-Sias^) before infection. This value was further reduced (p ≤ 0.001) when Sias-siglec-1 dependent phagocytosis was inhibited simultaneously both by blocking siglec-1 on macrophage and removing sialic acids from parasite.
A similar trend was observed in confocal microscopy also in which infected J774A.1 cells showed comparatively higher number of intracellular parasites as indicated by green dots than treated macrophages where Sias-siglec interaction was blocked, further confirming the role of sialic acids and siglec-1 in phagocytosis ([Fig 3B](#pntd.0004904.g003){ref-type="fig"}).
Sias-mediated interaction modulated the innate effector functions {#sec030}
-----------------------------------------------------------------
ROS and NO are two major effector molecules for the macrophage defense arsenal, which encounter the evading pathogens. As Sias-siglec interaction played a major role both in binding and phagocytosis of AG83^+sias^ in macrophages, we have extended our study to determine its effect in modulation of effector function. Due to the minimal presence of sialic acids on AG83^-Sias^ or UR6, J774A.1 cells were able to produce significantly higher (p ≤ 0.001) amount of ROS compared to infection with AG83^+sias^ as indicated by higher H~2~DCFDA positivity ([Fig 4A](#pntd.0004904.g004){ref-type="fig"}).
{ref-type="table"}. GAPDH was used as loading control throughout. **(D)** Total RNA was isolated from infected and uninfected J774A.1 cells and cDNA was prepared similarly as stated in Fig. 4C. The level of mRNA expression of Th1 and Th2 cytokines along with *iNOS* were quantified by real time PCR analysis. The mRNA level was normalized by 18s rRNA and the fold change was measured using uninfected cells as the control. Comparison was also made of AG83^+Sias^ infection with AG83^-Sias^ or UR6 infection. **(E)** Secreted cytokines were also measured in BMDM cells. BMDMs were isolated from the femur of healthy mice and macrophages were infected and stimulated by LPS or PMA-ionomycin as stated in Fig. 4C. The secreted cytokines (IL-4, IL-10 and IFNγ) in the culture supernatants were measured by respective ELISA kit as described in material and methods. **(F)** J774A.1 cells (1×10^4^) were adhered overnight on glass coverslip. Macrophages were left untreated or blocked with anti-siglec antibody cocktail (anti-siglec-1,-E,-F) for 1hr. Untreated and treated cells were infected with AG83^+Sias^ or AG83^-Sias^ or UR6 for 4 hr at 1:10 ratio. Unbound parasite removed and the infection was allowed for 20 hr. Macrophages were fixed in methanol and stained by Giemsa staining. Intracellular amastigotes were counted microscopically.](pntd.0004904.g004){#pntd.0004904.g004}
Furthermore, during the AG83^+Sias^ infection, there was a reduction in the NO level in the culture supernatant indicating Sias-mediated interaction in modulation of innate effector function of the macrophages ([Fig 4B](#pntd.0004904.g004){ref-type="fig"}). In contrast, infection with the AG83^-Sias^ or UR6, where Sias content is low, exhibited enhanced NO production (p≤ 0.05 & p≤ 0.01) indicating less infection.
Sias-mediated interaction modulated the cytokine level in infected macrophages {#sec031}
------------------------------------------------------------------------------
*Leishmania* infection is generally associated with Th2 type of response *in vitro*. As genes ultimately regulate the expression of proteins through mRNA, so the actual status of any changes of cytokines and NO synthesizing gene *iNOS* during infection were evaluated at genetic level through reverse transcriptase ([Fig 4C](#pntd.0004904.g004){ref-type="fig"}) as well as real time PCR ([Fig 4D](#pntd.0004904.g004){ref-type="fig"}). Due to infection of macrophages with AG83^+Sias^, reduction of the genetic expression of Th1 cytokine genes (IFNγ and IL-2) and upregulation of Th2 cytokine genes (IL-4, IL-10 and TGFβ) were observed ([Fig 4C](#pntd.0004904.g004){ref-type="fig"}). Removal of Sias from AG83 surface reversed the expression pattern of Th1/Th2 in the infected macrophages. This was further confirmed by infecting macrophages with avirulent UR6 strain. As expected, there was a significant reduction in expression of Th2 cytokines and upregulation of Th1 cytokines indicating the host protective immune response. The status of *iNOS* expression was also reduced upon infection of macrophages with AG83^+Sias^ compared to AG83^-Sias^ or UR6 infection.
This was further confirmed by evaluating mRNA transcript of different Th1 and Th2 cytokines by real time PCR. AG83^+Sias^ infected macrophages showed Th2 bias response, which was reversed to Th1 in AG83^-Sias^ and UR6-infected cells ([Fig 4D](#pntd.0004904.g004){ref-type="fig"}). Th2 cytokines (IL-4, IL-10 and TGFβ) were upregulated by \~7.2, 6.3 and 8.3 folds respectively in macrophages infected with AG83^+Sias^, which were significantly (p≤ 0.05 and p≤ 0.01) down regulated to \~4.3, 4 and 6 folds respectively when AG83^-Sias^ was used. Infection with UR6 showed the further reduction in the Th2 cytokines to \~3.5, 2.8 and 3.5 folds respectively. On the other hand, Th1 cytokines (IL-2 and IFNγ) were significantly (p≤ 0.05) enhanced (\~ 3.3--3.7 fold respectively) in AG83^-Sias^-infected macrophages and the level was further increased (\~5.3 and 4.5 fold) when cells were infected with UR6 compared to AG83^+Sias^ (\~ 1 and 1.3 fold respectively). Similarly *iNOS* level was only 1.7 fold increased in AG83^+Sias^ infected macrophages which was significantly (p≤ 0.05) upregulated to 4.8 fold and 5.2 fold during AG83^-Sias^ and UR6 infection. 18s rRNA was used as housekeeping gene for normalization. Similar trend was also observed for Th1/Th2 cytokines using β-actin as a normalizing housekeeping gene ([S3 Fig](#pntd.0004904.s003){ref-type="supplementary-material"}).
Additionally, the status of a few key cytokines was determined in the culture supernatant. AG83^+Sias^-infected macrophages produced significantly (p≤ 0.05) less IFNγ level which was enhanced when AG83^-Sias^ or UR6 (p≤ 0.01 and p≤ 0.001) were used for infection ([Fig 4E](#pntd.0004904.g004){ref-type="fig"}). In contrast, the increased levels of two immunosuppressive cytokines (IL-4 and IL-10) were observed during AG83^+Sias^ infection which was declined significantly (p≤ 0.05) during AG83^-Sias^ and UR6 infection.
Sias-siglec interaction induced enhanced multiplication of intracellular amastigotes {#sec032}
------------------------------------------------------------------------------------
Sias-siglec interaction played a significant contribution in enhanced phagocytosis and impairment of innate immune function in infected macrophages, thereby creating a perfect environment for multiplication of intracellular amastigotes. We have observed enhanced number of amastigotes in AG83^+Sias^ infected macrophages, which were significantly reduced (p≤ 0.05) when sialidase-treated AG83^+Sias^ was used for infection. Additionally, removal of sialic acids and blocking of siglecs together further significantly (p≤ 0.01) reduced the amastigote count confirming the role of Sias-siglec interaction in multiplication of intracellular parasites ([Fig 4F](#pntd.0004904.g004){ref-type="fig"}). Low Sias containing avirulent strain (UR6) showed minimal level of infection than AG83^+Sias^.
Sias-siglec interaction induced enhanced SHP-1 level in the host cell {#sec033}
---------------------------------------------------------------------
Next, we addressed the status of downstream molecular events that control the innate immune response for establishment of successful infection. Although siglec-1 and siglec-5 exhibited highest binding with AG83^+Sias^, only siglec-5 is capable to take part in signaling due to the presence of ITIM motif. Siglec-E, the murine counterpart of siglec-5 was quantified ([Fig 5A](#pntd.0004904.g005){ref-type="fig"}). Western blot showed upregulation of SHP-1 in AG83^+Sias^ infected macrophages compared to AG83^-Sias^ and UR6-infected cells indicating the role of sialic acids in upregulation of this phosphatase. However, as expected we did not find any significant alteration in the siglec-E level in these infected cells. ([Fig 5A](#pntd.0004904.g005){ref-type="fig"}).
{#pntd.0004904.g005}
To further confirm that upregulation of SHP-1 is specifically due to Sias-siglec mediated interaction, the association of SHP-1 with siglec-E was tested by immunoprecipitation ([Fig 5B](#pntd.0004904.g005){ref-type="fig"}). The levels of both SHP-1 and siglec-E were higher in the SHP-1-siglec-E complex during AG83^+Sias^ infection compared to AG83^-Sias^ indicating enhanced association of siglec-E and SHP-1.
Infection with AG83^+Sias^ inhibited the MAPKs and PI3K/Akt pathways {#sec034}
--------------------------------------------------------------------
The correlation between sialic acids-mediated virulence factor in modulation of MAPKs and PI3K/Akt pathways during parasite infection was addressed further. Accordingly, the status of important molecules in these pathways was compared in J774A.1 cells infected with AG83^+Sias^, AG83^-Sias^ or UR6. Upon infection of J774A.1 with AG83^+Sias^, phosphorylation of ERK1/2, p38MAPKand JNK were suppressed compared to uninfected control ([Fig 5C](#pntd.0004904.g005){ref-type="fig"}). In contrast, macrophages infected with AG83^-Sias^ restored the phosphorylation of these molecules. Similarly, low Sias-containing avirulent stain UR6 also failed to suppress the phosphorylation of the major immune activating MAPKs pathway molecules. However, total level of ERK1/2, p38MAPK and JNK remained constant upon infection.
Macrophages infected with AG83^+Sias^also induced the suppression of PI3K, p-PDK1 and p-Akt (Ser 473) in PI3K/Akt pathway ([Fig 5D](#pntd.0004904.g005){ref-type="fig"}). Infection with AG83^-Sias^ showed the reversal of phosphorylation of these molecules indicating the role of Sias-mediated interaction by the parasite in deactivation of this pathway. Infection with UR6 also exhibited the similar trend of signaling in this pathway. However, total level of PDK1 and Akt remained constant upon infection.
Sias-mediated interaction inhibited the translocation of a functional subunit of NF-κβ in the nucleus {#sec035}
-----------------------------------------------------------------------------------------------------
NF-κβ is a transcription factor translocate to the nucleus for transcription of proinflammatory genes. We have already observed the reduced macrophage effector function during AG83^+Sias^ infection. Therefore, the involvement of Sias-mediated interaction of *Leishmania* in the regulation of the translocation of a functional subunit of NF-κβ to the nucleus was assessed further. AG83^+Sias^ infection reduced the expression of IKKβ and IKKα in the cytoplasmic fraction of macrophages ([Fig 6A](#pntd.0004904.g006){ref-type="fig"}). Subsequently, IKKα and IKKβ-mediated phosphorylation status of inhibitory subunit IκBα were also suppressed, indicating the prevention of autodegredation of this protein of NF-κβ complex in the cytosol. So, functional subunit p65 could not set free to translocate into the nucleus and thus accumulated more in the cytosolic fraction ([Fig 6A](#pntd.0004904.g006){ref-type="fig"}). This reduces the chance of transcription of proinflammatory genes. In contrast, removal of Sias from virulent strain AG83^+Sias^ induced the expression of IKKβ and IKKα and, followed by IκBα phosphorylation-mediated degradation. This leads to enhanced translocation of p65 into the nucleus ([Fig 6B](#pntd.0004904.g006){ref-type="fig"}). UR6 infection also showed similar kind of effect like AG83^-Sias^.
{#pntd.0004904.g006}
Knocking down of siglec-E overturned the *Leishmania* induced regulation of macrophage effector function and signaling pathways {#sec036}
-------------------------------------------------------------------------------------------------------------------------------
Sialic acids-mediated interaction showed reduced macrophage effector functions and modulated downstream signaling molecules/pathway demanded to pin point the specific involvement of siglec (siglec-E) in these events. Accordingly, we transiently knocked down the expression of siglec-E by targeted siRNA in the macrophages. Infection of siglec-E depleted J774A.1 cells with AG83^+Sias^ showed enhanced (p≤ 0.05) ROS production with MFI value 322 ± 27 compared to untransfected cells (MFI 226 ± 31) ([Fig 7A](#pntd.0004904.g007){ref-type="fig"}).
{ref-type="fig"}. **(B)** J774A.1 cells were transfected with siSiglec-E and infected with AG83^+Sias^ overnight. The culture supernatant was collected and nitric oxide was measured by Griess reaction as stated in [Fig 4B](#pntd.0004904.g004){ref-type="fig"}. **(C)** Siglec-E depleted and control J774A.1 cells were infected with AG83^+Sias^ and the infection was allowed for 24 hr in presence of PMA-ionomycin or LPS as stated in [Fig 4C](#pntd.0004904.g004){ref-type="fig"}. Total RNA was isolated and processed for quantification of IFNγ and IL-10 genes by real time PCR as stated in [Fig 4D](#pntd.0004904.g004){ref-type="fig"}. **(D-F)** Untransfected or siSiglec-E-transfected J774A.1 cells were infected with AG83^+Sias^ for 4 hr. The cell lysate was prepared and western blotting of key signaling molecules were performed similarly as stated in [Fig 5A](#pntd.0004904.g005){ref-type="fig"}. **(G-H)** J774A.1 cells were or transfected with siSiglec-E. Cytosol and nuclear fractions were separated and level of key signaling molecules were determined as stated in [Fig 6](#pntd.0004904.g006){ref-type="fig"}.](pntd.0004904.g007){#pntd.0004904.g007}
Similarly infection with AG83^+Sias^ in siglec-E-depleted J774A.1 cells significantly (p≤ 0.05) upregulated NO compared to untransfected macrophages confirming the importance of siglec in the suppression of macrophage effector function during *Leishmania* infection through Sias-siglec interaction ([Fig 7B](#pntd.0004904.g007){ref-type="fig"}).
The status of key Th1 and Th2 cytokines during infection was also checked in siglec-E depleted macrophages. Significant (p≤ 0.05) upregulation of the IFNγ (\~ 3.3 fold) was observed in transfected cells after infection compared to \~ 0.9 fold in untransfected macrophages. In contrast, IL-10 level was significantly (p≤ 0.05) down regulated (\~ 1.8 fold) in siglec-E knockdown cells compared to \~ 3.9 fold in control cells due to the absence of Sias-siglec interaction during infection ([Fig 7C](#pntd.0004904.g007){ref-type="fig"}).
Next, the level of phosphorylation of key signaling molecules in siglec-E depleted cells was checked to further confirm the importance of siglec in *L*. *donovani* infection through Sias-siglec interaction. Siglec-E depleted macrophages showed a complete absence of siglec-E molecule ([Fig 7D](#pntd.0004904.g007){ref-type="fig"}). There was reduction in the SHP-1 level in these cells ([Fig 7D](#pntd.0004904.g007){ref-type="fig"}). Other key signaling molecules in MAPK ([Fig 7E](#pntd.0004904.g007){ref-type="fig"}) and PI3K/Akt ([Fig 7F](#pntd.0004904.g007){ref-type="fig"}) pathway such as pERK, pJNK, PI3K and p-Akt were upregulated in AG83^+Sias^ infected siSiglec-E macrophages. Additionally, status of nuclear translocation of NK-κβ functional subunit p65 was also checked in siglec-E knockdown cells. We observed reduced presence of p65 in the cytosol ([Fig 7G](#pntd.0004904.g007){ref-type="fig"}) along with enhanced phosphorylation of inhibitory molecule IκBα which leads to the enhance translocation of p65 in the nucleus ([Fig 7H](#pntd.0004904.g007){ref-type="fig"}) indicating the potential role of siglec in Sias-siglec pathway utilized by *Leishmania* in modulation of signaling pathways in macrophages.
Discussion {#sec037}
==========
Tackling of visceral leishmaniasis is still challenging due to inadequacy of effective drug and development of widespread drug resistant strains \[[@pntd.0004904.ref033]\]. Hence study the biology of host-parasite interaction is utmost important for identification of next generation drug target. Due to the unique location, sialic acids possess the strategic advantage to be a prime candidate for molecular interaction with host cells \[[@pntd.0004904.ref034]\].
The most important findings of the present study include the demonstration of the involvement of sialic acids on virulent parasite for their binding with macrophages through siglecs, thereby establishing a new gate for the entry of this parasite. This Sias-siglec-mediated interaction of virulent parasite demonstrated its superior ability to subvert the innate immune response, enhanced multiplication of intracellular form of parasite in the host compared to low Sias-containing avirulent parasite. Current investigation also revealed a mechanistic approach to understand the specific role of Sias-siglec-1 in phagocytosis and involvement of Sias-siglec-E/5 in inducing suppression of MAPKs and PI3K/Akt pathways along with inhibition of translocation of a functional subunit of NF-κβ into the nucleus and thereby impairing the macrophage activation. The role of sialic acids and siglecs is thus established in ascertaining successful infection of *Leishmania donovani*.
Involvement of many *Leishmania* surface-associated glycoconjugates like lipophosphoglycan (LPG), glycoprotein 63 (gp63) in pathogenesis have been reported \[[@pntd.0004904.ref035]--[@pntd.0004904.ref041]\]. The presence of different derivatives of Sias both on promastigotes and amastigotes of *L*. *donovani* was identified in our laboratory \[[@pntd.0004904.ref009], [@pntd.0004904.ref010]\]. Our previous study also revealed the global distribution of Sias on different strains of *Leishmania* species \[[@pntd.0004904.ref042]\]. However, the acquisition of Sias by *L*. *donovani* is still a matter of debate. Presence of any active metabolic enzyme (UDP-GlcNAc 2-epimerase) was not found in the parasite \[[@pntd.0004904.ref009]\]. Whether this enzyme is presented as biologically non-functional remain to be investigated further. Whole genome sequencing of *L*. *donovani* revealed the two putative CMP-sialic acid transporters LDBPK_240360 (NC_018251.1) and LDBPK_240350 (NC_018251.1) located at chromosome number 24. This may be further linked with the presence of sialyltransferase activity in this parasite \[[@pntd.0004904.ref043]\]. Based on the comparative study for the presence of linkage-specific sialic acids on different *L*. *donovani* strains including drug resistant, drug sensitive, typed, untyped and avirulent strain, a high sialic acids containing virulent strain AG83 was selected for this investigation.
There are many receptors present on macrophages for binding with mannose, fucose, fibronectin, Fcγ, complement etc. and actively take part in host-pathogen interactions \[[@pntd.0004904.ref021], [@pntd.0004904.ref044]\]. Siglecs, a unique class of membrane receptor, function as a negative regulator that prevents the over activation of immune cells. Our detailed investigation using siglec-transfected CHO cells along with macrophages/monocytes using five different strains conclusively confirmed that siglec-1 and -5 are two important candidate surface molecules served as receptors for virulent parasite binding. Specificity of sialic acids-siglec-mediated binding was confirmed by either removal of Sias or blocking siglecs. However, sialidase-treated parasite (AG83^-Sias^) didn't show complete reduction in binding with macrophages which are considered to be the natural host for parasite. This may be due to the presence of number of other receptors available for binding with parasite on the surface of macrophage besides siglecs unlike CHO cells. Thus the presence of linkage-specific Sias on parasite surface and their capability to form the Sias-siglec interaction with macrophages could screen the virulent *vs*. avirulent parasite. Binding of biotinylated siglec-1,-2,-5 with *L*. *donovani* further confirmed our finding \[[@pntd.0004904.ref043]\]. In contrast, other human pathogens such as *Pseudomonas aeruginosa*, Group B *Streptococcus* and *Campylobacter jejuni* exhibited specificity towards siglec-7/9; siglec-5/7/9 and siglec-1/7 respectively. This may also depends on the siglec-specific sialylated ligands present on the pathogen surface and their affinity towards specific siglecs \[[@pntd.0004904.ref004], [@pntd.0004904.ref045]\]. Therefore, siglecs are used by sialylated pathogens for their survival advantages \[[@pntd.0004904.ref046]\].
After binding with the host cells, *Leishmania* promastigote initially phagocytosed by macrophages into the phagosome and subsequently fused with lysosome to form a phagolysosomal vacuole \[[@pntd.0004904.ref047]\]. Thus phagocytosis is a prerequisite phenomenon in the life cycle of this pathogen. *Leishmania* undergo receptor-mediated phagocytosis and there are many candidate receptors that take part in this event \[[@pntd.0004904.ref044]\]. Due to the elongated structure of siglec-1, it is extended way out from the cell surface making it a prime target for receptor-mediated phagocytosis by pathogens \[[@pntd.0004904.ref007]\]. We have established siglec-1 as a new molecule that takes part in phagocytosis of AG83^+Sias^ during infection. Role of Sias-siglec-1 mediated phagocytosis was further confirmed as blocking of siglec-1 by antibody or removing Sias or combination treatment reduced the phagocytosed parasite inside the macrophages. Siglec-1 dependent phagocytosis was also reported in *Campylobactor jejuni* infection to the macrophages \[[@pntd.0004904.ref048]\].
Impairment of innate immune system is an indispensable event for *L*. *donovani* to establish a successful infection. The immunosuppressive effect associated with leishmaniasis is exerted by the alteration of Th1/Th2 cytokine balance due to deactivation of macrophages induced effector molecules (ROS and NO) \[[@pntd.0004904.ref049]\]. They were impaired during Sias-siglec mediated interaction of AG83^+Sias^ infection, indicating their direct involvement in immunosuppression. IFNγ and IL-4 are the key players involved both in VL and cutaneous leishmaniasis. However, IL-10 emerged as a most potent immunosuppressive cytokine in VL pathogenesis \[[@pntd.0004904.ref050]\]. As cytokine secretion is more prolific in the primary macrophages, the secreted cytokines were measured in BMDM also. Sias-siglec mediated interaction of AG83^+Sias^ showed Th2 dominant (IL-10, IL-4 and TGFβ) cytokine response. All these events resulted in the enhanced intracellular amastigote replication. Thus impairment of this specific Sias-siglec interaction either by removal of Sias from parasite or silencing siglec from macrophages resulted in the reversal of immune response leading to reduction of parasite burden.
*L*. *donovani* engages a negative regulator SHP-1 during their infection to the macrophages for inactivation of the defense mechanism \[[@pntd.0004904.ref051]\]. It is important to mention here that specific receptor present on macrophages as well as the molecular determinant on parasite which are directly involved in SHP-1 induction was not well documented. Present study conclusively demonstrated Sias-siglec-mediated interaction plays an important role in the upregulation of SHP-1 molecule and association between SHP-1 and siglec-E during infection. The specificity of the involvement of this receptor-ligand interaction for SHP-1 upregulation was further confirmed by removal of Sias from parasite or depleting siglec-E from macrophages.
SHPs act as negative regulator of NO production and suppressing MAPKs and Akt signaling pathways \[[@pntd.0004904.ref052]\]. An array of molecular determinants present on *Leishmania* is known to deactivate these pathways \[[@pntd.0004904.ref053], [@pntd.0004904.ref054]\]. Here we have established an alternative pathway (Sias-siglec-mediated interaction) utilized by the virulent parasite (AG83^+Sias^) for deactivation of MAPK and PI3K/Akt pathway in the infected macrophages. Thus, Sias-siglec interaction could be considered as another new avenue of host pathogen interaction that can suppress the downstream signaling leading to deactivation of macrophages.
MAPKs and Akt pathways transmit the signal to the nucleus through a well known transcription factor NF-κβ, which control an array of proinflammatory genes \[[@pntd.0004904.ref055]\]. We have demonstrated inhibition of nuclear translocation of a functional component (p65 subunit) of NF-κβ in AG83^+Sias^-infected macrophage through Sias-siglec-mediated interaction. This was correlated with the reduced ROS, NO and Th1 cytokines production. Removal of Sias or depletion of siglec showed reversal of this effect, indicating Sias-siglec interaction is an important determinant for immune suppression. A recent study on Group B *Streptococcus* also exhibited similar kind of distortion of innate immune response due to the sialic acids-mediated recruitment of siglec-E \[[@pntd.0004904.ref024]\].
Our study conclusively ascertains that the Sias-siglec mediated interactions play a significant role in the binding and phagocytosis of virulent parasites with macrophages through siglec-1. This important molecular determinant (Sias) is essentially responsible for subversion of innate immune function by modulation of downstream signaling pathways favoring the multiplication of intracellular parasite in the hostile environment of host through siglec-E/5 ([S4 Fig](#pntd.0004904.s004){ref-type="supplementary-material"}). Taken together, this in-depth study paved a novel horizon of host pathogen interaction, utilized by sialylated pathogens for their own survival advantages. Such finding may also help to design newer drug target. However, this needs further in-depth investigation.
Supporting Information {#sec038}
======================
###### Presence of α2--3 and α2--6 linked Sias on different *L*. *donovani* strains.
Six different *L*. *donovani* strains as mentioned in materials and methods, were grown in 10% FCS containing medium was designated as parasite^+sias^ and sialidase (along with esterase) treatment of this parasite^+Sias^ was designated as parasite^-Sias^. Parasite^+Sias^ and parasite^-Sias^ were incubated with FITC-SNA (specific for α2--6 linked Sias) and MAA (specific for α2--3 linked Sias) and the binding was measured by flow cytometry.
(TIF)
######
Click here for additional data file.
###### Binding of different *L*. *donovani* strains with CHO-WT, CHO-siglec-1 and CHO-siglec-5.
Binding of FITC-parasite^+Sia^ of five different *L*. *donovani* strains were incubated with different types of CHO-siglecs cells at 1: 10 ratio and binding was measured by FACS.
(TIF)
######
Click here for additional data file.
###### Real time PCR analysis of cytokines.
Total RNA was isolated from control and infected macrophages and differential expression of mRNA of Th1 and Th2 cytokines were quantified similarly as stated in [Fig 4D](#pntd.0004904.g004){ref-type="fig"}, using β-actin as housekeeping gene for normalization.
(TIF)
######
Click here for additional data file.
###### A schematic diagram of Sias-siglec interaction mediated phagocytosis and immunosuppression during *Leishmania* infection.
(TIF)
######
Click here for additional data file.
Authors thank Prof. Paul R. Crocker, College of Life Sciences, University of Dundee, UK, for providing human siglec-Fc chimera, CHO-siglec cell lines and anti-siglec antibodies; Dr. R. Vlasak of Applied BioTechnology, Salzburg, Austria, for kind gift of 9-*O*-acetylesterase; Dr. Anuradha Dube and Dr. Neeloo Singh, CSIR-Central Drug Research Institute, Lucknow, India for providing *L*. *donovani* Dd8, GE1F8R, UR6, 2001and 39 strains respectively.
[^1]: The authors have declared that no competing interests exist.
[^2]: **Conceived and designed the experiments:** SR CM.**Performed the experiments:** SR.**Analyzed the data:** SR CM.**Contributed reagents/materials/analysis tools:** CM.**Wrote the paper:** SR CM.
| null | minipile | NaturalLanguage | mit | null |
Bra 71089
With the special glue work and productive technology as its vital advantage over the others, the cups and straps are made out one-off, and put the steel rings into the bras simultaneously, people almost can't find where's the seam, joint in the bra | null | minipile | NaturalLanguage | mit | null |
Q:
How to get a list of CLs submitted since a specific CL?
I have a CL number, and I want the CL number for all change lists submitted since that change list. Is there a perforce command to do this?
A:
p4 changes //... @yourchangelistnumber,@now make sure you limit to a folder deeper then //... as that command can take a while if you do it against the entire depot.
| null | minipile | NaturalLanguage | mit | null |
President Trump tweeted Saturday night a link to a sycophantic website that traffics in conspiracy theories and has aligned itself to the alt-right and white nationalist movements. Here’s the Trump tweet, which promotes MAGAPILL.com’s “President Donald Trump Accomplishment List”:
Wow, even I didn’t realize we did so much. Wish the Fake News would report! Thank you. https://t.co/ApVbu2b0Jd — Donald J. Trump (@realDonaldTrump) November 25, 2017
The website’s name, MAGAPILL, references Trump’s campaign slogan “Make America Great Again” along with the “red pill” concept popular among the online alt-right and white nationalist movements. Taking a red pill in these circles refers to being awakened to the “reality” of the alt-right worldview, an allusion to a plot device in the 1999 science fiction film The Matrix.
MAGAPILL.com’s website appears to consist of links to archived news items from mainstream media outlets touting successes of the Trump presidency. “MAGAPILL is here to ensure that President Trump’s Legacy is properly documented,” reads the site’s about page. “It’s been recently reported that 95% of the News Media’s coverage of Trump is Negative, while only 5% is positive. This is the definition of an unfair bias and one of the main reasons why everyday American’s confidence in the ‘Main Stream’ media is at an all time low.”
A number of other old pages at the domain are inaccessible, but the website’s Twitter page remains active, tweeting out a mix of conspiracy theories, Fox News videos, news articles from mainstream outlets, and retweets of President Trump. In one recent tweet, MAGAPILL put out an unsourced image rife with outlandish conspiracies about the people and entities who control our institutions:
The image includes levels of the supposed conspiracy, each with an image of a rabbit going down a hole to the next level (another Matrix/alt-right allusion). Among the conspiracies listed are: “false flag terrorism”, genetically modified crops, the use of “algorithmic censorship” of social media, “rogue intel factions” at the CIA and Mossad, a “network of global corporate control”, “Luciferian rituals”, secret societies like the Knights Templar and the Jesuits, and “trauma based mind control.” At the bottom of the entire conspiracy are the “Overlords” from “Bloodline Families” that include the aristocracy and royalty, the papacy, and the banking families, all of whom apparently practice a Luciferian religion that worships “the Dark Side through rituals, including child/human sacrifice.”
And that’s just one tweet. Among the other crazy and baseless conspiracy theories MAGAPILL has promoted include the politically motivated murder of DNC employee Seth Rich, a cabal of members of Congress involved in satanic rituals and child sex abuse, and the existence of an anonymous internet poster with “Q-level” security clearance who is working to bring down the world order.
The tweet from President Trump appears to have brought an unprecedented amount of traffic to the bare-bones MAGAPILL website— enough to temporarily crash it.
Trump’s promotion of a fake-news site came shortly after another tweet of his blasting CNN’s international channel as “fake news.” The president regularly lobs this epithet at any legitimate news organization that he says is unfair or wrong in its coverage of him. | null | minipile | NaturalLanguage | mit | null |
All About Your Period and Other Body Blunders
Wondering what’s up with that hair growing … where!?! Ew, are those (gulp) stretch marks? And why is your period so darn unpredictable? Stop scratching your head and keep reading as we clear up some of the confusion.
“I got my first period (finally) and then … nothing. It’s been about three months, and I haven’t gotten it again. Is this normal?”It’s not unusual at all for your period to “sputter” after making its first appearance. For some girls, it just takes time for their bodies to adjust and get into a rhythm. If you don’t menstruate again at the one-year mark, ask a parent to make you an appointment with a gynecologist. Your body gave you a little preview of what’s to come, but your menstrual cycle should fall into a regular pattern as puberty progresses. If you’re an older teen, around 16 or 17, see your doc now to make sure something isn’t delaying your development. But many girls are simply late-bloomers, and that’s not a bad thing.
“Some hairs have suddenly sprouted, um, around my nipples. I haven’t told anyone about this. Help, please!”Surprise! During puberty, you will begin to grow hair in places you’ve never had it before, particularly under the arms and in the pubic area. And, yes, some girls sprout a few around their boobs, so don’t be freaked. This might go away as your hormones settle down, but it could be ongoing. Still, it’s no biggie, especially if the hair is fine in texture and light in color. But if it’s dark and coarse -- and really bothers you -- talk to your mom or other mature female relative about bleaching or using an over-the-counter depilatory. If “some hair” means a whole bunch, show your doctor so he can check for a hormonal imbalance.
“I’ve noticed some red lines around my hips. I think they might be stretch marks -- and they’re ugly! What should I do?”Yep, those sound like stretch marks -- but don’t distress. Lots of girls (and guys) develop stretch marks during spurts when the skin just can’t keep up with the rest of the body’s growth. First, the bad news: There’s absolutely nothing you can do about them. But the good news is this: They will naturally fade over time from that standout purplish-red color to a much less noticeable translucent hue that’s closer to your skin tone. Stretch marks, just like irregular periods and unwanted hair growth, are a fact of life for many girls. Don’t dwell on slight imperfections -- instead, embrace all your beautiful attributes!
Girl Word Daily is the destination tweens looking for great ideas on parties, celebrities and fun activities with friends. Articles and content promote girls power and healthy and safe activities for girls. | null | minipile | NaturalLanguage | mit | null |
[Rat kidney mitochondrial damage induced by acute cadmium administration].
To evaluate effect of acute cadmium administration on mitochondria from rat kidney. 24 male Sprague-Dawley (SD) rats were randomly divided into four groups. Four groups of rats were injected with saline, 0.6, 1.2, and 1.8 mg/kg weight subcutaneously, once daily, for 5 days, respectively. Ultrastructural change of rat kidney mitochondria was observed, and respiration function, membrane potential, mitochondria swelling, and superoxide level were determined. Ultrastructural changes included matrix vacuolation, swelling and condensation of mitochondria. In group of 1.8 mg/kg body weight, the oxygen consumption rate during state 3 respiration [(6.25 +/- 0.61) nmol/L O2 x min(-1) x mg(-1)] and RCR value (2.45 +/- 0.23) were significantly lower than those of control group [(9.66 +/- 1.16) nmol/L O2 x min(-1) x mg(-1)] (P < 0.05), indicating respiration inhibition. The membrane potential and superoxide level of the same group were 85.89% +/- 3.82% and 116.33% +/- 3.06% of control values (P < 0.05), respectively. Acute cadmium administration can cause rat kidney mitochondrial damage in a dose-effect manner, including inhibition of respiration, dissipation of membrane potential, swelling of mitochondria matrix. Such damage might be related to the increase of mitochondrial free radical. | null | minipile | NaturalLanguage | mit | null |
371 F.Supp.2d 155 (2005)
Elisabeth P. JOHNSON
v.
FLEET.[1]
No. 3:04CV162JBA.
United States District Court, D. Connecticut.
June 6, 2005.
*156 Elisabeth Johnson, South Windsor, CT, pro se.
Charles Francis Gfeller, William E. Murray, Edwards & Angell, Hartford, CT, George P. Kostakos, Edwards & Angell, Providence, RI, for Fleet Boston Financial.
Ruling on Defendant's Motions to Dismiss [Docs. # 16, 21]
ARTERTON, District Judge.
Pro se plaintiff Elisabeth P. Johnson, who was employed as a Home Equities Underwriter at Fleet Bank, commenced this suit on January 29, 2004, alleging that defendant FleetBoston Financial Corporation denied her vacation time, delayed in granting her underwriting authority, and ultimately terminated her position on account of her race. The Court reads her complaint as stating only a claim for violation of Title VII. Defendant now moves to dismiss the complaint on grounds of untimely service of process and for failure to exhaust administrative remedies. For the reasons that follow, defendant's motion is DENIED.
I. Background[2]
Plaintiff Elizabeth Johnson ("Johnson"), who is black, worked as a Home Equities Underwriter at Fleet Bank ("Fleet") from November 4, 2002, when she obtained her temporary assignment through Manpower Temporary Employment Agency, until February 21, 2003, when she was terminated from her job at Fleet. She alleges discrimination on account of her race, and in her complaint, focuses on three adverse employment actions taken against her. *157 First, she alleges that in late January 2003 her Fleet supervisor denied her request for five vacation days and a second alternative request for two vacation days because of her race, as two similarly-situated white colleagues were each granted vacation time during a period when the department's workflow was overloaded, while her request was made at a time when business was not busy. Second, plaintiff alleges that her supervisor delayed in granting her underwriting authority on account of her race, claiming that the white underwriters received their authority within two weeks to two months, while the black underwriters in the department were made to wait to two three times longer. Finally, plaintiff alleges that her termination on February 21, 2003 was on account of her race, and that her supervisor's stated reason for the termination that she took a sick day on February 20, 2003 was pretextual.
II. Discussion
Defendant seeks first to dismiss plaintiff's complaint because Johnson did not serve the complaint on Fleet until July 29, 2004, 203 days after filing suit, exceeding the 120 day service period set out in Fed.R.Civ.P. 4(m). Rule 4(m) provides:
If service of the summons and complaint is not made upon a defendant within 120 days after the filing of the complaint, the court, upon motion or on its own initiative after notice to the plaintiff, shall dismiss the action without prejudice as to that defendant or direct that service be effected within a specified time; provided that if the plaintiff shows good cause for the failure, the court shall extend the time for service for an appropriate period.
Plaintiff argues that this Court permitted an extension of time for effecting service in its Notice to Counsel issued on July 8, 2004. The Notice stated that the action was subject to dismissal pursuant to D. Conn. L. Civ. R. 41 for failure to prosecute, and provided that "[u]nless satisfactory explanation of why it should not be dismissed is submitted to the Court within twenty (20) days of the date of this notice, it will be dismissed on July 23, 2004." See Notice to Counsel [Doc. # 5]. Defendant was served on July 23, 2004, and thereafter, moved to dismiss on the basis of untimely service of process.
Although plaintiff is incorrect that the Notice extended her service time period, in light of plaintiff's pro se status and diligence in effecting service by the Rule 41 dismissal deadline, and the fact that defendant has now been served[3] and claims no prejudice, and because plaintiff has since manifested her intent to prosecute this case by timely objecting to defendant's motions and participating in conferences, this Court will not dismiss this action. By its terms, Rule 4(m) permits the extension of time for service of process even in the absence of good cause. See Fed.R.Civ.P. 4(m) (" ... the court... shall dismiss the action without prejudice as to that defendant or direct that service be effected within a specified time ... ") (emphasis added); Charles A. Wright and Arthur R. Miller, Federal Practice and Procedure § 1137 (3d ed.2002). In this case, moreover, dismissal "without prejudice" is not possible, because plaintiff was required to file her Title VII claim within 90 days of her receipt of the Equal Employment *158 Opportunity Commission's ("EEOC") right to sue notice, which in this case was issued on October 31, 2003. Any dismissal, therefore, would effectively end plaintiff's access to federal court. Accordingly, the Court extends plaintiff's time for service of process, and denies defendant's motion to dismiss under Rule 4(m).
Defendants also move to dismiss for failure to exhaust administrative remedies, on grounds that the complaint plaintiff filed with the Connecticut Commission on Human Rights and Opportunities ("CHRO") remains pending. Plaintiff's complaint in this action, which contains no count under the state Fair Employment Practices Act, notes that her CHRO complaint has been retained for full investigation, see Complaint [Doc. # 1] at § E.2, and defendants have attached to their motion a letter from the CHRO dated November 16, 2004, stating that although the complaint had been certified and assigned to the Human Rights Referee for a public hearing, the complaint was being decertified and would be investigated further. See Letter from Raymond P. Pech, Managing Director & Commission Attorney, to Donna Marie Wilkerson, Human Rights Referree, November 16, 2004 [Doc. # 16, Ex. A].
This administrative activity on plaintiff's state law claim is not of significance here. Plaintiff has submitted a copy of her Notice of Right to Sue from the EEOC, see [Doc. # 23], and defendant does not dispute that plaintiff has properly exhausted her federal administrative remedies. Pursuant to 42 U.S.C. § 2000e-5(f), a Title VII claimant may bring suit in federal court after filing a timely complaint with the EEOC and obtaining a right to sue letter.[4]See, e.g. Shah v. New York State Dept. of Civil Service, 168 F.3d 610, 614 (2d Cir.1999); Butts v. City of New York Department of Housing Preservation and Development, 990 F.2d 1397, 1401 (2d Cir.1993). Having provided notice to the appropriate state and federal administrative bodies, plaintiff is entitled to pursue her federal claims with the consent of the EEOC after 180 days. The CHRO recognized as much in denying Fleet's motion to suspend administrative proceedings pending completion of this suit, finding "[t]he Complainant has the right to pursue her complaint in the venues of her choice." See Ruling on Respondent's Motion to Suspend Administrative Proceedings, Oct. 15, 2004 [attached to Doc. # 23].
Title VII authorizes the EEOC to enter into cooperation agreements with state and local anti-discrimination agencies, see 42 U.S.C. § 2000e-8(b); Ford v. Bernard Fineson Development Center, 81 F.3d 304, 306 (2d Cir.1996), and under 42 U.S.C. § 2000e-5(c), the EEOC must defer for 60 days to any state or local proceeding which might be able to deal with charges of *159 employment discrimination. Defendant does not argue that the EEOC did not comply with this 60-day deferral period, and nothing in the statutory framework suggests that further deference to state anti-discrimination agencies is necessary before the EEOC may authorize commencement of a federal suit. Cf. Guse v. J.C. Penney Co., Inc., 562 F.2d 6, 8 (7th Cir.1977) ("[T]he Congressional policy of deference to state and local agencies is embodied in the limited form of a 60-day no-action period. Nothing in s 2000e-5(c) even remotely suggests that state procedures must be exhausted before federal action may continue."). Accordingly, this Court concludes that it has jurisdiction over plaintiff's federal claims, which were properly exhausted with the EEOC's issuance of a right to sue letter.
III. Conclusion
For the foregoing reasons, defendant's motions to dismiss [Docs. # 16, 21] are hereby DENIED.
IT IS SO ORDERED.
NOTES
[1] The originally-captioned defendant was incorrectly identified by plaintiff as FleetBoston Financial. Defendant's correct name at the time of suit was Fleet National Bank. Bank of America Corporation now owns 100% of the outstanding shares of stock of Fleet National Bank.
[2] The facts are drawn from plaintiff's complaint and will be accepted as true for purposes of the motions to dismiss. See Hishon v. King & Spalding, 467 U.S. 69, 73, 104 S.Ct. 2229, 81 L.Ed.2d 59 (1984).
[3] The Court recognizes that defendant has not waived its claim of insufficiency of service of process by its appearance, as it raised this claim as an affirmative defense in its answer and has moved to dismiss on this basis. Defendants challenge only the timeliness of the service, however, not its sufficiency on other grounds.
[4] 42 U.S.C. § 2000e-5(f) provides, in relevant part: "... If a charge filed with the Commission pursuant to subsection (b) of this section is dismissed by the Commission, or if within one hundred and eighty days from the filing of such charge or the expiration of any period of reference under subsection (c) or (d) of this section, whichever is later, the Commission has not filed a civil action under this section or the Attorney General has not filed a civil action in a case involving a government, governmental agency, or political subdivision, or the Commission has not entered into a conciliation agreement to which the person aggrieved is a party, the Commission, or the Attorney General in a case involving a government, governmental agency, or political subdivision, shall so notify the person aggrieved and within ninety days after the giving of such notice a civil action may be brought against the respondent named in the charge (A) by the person claiming to be aggrieved or (B) if such charge was filed by a member of the Commission, by any person whom the charge alleges was aggrieved by the alleged unlawful employment practice."
| null | minipile | NaturalLanguage | mit | null |
smiling sidekick – the true unsung hero, perhaps, for enabling such great deeds to happen while asking for no praise or even name recognition in return! This character is so deep, he contains another entire character that still seems like hot air by comparison! To top it all off, there's even a farewell catchphrase to go with it all!“Defart!” (“Sayo-onara!”)I’ll admit, I got some chuckles out of this one, and one or two were legitimate, un-ironic laughs. Regretful, dumb and embarrassed laughs, maybe, but then I came to realize this only amplifies the show’s greatest message. Perhaps our obsession with insisting on higher-than-thou highbrow-over-lowbrow entertainment is all missing the point; why treat our silly little human senses of humour as somehow subhuman? Why downplay the easy comedic options simply because they aren't "refined” or “sophisticated” enough? If one finds them amusing, then maybe there’s no sense feeling embarrassed, or holding it in.If I really must criticize anything, the only issues I can come up with are pacing problems and slow points, repetition, predictable punchlines, lazy writing, lazier presentation, overly-deadpan delivery to ever-diminishing effect, a soundtrack that's either cheesy or nonexistent, unremarkable sound design, ridiculous logic, and one-dimensional characters with instant and artificial development.Go watch it, seriously. Experiencing this modern classic requires mere minutes of your time!2.5/10 | null | minipile | NaturalLanguage | mit | null |
A provincial Crown agency, CLBC funds day programs, individualized supports, and residential supports, including licensed group homes, for adults with developmental disabilities. In her role as quality service analyst, Helen monitors the government-funded services and conducts site visits similar to the community care facility inspections carried out by licensing officers. She also negotiates and reviews contracts with the service providers.
Helen’s interest in the work stemmed from her experience during and after her bachelor degree studies at the University of Victoria when she worked as a registered care aide in group homes for adults with developmental disabilities.
“While I worked through my degree I saw a lot of examples in group homes of wonderful care and some examples of care that weren’t wonderful. I developed passion for quality assurance and quality care.”
When she researched career options, Helen discovered and enrolled in JIBC’s Advanced Specialty Certificate in Community Care Licensing program, the only program of its kind in Canada.read more »
Courtney Lee has always wanted to work with dogs. After graduating from JIBC’s Law Enforcement Studies Diploma program, she was hired by Securiguard as a dog handler for Diesel, who specializes in explosives detection, at YVR.
Courtney Lee has always loved animals, and dogs in particular. So when she became interested in pursuing a career in law enforcement, her goal of becoming a dog handler seemed a natural fit.
Courtney currently works for Securiguard at Vancouver International Airport as a handler for her canine partner, Diesel, who specializes in explosives detection.
“I decided to take JIBC’s LESD program because it was the only program I could find that offered more of a hands-on approach, and I thought that it would be valuable life experience,” Courtney said.
“I liked the program because it was a different approach to learning. The instructors were mostly ex-law enforcement officers and were able to offer hands-on experience. The courses were truly unique and offered information that students would not normally get, as well as experiences that no other schools offered, like the defensive driving course, applied law, and many others.”
It was at a career fair at JIBC where she learned about the career opportunities available at Securiguard. She had no prior experience working in the security industry but spent time volunteering with the company’s K-9 unit on its training days. The company hired her and eventually she was assigned to the K-9 unit and teamed up with Diesel.
Lana Fox’s peers and colleagues were suffering from the trauma of losing clients from the Downtown Eastside to the opioid overdose crisis. Thanks to JIBC’s Critical Incident Stress Management program, she learned how to help. (Story by Wanda Chow / Photo by Jimmy Jeong)
Lana Fox was working at the Portland Hotel Society in Vancouver’s Downtown Eastside when she noticed her peers and colleagues were suffering.
Her role involved supporting clients with mental health and addictions issues through housing, safe injection and other programs. But before the opioid overdose epidemic made national news headlines and was declared a public health emergency, there was already an obvious change.
“I saw a definitive increase in the trauma being suffered by my peers,” Lana said. “They were attending significantly more overdoses and having increased negative outcomes. Our tenants and program participants were dying at an alarming rate.”
Wanting to help support her colleagues and community, she enrolled in the Critical Incident Stress Management Certificate (CISM) program at the Justice Institute of British Columbia (JIBC).
She found all of her courses were applicable to life in general, citing emergency preparedness as one area she learned new tools that will prove useful one day. The program included simulated debriefings conducted with professional actors to help students practice what they learned.
“Throughout the coursework, it was very easy to imagine how the practice could be applied to my workplace.”
Matt Anderson is keen to be able to use his JIBC paramedic training to serve his remote Central BC community. He also hopes to eventually train others to help provide a basic level of medical care for the town’s 800 residents. (Story by Wanda Chow / Photo by Jimmy Jeong)
Just a week after Matt Anderson successfully completed his paramedic licensing exam he was practically bursting to talk about the possibilities that come with his training at the Justice Institute of British Columbia (JIBC).
After all, as the lone certified paramedic in Moricetown, a Wet’suwet’en village in Central BC halfway between Smithers and Hazelton, he and a licenced Emergency Medical Responder (EMR) were to be the main regular providers of health care to the approximately 800 residents.
It was yet another role in the community for Matt, who is also a high school teacher for at-risk youth, the town’s driving instructor, one of 12 members of its volunteer fire department, and one of only two certified EMRs.
As a first responder, he said, “It’s 24/7. I have a radio on me and I just go when I’m called.”
The town’s fire chief asked him to become the fire department’s “medical guy” because no one else wanted to do it. In a First Nations community, the close knit nature and location can often result in Indigenous firefighters and first responders attending to emergencies involving their own families. This can lead to some uncomfortable situations, unique to a small community.Matt, however, is one of the few non-Indigenous residents, from a family that’s called Moricetown home for almost 40 years.
He agreed to the role, was trained in Occupational First Aid Level 1 and enjoyed it so much he started thinking about becoming a paramedic. He attended JIBC to get his EMR certification and eventually community leaders agreed they wanted him to pursue further training.
His school supervisor and the fire chief both gave him leaves of absence so he could go through the eight-month process of training for the Primary Care Paramedic Certificate at JIBC’s Chilliwack campus and completing the licensing requirements; the Moricetown Volunteer Fire Department and the Kyah Wiget Education Society he works for helped cover some of the costs; and the Moricetown Band is also behind him.
The JIBC training was everything he’d hoped.
“I just loved it. I ate that program up. I loved the instructors. The instructors in Chilliwack are phenomenal and I hear that from everyone. Really great course.”read more »
Sebastien Therrien’s pursuit of a career in policing led him to JIBC. Thanks to his JIBC degree, he’s now enrolled in graduate studies to further his education. (Story by Wanda Chow / Photo by Jimmy Jeong)
Sebastien Therrien’s pursuit of a career in policing led him to the Justice Institute of British Columbia (JIBC) and now his JIBC degree is helping him expand his career opportunities as he pursues a graduate degree.
Growing up in Quebec, Sebastien, now 27, always wanted to be a police officer, a career where he could make a difference while working directly with the public.
That determination was strengthened after he graduated high school and joined the Canadian Forces Army Reserves, while completing a diploma in Police Foundations at La Cité Collégiale in Ottawa. It was at La Cité where he learned of a new agreement between that school and JIBC, where he could apply his education towards completion of JIBC’s Bachelor of Law Enforcement Studies (BLES) degree.
Sebastien says his JIBC education helped open his mind on many subjects, particularly the history of Indigenous peoples in Canada, how they were treated and how that continues to impact that community today.
“In high school I cannot remember learning about that and it’s so important to learn about it. That’s what struck me, like wow, I’m 25, 26 years old and I’m just learning about this?”
Casey Solis is an investigations manager at Canada’s largest risk mitigation and investigation firm. Thanks to her JIBC education in intelligence analysis, she assists clients in a wide range of areas, from mergers and acquisitions to threat risk assessments. (Story by Wanda Chow / Photo by Jimmy Jeong)
The uncovering of fraud, the safety of a community, the fate of billion-dollar corporate deals, protecting intangible assets, ensuring operational continuity, and reducing risk and minimizing loss. They can all depend on the work done by the growing number of intelligence and research analysts like Casey Solis.
She specializes in due diligence and special projects in areas such as mergers and acquisitions, intellectual property issues, threat risk assessments, protest monitoring and insurance or liability claims. Clients range from private corporations and government agencies, to insurance companies, and clients in the telecommunications and energy sector.
“Every day is different and challenging, from formulating investigation plans and exploring new social media platforms or technology to actively engaging in covert investigations. Each file is unique, and treated as such,” she said. “And because no two situations are the same, I am actively using the skills I acquired at JIBC to assess situations, solve problems, and identify solutions. It is addicting.”
There was a time when Anna Richards had a tendency to avoid conflict. Thanks to JIBC’s Conflict Resolution training, she now faces it head on and incorporates those lessons into her work as a counsellor. (Story by Wanda Chow / Photo by Jimmy Jeong)
Anna Richards was working as a wildland firefighter when she got promoted to leader of a fire crew. But while she knew how to dig a fire line and use a chainsaw, negotiating interpersonal matters was all new to her.
“My strategy was to be ‘easy going.’ I thought that if I treated everyone like they already knew what to do, that they would feel comfortable and motivated and would just ask questions along the way,” she recalls. “When conflict arose, I just hoped it would take care of itself.”
Ultimately, she learned that in that kind of leadership vacuum, people get confused about their roles and responsibilities. That experience helped her recognize that conflict intimidated her and that by avoiding it, she had not been as effective a leader as she wanted to be.
Anna left her firefighting career and went on to earn her master’s degree in counselling.
“When I decided to become a counsellor, I promised myself that I’d do whatever it took to gain the skills I needed to face conflict head on.”
Anna learned about the Justice Institute of British Columbia (JIBC) from a JIBC instructor who gave a workshop at her workplace and impressed her with his skills and ability to hold a room.
Adam was part of a fire crew recently called out to a fire at a rubber mat-manufacturing plant.
“The call came in as a small smoldering fire and naturally, we expected just that. However things took a quick turn when we pulled out of the hall to a large plume of thick black smoke coming from the area.”
When they arrived, they found a huge blaze outside fuelled by pallets loaded with rubber mats. They were very close to the side of the building which threatened to catch fire too.
It would be a big job to tackle in any case, but since they were responding to what was reported as a minor fire, they were the only fire engine on scene until additional crews could show up following his captain’s update.
“Being understaffed for a period of time at such a fire called on us to be extremely efficient with our resources and left us with absolutely no room for error in our techniques employed in efforts to keep the building from catching,” Adam recalled.
“During this fire more than any other one to date, it was critical for me to utilize the training I received from JIBC. How to individually manage a 2.5-inch fire hose line for an extended period of time, to conserve your air intake while exerting high energy, and how to communicate in a very dynamic and challenging environment are but some of the skills taught to me at the Maple Ridge campus that I employed.” | null | minipile | NaturalLanguage | mit | null |
Evaluation of cisplatin administered with piroxicam in dogs with transitional cell carcinoma of the urinary bladder.
To evaluate the antitumor activity and toxic effects of a conservative dose of cisplatin administered in combination with piroxicam to dogs with transitional cell carcinoma (TCC) of the urinary bladder. Clinical trial (nonrandomized, noncontrolled). 14 client-owned dogs with histologically confirmed TCC of the urinary bladder. Each dog was treated with cisplatin (50 mg/m(2), i.v., q 21 d [reduced to 40 mg/m(2), i.v., q 21 d because of toxic effects]) and piroxicam (0.3 mg/kg [0.14 mg/lb], PO, q 24 h). A CBC, serum biochemical analyses, and urinalysis were performed prior to each cisplatin treatment. Tumor staging (determined from thoracic and abdominal radiographic and urinary bladder ultrasonographic findings) was performed before treatment and at 6-week intervals during treatment. 5 dogs received only 1 dose of cisplatin because of the rapid progression of disease (n = 2) or toxic effects (3). With regard to the neoplastic disease among the other 9 dogs, 1 had partial remission, 5 had stable disease, and 3 had progressive disease after 6 weeks of treatment. Median progression-free interval was 78 days (range, 20 to 112 days). Median survival time was 307 days (range, 29 to 929 days). Moderate to severe renal toxicosis and moderate to severe gastrointestinal toxicosis developed in 5 and 8 dogs, respectively. Because of minimal efficacy and associated renal and gastrointestinal toxicosis, administration of cisplatin (40 to 50 mg/m(2)) with piroxicam cannot be recommended for treatment of dogs with TCC of the urinary bladder. | null | minipile | NaturalLanguage | mit | null |
[Type 2 diabetes: practical guide for starting ambulatory insulin therapy].
This practical guide describes the most currently used insulins--classified according to their duration of action, the insulin pens and the glucose monitoring devices. Various strategies of insulin treatment for type 2 diabetes are explained, with emphasis on the two most frequently used forms of therapy: combined daily oral agents and nocturnal insulin, and twice daily injections of long-acting insulin. The advantages and disadvantages of premixed insulin are described. Finally, the four main topics of patient education for starting insulin therapy are mentioned. | null | minipile | NaturalLanguage | mit | null |
Thanks.
I am looking for volumes that traded last year - not necessarily volumes that
flowed. Volumes that flowed include term transactions.
Can you think of a way to find this info?
Eric
Enron Capital Management
From: David Baumbach 01/25/2001 11:08 AM
To: Eric Bass/HOU/ECT@ECT
cc:
Subject: Stats
Hope this is what you were looking for.
---------------------- Forwarded by David Baumbach/HOU/ECT on 01/25/2001
11:07 AM ---------------------------
From: Jim Little on 01/25/2001 10:59 AM
To: David Baumbach/HOU/ECT@ECT
cc:
Subject: Stats
Here are the total volumes by quarter and by region. We are looking into the
EOL since we do not have currently have regional information. Perhaps you
have a way of estimating based on CPR? | null | minipile | NaturalLanguage | mit | null |
Q:
Avoid multiple data with same value when display list
i have a map with data like below
Map map = {{'data1': 500}, {'data2': 200}, {'data3': 750}, {'data4': 200}}
and then i display it using MapEntry
for (MapEntry<String, num> value in mapList.entries)
Column(children: <Widget>[
Text(value.key),
Text(value.value)
]
How do i display it sorting according to value by ascending and also avoid displaying multiple data with the same value
example output
data2 / data4
200
data1
500
data3
750
A:
I would properly use a SplayTreeMap and switch the key and value. Something like this:
import 'dart:collection';
void main() {
final list = [
{'data1': 500},
{'data2': 200},
{'data3': 750},
{'data4': 200}
];
final sortedMap = SplayTreeMap<int, List<String>>();
for (final entry in list) {
sortedMap
.putIfAbsent(entry.entries.first.value, () => [])
.add(entry.entries.first.key);
}
for (final entry in sortedMap.entries) {
print('${entry.value.join(' / ')}');
print(entry.key);
}
// data2 / data4
// 200
// data1
// 500
// data3
// 750
}
The SplayTreeMap will automatically sort the key values in the map so it makes sense to use your int-number here as the key and then save a List<String> of your keys which have the same numeric value.
| null | minipile | NaturalLanguage | mit | null |
Coal and Steel Industries
Modern mining has very strict regulations which require the use of portable gas detectors.
There are many different processes employed in making and forming steel and each stage generates and uses potentially hazardous gases. Coke ovens, the sinter plant, blast furnaces, forming operations as well as secondary steel and continuous casting use or produce dangerous levels of gases.
Workers in steel plants must wear carbon monoxide detectors at all times as this is a hazard in steel production. In addition, blast furnaces must be equipped with hydrogen detection equipment. For leak control, suitable portable gas detectors must be used, to give rapid warning of explosive and toxic gas leaks. Protect workers from exposure to toxic or flammable gas hazards.
Hanwei Electronics offer an extensive range of portable gas detection equipment designed to monitor a wide variety of toxic and combustible gases, such as methane, hydroxide, carbon monoxide, carbon dioxide and oxygen deficiency. | null | minipile | NaturalLanguage | mit | null |
Q:
C++ collection with variable types keyed by type
I'm making a class for lazy initialization of a bunch of objects (not totally generic, all under my control). Only one object of each type will exist. I have a linear-time implementation using std::vector and boost::any already. Hopefully it should give a better idea of what I'm talking about.
I can make the assumption that all the objects I'll want to access have
typedef boost::shared_ptr<CLASSNAME> HandleType
in their definitions and they all have a constructor that takes the ObjectProvider by reference.
class ObjectProvider {
typedef std::vector<boost::any> ContainerType;
ObjectProvider() : container() {}
public:
// this is where the relevant method is
template <class TElementType>
typename TElementType::HandleType get() {
for (ContainerType::iterator it = container.begin(); it != container.end(); ++it) {
try {
return boost::any_cast<typename TElementType::HandleType>(*it);
} catch (boost::bad_any_cast &) {}
}
// failed to find it so create it
TElementType::HandleType handle = boost::make_shared<TElementType>(*this);
container.push_back(handle);
return handle;
}
private:
ContainerType container;
};
// ----- FOR TESTING -----
class SomeObject {
public:
SomeObject(ObjectProvider &) {}
typedef boost::shared_ptr<SomeObject> HandleType;
};
int main(int argc, char** argv) {
ObjectProvider provider;
// expensive creation is done here
SomeObject::HandleType obj1 = provider.get<SomeObject>();
// expensive creation is not re-done
SomeObject::HandleType obj2 = provider.get<SomeObject>();
assert (obj1 == obj2); // pointers should point to the same object
}
Some motivation: Many of these objects (they're clients for various services) require creating additional clients of various types, but I don't want to be recreating them each time. So the goal of this class is to provide a method of caching the already-created clients.
Here is my question:
Is there a better way to do this?
In particular, is there a way to avoid the loop in get<...>() and somehow key by type? I'd love to have constant-time access instead of linear time and the current method fails to make use of the type information available for lookup.
Just for a little additional explanation of what I'm thinking, I might do something like this in Java:
Map<Class<?>, Object> objMap;
public <T> T get(Class<T> class) {
Object obj = objMap.get(class);
if (obj != null) {
return (T)obj;
} else {
T newObj = ;// fiddle with java reflection to create a new instance
objMap.put(class, newObj);
}
}
A:
If there is only one of each type, then you can use typeid to extract a string representing the type, and use that as a key to a map or unordered_map.
//...
typedef std::map<std::string, boost::any> ContainerType;
//...
template <class TElementType>
typename TElementType::HandleType get() {
std::string name = typeid(TElementType).name();
ContainerType::iterator it = container.find(name);
if (it != container.end()) {
try {
return boost::any_cast<typename TElementType::HandleType>(it->second);
} catch (boost::bad_any_cast &) {}
}
// failed to find it so create it
TElementType::HandleType handle = boost::make_shared<TElementType>(*this);
container[name] = handle;
return handle;
}
| null | minipile | NaturalLanguage | mit | null |
Search form
Search
Excel
Bank of Jordan Wins Award for OTP Service
Date:
07/01/2018
(Amman – November 2017) Bank of Jordan received the Excellence Award for being the first Bank in the Kingdom to offer the One-Time Password (OTP) service to all its credit card holders. The award was distributed during the fifth Payment Conference organized by leading payment solutions provider Network International held at the Four Seasons Hotel on 25/10/2017.
This year’s conference, which came under the theme “Taking e-payments forward for a Better Tomorrow” was held under the patronage of the Central bank of Jordan, and brought together industry experts who discussed rapid transformations in e-payment services.
Under the OTP service, online- shopping has become more secure; credit card holders receive an OTP via SMS on their registered mobile numbers that is valid for only one login session or transaction. It is worth noting that the OTP is generated for every transaction made using registered online shopping sites. | null | minipile | NaturalLanguage | mit | null |
817 F.2d 757
Unpublished DispositionNOTICE: Sixth Circuit Rule 24(c) states that citation of unpublished dispositions is disfavored except for establishing res judicata, estoppel, or the law of the case and requires service of copies of cited unpublished dispositions of the Sixth Circuit.UNITED STATES of America, Plaintiff-Appellee,v.Ollie E. LeFLORE, Defendant-Appellant.
No. 85-1010.
United States Court of Appeals, Sixth Circuit.
May 7, 1987.
Before MERRITT and NELSON, Circuit Judges, and CONTIE, Senior Circuit Judge.
PER CURIAM.
1
Defendant Ollie E. LeFlore appeals from his convictions under 18 U.S.C. Sec.Sec. 751 and 4082(d) for escaping from the custody of the Attorney General. Defendant principally asserts that his indictment-should have been dismissed because of violations of the Interstate Agreement on Detainers Act and that his convictions should be set aside because his trial counsel was ineffective. For the reasons which follow, we remand this case for further proceedings in connection with the ineffectiveness claim.
I.
2
Defendant LeFlore was committed to the custody of the United States Attorney General on January 2, 1974, pursuant to a conviction not before this court. He was transferred from a federal prison to Project Rehab Community Treatment Center (a contract halfway house) on February 3, 1983. On April 11, 1983, LeFlore did not return to the halfway house as scheduled, and an arrest warrant for his escape from the custody of the Attorney General was issued on April 19, 1983. On January 13, 1984, LeFlore was apprehended by Detroit, Michigan police officers and was placed in state custody pending trial on state charges.1 He went to trial on the state charges and was acquitted on May 10, 1984. It is evident that from the time of his arrest until his acquittal defendant LeFlore was not a state prisoner but was merely a state pre-trial detainee.
3
Between the time LeFlore was arrested by state authorities and acquitted on the state charges, he was transferred back and forth between state and federal jurisdictions. Pursuant to a writ of habeas corpus ad prosequendum, defendant was first taken into federal custody on February 9, 1984,2 but he did not have his first appearance on the escape charges until February 17, 1984. He returned to federal district court on February 21, 1984, for a bond hearing, and on March 2, 1984, for a preliminary examination. A grand jury indictment was issued on March 20, 1984. He was represented by court appointed counsel, Allan Long, from the time of his first appearance through the remainder of the trial proceedings. Between the time he was taken into federal custody and the time the indictment was issued, he remained in federal custody. However, he was transferred back to state custody on March 28, 1984.
4
Defendant asserts that on April 11, 1984, a detainer with respect to his escape charge was issued by the federal government, and on April 20, 1984, he was once again transferred from state custody to federal custody pursuant to a federal writ of habeas corpus ad prosequendum for an arraignment and the taking of his plea on the escape charge. He remained in federal custody from April 20 to May 3, 1984, at which time he was transferred back to state custody for trial.
5
Following his acquittal on the state charges, defendant was held by the state authorities pursuant to the federal detainer, and was transferred back to federal custody on May 18, 1984.
6
Prior to commencement of trial, but on the same day of trial, counsel for defendant filed a motion to dismiss the indictment pursuant to the Interstate Agreement on Detainers Act, 18 U.S.C. App., and defendant requested the court to appoint a substitute counsel asserting that his counsel was ineffective. The court denied both the motion and the request.
7
At trial, several witnesses from the Community Treatment Center testified that LeFlore had not returned as scheduled, and never made contact with any federal authorities to turn himself in. LeFlore testified in his own behalf. His defense, inter alia, was that on the date of his escape, someone shot at him and that the man he was with, Richard Ferguson, was hit by the gunfire. As a result, he was afraid of returning to the halfway house for fear that someone there was involved in the shooting. As time passed, he was afraid that he would be punished for something that he had not instigated. On cross-examination, the following colloquy took place between the federal prosecuting attorney and defendant:
8
Q You knew that Richard Ferguson had said that it was you who shot him isn't that true?
9
A Beg pardon.
10
Q Didn't you know that Richard Ferguson alleged that you had shot him?
11
A Yes, he lied.
12
Q Isn't that the reason that you did not return to the center?
13
A My reason is just what I stated.
14
Q You did not want to punished for being involved with Richard Ferguson who you shouldn't have been involved with and for getting involved in a shooting that you shouldn't have been involved with, isn't that true?
15
A No, it isn't.
16
Defendant's counsel did not elicit rebuttal testimony subsequent to this exchange regarding defendant's acquittal on state charges resulting from the shooting.
17
Defendant was convicted by a jury on both counts. He was sentenced to a total of three-years imprisonment on November 8, 1984, to be served consecutive to existing sentences.
18
A timely appeal was filed, and appellate counsel was appointed on October 16, 1985. Briefs were filed by both defendant, pro se, and defendant's counsel.
II.
A.
19
Defendant first asserts that his indictment should have been dismissed pursuant to the Interstate Agreement on Detainers Act.
20
The Interstate Agreement on Detainers Act (Agreement), 18 U.S.C. App., sets forth procedures for obtaining prisoners held in another jurisdiction, as well as sanctions for failing to abide by those procedures. The Agreement has two primary purposes: to facilitate the expeditious disposition of pending charges against prisoners, and to minimize the interference with treatment and rehabilitation of persons serving sentences. See United States v. Mauro, 436 U.S. 340, 343 (1978); United States v. Roberts, 548 F.2d 665, 669 (6th Cir.), cert. denied, 431 U.S. 931 (1977).
21
Defendant asserts that once the federal government had custody of him following the issuance of the detainer, the government was required to bring him to trial before returning him to the state of Michigan pursuant to Article IV of the Agreement; since that did not occur, he argues that the indictment should have been dismissed. However, even though a detainer is filed by the federal government against an individual, that factor alone does not trigger the Interstate Agreement on Detainers Act; rather, the defendant must be incarcerated in the "sending" state (the state in which the defendant is being held). Since defendant was only a pre-trial detainee in Michigan, the "sending" state, the Agreement was not rendered applicable. See United States v. Dixon, 592 F.2d 329, 333 (6th Cir.) ("the provisions of the Agreement are applicable only when a participating jurisdiction, having untried charges pending against , a prisoner, first lodges a detainer with the participating jurisdiction where the prisoner is incarcerated"), cert. denied, 441 U.S. 951 (1979); Roberts, 548 F.2d at 671 (Agreement's provisions do not "apply to persons being detained for trial who are not serving prison sentences").3
B.
22
The defendant also asserts that his convictions should be set aside due to the ineffectiveness of trial counsel. In Strickland v. Washington, 466 U.S. 668 (1984), the Supreme Court set forth a two-prong test for establishing a denial of effective assistance of counsel under the Sixth Amendment:
23
First, the defendant must show that counsel's performance was deficient. This requires showing that counsel made errors so serious that counsel was not functioning as the "counsel" guaranteed the defendant by the Sixth Amendment. Second, the defendant must show that the deficient performance prejudiced the defense. This requires showing that counsel's errors were so serious as to deprive the defendant of a fair trial, a trial whose result is reliable. Unless a defendant makes both showings, it cannot be said that the conviction or death sentence resulted from a breakdown in the adversary process that renders the result unreliable.
24
Id. at 687. Accordingly, a defendant is required to show that his counsel's performance was deficient, and that there is a "reasonable probability that, but for counsel's unprofessional errors, the result of the proceeding would have been different." Id. at 694. See also Watson v. Marshall, 784 F.2d 722, 725 (6th Cir. 1985), cert. denies, 106 S. Ct. 1955 (1986). A claim of ineffective assistance of counsel is made if defense counsel "deprive [s] a criminal defendant of a substantial defense by his own ineffectiveness or incompetence." Beasley v. United States, 491 F.2d 687, 696 (6th Cir. 1974).
25
Defendant asserts that his trial counsel was ineffective for failing to seek dismissal of the indictment pursuant to the speedy trial limitations set forth in 18 U.S.C. Sec.3161(b), and for failing to put forth rebuttal evidence regarding the April 11, 1983 shooting incident.4
26
While we believe that defendant has failed to establish that his counsel's performance was deficient or prejudicial in other respects,5 we are persuaded that his speedy trial argument may have merit. Section 3161 (b) provides in pertinent part: "Any information or indictment charging an individual with the commission of an offense shall be filed within thirty days from the date on which such individual was arrested or served with a summons in connection with such charges." This time limit can be extended in accordance with section 3161(h). If an indictment is not timely filed, the "charge against that individual contained in such complaint shall be dismissed or otherwise dropped." 18 U.S.C. Sec. 3162(a)(1).
27
In the instant case, there is evidence that defendant was taken into federal custody on this escape charge on February 9, 1984, had his first appearance on February 17, 1984, and was indicted on March 20, 1984. If the speedy trial limitations set forth in section 3161(b) began to run on February 9, or February 17, and was not tolled, it is evident that the indictment was not filed in a timely manner. Further, if the indictment was not timely filed and counsel failed to seek to have the complaint dismissed, we believe defendant states a viable Sixth Amendment claim. However, because of various conflicts in the record, it is not clear when defendant was "arrested or served with a summons in connection with such charges" within the meaning of section 3161(b), nor has the record been developed to establish possible extensions of time pursuant to section 3161 (h) . The record is simply too sketchy for this court to make a determination of ineffectiveness of counsel on appeal.
28
Accordingly, we REMAND this case to the district court for a development of the record and a determination on this particular ineffectiveness claim. We have reviewed the remainder of defendant's claims and find them to be without merit.
1
The state charges arose out of a shooting incident occurring on April 11, 1983, the date of LeFlore's escape from federal custody
2
There is a conflict in the record as to whether he was taken into custody on the escape charge, or whether he was taken into custody on other unrelated charges which were subsequently dismissed
3
Accordingly, even if defendant was "incarcerated" within the meaning of the Agreement while in the federal prison, that does not change the result in this case. The Agreement only applies when the "receiving" state (the state requesting to bring a prisoner to trial) files a detainer and that individual is incarcerated in the "sending" state. Since he was never incarcerated in Michigan, the Agreement was not applicable. Further, defendant's claim that he was not accorded pre-transfer hearings in violation of the Uniform Criminal Extradition Act is to no avail, since the federal government has not adopted that Act
4
The government argues that we cannot reach the speedy trial claim because defendant failed to raise speedy trial objections at trial. This argument ignores the fact that defendant is not raising speedy trial violations per se, but is challenging the ffectiveness of his trial counsel based upon counsel's failure to recognize the importance of that issue. The effectiveness of his trial counsel can be raised on appeal, particularly since defendant informed the district court of his concerns over counsel's performance
5
In particular, we note that appellant has failed to meet his burden of showing prejudice with respect to his trial counsel's failure to call certain witnesses. Appellant has not only failed to explain what the content of the testimony would have been, but he has also failed to show that the result of the proceeding would have been different had this testimony been elicited
| null | minipile | NaturalLanguage | mit | null |
1. Field of the Invention
The present invention relates to a press jacket for a press device in the treatment of a web material, e.g., draining (dewatering) or smoothing a fibrous pulp web, and to a press roll including the press jacket. The press jacket may include a plurality of holes formed in the surface of the press jacket.
2. Discussion of Background Information
Press jackets similar in general to the type described above may be utilized, e.g., in extended nip presses or smoothing mechanisms in the manufacturing of paper. The press jacket is conventionally formed as a continuous tube and is rotatable around its longitudinal axis via both jacket ends. The interior of the press jacket, i.e., in the axial direction, lies close to a press shoe positioned within the press jacket, i.e., to extend over the entire length of the press jacket and to extend in a circumferential direction over a pre-determined width. A pressure directed radially outwardly via a cylinder-piston arrangement may be exerted on the press shoe against the interior of the roll jacket. In this manner, a portion of the press jacket adjacent the press shoe, i.e., forming of the press nip or press zone, can be pressed against a mating roll positioned parallel to the press roll.
The fibrous pulp web to be treated is guided through the press zone, i.e., between the press roll and the mating roll, so that the pressure exerted in the press zone creates a smoothing and/or draining of the fibrous pulp web. Depending on the specific use, a felt belt may be positioned on one or both sides of the fibrous pulp web to guide the fibrous pulp web through the press zone. In this manner, the liquid removed from the fibrous pulp web may be absorbed by the felt belt(s) and transported away from the fibrous pulp web.
To improve the removal of liquid, it is conventional to form a plurality of holes in the surface of the press jacket. These holes are filled by the liquid removed from the fibrous pulp web or felt belt within the press zone. As the press roll rotates, the holes filled with liquid are emptied outside of the press zone. In this manner, upon reentering the press zone, the holes positioned in the press zone are ready to absorb liquid.
However, press jackets having such holes are problematic, particularly depending on the size and geometric arrangement of the holes in the press jacket surface. A shadow hole marking appears on the paper web being treated if the pressing and the fluid removal does not occur evenly over the surface of the paper web. Sometimes the marking is so subtle that they are not visible on the actual paper web, but become visible during the printing of the paper web.
Since the drainage holes in the roll jacket surface are usually distributed as evenly as possible over the surface of the press jacket, enabling even and sufficient draining, the hole shadow markings have a conspicuous regularity. It is this conspicuousness that is particularly troublesome. Further, variation in hole size or uneven distribution of the holes over the jacket surface is not suitable for reducing of the hole shadow markings, because the holes must have optimized dimensions and be substantially equidistant from each other to provide the necessary dewatering of the web. | null | minipile | NaturalLanguage | mit | null |
1. Introduction {#sec1-cells-09-00888}
===============
Circulating tumor cells (CTCs) are tumor cells that shed from solid tumors and circulate in the peripheral blood. As CTCs play a pivotal role in development of distant metastases, CTCs potentially provide important clinical information such as prognosis and therapeutic effect in a variety of malignant tumors \[[@B1-cells-09-00888],[@B2-cells-09-00888],[@B3-cells-09-00888],[@B4-cells-09-00888]\]. However, detection of rare CTCs contaminated in a large number of normal hematologic cells remains technical challenges. In fact, a variety of systems for detection of CTCs have been developed \[[@B5-cells-09-00888],[@B6-cells-09-00888],[@B7-cells-09-00888],[@B8-cells-09-00888],[@B9-cells-09-00888]\], but the CellSearch (Merarini Silicon Biosystems, Huntington Valley, PA, USA) is the only approved system for the clinical use. The CellSearch is an automated system in which CTCs are immunomagnetically isolated with an antibody against epithelial cell adhesion molecule (EpCAM) that is abundantly expressed on epithelial tumor cells \[[@B10-cells-09-00888]\]. Accordingly, CTCs without EpCAM expression, such as tumor cells undergoing epithelial-mesenchymal transition (EMT) and non-epithelial tumor cells, may not be detected with the CellSearch. In our previous study, we evaluated CTCs using the CellSearch in patients with malignant pleural mesothelioma (MPM). CTCs were detected in only one-third (32.7%) patients, which was mainly caused by negative or low expression of EpCAM on MPM cells \[[@B11-cells-09-00888]\]. To capture a wide variety of CTCs including tumor cells without EpCAM expression, we have developed a novel microfluidic system ("universal CTC-chip system") in which any antibody to capture CTCs is easily conjugated \[[@B12-cells-09-00888],[@B13-cells-09-00888],[@B14-cells-09-00888],[@B15-cells-09-00888],[@B16-cells-09-00888]\].
Podoplanin, a transmembrane mucin-type sialoglycoprotein, plays an important role in the prenatal development of lymphatic vasculature and lung. In the adulthood, podoplanin is expressed on some normal tissues such as lymphatic vessels and type I alveolar epithelium \[[@B17-cells-09-00888],[@B18-cells-09-00888]\]. Podoplanin is also expressed on a wide variety of malignant tumors \[[@B19-cells-09-00888],[@B20-cells-09-00888],[@B21-cells-09-00888],[@B22-cells-09-00888],[@B23-cells-09-00888],[@B24-cells-09-00888],[@B25-cells-09-00888]\], which may contribute to tumor progression mainly by promoting aggregation and activation of platelet \[[@B26-cells-09-00888],[@B27-cells-09-00888],[@B28-cells-09-00888],[@B29-cells-09-00888],[@B30-cells-09-00888]\]. Podoplanin is a well-known diagnostic marker of MPM, as mesothelioma cells show high expression of podoplanis whereas the specific function has yet to be determined \[[@B24-cells-09-00888]\]. Accordingly, to capture MPM cells, we coated the CTC-chip with an anti-podoplanin antibody. In our previous studies, we used a common anti-podoplanin antibody (clone E-1), and MPM cells were effectively captured with the CTC-chip \[[@B14-cells-09-00888],[@B15-cells-09-00888],[@B16-cells-09-00888]\]. In addition, the CTC-chip provided a superior sensitivity in detection of CTCs in MPM patients over the CellSearch \[[@B16-cells-09-00888]\]. In the current study, to achieve a higher sensitivity, we employed a novel and highly-reactive anti-podoplanin antibody (clone NZ-1.2 \[[@B23-cells-09-00888]\]) to detect CTCs in MPM.
2. Materials and Methods {#sec2-cells-09-00888}
========================
2.1. Cell Lines {#sec2dot1-cells-09-00888}
---------------
Human epithelioid-subtype MPM cell lines (ACC-MESO-4, ACC-MESO-1, and NCI-H226), biphasic-subtype MPM cells line (MSTO-211H), and sarcomatoid-subtype MPM cell line (NCI-H28) were employed. ACC-MESO-4 and ACC-MESO-1 were purchased from the Riken BioResource Center (Tsukuba, Japan), and the other cell lines were from American Type Culture Collection (ATCC; Manassas, VA, USA). Cells were cultured in RPMI-1640 (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific Inc., Waltham, MA, USA) at 37 °C and 5% CO~2~.
2.2. Flow Cytometry for Evaluation of Podoplanin Expression {#sec2dot2-cells-09-00888}
-----------------------------------------------------------
Cells were incubated with the anti-podoplanin antibody, NZ-1.2 (50 µg/mL) for 60 min at room temperature. Next, cells were washed with PBS and were incubated with an Alexa Flour 488-conjugated goat anti-rat IgG (H + L) (Thermo Fisher Scientific Inc.) diluted at 1:100. Flow cytometric analysis was performed using the EC800 Cell Analyzer (Sony, Tokyo, Japan) and the FlowJo software (BD Bioscience, Franklin Lakes, NJ, USA). The mean fluorescence intensity (MFI) ratio was determined as the ratio of the mean fluorescein intensity of NZ-1.2 to that of the negative control.
2.3. Preparation of CTC-Chip {#sec2dot3-cells-09-00888}
----------------------------
The CTC-chip was used after a two-step coating, as described previously \[[@B14-cells-09-00888],[@B15-cells-09-00888],[@B16-cells-09-00888]\]. Briefly, the chip was first incubated with a base-antibody at the concentration of 200 µg/mL overnight at 4 °C. Thereafter, the chip was incubated with a capture-antibody (an anti-podoplanin antibody, clone NZ-1.2 or clone E-1 \[Santa Cruz Biotechnology, Dallas, TX, USA\]) for 60 min at room temperature. A mouse anti-rat IgG antibody (SouthernBiotech, Birmingham, AL, USA) was used as the base antibody when the chip was coated with the NZ-1.2 antibody ("NZ1.2-chip"), and a goat anti-mouse IgG antibody (SouthernBiotech) when the chip was coated with the E-1 antibody ("E1-chip").
2.4. Evaluation of Cell-Capture Efficiency {#sec2dot4-cells-09-00888}
------------------------------------------
Cell-capture efficiency was evaluated as described previously \[[@B14-cells-09-00888],[@B15-cells-09-00888],[@B16-cells-09-00888]\]. In brief, 100 tumor cells labeled with CellTrace CSFE Cell Proliferation kit (Thermo Fisher Scientific Inc.) were suspended in 1 mL of the blood sampled from a healthy volunteer (K.T.). The cell suspension sample was applied to the CTC-chip, which was monitored and recorded with a fluorescence microscope (CKX41; Olympus, Tokyo, Japan) and a digital video camera (Sony). The total number of tumor cells applied to the CTC-chip (N-total) was determined as the number of cells that passed through the inlet of the CTC-chip. The number of captured cells (N-captured) was determined as the number of CFSE-labeled cells remained on the CTC-chip. The cell-capture efficiency was represented as N-captured/N-total. Experiments were performed in triplicate.
2.5. Clinical Evaluation of CTCs in MPM Patients {#sec2dot5-cells-09-00888}
------------------------------------------------
The peripheral blood was sampled from patients with pathological diagnosis of MPM, and was drawn to a sample tube (BD Vacutainer EDTA-2K; Becton, Dickinson and Company, Franklin Lakes, NJ, USA). A 1 mL of the blood was taken from the tube and was applied to the NZ1.2-chip, and another 1 mL of the blood taken from the same sample tube was applied to the E1-chip.
Cells captured on the CTC-chip were stained with an anti-cytokeratin (CK) antibody (rabbit polyclonal; Abcam, Cambridge, MA, USA) followed by incubation with an anti-rabbit IgG antibody conjugated Alexa Fluor^®^ 594 (Thermo Fisher Scientific Inc.), an anti-CD45 antibody (rat monoclonal, clone YTH24.5; Abcam) followed by incubation with an anti-rat IgG antibody conjugated Alexa Fluor^®^ 488 (Thermo Fisher Scientific Inc.), and with Hoechst33342 (Cell Signaling Technology, Danvers, MA, USA). Each cell with round to oval morphology, a Hoechst33342-positive nucleus, positive staining for CK in the cytoplasm, and negative staining for CD45 was judged as a CTC \[[@B16-cells-09-00888]\].
The revised TNM criteria were used to determine clinical stage (c-stage) \[[@B16-cells-09-00888]\]. This study was approved by the Ethics Committee of Medical Research, University of Occupational and Environmental Health, Japan (H26-15), and was performed in accordance with the Declaration of Helsinki.
2.6. Statistical Analysis {#sec2dot6-cells-09-00888}
-------------------------
The proportions of un-paired categorical data were compared by the chi-square test or the Fisher's exact test, and those of paired categorical data were compared by the McNemar's test. Continuous data were compared with a non-parametric test (Wilcoxon signed rank test for paired data, and Mann-Whitney U-test or Kruskal-Wallis test for un-paired data). Differences were considered to be statistically signified for *p*-value \< 0.05. All statistical analysis was performed with GraphPad PRISM software (GraphPad Software, Inc., La Jolla, CA, USA).
3. Results {#sec3-cells-09-00888}
==========
3.1. Podoplanin Expression in MPM Cell Lines {#sec3dot1-cells-09-00888}
--------------------------------------------
All epithelioid MPM cell lines (ACC-MESO-1, ACC-MESO-4 and NCI-H226) showed high podoplanin expression. In contrast, non-epithelioid MPM cell lines (NCI-H28 and MSTO-211H) showed no significant podoplanin expression ([Figure 1](#cells-09-00888-f001){ref-type="fig"}).
3.2. Cell-Capture Efficiency of NZ1.2-Chip {#sec3dot2-cells-09-00888}
------------------------------------------
First, we examined the optimal concentration of the NZ-1.2 antibody for the CTC-chip using the ACC-MESO-4 cells with the highest podoplanin expression. The highest capture efficiency was achieved at the concentration of 5.0 mg/mL ([Figure 2](#cells-09-00888-f002){ref-type="fig"}), which was adopted as the optimal concentration of the NZ-1.2 in further experiments.
Next, we examined the efficiency in capturing various MPM cell lines with the NZ1.2-chip. Epithelioid MPM cell lines (ACC-MESO-1 and NCI-H226) with high podoplanin expression were effectively captured, but the cell-capture efficiency for non-epithelioid cell lines (NCI-H28 and MSTO-211H) was low ([Figure 3](#cells-09-00888-f003){ref-type="fig"}).
3.3. Clinical Evaluation of CTCs in MPM Patients {#sec3dot3-cells-09-00888}
------------------------------------------------
We sampled the peripheral blood from a total of 22 MPM patients treated between November 2016 and September 2018 ([Table 1](#cells-09-00888-t001){ref-type="table"}) for detection of CTCs ([Figure 4](#cells-09-00888-f004){ref-type="fig"}) at the diagnosis of MPM. One or more CTCs were detected with either E1-chip or NZ1.2-chip in 19 (86.4%) patients; 6 (27.3%) patients were positive with E1-chip and positive with NZ1.2-chip, 4 (18.2%) patients were positive with E1-chip and negative with NZ1.2-chip, 9 (40.9%) patients were negative with E1-chip and positive with NZ1.2-chip, and 3 (13.6%) patients were negative with E1-chip and negative with NZ1.2-chip. In total, CTCs were detected in 10 (45.5%) patients with the E1-chip and in 15 (68.2%) patients with the NZ1.2-chip. Of noted, in most (12/13, 92.3%) epithelioid MPM patients, CTCs were detected in the peripheral blood with the NZ1.2-chip ([Table 1](#cells-09-00888-t001){ref-type="table"}).
The distribution of CTC-count detected with the NZ1.2-chip and that with the E1-chip in each sample was shown in [Figure 5](#cells-09-00888-f005){ref-type="fig"}A. The median CTC-count for the E1-chip and for the NZ1.2-chip were "0" (range, 0--7) and "2" (range, 0--11), respectively, indicating a significantly higher CTC-count was achieved with the NZ1.2-chip (*p* = 0.034). The difference in the CTC-count detected with the E1-chip and the NZ1.2-chip was highly significant in epithelioid patients (median CTC-count, 0 and 3, respectively; *p* = 0.013) ([Figure 5](#cells-09-00888-f005){ref-type="fig"}B). In some patients, changes in the CTC-count during treatment were monitored with the E1-chip and the NZ1.2-chip ([Figure 5](#cells-09-00888-f005){ref-type="fig"}C). At most points of time, a higher number of CTCs were detected with the NZ1.2-chip.
The median CTC-count detected with the NZ1.2-chip was 3 for epithelioid subtype and 0 for biphasic or sarcomatoid subtype, and the CTC-count was significantly higher in epithelioid MPM patients than in non-epithelioid patients ([Figure 6](#cells-09-00888-f006){ref-type="fig"}). The CTC-count was not significantly different according to clinical stage ([Figure 7](#cells-09-00888-f007){ref-type="fig"}A), but the CTC-count trended higher in advanced stage (stage III and IV) among epithelioid patients (*p* = 0.051) ([Figure 7](#cells-09-00888-f007){ref-type="fig"}B).
4. Discussion {#sec4-cells-09-00888}
=============
In this study, we employed a novel antibody (NZ-1.2) with a higher affinity to podoplanin in capturing MPM cells using the CTC-chip. A number of pathological studies have demonstrated that podoplanin expression is positive in most cases (80--100%) of epithelioid subtype of MPM \[[@B31-cells-09-00888],[@B32-cells-09-00888]\]. In the current study, epithelioid-type MPM cell lines showed high podoplanin expression ([Figure 1](#cells-09-00888-f001){ref-type="fig"}), and were effectively captured on the CTC-chip coated with the NZ-1.2 antibody (cell-capture efficiency, 62.8% for ACC-MESO-1, 97.9% for ACC-MESO-4, and 97.6% for NCI-H226) ([Figure 3](#cells-09-00888-f003){ref-type="fig"}). In previous studies, the cell-capture efficiency achieved by the CTC-chip coated with a common anti-podoplanin antibody (E-1) was 84.1% for ACC-MESO-4 and 76.3% for NCI-H226 \[[@B16-cells-09-00888]\]. Whereas direct comparison of cell-capture efficiency may not be feasible, MPM cells were more effectively captured on the CTC-chip when coated with the novel anti-podoplanin antibody (NZ-1.2). Podoplanin may be also expressed on sarcomatoid subtype of MPM, but the positivity seems lower (30--75%) as compared with epithelioid MPM \[[@B31-cells-09-00888],[@B33-cells-09-00888],[@B34-cells-09-00888]\]. In fact, non-epithelioid MPM cell lines (NCI-H28, and MSTO-211H) showed no significant podoplanin, which were not effectively captured on the NZ1.2-chip ([Figure 1](#cells-09-00888-f001){ref-type="fig"}; [Figure 3](#cells-09-00888-f003){ref-type="fig"}).
Next, we showed that the NZ1.2-chip enabled sensitive detection of CTCs in the peripheral blood of MPM patients. As MPM cells may not express strong EpCAM expression, CTCs cannot be effectively captured using EpCAM-dependent methods. In fact, the CellSearch provided only a modest sensitivity in detection of CTCs (32.7% \[[@B11-cells-09-00888]\] and 44.45% \[[@B35-cells-09-00888]\]). As an EpCAM-independent detection method, Bobek and coworkers employed a size-based preparation method \[[@B36-cells-09-00888]\]. They reported a promising sensitivity (80%, 4/5) in detection of CTCs in MPM patients, but no further study has been reported. The sensitivity obtained with the NZ1.2-chip (68.2% for all MPM patients and 93.2% for epithelioid patients) in this study might be promising. In addition, the CTC-count detected with the NZ1.2-chip was significantly higher than that with the E1-chip, especially for epithelioid patients ([Figure 5](#cells-09-00888-f005){ref-type="fig"}A,B). In addition, dynamic changes in the CTC-count evaluated with the NZ1.2-chip during treatment were documented in some patients ([Figure 5](#cells-09-00888-f005){ref-type="fig"}C). These results may indicate that the NZ1.2-chip provides useful clinical information in the diagnosis and decision-making of treatment for patients with epithelioid sub-type of MPM.
There are several limitations in this study. First, the number of patients included in this retrospective study was only 22, which was too small to draw any definitive conclusion, and we are aware that promising results of the CTC-test in the current study are preliminary. We are now sampling the peripheral blood from newly-diagnosed MPM patients for the CTC-test, which will be presented in the future. In addition, the CTC-test was performed only once for a single blood sample in the current study. The reproducibility of the CTC-test should be investigated using multiple samples obtained from each patient in a future study. To validate the clinical significance of the CTC-test, a multi-institutional prospective study shall be conducted. Second, the clinical impact of the CTC-test should be examined after a longer follow-up time. To reveal the prognostic and predictive value of the CTC-count, we are now conducting retrospective and prospective studies of monitoring the CTC-count in correlation with patient characteristics and clinical course of MPM patients. Third, the NZ1.2-chip may enable a sensitive detection of CTCs in epithelioid MPM patients, but not in non-epithelioid MPM patients with the sensitivity of 33.3%. In this study, non-epithelioid MPM cells (H28 and 211H) without significant podoplanin expression were not effectively captured with the NZ1.2-chip. To overcome the limitation, we are now testing the CTC-chip coated with multiple antibodies such as anti-EGFR antibody in combination with an anti-podoplanin antibody, as EGFR is highly overexpressed on MPM including non-epithelioid subtypes \[[@B37-cells-09-00888],[@B38-cells-09-00888]\]. Finally, non-malignant cells such as reactive mesothelial cells may highly express podoplanin, and can be detected in the peripheral blood. In the current study, we did not validate whether cells captured on the NZ1.2-chip were true MPM cells. We have just developed immunostaining of cells captured on the CTC-chip, and will examine loss of nuclear BAP1 expression, which is a useful marker in discrimination between MPM cells and non-malignant mesothelial cells \[[@B39-cells-09-00888]\].
In conclusion, the NZ1.2-chip achieved a higher performance in capturing CTCs in MPM. Future studies may reveal clinical relevance of CTCs detected with the NZ1.2-chip.
We thank Eri Kawashima for her valuable technical assistance.
Conceptualization, K.Y. and F.T.; methodology, T.K.; software, F.T.; validation, K.Y., M.M. and M.K.; formal analysis, K.Y.; investigation, K.K.; resources, M.K.K. and Y.K.; data curation, K.K.; writing---original draft preparation, T.K.; writing---review and editing, K.Y. and Y.K.; visualization, K.Y.; supervision, F.T.; project administration, K.Y.; and funding acquisition, F.T. All authors have read and agreed to the published version of the manuscript.
This research was funded by Grants-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (16K10697 and 16H01747), the Promotion of Occupational Health for the Post Graduate Student of the University of Occupational and Environmental Health, Japan, the UOEH Research Grant for Promotion of Occupational Health, and AMED under Grant Numbers (JP19am0101078, JP19am0101078, and JP19ae0101028).
The authors declare no conflict of interest.
{#cells-09-00888-f001}
{#cells-09-00888-f002}
{#cells-09-00888-f003}
{#cells-09-00888-f004}
######
(**A**) The number of circulating tumor cells (CTC-count) detected with the CTC-chip in 1 mL of the peripheral blood sampled from 22 patients with malignant pleural mesothelioma (MPM). The CTC-chip was coated with an anti-podoplanin antibody, clone E-1 (E1-chip) or clone NZ-1.2 (NZ1.2-chip), for capturing tumor cells. A 1 mL of the peripheral blood taken from the same sample tube was applied to the E1-chip or the NZ1.2-chip. (**B**) The number of circulating tumor cells (CTC-count) detected with the CTC-chip in 1 mL of the peripheral blood sampled from 13 patients with epithelioid-type malignant pleural mesothelioma (MPM). (**C**) Changes in the number of circulating tumor cells (CTC-count) detected with the E1-chip (black lines and dots) or the NZ1.2-chip (red lines and dots) during treatment in some selected patients with malignant pleural mesothelioma (MPM).
{#cells-09-00888-f006}
{#cells-09-00888-f007}
cells-09-00888-t001_Table 1
######
Characteristics of patients and detection of CTCs with the CTC-chip.
Number of Patients (Percentage) Number of CTC-Positive (CTC-Count ≥ 1/mL) Patients (Percentage)
-------------------- ---------------- --------------------------------- ----------------------------------------------------------------- ------------
Age Median (range) 68.5 years (54--79)
Sex Male 21 (95.5%) 10 (47.6%) 14 (66.7%)
Female 1 (4.5%) 0 (0%) 1 (100%)
Histologic subtype Epithelioid 13 (59.1%) 6 (46.2%) 12 (92.3%)
Biphasic 4 (18.2%) 2 (50.0%) 1 (25.0%)
Sarcomatoid 5 (22.7%) 2 (40.0%) 2 (40.0%)
Clinical stage I 10 (45.5%) 3 (30.0%) 7 (70.0%)
II 4 (18.2%) 3 (75.0%) 2 (50.0%)
III 5 (22.7%) 3 (60.0%) 4 (80.0%)
IV 3 (13.6%) 1 (33.3%) 2 (66.7%)
Total of patients 22 (100.0%) 10 (45.5%) 15 (68.2%)
| null | minipile | NaturalLanguage | mit | null |
In a computer system, various buses are provided for interconnecting a host processor(s) and other devices and transferring data among them. As an example, PCIe has been developed for replacing the older Peripheral Component Interconnect (PCI) and PCI-X standards. PCIe is used in consumer, server, and industrial applications as a motherboard-level interconnect to link motherboard-mounted peripherals and as an expansion card interface for add-in boards.
A difference between PCIe and earlier PC1 or PCI-X buses is a topology based on point-to-point serial links, rather than a shared parallel bus architecture. PCIe can be thought of as a high-speed serial replacement of the older parallel PC1 and PCI-X bus. At the software-level, PCIe preserves compatibility with PC1 so that a PCIe device can be configured and used in legacy applications and operating systems which have no direct knowledge of the new features of PCIe.
In PCIe 1.0 or 1.1, each lane carries 250 MBIs. PCIe 2.0, released in late 2007, adds a second generation signaling mode, doubling the rate to 500 MBIs. PCIe 3.0, currently in development, will add a third generation signaling mode at 1 GBIs.
PCIe 2.0 and 3.0 also maintain compatibility with the earlier generation of PCIe (i.e., PCIe 1.x). Since PCIe 1.x compatible devices are still being used in the market, PCIe 2.0 or 3.0 compatible devices may need to be connected with PCIe 1.x compatible devices. Upon power up or in certain conditions, the devices at both ends of the link perform link training and initialization. Conventionally, for backward compatibility with PCIe 1.x, the PCIe 2.0 or PCIe 3.0 devices initially advertise themselves as PCIe 1.1 devices. Upon training the PCIe link, the software determines whether the device on the other end of the link supports the PCIe 2.0 or PCIe 3.0 specification. If so, part of the training sequences have to be repeated with the PCIe 2.0 or PCIe 3.0 settings that were initially advertised with PCIe 1.1 settings. This is not desirable because of the high software overhead required to support the compatibility with the PCIe 1.x compatible devices. | null | minipile | NaturalLanguage | mit | null |
Donald Adam
Donald Adam is a former New Zealand rower.
At the 1950 British Empire Games he won the silver medal as part of the men's eight alongside crew members Kerry Ashby, Murray Ashby, Bruce Culpan, Thomas Engel, Grahame Jarratt, Don Rowlands, Edwin Smith and Bill Tinnock.
External links
Category:20th-century births
Category:Year of death missing
Category:New Zealand male rowers
Category:Rowers at the 1950 British Empire Games
Category:Commonwealth Games silver medallists for New Zealand
Category:20th-century New Zealand people
Category:Commonwealth Games medallists in rowing | null | minipile | NaturalLanguage | mit | null |
About Me
Thursday, October 20, 2011
Although we all make decisions, we don’t know what the final and complete outcome will be in the end. We tend to make most decisions based on the Right Now. It was my decision to walk away.
It’s Not Jealousy, its Anger… After all of the pain, the arguing, the late night returns, the not coming home, the cheating, the lying, the games, the not working, the divorce, I decided to walk away. I wanted more for you but couldn't get it out of you.
It’s Not Jealousy, its hurt… After all the years, the history, the children, the marriage, the good times, the holidays, the rekindling, now you decide to try and become a productive member to society. But it won’t be me to see this advancement.
It’s Not Jealousy, its common sense… After taking the weight and putting it on my shoulders for so long, you should want to help assist with maintaining the dwelling of where your seeds are. It shouldn’t take an outsider to say, you should do this or that. You should be willing or wanting to help on your own.
It’s Not Jealousy, it’s God’s Master Plan… I may have been angry… I may have been hurt… But maybe God needed me to walk away because He knew you could be a better Man. Maybe, I hindered you from being the better man because of the strong woman I am. Maybe I helped prepare you for the woman you are supposed to be better for.
It’s Not Jealousy, its confidence… You say you have moved on to better things… I would say you are right because your past was good and you have now found better but you’ve already had the Best (me)!... But I decided to walk away because Greatness is now before me!
Monday, February 7, 2011
Sometime we question ourselves or doubt our decisions. Sometime we have to stop and look at the signs that are in front of us, or the signs that are given to us. At times we may not want to see them, hear them, acknowledge them or even accept them. If you really want to know, take yourself out of the equation. Think as if the issue or signs were for another person. Would you tell that other person to make that decision? Sometimes it can be hard to take your own advice.
Instance one: A friend wanted to know if I thought the person she was dating, was really into her or if I thought he cared about her the same way she care about him. Now this can go for a man or a woman. That person will show you how much they are into you by a number of things. That person goes out more with their girls, or with their guys more then you get to see them... you all are probably just kickin' it.
You notice when you tell that other person how you feel and they don't reciprocate the feeling is mutual, that is a sign that this relationship isn't going much further. Prepare to only date or just see that person casually, because you will start to invest feelings that will not give you a return on your investment.
Instance two: A friend started seeing someone that was in the process of going through a separation. The stories all seemed so real and vivid. As the conversations grew, the build up to intimacy was sparked. Once the impact of intimacy happened, the conversations grew shorter and fewer. My friend wondered, if this happened because of the intimacy. I'm thinking, that separation has probably happened more then once and it will probably continue to happen. If there is no paper, without the judges seal on it, its a sign... don't do it.
Instance three: A friend of mine, runs into an old flame. They spark up conversation and reminisce. During the conversation, the mention of the past tryst they shared came up. Of coarse that topic was gently touched on as to possibly happen again, along with other things. Later in the conversation, the mention of being to busy to settle down came up also. I said, I hope you seen the sign in front of you! First, you know this will lead to one thing and one thing only... SEX. You might have a nice time and go out, but the main thing is, its gonna go down! The second thing is, all you will have is a good time and nothing more. In your first conversation, the mention of being to busy to be settled down with a person you can love or care about, is a hint.
If you see the signs up front and you are willing to play by that game, then its all good. As long as you pay attention to the signs. As adults, we have the choice to be busy, not want to settle down and have casual relationships. As long as you go in with your eyes wide open, then no one gets hurt. Don't sugar coat the signs, the signs are there to tell you something ( Stop, Winding road, Slippery When Wet, LOL), to help you make judgement calls. But if you ignore the signs, you might crash.
Wednesday, January 26, 2011
This is a late entry and I should be asleep but I was thinking of this. In every dark situation, there is always a little light. I am that little light that was in a dark place. No matter my circumstances, I was always determined to push through and go forward. Looking back now, I even realized that at an early age.Think back to being a child, like in Eighth grade. It could have been a fun time for many. For me, it was the best that I made it. Imagine not having name brand clothes or shoes. That was nothing to me, I was happy to just have any clothes or shoes. A parent with no car or even a job. Imaging having only one parent that had an illness that they preferred. Imagine getting ready for you Eighth grade graduation, with no parent there to help you. Not to comb your hair, not to pick out that special outfit, not to congratulate you or even knock the wrinkles out of your graduation gown. Not because your parent isn't alive but because their illness keeps them in places they prefer instead of where the should or need to be. Imagine that child being me. Imagine me, waking up that special morning, with the sun shining bright and being able to hear the birds chirping. Thinking, what a wonderful morning as I commence on a new and memorable journey in life. As I got out of bed to begin this important journey, I searched the house for my parent. My parent was no where in sight. Not because of death but because of an illness that destroys families. The outfit didn't matter to me, nor did the hair or the shoes. What did matter to me was the fact that my parent wasn't there to help me prepare to put on my graduation robe.I slowly grabbed my rode and began to lightly iron the robe, making sure I didn't apply to much heat to burn the material. I began to cry because I had to do it all by myself. No one to excite me, congratulate me or say how proud they were of me. After the last tear fell from my small face, I gathered my thoughts. I was the one that did the hard work to get here and I would be the one to make sure I got to where I needed to be. At that time in life, I thought the place I needed to be was the school building practicing on marching in the auditorium. I realized later in life that I would make sure I would get to any place that I am destined to be. I was determined, even as a child, to not let anything or anyone hold me back to completing success. You don't have to let your obstacles control you, but you get around and through those obstacles if you stay focus and determined. You must not give up.... ever! | null | minipile | NaturalLanguage | mit | null |
Q:
Rails 5 issue with doing a search
I've spent almost a day on this problem and cannot seem to figure it out. I have a form on my index.html.erb page that is a search for and looks something like this:
<%= form_with(url: "/search", method: "get") do |f| %>
<%= f.label :Start_date %>
<%= f.date_select :date_out %>
<%= f.label :End_Date %>
<%= f.date_select :endDate %>
<br>
<p>Enter Report Type:</p>
<%= select_tag :reportType,
options_for_select([['sale', 'sale'], ['received', 'received'], ['po', 'po'], ['invoice', 'invoice']]) %>
<br>
<%= submit_tag("Show Report") %>
<% end %>
In my controller I have a search action that looks like this:
class ItemInstancesController < ApplicationController
def search
# Converting the string params to a Date
startDate = Date.new(params["date_out(1i)"].to_i, params["date_out(2i)"].to_i, params["date_out(3i)"].to_i)
endDate = Date.new(params["endDate(1i)"].to_i, params["endDate(2i)"].to_i, params["endDate(3i)"].to_i)
# Getting the params from what the user submitted
reportType = params[:reportType]
if reportType == 'po'
# I have to do a search of the item_instances model to pull based on the date range of the date_out column
@item_instances = ItemInstance.search_for_records_by_date(startDate, endDate).order("po_number ASC")
format.html { render :search }
end
end
end
The problem is that I'm not going to the search page when I hit my form. I can see my params coming in just fine. This is what I see in the terminal when I hit the show report button:
Started GET "/search?utf8=%E2%9C%93&%5Bdate_out(1i)%5D=2020&%5Bdate_out(2i)%5D=8&%5Bdate_out(3i)%5D=11&%5BendDate(1i)%5D=2020&%5BendDate(2i)%5D=8&%5BendDate(3i)%5D=11&reportType=po&commit=Show%20Report" for 10.9.0.201 at 2020-08-11 15:40:00 -0400
Cannot render console from 10.9.0.201! Allowed networks: 127.0.0.1, ::1, 127.0.0.0/127.255.255.255
Processing by ItemInstancesController#search as JS
Parameters: {"utf8"=>"✓", "date_out(1i)"=>"2020", "date_out(2i)"=>"8", "date_out(3i)"=>"11", "endDate(1i)"=>"2020", "endDate(2i)"=>"8", "endDate(3i)"=>"11", "reportType"=>"po", "commit"=>"Show Report"}
2020-08-11
2020-08-11
po
ItemInstance Load (0.4ms) SELECT `item_instances`.* FROM `item_instances` WHERE `item_instances`.`date_out` BETWEEN '2020-08-11' AND '2020-08-11' ORDER BY po_number ASC
↳ app/controllers/item_instances_controller.rb:28
#<ItemInstance:0x00007f06bc1209e8>
#<ItemInstance:0x00007f06bc1208a8>
Completed 500 Internal Server Error in 3ms (ActiveRecord: 0.4ms)
ArgumentError (too few arguments):
app/controllers/item_instances_controller.rb:29:in `format'
app/controllers/item_instances_controller.rb:29:in `search'
I also do not know why my form is being processed as JS and not HTML. When I submit the form nothing happens on the web page - meaning it stays on the index.html.erb. Finally, my routes look like this:
Rails.application.routes.draw do
resources :item_instances
get '/search', to: 'item_instances#search'
resources :items
# Route to the home page
root 'home#index'
# For details on the DSL available within this file, see http://guides.rubyonrails.org/routing.html
end
And the model is this:
create_table "item_instances", options: "ENGINE=InnoDB DEFAULT CHARSET=latin1", force: :cascade do |t|
t.integer "inv_number"
t.string "serial"
t.integer "po_number"
t.date "po_date"
t.date "invoice"
t.date "date_out"
t.decimal "cost", precision: 8, scale: 2
t.string "acro"
t.datetime "created_at", null: false
t.datetime "updated_at", null: false
t.bigint "item_id"
t.index ["item_id"], name: "fk_rails_6ea33fd9d0"
end
Thank you for any help that may be provided.
Here is the index.html.erb file:
<p id="notice"><%= notice %></p>
<h1>Item Instances</h1>
<table>
<thead>
<tr>
<th>Inv number</th>
<th>Description</th>
<th>Serial</th>
<th>PO number</th>
<th>PO date</th>
<th>Invoice</th>
<th>Date Out</th>
<th>Cost</th>
<th>Acro</th>
<th colspan="3"></th>
</tr>
</thead>
<tbody>
<% @item_instances.each do |item_instance| %>
<tr>
<td><%= item_instance.inv_number %></td>
<td><%= link_to item_instance.item.description, edit_item_instance_path(item_instance)%></td>
<td><%= item_instance.serial %></td>
<td><%= item_instance.po_number %></td>
<td><%= item_instance.po_date %></td>
<td><%= item_instance.invoice %></td>
<td><%= item_instance.date_out %></td>
<td><%= item_instance.cost %></td>
<td><%= item_instance.acro %></td>
<td><%= link_to 'Show', item_instance %></td>
<td><%= link_to 'Edit', edit_item_instance_path(item_instance) %></td>
<td><%= link_to 'Destroy', item_instance, method: :delete, data: { confirm: 'Are you sure?' } %></td>
</tr>
<% end %>
</tbody>
</table>
<br>
<%= form_with(url: "/search", method: "get") do |f| %>
<%= f.label :Start_date %>
<%= f.date_select :date_out %>
<%= f.label :End_Date %>
<%= f.date_select :endDate %>
<br>
<p>Enter Report Type:</p>
<%= select_tag :reportType,
options_for_select([['sale', 'sale'], ['received', 'received'], ['po', 'po'], ['invoice', 'invoice']]) %>
<br>
<%= submit_tag("Show Report") %>
<% end %>
<%= link_to 'New Item Instance', new_item_instance_path %>
Here is the search.html.erb page: (I just want the page to display heading at this point)
<h1>Report Page</h1>
A:
The default for form_with is to send your form remotely. That is why you are seeing Processing by ItemInstancesController#search as JS. If you add local: true to your form, you should hit format.html in your controller. You can read more about form_with here.
| null | minipile | NaturalLanguage | mit | null |
We had a fantastic experience with Jacy and will not hesitate to use her again in the future. Jacy is a responsible, conscientious, and thoughtful sitter and we felt very comfortable leaving our furry children in her care.
Jacy M.
Jacy's Canine Clients
10%
of clients received photo updates
About Jacy
8
years of experience
Will love your dog as you would
I've grown up always having multiple pets at a time and have been pet/house sitting since I was 12. I've house/pet sat all different kinds of pets such as: Labs, English cockers, chihuahuas, guinea pigs, hamsters, fish, lizards, etc. I absolutely love animals (especially dogs) and enjoy playing with them. Most, if not all pets I've met, like me. I would definitely call myself an animal person and I will take great, loving ...
I've grown up always having multiple pets at a time and have been pet/house sitting since I was 12. I've house/pet sat all different kinds of pets such as: Labs, English cockers, chihuahuas, guinea pigs, hamsters, fish, lizards, etc. I absolutely love animals (especially dogs) and enjoy playing with them. Most, if not all pets I've met, like me. I would definitely call myself an animal person and I will take great, loving care of yours!
What Jacy would like to know about your dog
I would like to know if your dog is friendly with other dogs or not. I'd also like to know how much energy your dog usually has so, I know how much I should make sure to play with them to burn off that energy. I'd also like to know if you'd like me to feed your pet(s) and their potty schedule along with eating (I've had some dogs that need to go to the bathroom right after they eat and others that need to go about a half hour-hour after eating). Also if your dog is allowed to have treats and any other specific information you think I should know about your pet(s).
Additional Skills
Oral Medication Administration
Can provide daily exercise
Senior Dog Experience
When Jacy watches your dog
I am very flexible with what accommodations you expect. I can simply let your dog outside to use the bathroom and play, and I can also take your dog for a walk around the neighborhood. I'm more than happy to take your dog to a dog park or to a park nearby to walk and play. I'm available part-time or full-time. I really enjoy playing and interacting with dogs (and other pets). You an be ensured I will give your pets lots of attention, love, and play time!
In Your Home
Potty Breaks Every 2-4 Hours
Jacy's
Service Area
At Rover, we're dedicated to giving your pet the best possible care. To help keep your pet happy and healthy, all stays and services booked on Rover receive premium insurance. You can enjoy peace of mind knowing that if your dog becomes ill and needs to see a veterinarian, that care will be covered.
24/7 Customer Support
You can travel worry-free knowing that in the event of an emergency, Rover's customer support team will be available to assist you and your sitter, 24 hours a day, 7 days a week.
Reservation Guarantee
In the unlikely event your sitter can't care for your pet, Rover will make it right. We'll do everything we can to find a replacement, so you can focus on your trip! | null | minipile | NaturalLanguage | mit | null |
Heading into the offseason, the Oakland Raiders needed to add some more depth at cornerback. Gareon Conley was the only “proven” cornerback on the roster, and he has started just 14 career games in the NFL. To help with that need, the team signed defensive back Lamarcus Joyner, who will likely be the team’s nickel cornerback on passing downs and will be their starting free safety.
In the second round of the 2019 NFL draft, Oakland selected Clemson cornerback Trayvon Mullen, and he projects to be the team’s No. 2 corner soon, rather than later. However, in the fourth round, the Raiders took another defensive back who has the upside to be one of the best cornerbacks in the league in Isaiah Johnson.
Johnson was a combine superstar, testing in the 95th percentile for athleticism, according to 3sigmaathlete.com. Johnson has elite size, speed, and agility, making him the ideal selection in the fourth round.
According to Pro Football Focus, Johnson could prove to be one of the biggest draft steals of the year. Take a look at their thoughts on the former Houston wide receiver-turned-cornerback:
Johnson was seen as one of the draft’s biggest boom-or-bust prospects, though securing him in the fourth-round eliminates much of the bust risk. That low investment could pay big dividends with Johnson’s traits. At 6-foot-2, 208 pounds with 33” arms, a 4.40-second 40-yard dash, 11′-1″ broad jump, 6.81 three-cone and 4.06 short shuttle, Johnson is how you’d build an ideal cornerback. He simply needs some seasoning after moving to corner from receiver only two years ago.
One of the best things Oakland did this offseason was that they rebuilt their cornerback depth chart. Now, they can “stash” a player like Johnson on the bottom of the roster, and he won’t have to play much, if at all as a rookie.
If Johnson can continue to improve his technique and become a better/stronger tackler over the next few seasons, there is no reason he can’t develop into a starting-caliber cornerback in the NFL. And with that athletic profile, don’t be shocked if he develops into much, much more. | null | minipile | NaturalLanguage | mit | null |
By Do-Hyoung Park on September 21, 2015
After two consecutive tightly contested overtime victories against unranked opponents, No. 6 Stanford women’s soccer (6-2) finally gave way to Santa Clara (6-3) in a 1-0 road loss Sunday night.
The result marked Stanford’s first loss to an unranked team since 2013 and the first loss to Santa Clara since 2006.
Although Stanford consistently kept pressure in Santa Clara’s half of the pitch, pressuring the Broncos with 9 corners to Santa Clara’s 3, the Cardinal couldn’t finish despite their numerous opportunities, which has been a concerning development through the first half of the team’s season.
After a 0-0 deadlock throughout most of the match, Santa Clara finally broke through in the 85th minute on a goal from Megan Crosson off of one of the Broncos’ three corner kicks of the evening. This gave the Broncos a late lead that stood for the rest of the match despite Stanford’s desperate attempts towards the end of the game.
The Cardinal had an opportunity to score the go-ahead goal with a penalty kick in the 78th minute. Fifth-year senior Haley Rosen lined up to take the shot, but Santa Clara goalie Andi Tostanoski saved it to keep the game tied at zero for the Broncos.
Freshman Michelle Xiao and sophomore Andi Sullivan, the Cardinal’s two leading scorers, were limited to three combined shots by a stout Santa Clara defense. Santa Clara outshot Stanford 13-11 in the match.
Junior goalkeeper Jane Campbell notched 5 saves but took a tough-luck loss without much help from Stanford’s offense, which only notched 1 shot on goal all game, in the second half.
Stanford next takes to the road for a stretch of three consecutive games at Utah, Arizona State and Arizona to kick off Pac-12 play.
Contact Do-Hyoung Park at dhpark ‘at’ stanford.edu. | null | minipile | NaturalLanguage | mit | null |
With the NFL Combine just around the corner, here is an early look at my top 50 prospects in this year’s NFL Draft.
1. Myles Garrett, EDGE, Texas A&M
Garrett is solidified as the No. 1 overall prospect on virtually every big board you come across, reason being that he is a freak athlete with prototypical size and strength for a weakside 4-3 defensive end.
2. Reuben Foster, LB, Alabama
Medicals are going to be important for him, as he’s had to deal with multiple stingers and a shoulder injury. If he checks out, Foster is an immediate upgrade for any team looking for a WILL/MIKE linebacker.
3. Marshon Lattimore, CB, Ohio State
Maybe the most pro-ready, complete player in the draft is Marshon Lattimore. His footwork and ability to mirror receiver’s movements are unmatched by anyone in this year’s class.
4. Jonathan Allen, DL/EDGE, Alabama
Allen is built like a defensive tackle (6-foot-3, 291 pounds), but has the pliability of an edge rusher and can truly play anywhere along the defensive line. Just tell him to rush the passer, period, and he’ll go to work.
5. Solomon Thomas, EDGE, Stanford
Detroit Lions fans should be salivating at the idea of Solomon Thomas falling to their No. 21 overall pick, because he is a perfect fit as a closed end that can move inside. He’s a physical specimen that will test well at the combine.
6. Malik Hooker, S, Ohio State
There is no better center fielder in this year’s draft or the upcoming MLB draft than Malik Hooker. He can cover a ton of ground and make plays that very few can make in coverage. I love his speed and instincts, but he’ll have to get better versus the run.
7. Corey Davis, WR, Western Michigan
Lacking elite top end speed? Doesn’t matter. Corey Davis runs some of the crispiest routes you’ll see and exposes greedy cornerbacks with a nasty double move. Creating separation comes natural to him.
8. Takkarist McKinley, EDGE, UCLA
The combine is going to be ultra important for McKinley, who is reportedly set to undergo shoulder shoulder surgery following his workout. He is a phenomenal athlete that should turn some heads.
9. Dalvin Cook, RB, Florida State
There is no question whether Cook is a top prospect, he’s an absolute stud. The question is going to be Cook’s off-the-field concerns, as well as his injury history. We’ll have a better idea after the combine.
10. Jamal Adams, S, LSU
Adams isn’t quite the athlete that Hooker is, but his versatility (ability to play free, box or nickel safety), leadership and downhill aggression makes it difficult to keep him out of the top 10.
11. Leonard Fournette, RB, LSU
Don’t give me that, “he’s not going to fit in every running scheme” bullcrap. Fournette will get picked up by a team that heavily runs a power/gap scheme and he’s going to punish people. That’s all there is to it. I think he can play on all three downs, too.
12. O.J. Howard, TE, Alabama
Howard is arguably the best and most complete tight end prospect I’ve ever scouted. I thought he made a mistake by staying in college for an extra year, but I was wrong. He’s improved a ton and can punish defenses up the seam, as well as provide efficiency as a blocker. There isn’t much that he can’t do.
13. Malik McDowell, DL, Michigan State
Some will debate whether Malik is better suited as a defensive end or tackle. I say, why not both? Have him play DE on early downs and make him rush the passer as a 3-tech on passing downs. He’s raw, but there is so much potential there. He’d be a perfect fit for the Lions as a strongside DE too, if he miraculously fell to their first-round pick.
14. Sidney Jones, CB, Washington
NFL.com has Jones at a listed 170 pounds, while CBS has him at 181 pounds. Both numbers are rail thin for a 6-foot-1 corner, so combine weigh-ins will be huge for him if he’s able to add extra weight, because he looks like a clear first rounder on tape.
15. Taco Charlton, EDGE, Michigan
Taco had a slow start to the 2016 season, but absolutely dominated during big games against Ohio State and in their bowl game versus Florida State. He’s a solid run defender with a knack for turning the corner and pressuring the QB. He’s only going to get better with time.
16. Quincy Wilson, CB, Florida
For such a large man (6-foot-1, 213 pounds), I was alarmed by how timid Wilson was in the run game, but there may not be a more physical corner in press-man coverage. Wilson has the potential to be a shutdown CB1 at the next level.
17. Tim Williams, EDGE, Alabama
Williams is going to have one purpose in the NFL, and that’s rushing the passer. He wasn’t used much other than on obvious passing downs, but still adds a ton of value to any team that needs a pure pass rusher and should eventually give someone 10+ sacks a year.
18. Gareon Conley, CB, Ohio State
Conley’s footwork is only trumped by his teammate, Marshon Lattimore. He’s constantly staying in his receiver’s hip pocket, and if he can learn how to use his hands instead of just relying on his feet, he can turn into an All-Pro corner.
19. Teez Tabor, CB, Florida
If you’re looking for someone who can create a big play and turn the tables in your favor on a moment’s notice, Tabor is the CB for you. Teez can get caught looking in the backfield on occasion, but his playmaking ability more than makes up for it.
20. Forrest Lamp, OG, Western Kentucky
As a former left tackle, Lamp is a tremendous athlete who will likely make the transition to guard due to his lack of height and length. He was able to hold his own against a strong Alabama defensive front.
21. Deshaun Watson, QB, Clemson
I definitely wasn’t expecting Watson to be my QB1 at this point, but here we are. Watson isn’t perfect, but sometimes you just want a leader that shows up at the biggest of moments. He’s an elusive QB that can also put touch on his throws and connect on the deep ball. I think he has plenty of potential.
22. Caleb Brantley, DL, Florida
There may not be a more explosive 3-tech DT than Caleb Brantley. If his pad level wasn’t so inconsistent and if he didn’t appear to take some plays off last year, he’d be a top-10 talent to me.
23. DeShone Kizer, QB, Notre Dame
Kizer is an interesting case. He looked like a shoo-in top-2 pick through the first couple games of the season and then went on an awful stretch with nine touchdowns and seven interceptions through six games. He has a ton of talent, but I worry about his decision making.
24. Ryan Ramczyk, OT, Wisconsin
This year’s OT class is the weakest I’ve seen in recent memory, but Ryan Ramczyk is clearly at the top of the board at the moment. I love his technique and lateral agility.
25. Haason Reddick, LB, Temple
Earlier in February, I wrote about why Reddick is a real option for the Detroit Lions at No. 21 overall. I still maintain that thought and believe Reddick is the No. 2 linebacker in this class behind Foster.
26. Derek Barnett, EDGE, Tennessee
Barnett may not blow up the combine, but he is explosive enough with tremendous bend around the corner to make him one of the top pure pass rushers in the country.
27. Mike Williams, WR, Clemson
Williams reminds me of a poor man’s Devante Parker. He wins mostly with the ball already in the air by adjusting his body to the ball and tracking it at its highest point. He’ll need to add emphasis on selling his routes, along with showing more urgency in the run game.
28. Dorian Johnson, OG, Pittsburgh
Don’t make the same mistake you made with T.J. Clemmings, Alex. Don’t make that mistake again. Aw hell, I really like this Pitt lineman a lot. A former five-star recruit, Dorian Johnson is a remarkable athlete with plus-strength and can pull and make plays in space with the best of them.
29. Marlon Humphrey, CB, Alabama
If you’re looking for a pure press-corner, Humphrey might be your guy. He played a majority of his snaps in press coverage and may be the most physical corner in this draft. However, I worry whether he can turn his hips and keep up with faster receivers.
30. Adoree Jackson, CB, USC
This may be a bit high for most draft analysts, but Adoree is a complete game changer and that’s something you don’t find very often at CB. He can add value on all three phases of the game, and if he can correct his issues at CB, his potential is through the roof.
31. Derek Rivers, EDGE, Youngstown State
I talked a little about why I believe most draft outlets are underrating Rivers and believe he is a borderline first round talent. His flexibility and hand usage alone makes him a terror off the edge.
32. Jarrad Davis, LB, Florida
Davis is yet another top linebacker prospect that offers speed, cover ability and a great mentality in run support. He will need to clean up his inconsistencies and recklessness in the run game, however.
33. Obi Melifonwu, S, Connecticut
I’m a big fan of Melifonwu, but there is no doubt that he is a project at this stage of his career. His size and athleticism is otherworldly, but the amount of time it takes for him to diagnose plays at times is worrisome.
34. Cam Robinson, OT, Alabama
A 6-foot-6, 326-pound offensive tackle should not be allowed to move around the way that Cam Robinson does. With that, comes a raw prospect with technique and balance issues. He’ll have more than his fair share of struggles if given playing time right away, but give him some time and he can develop into a stud lineman.
35. Jabrill Peppers, S, Michigan
I’m not worried about the lack of turnovers created. Big plays can be made other ways, and there may not be a prospect that loves to hit more than Peppers. I like him a lot more as a box safety than linebacker, and he’s easily the best return specialist to enter the draft this year (sorry Adoree).
36. Kareem Hunt, RB, Toledo
Oh boy, where to start? I’m a huge Kareem Hunt fan. For an undersized back (5-foot-11, 208), I was extremely impressed by his north/south attitude, along with his balance and power. He’s also very reliable with the best fumble rate in the country.
37. JuJu Smith-Schuster, WR, USC
JuJu is a big, physical receiver that was able to bully CBs and make contested catches. He had an especially dominant game against Washington’s Sidney Jones. He can be inconsistent and his hands are average, but he remains a solid early-Day 2 WR option.
38. Charles Harris, EDGE, Missouri
Harris is one of the more explosive edge rushers and displays a nasty spin move with active hands. His stiff hips and lack of strength at the point of attack may limit his production at the next level.
39. John Ross, WR, Washington
Ross is likely to run a sub 4.35 40-yard dash and is easily the best deep threat in this year’s class. He reminds me of a DeSean Jackson in his prime with quicker feet.
40. Howard Wilson, CB, Houston
Earlier this month, I named Wilson as another prospect that I believe is being severely underrated, but that’s because many are still getting around to studying certain players. Wilson is a stud athlete with great feet and can change directions on a dime. He can fit in any scheme, but will have to prove he is healthy and add some muscle to his frame.
41. David Njoku, TE, Miami (FL)
Njoku is a great athlete and basically a poor man’s Eric Ebron if you ask me. The strengths and weaknesses are eerily similar, including the drop issues.
42. Carl Lawson, EDGE, Auburn
Lawson doesn’t have the pliability you look for in an edge rusher, but his strength, violent hands and wide variety of pass rushing moves cannot be overlooked.
43. Isaiah Ford, WR, Virginia Tech
The 6-foot-2, 190 pound receiver out of Virginia Tech has some of the quickest feet in the draft, which sometimes makes up for his thin frame in press. Ford is lethal across the middle and can take the top of of a defense with his speed and ability to haul in contested throws.
44. Joe Mixon, RB, Oklahoma
Teams will figure out whether they want Mixon and his character issues, but as a pure football talent, Mixon sports a huge frame and is one of the better catchers out of the backfield in his class.
45. Rasul Douglas, CB, West Virginia
Douglas is very tall (6-foot-2, 204 pounds) and is sometimes clunky with his movements, but he proved he has some of the best ball skills out there after tallying eight interceptions last year.
46. Dalvin Tomlinson, DL, Alabama
Top-tier defensive linemen prospects really do grow on trees in Alabama. Tomlinson is yet another big-bodied defensive lineman to leave the Crimson Tide after limited experience, but his strong punch and long arms will make him a highly coveted prospect.
47. Dede Westbrook, WR, Oklahoma
Speed for days. Westbrook is a blur on the football field and is also known to turn a small gain into a huge one. Teams will need to get him open in space as he may have trouble when put on the LOS at a measly listed 176 pounds.
48. Tre’Davious White, CB, LSU
There may not be a more improved prospect than Tre White. He made a great decision to stay in school and it paid off big time. I love his athleticism and upside, but he’ll need to improve on his hand placement in press coverage.
49. Zach Cunningham, LB, Vanderbilt
Cunningham is a tough watch on tape, as he may have missed more tackles than anyone in college football last year, but a lot of those missed tackles resulted after putting himself in a position to make a play that not many linebackers could have made. That’s because Cunningham is a freak athlete with quintessential size for his position.
50. Carlos Henderson, WR, Louisiana Tech
I still need to see more of Henderson, but from the limited tape out there, there is a lot to like. He can return kicks (averaged north of 30 yards per return), pluck the ball out of the air at its highest point and turn a short pass into a large gain with impressive elusiveness in the open field. | null | minipile | NaturalLanguage | mit | null |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.