Datasets:

---

jxm

/

nomic_embed_supervised

like 2

[ "How to peel hard boiled eggs easily? This is one of the most annoying duties in the kitchen, for me. What are yours tips and tricks to peel hard boiled eggs easily?", "How do I force TeX to completely use the 1st column before writing to the second column? Right now I dont have enough content to fill one whole page. So the left and right columns are equally filled, leaving 25% symmetrical empty page at bottom. How do I fill the left column first, and then the right? \\documentclass{article} \\usepackage{multicol} \\usepackage[scale=0.9]{geometry} \\usepackage{amssymb} \\renewcommand{\\labelitemi}{\\tiny$\\blacksquare$} \\begin{document} \\begin{multicols}{2} %lots of text goes here \\end{multicols} \\end{document}", "NSWindow Mac App Store like Title Bar", "Given two coprime integers, find multiples of them that differ by 1 I'll describe the problem with an example. Find integers $n$ and $m$ such that $n\\cdot13 + m\\cdot101 = 1$. This is the same as solving the equation $n\\cdot13 \\equiv 1 \\pmod {101}$ I'm revising for a maths exam in a few days and it seems like a lot of the questions and examples rely on an ability to solve this type of problem. I can't seem to find a method in my notes, the solutions just get plucked out of thin air! What is a neat way of doing it on pen and paper with a calculator?", "Do professors care about their rating on websites such as RateMyProfessor or Koofers? I am wondering if a professor is already an Associate Professor, do they still care about their reputation in the eyes of the department considering tenureship is already granted?", "How to make pipes work with Runtime.exec()?", "Which external Javascript libraries work with Lightning Locker Service? Components often seem to work with external libraries until the Locker Service is enabled. What libraries work with locker service enabled and where can I go to find out?", "Reserved words as names or identifiers Is there any tricky way to use Java reserved words as variable, method, class, interface, package, or enum constant names?", "I am developing a set of scripts, which I want to be present for all users, when I set up a server. But I don't want them in the standard locations like /usr[/local]/[bin],[sbin] etc. Is there some existing convention for where such scripts should be placed?", "How can I view the camera through an object as a material in Cycles?", "I have a small question regarding using sudo with output redirect >. To enable IP forwrding, someone can use the command: echo 1 > /proc/sys/net/ipv4/ip_forward Executing this command will give permission denied as it requires root privileges. However, executing the same command with sudo gives also permission denied error! It seems that output redirect > does not inherit the permissions of the preceding command echo. Is this right? As a workaround I do: echo 1 | sudo tee /proc/sys/net/ipv4/ip_forward Is this the best way to do it? Am I missing something? Please, note that this is an example and it applies to all commands that use output redirect.", "Let $A$ be a commutative ring and $S$ a multiplicative closed subset of $A$. If $A$ is a PID, show that $S^{-1}A$ is a PID. I've taken an ideal $I$ of $S^{-1}A$ and I've tried to see that is generated by one element; the ideal $I$ has the form $S^{-1}J$ with $J$ an ideal of $A$. $J$ is generated by one element but I can't see why $I$ has to be generated by one element, maybe I'm wrong.", "I would like to align the view straight on to a face, perpendicular to the normal. How do I align the 3D viewport to the face of a mesh?", "Guaranteed lifetime of temporary in C++? Does C++ provide a guarantee for the lifetime of a temporary variable that is created within a function call but not used as a parameter? Here's an example class: class StringBuffer { public: StringBuffer(std::string & str) : m_str(str) { m_buffer.push_back(0); } ~StringBuffer() { m_str = &m_buffer[0]; } char * Size(int maxlength) { m_buffer.resize(maxlength + 1, 0); return &m_buffer[0]; } private: std::string & m_str; std::vector<char> m_buffer; }; And here's how you would use it: // this is from a crusty old API that can't be changed void GetString(char * str, int maxlength); std::string mystring; GetString(StringBuffer(mystring).Size(MAXLEN), MAXLEN); When will the destructor for the temporary StringBuffer object get called? Is it: Before the call to GetString? After GetString returns? Compiler dependent? I know that C++ guarantees that a local temporary variable will be valid as long as there's a reference to it - does this apply to parent objects when there's a reference to a member variable? Thanks.", "Proof of $\\int_{[0,\\infty)}pt^{p-1}\\mu(\\{x:|f(x)|\\geq t\\})d\\mu(t)=\\int_{[0,\\infty)}\\mu(\\{x:|f(x)|^p\\geq s\\})d\\mu(s)$ Let $({\\Bbb R},{\\mathcal A},\\mu)$ be the measure space where ${\\mu}$ is the Lebesgue measure. Assume that $\\int_{\\Bbb R}|f|^pd\\mu<\\infty$ ($p\\geq1$). There is an exercise for proving that $$\\int_{[0,\\infty)}pt^{p-1}\\mu(\\{x:|f(x)|\\geq t\\})d\\mu(t)=\\int_{[0,\\infty)}\\mu(\\{x:|f(x)|^p\\geq s\\})d\\mu(s).$$ If one formally let $s=t^p$, then $ds=pt^{p-1}dt$ and one would immediately get the equality above. However, how can I justify it rigorously in the sense of Lebesgue integration? [Edited] What puzzles me is that I have the \"change of variable\" theorem for Riemann integration, but all the integrations here are in the Lebesgue sense. Unless one has shown that the integrands are also Riemann integrable, how can I directly use \"change of variable\"?", "How much should a \"button of Cure Light Wounds\" cost (should it be available at all?)", "I couldn't find anything about Ubuntu acting as a receiver or sender. Can it work at all? Are there hardware prerequisites? Is WiFi a requirement or can it work over LAN or another kind of network connection? WiFi direct seems to be a necessary requirement, is it a sufficient one? (i.e. if a system supports WiFi direct does that mean it supports Miracast?) Are there differences in support between receiving/sending? How is the latency? (compared to the competition, i.e. VNC, commercial Miracast devices, etc.) How do I actually use it, if it's difficult? Specifically, I plan to use it together with an Android phone (4.x Jelly Bean).", "Is there a program to mount all of my drives automatically?", "Is the ideal $(2,X+1)\\subset\\Bbb{Z}[X]$ prime, maximal or neither? I'm currently considering the ideal $(2,X+1)\\subset\\Bbb{Z}[X]$. I'm trying to figure out if this is a prime ideal, a maximal ideal, or neither. So far I have attempted to look at the quotient ring $\\Bbb{Z}[X]/(2,X+1)$. I know that if this quotient ring is a field, then our ideal is maximal, since $\\Bbb{Z}[X]$ is commutative. However I'm stuck on how I should be viewing this quotient ring.", "I've seen examples like this: public class MaxSeconds { public static final int MAX_SECONDS = 25; } and supposed that I could have a Constants class to wrap constants in, declaring them static final. I know practically no Java at all and am wondering if this is the best way to create constants." ]

[ "Why can you see virtual images?", "What is the right way to apply an image texture over a glass or plastic material? I am trying to put a label over the transparent plastic bottle, but i was unable to do so, because when i build the bottle material(plastic) and mix it with the diffuse shader(using the label texture), the label gets faded. So the solution i found was to duplicate the bottle and scale a little bit and apply the label material on it. So it looks its the same material, but in reality its one material over the other. How can I make my plastic material be under my label material(image)? Here's how it looks: Here's my material setting for the plastic bottle: Thanks in advance.", "Is a contradiction enough to prove a set equality to $\\varnothing$?", "I am trying to use mathematical induction to prove $$(2n)!\\ge2^n(n!)^2\\quad\\text{for }n\\in\\mathbb{N}$$ I am stuck at the $n=k+1$ point.", "The 3 different equals", "In Captain America: Civil War, T'Challa takes the mantle of the Black Panther after his father is killed. As the Black Panther, he appears to have enhanced abilities. In , the Russos talk about T'Challa having superpowers and being enhanced during Civil War JOE: It can absorb the energy, so it’s much harder to damage him as a character, and you can see that in the movie he can take a lot of punishment including bullets to the face. He is very well trained. He’s from one of the wealthiest countries on the planet, so there’s great infrastructure there; very technologically advanced country. So he’s been trained at the highest levels to fight, but he also has his own superpowers, which derive from the mythology of his nation. Those will be explored more in Black Panther, it’s clearly evident when he’s able to fight the Winter Soldier out of costume, and go toe-to-toe with him, that he is an enhanced individual. In Black Panther, we see that in order to become the Black Panther, one must imbibe juice from the heart-shaped flower and visit the spirit plane after being buried. But before this, T'Challa must have his Black Panther powers removed prior to the ritual combat challenge, which he does twice in the film. This raises the question of how T'Challa could have possibly become the Black Panther abroad - or if he even really had. How did Black Panther have his powers during Civil War?", "Mean Value Theorem: $\\frac{2}{\\pi}<\\frac{\\sin x}{x}<1$", "My question is how I can intergrate Salesforce with different FTP servers in real time. I have read some articles about it, but to be absolutely sure I thought it would be a good idea to post a question here. I want to be able to send and receive data from Salesforce as a csv file to a ftp server. How I'm thinking about doing this is listed below. Send the data: Create a apex class which query the necessary data in Salesforce and create a csv file. I guess this is trivial? Then send the file to a web service created in Salesforce, just by calling it in the apex code. Create a web service in Salesforce which receives the data from the apex code. This web service should in some way send the data to the appropriate ftp server. I guess I can simply modify some of the code provided by Salesforce to make this work? The file is sent. Receive the data This one is a bit trickier. I guess I have to pull the data from the FTP server by using my web service, which then send the file collected to the appropriate apex class. Or, the FTP server could send the data to the SFDC web service, I don't know if this is possible? The web services on the other side that sends the data to the ftp server, could send it directly to the SFDC web service, which then again forward it to the apex class. I guess the web service will use the remote site url to connect to the SFDC web service?", "Combination with repetitions. The formula for computing a k-combination with repetitions from n elements is: $$\\binom{n + k - 1}{k} = \\binom{n + k - 1}{n - 1}$$ I would like if someone can give me a simple basic proof that a beginner can understand easily.", "How to find historical stock price for a de-listed or defunct company?", "Moyal Product in Non Commutative Quantum Mechanics Can someone please explain me what is a ? Also, how does putting $$X_a(\\psi) ~=~ x_a\\star\\psi$$ realise $$[X_a,X_b]=i\\theta_{ab}{\\bf 1}?$$ Ref:", "I installed a nightly or unstable build of a custom ROM and now my phone doesn't work", "Is it possible to redirect a command's output to cd? For example, I searched for a directory using locate and got the path to it. Now, instead of writing a cd path, can I redirect the locate output to cd? I tried this: $ locate Descargas | grep Descargas$ /home/oliver/Descargas $ locate Descargas | grep Descargas$ | cd $ locate Descargas | grep Descargas$ &gt; cd $ locate Descargas | grep Descargas$ &lt; cd /home/oliver/Descargas $ No luck. This probably isn't particularly useful, but I'm curious.", "In Visual Studio, we've all had \"baadf00d\", have seen seen \"CC\" and \"CD\" when inspecting variables in the debugger in C++ during run-time. From what I understand, \"CC\" is in DEBUG mode only to indicate when a memory has been new() or alloc() and unitilialized. While \"CD\" represents delete'd or free'd memory. I've only seen \"baadf00d\" in RELEASE build (but I may be wrong). Once in a while, we get into a situation of tacking memory leaks, buffer overflows, etc and these kind of information comes in handy. Would somebody be kind enough to point out when and in what modes the memory are set to recognizable byte patterns for debugging purpose?", "What is an LUT in FPGA? I have gone through various sources... But I am not quite sure what it is.I want an and gate and the logical equivalent is two inputs feeding to one gate and for Y=AB' the logical equivalent is feeding to one not gate and one and gate. But it is the same LUT for both AND and Y=AB'. I think we store the values as desired in the LUT. Someone elaborate on this", "New installation – TeX editor says: \"Error: Could not start the command\" I just downloaded and installed Texmaker. I've never used any (La)TeX before. When I click the Run button with an arrow next to \"Quick build\" I get an error saying \"Could not start the command\". Why? What do I need to do?", "reveals x2 code snippets. The first result is to which has a lot of documentation and explanation, along with some useful discussion underneath. However, , whilst not containing so much documentation, includes sample code for passing commands such as start, stop and restart. It also creates a PID file which can be handy for checking if the daemon is already running etc. These samples both explain how to create the daemon. Are there any additional things that need to be considered? Is one sample better than the other, and why?", "I have an array of Foo objects. How do I remove the second element of the array? I need something similar to RemoveAt() but for a regular array.", "We all know how to blow up the first Death Star: Fire a couple of proton torpedoes into the thermal exhaust port. It's ray shielded, so only torpedoes will do. To do this, the Rebel pilots had to fly down a very long trench, where they were vulnerable to fire from any TIE fighters to the rear. In fact they were so vulnerable that most of the pilots on this run were blown up once the Imperial forces started responding to the attack. This battle is in space, so the fighters can, if necessary, come to a dead stop and hold their position while firing. Also, when Luke fired his torpedoes, they took a 90 degree turn and went straight into the port. So the torpedoes didn't have to be fired from in the trench. We also didn't see any gun emplacements firing at the fighters from near the exhaust port, but if there were, the Rebels could have targeted them and taken them out or run interference to make it hard for the towers to fire at a fighter targeting the exhaust port. (They were already dodging fire in the trench as well.) A fighter could have easily flown directly at the exhaust port, firing torpedoes multiple times on approach and, if not under fire (or if protected by other fighters), could have actually stopped and taken time to target the exhaust port before firing. Is there any valid in-universe reason that the pilots had to fly down the trench before firing on the port? And if there is, is there any reason they had to enter the trench so early? Just for reference, here is the on YouTube. There's no explanation given for having to fly in the trench.", "Why doesn't connecting a positive terminal of a battery to ground cause current?" ]

[ "Why would my TV image turn black when electrical appliances turn on?", "To show that $\\sum a_nb_n$ is absolutely convergent Assume that $\\sum a_n$ is convergent and $\\sum b_n$ is absolutely convergent.To show that $\\sum a_nb_n$ is absolutely convergent My try::Consider the sequence of partial sums of $\\sum |a_nb_n|$ $S_n=|a_1b_1|+|a_2b_2|+......+|a_nb_n|$ Now $(a_1b_1+a_2b_2+......+a_nb_n)\\leq ( (a_1^2+a_2^2+..+a_n^2))^\\frac{1}{2}((b_1^2+b_2^2+..+b_n^2)^\\frac{1}{2})$ How to proceed from here?", "Get the cartesian product of a series of lists? How can I get the Cartesian product (every possible combination of values) from a group of lists? Input: somelists = [ [1, 2, 3], ['a', 'b'], [4, 5] ] Desired output: [(1, 'a', 4), (1, 'a', 5), (1, 'b', 4), (1, 'b', 5), (2, 'a', 4), (2, 'a', 5) ...]", "Integral representation of Euler's constant Prove that : $$ \\gamma=-\\int_0^{1}\\ln \\ln \\left ( \\frac{1}{x} \\right) \\ \\mathrm{d}x.$$ where $\\gamma$ is Euler's constant ($\\gamma \\approx 0.57721$). This integral was mentioned in as in , but the solutions I've got uses corollaries from . Can you give me a simple solution (not using much advanced theorems) or at least some hints.", "Python idiom to return first item or None I'm sure there's a simpler way of doing this that's just not occurring to me. I'm calling a bunch of methods that return a list. The list may be empty. If the list is non-empty, I want to return the first item; otherwise, I want to return None. This code works: my_list = get_list() if len(my_list) &gt; 0: return my_list[0] return None It seems to me that there should be a simple one-line idiom for doing this, but for the life of me I can't think of it. Is there? Edit: The reason that I'm looking for a one-line expression here is not that I like incredibly terse code, but because I'm having to write a lot of code like this: x = get_first_list() if x: # do something with x[0] # inevitably forget the [0] part, and have a bug to fix y = get_second_list() if y: # do something with y[0] # inevitably forget the [0] part AGAIN, and have another bug to fix What I'd like to be doing can certainly be accomplished with a function (and probably will be): def first_item(list_or_none): if list_or_none: return list_or_none[0] x = first_item(get_first_list()) if x: # do something with x y = first_item(get_second_list()) if y: # do something with y I posted the question because I'm frequently surprised by what simple expressions in Python can do, and I thought that writing a function was a silly thing to do if there was a simple expression could do the trick. But seeing these answers, it seems like a function is the simple solution.", "How to sort a character vector where elements contain letters and numbers in R?", "What is the \"last\" data that get's backed up, when running pg_dump on a live server? I'm wondering: If I start doing a pg_dump of a very large database (it would take hours), that is still running actively receiving writes, what is then the last data that goes into the backup? Is it: The data as-it-was, at the point in time where the pg_dump command was initiated. The last changes that it encountered at some point where it was dumping that individual record. Something else. Bonus question: If I'm trying to dump a database as part of trying to rescue it from corrupt data, will it then make any difference whether I use the directory format or the custom format?", "How can I determine if a used game is pirated?", "What blueprints become available during story? As I progress, I realize that some blueprints open up throughout the story and don't have to be researched. Are these random or are they always the same and is there a list over those? Seems you can easily waste research point if you don't know that.", "Is there a better way to do optional function parameters in JavaScript? I've always handled optional parameters in JavaScript like this: function myFunc(requiredArg, optionalArg){ optionalArg = optionalArg || 'defaultValue'; // Do stuff } Is there a better way to do it? Are there any cases where using || like that is going to fail?", "Is there always an equilibrium point in space for gravity? For instance, for a two-body system, there will always be a point in-between the two in which the forces of gravity completely cancel, and if I were there then I would experience no net force. I believe there is also a point, or a region, for three body systems as well. Assuming we treat the stars or planets as simply point-masses, will there always be, for any number of objects, a point, or a region, of equilibrium? Or no?", "How many complements are in \"I ask you to clean the room\"? How many complements are needed in the below sentence? \"I ask you to clean the room.\" This sentence above has one complement or two complements?", "How do they film continuous blood pooling?", "When should I use \"when\" and \"while\"? But you can't find anything while you're crying. But you can't find anything when you're crying. I'll tell you about it while Frank saddles the horse. I'll tell you about it when Frank saddles the horse. When should I use when, and when while? Are these sentences correct?", "Space between 2 paths in Illustrator", "I tried to open the door. I tried opening the door We can use both infinitive and gerund with verb \"try\" as used in above sentences. Does it change the meaning of the sentence if use gerund or infinitive?.(here i don't know if the meaning of sentences is changed.) The same confusion arise in these two sentences. 1.I stopped seeing him. 2. I stopped to see him.(But in case of these two sentence i know the meaning is changed but don't know exactly what the change is).", "Google Docs thumbnails do not update, can I force an update?", "I am debating whether or not to get the Potato Sack (yes, I realize I've been debating for several weeks now) bundle through steam. I already own: Defense Grid: The Awakening, Super Meat Boy, and Audiosurf, all of which are part of the sack pack. What happens if I buy the Potato Sack? Do I get 2nd copies of the three above mentioned games to gift elsewhere? Is the price of the bundle reduced by the games I already have? Do I get nothing special for already owning those 3 games?", "Does a single photon's energy depend on frequency? (photoelectric effect)", "Etiquette for username changes I'm thinking of changing my username to my real name. Given that I have a presence on some of the sites here (mostly codegolf), what etiquette should I follow when choosing my new name? As my username is currently Quincunx, I'm thinking of changing it to MyRealName (formerly Quincunx). Or perhaps MyRealName (né Quincunx). Maybe just MyRealName (Quincunx). If I do use these usernames, will people be able to recognize who I am? Or is there already a standard way to change usernames (such as relying on the profile picture)?" ]

[ "Part of a fingernail known as the is informally known as the \"quick\". It is referenced in the saying \"cut to the quick\". What is the etymology of the word quick as in reference to the fingernail?", "Separate and visually indicate reversed events from the day's reputation changes We've been getting a lot of questions ever since the feature to see event reversals such as deleted posts and serial voting was added into the reputation history; and their confusion is legitimate. Even well-respected users have become confused by that number above the day. It should display the reputation changes for that day. I propose that reversal events such as these be visually separated from the main events for that day and not included in the total reputation change for that day. After all, their reputation isn't actually changing for that day, but reversing changes from previous days. These events already seem to get bumped down to the bottom of the events for the day, why not add a simple separator between them? Events indicating reversals Events which have been reversed Perhaps a second, smaller number could be added next to the main one to indicate that other events took place on that day, but I feel most users who really care will have noticed or went looking for the events anyways. However, including them in the actual change only serves to confuse people.", "Is it possible to have site-specific badges?", "Where [if anywhere] should the apostrophe go in \"three days work\"? Which is correct? 1 Three day's work 2 Three days' work 3 Three days work I would probably guess (2) is right, since the work belongs to the three days (\"three days of work\"). But I'm not sure. Would it be different if it was only one day?", "We all know that in an idealised world all objects accelerate at the same rate when dropped regardless of their mass. We also know that in reality (or more accurately, in air) a lead feather falls much faster than a duck's feather with exactly the same dimensions/structure etc. A loose explanation is that the increased mass of the lead feather somehow defeats the air resistance more effectively than the duck's feather. Is there a more formal mathematical explanation for why one falls faster than the other?", "Different font color for question status => closed <= When I stared at () and I even thought [question refined] as offical status of the post. &lt;somebody it now, So, I've edited this question to get same effect> How about official status [closed] as different font color or different font size or put the text [closed] outside the question link Or put a special tag as suggested in the to clarify from those?", "I loved the keyboard shortcuts in Windows 7 (i.e. Win + &larr; moves a window to the left side of the screen), but I'm not sure on what some of the new ones might be for Windows 8. What are all of the NEW keyboard shortcuts that I can use while working in Windows 8?", "How to find previous boot log after Ubuntu 16.04+ restarts? My question is, how can I find boot log from previous system boot attempt? Today when first powering on my PC, boot process stopped on Ubuntu logo, when I pressed Esc I have seen several lines containing some kernel error and restart required at the bottom, so I pressed Ctrl+ALt+Del and next boot went OK without problems. I have trouble finding messages from the screen I have seen during the first unsuccessful boot. Should I have taken picture to my phone? /var/log/boot is there but empty, I searched and for strings I remembered with today's date like error but found nothing familiar to what I have seen on previous boot screen. $ journalctl -b -1 gives me only kernel messages during boot, I can find that elsewhere too, and they are not what was appearing on screen during boot, journalctl is useless for me, I am looking for messages appearing on screen during boot time. For now, only option is take a photo of write the message on paper.", "I have noticed this on many different Windows machine, on many different occasions: the RAM usage reported by Task Manager or Resource Monitor often seems to add up to an amount which is significantly lower than the actual amount in use. For example, many times on my laptop or my desktop, I have seen something like 7GB in use, and yet the total of the Working RAM Set is more like 3GB. I just can't figure out where it's being used! Here's an extreme example I noticed today in Resource Monitor on a server: If you right-click the image and open in a new tab, and view the numbers, you'll notice that the Working Set (which doesn't include nonphysical virtual memory) add up to about 1.7GB. I get similar numbers by adding up RAM usage in Task Manager when \"Show processes from all users\" is enabled. Now here's a screenshot of task manager's Performance tab: This says 7.6GB of physical memory is in use. I see this all the time, on personal computers, laptops, and now servers: the total RAM usage reported by system tools only accounts for about 1/4 of the RAM usage I observe. WTF is going on??? Is there any satisfying explanation of where all my RAM is? What is gobbling it up, and why is it leaving no trace? EDIT: Here's a picture of the graphical RAM use, as user whs asked for: EDIT 2: In response to James' response, here's a picture of the nonpaged processes in poolmon.exe, sorted by size: These results confuse me. poolmon correctly states that I have 6GB of nonpaged pool in use, but all the nonpaged pool processes are less than 8MB in size. What could this mean? Is poolmon failing to detect some of the processes using the nonpaged pool?", "What is the fallacy that privileges one person over another? I see this a lot, someone in a category of people attempts to shut down anyone with an opinion that is not from the same category. For example, people without children weighing in on parenting; the parent may say something like \"well, since you don't have kids and I do, my position is of more validity than yours.\" Another example: a drug user (of some kind) telling someone who has never done drugs and does not care to, \"until you tried it, you have no right to judge me.\" People frequently try to limit the consideration on opinions to those in their same group, while it is perfectly reasonable that the non-drug user, especially if they are a chemist or well read on the subject, may have an equally valid opinion, or even more valid. In fact some might even say that someone NOT in the category has a better chance of being objective and seeing the forest for the trees. So what is the fallacy of trying to shut down opinions when the source of the opinion is not someone who has personally had the experience under discussion?", "rails - outputting user input with Paragraph Returns?", "I wish to have long and short forms of command line options invoked using my shell script. I know that getopts can be used, but like in Perl, I have not been able to do the same with shell. Any ideas on how this can be done, so that I can use options like: ./shell.sh --copyfile abc.pl /tmp/ ./shell.sh -c abc.pl /tmp/ In the above, both the commands mean the same thing to my shell, but using getopts, I have not been able to implement these?", "“All you have to do is read” vs. “All you have to do is to read”", "Why do I get \"Exception; must be caught or declared to be thrown\" when I try to compile my Java code?", "Why is my Spring @Autowired field null?", "Dynamically update a graphic object in Mathematica", "Zero morphism does not depend on zero object I want to prove that zero morphism does not depend on zero object. Let a zero object $0 \\in \\mathcal{C}$. I supposed that exists another zero object $0' \\in \\mathcal{C}$, and I considered $0: A \\to B$ and also $$A \\to 0 \\to 0' \\to B$$ But I don't know to prove that zero morphism $0: A \\to B$ not does not depend on zero object. Can anybody give me a suggestion?", "\"This one is\" OR \"This is\" I have seen people using \"This one is Daddy's\" with the word \"one\" before a form of the verb be. I am confused about which is more accurate, to use: This is Daddy's. or This one is Daddy's. Hope you can address my concerns, thank you.", "On the first puzzle of the quest Under Saarthal (the one with the six pillars), I enter the correct combination, but the door still doesn't open, and arrows are still shot at me. I've reloaded the game a couple hundred times, I've left the room, and it still doesn't work. What do I do?", "Are all multiplicative functions additive?" ]

[ "What gear do I need for a newborn photography session? I am an amateur photographer and I have a newborn session coming up for a family friend. My current gear is: Canon T5i (crop sensor) Canon 18-55 IS STM Kit lens 85mm f/1.8 lens I plan on buying a reflector for the shoot and will be using natural light as my light source. So my question is: is this enough gear to get some nice photos? Should I get another prime lens besides the 85mm? I don't really use the kit lens. I also have another 8 month old baby shoot coming up and an informal wedding shoot coming up so it would be nice to use the lenses in all situations. I don't need a telephoto at the moment and will probably not use one any time soon.", "How to include a document into another document?", "Reference template variable within Jinja expression", "How can I boot with an older kernel version? The latest kernel is causing problems with my sound, which worked fine with an older version. As I have only Ubuntu installed, Grub is not getting displayed while booting. How can I manually choose my kernel version while booting?", "I just installed Dufour on my Windows 7 Lenovo ThinkCentre desktop. When I open 2.0.1 I get this error window: And when I try to add the 'Add Delimited Text Layer' plugin I get this message: When I click 'OK' the program closes. Any help is greatly appreciated - thanks.", "Proof that a formula $\\theta$ is valid if and only if $\\forall x \\theta$ is valid I need to prove for first-order logic that $\\vDash\\theta$ if and only if $\\vDash\\forall x \\theta$. The proof for the forward direction seems simple enough: Suppose $\\theta$ is valid. Let $\\mathfrak{A}$ be an arbitrary structure and let $s:V\\to |\\mathfrak{A}|$ be an arbitrary function assigning values of the universe of $\\mathfrak{A}$ to variables. Then we know by assumption that $\\vDash_\\mathfrak{A}\\theta[s]$. But since $s$ is arbitrary, it follows that $\\vDash_\\mathfrak{A}\\theta[s(x|c)]$, for all $c\\in|\\mathfrak{A}$. But this means that $\\vDash_\\mathfrak{A}\\forall x\\theta[s]$. Since $\\mathfrak{A}$ and the function assigning elements of the structure to variables are arbitrary, it follows that $\\vDash\\forall x\\theta$. Now we have to show that if $\\vDash\\forall x\\theta$, then $\\vDash\\theta$, and this is where I'm stuck. I understand why it makes sense that this should be true, I'm just having a hard time writing it rigorously. Any suggestions would be greatly appreciated.", "Does Metal have to be Hemalurgically charged for Ruin to control someone?", "Ways to prove Euler's formula for $\\zeta(2n)$", "induction with 2 recursive sequnces I'm having trouble solving this problem. I have relation for two sequences of natural numbers. $$a(n)+\\sqrt3\\cdot b(n)=\\left(1+\\sqrt3\\right)^n$$ and I have to prove that recursions: $$\\begin{align*} &amp;a(n+1)=a(n)+3b(n)\\\\ &amp;b(n+1)=a(n)+b(n) \\end{align*}$$ will satisfy relation mentioned above. I tried solve it using induction but I failed. Can anybody help with some other ideas?", "What causes an electric shock - Current or Voltage? Though voltage and current are two interdependent physical quantity, I would like to know what gives more \"shock\" to a person - Voltage or Current? In simple words, will it cause more \"electric - shock\" when the voltage is high or Current is more?", "Finding roots/zeros for collision detection? For the most simple of 2D games, I have implemented a posteriori collision detection (overlapping rectangles) on the x/y Cartesian plane, but am now interested in understanding the basics of a priori collision detection... In the link , I noticed the reference to Newton’s Method. So, I want to better understand the link b/w finding zeros of an equation and detecting a posteriori collision. Let's start with the most obvious case of finding roots of an equation: If you have a projectile's trajectory modeled as a quadratic function, you can find the roots to predict at what time the height will equal zero (or any other constant height, actually, by just solving f(x)=C to be f(x)-C=0 and then finding roots of that expression). So, as I understand, finding the root can tell me the time at which the object will be at any chosen height. More broadly, we basically know the (x,y) location of the object for any given time. But how does root finding, in particular, translate to detecting collisions with another object? (The other object may be stationary, or be moving. If the latter, do you also determine roots/location of this moving object as well? Calculate the (x,y) trajectory of both objects and determine where they will intersect?) Again, the basic question is where does root finding come into play? Any links to a basic primer on this topic, with a simple example would also be greatly appreciated.", "Plotting bell shaped curve in TikZ-PGF I want to create some bell shaped curves for demonstrating hypothesis testing in statistics. Can anybody help me drawing curves like shown in the following picture?", "How to make a blank page in Google Chrome at start-up?", "Why AUC =1 even classifier has misclassified half of the samples?", "Find the center of the symmetry group $S_n$. Attempt: By definition, the center is $Z(S_n) = \\{ a \\in S_n : ag = ga \\forall\\ g \\in S_n\\}$. Then we know the identity $e$ is in $S_n$ since there is always the trivial permutation. Suppose $a$ is in $S_n$, but not equal to identity. Now we can imagine the permutation as bijective function that maps from $\\{1,2,\\dotsc,n\\}$ to $\\{1,2,\\dotsc,n\\}$. So suppose $p$ is a permutation map. Then $p$ maps from a location $i$ to a location $j$. Take $p(i) = j$ where $i\\neq j$. Let $k$ be in $\\{1,2,\\dotsc,n\\}$, where $k$, $i$ and $j$ are all different elements. The cycle $r = (jk)$, then we will see if this commutes. $rp(i) = rj$ Can someone please help me, I am stuck? Thank you.", "Doubly stochastic matrix proof A transition matrix $P$ is said to be doubly stochastic if the sum over each column equals one, that is $\\sum_i P_{ij}=1\\space\\forall i$. If such a chain is irreducible and aperiodic and consists of $M+1$ states $0,1,\\dots,M$ show that the limiting probabilities are given by $$\\pi_j=\\frac{1}{1+M},j=0,1,\\dots,M$$ I have no idea how to prove it but If a chain is irreducible then all states communicate i.e $$P_{ij}&gt;0\\space \\text{and}\\space P_{ji}&gt;0\\space\\forall i,j$$ If $d$ denotes the period of any state, if a chain is irreducible aperiodic, then $d(i)=1\\forall i$ If $P_{(M+1)\\times (M+1)}$ matrix and $\\pi$ is the stationary distribution $$\\pi_j=\\sum_iP_{ij}\\pi_i\\space j=0,1,\\dots,M+1$$ but how I can get this expression?", "Proof that a sequence is convergent I'm asked to prove the convergence of the sequence $$X_n=\\left(1+\\frac12\\right)\\left(1+\\frac14\\right)\\left(1+\\frac18\\right)\\cdots\\left(1+\\frac{1}{2^n}\\right)$$ I proved that it is increasing through the ratio test and then I want to prove that it is bounded. My question is the following : is it enough to say that $X_n&lt;\\left(\\frac32\\right)^n$ for $n&gt;1$ or not ? Namely, can we say that a sequence is bounded if $\\forall$ $n$ , $\\exists$ a $N$ such that $X_n&lt;N$ or do I have to find a N such that $\\forall$ $n$ , $X_n&lt;N$? In other words, can a bound depend on $n$ ? Thanks for your help.", "C++ cout hex values?", "Is there a number whose absolute value is negative?", "Why won't this ocelot do anything but breed?" ]

[ "What happens to objects that enter a Stargate from the destination side? We know that matter can only travel one way through a Stargate, ie. from the dialing gate to the destination. What happens to things that enter the wormhole from the destination side? For example, if someone dials a gate that has tipped on its side (as in the SG-1 episode Hundred Days) and walks through, what happens when he reaches the other side and gravity causes him to immediately fall back into the gate? Does the matter disappear, or does it pass through to the other side of the destination gate, as if the wormhole were not there? Related:", "Can I use Mage Hand to fly by Polymorphing myself and picking myself up with the hand? Could I first cast Mage Hand, then Polymorph into a Tiny creature less than 10 pounds then use the Mage Hand to pick myself up and fly at 30 Ft per turn? Polymorph says: The new form can be any beast ... The target's game statistics, including mental ability scores, are replaced by the statistics of the chosen beast. It retains its alignment and personality ... The creature is limited in the actions it can perform by the nature of its new form and it can't speak, cast spells, or take any other action that requires hands or speech. This keeps me from casting spells, which keeps me from just casting Mage Hand to fly as long as I want to over and over. But for that initial duration of the Mage Hand cantrip, could I use the Mage Hand to fly as a Tiny polymorphed creature until the spell runs out?", "Suppose I have some large datafile, which overflow the screen in both vertical and horizontal direction. How can I browse this file, while the header-lines stay on the screen? For the moment, I am using less -S, so that I can nicely scroll my file horizontally and vertically. However, when scrolling down, the header lines obviously disappear. Is there a way to keep these using less? An alternative is using vim in split-screen mode with :set nowrap. However, now if I scroll horizontally, the top window doesn't scroll in the same way (:windo set scrollbind only works for vertical scrolling as far as I know).", "Who knows about the summation of this series: $$\\sum\\limits_{i=1}^{n}i^m $$ where $m$ is constant and $m\\in \\mathbb{N}$? thanks", "Removable singularities and an entire function Function $f(z)$ is an entire function such that $$|f(z)| \\le |z^{n}|$$ for $z \\in \\mathbb{C}$ and some $n \\in \\mathbb{N}$. Show that the singularities of the function $$\\frac {f(z)}{z^{n}}$$ are removable. What can be implied about the function $f(z)$ if moreover $f(1) = i$? Draw a far-reaching conclusion. My attempt: If the singularities of $\\frac {f(z)}{z^{n}}$ are removable, it is entire (not sure, need help with the justification) and bounded, so constant from Liouville's theorem, the constant value of the funcion is $i$, hence $f(z)=iz^{n}$. But what about the $n$ here, is it arbitrary? Could somebody help me prove the removability of the singularities and suggest if my attempt is going the right way?", "Best approach to Windows Forms rolling log output in TextBox", "I have a shapefile with date in a string field. I create a new field with date type and use the calculator to make the conversion. But the result only provide the date part, the time part is removed. Even when the preview show the correct conversion. Here you can see the original string field time and the result date time2. And the use of the conversion function to_datetime() and the preview result at the end If you go to the layer properties you can change the edit mode to date/time. Then if go to the data and try to edit time2 you get the current date/time. So is possible save date and time in the same field. But the update tool still doesn't work as expected As J.R said. Even when you can change QGIS edit to allow Date/Time the save to shapefile will discard the time.", "Seeking copy of 19th century South African birth certificate? I'm trying to find the birth certificate of my wife's great grandmother who was probably born in Durban, South Africa in 1884. I'm currently unable to find any online resources for this. If such a thing does not exist online, is there any other method of retrieving a copy or at least just the details?", "Who is this running kid wearing a shirt with Uchiha symbol? There's a kid wearing a shirt with Uchiha symbol, but I have no idea who s/he is. Who is this kid?", "Ubuntu server: Cannot setup dummy driver alsa (LXC container) // modprobe issue", "The biggest peeve is sometimes I vote up an answer mid-way through reading it, and the \"don't forget to accept\" message blocks the remaining text, so I scramble and triple-click it until it closes. Anyways I frequently scan my question list and search for SO's reminders, (\"Consider accepting an answer\") so the \"don't forget to accept\" is wholly unnecessary to some, and there should be a way to disable it. Do you think so too?", "When quoting something said by someone else, should I use a comma before the quote? Suppose I quote the definition given in a dictionary. Am I correctly using the the punctuation marks in the following sentences? (I am using them in the way I think correct in American English.) One of the meanings of cat is, \"a small animal with soft fur that people often keep as a pet.\" A cadet is, \"a young person who is training to become an officer in the police or armed forces.\" Should I use a comma only when I explicitly quote somebody? Groucho Marx once said, \"Although it is generally known, I think it's about time to announce that I was born at a very early age.\" Should I use a comma in this case too? As Groucho Marx said, No one is completely unhappy at the failure of his best friend. On Comma Sense, A fun-damental guide to punctuation (Richard Lederer and John Shore), I read the following about using the comma: Use commas to set off complete quotations: The great general George S. Patton once said, \"No, no—the war is this way, you idiots!\"", "Can noindex tags on several pages affect the overall SEO or ranking on Google? Some SEO Gurus assured me that noindex attributes are good to devalue the unimportant pages. When I asked in the moz Q and A, they're quite sure that having noindex on the bulk of the articles on the website can harm overall SEO ranking. Which is true?", "Plot Details/Summary I only watched an episode or two of this one, so I can't recall a whole lot about it. The protagonist is a former astronaut of some sort, who makes it his mission to clean up the crime in his city. He might have been a police officer in his &quot;new life&quot; or he might have decided to become a sort of quasi-superhero. In either case, I distinctly recall his space suit being the gimmick that makes him an effective crime fighter in the show. I seem to recall the protagonist being a young, dark-haired man, and I think he had a friendship or an alliance with a young woman (maybe a fellow cop, or someone from the space program?). I don't think there were alien beings in the show. The criminal threats were all quite terrestrial, IIRC. Timeframe and other Publication Details This was a syndicated tv show I saw on American television, probably around the late 90s to early 2000's. I believe the show was filmed in Canada, though I'm not certain. I don't think it lasted very long - it was pretty dreadful. I can say for certain the show is not Space Cop or Gerry Anderson's Space Precinct.", "I was told that the Galilean relative velocity rule does not apply to the speed of light. No matter how fast two objects are moving, the speed of light will remain same for both of them. How and why is this possible? Also, why can't anything travel faster than light?", "Should flagging a question for closure prevent close-voting? Back in April, I flagged a post as \"not a real question\". The post was subsequently closed and reopened, then closed again and finally just reopened a 2nd time a short time ago. I still firmly believe the post is not acceptable for SO, so I went to use my recently acquired close vote privilege and was greeted with the following messsage: I specifically clicked close and not flag (and figuring I just clicked in error, I tried again and got the same message). I do understand that, in the new closing system, flagging for closure is treated very much like a close vote (since it throws it to the close vote queue) except no vote is actually recorded. My issue is why should by flag be counted as a close vote when I never actually voted to close.", "What does \"...from nonmagical attacks not made with silvered weapons\" mean? I'm sure your first thought is, that's perfectly clear. Unfortunately my group who aren't normally rules lawyers disagree. Party encounters a (MM p.211). It has: Damage Immunities: bludgeoning, piercing, and slashing from nonmagical attacks not made with silvered weapons. My reading of that is if the weapon has to be magical and silvered to hurt it. So a +1 silver dagger will hurt it, but a +1 regular dagger or a +0 silver dagger won't. The group's interpretation was that all three of those weapons would hurt and only a +0 regular dagger would be ineffective. I would also note my interpretation would mean something like blade barrier would also not harm it since you could argue they're magical blades but nothing indicates that they're silvered. This also appears to be the same wording for some undead so I'm not looking for a lycanthrope specific interpretation but something general for every time that wording is used. Thanks in advance.", "Is it possible to put commands in /etc/motd? Can I put shell commands in the /etc/motd login banner file? I have tried: $(uptime) and `uptime` Is this possible?", "By taking courses, I have learned topic A. Through self-studying and discussion with others, I have explored topic B. I also study topic A outside the classroom. What I want to emphasis is that topic B is not in my curriculum, but I study it on my own. Extracurricular activities can include both activities contributed to academic study although outside the normal curriculum, but also activities not contributed to academic study such as sports, volunteer work, etc. I want to emphasis the former activities. Do you say \"outside classes\", when mentioning study by yourself, i.e. Outside classes, I have explored B. If it were you, how would you rewrite the first quote for the same meaning? Thanks!", "Why use the 'ref' keyword when passing an object? If I am passing an object to a method, why should I use the ref keyword? Isn't this the default behaviour anyway? For example: class Program { static void Main(string[] args) { TestRef t = new TestRef(); t.Something = \"Foo\"; DoSomething(t); Console.WriteLine(t.Something); } static public void DoSomething(TestRef t) { t.Something = \"Bar\"; } } public class TestRef { public string Something { get; set; } } The output is \"Bar\" which means that the object was passed as a reference." ]

[ "What is the difference between Halt and Shutdown commands?", "I am trying to show the current date in my JSP page using JSTL. below is the code I am using. &lt;jsp:useBean id=\"now\" class=\"java.util.Date\" scope=\"request\" /&gt; &lt;fmt:formatDate value=\"${now}\" pattern=\"MM.dd.yyyy\" /&gt; But the above code is not producing any results? Am I missing anything here or is there any better approach for this? I am using JSTL 1.1.", "For example: Is (A &or; B &or; C) &and; (D &or; E &or; F) the same as (A &and; D) &or; (A &and; E) &or; (A &and; F) &or; (B &and; D) &or; (B &and; E) &or; ( B &and; F) &or; (C &and; D) &or; (C &and; E) &or; (C &and; F)? How would I check equivalence in general?", "In the case of languages with a C-like syntax, we declare the main() method to return an int or float value (or void). Is it possible to declare a non-void return type from main() in Java? If not, then why not? Does this mean that a Java program doesn't return any value to the OS?", "What makes Stealing Signs wrong?", "Java: Detect duplicates in ArrayList?", "How can I add a new user as sudoer using the command line? After I add a user using adduser, I can't see it via System > Administration > Users and Groups unless I log out and then log in again. Is that normal? Also, can I set a newly added user as a sudoer or do I have to change that only after adding it? How can I do that via the shell? Finally, can I delete the original user that was created upon initial installation of Ubuntu, or is this user somehow 'special'?", "What is the limit of $n \\sin (2 \\pi \\cdot e \\cdot n!)$ as $n$ goes to infinity? I tried and got this $$e=\\sum_{k=0}^\\infty\\frac{1}{k!}=\\lim_{n\\to\\infty}\\sum_{k=0}^n\\frac{1}{k!}$$ $$n!\\sum_{k=0}^n\\frac{1}{k!}=\\frac{n!}{0!}+\\frac{n!}{1!}+\\cdots+\\frac{n!}{n!}=m$$ where $m$ is an integer. $$\\lim_{n\\to\\infty}n\\sin(2\\pi en!)=\\lim_{n\\to\\infty}n\\sin\\left(2\\pi n!\\sum_{k=0}^n\\frac{1}{k!}\\right)=\\lim_{n\\to\\infty}n\\sin(2\\pi m)=\\lim_{n\\to\\infty}n\\cdot0=0$$ Is it correct?", "PHP syntax for dereferencing function result", "GCD of rationals Disclaimer: I'm an engineer, not a mathematician Somebody claimed that $\\gcd$ only is applicable for integers, but it seems I'm perfectly able to apply it to rationals also: $$ \\gcd\\left(\\frac{13}{6}, \\frac{3}{4} \\right) = \\frac{1}{12} $$ I can do this for a number of cases on sight, but I need a method. I tried Euclid's algorithm, but I'm not sure about the end condition: a remainder of 0 doesn't seem to work here. So I tried the following: $$\\gcd\\left(\\frac{a}{b}, \\frac{c}{d} \\right) = \\frac{\\gcd(a\\cdot d, c \\cdot b)}{b \\cdot d}$$ This seems to work, but I'm just following my intuition, and I would like to know if this is a valid equation, maybe the correct method. (It is in any case consistent with $\\gcd$ over the natural numbers.) I'm not a mathematician, so please type slowly :-)", "Can I prevent enumeration of usernames on my wordpress site? I can see users at the moment using the WPScan tool.", "So, i want to make a timer that will turn on/off a circuit. I want to turn on the connected device at 08:00 and stop it at 20:00, so the interval is 12 hours. Correct me if i'm wrong but i can't use IC 555(or another IC), i'll need some huge resistors/capacitors. Is there another way to build that other than using a microcontroller?", "Who is the Maker? C-3PO frequently speaks of “the Maker.” Is this a true droid religion, or is this a religious reverence by droids for their specific creators (in this case, Anakin, even though C-3PO has forgotten who he is)? Is this even a droid thing or is it just C-3PO? What else do we know about this “Maker”-worship?", "How to prevent system applications (like the Software Center) from asking for password?", "How to achieve this smudge effect in photoshop?", "How to check file types of uploaded files in PHP? On the PHP website, the only real checking they suggest is using is_uploaded_file() or move_uploaded_file(), . Of course you usually don't want user's uploading any type of file, for a variety of reasons. Because of this, I have often used some \"strict\" mime type checking. Of course this is very flawed because often mime types are wrong and users can't upload their file. It is also very easy to fake and/or change. And along with all of that, each browser and OS deals with them differently. Another method is to check the extension, which of course is even easier to change than mime type. If you only want images, using something like getimagesize() will work. What about other types of files? PDFs, Word documents or Excel files? Or even text only files? Edit: If you don't have or and system(\"file -bi $uploadedfile\") gives you the wrong file type, what other options are there?", "Is it worth self-funding a PhD to attend a top 10 university? What should I opt for? Option A) very well paid PhD, around €3000 per month at a respectable university or; Option B) a non-paid PhD, where I have to pay €2000 per year at one of the top 10 universities of the world? EDIT: Actually they are both UK universities, Option B is ranked between the top 10 in the world in engineering and tech, and I do get a scholarship that pays 18000 pounds which covers the difference between international student tuition and EU tuition. In Option A, I will be doing research in a good university and will be working alongside giants in the industry.", "dpkg: error: dpkg status database is locked by another process I just wondered if somebody could tell me what this means: E: dpkg was interrupted, you must manually run 'sudo dpkg --configure -a' to correct the problem. reidsr@ubuntu:~$ sudo dpkg --configure -a dpkg: error: dpkg status database is locked by another process reidsr@ubuntu:~$ How do I run sudo dpkg --configure -a manually?", "incoming mail just sits in the drop folder I want a document library to recieve email and store it so followed the steps outlined here: I seem to be a bit stuck. The mail's being delivered to the machine and it's appearing as .eml files in the drop folder, so SMTP and delivery is OK. I assume Sharepoint's supposed to pick up the file, stick it in a library and delete it, but it doesn't, the mail file just sits there. Nothing in the logs, obviously. I haven't set this up before, how often does the timer service come about and pick up the mail?", "Add a confirmation before moving comments to a chat" ]

[ "What is the moment of a joint random variable? Simple question, yet surprisingly difficult to find an answer online. I know that for a RV $X$, we define the kth moment as $$\\int X^k \\ d P = \\int x^k f(x) \\ dx$$ where the equality follows if $p = f \\cdot m$, for a density $f$ and Lebesgue measure $m$. So, what is the kth moment of, say, $(X,Y)$? $\\int (X,Y) \\ d P$ doesn't really seem like the answer to me....", "How do I find my follower if and when they leave me? I had parked my follower at an inn with a bunch of valuable items that I didn't want to carry. I guess I have been out a bit too long as this message appears: Your follower tires of waiting and leaves. There have been other situations where my follower has mysteriously disappeared as well. How can I find my follower when they get up and leave or disappear into thin air?", "Inspired by a StackOverflow question (). Is there a DBMS that actually supports the = NULL syntax?", "Best methods to fix broken tracks I've made a couple of PCBs which need the odd few 10 mil tracks, but are mostly 20/30 mil. Unfortunately the etching process isn't fantastic and there are numerous breaks in the traces, most of them small. I've managed to convince solder lumps to go over the top of the smaller gaps, and have used components legs to bridge some of the larger ones. The solder lumps don't feel particularly reliable though, and there are some gaps which are too small and awkward to get a piece of wire across but too big to be bridged with just the iron. Are there any standard ways to reliably fix up broken traces? Update: Thanks for the suggestions everyone! I found and tried out a silver conductive pen. As a first time user I found it difficult to dispense, and obviously I didn't use enough of it or mix it properly because it didn't even end up being conductive. It seems like the main problem was that I was trying to use pieces of wire which are too short. I found some small gauge tinned wire and used longer lengths, running it over significant lengths of good track on either side of the fault. That makes it much easier to position, and you can tack them down one end at a time.", "Why does flag marking as helpful/declined not always correlate with moderator action? I flagged a post and (choose one) my flag was marked as helpful, yet nothing was done my flag was marked as declined, yet the post was deleted/edited/closed Why?", "How do I update my TeX distribution? I'm trying to compile a document that only works with an up-to-date distribution, so I'd like to know: how do I update my distribution? Please provide screenshots where appropriate. List of answers To keep an eye on what’s going on at CTAN you may subscribe to the or the RSS feed feed://www.mail-archive.com/[email protected]/maillist.xml", "I am looking for information on Heinrich Märte (my grandfather) and his family. He was born on July 1, 1912 in Sipplingen and died On April 19, 1944 when the military plane crashed in Geierswalde because its engine failed. I am not sure if his family knows that he fathered my dad. I am hoping someone knows of him or his family. I would love to know how he met my grandmother or any further information on him. We have always had two photo's of him, but never knew his name. We have only just found out about him and it has opened so many more questions. How can I determine Heinrich's parents and siblings, and then locate any living family members?", "Alignment issue in 'Your Sites' section in the Android app There is some unwanted extra spaces in between each site in the Your Sites section. Steps to reproduce: Touch the Nav Icon in the left top corner Touch the EDIT link in YOUR SITES Scroll the screen; there is unwanted spaces in between the each site For reference I recorded the same: Configurations: App Version: 1.0.85 Device Manufacturer: Motorola Device Model: XT1033 OS Version: 5.1 (2)", "I have a mesh and in the region around each triangle, I want to compute an estimate of the principal curvature directions. I have never done this sort of thing before and does not help a lot. Can you describe or point me to a simple algorithm that can help me compute this estimate? Assume that I know positions and normals of all vertices.", "I am compiling a program which requires boost-thread-mt library. I have installed libboost-all-dev using sudo apt-get install libboost-all-dev but compiler says that it cannot find boost-thread-mt library. Is this library in some other package? Please guide me what i need to install for this.", "I am able to parse strings containing date/time with time.strptime &gt;&gt;&gt; import time &gt;&gt;&gt; time.strptime('30/03/09 16:31:32', '%d/%m/%y %H:%M:%S') (2009, 3, 30, 16, 31, 32, 0, 89, -1) How can I parse a time string that contains milliseconds? &gt;&gt;&gt; time.strptime('30/03/09 16:31:32.123', '%d/%m/%y %H:%M:%S') Traceback (most recent call last): File \"&lt;stdin&gt;\", line 1, in &lt;module&gt; File \"/usr/lib/python2.5/_strptime.py\", line 333, in strptime data_string[found.end():]) ValueError: unconverted data remains: .123", "How can I remove the site URL from enqueued scripts and styles? I'm dealing with an SSL issue and I would like to strip the domain from all scripts and styles being output via wp_enqueue_scripts. This would result in all scripts and styles being displayed with a relative path from the domain root. I imagine there is a hook that I can use to fileter this, however, I am not sure which one, nor how to go about it.", "I keep reading about ('PPAs') and people answer questions with a link to a PPA. What's the best way to use these? There are multiple valid answers for this question spanning over several versions of Ubuntu. For your convenience, an index of each is below.", "I have purchased a rather large bag of long-grain white rice (25 lbs.) and need to know the best way for storing it long-term. This rice will be used as both a food-storage food source and as my everyday source of rice for cooking, so the storage solution should (hopefully) be resealable, rather than once-it's-open-it's-open. I eat rice maybe three times a month, so it isn't really \"everyday\" but it will be my go-to when I have it.", "How can you prove that a function has no closed form integral? In the past, I've come across statements along the lines of &quot;function $f(x)$ has no closed form integral&quot;, which I assume means that there is no combination of the operations: addition/subtraction multiplication/division raising to powers and roots trigonometric functions exponential functions logarithmic functions which when differentiated gives the function $f(x)$. I've heard this said about the function $f(x) = x^x$, for example. What sort of techniques are used to prove statements like this? What is this branch of mathematics called? Merged with &quot;&quot; by : Sometimes we are told that some functions like $\\dfrac{\\sin(x)}{x}$ don't have an indefinite integral, or that it can't be expressed in term of other simple functions. I wonder how we can prove that kind of assertion?", "I have a bathroom door that is quite loud when operated. And when someone goes to the bathroom at night, it innevatibly wakes someone up (and baby room is just across from the bathroom!) there are 3 components of noise, and I was wondering if there is an alternative to fixing them: door bangs against the jamb (this is fixed with simple foam bumpers) latch mechanism makes a loud CLUNK when door is pushed closed (I was able to dampen it just a bit by putting foam inside strike plate, but it is still quite loud) lock button also makes a CLUNK when the knob is turned and it is released (this can be battled by replacing with a mechanism that needs to be manually opened [twist instead of push] but it is less convenient, and I would prefer something that automatically unlocks) Any suggestions as to a knob that has a dampening of the latch and lock button? I have only found one youtube video of my ideal handle, but there is no information on how it works, where to buy it, or anything else:", "Is it possible to migrate programs from 32 bit Windows to a new 64 bit Windows machine (both Windows 7)? I've got a Windows 7 Pro 32 bit PC. Getting a new Windows 7 Home 64 bit. Is there anything I can use to transfer my programs (the ones that don't come in a 64 bit flavor) to the new PC? There is a related that doesn't address the programs part.", "A proof for the inequality $\\sum_{i=0}^{t-2}{\\frac{1}{t+3i}} \\leq \\frac{1}{2} $ for all $t \\geq 2$ I'm struggling with proving the following inequality: $$\\sum_{i=0}^{t-2}{\\frac{1}{t+3i}} \\leq \\frac{1}{2}$$ for all $t \\geq 2$. I think it is monotonic non-increasing in $t$, which would suffice. Thanks in advance!", "How to unprotect GeneratingFunction", "I've just installed MariaDb on a fresh Ubuntu Gnome and ran afterwards where I set a decent admin password, removed the anonymous user etc. Afterwards I realized some strange behavior regarding the admin password: If I try to login from my normal user account using the command mysql -u root -p I always get an error: ERROR 1698 (28000): Access denied for user 'root'@'localhost' I'm pretty sure I entered the correct password which I set with earlier... When I run the command from root using sudo mysql -u root -p, I always get access to the database, no matter which password I actually enter... Is this normal behavior, am I doing anything wrong or have I somehow screwed up the installation?" ]

[ "Bash: What does \">|\" do? I have just seen this written down; $ some-command &gt;| /tmp/output.txt Vertical pipes are used in standard redirects \"piping\" the output of one command to another, is &gt;| in fact completely useless as it would be the same as just &gt; in this scenario?", "I have tried to map this simple object, but the uv mapping does not correspond to what i see in the textured object. It cuts the image a bit on top and a bit on the bottom of the faces. It does not fill the faces with the texture, even though i have mapped them correctly. Does anyone know what could be happening? Thanks in advance.", "How do I copy files using Windows Batch?", "How can I define the different properties of an Cycles/Eevee material? Such things as glossy, glass, diffuse, RGB-color, emissive via python scripting?", "Skyrim - Companions attacked me for no reason?", "Stop the Ubuntu updater from nagging about Firefox English Language pack even after uninstalling Firefox I have run sudo apt purge firefox, and I have gone through all of the /.config files, etc., and Software Updater is still asking me daily if I want to install the &quot;English Language Pack for Firefox&quot;. I don't have Firefox installed. How can I stop the updater from asking to update something on a program that doesn't exist? Output of dpkg -l | grep firefox: ii firefox-locale-en 88.0+build2-0ubuntu0.18.04.2 amd64 English language pack for Firefox", "Ring of rational-coefficient power series defining entire functions", "No internet after 16.04 LTS 18.04.01 upgrade This may seem like a duplicate, but many solutions have been unsuccessfully tried. Currently I have no internet, WIFI or Ethernet. Sometimes: \"no wifi adapter found\". The device is HP dm4, dual boot with Windows 7. Here is the The issue started 3 weeks ago as no GUI after 16.04 LTS to 18.04.01 upgrade. At that time, I was able to use the terminal to connect to the Internet and run \"fixes\" in Then mysteriously, the GUI ran after restarting several times. But since then, I am unable to connect to the Internet in the terminal or GUI. There is a chatroom about my issues. sudo nmcli c up &lt;saved WIFI connection&gt; only appears to connect. sudo nmcli d wifi list shows strong signal strength, but ping to google and nyt fails. The phone I use as a hotspot shows a successful connection. In the GUI Network Tools show the phone/hotspot recently used minutes ago, the Available Networks list shows the phone/hotspot as available with a check mark, but the \"connect\" button is grayed out and unfunctional. REGDOMAIN=00 and attempts to change this has failed as others describe. I have a similar set up to the one described by cipricus in and the situation described in", "I tried the Chrome development version for a few days, didn't like it because my tabs became broken and wouldn't load properly. I changed back to the live version, but I forgot to uninstall the development version, which gave me 2 chrome icons on my task bar, but they would both load a broken version of Chrome. I then uninstalled Chrome through the control panel and reinstalled the live version, but I now have one of those broken links on my task bar (a blank page with a folded corner) that points to a version of Chrome that's no longer there. Is there a way to remove this icon?", "Why can't I find the Karin Kuruma?", "The state postulate is as follows: The state of a simple compressible system is completely specified by two independent, intensive properties. My first question is whether there is any justification for this postulate or whether it is simply an empirical law? That is, why is it not the case that 3 intensive variables are required to fix the state or even 4? If it is an empirical law with no justification and just happens to be a law our universe abides by, then why is it not one of the laws of thermodynamics as it clearly provides foundational value to the field of thermodynamics? My second question pertains to how we can know whether 2 intensive variables are in fact independant. Say temperature $T$ and specific volume $v$ for example. If we are given a thermodynamic problem, how would we know whether these are independent or not? or perhaps specific internal energy $u$ and pressure $P$. Are there certain combinations that are simply always independent of each other or does independence between intensive variables vary from problem to problem and require a full understanding of the problem at hand? Let us take a phase change for example. From my understanding of phase changes, I know that the boiling temperature is dependent on the pressure and hence I won't be able to use $T$ and $P$ as 2 variables to completely specify the state. But how would I know know what combinations of intensive variables will be independent in this case or any other case for that matter? Does it simply require rote memorization of all independent pairs of intensive variables for all thermodynamic problems or is there a more simple way to figure out what is independent and what isn't? I hope this question makes some sense and any help would be most appreciated!", "Table of Contents for poetry collection (ConTeXt) I'm getting stumped about how to generate the ToC for this book. I'm about to give up and just do it by hand. The author wants to include a lot of structural information that isn't present in the actual text, and none of the numbers \"roll over\" as they're want to do in ConTeXt. This is the desired effect: Narrator 1... FIRST PART: PART SUBTITLE 1). First Poem // First Poem (Spanish title) . . . . . . . . . . . . . . . . . 1 Author of Poem (b. XXXX d. XXYY) 2). Second Poem // Poema Secunda . . . . . . . . . . . . . . . . . . . . . . . 3 Author of Poem Narrator 2... 3). Third Poem // Third Poem . . . . . . . . . . . . . . . . . . . . . . . . . 5 Author SECOND PART: Part 2 4). Fourth Poem // Fourth Poem . . . . . . . . . . . . . . . . . . . . . . . . 7 Author Narrator 3... The problems I have essentially boil down to these: There is this weird \"narrator\" concept that doesn't seem to contain or be contained by the part/poem structure. A new part doesn't imply a new \"narrator\" and a new \"narrator\" doesn't imply a new part. I need to aggrandize each title with the title in translation and the author, and I want to typeset them nicely. I need poems to continue counting up across parts. I see basically three approaches: Make each poem a chapter and customize the appearance with \\setuphead[chapter][....]. Then use \\writebetweenlist[chapter] to add the Narrator and author information. Make a new list with \\definelist[poem] and \\definecombinedlist[content][part,poem]; continue using \\writebetweenlist[poem] to insert the author and Narrator. This feels like the most conceptually valid option, but I think I'll still need a lot of customization. Forget all about ConTeXt and switch to plain TeX, use eplain's writetocentry system. Make it look right and forget maintainability.", "A weak converse of $AB=BA\\implies e^Ae^B=e^Be^A$ from \"Topics in Matrix Analysis\" for matrices of algebraic numbers. It is a well known fact that if $A,B\\in M_{n\\times n}(\\mathbb C)$ and $AB=BA$, then $e^Ae^B=e^Be^A.$ The converse does not hold. Horn and Johnson give the following example in their Topics in Matrix Analysis (page 435). Let $$A=\\begin{pmatrix}0&amp;0\\\\0&amp;2\\pi i\\end{pmatrix},\\qquad B=\\begin{pmatrix}0&amp;1\\\\0&amp;2\\pi i\\end{pmatrix}.$$ Then $$AB=\\begin{pmatrix}0&amp;0\\\\0&amp;-4\\pi^2\\end{pmatrix}\\neq\\begin{pmatrix}0&amp;2\\pi i\\\\0&amp;-4\\pi^2\\end{pmatrix}=BA.$$ We have $$e^A=\\sum_{k=0}^{\\infty}\\frac 1{k!}\\begin{pmatrix}0&amp;0\\\\0&amp;2\\pi i\\end{pmatrix}^k=\\sum_{k=0}^{\\infty}\\frac 1{k!}\\begin{pmatrix}0^k&amp;0\\\\0&amp;(2\\pi i)^k\\end{pmatrix}=\\begin{pmatrix}e^0&amp;0\\\\0&amp;e^{2\\pi i}\\end{pmatrix}=\\begin{pmatrix}1&amp;0\\\\0&amp;1\\end{pmatrix}.$$ For $S=\\begin{pmatrix}1&amp;-\\frac i{2\\pi}\\\\0&amp;1 \\end{pmatrix},$ we have $$e^B=e^{SAS^{-1}}=Se^AS^{-1}=S\\begin{pmatrix}1&amp;0\\\\0&amp;1\\end{pmatrix}S^{-1}=\\begin{pmatrix}1&amp;0\\\\0&amp;1\\end{pmatrix}.$$ Therefore, $A,B$ are such non-commuting matrices that $e^Ae^B=\\begin{pmatrix}1&amp;0\\\\0&amp;1\\end{pmatrix}=e^Be^A.$ It is clear that $\\pi$ is important in this particular example. In fact, the authors say what follows. It is known that if all entries of $A,B\\in M_n$ are algebraic numbers and $n\\geq 2,$ then $e^A\\cdot e^B=e^B\\cdot e^A$ if and only if $AB=BA.$ No proof is given. How does one go about proving that?", "How to find historical stock price for a de-listed or defunct company?", "I have a list of requirements for a program, but I don't know what program meets these criteria. That's about general-purpose software, for example, not a programming IDE or statistical workbench, questions about which would certainly go to respective sites. Is this question appropriate on Stack Overflow? Where should I ask about it? On Super User or elsewhere?", "Can Tamron 16-300mm Macro Lens fit to Canon EOS 600D? I use Canon EOS 600D and I want a lens with a larger range. I found out Tamron 16-300 f/3.5-6.3 Di II VC PZD Macro Lens, I added it into my wishlist. I did some research on it and I'm scared that it couldn't fit to my Canon EOS 600D. I'm still a beginner... I'm confused with EF, EF-S and APS-C/DX. Can someone please explain it to me?", "According to : By looking for trades that take place in between the bid and ask, you can tell when a strong trend is about to come to an end. This is because these trades are often placed by large traders who take a small loss in order to make sure that they get out of the stock in time. A trader when buying needs to buy at the ask price and when selling needs to sell at the bid price. So how can a trade happen 'in between' the bid and ask?", "How do I set a background image while I am editing? How do I put a backdrop behind the model that I am creating so that I can compare the picture to the model while editing?", "$\\mathbb Z[1/2]$ is not finitely generated ? Maybe I misunderstood, what finitely generated means. it says, we need finitely many elements and I think $1$ and $1/2$ suffices as generators. But , at the end of Proposition $5.1.4$, from the fact that $\\mathbb Z[1/2]$ is not finitely generated it is concluded that $1/2$ is not integral.", "is this set a regular surface? I'm reading \"Differential Geometry of Curves and Surfaces of Manfredo Docarmo\" I'm doing the exercises of the chapter 2. Here is the definition of regular surface that we are following: I have problems with this exercise: Is with the first part, I think that it's not true that it's a regular surface (the second it is). I don't know how to prove that something is not a regular surface." ]

[ "Anonymous questions and Avatars Some Stack Exchange sites allow to ask an anonymous question by specifying a one-time user name and an email which is \"required, but never shown\". However the Gravatar attached to the email is shown anyway. Anonymous users do not want their picture to appear - someone can find their identity via google image search or someone that knows them. Example: open incognito window and :", "My website used to have sitelinks and now it doesn't. It's very possible that it's due to changing the website to a sidebar design instead of having an \"interstitial\" type landing page which limited the number of choices, but I'm not sure. Here is how sitelinks might look for a site: What are some things that I can do to improve my chances of getting sitelinks?", "Lunch Meeting Probability for two person to meet in given 1 hour slot and none would wait more then 15 minute. Two friends who have unpredictable lunch hours agree to meet for lunch at their favorite restaurant whenever possible. Neither wishes to eat alone and each dislikes waiting for the other, so they agree that each will arrive at a random time between noon and 1 pm, and each will wait for the other for 15 minutes or until 1:00. What is the probability that the friends will meet for lunch on a given day?", "How can I find out which process is locking a file or folder in Windows? For instance, when trying to delete a folder, Windows reports this: The action can't be completed because the folder is open in another program Happens the same with a file, but how do I find out what program or application is currently using it and preventing me from deleting the file or folder?", "If $f'(x)\\le g'(x)$, prove $f(x)\\le g(x)$ I have to do the following exercise: Let $f$ and $g$ two differentiable functions such that $f(0)=g(0)$ and $f'(x)\\leq g'(x)$ for all $x$ in $\\mathbb{R}$. Prove that $f(x)\\leq g(x)$ for any $x\\geq0$. Now, I know this is true because the first derivative of a function is the angular coefficient of the function in a point $x$. So, $f'(x)\\leq g'(x)$ means, in other words, that the function $g(x)$ grows faster than $f(x)$. I think this is the base for a more formal proof, could someone help me to figure out a more formal proof?", "how to run the dialog command with proccess Please look on my code – ( bash script ) I want to display both dialogs on the screen on the same time, one dialog display the: tail –f from - /var/log/proccess1.log , and the second dialog display the: tail –f from the file - /var/log/proccess2.log but the sad fact is that I can display only one dialog and not both dialogs ( because when I run the first dialog , the second dialog will activate only if the first dialog will killed ) So I create process on the second dialog ( ….. ) &amp; , in order to display both dialogs But …. the second dialog create process number but not create the second dialog GUI , ( seems that when we create dialog with process , the process not send the dialog to standard output ) So how to run the second dialog with process but send the dialog GUI to screen ? , or other solution in order to display both dialogs on screen My code #!/bin/bash # this dialog will locate the tail box on the top of the screen dialog --begin 15 10 --tailbox /var/log/proccess1.log 13 125 # this dialog will locate the tail box down in the screen ( dialog --begin 37 10 --tailbox /var/log/proccess2.log 13 125 ) &amp;", "What happened to the voting buttons? Starting from yesterday, the up-/downvote buttons seem to have moved from the left of a post towards above (in the middle) of the bodies of all questions and answers. Here is a screenprint of a sample (containing such buttons for both a question and an answer to it): This happens on an iOS device (running 9.3.5), using various browsers and this in any SE site. No idea so far how it looks like in the most recent iOS version. Same for the (green) checkbox below those voting buttons (to mark an answer as accepted). Is this intended to be like this (IMO it looks ugly ... and a huge waste of available space), or is it rather some sort of CSS related issue that needs to be fixed? PS: Looking at the same page around the same time on a Win PC (using any of the common browsers) seems to work fine.", "How to show that the commutator subgroup is a normal subgroup", "Making data points different sizes based on data using QGIS? I am trying to plot sales data on a map using QGIS. I will add the disclaimer that I am a rookie at using the program. I added the different sales types by adding delimited text layers (utf16). The data included Longitude, Latitude, and Amount. I want to make the dots on the map scale with the value of the sale. Ive had no luck with trying to use Simple Marker->Data defined properties-> size and writing case functions. Some data points show up at different sizes while others show up at all data points. Here are my functions under different simple markers: CASE WHEN Amount &lt;= 10000 THEN '.2' END CASE WHEN 10000 &lt; Amount &lt; 75000 THEN '.4' END CASE WHEN 75000 &lt; Amount &lt;= 250000 THEN '.6' END CASE WHEN Amount &gt;= 250000 THEN '1' END The majority of my data set falls into the 10-75k range. However the .4 and .6 size circles show up at every data point on the map, while the .2 and 1 sizes only show up where the data specifies (along with the .4 and .6 sizes). At this point I am trying to figure out what is wrong with the equations, however I am stuck. Is there a better way to go about this or am I just simply messing up the equations? I wish I could share my whole map with you but it is looking great. I went with U/Joseph 's solution and here is an excerpt of the results for those interested.", "Reference — frequently asked questions about PDO", "How do I get started creating an Ubuntu Desktop App?", "Why are duplicates not being merged? I see more and more exact duplicates on SO. Instead of being merged they are being simply closed. I think this is very big disservice to SO. Why don't moderators merge duplicates? Why don't owners of the site do anything about this? EDIT It's disservice because this way we have more and more junk. Duplicates are duplicates and should be merged so that information in in one place. If the duplicate has no answers then there is no benefit to merging. Of course there is. You don't need to waste your time with dupes. It also means that the search routes to the main question are diminished which makes the posting of new duplicates more likely There's easy solution for this which I gave in back in march. If both questions have answers that have been accepted, which one should be unaccpeted? There are plenty of solutions. You accept most voted accepted answer or the first accepted answer or both (I think this is be the best). Yes, there will be possibility of many accepted answers to one question. So what? When a question is closed as a duplicate, there is a link to the duplicate question. What more do you want? I don't want yet another link. I want to have all answers to some problem in one place. Is this that hard? Isn't this natural expectaion? Removal of the question means that the text in it is no longer searchable - that's a disservice. See my answer above to Scrooge's comment.", "Textbook approach to modeling non-proportional hazards in the Cox model In Cox models with time varying coefficients, the effect of covariates on the hazard is allowed to change through time. In cases where a coefficient has a linear relationship with time, I am aware of at least two text books ( and an Appendix to ) that advocate for the following model, first in R code: coxph(Surv(time, death) ~ disease + disease:time) And now in mathematical notation: $$ h(t|X) = h_0(t) \\exp(\\beta_1X + \\beta_2X_T) $$ Where $h(t|X)$ is the instantaneous hazard rate at time $t$ given covariates $X$; $h_0(t)$ is the baseline hazard rate; and $T$ is the censoring or event times. $\\beta_1$ represents the log hazard ratio for individuals with $T=0$ (which is sort of nonsensical since you can't have $T=0$ in the data), while $\\beta_2$ is harder to interpret... $\\beta_2$ shows how the log hazard ratio depends on censoring/event times, but that is circular because event times are also the response variable (this point is made in Terry Therneau’s vignette “”). According to Therneau's vignette, to correctly specify a time varying coefficient, you need to use the following model, first in R code: coxph(Surv(time, death) ~ disease + tt(disease), tt=function(x,t,...){x*t}) And now in mathematical notation: $$ h(t|X) = h_0(t) \\exp(\\beta_1X + \\beta_2X_T) $$ The difference is that the time interaction is with $t$ in the model rather than with the event times $T$ in the data. The resulting parameters are easy to interpret: they are the intercept and slope of the linear relationship between the log hazard ratio of $X$ and time. This approach seems like the proper way to model a time varying effect. Can anyone justify or advocate for the first approach to modeling non-proportional hazards in the Cox model? If it is really incorrect (as I suspect it is), what are the practical consequences of using this approach?", "How do I open Chromium in incognito mode by default? I would like to be able to open Chromium in incognito mode automatically. I'm new to Linux and I love it so far but I haven't yet found a way to do this. I'm using Ubuntu 14.04.", "Cannot empty trash I am trying to empty my trash, and it keeps giving me an error message that says, .Trash can't be opened right now because it's being used by another task... I have tried restarting my computer, running Finder > Secure Empty Trash everything yields the same result and error message from above.", "What would happen to a teaspoon of neutron star material if released on Earth? I've read on NASA's page on neutron star that one teaspoonful of that star would weigh over 20 billion tonnes on Earth. If it was somehow possible to bring it to earth would it: Burn and disappear during Earth atmosphere entry? Assuming we have 20 billion tonnes of mass occupying the volume of a teaspoon here on Earth, would it fall through the ground under its own weight?", "When certain nationalities of people want to travel in the Schengen zone, they are required to apply for a Schengen visa. This is a straight-forward process for most, but when an applicant has had problems with removals or refusals they may be reluctant to apply because they want to avoid the complexities of serial visa refusals. This reluctance may lead some into wondering how their history can be expunged, and this line of thought inevitably leads to the idea of getting their passport replaced with a new one. This sounds like a great formula for people who have had prior refusals or removals. In essence they can become 'reincarnated' as a first-time traveller and hence avoid the unpleasantness of revealing their prior interactions with the Schengen authorities. The relevant parts of the application form are shown here... Nothing asks about a prior removal or refusal, and the applicant is left with simple denials for 3 questions in order to present themselves as a first-time traveller. Assuming the person is happy to set aside the moral issues associated with denying their history, are there any holes to this strategy? This question is scoped to Schengen visa applications so that it will not be unmanageably broad, but answers from other regimes (particularly the affluent Commonwealth and the USA) are acceptable as long as the main points are relatively consistent with Schengen.", "Is there a word for a person who avoids their responsibilities?", "Can you grab the blue shirts and socks? Is the above sentence stating that both the shirts and the socks are blue? Or only the shirts? At this stage, I am leaning towards the earlier (only the shirts) — though writing \"Can you grab the blue shirts and blue socks?\" seems redundant.", "How do I get started with Translations? My friend and i would like to translate Ubuntu. where should we start? where to find translation tools?" ]

[ "The propagation of electric field", "I recently ordered the GTA V PC from Steam and when I finished installing and launch the game. It gave me \"Grand Theft Auto V has exited unexpectedly\". I tried \"safe mod\" and every option available, but none of them work. I checked some forums and found a lot of people having the same problems. What could be the possible cause? I'm using a laptop with these specs: CPU: i7 4700m GPU: AMD HD8970M RAM: 8GB I'm pretty sure my laptop is way beyond the minimum specs. Does someone know how can I enter the game?", "Let $a=p_1^{x_1}p_2^{x_2}\\cdots\\cdot p_q^{x_q}$ and $b=p_1^{y_1}p_2^{y_2}\\cdots p_r^{x_r}$ , say — Since gcd(a,b) is the largest common divisor of a and b and is divisible by any other common divisor of the two, GCD$(a,b)=p_1^{\\min(x_1,y_1)}p_2^{\\min (x_2,y_2)} \\cdots p_q^{\\min (x_q,y_q)}$ LCM$(a,b)= p_1^{\\max(x_1,y_1)}p_2^{\\max(x_2,y_2)}\\cdots p_r^{\\max (x_r,y_r)}$ I understand GCD(a,b) has to divide both $a,b$. Therefore the exponent of any prime factor $p_i$ in GCD has to be in both $a,b$ — therefore $p_i^{\\min(x_i, y_i)}$. But I'm muddled and anxious. Why does $\\min$ appear in GREATEST common divisor? Why does $\\max$ appear in LOWEST common multiple?", "Consider the integral equation $\\phi(x)-\\frac{e}{2} \\int_{-1}^{1} x e^{t} \\phi(t) d t=f(x) .$ Then there exists a continuous function $f:[-1,1] \\rightarrow(0, \\infty)$ for which solution exists there exists a continuous function $ f:[-1,1] \\rightarrow(-\\infty, 0)$ for which solution exists for $f(x)=e^{-x}\\left(1-3 x^{2}\\right)$, a solution exists for $f(x)=e^{-x}\\left(x+x^{3}+x^{5}\\right),$ a solution exists what I tried $f(x)=f(x)+\\frac{e}{2} \\int_{-1}^{1} x e^{t} \\phi(t) d t$ $\\phi(x)=f(x)+\\frac{e x}{2} \\int_{-1}^{1} e^{t} \\phi(t) d t$ $ \\begin{array}{l}L e t \\quad c=\\int_{-1}^{1} e^{t} \\phi(t) d t \\\\ \\Rightarrow \\phi(x)=f(x)+\\frac{x e}{2} c\\end{array} $ $c=\\int_{-1}^{1} e^{t}\\left(f(t)+\\frac{c e}{2} t\\right) d t$ $c=\\int_{-1}^{1} e^{t} f(t)+\\frac{\\operatorname{ce}}{2} \\int_{-1}^{1} t e^{t} d t$ $c=\\int_{-1}^{1} e^{t}f( t)+\\frac{\\operatorname{ce}}{2}\\left[t e^{t}-e^{t}\\right]_{-1}^1$ $c=\\int_{-1}^{1} e^{t} f(t)+\\frac{c e}{2}\\left(2 e^{-1}\\right)$ $c=\\int_{-1}^{1} e^{t} f(t) d t+c$ $\\int_{-1}^{1} e^{t} f(t) d t=0$ Option (3) and (4) satisfies this Relation so, (3) and (4) seems true to me.is i am right? I am stuck for option (1) and (2) is there any result or theorem ?", "Any good application for data usage monitor? I was wondering if there are any good applications to monitor how much data I use on my laptop in a month. My net connection has a restriction of how much data I can use after which the speed goes down considerably. I saw ntop, but I just wanted to ask if there are any other good options or suggestions regarding this. Regards.", "Confirmation that someone is listening to another person's speech When someone is telling you a very long and detailed story he usually wants to hear some \"confirmations\" (or response) that you are listening to his story. In Russian we often use something like \"tak\" (which has a meaning of \"ok\" and \"well, proceed further\"), \"a-ha\" or \"uh-huh\". What word serves the same purpose in English and American English?", "When I add the picture, the word and pdf is the full page and the Latex moves to the right of the page. How can I solve this problem? this is my work. this is my work and pdf link: https://we.tl/t-cgDSwDuu8H I couldn't stop the pictures from sliding right. What should I do to make the image look like the original PDF file? If I reduce the scale of the picture is centered but this time it becomes very small. Is a situation caused by page margins? \\documentclass [12pt, a4paper]{article} \\usepackage{color} %\\usepackage[turkish]{babel} \\usepackage{graphicx} \\usepackage{tabularx} \\usepackage{multirow} \\usepackage{graphicx} %\\usepackage[pass,showframe]{geometry} %\\usepackage[T1]{fontenc} \\begin{document} \\definecolor{renkbir}{RGB}{0,32,96} \\begin{tabular}{ m{8,5cm} m{6cm} } \\Large{\\textbf{MsdasdasdN }} \\large{\\textbf{\\textcolor{renkbir}{Firma Adı }}} &amp;\\small {Uçak Mühendisi \\newline T.C No: asd \\newline asd \\newline asd \\newline asd} \\end{tabular} \\ %Uçak mühendisi Tc No kısımını sağa yaslamak istedim fakat yapamadım. \\begin{center} \\large{\\textbf{\\textcolor{renkbir}{KİŞİSEL BİLGİLER}}} \\end{center} \\begin{center} \\begin{tabular}{ l l r } Ad &amp; Mehm &amp; \\multirow{9}{*}{\\includegraphics[scale=0.15]{2.pdf}} \\ Soyad &amp; asdasd \\ Doğum Tarihi &amp; sanane (23 Yaşında) \\ Adres &amp; asd \\ Telefon &amp; asd \\ Mail &amp; asd \\ Sigara Kullanımı &amp; Hayır \\ Ehliyet &amp; B \\ Askerlik &amp; Tecilli (31.12.2020) \\ \\end{tabular} \\end{center} %\\vspace{1cm} Burası boşluk bırakma komutu. \\begin{center} \\begin{tabular}{ m{4cm} m{6cm} m{5cm} } \\multicolumn{3}{c}{\\large{\\textbf{\\textcolor{renkbir}{EĞİTİMLER}}}} \\ \\hline \\multirow{2}{}{Üniversite(YL)} &amp; asd \\newline Makine Mühendisliği \\newline Özel Öğrenci / Türkçe \\newline Durumu : Devam ediyor &amp; \\multirow{2}{}{Eylül 2018 / } \\ \\hline \\multirow{2}{}{Üniversite} &amp; asd \\newline Uçak ve Uzay Bilimleri Fakültesi \\newline Uçak asd \\newline Örgün Öğretim / İngilizce \\newline Durumu : Mezun &amp; \\multirow{1}{}{Ekim 2013 / Haziran 2018} \\ \\hline \\multirow{1}{}{Lise} &amp; asd \\newline Anadolu Lisesi (100 / 90,02) &amp; \\multirow{1}{}{Ekim 2013 / Haziran 2018} \\ \\end{tabular} \\end{center} \\begin{center} \\begin{tabular}{ m{3cm} m{4cm} m{4cm} m{4cm} } \\multicolumn{4}{c}{\\large{\\textbf{\\textcolor{renkbir}{YABANCI DİLLER}}}} \\ \\hline \\textbf{İngilizce} &amp;\\textbf{Okuma:} İyi &amp;\\textbf{Yazma:} İyi &amp;\\textbf{Konuşma:} Orta \\ \\end{tabular} \\end{center} \\begin{center} \\begin{tabular}{ m{5cm} m{5cm} m{5cm} } \\multicolumn{3}{c}{\\large{\\textbf{\\textcolor{renkbir}{BİLGİSAYAR BİLGİLERİ}}}} \\ \\hline \\multicolumn{3}{l}{Donanım - Ofis Programları} % donann ofis koyu yazmak istedim yapamadım. \\ Ms Excel &amp; Çok İyi &amp; +5 Yıl \\ MS Word &amp; Çok İyi &amp; +5 Yıl \\ Ms Powerpoint &amp; Çok İyi &amp; +5 Yıl \\ \\hline \\multicolumn{3}{l}{Yazılım Geliştirme} % donann ofis koyu yazmak istedim yapamadım. \\ Office &amp; Orta &amp; 2-3 Yıl \\ Matlab &amp; Orta &amp; 2-3 Yıl \\ Phyton &amp; Orta &amp; 0-1 Yıl \\ Fortran &amp; Başlangıç &amp; 0-1 Yıl \\ C++ &amp; Başlangıç &amp; 0-1 Yıl \\ Ansys &amp; Başlangıç &amp; 0-1 Yıl \\ Miktex &amp; Başlangıç &amp; 0-1 Yıl \\ \\hline \\multicolumn{3}{l}{Bilgisayar Destekli Tasarım} % donann ofis koyu yazmak istedim yapamadım. \\ SolidWorks &amp; Orta &amp; 2-3 Yıl \\ AutoCAD &amp; Orta &amp; 0-1 Yıl \\ \\end{tabular} \\end{center} \\begin{figure} \\includegraphics[width=\\linewidth]{2.pdf} \\end{figure} \\begin{figure} \\includegraphics[scale=1]{2.pdf} \\end{figure} \\end{document} Latex SS is here: PDF SS is here:", "From a technical perspective, what exactly is RAW and how does it differ from JPG or bitmap images? I'm not asking about the pros/cons versus another format, but rather what constitutes RAW format, how is the data stored, how does it differ from JPG (other than lack of compression), and how is it different than bitmap?", "What does \\s! do?", "Standard error of regression coefficient without raw data", "How can I monitor my Samba traffic?", "Let $(A,+,\\cdot)$ be a unity ring with the property that if $x \\in A$ and $x^2=0$ then $x=0$. Consider the set $M=\\{a\\in A | a^3=a\\}$. Prove that: a) $2a\\in Z(A)$, $\\forall a\\in M$, where $Z(A)$ denotes the centre of the ring $A$; b) $ab=ba$, $\\forall a,b\\in M$. My attempts revolved around the fact that an idempotent element in a reduced ring is central. So, since for $a\\in M$ we have that $(a^2)^2=a^2$, it follows that $a^2\\in Z(A)$, $\\forall a\\in M$. The next thing I wanted to use in order to solve a) was that $Z(A)$ is a subring of $A$, so if I had proved that $(a+1)^2 \\in Z(A)$, $\\forall a\\in M$, then we would have reached the desired conclusion. However, I couldn't prove this and I honestly doubt that it is true. Another idea that I had was to prove that $M$ is a subring of $A$. Of course, this didn't work out because I cannot even prove that $M$ is closed under addition. Again, I don't know if this is true and it most likely isn't. As for b), I think that a) should be of use, but I don't know how. It is a well-known problem that a ring with $x^3=x$ for any $x$ in that ring is commutative, but since $(M,+,\\cdot)$ is almost definitely not a ring, this doesn't help. EDIT: Is there any chance that this question is simply wrong? I tended to believe this before asking it here too, but since nobody has made any progress on it until now I am even more inclined to think so.", "Here is the proof I tried to weave while trying to prove this theorem: Theorem. Every infinite subset of a countable set is countable. Proof. Let $A$ be a countable set and $E\\subset A$ be infinite. Then $A\\thicksim\\mathbb{N}$. This implies that there is a sequence $\\left\\{x_{n}\\right\\}_{n\\in\\mathbb{N}}$ where $x_{n}\\in A$. Construct a sequence $\\left\\{n_{k}\\right\\}_{k\\in\\mathbb{N}}$ where $x_{n_{k}}\\in A$, $n_{1}$ is the smallest positive integer such that $x_{n_{1}}\\in A$, and $n_{k+1}&gt;n_{k}$. Then $$ E=\\bigcup_{k=1}^{\\infty}x_{n_{k}}, $$ and $E$ is countable, because $E\\thicksim\\mathbb{N}$. $\\blacksquare$ Is it convincing?", "Keyboard shortcuts for chat Yes, I know there's a script for that. But I think it's useful enough to be inserted into the live chat for everyone. The following keyboard shortcuts are incredibly useful: CTRLUp and CTRLDown - For replying to messages (each Ctrl+Arrow should change the :[message ID] in the chat input. CTRLSpace - For retrying a failed message, or ESC to cancel it. There should also be a keyboard shortcut to edit a failed message as per the newest functionality (Maybe the Down key?) Using a chat with only the keyboard is very useful, it will be especially appreciated on chats with a more technical nature.", "Creating a .desktop file for a new application I just installed the lastest version of . I works fine but in order to use it, I have to enter the following in the terminal: cd ugene-1.11.5/ then execute ./ugene -ui to launch UGENE GUI. This takes too long. I would like to build a .desktop file for UGENE to be used in Ubuntu 12.04 so that I can simply open it from the unity launcher. Not sure if this is helpful but the website says: By default ugene script launches the command-line version of UGENE. Here's what I have (not sure if it's right): [Desktop Entry] Version=1.0 Name=my Unipro UGENE GenericName=Integrated Bioinformatics Suite Comment=Unipro UGENE is a cross-platform visual environment for DNA and protein sequence analysis. MimeType=text/english;text/plain;text/x-makefile;text/x-c++hdr;text/x-c++src;text/x-chdr;text/x-csrc;text/x-java;text/x-moc;text/x-pascal;text/x-tcl;text/x-tex;application/x-shellscript;text/x-c;text/x-c++; Exec=/home/samuel/ugene-1.11.5 ./ugene -ui -c %F Icon=/usr/share/icons/hicolor/scalable/apps/ugene.svg Type=Application Terminal=true Categories=Utility;Development; StartupWMClass=UGENE I added the launcher named my Unipro UGENE to my unity bar and tried opening it but it doesn't appear. I must be missing something. I don't know what the StartWMCClass field is suppose to be nor do I know whether I entered the correct MimeType.", "Pretty printing XML with javascript", "TimeSpan to String causing an error", "Which pronoun to refer to \"person\"? It? He or She? They? \"When he found his seat on the plane, Sam recognized the person who was sitting in the seat next to his. It? She? was a woman he knew.\" Which is more common/natural? Isn't 'it' more correct – grammatically speaking – than 'she', since 'a person' can be a 'he' or a 'she', and obviously you cannot use the singular 'they' here?", "If I need to use Blender within a colour-accurate workflow, what do I have to do to set that up (including hardware calibration, etc)?", "From the Windows NT-based (Windows XP and 7 specifically) command prompt, how can I get the serial number of a hard drive as a variable? The one I'm looking at is the serial number of the physical hard disk drive" ]

[ "Power Supply Capacity Formula", "How do I run .sh scripts? Whenever I open a .sh file, it opens it in gedit instead of the terminal. I can't find any option similar to Right Click → Open With → Other Application... → Terminal. How do I open this file in the terminal?", "Let $A = \\mathbb{Z}$, $B = [−1, \\pi]$, $C = (2, 7)$. List all elements of $A \\cap (B^c \\cap C)$. After working it out on a number line, I got: $\\{4, 5, 6\\}$. As it stands, the expression contains the integers that do not belong to the set $B$ that cross into $C$. This would result in $4, 5, 6$. Number $7$ would not be included because of the soft brackets surrounding $C = (2, 7)$. Is this correct?", "Presently, how much information can a quantum computer store, in how many qubits? What restrictions are there and how does it vary across realizations (efficiency of data storage, ease of reading and writing, etc)?", "Auto-sort column Google Spreadsheet on incoming Google Form response How can I get the Google Spreadsheet to automatically order the incoming form responses alphabetically (2nd column)? I know how to do this manually or by going in and editing a cell, but cannot get it to do this as an onevent for incoming response.", "Why $¬¬\\bot \\not\\in PROP$? I'm reading Dalen's Logic and Structure. He gives the definition of the set $PROP$: Definition $\\bf2.1.2$ The set $PROP$ of propositions is the smallest set $X$ with the properties $\\begin{array}{rl} \\rm(i)&amp;p_i\\in X(i\\in N),\\bot\\in X,\\\\ \\rm(ii)&amp;\\varphi,\\psi\\in X\\Rightarrow(\\varphi\\wedge\\psi),(\\varphi\\vee\\psi),(\\varphi\\to\\psi),(\\varphi\\leftrightarrow\\psi)\\in X,\\\\ \\rm(iii)&amp;\\varphi\\in X\\Rightarrow(\\neg\\varphi)\\in X.\\\\ \\end{array}$ Then there are some examples: And he says that $¬¬\\bot \\not\\in PROP$, but I don't understand it. Isn't $¬¬ \\bot=\\bot$ due to the property of double negation? Considering this is true, $\\bot\\in PROP$. Of course, in this question, I'm pressuposing some kind of evaluation, that $¬¬ \\bot$ becomes $\\bot$ due to the law of the double negation, but perhaps it should be hold in an unevaluated form. Ex:. $1+1=2$ because we presupose the $1$ merges with $1$ and then becomes two. If the merge (evaluation) does not happen, then I guess: $$1+1=1+1$$ $$2=2$$ $$2\\neq 1+1$$ $$1+1\\neq 2$$ Perhaps it's something like that, I took the idea from Mathematica. Sometimes it does treats things as different in the absence of full evaluation.", "What is a word/idiom for 'unable to decide'? Let's say I have an important decision to make and I can't decide between two competing things (like break up with a girl or not break up with her). What would be a word/idiom to express that?", "What is an English adjective that means \"able to learn new things quickly\"?", "I want to install the latest Firefox on my Ubuntu (64bit) box. What is the best way to do this? Is there a specific update site or should I download the binaries manually? If doing manually, in which directory should I put the files? In my home directory, or is there a better place?", "How can I display keyboard shortcuts as I press them?", "Regarding the `book`, `report`, and `article` document classes: what are the main differences?", "$\\lim_{x \\rightarrow 0} f'(x) = L$ exists, does it follow that $f'(0)$ exists?", "Let $F$ be a field. $(x-c)|(p(x)-p(c))$. So if $x-c|p(x)=q(x)-\\frac{r}{x-c}$ so for $x-c|p(x)-p(c)=s(x-c)-\\frac{r}{x-c}$. Is that correct? Or is there a different way to go about proving this? I have proved that $x-c|p(x)$ has a remainder of $p(c)$ so It wuld make sense that $p(x)-p(c)$ would be $x-c$.", "I unlocked the 'Files' button/icon from my unity launcher and now it disappearead and I cannot restore it or get it back I unlocked the 'Files' button for the Ubuntu file manager from the unity launcher and I cannot get it back. When I run the file manager from the dash, the icon does not appear on the launcher like it does for all other applications while they are running. I wanted to have an empty launcher when no applications are running, and just have the icons of those I am actively using there. Any idea why I don't see it in the launcher when its running or how to lock it back?", "What resolution should a large format artwork for print be?", "Finding critical points (extrema) directly without using eigenvalues If we have a function $f: \\mathbb R^3\\rightarrow \\mathbb R$ of the form: $$f(x)=(a_1x_1^2+a_2x_2^2+a_3x_3^2)e^{-x_1^2-x_2^2-x_3^2}$$ where $a_1&gt;a_2&gt;a_3&gt;0$. We can find the critical points by: $$\\frac{\\partial f}{\\partial x_1} =2x_1e^{-x_1^2-x_2^2-x_3^2}(a_1-a_1x_1^2-a_2x_2^2-a_3x_3^2)=0$$ And solving symmetrically for $x_2$ and $x_3$. We get critical points: $(0,0,0) , (\\pm 1,0,0) , (0,\\pm 1, 0) , (0,0,\\pm 1)$ We could determine the nature of them by looking at the eigenvalues of the Hessian, but is there a way to just analyse it directly? Obviously $(0,0,0)$ is a strict global minimum, but I can't quite see that the other points are. Any pointers/hints would be appreciated.", "Is Iron Man stronger than the Hulk? In Avengers: Endgame, when Hulk initially uses the new Infinity Gauntlet, it takes a tremendous effort from him (in addition to almost burning his entire arm), in order to snap his fingers and restore the world as we knew it. Yet at the end of the movie, when Iron Man uses the Gauntlet, it seems very easy for him to snap his fingers. How was Tony able to wield the stones with such ease when Hulk was clearly struggling with it?", "I process all my photos to black and white. Although I use a polariser where possible, I often find myself wanting to drop the luminance of the sky further which I do using a Black and White adjustment layer (in Photoshop). This usually results in a lighter halo following the line of the horizon, where the blues of the sky meet whatever the colour of the land is. My current solution to this problem is to run a brush along this margin with a colour set to the same as the sky and the blend-mode set to Darken. This effectively paints in the lighter band with the sky colour while not laying down the colour on top of the darker horizon. Whilst this is effective, it is very time consuming. Is there a better approach to dealing with these halos? Here is a video that illustrated the Darken solution that I mention:", "How can I show that if the second fundamental form of a surface is identically equal to zero, then the surface is a plane? This is my question: Let P be a plane considered as a surface in 3-space. Show that its second fundamental form is zero. Conversely, show that if the second fundamental form of a surface is identically zero then the surface is a plane. So far I have that the general equation of the plane is $$ax+by+cz+d=0.$$ Then $$M(u,v)=(u,v,\\alpha u + \\beta v + \\gamma),$$ where $a,b,c,d,\\alpha,\\beta, \\gamma$ are all constants and $c\\not=0$. Then $M_u=(1,0,\\alpha)$ and $M_v=(0,1,\\beta)$. I know that $\\vec{n} =\\frac{M_u \\times M_v}{|M_u \\times M_v|}$ which gives $$ \\vec{n}=\\frac{(-\\alpha,-\\beta, 1)}{\\sqrt{\\alpha^2+\\beta^2+1}}.$$ Hence, the unit norm is a constant. $$ M_{uu}=M_{uv}=M_{vv}=0$$ Hence $l=m=n=0$, so the second fundamental form is $$ ldu^2+mdudv+ndv^2=0.$$ Now I need to show the converse, but I don't know how. Please help :)", "After upgrading to Firefox 57 Quantum many website have rendering issues, such as empty frames, missing text or fonts, etc. I use Kubuntu 16.04 64 bit. So far, I've tried: Restarting Firefox in safe mode Disabling \"hardware acceleration\" Wiping out my profile Purging Firefox and reinstalling Running Firefox from a clean user account But nothing helped so far. Any tips on how to solve this are much appreciated" ]

[ "NetGear A6100 AC600 wireless adapter not working in Ubuntu 20.04. Worked fine in 18.04. Not same problem as previously Firstly, I know very well there are answers to this already. But, in my case, it is installed and shows in the terminal as such Bus 001 Device 007: ID 0846:9052 NetGear, Inc. A6100 AC600 DB Wireless Adapter [Realtek RTL8811AU] It says it is installed in as well. I have tried downloading the driver for this adapter from several guides online, linking to GitHub, but no luck there either... Any help is greatly appreciated! Thanks in advance! EDIT: The answer from sudo dkms status command reads: rtl8812au, 4.3.8.12175.20140902+dfsg, 5.4.0-31-generic, x86_64: installed The other command modinfo 8812au | grep 9052 spits out the following: alias: usb:v0846p9052d*dc*dsc*dp*ic*isc*ip*in*", "Removing all \\n\\r characters from a node XSLT? wondered if you could help me please? I have node in xml that is as followed $LOG: 08880xbpnd $ fhdsafidsfsd df sd fsd f sd fsd I was wondering is there anyway to make all the text go on to one line so that it then can be passsed through to a javascript function? so it would turn out like this $LOG: 08880xbpnd $fhdsafidsfsddfsdfsdfsdfsd", "Demonstrate that if $f$ is surjective then $X = f(f^{-1}(X))$ I haven't been able to do this exercise: Let $f: A \\rightarrow B$ be any function. $f^{-1}(X)$ is the inverse image of $X$. Demonstrate that if $f$ is surjective then $X = f(f^{-1}(X))$ where $X \\subseteq B$. Since $X \\subseteq B$, all the elements in $X$ belong to the codomain of $f$. Since $f$ is surjective, it means that all elements in the codomain $B$ have some preimage in $A$. Given that $X \\subseteq B$, all elements in $X$ must also have a preimage in $A$. Have $\\triangle = f^{-1}(X)$, $\\triangle$ is now a set containing the preimages of the elements in $X$. Because of this, $\\triangle \\subseteq A$. If we evaluate $f(\\triangle)$, we...... nope, I don't know what I'm doing now. What do you think?", "Is it worth self-funding a PhD to attend a top 10 university? What should I opt for? Option A) very well paid PhD, around €3000 per month at a respectable university or; Option B) a non-paid PhD, where I have to pay €2000 per year at one of the top 10 universities of the world? EDIT: Actually they are both UK universities, Option B is ranked between the top 10 in the world in engineering and tech, and I do get a scholarship that pays 18000 pounds which covers the difference between international student tuition and EU tuition. In Option A, I will be doing research in a good university and will be working alongside giants in the industry.", "I would like to see an explicit example of a non-trivial elementary extension of the structure $(\\mathbb{N}, +, \\cdot, 0, 1)$ where $\\mathbb{N}$ includes zero. Most of all I am interested in countable ones.", "UITextField - capture return button event", "Can I programmatically open the devtools from a Google Chrome extension?", "Who killed Ra's Al Ghul first, Batman or Arrow?", "I am trying to write a script that will delete all comments and everything in between inside C files in my current directory. I've been using sed, and this is what I have so far: sed -i '/ * [^()] */d' *.c This works when the comments are on the same line as an asterisk or backslash. However it doesn't work when there is a commented line without a slash or asterisk. I know sed goes line by line, I just don't know how to tell it to keep deleting until it sees a */.", "\"EOL while scanning single-quoted string\"? (backslash in string) import os xp1 = \"\\Documents and Settings\\\" xp2 = os.getenv(\"USERNAME\") print xp1+xp2 Gives me error File \"1.py\", line 2 xp1 = \"\\Documents and Settings\\\" ^ SyntaxError: EOL while scannning single-quoted string Can you help me please, do you see the problem?", "On the uniqueness of the Riemann-Christoffel tensor According to Section 6.2, Gravitation and Cosmology by Weinberg, the Riemann-Christoffel tensor is the only tensor that can be constructed out of the second (or lower) order derivatives of the metric tensor and is linear in the second order derivatives. The reasoning behind the same goes like this: In a class of frames where $\\Gamma^{\\lambda}_{\\mu\\nu} =0$, the transformation rule for $\\dfrac{\\partial \\Gamma^{\\lambda}_{\\mu\\nu}}{\\partial x^{\\kappa}}$ involves an inhomogeneous term which is symmetric in $\\mu$, $\\nu$, and $\\kappa$. Thus, if one is to construct a tensor which is a linear combination of the first order derivatives of the Christoffel symbol then the only way to do so is by eliminating the inhomogeneous part of the transformation and this could be done only by making the combination explicitly antisymmetric in $\\mu$ and $\\kappa$. Since in these frames, $R^{\\lambda}_{\\mu\\nu\\rho}$ $ = \\dfrac{\\partial \\Gamma^{\\lambda}_{\\mu\\nu}}{\\partial x^{\\rho}} - \\dfrac{\\partial \\Gamma^{\\lambda}_{\\mu\\rho}}{\\partial x^{\\kappa}} $, $R^{\\lambda}_{\\mu\\nu\\rho}$ is the only tensor that can be formulated using the second (or lower) order derivatives of the metric tensor and is linear in the second order derivatives. I think the presented argument can only suffice to prove that $R^{\\lambda}_{\\mu\\nu\\rho}$ is the only tensor that can be formulated from the first derivatives of the Christoffel symbol and is linear in them. I can't figure out why this suffices to assert that $R^{\\lambda}_{\\mu\\nu\\rho}$ is the only tensor that can be constructed out of the second (or lower) order derivatives of the metric tensor and is linear in the second order derivatives. Edit: As the metric is covariantly constant, $\\dfrac{\\partial g_{{\\mu}{\\nu}}}{\\partial x^{\\rho}} = \\Gamma^{\\kappa}_{{\\mu}{\\rho}}g_{{\\kappa}{\\nu}}+\\Gamma^{\\kappa}_{{\\nu}{\\rho}}g_{{\\kappa}{\\mu}}$. Therefore, $\\dfrac{\\partial^2 g_{{\\mu}{\\nu}}}{\\partial x^{\\xi}\\partial x^{\\rho}} = \\bigg(\\dfrac{\\partial \\Gamma^{\\sigma}_{{\\mu}{\\rho}}}{\\partial x^{\\xi}} + \\Gamma^{\\sigma_1}_{{\\mu}{\\rho}}\\Gamma^{\\sigma}_{{\\sigma_1}{\\xi}}\\bigg)g_{{\\sigma}{\\nu}}+\\bigg(\\dfrac{\\partial \\Gamma^{\\sigma}_{{\\nu}{\\rho}}}{\\partial x^{\\xi}} + \\Gamma^{\\sigma_1}_{{\\nu}{\\rho}}\\Gamma^{\\sigma}_{{\\sigma_1}{\\xi}}\\bigg)g_{{\\sigma}{\\mu}} + \\bigg(\\Gamma^{\\sigma}_{{\\mu}{\\rho}}\\Gamma^{\\sigma_1}_{{\\nu}{\\xi}}+\\Gamma^{\\sigma}_{{\\nu}{\\rho}}\\Gamma^{\\sigma_1}_{{\\mu}{\\xi}}\\bigg)g_{{\\sigma}{\\sigma_1}} $ Now, if I want to show that the Riemann-Christoffel tensor is the only (non-trivial and independent) tensor that can be formulated out of the linear combinations of the second order derivatives of the metric tensor then I can equivalently show that the above expansion can be expressed linearly in terms of the Riemann-Christoffel tensor. But I am stuck over how to do it. Also, I am a little bit unclear as to what a linear combination means in this context. The coefficient of the second order term can be only a scalar constant or can it be the metric or can it be the metric that is getting summed over any of the indices as well?", "Do you really answer \"How do you do?\" with \"How do you do?\"", "Most common method for deciding when to stop training a neural net on a batch I have created my own neural net which is using batch gradient descent. In other words, it trains on batches of examples all at once. My issue is trying to figure out when to stop the training of the batch. I'll try to make things as understandable as possible since there are so many options, but please comment if you need clarification. Each batch allows me to compute a list of output errors that correspond to the error the computer has on each example. Each error is a vector with elements equal to the number of output neurons. Let each error vector be notated by e1, e2, e3, ... so the list of output errors is [e1, e2, ...]. Let an error vector in general be notated by e. Now there are 2 things we can do to a vector or a list: Average: average all of the elements in a vector or list. This will be notated by the function a(). For example to find the average error of an example we would do a(e) Check: make sure that each element in the vector or list is below a certain value. If any of the elements are too high, we continue to train on the entire batch. (This function can also be applied to a single value.) This will be notated by the function c(). For example, if we wanted to make sure the average error in e was low enough, we would do c(a(e)) Sum: add up all of the elements in the vector or list. This will be notated by the function s(). For example, s(e) would be totaling the error found in error vector e. Here are the methods I have determined for deciding when to stop gradient descent: Iterative: just run the training a certain number of times Average of averages: Find the average error of each example, then find the average of those and make sure it's below a certain amount. This is given by the formula c(a([a(e1), a(e2), ...])) Specific error: Check to make sure the error in each output neuron is below a certain amount. This is given by the formula c(e1), c(e2), ... Specific averages: Check to make sure the average error in each example is below a certain amount. This is given by the formula c([a(e1), a(e2), ...]) Sum of sums: Total up all the error in the entire batch and then make sure it's low enough. This is given by the formula c(s([s(e1), s(e2), ...]) Sum of averages: Find the average error of each example, then add up all those and make sure it's below a certain amount. This is given by the formula c(s([a(e1), a(e2), ...])) Average of sums: Compute the average total error in each example, and then make sure it's below a certain amount. This is given by the formula c(a([s(e1), s(e2), ...])) Specific sums: Check to make sure the total of the error in each example is below a certain amount. This is given by the formula c([s(e1), s(e2), ...]) So my question is this: Which one of these options is most commonly used when training neural nets? Why? (Is there another option that I've missed?) (Edit: I have found a very general version of this question , where the answers seem to say there is no specifically good way. If that is still true, please say so in your answer. Note that this is not a duplicate, as I explain the specific methods I would like to use.) Edit: as A.D pointed out, summing is pretty useless because it depends on how many values are in each list/array/batch. And if you know how many examples there are, you can just use averaging. So, the methods involving \"summing\" have been cut.", "Must an uncountable subset of R have uncountably many accumulation points?", "If temperature makes particles vibrate faster, and movement is limited by the speed of light, then I would assume that temperature must be limited as well. Why is there no limit?", "Upon trying to upgrade from 10.10 to 11.04 all seemed to go well until the restart. This error message is what comes up: Kernel Panic - not syncing: VFS: Unable to mount root fs on unknown-block(0,0) How do we fix that?", "I have researched and found out long time no see is a direct translate from the Chinese phrase, 好久不见. As much as we use it almost everyday in our lives, is it actually grammatically correct? Since it is a direct translate, is it grammatically approved?", "register_globals error in php I was stuck up with the error directive 'register_globals' is no longer available in PHP in unknown on line 0 when tried to check the php version using \"php -v\" after enabling register_globals in php.ini file. I am not getting any php version info by doing so. Instead it throws the above mentioned error.After turning off this option, php info works quite well. It is very essential for me to have register_globals to be turned on.How can I have this corrected. my php.ini is as follows: ; Default Value: None ; Development Value: \"GP\" ; Production Value: \"GP\" ; http://php.net/request-order request_order = \"GP\" ; Whether or not to register the EGPCS variables as global variables. You may ; want to turn this off if you don't want to clutter your scripts' global scope ; with user data. ; You should do your best to write your scripts so that they do not require ; register_globals to be on; Using form variables as globals can easily lead ; to possible security problems, if the code is not very well thought of. ; register_globals = On ; Determines whether the deprecated long $HTTP_*_VARS type predefined variables ; are registered by PHP or not. As they are deprecated, we obviously don't ; recommend you use them. They are on by default for compatibility reasons but ; they are not recommended on production servers. ; Default Value: On ; Development Value: Off ; Production Value: Off ; register_long_arrays = Off ; This directive determines whether PHP registers $argv &amp; $argc each time it ; runs. $argv contains an array of all the arguments passed to PHP when a script ; is invoked. $argc contains an integer representing the number of arguments ; that were passed when the script was invoked. These arrays are extremely ; useful when running scripts from the command line. When this directive is ; enabled, registering these variables consumes CPU cycles and memory each time ; a script is executed. For performance reasons, this feature should be disabled ; on production servers. ; Note: This directive is hardcoded to On for the CLI SAPI ; Default Value: On ; Development Value: Off ; Production Value: Off ; register_argc_argv = Off ; When enabled, the SERVER and ENV variables are created when they're first ; used (Just In Time) instead of when the script starts. If these variables ; are not used within a script, having this directive on will result in a ; performance gain. The PHP directives register_globals, register_long_arrays, ; and register_argc_argv must be disabled for this directive to have any affect. ; auto_globals_jit = On", "Testing for linear dependence among the columns of a matrix I have a correlation matrix of security returns whose determinant is zero. (This is a bit surprising since the sample correlation matrix and the corresponding covariance matrix should theoretically be positive definite.) My hypothesis is that at least one security is linearly dependent on other securities. Is there a function in R that sequentially tests each column a matrix for linear dependence? For example, one approach would be to build up a correlation matrix one security at a time and calculate the determinant at each step. When the determinant = 0 then stop as you have identified the security who is a linear combination of other securities. Any other techniques to identify linear dependence in such a matrix are appreciated.", "How to prove that there are finitely many $n$ such that $f(1+1/n) = \\frac{1}{n+1}$? Let $f : \\mathbb{C} \\to \\mathbb{C}$ be analytical. How does one prove that there are finitely many positive $n$ such that $f(1+1/n) = \\frac{1}{n+1}$ ? A hint is given: think of the expression $\\frac{z-1}{z}$. I think this is a pretty hard homework assignment. Here's what I tried so far: Let $g(z) = \\frac{z-1}{z} $ . Then $g(1 + 1/n) = \\frac{1 + 1/n - 1}{ 1 + 1/n} = \\frac{1/n}{1+1/n} = \\frac{1}{n+1} $. So the given hint is probably indeed useful, but I'm not sure yet how. Another thing I tried to use to obtain the solution was the given fact that $f$ is analytical. Let $f = g$. Then $f(z) = f(x+iy) = \\frac{ x + iy - 1}{x+iy} = \\frac{x+iy-1}{x+iy} \\cdot \\frac{x-iy}{x-iy} = \\frac{x^2 - 2 i x y + y^2 + iy}{x^2 + y^2} = 1 + i \\frac{y(1-2x)}{x^2 + y^2} $ . Now I have written $f$ in the form $ f = u + i v$, with $u,v$ being real-valued functions. So now we can use the Cauchy-Riemann Integral formulas: $ \\frac{d}{dx} 1 = 0 = \\frac{d}{dy} \\frac{ y(1-2x) }{x^2+y^2} \\implies \\frac{y(1-2x)}{x^2+y^2} = c $. The other formula yields a similar result. But now what? I still have no idea how to prove that there are finitely many positive $n$ such that the aforementioned equality holds. Should I use any of the results I already obtained? If so, how? If not, do you know how to prove this?" ]

[ "If $$Y=\\sum_{i=1}^{N}X_i^2$$ where $X_i \\sim \\mathcal{N}(0,\\sigma^2)$, i.e. all $X_i$ are i.i.d. normal random variables of zero mean with same variances, then $$Y \\sim \\Gamma\\left(\\frac{N}{2},2\\sigma^2\\right).$$ I know the chi-squared distribution is a special case of the gamma distribution, but could not derive the chi-squared distribution for random variable $Y$. Any help, please?", "Eliminating non-integer solutions to $ab / (2\\sqrt{ab} + a + b)$", "How do I find out which DOM element has the focus?", "When quoting something said by someone else, should I use a comma before the quote? Suppose I quote the definition given in a dictionary. Am I correctly using the the punctuation marks in the following sentences? (I am using them in the way I think correct in American English.) One of the meanings of cat is, \"a small animal with soft fur that people often keep as a pet.\" A cadet is, \"a young person who is training to become an officer in the police or armed forces.\" Should I use a comma only when I explicitly quote somebody? Groucho Marx once said, \"Although it is generally known, I think it's about time to announce that I was born at a very early age.\" Should I use a comma in this case too? As Groucho Marx said, No one is completely unhappy at the failure of his best friend. On Comma Sense, A fun-damental guide to punctuation (Richard Lederer and John Shore), I read the following about using the comma: Use commas to set off complete quotations: The great general George S. Patton once said, \"No, no—the war is this way, you idiots!\"", "Beamer: bold math no longer working", "How to automatically create large number of columns in Excel 2013 I would like to start a new excel spreadsheet, create a column named Column1, and quickly fill in increments, (Column2, Column3 etc) up to Column500. Is there an easy way to do this? Also is there an easy way to afterwards select all 500 columns and add 10 rows of data to all of them?", "I havent used my Ubuntu for quite a long time. Today, when I booted Ubuntu (14.04 LTS), the software updater and Software &amp; Updates (from Settings) are not working. The software updater's window will show up for around 1 sec, but it will close automatically. Software &amp; Updates is never shown, no matter how many times I click the icon. Note that neither of them show any error message. Those 2 features were working perfectly the last time I used Ubuntu. I want to do some system upgrade and update. For now, I use sudo apt-get update &amp;&amp; sudo apt-get upgrade. This command runs very fast, meaning (I think) my Ubuntu is not updated properly. The update from software updater always has a big size hence the download should be slower. What should I do? Can I just uninstall and reinstall both of them? If I can, how to do it? Just to clarify, I don't want to upgrade my Ubuntu version (I want the LTS one), I just want to upgrade the software/packages I used. Thanks for your time.", "Documents required by Indian citizens wishing to travel to Nepal I'm a citizen of India and I'm travelling to Nepal by air. Is an Aadhaar Card a valid document used for travelling to Nepal by air?", "Does photon have size measurement because of its particle nature Does photon have size measurement because of its particle nature like electron's 3.86*10^-13m etc..", "Long, blurry reflections in wet road", "My processor is 64-bit - does that mean I need the amd64 image?", "How to reset KDE desktop to default on Ubuntu 14.04? KDE and Gnome Desktops were looking awesome on my Ubuntu 14.04 LTS, today everything seemed ugly. Slim long font, arabic letters in Chromium/Firefox are barely readable no matter how big I made them on system font settings. How can I get back to my previous looks settings, without compromising other settings and tweaks? Here are my versions: kde4-config -v: Qt: 4.8.6 KDE Development Platform: 4.13.3 kde4-config: 1.0 kded4 --version: Qt: 4.8.6 KDE Development Platform: 4.13.3 KDE Daemon: 4.13.3", "I used to edit the startup script for the GDM (/etc/gdm/Init/Default) to permanently change my display resolution. How can I do this with LigthDM in Ubuntu Oneiric?", "Why is CDC capture failing due to a missing dbo principal", "Can I SSH into a specific directory? I SSH into a multitude of different servers every day and some of them have different filesystem structures for their websites. Each time I change server, I have to work out where I'm going to get to the files I really want (because it's very rarely that I want to be in ~). I use Fabric files to automate all my actions (pushing to git, automated SSH to the server to pull from git, restarting the web application, changing dependencies, etc), so I was wondering if I couldn't also tell it that I want to SSH into the right directory so I can run fab ssh and be in a normal SSH session, just in the right place and start working immediately. This is not about Fabric though; please ignore it. Fabric is just running a batch of commands. My argument is with the ssh command. That's what I'll be telling Fabric to run. So how I can get ssh to cd into a specific directory on login? Note: this cannot be a server or user-wide thing. I have multiple websites under one user on some servers so sticking something in ~/.bashrc would not work for me.", "How to handle dynamic changing ID's In XPath? How to Handle Dynamic Changing IDs In XPath? for example : //div[@id='post-body-3647323225296998740']/div[1]/form[1]/input[1] In this xpath id \"3647323225296998740\" is changing every time when reloading the page. Is there any way to handle this type of situation in Selenium?", "How do I fix a \"Problem with MergeList\" or \"status file could not be parsed\" error when trying to do an update?", "Using the itemize environment inside a caption The following code does not compile. However, if I remove the itemize environment it does. I googled for this problem, and found suggestions that using the caption package would solve the problem, though I did not find any clear description of why the problem occurred in the first place. See for example I'm using Debian squeeze with TeX Live 2009-11. The included version of caption has \\ProvidesPackage{caption}[2009/10/09 v3.1k Customizing captions (AR)] I also tried downloading and using the caption package from but this doesn't change anything. I put the sty files in my current directory. I assume that overrides the system files. This one corresponds to \\ProvidesPackage{caption}[2010/01/09 v3.1m Customizing captions (AR)] Error message and example file follow. ******************************************* ERROR: Argument of \\@caption has an extra }. --- TeX said --- &lt;inserted text&gt; \\par l.13 } --- HELP --- From the .log file... I've run across a `}' that doesn't seem to match anything. For example, `\\def\\a#1{...}' and `\\a}' would produce this error. If you simply proceed now, the `\\par' that I've just inserted will cause me to report a runaway argument that might be the root of the problem. But if your `}' was spurious, just type `2' and it will go away. ****************************************************** \\documentclass{article} \\usepackage{caption} \\begin{document} \\begin{figure} \\captionsetup{singlelinecheck=off} \\caption { foo \\begin{itemize} \\item bar \\end{itemize} } \\end{figure} \\end{document}", "How do I identify SMD components? (or how do I identify any component) How do I identify the markings on an SMT component and match it up with a part number so I can be a good designer and actually look at a datasheet (and read the whole thing)? Or identify a part to replace an unknown part on a PCB?", "How old should you be when you begin Jedi training?" ]

[ "Update help center on syntax highlighting to point to an actual list of options Reading the help center article on syntax highlighting, one of the paragraphs within it reads: You can use either , like lang-cpp or lang-sql, or you can specify a tag, and the syntax highlighting language associated with this tag will be used: Note the link in there, which goes to . Problem is, a long time ago we removed the list of options from several questions/answers across meta Stack Exchange because it was a pain trying to keep all of them updated. It makes a lot more sense to just have one list that we keep updated, and the most logical place for that list was in the , which is where it now resides. Can the link in the help center be updated to point directly to the list, rather than to a post that explains that the list has been moved?", "Algebraic proof of $\\sum_{i=0}^k{{n \\choose i}{m \\choose {k-i}}}= {{m+n}\\choose k}$ I can't figure out an algebraic proof for the following identity: $$\\sum_{i=0}^k{{n \\choose i}{m \\choose {k-i}}}= {{m+n}\\choose k}$$ Combinatorical solution: We can see that as choosing some from $n$ and the rest of $k$ from $m$, thus $k$ in total. Or we could just choose $k$ from the union.", "I've tried to setup an autologin, but that isn't possible, because my home is encrypted. What are the reasons for this? PS. Here I have described my problem: .", "How do I easily rename multiple files using command line?", "What is the difference between # and . when declaring a set of styles for an element and what are the semantics that come into play when deciding which one to use?", "It has been a long time since I have used calculus, and I am trying to understand how the mean and variance of the Laplace distribution with pdf $$f(x|\\mu,\\sigma) = \\dfrac{1}{2 \\sigma}\\,e^{-\\Large\\frac{|x-\\mu |}\\sigma}$$ are derived. I know that E$[X] = \\mu$ and Var$[X] = 2\\sigma^2$, but I don't understand how that happens. Many thanks.", "Lightning force:createRecord capture redirect after save Is there a way to use force:createRecord but capture the redirect to the newly created record page that occurs after saving the record? Finally, prevent the redirect from completing? createRecord : function (component) { var createRecordEvent = $A.get(\"e.force:createRecord\"); createRecordEvent.setParams({ \"entityApiName\": \"Event__c\" }); createRecordEvent.fire(); }", "Zorn's Lemma states that if every chain $C$ in a partially ordered set $X$ has an upper bound then there is at least one maximal element in $X$. Let $n\\in \\mathbb{N}$, $C_n \\subset \\mathbb{N}$ be the set containing the natural numbers $\\{1,\\dots,n\\}$. Then if $k\\le n$, $C_k\\subset C_n$, so $C_n$ is a chain. Also, $C_n$ has an upper bound, such as $n+1$. But what is the maximal element of $\\mathbb{N}$? There's something I don't get in Zorn's Lemma statement.", "Could someone please tell me what the symbol ringed in red represents? I know it has ON Switch pointing to it, but the symbol has other lables in different parts of the document.", "How many questions on meta have asked, \"Why can't I ask this question when that question is open\"?", "How can I model the mechanics of an army battlefield scene? TL;DR; I want to model a strategic battlefield fight for my players to command and participate. I'm seeking advice on how to model it mechanically so that it is exciting for the players. Background The final scene of Act II of my campaign is envisioned to be a big battle between the army of the Big Bad and the allied forces gathered by my players. The full set of Act II runs with the players gaining the allegiance of the different factions to support them on the fight. Now, in terms of that final scene, I'm struggling to decide how to DM the fight. In games and movies the action is made epic by having cinematic scenes of the fight happening with cuts to our heroes doing their amazing things, be it just plowing through dozens of enemies in quick succession or fighting the big ugly overpowered monster that is otherwise cause havoc among the army. I want that feeling The set up will involve an army of several thousand enemies agains the different forces gathered by my players. Depending on what they've done during the second act, they'll have more or less support with a minimum number of regiments belonging to several faction (i.e. the silver guard of Wizardwight). Intended way of DMing the scenario. What I've come up with is to have the players be military leaders. Draw the map of the battlefield and have them manage the battlefield strategically and tactically, distributing the units and, somehow, enabling a dice based mechanism to evaluate how well each unit is doing. This will transform the tabletop into something similar to Warhammer Fantasy. They can choose to join a particular place of the battlefield to help either together or separately. I have absolutely no idea on how to model this mechanically (as far as I know D&amp;D 5e does not cover this kind of fights). Question: What are good ways to mechanically model this kind of strategic army combat? Should I switch to a different system just for this scene or can I model this with D&amp;D 5e? Notes on level: At this point I expect my players to range between level 9-12 and for the party to be between 3 and 4 players (this is not a limitation of the campaign, more like the players I'm running the campaign with).", "$\\exp(A)$ is orthogonal iff $A$ is skew symmetric Let $A \\in M_n(\\mathbb R)$ and $\\exp(A)=\\sum_{i=0}^{\\infty}\\frac{A^i}{i!}$. How to prove $\\exp(A)$ is an orthogonal matrix iff $A^t=-A$? I can get that $\\exp(A)$ is an orthogonal matrix iff $\\exp(A^t)=\\exp(-A)$, but how to get $A^t=-A$ from it? What's more, is $\\exp(A)$ injective or not?", "Error installing any module", "Ubuntu gets stuck in a login loop My Ubuntu is stuck in a login loop when trying to enter my desktop. When I login, the screen gets black and soon after that the login screen comes back. I've read that the problem might be caused by an error depending on the graphics, here's my graphics card: ATI Radeon 7670M", "How do you post to an iframe? How do you post data to an iframe?", "Showing that the class of all sets of a particular cardinality is not a set. How to show that the class of all sets of a particular cardinality ,say $h$ is not a set. My argument: I assume that I've shown the following lemma. Lemma: If $X$ is an infinite set of cardinality $h$ , $a\\ne x$ for every $x\\in X$ then $\\{a\\}\\cup X$ is of cardinality $h$ too i.e. adding new element to an infinite set doesn't change cardinality. Let $h$ be an infinite cardinal number. Let $T_h=\\{x:\\text{x is a set of cardinality h}\\}$. Suppose $T_h$ is a set. Let $a$ be any set and consider any $t\\in T_h$. Let $R=t\\cup \\{a\\}$. Using the above lemma, $R\\in T_h$. So, $a\\in R\\subset \\bigcup T_h$. As $T_h$ is a set then $\\bigcup T_h$ is also a set. As $a$ was arbitrary set then we have, $a\\in\\bigcup T_h$ for every set $a$. Hence, the set $\\bigcup T_h$ contains all sets which meas that the collection of all sets is a set, contradiction. If $h$ is non-zero finite cardinal number. Define $T_h$ the same way as above. Let $a$ be any set, Let $A_1=a, A_{n+1}=A_n\\times a$. Consider $A=\\{A_1,A_2,...,A_h\\}$. So, $A\\in T_k$. Hence, $a=A_1\\in \\bigcup T_h=K$. So K is a set containing all sets $a$ since $a$ was arbitary,contradiction. My main question is, Is there any flaws in my argument? If yes, point it out please. If the argument is valid, Is there any standard proof to show the same fact?", "Apply the latest Service Pack and Cumulative Update", "What are the rules for China's visa-free transit programs? Assuming one wants to travel through China, what are the rules for visa-free access? To be more specific: How does the 24-hour visa free transit work? How does the 72-hour version work? What does a person ineligible for either of these programs have to do to transit China? Do the programs apply to flights only or do they also work for transit on land? Would a visitor save much hassle by using visa free transit instead of just getting a visa? NB: this is intended as a canonical question on transiting China", "Almost sure convergence of the Poisson process Let $N = \\{N(t) \\}_{t\\geq 0 }$ be a Poisson process. I already know that $N(t)- \\lambda t$ is a martingale where $\\mathbb{E} [ N(t) ] = \\lambda t$. I want to prove that $$ \\frac{N(t)}{t} \\rightarrow \\lambda, \\quad t \\rightarrow \\infty \\quad \\text{ a.s.}. $$ To prove this I received a hint that I should use the martingale law of large numbers which states that: Theorem: (Martingale LLN) Let $S= (S_n = \\sum_{k=1}^n X_k)_{n=1,2,\\ldots}$ be a martingale with respect to the filtration $(\\mathcal{F}_n)_{n=1,2,\\ldots}$. Then $\\sum_{k=1}^n X_k/k$ converges almost surely on the set $\\left\\{ \\sum_{k=1}^\\infty k^{-2} \\mathbb{E}\\left[ X_k^2 \\mid \\mathcal{F}_{k-1} \\right] &lt; \\infty \\right\\}$. Hence $S_n/n \\rightarrow 0$ a.s. on the same set. Now to use this theorem I think I need to use Doob-Meyer to decompose $N(t)$ as the sum of a martingale and an increasing process. Which would be the martingale $M(t) = N(t) - \\lambda t$ and increasing process $A(t) = \\lambda t$. But how is $M(t)$ the sum of a martingale? And I do not know how this exactly relates to the thing I have to prove. Thanks for any help.", "I want to center a div vertically with CSS. I don't want tables or JavaScript, but only pure CSS. I found some solutions, but all of them are missing Internet Explorer 6 support. &lt;body&gt; &lt;div&gt;Div to be aligned vertically&lt;/div&gt; &lt;/body&gt; How can I center a div vertically in all major browsers, including Internet Explorer 6?" ]

[ "Can anyone help me out with how to make Bing Picture to my Desktop Wallpaper? So it works by downloading the highest quality of todays picture. Then storing it ex in the Picture folder of your account. After that automatically changing the picture itself. It should continue the same everyday without hassle in the background. Probably something I have to add in the Startup Applications. Any differences between Ubuntu versions? -Do I have to write a script? This would be appreciated by many others too! Thank You in Advance :)", "How to use C++ 11 features in the latest version of g++ Newbie here. I just got an error running from the terminal a C++ program I wrote: error: ‘stoi’ is not a member of ‘std’. They told me the compiler is too old. I'm using Ubuntu 14.04. My g++ version is 4.8.4. How do I upgrade?", "Having line color vary with data index for line graph in matplotlib?", "Equality holds in triangle inequality iff both numbers are positive, both are negative or one is zero How do we show that equality holds in the triangle inequality $|a+b|=|a|+|b|$ iff both numbers are positive, both are negative or one is zero? I already showed that equality holds when one of the three conditions happens.", "The MathJax code in Mathematics Stack Exchange doesn't render after I updated to the new version (It used to): App Version: 1.6.2.5 Device: iPhone 6s OS Version: Version 9.0 (Build 13A342)", "How to turn hundreds of text URLs in Excel into clickable hyperlinks?", "Even though I have the latest Adobe Flash player 11.2 for Linux in Firefox - - a particular online flash game still requests that I update to the latest flash player. I've tried this online game on my laptop (Windows 8 with Flash Player 11.8) and it has no problems. Is there a way to trick Ubuntu or this game into thinking Flash Player 11.8 is \"installed\"?", "In the 70's I had a stack of old Amateur Radio magazines (50s-60s), and for a long time I saved an article about using the to combine a number of resistors to achieve a specific value. Does anyone recall and have a copy of this article, or know how the Euclidean algorithm is applied to solve this problem?", "Proof that every repeating decimal is rational", "Why do the Walking Dead Zombies only show intelligence in the very first episode? I enjoy The Walking Dead, however one question keeps nagging me. The 'Walkers' are always shown to not have any intelligence or memory of having been human. This is for all seasons except the very first one. In the very first scene of Season One, Episode One, we see a little zombie girl stop to deliberately pick up a teddy bear from the ground. Later in the same episode we see a zombie apparently try to turn the door knob to get into Morgen Jones' house. Also at Atlanta they can climb fences and used rocks to break glass. After season 1 I do not recall seeing any such intelligence demonstrated by a zombie again. My question is: are these initial displays of intelligence a discrepancy in the story, or is there a plausible explanation why the Walkers performed these actions?", "Distribution of sum of exponentials Let $X_1$ and $X_2$ be independent and identically distributed exponential random variables with rate $\\lambda$. Let $S_2 = X_1 + X_2$. Q: Show that $S_2$ has PDF $f_{S_2}(x) = \\lambda^2 x \\text{e}^{-\\lambda x},\\, x\\ge 0$. Note that if events occurred according to a Poisson Process (PP) with rate $\\lambda$, $S_2$ would represent the time of the 2nd event. Alternate approaches are appreciated. The approaches provided are commonly used when learning queueing theory &amp; stochastic processes. Recall the Exponential distribution is a special case of the Gamma distribution (with shape parameter $1$). I've learned there is a more general version of this that can be applied.", "What is \"preimage resistance\", and how can the lack thereof be exploited? How is this different from collision resistance, and are there any known preimage attacks that would be considered feasible?", "Solve differential equation: $x'=x^2- \\frac{2}{t^2}$ Maybe is it sth connected with homogeneous equation? I have no idea how to solve it.", "Why the principal value of complex number argument is taken within $(-\\pi,\\pi]?$ Why the principal value of complex number argument is taken within $(-\\pi,\\pi]?$ What is the harm in considering similar other intervals like $[0,2\\pi)$ for the purpose?", "Regex to match only letters", "Row colour gaps in tabularx with \\aboverulesep and \\{} \\documentclass[]{article} \\usepackage[table,dvipsnames]{xcolor} \\usepackage{multicol,booktabs,tabularx} % Table settings \\renewcommand{\\aboverulesep}{1pt} \\renewcommand{\\belowrulesep}{1pt} \\begin{document} \\begin{tabularx}{\\textwidth}{@{}X l@{}} This is Header 1 &amp; This is Header 2 \\\\ \\toprule \\rowcolor{Apricot} This is Text 1 &amp; This is Text 2 \\\\\\midrule This is Text 1 &amp; This is Text 2 \\\\\\midrule This is Text 1 &amp; This is Text 2 \\\\ \\bottomrule \\end{tabularx} \\end{document} I have the above table MWE using tabularx, and I am trying to colour the row from the table. However, due to the use of my \\aboverulesep and \\belowrulesep, I now have gaps above and below my table row that is not coloured. Also, because of the use of my @{} on either side of the table to 'remove' the excess padding on the sides of the table, the row colour is being applied in those padding as well. Qn 1: How can I colour the aforementioned gaps (arising due to the \\aboverulesep) in, while maintaining the rule separation? Qn 2: How to remove the colour from the two sides of the table? EDIT This is in response to Zarko's answer. I want to maintain the use of @{} on either side to remove the padding. If I were to adapt this into your answer, like so: % @Zarko's answer \\documentclass{article} \\usepackage[table,dvipsnames]{xcolor} \\usepackage{booktabs, cellspace, tabularx} % Table settings \\renewcommand{\\aboverulesep}{0pt} \\renewcommand{\\belowrulesep}{0pt} \\setlength\\cellspacetoplimit{5pt} \\setlength\\cellspacebottomlimit{5pt} \\begin{document} \\begin{tabularx}{\\textwidth}{@{}SX Sl@{}}% &lt;-- S is append for activate additional vertical space This is Header 1 &amp; This is Header 2 \\\\ \\toprule \\rowcolor{Apricot} This is Text 1 &amp; This is Text 2 \\\\\\midrule This is Text 1 &amp; This is Text 2 \\\\\\midrule This is Text 1 &amp; This is Text 2 \\\\ \\bottomrule \\end{tabularx} \\end{document} I obtain this: and so my second question (Qn2) is still unresolved.. For Qn 1, I prefer to use the solution by @Skillmon with \\renewcommand{\\arraystretch}{1.15} as I need not add a new package.", "How should a GM deal with \"standing orders?\"", "Cardinality of $\\mathbb{R}^\\mathbb{R}$ by diagonal argument I want to prove that the set of all real functions $\\mathbb{R}^\\mathbb{R}$ has a higher cardinality than the real numbers $\\mathbb R$, by Cantor's diagonal argument. I'm having difficulties with approaching this problem. What I'm looking for is a hint in the right direction. I've seen an example where it is shown that the power set $2^S$ of a countable set $S$ is uncountable, by the diagonal argument.", "Is posting a very long quote OK for an answer? I just found to a question on SO. While it provides a source for the (very long) quote, I do not like the fact that the answerer just posted the quote, without adding anything. Maybe add highlights/emphasis or remove uninteresting passages. Or skip the quote altogether and write a short summary. I feel, in the current form, this should have been a comment that just links to the original article. Am I too pedantic? Should I flag this as not an answer? Should I downvote it? What do you think about such answers?", "Radiation– white vs black house, hot or cool? In my book's thermodynamics chapter, it says that an \"object that radiates heat faster also absorbs heat faster. This means that an object that is a more efficient radiator comes to equilibrium with its environment more quickly. With this in mind, is it better to paint your house black or white?\" I am confused which it would be. The book says white because \"in summer, you house is cooler than the environment and white reflects away the heat. In winter your house is warmer than the environment and white radiates away the heat\"" ]

[ "How do I play a sound in Octave?", "Derive Fourier transform of sinc function We know that the Fourier transform of the sinc function is the rectangular function (or top hat). However, I'm at a loss as to how to prove it. Most textbooks and online sources start with the rectangular function, show that $$\\int_{-\\infty}^\\infty \\text{rect}(x)e^{i\\omega x}dx=\\int_{-1/2}^{1/2}e^{i\\omega x}dx=\\left.\\frac{e^{i\\omega x}}{i\\omega}\\right\\vert_{-1/2}^{1/2}=\\text{sinc}(\\omega/2)$$ and then just invoke duality and claim that the Fourier transform of the sinc function is the rectangular function. Is there any way of deriving this directly? i.e., starting with the sinc function? I've tried, but I'm not sure as to how to proceed. I know that the sinc is not Lebesgue integrable and only improper Riemann integrable. Some vague recollection of these being important in the Fourier transform hinders my thought process. Can someone clear things up for me?", "How do I reference an alias in a WHERE clause?", "My case here is that I was writing something for school, and my teacher explained an error which I really can't see. She referred to articles about &quot;dangling participles&quot;, which was previously unknown to me. I find it hard to relate the examples I've found about it to my situation. So this is a text I've written and the bold part is where the problem arises: (You could read only the bold part if you please) Wandering, and lost in his thoughts, there is a deep despair occupying the mind of this man. He is barely aware of his surroundings, except for those few moments when the loud blissful voices break through the protective barriers, developed by his immense sadness and grave frustration, into his mind. ”How can they all possibly be so happy?” he thinks to himself. Staring blindly, with his head low, as he walks in a slow pace, whispering ”Mary, Mary, my Mary,” over and over again. Yesterday was her funeral. She had passed away from a severe type of cancer, at a relatively young age. It was his wife. They had been together since high school and were greatly attached to each other. Having spent nearly half his life by her side, we cannot but imagine his grief. Indeed, he could hardly picture a life without her. So, alone he roams in the midst of all the seemingly incessant cheering and noises, drowned by his sorrow. Her comments on that part was: we is slightly out of place here – see my comment below These few sentences are about him and his emotions, so ‘we’ seems out of place. If the sentence starts: ‘Having spent nearly half his life by her side’, the reader expects it to continue: ‘he’. After all we have not spent half our lives by her side. Is she right? If so, could anyone try to explain why?", "I own a Nikon D40X and just the kit lens and I'm considering buying either a macro lens or some extension tubes. I don't necessarily want to do true 1:1 macro, just some close ups of bugs, fungi and flowers.", "Find the condition on $a$ and $b$ so that the two tangents drawn to the parabola $y^2=4ax$ from a point are normals to the parabola $x^2=4by$ Find the condition on $a$ and $b$ so that the two tangents drawn to the parabola $y^2=4ax$ from a point are normals to the parabola $x^2=4by.$ The required condition is $a^2&gt;8b^2$.I dont know how to prove it.I tried. Let $(h,k)$ be the point from where tangents are drawn to the parabola $y^2=4ax$.Let $m_1,m_2$ be the slopes of the tangents.Equations of tangents are $y=m_1x+\\frac{a}{m_1}$ and $y=m_2x+\\frac{a}{m_2}$ and equations of normal to the parabola $x^2=4by$ is $y=m_1x-2bm_1-bm^3_1$ and $y=m_2x-2bm_2-bm^3_2$. As $y=m_1x+\\frac{a}{m_1}$ and $y=m_1x-2bm_1-bm^3_1$ are the same lines.Therefore,$\\frac{a}{m_1}=-2bm_1-bm^3_1$ $bm^4+2bm^2+a=0$ And I am stuck.I cannot get the desired condition.Please help me.", "Is it okay to say \"Yes you're.\" instead of \"Yes you are.\"? Possible Duplicate: I was having an SMS conversation with a friend and somehow &quot;Yes you're&quot; came into play in retaliation to a comment. Example: Person 1: &quot;You are bad at English&quot;. Person 2: &quot;No I are not.&quot;. Person 1: &quot;Yes you're&quot;. Is that acceptable? I would assume that it is. Think of &quot;don't&quot;. You can say: &quot;No, don't.&quot; or &quot;I don't.&quot; and it is a contraction like &quot;you're&quot;. So, is it okay?", "Forced to Quit PhD although the hard and proved work I am a first year Ph. D student, and I have been working on a new topic of research. I worked day and night to prove something new and verified it. I began my Ph. D while my supervisor was on travel, but he returned before I had been here for long. When he returned, he told me we have to stop and not continue without any reasonable reasons. After a few months he began treating me poorly---always belittling and underestimating---although I got two grants from a top conference, made videos and podcasts, and constantly received praise for my good work and personality. It seems that I have been treated as a competitor, not a collaborator. Although agreeing with my approaches in private, my supervisor said false words to the committee to take the decision and stop my Ph. D work! It is not surprising, as there was another former senior Ph. D student who I met on campus, who was not allowed to defend his Ph. D: this same supervisor claimed he was not able to finish his dissertation although he had published in a peer reviewed journal and having citation as well, it was scary and not familiar. In front of committee, he lied, and said something without proving. I asked if he can make a detailed constructive criticism, but he could not. All I can say that they are a gang literally, and he said words that show that he is jealous and doesn't want to see me having self confidence in my self. I know no one will believe me, but this is the truth. Honestly, I am distressed and I'm losing sleep. I had this dream where there were many people who saw me fail. All things considered, I don't know whether what happened is good or bad, and I definitely don't know what I should do next! I would be grateful for your advice and whether there is someone has encountered any similar situation.", "I never liked that SO/SE relied on the external gravatar service, so I was glad to . However, it turns out that one cannot use as profile picture a PNG file with transparent background (something that is supported by gravatar): Above is a screen capture of my profile page, with a profile picture that has a transparent background. That background is turned into black, which I suppose is a bug. The method of upload doesn't change anything (I uploaded it manually to imgur, but the same black background is observed). See the difference between the two following URLs: http://i.stack.imgur.com/Da3ex.png?s=128&amp;g=1 and http://i.stack.imgur.com/Da3ex.png The problem is thus in the resizing code from imgur.", "How would I import/export Blender's preferences?", "How to move a database from SQL Server 2012 to SQL Server 2005", "How many irreducible polynomials of degree $n$ exist over $\\mathbb{F}_p$? I know that for every $n\\in\\mathbb{N}$, $n\\ge 1$, there exists $p(x)\\in\\mathbb{F}_p[x]$ s.t. $\\deg p(x)=n$ and $p(x)$ is irreducible over $\\mathbb{F}_p$. I am interested in counting how many such $p(x)$ there exist (that is, given $n\\in\\mathbb{N}$, $n\\ge 1$, how many irreducible polynomials of degree $n$ exist over $\\mathbb{F}_p$). I don't have a counting strategy and I don't expect a closed formula, but maybe we can find something like \"there exist $X$ irreducible polynomials of degree $n$ where $X$ is the number of...\". What are your thoughts ?", "What does \"Baking\" mean? I want to make some cool items for Dota 2 and I'm reading a guide. There are some tips about baking etc. but I can't use them, because I don't even know what baking means. Can somebody explain this, please? Thanks for all answers.", "Why does chmod succeed on a file when the user does not have write permission on parent directory? I am trying to understand file/dir permissions in Linux. A user can list the files in a directory using cd test ls -l Even if the user issuing above commands does not have read, write or execute permission on any of the files inside the test directory, still he can list them because he/she has read permissions on the test directory. Then why in the following scenario user B can change permissions of a file he owns but does not have write permissions of the parent directory? User A, makes a test directory and gives other users ability to write in it: mkdir test chmod o+w test User B, creates a file in test folder. cd test touch b.txt User A removes write permission of others from the directory chmod o-w test User B, can successfully change permissions, even though permissions are part of directory and this user does not have write permission on the parent directory of the file he owns chmod g-r b.txt why does chmod not fail since the user cannot modify the directory which has the file information - permissions etc?", "Prove that $z^2 \\equiv ab\\pmod p$ is solvable if and only if both or neither of $x^2 \\equiv a \\pmod p$, $x^2 \\equiv b \\pmod p$ are solvable. Suppose the $p$ is an odd prime not dividing $ab$. Prove that $z^2 \\equiv ab \\pmod p$ is solvable if and only if both or neither of $x^2\\equiv a\\pmod{p}$ and $x^2 \\equiv b \\pmod p$ are solvable.", "I want to create an image like below, so a balloon with text on it. I have been googling for ideas (text, sphere, ....) and came on earlier question. So I tried Shrinkwrap and Cast modifier. Here is the situation before applying the modifiers. This was after trying Shrinkwrap And this after Cast modifier. For me it does not look like it is going to work with one of these modifiers. Question How to create the image of a balloon with text on it ? With one of these modifiers or should I try a complete other approach ?? How to do this ?", "If friction acts on car all time, why is it not accelerating forever? In the first gear, slowly releasing my clutch i push the gas pedal to the maximum torque level, say at 2000 rpm. Now as the engine torque is acting on the wheel, friction helps the car to accelerate. If i hold the gas pedal at that position, the torque should continuously act on the wheel and the car should increase speed forever. But in reality even if we put the gas pedal at the max.torque rpm range in first gear it speeds up to certain wheel rpm (say 500rpm) and it stays there only. Why?", "The use of weak references is something that I've never seen an implementation of so I'm trying to figure out what the use case for them is and how the implementation would work. When have you needed to use a WeakHashMap or WeakReference and how was it used?", "Homeomorphism(topological spaces) version of Cantor–Bernstein–Schroeder theorem", "What is the concept of erasure in generics in Java?" ]

[ "When to use RSA and when ElGamal asymmetric encryption", "Unable to 'apt-get dist-upgrade' due to appstreamcli database error I have created a USB stick with a persistent Ubuntu 16.04 (release version). I tried a couple of ways, using Startup Disk Creator and MultiSystem, but I get the same end result. When I boot into the USB and do 'apt-get update', all is well. When I try 'apt-get dist-upgrade' I get: ** (appstreamcli:2761): CRITICAL **: Error while moving old database out of the way. AppStream cache update failed. The only reference to this error message I can find is but would appear to be fixed, at least fixed by the time the release version of Ubuntu 16.04. Aside: I want to test Unity8, which includes installing software. I don't have a spare computer, so I thought a persistent USB would do the trick. Any takers?", "Index entries duplicated for captions In document class book, and package caption, creating index with makeidx. Index entries for the main text and for footnotes collate properly; but those for captions create their own entries. Example: for the tag \\index{New York!Custom House!\\textit{Cartouche}}, text and footnotes collate properly; but used in a caption, a new entry is created at the third level, and is also out-of-alphabetic-sequence. Note: the top level, and first sub are correct; only the second sub is duplicated. How to get the caption index entries under the same entry?", "Floating Objects and Weight The Situation: A ball is placed in a beaker filled with water and floats. It is also attached to the bottom of the beaker via a string. The Question: The ball is attached to the beaker, thus making the ball and beaker (and string included) a system. However, it is floating. Does the ball add to the weight of the beaker?", "How to create an animated Electric Arc or Lightning? I know about the technique of using a displace modifier with an animated displace object on a thin plane, but there are no \"branches\", no forking in the lightning. Here is an image that shows more or less what I'm thinking of: Is it possible to achieve an 3D animated affect like this? I have tried a few things, such as the . However, it doesn't support animation and repeatedly generating meshes and then manually animating the visibility is a tedious.", "If the matrix $A^3 = 0$, is $A$ singular?", "Bending of light - photon's inertia instead of mass Using classical mechanics, the formula for gravitational attraction is $$F = G\\frac{m_1m_2}{r^2}.$$ This formula does not work for photons, and we need to use Einstein's theory of gravity to account for that, as the photon is massless. What if, instead of using the mass of the photon, we rather used the inertia of it? The momentum of a photon is $$p=\\frac{h}{\\lambda}.$$ Thus, using that, we can calculate its supposed 'mass' (inertia) as momentum is also equal to mass times velocity. So 'mass' of a photon is $$m=\\frac{p}{v}=\\frac{h}{\\lambda c}.$$ If we use this mass as the mass of a photon, can we use Newton's equation for gravitational attraction?", "Repeatedly rolling a six sided die four times and summing the highest three results gives you a distribution with what mean and standard deviation? Repeatedly rolling a six sided die four times and summing the highest three results gives you a distribution with what mean and standard deviation? I've only taken AP statistics, but I would like to learn how to do this.", "I have a Python script I recently wrote that I call using the command line with some options. I now want a very thin web interface to call this script locally on my Mac. I don't want to go through the minor trouble of installing mod_python or mod_wsgi on my Mac, so I was just going to do a system() or popen() from PHP to call the Python script. Any better ideas? Thanks in advance!", "Firefox browser opens but URL is not launched", "Tips to extend battery life for laptops and notebooks This question is present as a matter of historical interest. While you are encouraged to help maintain its answers, please understand that \"big list\" questions are not generally allowed on Ask Ubuntu and will be closed per the . It is possible to greatly extend the usage time of a laptop or netbook running on battery by disabling various services and installing various packages. What tricks or tips do people have for getting an extra hour or two out of their batteries?", "Change the selected value of a drop-down list with jQuery I have a drop-down list with known values. What I'm trying to do is set the drop down list to a particular value that I know exists using jQuery. Using regular JavaScript, I would do something like: ddl = document.getElementById(\"ID of element goes here\"); ddl.value = 2; // 2 being the value I want to set it too. However, I need to do this with jQuery, because I'm using a CSS class for my selector (stupid client ids...). Here are a few things I've tried: $(\"._statusDDL\").val(2); // Doesn't find 2 as a value. $(\"._statusDDL\").children(\"option\").val(2) // Also failed. How can I do it with jQuery? Update So as it turns out, I had it right the first time with: $(\"._statusDDL\").val(2); When I put an alert just above it works fine, but when I remove the alert and let it run at full speed, I get the error Could not set the selected property. Invalid Index I'm not sure if it's a bug with jQuery or Internet Explorer 6 (I'm guessing Internet Explorer 6), but it's terribly annoying.", "The highest common factor and the lowest common multiple of two numbers $A$ and $B$ are $12$ and $168$ respectively. Find the possible values of $A$ and $B$ with the exception of $12$ and $168$. Help me with this equation please. I kind of get it but I don't understand the concept behind it... I do not want to memorize.", "How to redirect a URL to a custom IP address? I have an Ubuntu machine that I'm using as my home Internet router. It uses a USB mobile broadband modem as its Internet connection, and shares this with another router (via the router's \"Internet\" port) which I use as my LAN. How do I redirect requests from within my LAN for a given URL to a custom IP address (ex have google.com redirect to x.x.x.x)?", "Top-bar hat misplaced", "Vandermonde Determinant This is an exercise from Ian Stewart's Galois Theory, $3^{rd}$ edition: If $z_1,z_2,\\ldots,z_n$ are distinct complex numbers, show that the determinant $$D=\\left|\\begin{array}[cccc] 11&amp;1&amp;\\cdots&amp;1\\\\ z_1&amp;z_2&amp;\\cdots&amp;z_n\\\\ z_1^2&amp;z_2^2&amp;\\cdots&amp;z_n^2\\\\ \\vdots&amp;\\vdots&amp;\\ddots&amp;\\vdots\\\\ z_1^{n-1}&amp;z_2^{n-1}&amp;\\cdots&amp;z_n^{n-1} \\end{array}\\right|$$ is nonzero. Hint: Consider the $z_j$ as independent indeterminates over $\\Bbb C$. Then $D$ is a polynomial in the $z_j$, of total degree $0+1+\\cdots+(n-1)=\\frac{1}{2}n(n-1)$. Moreover, $D$ vanishes whenever $z_j=z_k$ for $k\\neq j$, as it then has two identical rows. Therefore $D$ is divisible by $z_j-z_k$ for all $j\\neq k$, hence it is divisible by $\\prod_{j&lt;k}(z_j-z_k)$. Now compare degrees. My question is how to do this. I follow the hint and I'm thinking of $D$ as a cofactor expansion; is that the idea? Also, the fact that $D$ vanishes whenever $z_j=z_k$ for $k\\neq j$ follows since it would have two identical columns, right? I don't see why $z_j=z_k$ would imply it has two identical rows, as the hint suggests. The fact that it is divisible by $(z_j-z_k)$ is easy since that would make $z_k$ a root for $k=j$, but I'm not quite sure I follow why the degrees would be different. I think the degree of the product would be $1+2+\\cdots+(k-1)$, but then add these up for all $k&lt;n$? I appreciate any clarification that you can provide!", "For some complicated diagrams, I need to use something like Adobe Illustrator or Inkscape, and would like to include nicely typeset labels. (I'm aware of post-processing solutions, such as pinlabel.) One way to do this is to use a closely-matching font, and then convert fonts to outlines. Better, however, would be to use Computer Modern directly in Illustrator. Where can I find a Computer Modern font compatible with Adobe Illustrator?", "Privilege Notifications", "The Problem For a small mass a distance $R_i$ away from the center of the Earth, how long would it take for the object to fall to the surface of the Earth, assuming that the only force acting upon the object is the Earth's gravitational force? Relevant Information The following discussion seems to have solved exactly the same problem: However, upon working out the mathematics, I'm not exactly sure how to evaluate the constant of integration. A Partial Solution $$ F=\\frac {-GMm}{s^2} $$ $$ a=\\frac {-GM}{s^2} $$ $$ \\frac {dv}{dt} = \\frac {-GM}{s^2} $$ Multiplying by $v$ and then integrating by $dt$ on both sides, we have $$\\frac {1}{2} v^2=\\frac {GM}{s} +c_1$$ where $c_1$ is a constant of integration. Substituting initial conditions of $v=0, s=R$, we have $$\\frac {1}{2} v^2=GM(\\frac {1}{s}-\\frac{1}{R})$$ At this point of time, when I use Wolfram Alpha, I get $$c_2+\\sqrt{\\frac{2}{R}}t=\\frac{\\sqrt{s}(s-R)+R\\sqrt{R-s}\\times{\\tan^{-1}(\\sqrt{\\frac{s}{R-s}})}}{\\sqrt{GM(R-s)}}$$ where $c_2$ is a constant of integration. Substituting initial conditions of s=R, t=0, we find that the term $$\\tan^{-1}(\\sqrt{\\frac{s}{R-s}})$$ is undefined. At this point, I'm stuck. Any ideas on where I've made the mistake here? (For those interested, this question was inspired by the Greek myth which states that a bronze hammer dropped from heaven would take 9 days to hit the Earth and would reach on the tenth).", "How to sail downwind faster than the wind? Recently a set a record for sailing a wind-powered land vehicle directly down wind, and a speed faster than wind speed. Wikipedia has a talking about it, but it doesn't explain exactly how it works. I can imagine some configurations, but I don't get how a system could be set up to push forward with a tailwind (when the cart is moving slower than the wind) and push forward with a head wind (when the cart is moving faster than the wind). Could someone help explain how this is possible?" ]

[ "How to enforce sender address to be \"[email protected]\" in Postfix? I have set up a Postfix server with SMTP AUTH (STARTTLS on port 587). All my users are in the domain \"example.org\". I want to enforce the sender address to be \"[email protected]\". I learned that this can be achieved with the main.cf options smtpd_sender_restrictions = reject_sender_login_mismatch, ... smtpd_sender_login_maps = hash:/etc/postfix/smtpd_sender_login_maps with a login_maps file like: [email protected] a [email protected] b [email protected] c ... (see also ), but this would mean I'll have to edit the login_maps file every time I have a new user. I don't need such a flexible mapping: It should always be \"[email protected]\". Is there an easier option?", "How do I get from Terminal 1 to Terminal 5 in Fiumicino Airport? The official site mentions a shuttle bus service, I also googled but the infos are not clear, so I hope to find some firsthand experience. I have a flight with a stop in Fiumicino, I will arrive in Terminal 1 and the next departure is from Terminal 5, the transfer time is around 5 hours. Is it correct that I should go to Terminal 3 first (using the internal transfer area) and after exit from Terminal 3 and take the shuttle to Terminal 5? The terminal 5 has a waiting area with some shops or is just a terminal for departure? In your opinion is better to wait some hours inside Terminal 3 before going out to take the shuttle bus?", "Upload files with HTTPWebrequest (multipart/form-data)", "I'm trying to remember the name of a series of books about a boy who works with dragons. Dragon's blood (or maybe it was slobber?) is acidic, and the children who wrangle these dragons often end up with deep pock marks. On this world, days are like ours but nights get very cold, requiring anyone stuck outside to find a shelter until dawn (not the false dawn) The other thing I remember is that in one of the books by slicing open a dragon and spending the night, the character emerged with special dragon powers.", "Do immigration checks exist between Northern Ireland and England/Scotland? (not just for flights but also ferry/bus/train) Do immigration checks exist between the Republic of Ireland and England/Scotland?", "Possible Duplicate: Well, the question is in the title. I always had the impression that \"talk to someone\" refers to situations when some information must be conveyed to someone else, while \"talk with someone\" refers to cases that involve a more complex two-sided interaction. E.g., I \"talk to my colleague\" to tell him that I'm going for a lunch break (no response is required apart from maybe an acknowledgment), while I go and \"talk with my colleague\" if I have to discuss something with him in detail. Is this correct, or is there any difference between the two phrases, or is there no difference at all?", "Do SharePoint 2013 JavaScript Client object model support run with elevated privileges code Can I elevate Visitors Group users permission via javascript client object model code to do some list or library item updates ?", "I installed Drush for the first time (so it may be a configuration error) and I'm trying to update to the latest core version of Drupal. Drush is giving me this error - I'm on an OSX box. dev5:clientnamedirectory my.name$ drush pm-update projects drupal-7.25 &lt;h1&gt;Additional uncaught exception thrown while handling exception.&lt;/h1&gt; &lt;h2&gt;Original&lt;/h2&gt;&lt;p&gt;PDOException: SQLSTATE[HY000] [2002] No such file or directory in drupal_get_installed_schema_version() (line 155 of /Users/my.name/Sites/proface/includes/install.inc).&lt;/p&gt; &lt;h2&gt;Additional&lt;/h2&gt; &lt;p&gt;PDOException: SQLSTATE[HY000] [2002] No such file or directory in system_list() (line 165 of /Users/my.name/Sites/clientnamedirectory/includes/module.inc).&lt;/p&gt;&lt;hr /&gt; Drush command terminated abnormally due to an unrecoverable error.", "I have an excel spreadsheet with header and survey drill data. Header data contains hole ID, and location coordinates, and the survey data contains related downhole survey with Distance, Azimuth and Dip values. Since I know the hole location and surface elevation, I would like to be able to convert the survey table to XYZ coordinates as well. Does anyone has a function / procedure / example? (VB &amp; ArcObjects) Header Data: Survey Data:", "I'm using a BooleanToVisibilityConverter in WPF to bind the Visibility property of a control to a Boolean. This works fine, but I'd like one of the controls to hide if the boolean is true, and show if it's false.", "Is char *envp[] as a third argument to main() portable", "Let $|A|=\\alpha, |B|=\\beta, |C|= \\gamma$ be cardinals and $\\beta \\leq \\gamma$. Prove $\\alpha ^{\\beta}\\le \\alpha ^{\\gamma}$. So from the given we know that there's an injection $f:B\\to C$ and some functions $h:B\\to A, g: C\\to A$. We want to prove there's an injection $l_1:A\\to C$. It appears that $f$ doesn't help here. Trying to take representatives from $A$ and show they're in $C$ and there's an injection doesn't work so maybe the function should be $l_2: h \\to g$ but I don't know how to work with it.", "I read some articles, and seen some videos about a github project that do a sort of thing, but it's a little bit outdated things.I wanna see if this thing is possible to do, nowadays. Thanks", "Some spells, such as Forbiddance, say that under certain circumstances, they last \"Until Dispelled\". Other spells, such as Mordenkainen's Private Sanctum, say that under certain circumstances, they become \"Permanent\". What is the difference between these two terms? Does \"Permanent\" mean that the effect can never be dispelled?", "Images are escaping from the help center privilege page Images included in the fully expanded privilege pages are escaping from the body. This is most noticeable on the (which I know is going away soon anyway): But is also apparent on: In the edit page preview, the images sit correctly within the borders. Chrome 27, Windows 7", "Why does the symbol for the multiplication operation change shape? Why does the \"$\\times$\" used in arithmetic change to a \"$\\cdot$\" as we progress through education? The symbol seems to only be ambiguous because of the variable $x$; however, we wouldn't have chosen the variable $x$ unless we were already removing $\\times$ as the symbol for multiplication. So why do we? I am very curious. It seems like $\\times$ is already quite sufficient as a descriptive symbol.", "\"Unable to install GRUB in /dev/sda\" when installing GRUB I recently bought a shiny new Lenovo Yoga 2 Pro and I want to dual boot it with Ubuntu for studying purposes. Its built-in OS is Windows 8.1 and it has a 256GB SSD. I've made a separate 90GB partition just for Ubuntu and a live USB to install it. The first time everything seemed to work great, I solved the wifi issued by blacklisting ideapad_laptop, the installation went flawlessly and Ubuntu worked fine. When I got up the next morning and turned on my laptop it booted into Windows right away without ever showing the GRUB menu. So I tried to reset, and checked my partitions with the Disk Manager and everything looked fine. Since I couldn't find a solution online I went ahead and formatted the partition to try and install again. This time and every time since, the installation was aborted and I got a fatal error saying: Unable to install GRUB in /dev/sda Executing `grub-install /dev/sda` failed. This is a fatal error. Can anyone please suggest a solution to this problem? If any further information is needed I would be happy to provide it. Thanks. When installing I get the following in details: ubuntu kernel: [ 1946.372741] FAT-fs (sda2): error, fat_get_cluster: invalid cluster chain (i_pos 0). ubuntu grub-installer: error: Running 'grub-install --force failed.", "$p_1p_2...p_n +1$ is not square for $p_k = k$'th prime", "I'm new to latex, I'm thankful if someone can give me an example script to customize TOC that looks like Chapter 1.XXXXXX (1-15) 1.1 Introduction 1.2 xxxxxxxx 1.3 xxxxxxxxxx 1.4 xxxxxxx ............... Chapter 2.xxxxxxx 2.1 xxxxx ...... (16-30) because the (default) TOC appears to be very large for my book, since it arranges the section name row-by-row.", "Regex for splitting a string using space when not surrounded by single or double quotes" ]

[ "A 2x2 matrix $M$ exists. Suppose $M^3=0$ show that (I want proof) $M^2=0$", "Top of answer covered by sticky top bar after clicking direct link With the introduction of the network-wide sticky top bar , I noticed a bug that's happening on every site (except for Stack Overflow). When you click on an answer link (of the form https://site.stackexchange.com/a/####), the very top of the answer and the upvote button are covered by the top bar: Stack Overflow shows the correct behavior:", "What does the explicit keyword mean in C++?", "If $p,q$ are primes $(pq,a)=1$ and $p-1|q-1$ then prove $a^{q-1}\\equiv 1\\pmod{pq}$ $p,q$ primes, $(pq,a)=1$ and $p-1|q-1$ then prove $a^{q-1}\\equiv 1\\pmod{pq}$ Got this in an exam today and had no idea how to do it.", "In order to show $e^{x+y}=e^{x}e^{y}$ by using Exponential Series, I got the following: $$e^{x}e^{y}=\\Big(\\sum_{n=0}^{\\infty}{x^n \\over n!}\\Big)\\cdot \\Big(\\sum_{n=0}^{\\infty}{y^n \\over n!}\\Big)=\\sum_{n=0}^{\\infty}\\sum_{k=0}^n{x^ky^n \\over {k!n!}}$$ But, where should I go next to get $e^{x+y}=\\sum_{n=0}^{\\infty}{(x+y)^n \\over n!}$. Thanks in advance.", "Chain skip happening seemingly at random with a new chain", "Printing a .NET DataGridView I am fairly new to .NET and C#, but I have a DataGridView that I would like to print. What would be the best way to go about doing so?", "Why bosons have integer spin and fermions have half-integer ones? Due the fact that the fermions are the \"block particles\" and the bosons are the \"carriers\" I just came out with the question that, why the \"block particle\" have half-integer spin and the \"carriers\" have an integer spin?", "Can I run CAT5/6 cables parallel to electrical cables?", "SQL function as default parameter value? I tried changing a default parameter value with this: ALTER PROCEDURE [dbo].[my_sp] @currentDate datetime = GETDATE() and all the SQL pre-compiler gave me was this error: Msg 102, Level 15, State 1, Procedure my_sp, Line 8 Incorrect syntax near '('. I have already created the procedure. (I'm not sure if that's relevant.) I was using a null default value and checking for that later, but that doesn't seem proper. Can I do this in one line? Update: I was going off of : [ = default ] Is a default value for the parameter. If a default value is defined, the function can be executed without specifying a value for that parameter. Note: Default parameter values can be specified for CLR functions except for the varchar(max) and varbinary(max) data types. When a parameter of the function has a default value, the keyword DEFAULT must be specified when the function is called to retrieve the default value. This behavior is different from using parameters with default values in stored procedures in which omitting the parameter also implies the default value. Am I reading this wrong? Many thanks.", "Finding a closed form for a recurrence relation $a_n=3a_{n-1}+4a_{n-2}$ Consider the sequence defined by $$ \\begin{cases} a_0=1\\\\ a_1=2\\\\ a_n=3a_{n-1}+4a_{n-2} &amp; \\text{if }n\\ge 2 \\end{cases} .$$ Find a closed form for $a_n$. I tried listing out examples, but I don't see any common pattern between them. All solutions are greatly appreciated.", "A real $2 \\times 2 $ matrix $M$ such that $M^2 = \\tiny \\begin{pmatrix} -1&0 \\\\ 0&-1-\\epsilon \\\\ \\end{pmatrix}$ , then : A real $2 \\times 2 $ matrix $M$ such that $$M^2 = \\begin{pmatrix} -1&amp;0 \\\\ 0&amp;-1-\\epsilon \\\\ \\end{pmatrix}$$ (a) exists for all $\\epsilon &gt; 0$. (b) does not exist for any $\\epsilon &gt; 0$. (c) exists for some $\\epsilon &gt; 0$. (d) None of the above is true. Attempt: I couldn't think of any theory base to prove / disprove the existence of such a matrix. Could someone please give me a hint on how to go about this problem? Thank you very much for your help in this regard.", "How to force a table into page width? I have the following table: \\begin{table}[htb] \\begin{tikzpicture} \\node (table) [inner sep=0pt] { \\begin{tabular}{ l | l } {\\bf Symptom} &amp; {\\bf Metric} \\\\ \\hline Class that has many accessor methods and accesses a lot of external data &amp; ATFD is more than a few\\\\ Class that is large and complex &amp; WMC is high\\\\ Class that has a lot of methods that only operate on a proper subset of the instance variable set &amp; TCC is low\\\\ \\end{tabular} }; \\draw [rounded corners=.5em] (table.north west) rectangle (table.south east); \\end{tikzpicture} \\caption{God class symptoms} \\label{tbl:god_class} \\end{table} Now I want to force the width of the table to be the same as the \\textwidth, either by linewrapping of table text or by scaling. How can I achieve that?", "Adding parentheses around subfig references Say I have a figure with two subfloats inserted using the subfig package. When I reference them with \\ref{myLabel} I get this Figure 3.5a and 3.5b. But what I want is this: Figure 3.5(a) and 3.5(b). How can I add the parentheses?", "What's the nice 'trick' to showing that the following expression is irrational? $2^{1/3} + 2^{2/3}$", "Delete duplicate records in SQL Server?", "Caption on tabular environment I have got codes like the following (generated by Kile). How can I add a caption. I guess I should have used the table environment. Is there any solution now? \\newcommand{\\mc}[3]{\\multicolumn{#1}{#2}{#3}} \\begin{center} \\begin{tabular}{rccll} &amp; &amp; \\mc{3}{c}{Colin}\\\\ &amp; &amp; a &amp; \\mc{1}{c}{b} &amp; \\mc{1}{c}{c}\\\\\\cline{3-5} Rose &amp; \\mc{1}{c|}{A} &amp; \\mc{1}{c|}{(1,2)} &amp; \\mc{1}{c|}{(2,5)} &amp; \\mc{1}{c|}{(4,4)}\\\\\\cline{3-5} &amp; \\mc{1}{c|}{B} &amp; \\mc{1}{c|}{(7,4)} &amp; \\mc{1}{c|}{(3,5)} &amp; \\mc{1}{c|}{(0,6)}\\\\\\cline{3-5} \\end{tabular} \\end{center}", "Here is my problem: I've got a dialog with some parameters that the user can change (via a spinner for example). Each time one of these parameters is changed, I launch a thread to update a 3D view according to the new parameter value. If the user changes another value (or the same value again by clicking many times on the spinner arrow) while the first thread is working, I would like to abort the first thread (and the update of the 3D view) and launch a new one with the latest parameter value. How can I do something like that? PS: There is no loop in the run() method of my thread, so checking for a flag is not an option: the thread updating the 3D view basically only calls a single method that is very long to execute. I can't add any flag in this method asking to abort either as I do not have access to its code.", "Why is it differential equations exist on an interval instead of a domain? I understand a domain is the set of input elements a function is defined for (and can have breaks in it e.g. union of 2 sets) and a interval is a continuous range of real numbers. Why do we speak of the solution to a differential equation over an interval instead of an domain? If the solution to an ODE is just a function, and we normally speak of functions as having a domain, then why wouldn't we use domain?", "How can I change some pages into document into landscape mode, while leaving the others in portrait mode (or vice versa)?" ]

[ "I wrote the wrong thing in a commit message. How can I change the message? The commit has not been pushed yet.", "How do I restore .bat files association with the system (make them run when double-clicked)?", "How did \"but\" mean \"only\"? : Old English butan, buton &quot;unless, except; without, outside,&quot; [...] I don't know Old English. From the étymons overhead, how did but to mean |adverb| = 1. No more than; only ? What can explain the semantic shift? I didn't understand , because English is not my first language : In sense: Only. An elliptic development of the conjunction: see . a. By the omission of the negative accompanying the preceding verb (see ), but passes into the adverbial sense of: Nought but, no more than, only, merely. I understand Shakespeare's use in . Thank you all.", "I'm very confused about tenses. I have examples in two different situations here. Situation 1: I went to New York two months ago and was talking to someone about it. A. This is the first time I've been to New York. B. That was the first time I'd been to New York. Which is correct in a daily conversation? Situation 2: I'm going to New York next month and talking to someone. A. This will be the first time I've been to New York. B. This is the first time I've been to New York. C. This will be the first time I go to New York. Which sentence is appropriate? According to a grammar article I've read before, I think it says that I can use this sentence in both cases: This is the first time I've been to New York. But I'm not sure if this is really so. So I'd like to know which tense I should use in each case. Could you explain it?", "When I create a new Date object, it is initialized to the current time but in the local timezone. How can I get the current date and time in GMT?", "Computing sums of divisors in $O(\\sqrt n)$ time? I have a sequence: $1,3,5,8,10,14,16,20,23,27,\\dots$ I know that the recursive relation is: $$p[i] := p[i-1] + \\text{number of factors of $i$}, \\quad \\text{with $p[1]=1$.}$$ How do I solve this recursive relation in $O(n^{0.5})$ time? I have to write a program for it, and $n$ can be as large as $10^9$. So, some appropriate precomputation and prestorage is allowed, provided that they comply (memory and time wise) with the range of $n$.", "I have the following enumeration: public enum AuthenticationMethod { FORMS = 1, WINDOWSAUTHENTICATION = 2, SINGLESIGNON = 3 } The problem however is that I need the word \"FORMS\" when I ask for AuthenticationMethod.FORMS and not the id 1. I have found the following solution for this problem (): First I need to create a custom attribute called \"StringValue\": public class StringValue : System.Attribute { private readonly string _value; public StringValue(string value) { _value = value; } public string Value { get { return _value; } } } Then I can add this attribute to my enumerator: public enum AuthenticationMethod { [StringValue(\"FORMS\")] FORMS = 1, [StringValue(\"WINDOWS\")] WINDOWSAUTHENTICATION = 2, [StringValue(\"SSO\")] SINGLESIGNON = 3 } And of course I need something to retrieve that StringValue: public static class StringEnum { public static string GetStringValue(Enum value) { string output = null; Type type = value.GetType(); //Check first in our cached results... //Look for our 'StringValueAttribute' //in the field's custom attributes FieldInfo fi = type.GetField(value.ToString()); StringValue[] attrs = fi.GetCustomAttributes(typeof(StringValue), false) as StringValue[]; if (attrs.Length &gt; 0) { output = attrs[0].Value; } return output; } } Good now I've got the tools to get a string value for an enumerator. I can then use it like this: string valueOfAuthenticationMethod = StringEnum.GetStringValue(AuthenticationMethod.FORMS); Okay now all of these work like a charm but I find it a whole lot of work. I was wondering if there is a better solution for this. I also tried something with a dictionary and static properties but that wasn't better either.", "A geometric reason why the square of the focal length of a hyperbola is equal to the sum of the squares of the axes?", "Does someone falling into a black hole see the end of the universe?", "Legitimate edits of less than 6 characters I recently came across an by which contained a link to a specification that has since been moved. When attempting to edit the link, a change which involved the subtraction of only 4 characters, I ran up against the 6 character minimum requirement. Ordinarily this would not be an issue. A less experienced poster would likely have other things within the answer that could be changed (). In fact, this seems to be the answer on every meta post relating to this topic (, , etc...). The problem here, since I don't have 2k reputation, is that BalusC writes excellent answers... with the reputation to back them up. I don't feel there is anything in the post (besides the link) that would benefit from me editing. What is the standard practice here? Flag the post and explain my situation in the notes (for someone with higher reputation)? Comment on the post and hope that a) visitors read the comments or b) the OP gets notified and updates their post? Make edits, for the sole purpose of increasing characters, providing no benefit and possibly hurting the quality of the post? For reference, the EL Specification in the post should be changed to , if someone wants to go ahead and take care of this.", "Adding objects algorithm in Objective-C", "\"Unable to locate package\" while trying to install packages with APT When I try to install any package through the command line, I get an error. $ sudo apt-get install &lt;package&gt; Reading package lists... Done Building dependency tree Reading state information... Done E: Unable to locate package &lt;package&gt; Can anyone help me on this?", "Crossroads / Second Chance / Choices I am trying to find a short story involving an alien race of 'Intellectuals.' They possess no opposable thumbs or other limbs to control their world. I think the basis of the story is their discovery of a way to influence another unintelligent species that can manipulate objects. This leads to a new start for them. They may have been at risk of breeding beyond available resources. The story ends with explorers returning from sea. They may have discovered a new land into which they can expand. The last few scenes have a darker flavor where one character has been presented with a rock that glows in the dark. He considers it for a period before being called away to greet the explorers. The author then takes over and makes some comments about most species passing one crossroads only to meet another. The story could have been written at any time from the Golden Age though to the 1970's.", "Bizarre spacing with 4 $\\star$s", "Comparing two Lists and returning the distinct values and the differences", "Mann-Whitney U test and K-S test with unequal sample sizes", "Could humans choose to establish fibre digesting colonies in our guts?", "How long was Luke Skywalker's training with Yoda?", "Here are some options I thought of, not sure which is the right one. There was an I/O error reading from the pipe. The process writing to the other end of the pipe died with a failure. All processes who could write to the pipe have closed it. The write buffer of the pipe is full. The peer has closed the other direction of the duplex pipe. Writing failed because there are no processes which could read from the pipe. A system call returned the EPIPE error, and there was no error handler installed.", "Detecting outliers using standard deviations Following my question , I am wondering if there are strong views for or against the use of standard deviation to detect outliers (e.g. any datapoint that is more than 2 standard deviation is an outlier). I know this is dependent on the context of the study, for instance a data point, 48kg, will certainly be an outlier in a study of babies' weight but not in a study of adults' weight. Outliers are the result of a number of factors such as data entry mistakes. In my case, these processes are robust. I guess the question I am asking is: Is using standard deviation a sound method for detecting outliers?" ]

[ "Should I vary input field lengths in a single page checkout form?", "Change default shell for Terminator", "Calculation of pressure from flow rate of water Anybody kindly help me to find how to calculate pressure in bar from flow rate. I have a pipe and from that I am transferring water at a constant flow rate of 5ml/min. At this flow rate, with a 0.5 cm diameter pipe, what will be the pressure generated by water?", "Maximum of $|\\sin(z)|$ as $\\{z: |z| \\leq 1 \\} $ So according to the Maximum Principle, the maximum is when $|z|=1$. I tried using the fact that $\\sin z= \\dfrac {e^{iz}-e^{-iz}}{2i}$, but didn't know how to continue from there. Setting $z=e^{it}$ doesn't help much. I saw this question was answered before, however the answer uses hyperbolic functions ($\\sinh, \\cosh$) which I haven't actually studied. Thanks in advance for any assistance!", "I'm trying to use the ant migration tool to retrieve all the Custom Metadata records for a single Custom Metadata Type. However, I can't figure out the syntax. I would think that something like this would work: &lt;Package xmlns=\"http://soap.sforce.com/2006/04/metadata\"&gt; &lt;types&gt; &lt;members&gt;State_Sales_Tax.*&lt;/members&gt; &lt;name&gt;CustomMetadata&lt;/name&gt; &lt;/types&gt; &lt;types&gt; &lt;members&gt;State_Sales_Tax__mdt&lt;/members&gt; &lt;name&gt;CustomObject&lt;/name&gt; &lt;/types&gt; &lt;version&gt;36.0&lt;/version&gt; &lt;/Package&gt; but no dice.", "PHP & MYSQL: using group by for categories", "How to make a good glow effect around a sun?", "$_POST empty on utf-8 characters", "I would like to show that $$ \\int_{0}^{1} \\frac{x-1}{\\ln(x)} \\mathrm dx=\\ln2 $$ What annoys me is that $ x-1 $ is the numerator so the geometric power series is useless. Any idea?", "Is volunteer work allowed in the US while visiting under the VWP or a B1/B2 visa? I am going to Santa Monica for 4 weeks to polish my English in July and would like to volunteer at the Planetary Society located in Pasadena. I am a Swiss citizen and have a biometric passport. However, I don't have any special visa, as there is no visa needed for the school I am attending and using the Visa Waiver Program, I am allowed to stay up to 90 days in the US. Am I allowed to do volunteer work during my stay?", "I cancelled the Microsoft Windows 10 Reservation and uninstalled KB3035583, but Windows 10 is still trying to install. After I uninstalled KB3035583 and restarted my laptop as instructed, I could not find KB3035583 to hide it. Now Windows 10 is sitting in my Windows Update saying that it will install when I restart my computer.", "Just noticed a minor css issue on this question: The related questions on the right hand side have some overlapping text in Chrome: (This only applies to this very site, Meta Stack Exchange)", "SyntaxError: invalid syntax // SyntaxError: unexpected EOF while parsing How do I detect text inside of this, this is HTML &amp; this is XPath. I tried HTML &lt;span class=\"messageText\"&gt;Hello.&lt;/span&gt; XPath //*[@id=\"liveAgentChatLogText\"]/span[22]/span[2] I tried with this but it didn't work, it said no such element found. driver.find_element(By.XPATH, '//*[@id=\"liveAgentChatLogText\"]//*[contains(string(.), \"Hello\")]')", "E.g.: If your Gmail ID is [email protected], it considers this the same as [email protected]. Why is this so?", "Purge unused data (e.g. particle system, or groups) by script How can I completely remove a objects (e.g. particle system or groups used in particle systems) in blender using python? The problem is this: I have a script, with which I create a scene (e.g. adding some normal objects and some group of objects with a particle system). For a research study I would like to repeat that that several times, without restarting blender. So I can create a scene, delete everything, e.g. with a script like this: import bpy scn = bpy.context.scene for obj in scn.objects: obj.select = True bpy.ops.object.delete() If I rerun the script to recreate the scene with objects using particle system, the latter is not shown in the scene anymore (only the placeholders of the particle system). Now I'm not sure where exactly the problem lies, but I guess not everything is immediately deleted, running the script above. Only the startup of blender helps (but that's not what I want) or pushing the purge button. The purge button seems to start the command: bpy.ops.outliner.orphans_purge() But I can't get this piece of code to run in the console. It says that \"the context is incorrect\". Is there a way to purge the unused data by python script? Thanks a lot for any help.", "Equivalent definitions for simple connectivity", "Register On-Click Event with jQuery - Not Firing", "How to modify itemize vertical spacing within blocks in beamer? I have noticed that when I have \"itemize\" environments defined within blocks in beamer, that they introduce more vertical spacing between the top and the bottom of the blocks, than vertical text. Since I have a slide with some text filled blocks and directly after, a slide with only \"itemize\" holding blocks, I would like the spacing between the itemized text and the block to be the same as for regular text. On I have read about \"squeeze\" option, but it doesn't seem to work... Additional info: The problem is in the additional vertical space that is included by the \"\\itemize\" environment. I have found on how to remove vertical spacing from the itemize list, and I am using this approach. However, it is a brute force approach. What I would like to know if it is possible to have the same vertical space between the end of the itemize list and the bottom of a block, as the one set between the normal text and the bottom of the block. MWE: \\documentclass[10pt]{beamer} \\usepackage{amsmath} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{exscale} \\usepackage{epsfig} \\usepackage{fancybox} \\usepackage{lmodern} \\usepackage[T1]{fontenc} \\usepackage{overpic} \\usepackage{multimedia} \\usetheme{default} \\usecolortheme{crane} % -- Modifications that enable the footline and set black color for the fonts \\setbeamertemplate{footline}{% \\begin{beamercolorbox}[wd=\\paperwidth,ht=2.25ex,dp=1ex,right, rightskip=1mm, leftskip=1mm]{titlelike} \\textcolor{black}{ %\\inserttitle\\hfill\\insertauthor\\hfill\\insertframenumber% Something\\hfill Something Else \\hfill\\insertframenumber% } \\end{beamercolorbox} } \\setbeamertemplate{itemize items}[square] \\setbeamercolor{item}{fg=black} \\setbeamercolor{frametitle}{fg=black} \\setbeamercolor{block title}{fg=black} \\setbeamercolor{title}{fg=black} \\setbeamercolor{block body}{bg=white} % END Modifications \\begin{document} \\begin{frame} \\frametitle{text blocks} \\begin{block}{block} block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block blockk \\end{block}{block} \\begin{block} block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block \\end{block} \\begin{block}{block} block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block block \\end{block} \\end{frame} \\begin{frame} \\frametitle{itemize blocks} \\begin{block}{item} \\begin{itemize} \\item item \\item item \\item item \\end{itemize} \\end{block} \\begin{block}{item} \\begin{itemize} \\item item \\item item \\item item \\end{itemize} \\end{block} \\begin{block}{item} \\begin{itemize} \\item item \\item item \\item item \\end{itemize} \\end{block} \\end{frame} \\end{document}", "I have the Xiaomi Mi A3 and I'm currently on both phone and PC latest stock update. I am using Windows 10 20H2 and I have tried everything – but still don't get it. I tried another Mi A3 and it got attached normally. I've tried installing all kind of drivers and different ports, nothing. When suddenly it worked and I installed the stock ROM – but because the stock ROM is kinda laggy and ugly I want to change it. But I can't because I am also on stock recovery and I can't install another recovery because my device isn't recognized in fastboot mode. My device is recognized in adb mode and in edl mode as well, only not in fastboot.", "If $A^2\\succ B^2$, then necessarily $A\\succ B$ I remember reading somewhere about the following properties of non-negative definite matrix. But I don't know how to prove it now. Let $A$ and $B$ be two non-negative definite matrices. If $A^2\\succ B^2$, then it necessarily follows that $A\\succ B$, but $A\\succ B$ doesn't necessarily leads to $A^2\\succ B^2$. How can you prove it? Thanks!" ]

[ "How do I clone a generic list in C#?", "Can you wait to add optional damage dice that apply on a hit (such as Divine Smite) until after seeing if the roll is a critical?", "I know this issue has been addressed before with different software, but how do I do it with Shapely? I have a polygon with a very small gap on the interior of the shape: Here is a close up: The polygon is valid so I can't use the buffer trick, and simplifying the polygon also doesn't work.", "Multiple monitors, multiple workspaces? I connected my laptop to my LCD. Using the laptop display hotkey I can switch between different modes - only laptop monitor on, only LCD monitor on, both on and display the same view, both on and the desktop is stretched (divided). But, I'm looking for something else - I would like to have two workspaces, one visible on the laptop monitor and the other on the LCD. Is that possible?", "Google App Engine: Is it possible to do a Gql LIKE query?", "Homotopy equivalence of universal cover As part of am exam question (Q21F ), I'm trying to prove that if $X$ and $Y$ are path-connected, locally path-connected spaces with universal covers $\\widetilde{X}$ and $\\widetilde{Y}$, respectively, then if $X \\simeq Y$ then $\\widetilde{X} \\simeq \\widetilde{Y}$. My attempt might be correct, but it seems too complicated and amongst the jumble I may have made some incorrect assumptions. So what I'm looking for is (a) verification or correction; and (b) ideas as to how I could simplify my argument. My argument: Let $p:\\widetilde{X} \\to X$ and $q:\\widetilde{Y} \\to Y$ be the covering maps, and let $X \\overset{f}{\\underset{g}{\\leftrightarrows}} Y$ be a homotopy equivalence. Fix a point $\\widetilde{x} \\in \\widetilde{X}$, let $x=p(x) \\in X$ and $y=f(x) \\in Y$, and fix $\\widetilde{y} \\in q^{-1}(\\{y\\}) \\subseteq \\widetilde{Y}$. Also let $x' = g(y) \\in X$ and fix $\\widetilde{x'} \\in p^{-1}(\\{x'\\}) \\subseteq \\widetilde{X}$. Define a map $\\widetilde{f} : \\widetilde{X} \\to \\widetilde{Y}$ as follows. For $\\widetilde{z} \\in \\widetilde{X}$ let $\\widetilde{u}:[0,1] \\to \\widetilde{X}$ be a path from $\\widetilde{x}$ to $\\widetilde{z}$. Let $z=p(z)$ so that $u=p\\widetilde{u}$ is a path in $X$ from $x$ to $z$. Let $v=fu$, so that $v$ is a path in $Y$ from $y$ to $f(z)$. Lift $v$ to a path $\\widetilde{v}$ in $\\widetilde{Y}$ with $\\widetilde{v}(0) = \\widetilde{y}$. Define $\\widetilde{f}(\\widetilde{z}) = \\widetilde{v}(1)$. Notice that $q\\widetilde{v}=v$ so that $q\\widetilde{f} = fp$. Define $\\widetilde{g}:Y \\to X$ analogously: For $\\widetilde{z} \\in \\widetilde{Y}$ let $\\widetilde{a}:[0,1] \\to \\widetilde{Y}$ be a path from $\\widetilde{y}$ to $\\widetilde{z}$. Let $z=q(z)$ so that $a=q\\widetilde{a}$ is a path in $Y$ from $y$ to $z$. Let $b=fa$, so that $b$ is a path in $X$ from $x'$ to $g(z)$. Lift $b$ to a path $\\widetilde{b}$ in $\\widetilde{X}$ with $\\widetilde{b}(0) = \\widetilde{x'}$. Define $\\widetilde{g}(\\widetilde{z}) = \\widetilde{b}(1)$. Likewise, notice that $p\\widetilde{g}=gq$. Claim: $\\widetilde{X} \\overset{\\widetilde{f}}{\\underset{\\widetilde{g}}{\\leftrightarrows}} \\widetilde{Y}$ is a homotopy equivalence. We have $p\\widetilde{g}\\widetilde{f} = gq\\widetilde{f}=gfp \\simeq p$ and $q\\widetilde{f}\\widetilde{g} = fp\\widetilde{g} = fgq \\simeq q$. This shows that $\\widetilde{g}\\widetilde{f}$ and $\\widetilde{f}\\widetilde{g}$ are covering translations (deck transformations) and are therefore homotopic to the respective identity maps. So we have a homotopy equivalence. Any comments would be appreciated.", "16.04 Japanese Text Input not working", "How do I delete a file whose name begins with \"-\" (hyphen a.k.a. dash or minus)?", "Name \"Chapter\" is not showed in the table of the content", "Been trying to this line to parse for a good 20mins, but all attempts have failed: \\beta = $-$0.84, t = $-$2.09, P = 0.04 Could anyone tell me why I'm getting a Missing $ inserted error here?", "Suspend process without killing it So I've got a persistent program running in the background. Killing it just causes it to restart with a different PID. I'd like to suspend it (put it to sleep without actually killing it). Does kill -9 do this? If not, how should this be done?", "Objective-C - When to use 'self'", "Passing HTML to template using Flask/Jinja2", "Could someone help me prove that given a finite measure space $(X, \\mathcal{M}, \\sigma)$ and a measurable function $f:X\\to\\mathbb{R}$ in $L^\\infty$ and some $L^q$, $\\displaystyle\\lim_{p\\to\\infty}\\|f\\|_p=\\|f\\|_\\infty$? I don't know where to start.", "About number truncation of ticks display in ListPlot", "Place each foot on a scale: can you add the two to find your weight? I frequent a blog from a British psychologist, and every Friday he likes to pose an interesting puzzle or riddle. The Monday after that he posts the answer. They're good fun, and IANAP but made my it-might-not-be-quite-as-simple-as-that detector go off. My question boils down to this: let's say I have two identical scales, and I stand on the scales with one foot on each scale. The scales read W1 and W2. Does my weight equal W1 + W2?", "EDIT: My question was poorly worded. I wasn't asking about showing $\\ln(1+x) &gt; \\frac{2x}{2+x}$ for $x&gt;0$. What I wanted to know is why the lower bound provided by $ \\frac{2x}{2+x}$ was so tight for small positive values of $x$. This is addressed in robjohn's answer.", "I have this weird object (vascular tree) which is empty inside, but closed from the top and the bottom: However, it is empty inside, which makes me unable to use boolean on a bigger object (I want to make a hole in an object through which this object will go through). So I thought I should fill it and then try to boolean. But, how do I fill it? Thank you sincerely.", "Converting GeoPDF to vector format like CAD or shapefile? I want to convert a GeoPDF that has vectors entity in it to a vector format and preserve the real coordinates of these vectors. The GeoPDF has been exported from ArcMap and has layers in it. I have try GDAL, but it rasterize the PDF before exporting it. Which is not good for me. Also I don't want a solution that would convert this image back to vectors, too complicated for the data I have. Is someone aware of any tool that can do that? The resulting format can be a CAD file or a shapefile or anything that is a vector format.", "If $A + A^t = 2I$ then $\\det(A) \\geq 1$" ]

[ "When I search for my address on Google Maps it cannot be found which means I can't order takeaway etc. Is there a way of adding my address to Google Maps or even add a street address? I want the address to be publicly available so others can search it.", "What is \"it\" in the following sentence: It is clear that Bob likes doughnuts I am very confused. Unless I am mistaken, I know \"it\" has to be a noun of some sort, but I am unable to figure out what noun \"it\" is referring to. What is \"it\" in the following sentence: It is clear that Bob likes doughnuts. Heres another couple of examples: It is impossible to fly.", "Normal text is invisible when using beamer with notes and XeLaTeX", "C# equivalent to wildcard imports in Java Is there a way in C# to import everything inside a namespace like there is in Java with the wildcard character? import java.awt.*;", "Windows 7 File Explorer search not working", "Windows 10 Icon Gone Missing TL;DR: The Windows 10 upgrade icon went missing. How do I get it back in order to update my system? I am running Windows 7 SP1. I woke up this morning... er, noon all excited about Windows 10. I had reserved my copy using the clever little icon in the taskbar a few weeks back, so I thought I would be set to go. I booted my computer and checked the icon to see if it would download the update. It still behaved the same as if Windows 10 wasn't launched yet. I supposed this was normal behaviour. After all, Microsoft can't roll out the update to everyone at once. Windows Update did want me to install several updates though. I installed KB2952664, KB3064209 and KB3048761. Everything went fine, and I was prompted to restart my system. After restarting, the icon wasn't there anymore. I tried a lot of solutions including the answers provided by our awesome community on , and the answer provided to posted on the Microsoft Windows support forums. How do I get the icon back in order to update my system? UPDATES: Installing from the Media Creation Tool does not working with an error \"Something Happened\" with as description \"Something Happened\". Both are translated from Dutch. I tried to install it from the Media Creation Tool using PowerISO to mount the created ISO. It will not accept my product key, even though I am able to verify my Windows installation is already registered and the product key is correct. I looked into the Event Log, and GWX-Ins has a bunch of error messages saying: Error message: GWX Main: App failed to start hresult. After that it says what is roughly translated to English as \"Cannot find the element\".", "I built a simple bridge rectifier. &ndash; Schematic created using I connected the output of the function generator with CH1 of my oscilloscope and with the input of the rectifier (using a T-Piece). The output goes into CH2. The original wave looks like this: After connecting CH2 the picture looks like this: While CH2 looks good, CH1 now shows the wave I would expect without capacitator but not the expected original wave. Could somebody explain why? I'm using a Gwinstek GDS-1072A-U Oscilloscope and a Gwinstek SFG-1003 function generator.", "I have a bibliography in which a particular author wrote two papers in the same year. Bibtex is sorting them alphabetically by title, but I want them listed chronologically. (So in the example below 'universal grammar' should precede 'English as a formal language'.) What's the appropriate way to flip the order? MWE: \\documentclass{article} \\usepackage{natbib} \\begin{document} ... formal semantics in the Montagovian tradition \\citep{montague1970aug,montague1970befl,montague1973ptq}. \\bibliographystyle{harvard} \\bibliography{test} \\end{document} This generates the text 'formal semantics in the Montagovian tradition (Montague, 1970b,a, 1973)' whereas I actually want '1970a,b,1973'. test.bib file for MWE: @incollection{montague1973ptq, title={The proper treatment of quantification in ordinary {English}}, author={Montague, Richard}, booktitle={Approaches to natural language}, editor={Hintikka, K. Jaakko J. and Moravcsik, Julius M.E. and Suppes, Patrick}, pages={221--242}, year={1973}, publisher={Dordrecht} } @article{montague1970aug, title={Universal grammar}, author={Montague, Richard}, journal={Theoria}, volume={36}, number={3}, pages={373--398}, year={1970}, publisher={Blackwell Synergy} } @incollection{montague1970befl, title={English as a formal language}, author={Montague, Richard}, booktitle={Linguaggi nella Societa e nella Tecnica}, editor={Visentini, Bruno and others}, publisher={Edizioni di Comunità}, pages={189--224}, year={1970} }", "Avoid synchronized(this) in Java?", "I have now almost completed my family tree, having each branch going back to approximately the French revolution, discovering dozens of previously unknown ancestors. I would like to share the family tree with my family, the problem is that I cannot have a tree in a nice format that could be printed on a standard A4 sheet (maybe using both sides or whathever). I have a SVG tree that use graphics, but it is unconventionally large and if scaled down to a A4 sheet, the text would be so small that it would not be legible. The maximum width is of about 50 ancestors of a generation, then it goes sparse again. I'd like to know if a format exist where the family tree (with direct ancestors only) would be printable, with names but also other complementary information, and the format should be printable as not all my family users are particularly skilled with computers.", "Change default XML comment snippet in Visual Studio When I hit /// in Visual Studio, is it possible to change the resulting snippet from this: /// &lt;summary&gt; /// /// &lt;/summary&gt; to this?: /// &lt;summary&gt;&lt;/summary&gt;", "Were these other people Chronicoms? We know that Enoch is a Chronicom, which is to say a sort of alien temporal observer. When Enoch and his agents came and kidnapped Coulson’s team, for the purpose of sending them where they wanted; were these other agents also Chronicoms? I’m inclined to think they must have been (would Enoch have shared their advanced technology and goals, etc. with mere mortals), but on the other hand only one pod was mentioned.", "Is there is a way to exclude nested subdirectory specified by a path to that dir from grep recursive search? Or I have to use ack or find for this? Here's what I want. Say I have this dir structure: dir/nesteddir/match.txt otherdir/nesteddir/match.txt How do I exclude first nesteddir only? Is it even possible using grep? Most obvious answer $ grep -r --exclude-dir=\"dir/nesteddir\" \"stringToFind\" . doesn't seem to work, nor do any of my experiments with various --exclude-dir paths using globbing, leading ./, etc. Reading man page and googling didn't help, the only mention of this usecase I found is this question: It was concluded that this is bug introduced in grep 2.12, but I'm using latest version (2.16) and grep's bugtracker () doesn't mention anything related to --exclude-dir, so I guess either it was fixed or it's an intended behaviour. Would be really nice to get some clarification.", "I am including pages using Ajax but I also need to include their respective javascript files, which requires removing the previous javascript files from memory at the same time. How can I unload the currently-loaded javascript files (as well as their code in memory) so that I can load the new page's files? They will more than likely conflict, so having multiple independent files' javascript files loaded.", "How to install Internet Explorer (multiple versions)? I am developing one site which has chat feature in Rails. I am using Ubuntu 12.04 LTS. I need to check that the site is IE9 because the chat feature using socket io of HTML5. I want to know that how to install IE9 in Ubuntu. I have looked at Chrome and Firefox extensions but if any standalone is available then please give me suggestion.", "My question comes from what I learned in the movies, considering I have not yet been able to read the books. I would just like to know why Severus Snape called himself the Half-Blood Prince? Did many people call him that or did he just think that it was a cool nickname? This question might be answered in the books so feel free to quote from it.", "What does Pirsig mean by \"Quality\"?", "How can I achieve more clarity in my photos of the moon? I took this photo of the blood moon this morning and I am finding many of my photos, especially landscape photos, have a significant lack of clarity. I'm not looking for a photo critique because I know this particular photo is crap. I'm looking to identify my source of failure to nail a significantly clear photo. Setup Canon EOS 70D with a 100-300 telephoto lens (I'm sorry I don't know the exact model. It's from Canon but not one of their professional quality lenses.) Aperture: f/5.6 Shutter: 1 sec. ISO: 1000 Focal Length: 300mm Metering mode: Spot White Balance: I manually set the WB to 5500 kelvin, it looked fine in live view. Focus Mode: Manual Drive: 2 sec timer delay Mounted on a decently stable tripod Process I turn on live view, and square up the target in the display. I then set my focal length, focus in using live view, adjust the focus as sharp as possible and take the pic. I've noticed that in this case, the picture was incredibly grainy, which doesn't translate to the final photo, but wonder if it has anything to do with it. This particular shoot I found it difficult to balance out the variables with a dark sky and a moving moon that starts blurring after 1-2 seconds of exposure, which is why I had the aperture wide open and the ISO cranked up. I can't tell where I'm failing: Equipment: The 70d takes great photos but the telephoto is not great when it's totally zoomed in. My wallet doesn't hold enough cash for a motorized mount to track objects in the sky. Circumstance: I've seen great photos of the moon with the use of a camera and a tripod, so I know this is possible. Although, I keep seeing pictures of this big gorgeous moon over the landscape, and when I use my wide-angle, the moon shows up as a dot. What the hell are people doing to get the moon so big? Beginner skill level: I know this is the biggest culprit, but being the beginner, I'm unable to know where to adjust.", "Searching for a string on multiple zip files", "Short story collection about Transporter \"Doors\" I'm looking for a short story collection about different uses/inventions of transporter doors. I think it was just a single author collection, that I read in the early 2000s. In each story these Transporter Doors exist, I seem to remember them being described as blank grey sheets. You step through them and come out somewhere else. The forward to the book talked about early Rocket stories where the launch of a spaceship would be the end of the tale. Plots of the individual stories: Two men one of whom's home is inside an asteroid are discussing the use of Base12 in their society and if it is because they have 12 fingers, one says that \"people\" used to use base10. The implication is that a different species arrived through the doors and replaced humans. A man puts the code for his home into a door and is instead transported to prison where he's accused of murdering his wife, which he strongly denies. Two scientists and a pilot take a probe ship deep into Jupiter's atmosphere, the will return to base via a door that they need to construct while they are down there. The scientists dislike each other and don't work well together. When they finish the door, the hamsters seem woosy out the other side, but the scientists insist it is ready. The pilot says he will go first as he can't fix it if it's wrong. When he arrives on the far side he's mentally damaged and the scientists have to get along without him acting as a buffer while the try to save themselves." ]

[ "How can I check dependency list for a deb package How can I check dependency list for a deb package. I am running Ubuntu 11.10 and I have backed up all deb packages from var/cache/apt/archives. I want to format my pc and re-install selected applications only. Also how can I get the list of installed packages and dependencies.", "Possible to have the default landing page of my Sharepoint Site be an applicaiton page? So basically when someone goes to: http://mysite.com I would like to show an Application Page that I have created, without the giant URL. Example of the giant URL : http://mysite.com/_layouts/ap/myAppPage.aspx Is there any way for me to do this?", "Let $V$ be an n-dimensional vector space over $\\mathbb{R}$ and $T:V \\rightarrow V$ be linear. Call a vector $v \\in V$ cyclic if $V$ is spanned by $\\{v, \\ Tv, \\ T^2v,..\\}$. Question: Show that $v$ is cyclic for $T$ then there is some $k \\geq 1$ such that $$B=\\{v, \\ Tv,..T^{k-1}v \\}$$ is linearly independent in $V$ and that $T^kv$ lies in the span of $B$. Thoughts: If we suppose that no such $k$ exists, then every subset of the form $\\{v, \\ Tv,..T^{l-1}v \\}$ is linearly dependent, or it is linearly dependent with $T^lv$ not lying in it span. There are in effect then two cases to consider. Suppose every subset of the form $\\{v, \\ Tv,..T^{l-1}v \\}$ is linearly dependent. Then $T^{l-1}$ can be expressed as a linear combination of $v,...,T^{l-2}v$. Now, $\\{v, \\ Tv,..T^{l-2}v \\}$ is also linearly dependent by assumption and so we can express $T^{l-2}$ as a linear combination of $v,...,T^{l-3}v$ etc... Continuing in this way, we show that $T^{l-1}v= \\lambda v$ for some $\\lambda \\in \\mathbb{R}$. Thus $$B=\\{ \\mu v \\ | \\ \\mu \\ \\text{is an eigenvalue of} \\ T^mv \\ \\text{for some} \\ m \\}$$ This is 'at best' countably infinite, and therefore could not span $V$ even if it were 1-dimensional, wince our base field is $\\mathbb{R}$, which is uncountable. Suppose then that $B$ is linearly independent for some $k$ but that $T^kv$ does not lie in its span. I can't see how to progress this argument. Note: This question is for second year Undergraduates, and I think there must be some more simple approach; even the first part surprises me if we need to argue using the uncountability of $\\mathbb{R}$, so any alternative approaches are also appreciated.", "How do you get \\mathbb{1} to work (characteristic function of a set)?", "is there a way to get the option \"Organize Desktop by Name\" in Ubuntu 19.10 same as in 18.04? the option in Ubuntu 18.04 is \"Organize Desktop by name\" But there is no option available in Ubuntu 19.10", "How to mount PCIe SSD from MacBook Air in another computer I got this SSD out of an Apple laptop that's broken from liquid damage. What is this connection called and how do I mount this storage device to retrieve data from it? It looks like PCIe. Does Apple sell a part to mount this via USB adapter or something?", "Can we have a way to edit bounty custom message?", "Is there a constructive way to exhibit a basis for $\\mathbb{R}^\\mathbb{N}$?", "I go to change my birthdate on Roblox, but nothing shows up, the dropdowns are just blank with no Month, Day or Year: It also shows me a pop up asking to put in the Missing Details to improve the experience, but no matter how many times I put in my age it doesn't save and asks it again.", "I am creating a chat using Ajax requests and I'm trying to get messages div to scroll to the bottom without much luck. I am wrapping everything in this div: #scroll { height:400px; overflow:scroll; } Is there a way to keep it scrolled to the bottom by default using JS? Is there a way to keep it scrolled to the bottom after an ajax request?", "To find all $n$ such that $(n-1)!+1$ is a perfect power of $n$ How to find all positive integers $n$ such that $(n-1)!+1$ can be written as $n^k$ for some positive integer $k$?", "'pyrcc5' is not recognized as an internal or external command", "The real fastest gun in the west Are the questions in the about page taken from real posts? If not, who designs them? Particularly, why does this specific answer have a date from before the question was asked?", "Is it possible to run Snow Leopard on a LATE 2011 MacBook Pro?", "Local collection of Python packages: best way to import them?", "I downloaded and installed Ubuntu from the official site. However, I don't know if I installed the 32-bit or 64-bit version. In Windows 7 I could right click My Computer and it listed which version it was. Is there an easy way to check in Ubuntu?", "Can the Help action be used to give advantage to a specific ally's attack (rather than just the next ally who attacks the target)?", "Do I need internet/3G to use GPS? I have a Samsung Galaxy S2 that has some problems with the GPS: If I use internet my navigation works but when I turn the 3G off, GPS does not work. Do I need internet/3G to use GPS?", "How to disable the skype ads (advertisement)?", "How to backup an Android device?" ]

[ "Finding a ray that intersects a polygon as many times as possible", "Efficiently replace all accented characters in a string?", "CSH - How to check if input is NOT number Need to apply it on csh. to check if the inputted $2 is not number nor the word \"all\" if ($#argv == 2 &amp;&amp; ($2 != all &amp;&amp; $2 != **any number**)) then echo \"wrong parameter\"", "If a linear operator has an adjoint operator, it is bounded", "I've ran out of chocolate bars and didn't realize I could enchant my giant spoon and knight's armor. Is there any way to get more reliably?", "Password Reset for Users on a Multisite Subsite I have a multisite network. I want my users to be able to reset their passwords while staying within their subsites. So for example clicking the \"lost your password?\" link keeps them within their subdomain (subdomain.domain.com/wp-login.php?action=lostpassword) as opposed to taking them to the main site (domain.com/wp-login.php?action=lostpassword). After they submit the username or email to reset the password, I would like for that email to contain links back to their subdomain and not the main site as is the default functionality. Prior to the 4.0 update I was able to use this patch and ultimately this plugin to get the exact functionality described above. All was great. However after the update it is no longer working. Asking for assistance in the various places referenced has still not helped solve the problem. Is anyone able to help?", "One of the most commonly asked questions of beginners. How do ranks work in Go for amateurs? Why do we start backwards? And why do we suddenly count upwards again? What is the difference between 9d and 9p? How is this related to rating? What are the basic differences between ranks used in different countries and different servers?", "Why do RAW images look worse than JPEGs in editing programs? I've found that when you load a RAW image into an editing program such as Lightroom/Aperture, the image is usually worse than if you just took the image as JPEG. Now I understand that the camera does some magic during the JPEG conversion. But I'm trying to understand what that \"magic\" is. If I'm looking to implement that \"magic\" myself on the desktop, what kind of settings should I be trying? I find that the RAW files have more extreme contrast. The dark areas for example are way darker than JPEG. Why is this? And what is the best way to fix this?", "TeX capacity exceeded with glossary package My document contains many thousands of glossary items. When compiling with XeLaTeX, about 1/8 of the way through the document, it reports: ! TeX capacity exceeded, sorry [main memory size=3000000]. \\@glolist@ ...},{13586},{9406},{4539},{12811},{179 51},{5831},{1047},{14948}, The numbers you see above are ones placed in #1 of \\newglossaryentry{#1}{#2}. These unique numbers are assigned to each entry for convenience. I have successfully compiled short tests of the document, which only used 1% of the full content. The resulting .glo file is about 1 MB in size. Could this be the result of some error on my part or am I giving TeX too much work to do? Update: I have followed the instructions below (edited texmf.cnf and running fmtutil-sys --all. This has allowed me to compile an additional portion of the book, but no matter the settings I add, I can't go beyond 5/8 of the way through. A compile with extra_mem_top.xelatex = 30000000 and extra_mem_top.xelatex = 50000000 both result in: TeX capacity exceeded, sorry [pool size=3186676]. Update: I have done the following: $ kpsewhich texmf.cnf /usr/local/texlive/2011/texmf.cnf $ nano /usr/local/texlive/2011/texmf.cnf To the texmf.cnf file, following instructions at , I added: main_memory = 230000000 extra_mem_top = 10000000 extra_mem_bot = 10000000 save_size = 150000 stack_size = 150000 main_memory.xelatex = 30000000 extra_mem_top.xelatex = 30000000 After this, I tried: - fmtutil-sys --all, then compiling xelatex file.tex. - fmtutil --all, then compiling xelatex file.tex. - fmtutil-sys --byfmt xelatex, then compiling with xelatex file.tex. - texhash, then compiling with xelatex file.tex. All of these resulted in no changes in results. I still get: TeX capacity exceeded, sorry [pool size=3186676].", "Can't open a folder in windows 7 64bit, by double clicking, it shows me that the default option for opening folder is \"cmd\" (it's highlighted when i'm right clicking a folder, and the \"open\" option comes next). I've tried running some registry fixing tools, but it didn't fix it. Can someone suggest me what should I do.", "I am trying to classify using randomForest classification in GEE . However, I always get the error User memory limit exceeded, so I assume the number of the feature are too large. Nevertheless, I saw many developers can classify even bigger dataset, so I am wondering if there is a better option there? The code can be accessed via var fire= ee.FeatureCollection('users/spatola/recovery_rf_1712').map(function(feature){ var num = ee.Number.parse(feature.get('CLC_311')); return feature.set('CLC_311', num); }) var indices= ['EVI_mean','Dnbr','NBR2_mean','NBR2_min','NBR2_max','EVI_min','EVI_max']; var fire1= fire.filter(ee.Filter.notNull(indices)); var fire2= fire1.select('Class_R','Dnbr','EVI_max','NBR2_max','imageId') var bands= ['NBR2_max', 'EVI_max']; var classProperty= 'Class_R'; var random= fire2.randomColumn('random'); var split_train= 0.8; var split_test= 0.2; var trainPartition= random.filter(ee.Filter.lt('random',split_train)); var testPartition= random.filter(ee.Filter.gte('random',split_test)); var RFtrained_c= ee.Classifier.smileRandomForest({ numberOfTrees: 100, minLeafPopulation:2, seed: 123, }) .setOutputMode('CLASSIFICATION') .train({ features: trainPartition, inputProperties: bands, classProperty: classProperty, }) print(RFtrained_c); var dict = RFtrained_c.explain(); var test = testPartition.classify(RFtrained_c) print(test.first())", "Variance of a linear combination of vectors Let $A$ and $B$ be two constant matrices and let $x$ and $ y$ be two random vectors, what is the general formula for $Var(Ax+By)$? I know the formula for when $x$ and $y$ are scalar random variables and $A$ and $B$ are constants, but what about the matrix case?", "Cross-site AJAX requests I need to make an AJAX request from a website to a REST web service hosted in another domain. Although this is works just fine in Internet Explorer, other browsers such as Mozilla and Google Chrome impose far stricter security restrictions, which prohibit cross-site AJAX requests. The problem is that I have no control over the domain nor the web server where the site is hosted. This means that my REST web service must run somewhere else, and I can't put in place any redirection mechanism. Here is the JavaScript code that makes the asynchronous call: var serviceUrl = \"http://myservicedomain\"; var payload = \"&lt;myRequest&gt;&lt;content&gt;Some content&lt;/content&gt;&lt;/myRequest&gt;\"; var request = new XMLHttpRequest(); request.open(\"POST\", serviceUrl, true); // &lt;-- This fails in Mozilla Firefox amongst other browsers request.setRequestHeader(\"Content-type\", \"text/xml\"); request.send(payload); How can I have this work in other browsers beside Internet Explorer?", "running rmi server, classnotfound", "Terminal limits scrolling I have a running log, it outputs a lot to the terminal. Unfortunately, when I try to scroll up and view older output, it appears there is a limit. And I am unable to scroll past a certain point. On the Mac, the terminal allows you to scroll up to the start of the session. Is there a way to do this in ubuntu terminal?", "Vertical line of white pixels between launcher and maximized application (Firefox) Is this a bug or is it expected? How can it be solved if it's not expected?", "Is it ever bad to use \\left and \\right? For mathematics, is it ever disadvantageous to use \\left( and \\right) in equations? I can't see any way that doing this would hinder the typesetting, so why isn't () just converted into \\left( \\right) automatically? This would save a lot of typing. Cheers!", "Dial PPPoE connection on Windows startup Is there a way to automatically dial a PPPoE connection on startup? In Mac OS X, this is done automatically after login. It was also possible in Windows XP: when creating a new connection, it also created a shortcut to it on the desktop. Adding it to the startup folder and setting it to not prompt for credentials solved the problem. But in Vista and Windows 7, there are no shortcuts to the newly created connections, so I can't do the same thing here. Is there any other way to do this?", "I found Minecraft's marvelous large worlds extremely slow to navigate, even with a quad core and meaty graphics card. I assume Minecraft's slowness comes from: Java, as spatial partitioning and memory management are faster in native C++. Weak world partitioning. I could be wrong on both assumptions. However, this got me thinking about the best way to manage large voxel worlds. As it is a true 3D world, where a block can exist in any part of the world, it is basically a big 3D array [x][y][z], where each block in the world has a type (i.e BlockType.Empty = 0, BlockType.Dirt = 1, etc.) I assume that to make this sort of world perform well, you would need to: Use a tree of some variety (//) to split all the cubes out; it seems like an oct/kd would be the better option, as you can just partition on a per cube level not a per triangle level. Use some algorithm to work out which blocks can currently be seen, as blocks closer to the user could obfuscate the blocks behind, making it pointless to render them. Keep the block object themselves lightweight, so it is quick to add and remove them from the trees. I guess there is no right answer to this, but I would be interested to see peoples' opinions on the subject. How would you improve performance in a large voxel-based world?", "I can't execute newest Blender 2.80, it says that I need a graphics card that supports OpenGL 3.3 or higher ERROR: A graphics card and driver with support for OpenGL 3.3 or higher is required Processor: AMD A6-3670 APU with Radeon(tm) HD Graphics, 2695MHz BIOS Version: HPQOEM - 1072009 Dedicated GPU: This is a very old PC, but when I search online it seems that theoretically Blender 2.8 should run since my openGL is 4.4" ]

[ "Why is it safe to use 15 A receptacles on a 20 A circuit?", "Using induction, how can I show the following identity about the fibonacci numbers? I'm having trouble with simplification when doing the induction step. Identity: $$f_n^2 + f_{n+1}^2 = f_{2n+1}$$ I get to: $$f_{n+1}^2 + f_{n+2}^2$$ Should I replace $f_{n+2}$ using the recursion? When I do that, I end up with the product of terms, and that just doesn't seem right. Any guidance on how to get manipulate during the induction step? Thanks!", "Why does a 'sudo -i' login shell break a here-doc command string argument? In the sequence of five commands below, all depend on single-quotes to hand off possible variable substitution to the called bash shell rather than the calling shell. The calling user is xx, but the called shell will be run as user yy. The first command substitutes $HOME with the calling shell's value because the called shell is not a login shell. The second command substitutes the value of $HOME loaded by a login shell, so it is the value belonging to user yy. The third command does not rely on a $HOME value and creates a file in the guessed home directory of user yy. Why does the fourth command fail? The intention is that it writes the same file, but relying on the $HOME variable belonging to user yy to ensure it actually does end up in her home directory. I don't understand why a login shell breaks the behaviour of a here-doc command passed in as a static single-quoted string. The failure of the fifth command verifies that this problem is not about variable substitution. xx@host ~ $ sudo -u yy bash -c 'echo HOME=$HOME' HOME=/home/xx xx@host ~ $ sudo -iu yy bash -c 'echo HOME=$HOME' HOME=/home/yy xx@host ~ $ sudo -u yy bash -c 'cat &gt; /home/yy/test.sh &lt;&lt; \"EOF\" &gt; script-content &gt; EOF &gt; ' xx@host ~ $ sudo -iu yy bash -c 'cat &gt; $HOME/test.sh &lt;&lt; \"EOF\" &gt; script-content &gt; EOF &gt; ' bash: warning: here-document at line 0 delimited by end-of-file (wanted `EOFscript-contentEOF') xx@host ~ $ sudo -iu yy bash -c 'cat &gt; /home/yy/test.sh &lt;&lt; \"EOF\" &gt; script-content &gt; EOF &gt; ' bash: warning: here-document at line 0 delimited by end-of-file (wanted `EOFscript-contentEOF') These commands were issued on a Linux Mint 18.3 Cinnamon 64-bit system, which is based on Ubuntu 16.04 (Xenial Xerus). Update: The here-doc aspect is just clouding the issue. Here's a simplification of the problem: $ sudo bash -c 'echo 1 &gt; echo 2' 1 2 $ sudo -i bash -c 'echo 1 &gt; echo 2' 1echo 2 Why does the first of those two commands preserve the linebreak and the second does not? sudo is common to both commands, yet seems to be escaping/filtering/interpolating differently depending on nothing but the \"-i\" option.", "When I press F3 to see the debug screen in I use Minecraft 1.8.1, some information is missing. Most notably, there are no X, Y, Z coordinates. What happened to my debug overlay?", "Can FFMPEG extract images from a video with timestamps?", "Does the ANSI standard mandate the logical operators to be short-circuited, in either C or C++? I'm confused for I recall the K&amp;R book saying your code shouldn't depend on these operations being short circuited, for they may not. Could someone please point out where in the standard it's said logic ops are always short-circuited? I'm mostly interested on C++, an answer also for C would be great. I also remember reading (can't remember where) that evaluation order isn't strictly defined, so your code shouldn't depend or assume functions within an expression would be executed in a specific order: by the end of a statement all referenced functions will have been called, but the compiler has freedom in selecting the most efficient order. Does the standard indicate the evaluation order of this expression? if( functionA() &amp;&amp; functionB() &amp;&amp; functionC() ) cout&lt;&lt;\"Hello world\";", "I am trying to remove the Facebook and Messenger apps from my Asus Zenphone Laser 2. Unfortunately, in both cases, I seem to be unable to find the option to fully delete them from the device. I have disabled them, but the app management screen now shows the following: How can I fully delete/uninstall them?", "TV documentaries invariably show the Big Bang as an exploding ball of fire expanding outwards. Did the Big Bang really explode outwards from a point like this? If not, what did happen?", "Basic Electronics Book", "I have been reading Hamilton Chapter 13 and he has the following state space representation for an ARMA(p,q). Let $r = \\max(p,q+1)$.Then the ARMA (p,q) process is as follows: $$ \\begin{aligned} y_t -\\mu &amp;= \\phi_1(y_{t-1} -\\mu) + \\phi_2(y_{t-2} -\\mu) + ... + \\phi_3(y_{t-3} -\\mu) \\\\ &amp;+ \\epsilon_t + \\theta_1\\epsilon_{t-1} + ... + \\theta_{r-1}\\epsilon_{t-r+1}. \\end{aligned} $$ Then, he defines the State Equation as follows: $$ \\xi_{t+1} = \\begin{bmatrix} \\phi_1 &amp; \\phi_2 &amp; \\dots &amp; \\phi_{r-1} &amp; \\phi_r \\\\ 1 &amp; 0 &amp; \\dots &amp; 0 &amp; 0 \\\\ \\vdots &amp; \\vdots &amp; \\dots &amp; 0 &amp; 0 \\\\ 0 &amp; 0 &amp; \\dots &amp;1 &amp;0 \\end{bmatrix} \\xi_t + \\begin{bmatrix} \\epsilon_{t+1} \\\\ 0\\\\\\vdots \\\\ 0 \\end{bmatrix} $$ and the observation equation as: $$y_t = \\mu + \\begin{bmatrix} 1 &amp; \\theta_1 &amp; \\theta_2 &amp; \\dots &amp; \\theta_{r-1} \\\\ \\end{bmatrix} \\xi_t. $$ I do not understand what the $\\xi_t$ is in this case. Because in his AR(p) representation it is $\\begin{bmatrix} y_{t} - \\mu \\\\ y_{t-1} - \\mu\\\\\\vdots \\\\ y_{t-p+1} - \\mu \\end{bmatrix} $ and in his MA (1) representation it is $\\begin{bmatrix} \\epsilon_{t} \\\\ \\epsilon_{t-1} \\end{bmatrix} $. Could someone explain this to me a little bit better?", "Is $v=\\ (r_i)^{-1}\\cdot z $, a uniformly random value of a field? We consider a finite field $\\mathbb{F}_q$ where $q=2p+1$ and $q$ and $p$ are prime numbers. Let $r_i$ be a value picked uniformly at random from the field such that $r_i&gt;\\frac{q}{2}$. Let $z$ be a fixed field element. Question: Is $v=(\\ (r_i)^{-1}\\cdot z) \\bmod q$, a uniformly random value of the field?", "During real, everyday use, that is? I'm looking to upgrade a drive in a MacBook Pro, and am looking at either a 750GB/7200RPM or a 1TH/5400RPM drive. Would I care about the speed difference? Is it worth giving up the additional space on the larger drive?", "How to change from csh to bash as default shell I have csh as my default shell, as shown by echo $SHELL. I want to switch to bash as my default shell. I tried the following approaches to no avail: With chsh I get: chsh: can only change local entries; use ypchsh instead. With ypchsh I get: ypchsh: yppasswdd not running on NIS master host (\"dcsun2\"). I only have .chsrc in my home directory and I cannot find any .profile files in /etc. How can I change my default shell to bash?", "How to prove polynomials with degree $n$ does not form a vector space? This is one of my linear algebra problems: Prove that polynomials of degree $n$ does not (The professor made these words bold intentionally) form a vector space. From what I read, the set of polynomials of degree $n$ should be a vector space, because: There is an \"One\" and a \"Zero\" in this set; We can find inverse for addition and multiplication from this set; It follows all the axioms of addition. It follows all the axioms of scalar multiplication. Then can someone give me some hints to prove it does not form a vector space?", "Halo particles don't render in Cycles", "I want my app automatically know user phone number by accessing their SIM Card", "Are \"w/o\", \"w/\", \"b/c\" common abbreviations in the US?", "Name of a special matrix I have a matrix which is kind of symmetrical with the other diagonal, i.e., something like $$A = \\left[ \\begin{array}{c c c c} a &amp; b &amp; c &amp; d \\\\ e &amp; f &amp; g &amp; c \\\\ h &amp; i &amp; f &amp; b \\\\ j &amp; h &amp; e &amp; a \\end{array} \\right]$$ Does this matrix have a special name in literature? What are it's properties? And a matrix that is symmetrical by both diagonals $$A = \\left[ \\begin{array}{c c c c} a &amp; b &amp; c &amp; d \\\\ b &amp; e &amp; f &amp; c \\\\ c &amp; f &amp; e &amp; b \\\\ d &amp; c &amp; b &amp; a \\end{array} \\right]$$ What's the name of it? Any interesting properties?", "What does ':' (colon) do in JavaScript?", "What is a good SSH server to use on Windows? In my spare time I remotely support my wife's office via VPN into a Windows Server. I am about to purchase a wireless broadband service which doesn't support VPN. I don't want to open up the remote desktop ports directly, and I would like to set up an SSH tunnel into the network, and if necessary then VPN over the top of that. What is the best windows SSH Server implementation to use on a Windows 2003 Server, or should I just be using ?" ]

[ "if $(x_0,y_0)$ is local extrema in $ax^2 + by^2 + cxy + dx + ey + l$ then its global too. An exercise on a book asks me to prove that if a point $(x_0,y_0)$ is a local extrema for the function $$f(x,y) = ax^2 + by^2 + cxy + dx + ey + l$$ then it's also a global extrema. The exercise asks me to consider that $g(t) = f(x_0+ht,y_0+kt)$ is a parabola, but I couldn't understand how it helps. Maybe since it's a parabola, I know that this derivative has to be $0$ in some point, and also that this function $g(t)$ has a global extrema point, but I couldn't derive anything from this. I also tried to find the derivatives, equal them to $0$ and solve the system. I got: $$x_0 = -\\frac{2 b d - c e}{4 a b - c^2}, y_0 = -\\frac{ c d - 2 a e}{-4 a b + c^2}$$ But when I try to find $$f\\left(-\\frac{2 b d - c e}{4 a b - c^2},-\\frac{ c d - 2 a e}{-4 a b + c^2}\\right)$$ so I can try to prove: $$f(x,y)-f(x_0,y_0)$$ is either greater or less $0$ depending on the case (so I can do $f(x,y) \\le f(x_0,y_0)$ and $f(x,y) \\ge f(x_0,y_0)$) things get hairy.", "I'm taking a look at (now removed), which all seem to be pretty much the same. Should any be downvoted/flagged, and if so, which ones?", "I was using this: To try and create numbered examples in my document. However, when I load it and put the example exe in that link in one of the separate Tex files (Introduction.tex) I include in main.tex, I get: ./Chapters/Introduction.tex:14: TeX capacity exceeded, sorry [parameter stack s ize=10000]. \\gb@ifnextchar #1#2#3-&gt; \\let \\reserved@d =#1\\def \\reserved@a {#2}\\def \\reserv... l.14 ... and political news \\cite{washington_post} . More importantly, when ... Which is not even referring to the exe example I inserted but a couple of blocks of tex above it. For info, here is my full code before my document begins: \\documentclass{report} % [fontsize=11pt,border=5pt] % standalone for the tree \\usepackage{forest} % This overrides warnings like http://tex.stackexchange.com/questions/52576/difference-between-bookmark-levels-greater-than-one-what-does-this-mean \\usepackage{bookmark} \\usepackage{amsmath} \\usepackage{subcaption} \\usepackage{standalone} \\usepackage[round]{natbib} \\usepackage[T1]{fontenc} \\usepackage{lmodern} \\usepackage[utf8]{inputenc} % This is for hyperlinks \\usepackage{hyperref} \\hypersetup{ colorlinks=true, linkcolor=blue, filecolor=magenta, urlcolor=cyan, } \\urlstyle{same} % Not sure why I need to use this % \\usepackage{graphicx} % \\graphicspath{ {images/} } % \\usepackage[pdftex]{graphicx} % fontsize=11pt,twoside]{scrartcl} % This is for numbered examples \\usepackage{gb4e} Would appreciate some help as I feel like my Latex is very messy here.", "How do I know if food left at room temperature is still safe to eat? If I left food out of the refrigerator for some period of time, is it still safe? If I left it out too long, can I salvage it by cooking it more?", "When I create beamer frame, the content is centred in the slide. How do I make the content move to the top of the slide by default?", "What size images do I need for common print sizes, such as wallet size, 8x10, and 16x20? Is there a general formula? How could that size change if, for example, a 16x20 was printed on canvas rather than photopaper?", "If a function $f$ is continuous $\\implies$ $|f|$ is continuous.(Answered by Myself) $(i)$ Given a function $f:E \\rightarrow \\mathbb{R}$ define $|f|:E \\rightarrow \\mathbb{R}$ by $|f|(x)=|f(x)|$ for $x \\in E$ show if $f$ is continuous at $c \\in E$ then so is $|f|$. $(ii)$ Now the converse is not true, find $f$ such that $|f|$ is continuous but $f$ is not.", "Remove Background in Inkscape", "Indecomposable limit ordinals", "Since the Stack Exchange sites run on one clock, and a clock that is not common to most of us (such as those of us in the US), can we display a clock with the site time (UTC) displayed somewhere on every page, such as at the bottom with the other text? That way we are more aware of when the days turn over, and ecetera... close votes, delete votes, flags, and normal votes would also benefit from this as well (thanks @Grace Note!)... What do you guys think? yea or nay? thoughts?", "How do I find my follower if and when they leave me? I had parked my follower at an inn with a bunch of valuable items that I didn't want to carry. I guess I have been out a bit too long as this message appears: Your follower tires of waiting and leaves. There have been other situations where my follower has mysteriously disappeared as well. How can I find my follower when they get up and leave or disappear into thin air?", "Why Wi-Fi is getting turned-on automatically in iOS 11", "TikZ: Bend text so that it follows a line I have two arrows going from a node on the left to a node on the right. Both arrows are slightly bent. I want to label the arrows with text that is bent just like the arrows. This is as far as I've got: \\begin{tikzpicture} \\node (One) at (-3,0) [shape=circle,draw] {One}; \\node (Two) at (3,0) [shape=circle,draw] {Two}; \\draw [-&gt;, thick] (One) to [bend right=45] (Two); \\draw [-&gt;, thick] (One) to [bend left=45] (Two); \\node (mental) at (0,1.75) {Some bent text}; \\node (non-mental) at (0,-1.75) {Some more bent text}; \\end{tikzpicture}", "Why does Yoda speak the way he does? Yoda's unique speech consisting of reversed grammar is iconic. Is there any reason he has adopted this speech pattern? All other alien species encountered seem to have no trouble speaking normally. Why does Yoda speak in this way?", "I can't destroy blocks in Minecraft Creative Mode (singleplayer)", "The statement is: $f$ is a real fucntion on $\\mathbb R$. Then if $f'(x)=f(x)$ and $f(0)=1$, then $f(x)\\neq 0.$", "Can a probability distribution value exceeding 1 be OK?", "How do I rename a domain and preserve SEO? As part of graduating from Area51 and becoming a full fledged site we sometimes change domain names from http://topic.stackexchange.com to http://example.com. Aside from the obvious 301 redirect rules to support existing urls transparently, are there other techniques that would aid in the preservation of SEO?", "releasing a second question concerning ordered stuff and set theory, which is very similar to my first question () which I'm putting here for reference. The next problem that I'm stuck at in my book is this: we have an ordered triple $(a,b,c)$ and we want to define it using set theory. Why would $\\{\\{ a\\} ,\\{ a,b\\} ,\\{ a,b,c\\}\\}$ not work? The book requires from me to prove why it is not valid. Additional info: I don't know how this matters but I'm gonna put it up anyhow. It is written within the book that the correct way to show it is $\\{\\{ a\\} ,\\{\\{ a\\} ,\\{\\{ b\\} ,\\{ b,c\\}\\}\\}\\}$ EDIT: Now, I consider that the correct case should matter. Besides pointing out why the first case is wrong I'm curious as to why the second one is correct", "Where is composition tab in QGIS Composer to change page size? I am trying to change the page size in the QGIS 3.0 Composer but I am not able to see the Composition tab. I have right clicked an empty space in the toolbar but did not see anything about composition. I am using Windows 7. I tried looking at the QGIS docs but they are still in testing." ]

[ "Is it possible to have connecting loop lines (like algorithm2e) in algorithmic?", "I am planning to visit Moscow this winter as a solo tourist. I am a Hungarian citizen. I booked airplane tickets myself. I was informed that I will need an invitation letter, and I think I will go this way: (), but now the tourist visa application online form asks: the options are: None, Travel company. I think I will need to select travel company because the description says: In the case of a tourist visa select \"Travel company\" from the list and give the name and address of the travel company. In the case of business visa select \"Organization\" from the list and enter in the \"Name of organization\" name of the host organization, enter the address of the organization and TIN in the appropriate fields. In the case of private visa select “Individual” from the list and enter the name, birth date and home address of the host. In the case of transit, select \"None\" from the list. Reference number: printed on the bottom line of approval of a foreign tourist \"Референс №». It is necessary to introduce whole number with leading zeros. Confirmation number: printed on the top line of confirmation of a foreign tourist. The number can contain only numbers or numbers with letters. You should only enter the numbers. However I do not have a travel company. What do I do? Select \"None\" from the drop down so that I don't have to fill in travel company(this seems to be against the description that says select travel company for tourist visa) Select Travel company and the Invitation letter company will be my travel company and they will provide appropriate details? as in () Apply at some additional travel company, because there is no other way? Some other option? I didn't expect the visa application to be this complicated. I hope I get there.", "How to make a press proof with crop marks and color bars? A standard proof for press needs crop marks and color bars as below With the package crop, the crop marks can be easily added. But how about the color bar ? Is there a way or a package to make it ? An example is \\documentclass[b5paper,10pt]{article} \\usepackage[utf8]{inputenc} \\usepackage[cross,a4,center,info,axes]{crop} \\title{Test} \\author{User} \\begin{document} \\maketitle \\section{Fox} The quick brown fox jumps over a lazy dog. \\end{document}", "I have a file containing lists on Solaris: List A hi hello hw r u List B Hi Yes List C Hello I need to transpose the lists as shown below: List A List B List C hi Hi Hello hello Yes hw r u How can I do this on Solaris?", "I want to describe my business and want to refer to it in a sentence. I am trying to say: \"In 2015 we established a business (that is) named X\". Intuitively, the \"that is\" part is redundant, and makes the sentence more cumbersome. But I cannot think of a reason why we should be able to drop the verb. Is the version without the \"that is\" part grammatically correct? How can it be explained?", "Example where Hamiltonian $H \\neq T+V=E$, but $E=T+V$ is conserved I'm looking for an example of a Hamiltonian $H$, where $H\\neq T+V$, but the total energy in the system, $E=T+V$, is still conserved. While I'm at it, I might as well add that I'd be most interested in an example from a classical field theory. Furthermore, I am looking for a nontrivial example, e.g. where $H$ doesn't just differ from $E$ by some gradient function that integrates to 0 in the action. In particular, I am trying to get a better understanding of the physical implications of $H$ being conserved when nontrivial variables are used, i.e. physically, what does $H$ this correspond to. Conversely, can one have a system where $E = H$ in one frame, and is conserved, while in another frame $E'\\neq H'$, and $H'$ is conserved while $E'$ is not?", "How to grep for text in a file and display the paragraph that has the text?", "Cutting a circular hole in a hollow cylinder without distorting the cylinder Whenever I try to cut out a circular hole in either a cylinder or sphere the polygons around the circular hole always have distorted normals after smoothing. Is there anyway to fix this. I've tried using the remesh modifier but wind up with some pretty ugly results.", "Undefined variable as function argument javascript", "Let's say you have a typical web app and with a file configuration.whatever. Every developer working on the project will have one version for their dev boxes, there will be a dev, prod and stage versions. How do you deal with this in source control? Not check in this file at all, check it with different names or do something fancy altogether?", "unsigned int vs. size_t I notice that modern C and C++ code seems to use size_t instead of int/unsigned int pretty much everywhere - from parameters for C string functions to the STL. I am curious as to the reason for this and the benefits it brings.", "Intuition of pdf of a continuous random variable What is the intuition behind the probability density function of a continuous random variable? Integrating it within two points provides the probability that is associated between two points, but if you plug a single value into $f(X=x)$, it outputs a value. What is the intuitive understanding of this value for a given x? For example, in the above image, the value of the red curve at x=0 is 0.4. How can 0.4 be interpreted?", "Can't boot into Ubuntu in Windows 10 / Ubuntu dual boot", "How can I prove that if $G$ is an Abelian group with elements $a$ and $b$ with orders $m$ and $n$, respectively, then $G$ contains an element whose order is the least common multiple of $m$ and $n$? It's an exercise from Hungerford's book, but it's not homework. I could not solve it when I take the course on groups and I think it should be easy. There is a hint that says to first prove when $m$ and $n$ are coprimes. I did this part. But I have no idea how to solve the general case. Thanks.", "How to show $\\alpha\\int_a^cf(x)dx+\\beta \\int_c^b f(x)dx =0$ means $f(x)=0$ everywhere $?$ Question : Let $$f\\ :\\ [a,b]\\rightarrow \\mathbb R$$ be continuous . And there exist constants $\\alpha$ $\\beta$ such that $\\forall c\\in [a,b]$ $$\\alpha \\int_a^c f(x)dx +\\beta \\int_c^b f(x)dx =0 $$ Prove that $f=0$ allover $[a,b]$. Attempt :(not much useful ) Since the equation holds for all $c\\in [a,b]$ , if take $c=a$ then we have $$\\beta \\int_a^b f(x)dx =0 $$ And taking $c=b$ we get $$\\alpha \\int_a^b f(x)dx=0 $$ See if both $\\alpha=0$ and $\\beta=0$ hold then there is nothing to do . If only one of them is $0$ and the other is non-zero then from the last two equations we get $$\\int_a^b f(x)dx =0 $$ and this does not ensure $f$'s being identically $0$ on $[a,b]$ (for example : $f(x)=sin x$ and $a=0$,$b=2\\pi $ ) . So our only possibility is that both $\\alpha \\neq 0$ and $\\beta \\neq 0$ must hold . Now I cannot proceed any further from this point . Please give me some hints as to what to do next . Thaanks.", "Currently, this site embeds YouTube videos as Flash. (see an example: ) However, this is not the best solution, as now YouTube also supports HTML5, and some users (like me!) prefer to use HTML5 player instead of Flash. Supposedly, it should also work on devices that don't have Flash player (I can't confirm because I don't have one). The solution seems quite simple: just change the embed code to an iframe, as described at EDIT: says: Note: YouTube &lt;object&gt; embeds were on January 27, 2015. Please migrate your applications to the , which can intelligently use whichever embedded player – HTML (&lt;video&gt;) or Flash (&lt;object&gt;) – the client supports.", "Joining two rigged models I currently trying to join two rigged (and animated) models, which both has separate meshes, separate bones and separate animations. The first mesh is the horse while the second mesh is human: So I am interested to join human model onto horse model to make a rider: I think the best way would be to make horse as a parent and human as a child during the join process. In that case I would like that all horse animations (there are 3 of them - idle, walk and run) would remain as they are, while I can lose human animations, as I will need different ones for it. I was also thinking to make human root bone as a child of one horse back bones, that when horse moves up and down it would move entire human mesh together. It would be also good to keep the same weights that human bones would not start deforming horse mesh and vice versa. I tried to use Ctrl+J by selecting various combinations between bones and meshes in object mode, however, I noticed that it messes up scaling and rotation of the child object. So I was wondering how it would be possible to properly join these models to create a rider?", "Windows 98 on a modern computer?", "What does ‘Sport’ mean when you say ‘the new Apple iPad sports cameras for video conferencing’?", "Why can't we downvote our own posts? Once in a blue moon, I've wanted the ability to downvote my own answer to some question. () Obviously upvoting one's own posts is out of the question. But down is different. Voting my own answer down can help me improve the site by pushing my answer lower in the ranking than another answer with a better or more situation-appropriate alternative. It's not something I'd do often, but I would use this feature if it were available. If implemented, I'd expect this feature to operate just like downvotes on other user's posts. That is: I get a few seconds to undo the downvote; I get to remove the downvote after an edit to the post; I lose a point for placing the downvote (CW excepted); I lose two points for receiving the downvote (CW excepted). If you're noticing that I'd lose 3 points for downvoting my own non-CW post, congratulations! You can add! I can think of a couple of potential downsides to this change. The first one may be a dealbreaker; the second is probably not that big a deal. Strategic downvoting of oneself: since you can undo the vote after an edit, and you can always edit your own posts, someone could downvote themselves soon after posting (especially on a FGITW answer) to garner extra sympathy upvotes. Badge collecting: the Peer Pressure badge just got easier, because if you have a -2 score on an answer, just downvote and delete for an instant badge." ]

[ "How to prove that $P \\rightarrow Q$ is equivalent with $\\neg P \\lor Q $? In my book about Logic, which is called 'Language, Proof and Logic', by the way, there is explained that the conditional $ P \\rightarrow Q $ is equivalent with $\\neg P \\lor Q$. that gives as answer: 'just compare the truth tables and you can see that they are equivalent'. However, I would like to know how to prove this using formal propositional logic. This should be possible, right?", "TL2018 (MacTeX) and TikZ calligraphy library", "I am a new user of Ubuntu 12.04. I installed Ubuntu and Windows XP, and I want to use both operating systems. When I restart or boot my PC the GRUB menu does not appear. How can I solve this problem?", "A better serial voting trap Currently we capture fanatic, voting ring or rage-type activities, by measuring the number of up-votes or down-votes between the same two users in a certain (relatively short) time period. When this is detected by the system, the votes are reversed, and I've never bothered to investigate what else happens after that - though I'm sure some form of wrist-slapping ensues. While it is intended to be well-guarded for obvious reasons, the algorithm used is not exactly a secret, and I am sure there are plenty of examples where people are dangling (maybe intentionally, or maybe by dumb luck) just on the safe side of getting caught. Personally I believe there are active, intentional, long-term vendettas in operation right now where users either: blindly up-vote every answer from a user; or, down-vote a particular user once or twice a day, regardless of topic or quality. Now, maybe the first one is valid - if I'm operating in the same tag-sphere as some smart person, it may just be that I'm constantly enthralled with their answers, and I'm not even noticing who they're written by. (Though, even Skeet isn't perfect, and I haven't up-voted every answer I've seen him post.) But still, can we do a better job of catching - or at least noticing - this activity over the long term in addition to the short term? The behavior is the same, and shouldn't be tolerated, regardless of the time frame - vengeful rage serial voting, blind staker crush serial voting, and painstakingly patient serial voting are all undesirable behaviors IMHO. I'm not saying it has to do anything automatically, as I'm well aware of the possibility of false positives. And I'm not even sure what to propose as a time frame or a vote threshold. But if a large percentage of my up-votes or down-votes are against a particular user, and especially if on a majority of those posts I am the only one voting in that direction, I think it should at least be raised as some kind of flag to moderators. This would work much like how other suspicious activity is highlighted (but also not dealt with automatically). If a pattern becomes obvious and persists, then they can intervene in some way (or not, but at least they were provided with the information - just like they can reject and ignore manual flags). Today, all I can do is e-mail [email protected], and unless I know exactly which person(s) are involved, there is not much they can do about it. And you're thinking, \"Meh, let some hater down-vote you once or twice a day. Unless all you're posting is utter crap, it should be statistically insignificant.\" You're right. But reputation is not the point, and is not the motivation behind my request. What I'd like to see curtailed is the tendency for folks to down-vote a question or answer because of who posted it, not because of what it said or didn't say. When a down-vote is personal it can leave a person second-guessing the quality of their post. Which isn't necessarily a bad thing, except when it happens repeatedly. Sorry for the essay but I wanted to try to anticipate and cover all the objections and hole-poking.", "Grep equivalent for Windows 7? Is there a command prompt equivalent for Windows 7? That is, I want to filter out the results of a command: Bash use: ls | grep root What would it be from a Windows command prompt?", "Problem working fontspec, babel and datetime with cyrillic I have discovered that fontspec with russian babel settings doesn't work with datetime package. I tried to compile such code: \\documentclass[a4paper,11pt]{article} \\usepackage[T2A]{fontenc} \\usepackage[utf8]{inputenc} \\usepackage[main=russian,english]{babel} \\usepackage{datetime} \\usepackage[cm-default]{fontspec} \\begin{document} \\today \\end{document} with a xelatex and got an error: Command \\cyri unavailable in encoding EU1. Is there any way to handle it? UPDATE: I really bungle with charset in XeLateX. Thanks to egreg. I have removed fontenc and inputenc and used some cyrillic font, so my MWE now looks this way: \\documentclass[a4paper,11pt]{article} \\usepackage[main=russian,english]{babel} \\usepackage{fontspec} \\setromanfont{PT Sans} \\usepackage{datetime} \\begin{document} \\today \\end{document} and I've got another error, if I used russian as a main language in babel: Undefined control sequence. \\\\monthnamerussian ...cyrm \\cyra \\cyrya \\or \\cyri \\cyryu \\cyrn \\cyrya \\or \\c... Is it still because of XeLaTeX?", "Solving linear congruences by hand: modular fractions and inverses When I am faced with a simple linear congruence such as $$9x \\equiv 7 \\pmod{13}$$ and I am working without any calculating aid handy, I tend to do something like the following: \"Notice\" that adding $13$ on the right and subtracting $13x$ on the left gives: $$-4x \\equiv 20 \\pmod{13}$$ so that $$x \\equiv -5 \\equiv 8 \\pmod{13}.$$ Clearly this process works and is easy to justify (apart from not having an algorithm for \"noticing\"), but my question is this: I have a vague recollection of reading somewhere this sort of process was the preferred method of C. F. Gauss, but I cannot find any evidence for this now, so does anyone know anything about this, or could provide a reference? (Or have I just imagined it all?) I would also be interested to hear if anyone else does anything similar.", "How to get reflections from 3D to show up on real images Andrew Price released a nice tutorial on how to nicely put 3D objects on top of a real image: I have seen images, such as this: which have 3D elements over images and have actual reflections from the object showing up on the wet asphalt. How can this effect be achieved using render passes (or any other way)? Here is another example (from ):", "How do I boot into recovery mode?", "This is really two questions. Is there a definition of the principal $n$th root of a complex number? I can't find it anywhere. Presumably, the usual definition is $[r\\exp(i\\theta)]^{1/n} = r^{1/n}\\exp(i\\theta/n)$ for $\\theta \\in [0,2\\pi)$, but I have yet to see this anywhere. Is this because it has bad properties? For instance, according to this definition is it true that for all complex $z$ it holds that $(z^{1/a})^b = (z^b)^{1/a}$?", "the slash (/) after a directory name on shell commands I have a little question here. If I have two files, say filea and fileb, mv filea fileb would delete fileb rename filea to fileb Then if I have two directories, say dira and dirb, mv dira dirb would move dira into dirb (it will become dirb/dira) Noting that in both cases there are no notice or message, then this is pretty inconsistent to me. I think mv dira dirb should just overwrite dirb with the contents of dira (or merge the two directories under a directory named dirb). I remember reading somewhere that a directory name with a slash (like dira/) is treated like a directory, and name with no slash (like dira) is treated like a file (to certain extents, of course). Anyway now I want to make the shell (zsh and possibly bash) respect my notation of a directory by using a slash. Is there a terminal option which enable me to enforce that? To clarify, here is my desired behaviour: mv dira dirb results in dirb being overwritten with the contents of dira mv dira dirb/ results in dira being moved into dirb (in dirb/dira) Has anyone thought the same way as me? Or am I just weird?", "Let $x\\in\\mathbb{Q}$ with $x&gt;0$. Prove that we can find $n\\in\\mathbb{N}^*$ and distinct $a_1,...,a_n \\in \\mathbb{N}^*$ such that $$x=\\sum_{k=1}^n{\\frac{1}{a_k}}$$", "Stealing and reattaching a running process It's sunday and I left an instance of R running in the office. The script finished running, and I would like to save my workspace without going to the office. I can ssh to the computer, but I have not run the program into screen. Is there a way, over ssh, to disown the process (I don't have access to jobsid of the terminal the program is running on!) and reattach it with say, reptyr? Reptyr and reptyr -T don't work without previously disowning the process 28845 3diag 20 0 139.3m 10.4m 0.0 0.1 0:12.06 S `- urxvtd 5327 3diag 20 0 16.4m 4.6m 0.0 0.1 0:00.02 S `- bash 5335 3diag 20 0 3499.3m 3.244g 0.0 43.3 171:57.89 S `- R The unique part of my question is that I explicitly require to detach a program without having access to the terminal in which it was created.", "I am trying to understand the permission usage for the cp command in unix. What are the permissions required for copying a file into a directory What are the permissions required for copying out of a directory? I'm assuming for my first question, the directory will need execute permissions to perform the operation and the file will need read permissions to read the binary of the file and then the output file will need write permissions. For the second the directory itself would need execute permissions to perform the copy operation and the file would need read permissions to extract the data from the file. Can anyone tell me if my logic is flawed?", "How to overlay images I want to overlay one image with another using CSS. An example of this is the first image (the background if you like) will be a thumbnail link of a product, with the link opening a lightbox / popup showing a larger version of the image. On top of this linked image I would like an image of a magnifying glass, to show people that the image can be clicked to enlarge it (apparently this isn't obvious without the magnifying glass).", "When using zero as a quantifier, is it correct to use the singular form on the object of the quantifier, or the plural form? It sounds confusing when I put it that way, but what I mean is: Which is correct? Your password expires in 0 days. Your password expires in 0 day. Essentially I suppose I'm asking, does \"singular\" mean \"one\" or \"the opposite of more than one\", as zero is not \"plural\" in the traditional \"more than one\" sense? I'm pretty sure \"days\" sounds correct, but I can't be sure.", "Since the last update (v1.0.85), I am getting all the question pages blank on the Android app. For those who are confused with the image, I'm using RtL (Right-to-Left) layout. If I scroll down (quite a bit) I can see the question. But even then I cannot see the question title, the related comments or answers. App Version: 1.0.85 Device Manufacturer: LGE Device Model: LG-D620 OS Version: 5.0.2 (152541901f156)", "Digitally selectable filter I have asked a but I did not get an answer, as it was too specific. So I will build on it but make it a bit more broad spectrum. I would like to make a digitally selectable BPF using transistors to select a component in the filter; resulting in the center frequency being changed. I have used FilterPro to generate quick second order filters and get a rough filter response. For all the designs, a Multiple-feedback was selected: In the first picture, a center frequency at 108KHz with a bandwidth @ -3dB of 103K to 113KHz is given. For the second, a center frequency at 117.5KHz with a bandwidth @ -3dB of 112.8K to 122.2KHz is given. The only difference between these two circuits is R3. If I were to implement a circuit as shown below, would it work and what transistor would be recommended? I have selected the as the Opamp in the circuit design as that is what was used for the . For the transistors, I was thinking of using the MOSFETs (2N7002) used in the ST7590 design as well.", "Is there a formal proof for the superposition theorem?", "Is it true that $$\\int_a^b f(x) dx = \\int_{f(a)}^{f(b)} f^{-1}(x) dx$$ Just making sure. If not, how about: $$\\int_a^b f(x) dx = (f(b)-f(a))b - \\int_{f(a)}^{f(b)}f^{-1}(x)dx$$ I'm having a hard time concentrating right now, and I'm trying to figure out how to get the area under a curve when the function is inverted." ]

[ "What does the origami represent in Blade Runner? Throughout Blade Runner we see Gaff (Edward James Olmos) making origami figures at various points in the movie. He makes a chicken, matchstick men and at the end of the film there is a unicorn waiting outside Deckard's apartment. There is a of out there regarding the unicorn in particular, and how it indicates that Deckard is a replicant. I think an answer regarding the use of origami in general will be interesting new ground to cover. Why origami? What does the origami represent in Blade Runner?", "Applying an ellipsis to multiline text", "Non in front of hyphenated adjective If one wishes to add \"non\" in front of a hyphenated adjective, should one add a hyphen after \"non?\"", "How do I run a command before or after every command written in the console?", "How did Google find my unlinked newly created pages? I am building a new site, but creating the content using a subdirectory on an existing site. I have never posted a link to this subdirectory anywhere, yet searching Google reveals that Google has found these pages on my site and indexed them. Further, I updated the site with a robots.txt file that WMT reports as being read, and testing the blocked pages using the WMT test tool indicates that the pages will not be indexed. Apparently this does not remove the pages from existing results, though I submitted a request to do so. How did Google find these pages to begin with? Is it because I used a common subdirectory name and Google guesses at common subdirectories?", "CodeIgniter/PHP Active Record won't increment an integer", "What does \"No bootable medium found\" mean in VirtualBox?", "Let $L$ and $R$ be $n \\times n$ matrices. I am trying to solve the following minimization problem $$ L^{k+1} := \\arg \\min_{L} \\lambda \\|L\\|_{\\ast} + \\frac{1}{2\\mu}\\|L-R^{k}\\|_{F}^{2} $$ $$ \\mbox{s.t.}\\ L \\succeq 0 $$ where $\\|\\cdot\\|_{\\ast}$ and $\\|\\cdot\\|_{F}$ denote the nuclear and Frobenius norms, respectively. Also, $k$ expresses the $k$th iteration when solving an optimization problem successively. I don't know how to solve this problem. Would you tell me the way?", "$k[x]/(x^n)$ module with finite free resolution is free", "steam fatal error \"steam needs to be online to update, but was set to offline movies.\" I tried re-installing it but it simply keeps giving me this error in a little window. When I close it, an identical error pops up some 3 seconds later without any new provocation.", "How to find the list of all available packages along with the lastest version number available in the repositories? I want to list all the packages(installed or not installed) along with the latest version number available in the repositories. For example: The output of apt-cache policy chromium-browser shows like below $ apt-cache policy chromium-browser chromium-browser: Installed: (none) Candidate: 34.0.1847.116-0ubuntu2 Version table: 34.0.1847.116-0ubuntu2 0 500 http://ftp.cuhk.edu.hk/pub/Linux/ubuntu/ trusty/universe amd64 Packages So the latest version of chromium-browser package available in the repository is 34.0.1847.116-0ubuntu2. Like that, i want to list the version number along with the package names that are available in repositories. And all i want to do this through command-line. I want the output to be like this, chromium-browser 34.0.1847.116-0ubuntu2 xxxxxxxxxxxxxx yyyyyyyyyyy ............ ............", "The responsiveness is really bad on a newly installed Ubuntu 14.04 LTS. Here's the specs of my laptop: Quadcore Intel i7-4600U CPU @ 2.10GHz 12GB Ram 1TB Samsung EVO SSD And when gradle is compiling, my entire system slows to a crawl, videos begin stuttering, browser scrolling lags... etc. The same goes when a page refresh occurs in another window in Chrome, and while it refreshes, the HTML5 video in another tab begins stuttering. How can I fix this? Here are some logs: $ vmstat -a 1 5 - $ iostat -x 1 5 - $ top -b -", "The review system suggested something was probably spam, what should I do when I see this? While reviewing suggested edits and first posts by new users today, the review system did something new - an alert appeared that suggested that what I was reviewing was probably spam, and prompted me to take a careful look at it. Should I be doing anything differently than I otherwise do while reviewing when I see this? Additionally, are my actions contributing to helping the spam prevention systems learn?", "Sharepoint REST API - Using caml query and select/expand to get lookup data", "It looks like we'll be adding support to Stack Overflow. This is necessary to prevent bots, spammers, and other malicious scripted activity. We only want human beings to post or edit things here! We'll be using a JavaScript (jQuery) CAPTCHA as a first line of defense: The advantage of this approach is that, for most people, the CAPTCHA won't ever be visible! However, for people with JavaScript disabled, we still need a fallback and this is where it gets tricky. I have written a which we can re-use. However, I'd prefer to go with something textual to avoid the overhead of creating all these images on the server with each request. I've seen things like.. ASCII text captcha: \\/\\/(_)\\/\\/ math puzzles: what is 7 minus 3 times 2? trivia questions: what tastes better, a toad or a popsicle? Maybe I'm just tilting at windmills here, but I'd like to have a less resource intensive, non-image based &lt;noscript&gt; compatible CAPTCHA if possible. Ideas?", "Did I \"get\" (or \"take\") my degree \"from\" (or \"in\") the University of Somewhere? I would like to know what is the preferred way to indicate that I took a degree in some subject while also naming the place where I obtained the degree from: I got my master's degree from the University of Somewhere; I got my master's degree in the University of Somewhere; I took my master's degree in the University of Somewhere. I would say that \"in\" is more suitable to mention the particular subject (a degree in maths, for instance) than to indicate the place, but I still have doubts. By the way, is it a \"master's degree\" or a \"Master's degree\"?", "T-SQL: Selecting Column Based on MAX(Other Column)", "Why are SMD LEDs shipped in a sealed bag containing desiccant? I had a selection of 0805 LEDs in my last Mouser order and was a bit surprised to discover they arrived in heat-sealed (rather than folded and taped with sticker) bags containing a desiccant bag and some sort of litmus-esque paper indicator saying something about baking them if the dots on it went pink (instead of blue). A quantity of through-hole LEDs I had in the same order just came in the regular ESD-protective bag, folded over with a sticker. What's up with SMD LEDs that they work so hard to keep them dry? Surely their dryness can't be assured once they're installed. Does it have to do with their solderability or something? Why would that be different than other SMD parts?", "I accidentally unset all the directories of $PATH while trying to add a new one in ~/.bashrc. I opened a new terminal window as I was editing and now $PATH is empty. I'm worried if I boot from another drive to find the $PATH I won't be able to boot into this drive again. Basically, what is the default result of echo $PATH?", "How do I close a connection early? I'm attempting to do an AJAX call (via JQuery) that will initiate a fairly long process. I'd like the script to simply send a response indicating that the process has started, but JQuery won't return the response until the PHP script is done running. I've tried this with a \"close\" header (below), and also with output buffering; neither seems to work. Any guesses? or is this something I need to do in JQuery? &lt;?php echo( \"We'll email you as soon as this is done.\" ); header( \"Connection: Close\" ); // do some stuff that will take a while mail( '[email protected]', \"okay I'm done\", 'Yup, all done.' ); ?&gt;" ]

[ "'The average person' or 'an average person'?", "I have to prove this : \"$n^7-n$ is a multiple of 7\". This is what I have done this so far : $P(n):n^7-n$ On putting $n=1,$ $P(1):1^7-1=0$, which is a multiple of 7. So, $P(1)$ is true. Let $P(k)$ be a multiple of 7. So, $k^7-k$ is a multiple of 7. So, $k^7-k=7m$, where $m$ is any natural number. Let $P(k+1)$ be true, Hence, $(k+1)^7-(k+1)$ is a multiple of 7. Now, how do I evaluate $(k+1)^7$ without using the binomial theorem ? Or is there some other way to do it ?", "Build and strengthen the Stack Exchange community with \"crossover questions\" between sites I've been a Stack Exchange contributor for a couple of years now, currently most active on . One thing that keeps coming up is questions that would appeal to audiences on two different Stack Exchange sites but there are almost no features taking advantage of these questions. On travel.SE we have crossover questions most often with and possibly next most often with - but it can happen with almost any SE site. Today alone we had with and had . I am absolutely sure that this must happen all the time between arbitrary pairs of Stack Exchange sites but the only feature that takes advantage of it is the possibility of migrating off-topic questions which leaves the original question acting as a redirect across the two sites. I think there is a missed opportunity to build the network between sites where users of one site don't realize they could make valuable contributions to a sister site they have had so far little to do with. At the very least there could be a way to &quot;advertise&quot; a question on a second site that could be interested in it. Probably by listing it in the sidebar where there are also links to meta questions, linked questions, related questions, new blog posts, and But there could also be some kind of features that make some sort of acceptable crossposting. There could be gamification/badges added around building cross-site questions or whatever else you can think up. I think this is a great way for people to spread their expertise from their main site onto other sites, to make the network stronger and more cohesive, to bring more attention to questions that would have a divided audience between two sites. I can think only of positives and no negatives. Does anyone else have some ideas to add or think this is a bad idea for any reason? Example crossover questions: Here are some links to some crossover questions I've been finding in the Stack Exchange network here. (This was previously posted as an answer, but more people wanted it to be part of the question.) ▶ : ▶ : ▶ : ▶ : ▶ : ▶ : ▶ : ▶ : ▶ : ▶ : ▶ : ▶ : ▶ :", "Proving with induction $(1-x)^n<\\frac 1 {1+nx}$ Prove using induction that $\\forall n\\in\\mathbb N, \\forall x\\in \\mathbb R: 0&lt;x&lt;1: (1-x)^n&lt;\\frac 1 {1+nx}$ My attempt: Base: for $n=1: 1-x&lt;\\frac 1 {1+x}\\iff 1-x^2&lt;1$, true since $0&lt;x&lt;1$. Suppose the statement is true for $n$, prove for $n+1$: $(1-x)^{n+1}=(1-x)(1-x)^{n}\\overset{i.h}&lt;\\frac{(1-x)}{1+nx}$ Now I got stuck, maybe another induction to show that $1+nx+x&lt;1+nx$? Is there another way? Moreover, I was told it's wrong to begin with $(1-x)^{n+1}$ and reach to $\\frac 1 {1+(n+1)x}$ but why? Is it assuming what I need to prove?", "How can I make 3D Text in Russian? I've seen a similar question on BSE about entering foreign languages into 3D Text, but it doesn't help. I've tried using two different fonts (both of which support Russian). I've tried enabling International Fonts in Blender's User Preferences, but it doesn't work as well. It either types English text with Greek letters or displays empty vertical rectangles. If anyone has been able to add text in any foreign language, please let me know. I actually found out that it can be easily done through Text Editor, which would be probably the best way for me since I would prefer to paste my text. Can anyone perhaps guide me through?", "Already the early papers on supergravity were written using computer algebra software to do some calculations. What modern packages do people normally use for doing such calculations? Of course Mathematica and presumable a lot of other programs can be made to do such calculations, I am wondering if there are special packages or tutorials how to do such calculations in them.", "How to end paragraph text in an inverted pyramid shape? In many old books, the final paragraphs of chapters end in an inverted pyramid shape, like this: I think this is beautiful, so I would like to imitate this for my book. I've found the code for a triangle in this post \\documentclass{article} \\usepackage{microtype,shapepar} \\def\\triangleupshape{% {0}% {0}b{0}\\\\% {8.66}t{-5}{10}\\\\% {17.32}t{-10}{20}\\\\% {17.32}e{0}% } \\begin{document} \\shapepar{\\triangleupshape}A ipsum dolor sit amet, consectetuer adipiscing elit, sed diam nonummy nibh euismod tincidunt ut laoreet dolore magna aliquam erat volutpat. Ut wisi enim ad minim veniam, quis nostrud exerci tation ullamcorper suscipit lobortis nisl ut aliquip ex ea commodo consequat. Duis autem vel eum iriure dolor in hendrerit in vulputate velit esse molestie consequat, vel illum dolore eu feugiat nulla facilisis at vero eros et accumsan et iusto odio dignissim qui blandit praesent luptatum zzril delenit augue duis dolore te feugait nulla facilisi. Lorem ipsum dolor sit amet, consectetuer adipiscing elit, sed diam nonummy nibh euismod tincidunt ut laoreet dolore magna aliquam erat volutpat. \\par \\end{document} Which results in this: But I'd like it to be inverted and the first part of the paragraph need to be full line width. Only the last few lines should end in an inverted pyramid like in the example above. Is there a way to do this? Thanks in advance for your help.", "Use of each and every", "Find Java classes implementing an interface Some time ago, I came across a piece of code, that used some piece of standard Java functionality to locate the classes that implemented a given interface. I know the functions were hidden in some non-logical place, but they could be used for other classes as the package name implied. Back then I did not need it, so I forgot about it, but now I do, and I can't seem to find the functions again. Where can these functions be found? Edit: I'm not looking for any IDE functions or anything, but rather something that can be executed within the Java application.", "deleting windows system folder I want to use an old drive as a secondary hard drive without reformatting. But this old hard drive contains my old Vista installation which takes up gigs of space. I tried changing ownership and it works to some extent but I can not delete anything in Windows/System32 folder. Is there an easy way to change permissions so I can delete everything? The solution is to use Takeown as Wil suggested and use cacls to take full control of the files. Since cacls doesn't seem to be recursive, I fired up cygwin and ran this command to recursively change all the files: for d in $(find directory-of-interest -type d);do cacls $d'/*' /e /G username:F; done where directory-of-interest is in my case /cygdrive/g/Windows and username is my username. I had to manually run it on directories that had spaces in its name. But after all this, I can now delete the directory. Warning: it seems to me that cacls can potentially royally screw things up if improperly used.", "How to tell a wlan card supports RFMON mode Can someone please tell me how to check if a wlan card supports promiscuous mode", "How do I change the launcher commands?", "Upgrade to the latest PHP version in Ubuntu", "Send values from one form to another form", "Disable window animations when the menu option is missing? How do I set Window animation scale and Transition animation scale to Animation off when the option to do so is not available on my ROM (though it ought to be). Specifically it should be under Developer options in Settings but all of the User interface options are missing.", "In the King James version of the Bible there is a verse like this: The Lord is my strength, and my fortress, and my song. And He is become my salvation. Is it still feasible to use \"is become\" instead of \"has become\" and what is the semantic difference?", "How to know if Mac OS X machine is being remotely viewed? Currently I have no way to know if my machine is being remotely viewed by our tech support, and would prefer to know, given the massive privacy breach that would entail should this be happening. I am running Mac OS X Snow Leopard. Running ps -A | grep Remote I know this service is running: /System/Library/CoreServices/RemoteManagement/ARDAgent.app/Contents/MacOS/ARDAgent My knowledge of administration of Macs on a network is limited, so I don't know what tools allow this.", "What is the meaning of double pound symbol (number sign, hash character) ##1 in an argument?", "Why didn't the Alliance send for Yoda instead of Obi-Wan?", "What's the difference between a projection and a datum?" ]

[ "I am writing my thesis, and i am in restructuring phase - sorting theorems where they should belong thematically. And it would be helpful to have all the proofs hidden so i am not laden with the additional information. Is it possible to add something like hideproof to documentclass options to omit them when compiling the latex file.", "Can a quasiclassical electron wave packet in elliptic orbit be formed from bound hydrogen-like eigenstates? Position probability densities of eigenstates of hydrogen-like systems have axial symmetry, so that the wavefunction too much resembles the circular orbits in Bohr's model. I'd like to have a demonstration of correspondence principle, where an electron would be localized to look somewhat like a classical particle, and move in an elliptic (non-circular) orbit around a nucleus. It seems though that if we try to make a wave packet too localized, then it'll disintegrate (get scattered by the nucleus) too fast to see anything resembling an elliptic orbit. OTOH, if we take it too spread out, it'll have to be quite far from the nucleus so as to avoid hitting it, and thus it'll have high total energy, which may appear to be above ionization threshold (at least partially), after which it'd be quite hard to analytically calculate evolution of the wave packet. Thus my question is: is it possible to form a more or less localized wave packet, which would (on average) move in an obviously-elliptic orbit (major/minor axes ratio of 4:3 or higher), and only require bound states to fully represent it? If yes, then what properties (FWHM, apocenter, angular momentum etc.) should it have for this to be possible?", "What dried food can I take across the American border from Canada?", "How should ambiguous tags be dealt with?", "Is it possible to configure Windows 7 to use YYYY-MM-DD instead of DD/MM/YYYY as the date format? How? Where?", "pgfplots: prevent single plot from being listed in legend In order to fill the area between two complex curves I use tables and the vertcat command (see ). Now I don't want the plotted area to appear in my legend, just the two curves. Is there any command to prevent the yellow area plot from being added to my legend? this could be a minimal example: \\documentclass{article} \\usepackage{pgfplots} \\begin{document} \\begin{tikzpicture} \\begin{axis}[area style,axis on top] \\addplot+[mark=none,fill=yellow,draw=none] {0.1*x^2} \\closedcycle; \\addplot[mark=none,draw=red,line legend] {0.1*x^2}; \\addplot[mark=none,draw=blue,line legend] {0.0*x^2}; \\legend{red curve,blue curve}; % \\legend{\\empty,red curve,blue curve}; \\end{axis} \\end{tikzpicture} \\end{document} With this legend{...}-command the last plot is skipped, an additional \\empty doesn't help, too. Sadly, drawing the first to plots together with fill=yellow,draw=red is not an option for me. Does anybody know any inside hacks? As far as I know, there is no command shown in the manual. Thanks in advance.", "Although work and heat do the same thing (increase or decrease the internal energy of the system), There is still a fundamental difference between them. For example, The way in which entropy is defined is a very good way to differentiate between work and heat. But, why is there such a distinction between the two things? Is it the limitation of Newtonian mechanics that it never accounted for something like heat which could also change the energy of the system? Is the word \"Thermodynamical work\" or \"Hidden work\" suitable for heat?", "How to make the BibTeX reference list visible in a LaTeX document Im very new at LaTeX and I would appreciate some help solving this problem. I have created a BibTeX file containing all references to a document. In this text file BibTeX items are inserted and no other text are written, for instance @article{...}. When I call for this bib file from the main.tex file I use the commands: \\bibliographystyle{plain} \\bibliography{thebibliography} Now to my question. All i get when I compile this main.tex is the title (bibliography) for this chapter, otherwise the textfield is blank. Is this error occurring because I should write anything in the bib file or have I missed any lines in the main.tex file.", "Do multi-use keys get discarded when finished with? As with many resident evil games, you sometimes needs to collect certain keys to open certain doors, and resident evil 7 has plenty of these around. Some keys are clearly single use, and get left in the lock in which you use them. However, there are a number of keys that can be used on multiple doors. For example, the Scorpion Key. I am concerned that I might end up carrying these around needlessly and using up valuable inventory space, so... Do these multi-use keys get discarded when you use them on all the doors they apply to? Or do you get a warning saying the key is no longer needed? (like previous games are known to do)", "Should I get Enlightened badge? Today I've got 10 upvotes for an answer. Answer was a first answer in the question. I got an Nice Answer badge for this, but no Enlightened badge. Shouldn't I get both? is my answer :)", "Syntax error while defining an array as a property of a class", "Performance difference between dot notation versus method call in Objective-C", "Is there a good reason to use \"printf\" instead of \"print\" in java?", "How to disable Alt + ` (backtick/grave)", "My son has been playing Minecraft on our home computer for a couple of years now. He just got an iPad Mini 2 for his birthday. Is it possible to transfer his game and his saves onto his iPad Mini 2?", "What is the accepted/most commonly used way to manipulate dynamic (with all dimensions not known until runtime) multi-dimensional arrays in C and/or C++. I'm trying to find the cleanest way to accomplish what this Java code does: public static void main(String[] args){ Scanner sc=new Scanner(System.in); int rows=sc.nextInt(); int cols=sc.nextInt(); int[][] data=new int[rows][cols]; manipulate(data); } public static void manipulate(int[][] data){ for(int i=0;i&lt;data.length;i++) for(int j=0;j&lt;data[0].length.j++){ System.out.print(data[i][j]); } } (reads from std_in just to clarify that dimensions aren't known until runtime). Edit:I noticed that this question is pretty popular even though it's pretty old. I don't actually agree with the top voted answer. I think the best choice for C is to use a single-dimensional array as Guge said below \"You can alloc rowscolssizeof(int) and access it by table[row*cols+col].\". There is a number of choices with C++, if you really like boost or stl then the answers below might be preferable, but the simplest and probably fastest choice is to use a single dimensional array as in C. Another viable choice in C and C++ if you want the [][] syntax is lillq's answer down at the bottom is manually building the array with lots of malloc's.", "Is the force which throws a body on a rotating disk outwards centrifugal force? If some object is kept in a radial groove made on a disk and the disk is rotated with say constant angular velocity. Now as we know that the object moves outwards ie away from the centre of the disk. I want to know which force is it which throws the object outwards. As centrifugal force is a pseudo force and hence when the observer is in ground frame it shouldn't be present so which force exactly pulls it out.", "How to make a different font and color of text in labels? Is it possible to make a bold or italic, and change the color of individual words Label? Example: the first line is bold in red text, font 12, second row 10 green italic font", "Quantum Field Theory without LSZ, how is it possible?", "Abstract, Interface, Classes OH MY - Question on Approach" ]

[ "\"Not with a whimper, but with a roar of triumph!\" Looking for the title of an old sci-fi book, pretty sure it is a Baen or Del Rey imprint. Basically, mankind has reached the stars and expanded throughout the galaxy. Suddenly, an unknown race appears and begins a war of extermination against man. Finally, the galaxy is desolate, and one man remains. He is in a starship with an AI and becomes injured in the battle. The ship's AI takes over and speeds out into the unknown, followed by the last remaining member of the unknown alien race. As all speeds are at tremendous multiples of the speed of light, the man cannot get away, but the alien cannot catch up. Finally, communication is opened, at which point the man asks \"why?\" The alien tells him that man had discovered immortality, but that it required the death of a member of a race known as the Flower People for every human who achieved immortality. The alien says that Man would have found the answer eventually, but that genocide was so intolerable that the aliens came from another dimension, to which they could never return, to stop Man, which resulted in the war of extermination. Finally, the light speeds become so great that the two remaining living beings in the universe approach the Big Crunch. As the Man begins to dive into the singularity, with the alien hot on his heels, he says that maybe there will be room in the next universe for both races to live in peace, and the final line is \"not with a whimper, but with a roar of triumph\"!", "Why does shell Command Substitution gobble up a trailing newline char? As per the following example, and as in In bash, where has the trailing newline char gone?, I want to know \"why\" it happens x=\"$(echo -ne \"a\\nb\\n\")\" ; echo -n \"$x\" | xxd -p # Output is: 610a62 # The trailing newline from the 'echo' command # has been \"deleted\" by Command Substitution I assume there must be some very significant reason for a shell action, namely Command Substitution, to actually delete some data from the command output it is substituting... but I can't get my head around this one, as it seems to be the antithesis of what it is supposed to do.. ie. to pass the output of a command back into the script process... Holding back one character seems weird to me, but I suppose there is a sensible reason for it... I'm keen to find out what that reason is...", "How to add multiple relative hyperlinks to single point in ArcGIS for Desktop with Basic level license?", "A question about long exact sequence of finite dim vector spaces", "What price should I charge for design services? I was hoping I would find some people in the industry that could help me decide what's the best price to charge to design (in this case) business cards. What are standard prices for professional designers? From a firm point of view? From a freelancer? I don't want to overcharge clients but I don't want to ruin the industry by underselling my services.", "How to remove shortcut key for Unity , which is \"Meta\" key on keyboard", "I need to be able to merge two (very simple) JavaScript objects at runtime. For example I'd like to: var obj1 = { food: 'pizza', car: 'ford' } var obj2 = { animal: 'dog' } obj1.merge(obj2); //obj1 now has three properties: food, car, and animal Does anyone have a script for this or know of a built in way to do this? I do not need recursion, and I do not need to merge functions, just methods on flat objects.", "How to prove or disprove statements about sets Prove or disprove: The set: $\\{ \\emptyset\\}^{\\Bbb N}$ has only one element. The set $\\emptyset^{\\Bbb N}$ is empty. I'm pretty sure both are true, for 1. all the natural numbers go to the empty set and that is the only element. Where as 2. all the natural numbers go to nothing so that's why it's empty. (Same as $ {\\Bbb N}^{\\emptyset} $ nothing goes to something is nothing (I think)). The problem is I have no idea how to show this so advice would be appreciated. Edit: My defintion of a function is: $f:B\\to A$ if $(a_1,b),(a_2,b)\\in f \\ \\Rightarrow \\ a_1=a_2$ So for 2. I can simply say that: $(1,\\emptyset),(2,\\emptyset)\\in f \\Rightarrow a_1\\neq a_2$ ?", "Why is unity feedback used?", "Stack Exchange iOS app crashes on start Upon clicking on SE icon, blue (starting) screen appears and then I am back to home screen, SE app simply won't start. This kind of behaviour never happened before (on any other app). I tried to remove it from &quot;task manager&quot;, reinstalling and logging back in; neither did work. In Settings -&gt; Stack Exchange -&gt; Notices I found a log message: FILE DOESN'T EXIST, WILL CREATE: users/dev/buildagent/work/{id}/pods/target support files/pods/pods-ack...plist App Version: 1.4.0 Device: iPhone7,2 OS Version: Version 9.1 (Build 13B143) TLDR: app starts when cellphone has no internet access. I just noticed when I am on 3G (cellular internet) it crashes ASAP, but when I am on wifi that has no internet (for LAN etc.) app starts normally but no new content, when I turn off WiFi and iPhone switches to cellular; app crashes. Note: I turn off WiFi using control center - so I never leave the app. Another thing, when I force iPhone to use EDGE (slowest possible internet) app starts, and crashes after 5 seconds or so. I assume when app downloads some data from server. Known workaround (works for me too) I found a workaround: turn on Airplane Mode, launch the app, then turn Airplane Mode off. – NobodyNada", "Extruding surface while keeping the shape here is the picture of what I would like to get(example nr. 2). I need the edge frame to be same in width and length. Also the extrusion is on surface (without depth) I tried extruding region, but it did not give me the result I wanted. I know I could just adjust the scale and do it manually, but that would be eyeballing without achievign accuracy. I would like to know if it is possible to extrude or inset while keeping the shape (even edge space)", "What's the batched Refactor Fields tool \"field mapping\" syntax in QGIS? In QGIS, there is this nice tool \"Refactor Fields\" in the Processing Toolbox : Using it on a single layer is fairly straightforward. However, when you plan on using it in a batch mode, one can see the \"Fields mapping\" textbox. I'm looking for an example of the syntax to be used there. I haven't found any specific documentation yet.", "How do I view my whole character? I have played Oblivion and in Oblivion you can see your person on the menu screen. When I go into 3rd person all I see is their back. Is there any way I can see my whole character?", "Paperback novel about a man who kills a birdlike alien on his balcony with a watering can", "Maven project with native dependency and copying files", "What is the best solution for database connection pooling in python? I have developed some custom DAO-like classes to meet some very specialized requirements for my project that is a server-side process that does not run inside any kind of framework. The solution works great except that every time a new request is made, I open a new connection via MySQLdb.connect. What is the best \"drop in\" solution to switch this over to using connection pooling in python? I am imagining something like the commons DBCP solution for Java. The process is long running and has many threads that need to make requests, but not all at the same time... specifically they do quite a lot of work before brief bursts of writing out a chunk of their results. Edited to add: After some more searching I found which looks decent, but as I'm relatively new to python I guess I just want to make sure I'm not missing a more obvious/more idiomatic/better solution.", "self referential struct definition? I haven't been writing C for very long, and so I'm not sure about how I should go about doing these sorts of recursive things... I would like each cell to contain another cell, but I get an error along the lines of \"field 'child' has incomplete type\". What's up? typedef struct Cell { int isParent; Cell child; } Cell;", "Can I connect to a sandbox using JWT Flow and Prod connect app? I'm trying to connect to a sandbox using the sfdx cli and the JWT flow through force:auth:jwt:grant. According to , we can use the same connected app information from Production to connect to our Scratch Org. Is it something that should work for sandbox too ? I'm getting a \"Failed: Not approved\" error. Connected app in sandbox comes from the refresh but has a different consumer key. The Permission set is set correctly on my user. Is there a way to connect to a recently refreshed sandbox using the JWT flow (without manually changing something like the consumer key) ?", "Why would I buy a bond with a negative yield? The only reason that I can think of is because I expect the bond to appreciate in price thus offsetting the loss in yield. I could still end up with less money than I started with, if I hold the bond until maturity. Ultimately, the only scenario where I would want to buy a bond with a negative yield is because I anticipate deflation and even lower rates in the future. Is this correct, or is there another reason? Currently, a lot of the global government bond market is trading on negative yield, and there are even some corporate bonds that are too.", "I'm going to submit form using cURL, where some of the contents is come from other file, selected using sed If param1 is line matching pattern from other file using sed, below command will works fine: curl -d param1=\"$(sed -n '/matchpattern/p' file.txt)\" -d param2=value2 http://example.com/submit Now, go to the problem. I want show only text between 2 matching pattern excluding the matching pattern itself. Lets say file.txt contains: Bla bla bla firstmatch It is a long established fact that a reader will be distracted by the readable content of a page when looking at its layout. secondmatch The point of using Lorem Ipsum is that it has a more-or-less normal distribution of letters, as opposed to using 'Content here, content here', making it look like readable English. Currently, lots of \"beetween 2 matching pattern\" sed command won't remove firstmatch and secondmatch. I want the result to become: It is a long established fact that a reader will be distracted by the readable content of a page when looking at its layout." ]

[ "Computing $\\lim_{(x,y)\\to (0,0)}\\frac{x+y}{\\sqrt{x^2+y^2}}$ What is the result of $\\lim_{(x,y)\\to (0,0)}\\frac{x+y}{\\sqrt{x^2+y^2}}$ . I tried to do couple of algebraic manipulations, but I didn't reach to any conclusion. Thanks a lot.", "Superscript in CSS only? How can I get superscript done, only in CSS? I have a stylesheet where I mark the external links with a superscript character, but I'm having a hard time getting the character aligned correctly. What I have currently, looks like this: a.external:after { font-size: 50%; vertical-align: top; content: \"+\"; } but it doesn't work. Naturally, I'd use the &lt;sup&gt;-tag, only if content would allow for HTML...", "How do you open a command line? How do you access the command line or run option to put the commands into the system?", "What are 'user' and 'system' times measuring in R system.time(exp) output?", "What free Remote Desktop (server) solutions are there? I know Ubuntu comes with a \"Remote Desktop\" option that appears to be a straightforward VNC server, and I'm trying to understand the alternatives. Here are the possibilities I've heard about so far: VNC VNC + SSH Tunnelling NX Server, free edition FreeNX NeatX X2Go X11 Forwarding over SSH xrdp I'm coming at this from a Windows user's perspective: To the best of my experience, RDP (aka Terminal Services) is a reasonably secure (barring mitm/server spoofing), efficient desktop sharing protocol with well-supported clients, that can be exposed to the internet when necessary without major fears of intrusion. To the best of my knowledge straight VNC is none of those things, which is where I get confused - why wouldn't a better desktop sharing technology be developed or used in the open-source world? I know VNC can be wrapped with SSH, but that seems beyond the reach of a casual user. X11 forwarding over SSH may be more or less efficient, I have no idea, but is definitely even more complicated, and doesn't (as far as I know) give you access to already-running stuff (no desktop sharing as such, just remote application running). So, I'd like any feedback/preferences amongst these or any other \"Free\" desktop sharing options, using these criteria and/or any others: Security (esp. for access across internet) Efficiency (bandwidth usage, responsiveness, etc) Free-ness, as in Speech (not sure where RDP or FreeNX lie for this) Free-ness, as in Beer (are there any commercial solutions with usable dependable free offerings?) Ease of use (server and client side) Cross-OS Client availability Cross-OS Server availability Support for independent sessions and shared (and/or \"Console\") sessions Ongoing support/maintenance/development Thanks!", "Possible Duplicate: I'm working on a website that displays distance to various locations to the nearest 1/10 mile. One of the developers (a non-native speaker) asked me an interesting question: If the distance is 1.0 mile(s), is that singular or plural? Clearly, anything other that 1.0 is plural, but is it: 1.0 miles away or 1.0 mile away The first option sounds more correct to my ear, but the voice of my elementary school language arts tells me that the latter option is correct. Edit: Added the word 'away' to the example. It doesn't change the question, but might provide clarity for the answer. Also, regarding numbers between 0 and 1, after more thought, I'm not sure that the answer is as clear as I originally thought. See .", "Are fractions with prime numerator and denominator dense?", "Previously I thought this is a universal theorem, for one can prove it in the one dimensional case using variational principal. However, today I'm doing a homework considering a potential like this:$$V(r)=-V_0\\quad(r&lt;a)$$$$ V(r)=0\\quad(r&gt;a)$$ and found that there is no bound state when $V_0a^2&lt;\\pi^2\\hbar^2/8m$. So what's the condition that we have at least one bound state for 3D and 2D?", "Query to compare the structure of two tables in MySQL To automate the backup process of one of my MySQL databases, I would like to compare the structure of two tables (current version vs old version). Can you think of a query that can compare two tables? Here are some example tables that you can compare. CREATE TABLE product_today ( pname VARCHAR(150), price int, PRIMARY KEY (pname) ); CREATE TABLE product_yesterday ( pname VARCHAR(150), price int, PRIMARY KEY (pname) ); CREATE TABLE product_2days_back ( pname VARCHAR(15), price int, PRIMARY KEY (pname) ); The first two tables have identical structures. The last one is different. I just need to know whether two tables have different structures or not. I'm not interested in the how they differ.", "A lady and a monster A famous problem: A lady is in the center of the circular lake and a monster is on the boundary of the lake. The speed of the monster is $v_m$, and the speed of the swimming lady is $v_l$. The goal of the lady is to come to the ground without meeting the monster, and the goal of the monster is to meet the lady. Under some conditions on $v_m,v_l$ the lady can always win. What if these conditions are not satisfied? Edited: the monster cannot swim. If the conditions are not satisfied, then monster can always perform a strategy such that the lady will not escape the lake. On the other hand this strategy is not desirable for both of them because they do not reach their goals. As there was mentioned, this deals with undecidability of the problem. On the other hand, if you imagine yourself to be this lady/monster, you can be interested in the strategy which is not optimal. What is it? If there are such strategies in the game theory? Edited2: My question is more general in fact. If we have a game with one parameter $v$ when two players $P_1, P_2$ are enemies and if $v&gt;0$ then for any strategy of $P_2$ the player $P_1$ wins. If $v\\leq 0$ then for any strategy of $P_2$ there is a strategy of $P_1$ such that $P_2$ does not win and vice versa. I am interested in this case. From the mathematical point of view as I have understood the problem is undecidable since there is no an ultimate strategy neither for $P_1$ nor for $P_2$. But we are solving somehow these problem IRL. Imagine that you are a lady in this game - then you would like to win anyway even while knowing that your strategy can be covered by the strategy of the monster. On the other hand, the monster knows that if he will cover all strategies of the lady she will never reach the shore and he will never catch her. I mean they have to develop some non-optimal strategies. I hope now it's more clear.", "I never dealt with Android devices before so I'm completely newbie at it, please comment if something is too simple. Say I purchase , that has got Android Froyo 2.2 installed in it. If there is a new version of Android released tomorrow or next month, will I be able to update it (like I will be able to update my iPod Touch 4 to iOS 5)?", "Is past simple ever justified with 'by'? Can anyone shed some light on the following aspect? By 5 PM I gave him the book. By 5 PM I had given him the book. In both the sentences the book was given before 5 PM and no later than 5 PM. But I can't understand then what the difference between them is. a Also is it right to use simple past with 'by' at all? If yes, then why and if not, then why is it incorrect to use simple past with 'by'?", "Akhil showed that the is the same as the continuum, using as a step the observation that continuous functions that agree at rational points must agree everywhere, since the rationals are dense in the reals. This isn't an obvious step, so why is it true?", "In my opinion the accepted answer should permanently stick as only the original question submitter has the ability to accept.", "I try to understand why for a connected Lie group $G$ the first fundamental group $\\pi_1(G)$ is abelian, and mainly why the second fundamental group is trivial $\\pi_2(G)=0$? Thanks for anyone who give me references for a 'simple proof' of these results", "How to have a one-to-many relationship with a privileged child?", "Spotlight overrides first character What's wrong: I hit CMD+SPACE to open up spotlight, typically type in the name of the application I want to start, hit enter and either the wrong app or no app at all will start, because the app name is missing the first character. \"Learn to type\" I hear you say but wait: as I enter the first character in the search bar, the cursor jumps to the beginning of the line and my second character input overrides the first one. So entering for example \"ever\", in order to start Evernote, will result in \"ver\". \"php\" to start PHPStorm will result in \"hp\" and start my damn HP printer app and so on. This cursor jump to the beginning of the line will not happen in any other application and even if I accept the fact that my cursor jumps from time to time, I don't get why the second character overrides the first one. I'm not even sure if you can configure your Mac to always override the character at current position, but I surely haven't. So this keeps on happening quite regularly and I cannot reproduce it. It just happens and when I try it again (close Spotlight, CMD+SHIFT again), it won't happen again, even if I give it like 5 tries or so. It won't kill me but I am a software developer myself and this kind of bugs just leave me frustrated plus I can not imagine that this is the desired behavior. I have seen some talk about this issue on the internet but I did not come across a solution.. I have 3 MacBooks, different ages, all with German keyboard layouts and German set as system language and they all do this. Just mentioning this, because after that fact, I can barely imagine this isn't affecting at least a lot, if not all, MacBook (Pro?) users. 13\" Pro 2010 or so 15\" Pro Retina 2013 13\" Pro Retina 2015 They all run El Capitan but I already encountered this before. I don't know the OS X version I had installed when I first stumbled across it.", "D'Alemberts Principle to solve a Classical Mechanics problem I found this question on this very site and was curious on how to solve it using D'Alembert's Principle .I already know how to do it by balancing the torque about toppling point so please don't post the latter as an answer . My attempt was to displace the upper sphere by $d\\theta$ which gives its virtual displacement as $rd{\\theta}cos(\\theta)$j(notice we are only interested in the y component becuz the only component of the applied force which is gravity in this case is the y component in the dot product the other components vanish) similarly the cylinder is also displaced $r'd{\\phi}cos(\\phi)$ where r' is the distance from the point of toppling of the center of mass. $r'cos(\\phi)=H/2=r(1+sin(\\theta))$ ,$r'sin(\\phi)=R=r(1+cos(\\theta))$ and $tan(\\phi)=H/2R$ the equation coming from D'Alemberts principle is $mgrcos(\\theta)d\\theta=Mgr'cos(\\phi)\\phi$ I tried solving this but couldn't arrive at the right answer. Any help would be appreciated!", "Which function ($f$) is continuous nowhere but $|f(x)|$ is continuous everywhere? I found this question , the question seems much interesting but for obvious reason it is closed there, I was wondering how to derive such a function?", "What are the pros and cons of engineered hardwood? Are there any downsides to engineered hardwood? I'm looking to install hardwood in dining room and kitchen areas." ]

[ "How to convert standard IP address format string to hex and long? Does anyone know how to get the IP address in decimal or hex from standard IP address format string (\"xxx.xxx.xxx.xxx\")? I've tried to use the inet_addr() function but didn't get the right result. I tested it on \"84.52.184.224\" the function returned 3770168404 which is not correct (the correct result is 1412741344). Thanks!", "How do injuries work with Polyjuice Potion? We know that if you (using Polyjuice), take the form of someone who had been injured, you assume that injured form (e.g. Barty/Moody). If you are injured, presumably you would be uninjured while under Polyjuice. My question is, is this in real-time? That is, if you take a Polyjuice, and while you're still under its effects, the person being transformed into gets injured (or even dies), will that injury be transferred onto you? And conversely, if you get injured while in someone else's body, will that transfer over to your real body after the Polyjuice wears off, will it disappear, or will it go to the person you turned into?", "Is it acceptable to add a duplicate answer to several questions?", "How to install Flash player on Ubuntu?", "Intuition behind the definition of a measurable set This week I saw the definition of a measurable set for an outer measure. Let $\\mu^*$ be an outer measure on a set $X$. We call $A \\subseteq X$ measurable if $$\\mu^*(E) = \\mu^*(A\\cap E) + \\mu^*(A^c\\cap E)$$ for every $E \\subseteq X$. This is not the first time I've seen this definition. Unlike most other things in mathematics, over time I have gained absolutely no intuition as to why this is the definition. The only explanation I've ever seen is that a set is measurable if it 'breaks up' other sets in the way you'd want. I don't really see why this is the motivation though. One reason I am not comfortable with it is that you require a measurable set to break up sets which, according to this definition, are non-measurable; why would you require that? Of course, you can't say what a non-measurable set is without first defining what it means to be measurable so I suppose no matter what your condition is, it will have to apply to all subsets of $X$. Is there an intuitive way to think about the definition of measurable sets? Is there a good reason why we should use this definition, aside from \"it works\"?", "All of my Firefox extensions were spontaneously and simultaneously disabled (converted to Legacy status) a few moments ago. How can I re-enable them? Firefox 66.0.3 (64-bit)", "Check Constraint with Case Statement", "Under what conditions will healers switch targets? I've been using healers lately, which I haven't really utilized much before. I've noticed that they will sometimes switch targets, even when their original target still lives. What conditions are needed for healers to switch targets?", "I am Peruvian, and will study in the Turkish Republic of Northern Cyprus for two years. As a South American, what problems may I have if I decide to study in the TRNC, as it is recognized only by Turkey? What if, having been in the TRNC, I decide to travel to the EU (Amsterdam) for summer vacations? Would I encounter any problem entering The Netherlands, a member of EU, after having been in the TRNC? I have read that many tourists (Russians and Asians for now) are deported mostly because they go from Northern Cyprus to the Republic of Cyprus. Cyprus, a member of the EU, believes that those entering the country from the north are illegal immigrants. Does this rule apply to Cypriot internal issues only, or does it extend throughout the EU? Will it cause problems for my intended travel to Amsterdam?", "Moon photography Hi I am a photography hoobyist. At the moment I am using a Nikon D3100 with the standard kit lens (18-55mm). I am interested in taking photos of the moon. I am debating whether to buy a 55-200mm lens or a 55-300mm lens. Which one would be better? P.S I am on a tight budget and I am looking for a lens for personal use, not commercial. Would appreciate any answers! Thank you!", "Why is the (non-relativistic) stress tensor linear and symmetric? From : \"[...] the stress vector $T$ across a surface will always be a linear function of the surface's normal vector $n$, the unit-length vector that is perpendicular to it. [...] The linear relation between $T$ and $n$ follows from the fundamental laws of conservation of linear momentum and static equilibrium of forces, and is therefore mathematically exact, for any material and any stress situation. The components of the Cauchy stress tensor at every point in a material satisfy the equilibrium equations (Cauchy’s equations of motion for zero acceleration). Moreover, the principle of conservation of angular momentum implies that the stress tensor is symmetric.\" What is the more detailed explanation for this, and/or where can I find it?", "I want to digitize my old family albums using a scanner and there are lots of photos in them. Thus far, my method has been to scan 4 images at a time and then manually cropping them in a simple editor like Picasa or Windows Live Photo Gallery. This has been pretty time consuming as each scan is followed by 4 crop operations. Scanning each image individually would possibly be even more time consuming. Is there any software or simple plugin (preferably free) that does this job? The best solution I have found is in , but that's an overkill. Is there a similar feature for one of the free photo editors like Paint.NET or GIMP?", "Proving a simple graph is a connected graph Does any proof exist that a simple graph with $n$ vertices such that the least vertex degree is $\\geq \\frac{n-1}{2}$ is a connected graph? (i.e. does such a proof have a name?)", "Locate the \".Rprofile\" file generating default options", "Enumerate after \\label", "Let $A_n$ denote an $n \\times n$ tridiagonal matrix. $$A_n=\\begin{pmatrix}2 &amp; -1 &amp; &amp; &amp; 0 \\\\ -1 &amp; 2 &amp; -1 &amp; &amp; \\\\ &amp; \\ddots &amp; \\ddots &amp; \\ddots &amp; \\\\ &amp; &amp; -1 &amp; 2 &amp; -1 \\\\ 0 &amp; &amp; &amp; -1 &amp; 2 \\end{pmatrix} \\quad\\text{for }n \\ge 2$$ Set $D_n = \\det(A_n)$ Prove that $D_n = 2D_{n-1} - D_{n-2}$ for $n \\ge 4$.", "Calculus book recommendations (for complete beginner) Well I have not started calculus yet but I am really keen to. I would love if you suggest some books. Points to be noted: I really don't like the way textbooks are written so please no \"textbooks\" I am COMPLETELY beginner in calculus. I know a little bit of trigonometry and what functions are but not really in depth.The book should start from the base, I mean really from the base. I may require a precalculus book too if the books don't cover that. I would really love if the book shows how calculus was developed, why it was developed and things like that. Well,thanks in advance!", "Can I view a list of my \"great comments\", perhaps in my profile? I'm a little surprised no one asked this yet, but why isn't it possible to show your comments in descending order of \"great comment\" votes it has received? You can do this with upvotes on questions and answers, and since I think comments are the third major activity on SO, I'd like to view them. Even if you couldn't order them, it should at least show the number of votes on the activity#comments page of your profile...", "Add new item in existing array in c#.net How to add new item in existing string array in C#.net? I need to preserve the existing data.", "How to handle a native OS (Ubuntu) file upload window in selenium webdriver with python? This is my first time here but I have already posted this question on SO. I keep getting solutions for Windows + Java and not for Linux or python for that matter. I am using Selenium and Python to automate a file upload application for the past many hours but nothing helpful! The HTML DOM structure for this file upload is an input tag with its type attribute value = 'file'. I know I can make use of the send_keys. The problem is I am not supposed to use send_keys() (as per the question I am trying to solve). The assumption is there are other ways of doing it. Can anyone suggest me alternative ways to upload the file? I do get solutions for windows but not for Linux(Ubuntu). I know there are applications/tools to automate GUI components like AutoIt but there is nothing for Linux close to AutoIt. I can say I have done my homework to find a solution. Only after not finding anything useful, I am asking this question, please help!" ]

[ "Transpose of inverse vs inverse of transpose", "How to enable numlock at boot time for login screen? I am trying to force numlock to be on upon initial boot at the login screen on Ubuntu 12.04. The only solutions I have found so far switch numlock on only after initial login. I'm looking to force numlock to be on when the login screen is displayed, and before the user has logged in. Can anyone assist?", "Minimum eigenvalue and singular value of a square matrix How to show that the relationship $\\left | \\lambda_{min} \\right | \\geq \\sigma_{min}$ holds between the minimum eigenvalue and singular value of a square matrix $A \\in \\mathbb{C}^{n \\times n}$?", "Why are extra dimensions necessary? Some theories have more than 4 dimensions of spacetime. But we only observe 4 spacetime dimensions in the real world, cf. e.g. Phys.SE post. Why are the theories (e.g. string theory) that require more dimensions taken seriously by scientists? Is there any proof that these extra dimensions exist? Is there a simple layman's explanation for the need [or strong hint] for extra dimensions?", "How to mount a remote (over SSH) directory to be available like a local directory (incl. in shell, not just in Gnome)?", "Can't redirect cut output", "Evaluating the integral $\\int_0^\\infty \\frac{\\sin x} x \\,\\mathrm dx = \\frac \\pi 2$? A famous exercise which one encounters while doing Complex Analysis (Residue theory) is to prove that the given integral: $$\\int\\limits_0^\\infty \\frac{\\sin x} x \\,\\mathrm dx = \\frac \\pi 2$$ Well, can anyone prove this without using Residue theory? I actually thought of using the series representation of $\\sin x$: $$\\int\\limits_0^\\infty \\frac{\\sin x} x \\, dx = \\lim\\limits_{n \\to \\infty} \\int\\limits_0^n \\frac{1}{t} \\left( t - \\frac{t^3}{3!} + \\frac{t^5}{5!} + \\cdots \\right) \\,\\mathrm dt$$ but I don't see how $\\pi$ comes here, since we need the answer to be equal to $\\dfrac{\\pi}{2}$.", "How to get relative path from absolute path There's a part in my apps that displays the file path loaded by the user through OpenFileDialog. It's taking up too much space to display the whole path, but I don't want to display only the filename as it might be ambiguous. So I would prefer to show the file path relative to the assembly/exe directory. For example, the assembly resides at C:\\Program Files\\Dummy Folder\\MyProgram and the file at C:\\Program Files\\Dummy Folder\\MyProgram\\Data\\datafile1.dat then I would like it to show .\\Data\\datafile1.dat. If the file is in C:\\Program Files\\Dummy Folder\\datafile1.dat, then I would want ..\\datafile1.dat. But if the file is at the root directory or 1 directory below root, then display the full path. What solution would you recommend? Regex? Basically I want to display useful file path info without taking too much screen space. EDIT: Just to clarify a little bit more. The purpose of this solution is to help user or myself knowing which file did I loaded last and roughly from which directory was it from. I'm using a readonly textbox to display the path. Most of the time, the file path is much longer than the display space of the textbox. The path is supposed to be informative but not important enough as to take up more screen space. Alex Brault comment was good, so is Jonathan Leffler. The Win32 function provided by DavidK only help with part of the problem, not the whole of it, but thanks anyway. As for James Newton-King solution, I'll give it a try later when I'm free.", "Javascript mechanism to autoscroll to the bottom of a growing page?", "iOS 11-13 - unable to paste into comments", "I got the following problem: Right now I am checking my equations, which are usually written in align. This looks great in most of the cases, but sometimes the pagebreaks are weird, ie there is a lot of vertical whitespace left (like 2.5cm) at the end of a page. I made the following MWE to illustrate this. \\documentclass[a4paper, 12pt, headsepline]{scrreprt} \\usepackage[onehalfspacing]{setspace} \\usepackage{amsmath, amssymb, mathtools} \\usepackage{mathptmx} \\usepackage[a4paper]{geometry} \\geometry{left=2cm,right=5cm,top=2cm,bottom=2cm} % \\usepackage{lipsum} %\\lipsum \\usepackage[pangram]{blindtext} \\begin{document} \\Blindtext[1][3]%1 paragraph, 3 pangrams \\begin{align} X_{t+1} &amp;= \\frac{X_{t+1}+X_{t+1}}{Y_t} \\label{eq:1} \\intertext{Solving...:} \\notag X_{t} &amp;= \\frac{X_{t+1}+X_{t+1}}{Y_{t+1}} \\notag \\\\ \\intertext{Solving further...:} \\notag % ===PAGEBREAK HERE: 2nd page begins=== &amp;= \\frac{X_{t+1}+X_{t+1}}{Y_t} + \\frac{X_{t+1}+X_{t+1}}{Y_t} \\notag \\\\ &amp;= \\frac{X_{t+1}+X_{t+1}}{Y_t}... \\notag \\\\ \\intertext{Solving further...:} &amp; = \\frac{X_{t+1}+X_{t+1}}{Y_t} \\notag \\end{align} \\end{document} In the MWE, the first 'Solving further' should be on the first page instead (to save space and it would also look better I guess?). The position where I would like the pagebreak to be is also marked as a comment in the MWE. My question is first on a general basis: Which is the best environment to achieve multiple line equations, which can be aligned as in align, and to save space at the same time? Or to be more precise: If possible, I'd like to stick with align and adapt the pagebreaks only if necessary. Thanks!", "How do you implement Coroutines in C++", "I have to prove that a function $f:]0,1] \\rightarrow \\Bbb R$ : $$ f(x) = \\begin{cases} \\frac1q, &amp; \\text{if $x \\in \\Bbb Q$ with $ x=\\frac{p}q$ for $p,q \\in \\Bbb N$ coprime} \\\\ 0, &amp; \\text{if $x \\notin \\Bbb Q $} \\end{cases} $$ is discontinuous in every point $x \\in \\ ]0,1] \\cap\\Bbb Q$. And then to consider $x \\in \\ ]0,1] \\backslash \\Bbb Q$ and prove that it is continuous. For now I learned different ways to prove continuity (epsilon-delta, sequences), but I'm never sure what would be better to use in each different case. I wanted to prove the discontinuity by using sequences: $$\\forall x_n \\quad x_n\\rightarrow a \\quad \\Rightarrow \\quad f(x_n) \\rightarrow f(a)$$ I tried creating a sequence $ x_n=\\frac1n + a$, we know it converges to $a$ but $f(x_n)\\ $ doesn't converges to $\\ f(a)$ because there would still be some points not in our set (irrational numbers that creates gaps). But I don't think it works, so I'm asking you if you could help me solving the two questions.", "Are +1/+1 counters different from +1/+1 effects?", "Difference between declaring variables before or in loop? I have always wondered if, in general, declaring a throw-away variable before a loop, as opposed to repeatedly inside the loop, makes any (performance) difference? A (quite pointless) example in Java: a) declaration before loop: double intermediateResult; for(int i=0; i &lt; 1000; i++){ intermediateResult = i; System.out.println(intermediateResult); } b) declaration (repeatedly) inside loop: for(int i=0; i &lt; 1000; i++){ double intermediateResult = i; System.out.println(intermediateResult); } Which one is better, a or b? I suspect that repeated variable declaration (example b) creates more overhead in theory, but that compilers are smart enough so that it doesn't matter. Example b has the advantage of being more compact and limiting the scope of the variable to where it is used. Still, I tend to code according example a. Edit: I am especially interested in the Java case.", "Lock in mysql database", "Why are map tiles being repeated? Using MapServer and Openlayers Problem I have: map tiles from my layer are being repeated. Shapefile is projection 3059. I have specified 3059 is in the mapfile and also when creating map object. I know OpenLayers.Layer.WMS is recommended, but when I use it I only see empty map. When I use OpenLayers.Layer.MapServer, map is displayed (and tiles are repeated), so I'm using that for now. My layer (EPSG:3059) looks like this Versions: Openlayers 2.13.1 MapServer 6.0.3 WMS Server mapfile: MAP NAME country_map STATUS ON SIZE 800 500 EXTENT 313187.4 146161.56 766469.92 470367.64 UNITS METERS SHAPEPATH \"shapefiles\" IMAGECOLOR 155 155 155 WEB TEMPLATE \"template.html\" IMAGEPATH \"C:/MS4W/ms4w/apache/htdocs/gis/output/\" IMAGEURL \"/gis/output/\" METADATA \"wms_title\" \"MapServer + Openlayers\" \"wms_onlineresource\" \"http://localhost:1025/cgi-bin/mapserv.exe?map=C:\\MS4W\\ms4w\\Apache\\htdocs\\gis\\mapfile2.map\" \"wms_enable_request\" \"*\" \"wms_srs\" \"EPSG:3059\" END END PROJECTION \"init=epsg:3059\" END # example layer LAYER METADATA \"wms_title\" \"lat_rob_region\" END NAME \"lat_rob_region\" DATA lat_rob_region STATUS ON TYPE POLYGON CLASS NAME \"lat_rob_region\" STYLE COLOR 0 255 0 END END END END Javascript: var lon = 25; var lat = 57; var zoom = 5; var map, layer1; function init() { map = new OpenLayers.Map( 'map',{displayProjection: new OpenLayers.Projection(\"EPSG:3059\")} ); layer1 = new OpenLayers.Layer.MapServer( \"Country map\", \"http://localhost:1025/cgi-bin/mapserv.exe?map=C:/MS4W/ms4w/Apache/htdocs/gis/mapfile2.map\", {layers: 'lat_rob_region'}, {gutter: 15},{srs: 'EPSG:3059'}); map.addLayer(layer1); map.setCenter(new OpenLayers.LonLat(lon, lat), zoom); map.addControl( new OpenLayers.Control.LayerSwitcher() ); }", "How to fully backup non-rooted devices? I know I'm asking for the close-to-impossible -- as a real full-backup certainly requires root permissions. But still there are many folks around not wanting to root their devices -- afraid of voiding their warranties or bricking their devices, or just not having their devices supported by any rooting method. I also know there were a lot of questions asked already on this topic, and I checked all of them having the backup tag -- none covers the entire topic, all just have pieces, and especially people new to Android (but other non-power-users as well) would have a hard time figuring out the best way. So I want a detailed canonical answer to the question: Not involving root-solutions, how to achieve a backup as close as possible to a full backup? Please do not give simple one-liner answers like \"Use app xyz [full-stop].\" If mentioning an app (and I doubt a single app would be the answer here), include what parts are covered by it -- as well as ideas on how to fill the gaps it leaves. (And to make it absolutely clear: I know the first thing coming to mind is Titanium Backup -- I use it myself, but this does not apply here: This question is strictly about methods for non-rooted devices!) Moreover, the answer should be as generic as possible in terms of applying to a wide range of devices (i.e. it should not be restricted to one device or manufacturer). I already mentioned having investigated all questions here tagged backup. These will certainly be helpful providing details for answers here, so I will list up the topmost ones concerning my question: All these provide some details for my question (so feel free to get inspired by them) -- but I feel there are still details missing. Also it would be helpful to have a summary -- say, an answer including the full description of \"the maximum possible\". A last criterium: While I'd consider cloud-based solutions legit, I'd favour local solutions. If you can provide both: all the better. But some people value privacy quite high (I'm one of them), and thus would not trust their data to some cloud service. Thanks to Ryan, we now have a solution for a really complete backup of all apps and their data -- which I didn't dare to hope for! The only disadvantage: His solution only works for less than 10% of all Android users; namely those whose devices are running at least with Android 4.x. So again, I ask the close-to-impossible: Any solutions applicable at least on Gingerbread (2.3.x) or, better, even Froyo (2.2.x) -- so they cover the majority of current devices? These solutions may involve multiple tools (try to keep it as simple as possible though; think of your mother to follow your instructions ;) And keep in mind: NO ROOT! To further motivate high-quality answers (and hopefully avoid low-quality ones), I will be a harsh one here: As I rarely do, I will down-vote answers not fitting the mentioned criteria on one end -- but on the other end, I will setup a bounty for the best answer (which cannot be done immediately, but earliest after 2 days).", "Determining if trees within forest gaps are clustered using R?", "Transfer from JFK Terminal 2 to Terminal 4 I have family who does not speak English. They are changing planes in JFK Airport and will most likely be transferring from Terminal 2 (Delta) to Terminal 4 (China Southern Airlines). At first I thought that directing them to use the Airtrain would be best. However, in doing more reading my understanding is that the Airtrain would mean they would need to go through security again. I found this on Delta's site: If they use the JITNEY Shuttle to change from Terminal 2 to Terminal 4, does that mean they would not need to re-clear Security? Edit: They are flying TO China. They are going from Tampa -> NY JFK -> China." ]

[ "Center of a free product Let $A$ and $B$ be two groups and let $G=A*B$ be their free product. Suppose both $A$ and $B$ are nontrivial. I want now to prove that $G$ is infinite and that $Z(G)$ is trivial. I think I can prove that $G$ is infinite using this argument: two reduced words of $A*B$ are equal if and only if they have the same length and the ith letter of the first word is the same as the ith letter of the second one. Hence one can find a reduced word of $G$ of length arbitrarily big (since we are sure it won't be equal to a shorter word). Do you think it works? Has anyone another suggestion? On the other hand, I don't really have a clue for the second part except trying to analyze a long list of cases of reduced words and prove for each one that the only element with which they commute is the identity. Does anyone have a smarter idea? Thanks in advance!", "Style/class tutorials What are some good tutorials on writing custom styles (classes) that clearly explain commands used and some of the features that TeX has to offer in the way of styles?", "Show that $u(x)=\\ln\\left(\\ln\\left(1+\\frac{1}{|x|}\\right)\\right)$ is in $W^{1,n}(U)$, where $U=B(0,1)\\subset\\mathbb{R}^n$. The entire problem statement is: Let $n&gt;1$ and let $U=B(0,1)\\subset\\mathbb{R}^n$. Show that $u:U\\to\\mathbb{R}$ given by $$u(x)=\\ln\\left(\\ln\\left(1+\\frac{1}{|x|}\\right)\\right)$$ is in $W^{1,n}(U).$ My attempt at the proof is as follows: To show that $u\\in W^{1,n}(U)$ it suffices to show that $|Du|\\in L^{n}(U)$. Consider $$u_{x_i}=\\frac{1}{\\ln\\left(1+\\frac{1}{|x|}\\right)}\\frac{1}{1+\\frac{1}{|x|}}|x|^{-2}\\frac{x_i}{|x|},$$ which simplifies to, $$u_{x_i}=\\frac{1}{\\ln\\left(1+\\frac{1}{|x|}\\right)}\\frac{1}{1+\\frac{1}{|x|}}\\frac{x_i}{|x|^3}.$$ Thus, $$|Du|=\\frac{1}{\\ln\\left(1+\\frac{1}{|x|}\\right)}\\frac{1}{1+\\frac{1}{|x|}}\\frac{1}{|x|^2}$$ which can be manipulated to, $$|Du|=\\frac{1}{\\ln\\left(1+\\frac{1}{|x|}\\right)}\\frac{1}{1+|x|}\\frac{1}{|x|}.$$ Moreover, since $U=B(0,1)$ we can bound the second term from above which gives, $$|Du|\\leq\\frac{1}{\\ln\\left(1+\\frac{1}{|x|}\\right)}\\frac{1}{|x|}$$ Thus, we can instead show that $$\\int_U\\left(\\frac{1}{\\ln\\left(1+\\frac{1}{|x|}\\right)}\\frac{1}{|x|}\\right)^n&lt;\\infty.$$ Converting this into polar coordinates we have with $r=|x|$, $$\\int_0^R\\int_{\\partial B(0,r)}\\left(\\frac{1}{\\ln\\left(1+\\frac{1}{r}\\right)}\\frac{1}{r}\\right)^n\\,dSdr=\\int_0^R\\left(\\frac{1}{\\ln\\left(1+\\frac{1}{r}\\right)}\\frac{1}{r}\\right)^n\\int_{\\partial B(0,r)}dSdr$$ Note that $\\int_{\\partial B(0,r)}\\,dS=n\\alpha(n)r^{n-1}$, which is the surface area of $B(0,r)$. Thus, we have then $$n\\alpha(n)\\int_0^R\\left(\\frac{1}{\\ln\\left(1+\\frac{1}{r}\\right)}\\frac{1}{r}\\right)^nr^{n-1}\\,dr=n\\alpha(n)\\int_0^R\\left(\\frac{1}{\\ln\\left(1+\\frac{1}{r}\\right)}\\right)^n\\frac{1}{r}\\,dr$$ And so this is where I get stuck in the problem, since I don't how I can evaluate that last integral to show it's finite. Thank you for any help or feedback!", "Yes, I'm a moron, and I tried to manually install a higher point release of python 2.7.16 to /usr/bin/ (i did ./configure --prefix=/usr) on my Ubuntu 16.04 machine. It seems to work fine EXCEPT for packages that depended on python, like apt-listchanges, which fails with messages like ImportError: No module named apt_pkg there's no make uninstall available, I've tried manually removing files, and still when I try apt --reinstall install python, Nothing gets overwritten and the python executable still gives the new 2.7.16 version... Any idea how to get the official repository version back??", "How to get back sudo on Ubuntu?", "The usage of singular and plural has always been confusing for me. I often see sentences like these People are using cell phones. People are using a cell phone. Does the first sentence mean everyone has a phone and they are all using their own? Does the second sentence mean they are sharing one cell phone? If I see a group of people holding a cell phone in their hand(s), &lt;- even this is confusing for me, should I use the first sentence then? Another example: you see two men, and both of them are carrying a bag. Which sentence should I say/use? They are carrying backpacks They are carrying a backpack Could you please make it clear for me?", "Insect identification - Is this a bedbug? This bug was found on a couch in . The couch, and the two beds in the room show no signs of other bugs. Is this a bed bug that I should worry about or something harmless? It was slightly larger than a common tick.", "Xcode 6.1 won't let me create a new project I'm running Xcode 6.1 on OS X Yosemite and I'm unable to create a new project, as you can see below it just says 'loading'. I've removed the product and org name for the purpose of this image. I have tried uninstalling but that didn't work. I am new to Xcode and coding in general so I would appreciate it if any solution could be given in lay terms.", "How are echo and print different in PHP? Possible Duplicate: Is there any major and fundamental difference between these two functions in PHP?", "I have a (symmetric) matrix M that represents the distance between each pair of nodes. For example, A B C D E F G H I J K L A 0 20 20 20 40 60 60 60 100 120 120 120 B 20 0 20 20 60 80 80 80 120 140 140 140 C 20 20 0 20 60 80 80 80 120 140 140 140 D 20 20 20 0 60 80 80 80 120 140 140 140 E 40 60 60 60 0 20 20 20 60 80 80 80 F 60 80 80 80 20 0 20 20 40 60 60 60 G 60 80 80 80 20 20 0 20 60 80 80 80 H 60 80 80 80 20 20 20 0 60 80 80 80 I 100 120 120 120 60 40 60 60 0 20 20 20 J 120 140 140 140 80 60 80 80 20 0 20 20 K 120 140 140 140 80 60 80 80 20 20 0 20 L 120 140 140 140 80 60 80 80 20 20 20 0 Is there any method to extract clusters from M (if needed, the number of clusters can be fixed), such that each cluster contains nodes with small distances between them. In the example, the clusters would be (A, B, C, D), (E, F, G, H) and (I, J, K, L). I've already tried UPGMA and k-means but the resulting clusters are very bad. The distances are the average steps a random walker would take to go from node A to node B (!= A) and go back to node A. It's guaranteed that M^1/2 is a metric. To run k-means, I don't use the centroid. I define the distance between node n cluster c as the average distance between n and all nodes in c. Thanks a lot :)", "I was wondering why the software center doesn't download all the requested apps and install one by one as they finish to download. Or instead why the software center doesn't download an app while the other is installing", "How is $ \\cos (\\alpha / \\beta) $ expressed in terms of $\\cos \\alpha $ and $ \\cos \\beta $? If it is possible to express $ \\cos n \\alpha $ in terms of $ \\cos \\alpha $ as a power series for integer $n$ ... I like to see an expression for the quotient angle that obviously tallies when $ (\\alpha , \\beta) $ are swapped. EDIT1: Something like: $$ \\cos (\\alpha - \\beta)= \\cos \\alpha \\cos \\beta + \\sin \\alpha \\sin \\beta $$ EDIT2: Like to know why $ \\cos ( \\alpha / \\beta )$ cannot be expressed in terms of $ \\cos \\alpha, \\cos \\beta $, but $ \\cos ( \\alpha + \\beta) $ can be expressed in terms of $\\cos \\alpha $ and $ \\cos \\beta. $", "With a two-party system, our nation will divide the people (who/whom) most need to be brought together. Do I use who or whom for this sentence? I think that \"people\" is the direct object and warrants the use of \"whom\", but I want to make sure I'm right.", "Two definitions of $\\limsup$ Here are two equivalent definitions of $\\limsup_{n\\rightarrow\\infty} a_n$: Let $u_n=\\sup\\{a_n, a_{n+1}, a_{n+2},\\ldots\\}$. Then $$\\limsup_{n\\rightarrow\\infty} a_n = \\lim_{n\\rightarrow\\infty} u_n = \\lim_{n\\rightarrow\\infty}\\left(\\sup\\{a_n,a_{n+1},\\ldots\\}\\right)$$ Let $E$ be the set of all subsequential limits of $\\{a_n\\}$. Then $$\\limsup_{n\\rightarrow\\infty} a_n = \\sup E$$ I'm curious as to which one people usually learn first, or which one people find more intuitive. Baby Rudin only has the second definition, but doesn't mention the first as far as I know. As far as intuition, I think of the second definition as \"the biggest limit point.\" I'm not sure how to think of the first definition though. I can see that $u_n \\ge u_{n+1}$ for all $n$, but I'm not sure how to interpret the limit of those $u_n$ conceptually. Are there any other ways to conceptualize $\\limsup$?", "OK guys I have this problem: For $x,y,p,q&gt;0$ and $ \\frac {1} {p} + \\frac {1}{q}=1 $ prove that $ xy \\leq\\frac{x^p}{p} + \\frac{y^q}{q}$ It says I should use Jensen's inequality, but I can't figure out how to apply it in this case. Any ideas about the solution?", "What does \"Incompatible types: void cannot be converted to ...\" mean?", "Floating point comparison", "Why does chmod 777 -R / leave the system unusable? I'm only granting permission to all to do anything but why does the system crash by giving permissions only? I'm only modifying the permission not changing the files.", "OS: Ubuntu 12.04 Accidentally deleted dpkg. Now, packages can't be installed. So, needs an dpkg installer which installs packages.", "How to download packages from a command-line given repository?" ]

[ "Is it a bad practice to catch Throwable?", "Ohmic Heating in Wires please could someone tell me why Ohmic losses are always referred to as $I^2 R$ losses? Here is my problem. If the power coming from a power station is fixed then you can either deliver this power as high voltage, low current or high current, low voltage. But isn't $I^2R$ equal to $V^2 / R$, therefore if R is constant doesn't the power depend on the square of the voltage so surely it doesn't matter whether it is high voltage or high current. The only way I can reconcile this is that a high current must cause a greater heating effect than a high voltage. I can't figure why though. If this is the case then is there a reason why a high current causes more heating than a high voltage?", "I'd like to modify the names used to typeset some of my document elements. For example, the caption of figure floats should change from \"Figure\" to \"Fig.\", and my \\tableofcontents sectioning heading shouldn't read \"Contents\", but \"Table of Contents\". How can I do that? \\documentclass{article} % \\usepackage[english]{babel} \\begin{document} \\tableofcontents \\section{foo} \\begin{figure}[h] \\centering \\rule{1cm}{1cm}% placeholder for graphic \\caption{A figure} \\end{figure} \\end{document}", "LINK : fatal error LNK1104: cannot open file 'D:\\...\\MyProj.exe'", "Prove equation with binomial coefficient", "Specific derivatives have specific names. First order is often called tangency/velocity, second order is curvature/acceleration. I've also come across words like Jerk, Yank, Jounce, Jolt, Surge and Lurch for 3rd and 4th order derivatives. Is there a widely agreed list of names for these? How many orders have specific names? In this case, I'm dealing with NURBs curves, so the \"tangency\" and \"curvature\" related words are to be preferred over \"velocity\" and \"acceleration\" words.", "Post Problem Analysis - Rod in a cylindrical time varying magnetic field? A metal rod of length $l$ is placed (as shown in figure) in a cylindrical time varying magnetic field. Find the potential difference across it. My answer: As electric fields as forming circles around the centre with magnitude $$\\frac12r\\frac{dB}{dt}$$ whose magnitude is same along any chord at a fix distance from centre: $$\\Delta V=E.l=\\frac12r\\frac32at^{\\frac12}.l$$ $$\\Delta V=\\frac34arlt^{\\frac12}$$ My question: Is $\\Delta V =V_M-V_N$ or $\\Delta V=V_N-V_M$ $\\bf OR$ equivalently which side is at high potential? Possible $(i)$ As Field lines are circular from $M$ to $N$, $M$ must be high potential. $(ii)$ As this field line apply a force on electrons- in the rod- towards left, then $M$ must have excess $e^-$ and $N$ must have deficiency; so $N$ would be high potential as $M$ is $(+)$ and $N$ is $(-)$.", "Elantech Touchpad not working on Ubuntu 16.04 and Arch Linux So I have and Asus R558UF notebook with an Elantech Touchpad. After installing Ubuntu 16.04, the touchpad worked once but after restarting, it failed to work and has not been working ever since. This is output of xinput: ↳ Elan Touchpad id=12 [slave pointer (2)] In Mouse and Touchpad settings, the touchpad is enabled. What should I do to fix this?", "Sarrus Rule with LaTeX Is there a way to create a new command with 9 arguments ({a_{11}},{a_{12}},{a_{13}},{a_{21}},{a_{22}},{a_{23}},{a_{31}},{a_{32}},{a_{33}}) that has as output a matrix with the Sarrus Rule? For instance: to obtain just use the command that we will call sarrus: \\sarrus{-k}{k-1}{1}{0}{k-1}{k}{2}{0}{1}. If it is possible i want to use the command sarrus in math mode just like matrix for istance.", "Is it safe to use file's hash as IV? I'm encrypting some files using AES in CBC mode. I'm also using file's digest (SHA-1) to check that data is decrypted correctly (so I need to store it with file). Is it safe to use this digest as AES's IV and store it in the header of file? Or it has security issue?", "Will stationary charge radiate E.M waves if observer is accelerating?", "I've been perusing the internet looking for interesting problems to solve. I found the following problem and have been going at it for the past 30 minutes with no success: Find a function $f: \\mathbb{R} \\to \\mathbb{R}$ satisfying $f(f(x)) = -x$ for all $x \\in \\mathbb{R}$. I am also wondering, can we find $f$ so that is continuous? I was thinking of letting $f$ be a periodic function, and adding half the period to x each time. I had no success with this, and am now thinking that such a function does not exist. Source:", "Excel automatic hyperlinks", "An awful lot of people seem to use the phrase \"substitute X for Y\" to mean \"replace X with Y\", while I've always used and understood it as \"replace Y with X\". This makes sense to me, given that a substitute is the replacement, not the thing which has been replaced. I thought I might be able to figure things out from a dictionary, but now after seeing two sorts of definitions, I'm even more confused: to put or use in the place of another to take the place of; replace The first one suggests that the object will be the substitute (replacement), the thing put into place, while the second suggests that the object will be the thing which has been replaced. Is one of these usages more correct in any sense? (I know this is probably a pointless question, since people will continue to speak the way they speak.) Is there perhaps a difference between American and British English? And most importantly, is there any reliable way to tell what someone means when they ask how to substitute honey for sugar, or is the verb simply guaranteed to cause confusion?", "Do different databases use different name quote? For example, mysql quote table name using SELECT * FROM `table_name`; notice the ` Does other database ever use different char to quote their table name", "How do I know if food left at room temperature is still safe to eat?", "Suppose you had a question, and you really want a good answer that would solve your problem, but noticed it was already asked by someone else. However, no one has posted any answers. The question is technically considered \"unanswered\", but a lot of users who would otherwise bother to give a correct answer probably skip the question completely for some reason. What should I do in this case? One idea is to ask a new, completely identical question, in the hope users will notice the new question and post an answer there. But would that go against SE policy? Note: This is adapted from , but that doesn't cover the case where the original question is unanswered. Also, it is not a duplicate of , as that question asks about getting attention for one's own questions, while this one and the one linked above ask about getting an answer if someone else has already posted the same thing.", "I have six upvotes for the one question with no intervening history. They have been summarised into two groups - one with 4 events and one with 2 events. However, when you expand either, both show all 6 events. Minor I know, just letting you know.", "change terminal title I want to make a shell alias that starts a certain program and also changes the title of the terminal to the name of the program. How can I do that? In case it matters, I am running the terminal on Ubuntu and connecting to a Debian server via ssh.", "If two functionals have the same kernel, then one is a multiple of the other I would like some help with this exercise. Suppose that $f_1,\\ f_2 \\in V^*$ and that $\\text{Ker} f_1 = \\text{Ker} f_2$. Show that $f_1 = k f_2$ for some scalar $k$. I expect your suggestions. Thanks!" ]

[ "RegEx for Javascript to allow only alphanumeric I need to find a reg ex that only allows alphanumeric. So far, everyone I try only works if the string is alphanumeric, meaning contains both a letter and a number. I just want one what would allow either and not require both.", "Consider the following example: \\documentclass{article} \\newtheorem{Theorem}{Theorem} \\begin{document} \\begin{Theorem} On the other hand, this one has only one claim. \\end{Theorem} \\begin{Theorem} \\begin{enumerate} \\item First claim \\item Second claim \\end{enumerate} \\end{Theorem} \\end{document} Typesetting it results in: Notice there is extra horizontal space before the first item in the list of the second theorem. Is there a sensible way to get rid of that? Ideally, the solution would work with amsthm, thmtools, enumitem. N.B.: this is related to but not quite the same.", "Find the value of $\\binom{2000}{2} + \\binom{2000}{5} + \\binom{2000}{8} + \\cdots \\binom{2000}{2000}$ Find the value of $\\binom{2000}{2} + \\binom{2000}{5} + \\binom{2000}{8} + \\cdots \\binom{2000}{2000}$ I've seen many complex proofs. I am looking for an elementary proof. I know the fact that $\\binom{2000}{0} + \\binom{2000}{1} + \\binom{2000}{2} + \\cdots \\binom{2000}{2000} = 2^{2000}$. This may help here.", "Is it possible to transfer Minecraft PE worlds to Minecraft PC?", "Why are duplicates not being merged? I see more and more exact duplicates on SO. Instead of being merged they are being simply closed. I think this is very big disservice to SO. Why don't moderators merge duplicates? Why don't owners of the site do anything about this? EDIT It's disservice because this way we have more and more junk. Duplicates are duplicates and should be merged so that information in in one place. If the duplicate has no answers then there is no benefit to merging. Of course there is. You don't need to waste your time with dupes. It also means that the search routes to the main question are diminished which makes the posting of new duplicates more likely There's easy solution for this which I gave in back in march. If both questions have answers that have been accepted, which one should be unaccpeted? There are plenty of solutions. You accept most voted accepted answer or the first accepted answer or both (I think this is be the best). Yes, there will be possibility of many accepted answers to one question. So what? When a question is closed as a duplicate, there is a link to the duplicate question. What more do you want? I don't want yet another link. I want to have all answers to some problem in one place. Is this that hard? Isn't this natural expectaion? Removal of the question means that the text in it is no longer searchable - that's a disservice. See my answer above to Scrooge's comment.", "Experimental Fractional scaling makes fonts dirty in Ubuntu 17.10 I updated to 17.10 from 17.04. I activated the fractional scaling by running the following command. gsettings set org.gnome.mutter experimental-features \"['scale-monitor-framebuffer']\" Then, I changed 125% scale. The scale was changed, but the fonts and icons are so dirty. The launcher icon and font in Google Chrome and other application except the system setting are dirty. How can I resolve this problem? For some reason, font in the system setting is not dirty...", "How to disable autorefresh in snap Is it possible to disable autorefresh in snap? This says that Snaps are updated automatically in the background to the latest version, every day. Some snaps (e.g. vlc) are built daily, and it makes no sense to install them every day.", "Is it possible to create a \"weak reference\" in javascript? Is there any way in javascript to create a \"weak reference\" to another object? Can anyone think of a way to implement this behavior in javascript?", "Assume there is a public-key encryption scheme $(KeyGen, Enc, Dec)$ with perfect correctness (i.e., for all messages M and valid key-pairs (PK,SK), we have $Dec_{SK}(Enc_{PK}(M))=M$). Will there always be a function $A$ such that for all messages M and valid public-keys PK, $A_{PK}(Enc_{PK}(M))=M$? In other words, can a computationally unbounded adversary decrypt the message, having only the public key?", "I am flying from Los Angeles to Bangalore. I have a flight option from LAX to Minneapolis and from there to Paris. I have only 45 minutes at Minneapolis before my next flight. Is this too risky a schedule? I am not an American, so I guess I would need to cross emigration too?", "Limit of Multivariate Probability Density Function as one or more or all variables approach positive or negative infinity Could someone point out a good source or provide justification as to whether the limit of a multivariate probability density function, as one or more or all variables tends to positive or negative infinity, goes to zero. $$\\lim_{x_{1}\\to\\pm\\infty}f(x_{1},x_{2},...,x_{n})=0$$ $$\\lim_{x_{1},x_{2}\\to\\pm\\infty}f(x_{1},x_{2},...,x_{n})=0$$ $$\\lim_{x_{1},x_{2},...,x_{n}\\to\\pm\\infty}f(x_{1},x_{2},...,x_{n})=0$$ I have found this related question for the univariate case:", "What command(s) would you use to extract all of the usernames from a database called /etc/passwd and then sort this output alphabetically in reverse order?", "How can I run Windows applications on a MacBook Pro? I have a friend that wants to buy a Mac Book Pro and he has some windows applications that he needs to run. He doesn't want to buy the applications again. Can he run the Windows applications on his MacBook Pro? What ways to accomplish this are available?", "How to pass argument to script which is input to bash", "Proving $\\gcd \\left(\\frac{a}{\\gcd (a,b)},\\frac{b}{\\gcd (a,b)}\\right)=1$ How would you go about proving that $$\\gcd \\left(\\frac{a}{\\gcd (a,b)},\\frac{b}{\\gcd (a,b)}\\right)=1$$ for any two integers $a$ and $b$? Intuitively it is true because when you divide $a$ and $b$ by $\\gcd(a,b)$ you cancel out any common factors between them resulting in them becoming coprime. However, how would you prove this rigorously and mathematically?", "First of all, I think this question is not duplicated, because I have tried all other solutions I found here, but nothing solved my problem. I use Ubuntu 14.04 64 bit. I have tried until now: sudo apt-get install skype -> It didn't work. The error was: The following packages have unmet dependencies: skype : Depends: skype-bin E: Unable to correct problems, you have held broken packages. I have tried sudo dpkg add-architecture &amp;&amp; sudo dpkg -i skype-ubuntu-precise_4.3.0.37-1_i386.deb but it didn't work either. The error was: dpkg: dependency problems prevent configuration of skype: skype depends on libqt4-dbus (&gt;= 4:4.5.3); however: Package libqt4-dbus is not installed. skype depends on libqt4-network (&gt;= 4:4.8.0); however: Package libqt4-network:i386 is not installed. skype depends on libqt4-xml (&gt;= 4:4.5.3); however: Package libqt4-xml:i386 is not installed. skype depends on libqtcore4 (&gt;= 4:4.7.0~beta1); however: Package libqtcore4:i386 is not installed. skype depends on libqtgui4 (&gt;= 4:4.8.0); however: Package libqtgui4:i386 is not installed. skype depends on libqtwebkit4 (&gt;= 2.2~2011week36); however: skype depends on libstdc++6 (&gt;= 4.2.1); however: Package libstdc++6:i386 is not installed. skype depends on libx11-6; however: Package libx11-6:i386 is not installed. skype depends on libxext6; however: Package libxext6:i386 is not installed. skype depends on libxss1; however: Package libxss1:i386 is not installed. skype depends on libxv1; however: Package libxv1:i386 is not installed. skype depends on dpkg: error processing package skype (--install): dependency problems - leaving unconfigured Processing triggers for hicolor-icon-theme (0.13-1) ... Processing triggers for gnome-menus (3.10.1-0ubuntu2) ... Processing triggers for desktop-file-utils (0.22-1ubuntu1) ... Processing triggers for bamfdaemon (0.5.1+14.04.20140409-0ubuntu1) ... Rebuilding /usr/share/applications/bamf-2.index... Processing triggers for mime-support (3.54ubuntu1) ... Errors were encountered while processing: skype I have tried to use after sudo apt-get -f install but it didn't solve the issue. I have tried to install by using Gdebi. The error was: Cannot install 'libqtwebkit4:i386' I have tried to install using Ubuntu Software Center. The error was: Cannot install 'libqtwebkit4:i386' I have tried changing the server in \"Software and Updates\". I have tried to use \"Main Server\" and \"Servers for United States\". But it couldn't solve my problem. Anyone has any idea how to solve that? SOLVED Well, I formatted my pc and I installed Skype first of all. Probably another installation that I had done before the Skype installation was the problem, i guess. Thanks people!", "Algorithms for computing multiplicative order modulo $n$ If I take the $k \\in \\mathbb{N}$ power of 10 and mod it by a large prime, I notice that the remainders repeat at some point. For instance $10^k mod~7$ seems to repeat every $8$th value of $k$. Given $k$ (the power of ten), and a large prime number $p$, how can I compute the size of the cycle? I tried writing a python script that computes the first instance of a repeat. However, I don't know if this works since a single instance of a repeat may not necessarily mean a full cycle.", "\"24 hours' notice\" or \"24 hours notice\"? Which one is correct? 1: Well, you canceled on Tuesday and our policy is 24 hours' notice for all cancellations. 2: Well, you canceled on Tuesday and our policy is 24 hours notice for all cancellations. To me personally, the first one makes more sense grammatically. But I've also heard that the second version is how they typically write it on paper forms at hospitals (that's what native speakers say). Could you please clarify my confusion?", "Where is the cron / crontab log?", "Book about a boy who travels to a parallel universe to get a book" ]

[ "dpkg error: \"trying to overwrite file, which is also in...\" For example: $ sudo apt-get install curl Reading package lists... Done Building dependency tree Reading state information... Done You might want to run 'apt-get -f install' to correct these: The following packages have unmet dependencies: bsh : Depends: libjline-java but it is not going to be installed groovy : Depends: libjline-java but it is not going to be installed rhino : Depends: libjline-java but it is not going to be installed E: Unmet dependencies. Try 'apt-get -f install' with no packages (or specify a solution). I get the same or similar errors when I attempt to install clojure1.3, leiningen, and several other packages. When I try the suggestion made in the error message, this is what happens: $ sudo apt-get -f install Reading package lists... Done Building dependency tree Reading state information... Done Correcting dependencies... Done The following packages were automatically installed and are no longer required: diffstat linux-headers-3.2.0-26-generic linux-headers-3.2.0-26 dh-apparmor dkms html2text libmail-sendmail-perl libsys-hostname-long-perl Use 'apt-get autoremove' to remove them. The following extra packages will be installed: libjline-java Suggested packages: libjline-java-doc The following NEW packages will be installed: libjline-java 0 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 23 not fully installed or removed. Need to get 0 B/72.0 kB of archives. After this operation, 129 kB of additional disk space will be used. Do you want to continue [Y/n]? Y (Reading database ... 226243 files and directories currently installed.) Unpacking libjline-java (from .../libjline-java_1.0-1_all.deb) ... dpkg: error processing /var/cache/apt/archives/libjline-java_1.0-1_all.deb (--unpack): trying to overwrite '/usr/share/java/jline.jar', which is also in package scala 2.9.2-400 Errors were encountered while processing: /var/cache/apt/archives/libjline-java_1.0-1_all.deb E: Sub-process /usr/bin/dpkg returned an error code (1) $ sudo apt-get upgrade Reading package lists... Done Building dependency tree Reading state information... Done You might want to run 'apt-get -f install' to correct these. The following packages have unmet dependencies: bsh : Depends: libjline-java but it is not installed groovy : Depends: libjline-java but it is not installed rhino : Depends: libjline-java but it is not installed E: Unmet dependencies. Try using -f.", "Why is the mean function in Gaussian Process uninteresting?", "When should I use or >()? I know that &lt;, &lt;(), &lt;&lt; all are used to give input and &gt;, &gt;() which are used to redirect output. But I don't know what is clear difference between them and when to use them. Please explain in detail and along with references if possible. Thanks", "Is there a difference between foo(void) and foo() in C++ or C? Consider these two function definitions: void foo() { } void foo(void) { } Is there any difference between these two? If not, why is the void argument there? Aesthetic reasons?", "What’s the rule for using “who” and “whom” correctly?", "I have a beautiful inequality, but I can only prove part of cases. Given any positive real numbers $a,b,c$, we have $$(a^{2}+2)(b^{2}+2)(c^{2}+2)\\geq 9(ab+bc+ca)$$ How can we prove this statement?", "Chat reputation in left bar seems different than any other reputation displayed for users", "Why is the Star Trek 2009 reboot called a reboot? Doctor Who (2005) isn't called a reboot. It is called a continuation of the old series. This was made possible by that regeneration ju-ju and stuff. On the other hand, Star Trek 2009 reincarnation is often called a reboot. Nobody dared call it continuation. I don't think I need to do citation because it's common. Now, if we actually go into the details: The new universe contains two Spock. One is from the original timeline. The Spock Prime even gives data from the original timeline like trans-warp equation, Khan etc. We see other past data from before the timeline diverged. For example, Scott told that he transwarped Admiral Archer's dog. \"Archer's dog\" existed in Star Trek: Enterprise TV series. So, why didn't the legacy survive in-universe? Why isn't it considered a continuation of the old Star Trek TV shows and movies? Or, is the reboot word used by mistaken fans and media only? Update: After the release of Star Trek: Beyond (2016), this is no longer a confusion as the movie showed a photo from original timeline.", "Is there any Stack Exchange site where the main topic is literature? I have tried the English Language site, but it seems that it is not the appropriate site. Perhaps the writers site would work? But, then again, the main point is different than the one I am searching for.", "I want to clear the inputtext used to search, and clear all search results using a commandbutton. I tried the following on the 'Reset' button I added but it only clears the inputtext and the search results are not clearing. &lt;apex:pageBlockSectionItem &gt; &lt;apex:outputPanel layout=\"block\" Rendered=\"true\"&gt; &lt;apex:inputText value=\"{!ReportSearchString}\" /&gt; &lt;apex:commandButton value=\"Search\" action=\"{!searchReports}\" reRender=\"ReportSearchResults, \"/&gt; &amp;nbsp;&amp;nbsp; &lt;apex:commandButton value=\"Back\" action=\"{!BackToCreateFeedPage}\"/&gt;&amp;nbsp; &lt;apex:commandButton value=\"Reset\" onclick=\"this.form.reset();return false;\"/&gt; &lt;/apex:outputPanel&gt; &lt;/apex:pageBlockSectionItem&gt; &lt;/apex:pageBlockSection&gt; &lt;apex:pageBlockSection id=\"ReportSearchResults\"&gt; &lt;apex:outputText value=\"{!warningMessage}\" rendered=\"{!!showTable}\" /&gt; &lt;apex:pageBlockTable value=\"{!reportList}\" var=\"item\" rendered=\"{!showTable}\"&gt; &lt;apex:column headerValue=\"Report Name\" &gt; &lt;apex:commandLink value=\"{!item.Name}\" action=\"{!BackToCreateFeedPage}\"&gt; &lt;apex:param value=\"{!item.Id}\" name=\"SelectedReport\" assignTo=\"{!selectedReportId}\" /&gt; &lt;/apex:commandLink&gt; This is my search function, it works fine. I need to clear the results of this search on clicking 'Reset' button. public void searchReports() { showTable = false; reportList = new List&lt;Report&gt;(); reportSearchResult = new Map&lt;Id, Report&gt;(); selectedReport = new Report(); if((ReportSearchString != null &amp;&amp; ReportSearchString != '') &amp;&amp; ReportSearchString.length() &gt;= 3) { reportSearchResult = new Map&lt;Id, Report&gt;([Select Id, Name From Report Where Name Like :'%'+ReportSearchString+'%' limit 2000]); warningMessage = 'No Result Found'; } else { warningMessage = 'Search text should have atleast 3 characters'; } }", "Convert char to int in C#", "How can I pass a class member function as a callback? I'm using an API that requires me to pass a function pointer as a callback. I'm trying to use this API from my class but I'm getting compilation errors. Here is what I did from my constructor: m_cRedundencyManager-&gt;Init(this-&gt;RedundencyManagerCallBack); This doesn't compile - I get the following error: Error 8 error C3867: 'CLoggersInfra::RedundencyManagerCallBack': function call missing argument list; use '&amp;CLoggersInfra::RedundencyManagerCallBack' to create a pointer to member I tried the suggestion to use &amp;CLoggersInfra::RedundencyManagerCallBack - didn't work for me. Any suggestions/explanation for this?? I'm using VS2008. Thanks!!", "How to make a vf page with the same look &amp; feel as salesforce1, any ideas?", "Error in updating to ADT rev 23 for Eclipse", "Calculating $1+\\frac13+\\frac{1\\cdot3}{3\\cdot6}+\\frac{1\\cdot3\\cdot5}{3\\cdot6\\cdot9}+\\frac{1\\cdot3\\cdot5\\cdot7}{3\\cdot6\\cdot9\\cdot12}+\\dots? $", "Does 10 heads in a row increase the chance of the next toss being a tail? I assume the following is true: assuming a fair coin, getting 10 heads in a row whilst tossing a coin does not increase the chance of the next coin toss being a tail, no matter what amount of probability and/or statistical jargon is tossed around (excuse the puns). Assuming that is the case, my question is this: how the hell do I convince someone that is the case? They are smart and educated but seem determined not to consider that I might be in the right on this (argument).", "Double dual mappings $\\newcommand{\\Hom}{\\operatorname{Hom}}$Let $U,V$ be vector spaces. Denote the dual space of $U$ with $U^\\intercal$ and the dual mapping of a linear map $\\Phi$ be $\\Phi^\\intercal$. Define the double dual embedding on $U$ to be $\\iota_U:U \\to U^{\\intercal\\intercal}$. ($u \\in U, f \\in U^\\intercal$) $$ \\iota_U(u)(f) = f(u) $$ If $\\Phi \\in \\Hom(V,U)$, then $\\Phi^{\\intercal\\intercal} \\circ \\iota_V = \\iota_U \\circ \\Phi:V \\to U^{\\intercal\\intercal}$ Proof: Let $v \\in V, f \\in U^\\intercal$. Then $$ \\iota_U \\circ \\Phi(v)(f) = f(\\Phi(v)) $$ but how do I show that $$ \\Phi^{\\intercal\\intercal} \\circ \\iota_V(v)(f) = f(\\Phi(v)) $$ ?", "I am seeing quite a few conversions which have as source \"accounts.google.com\" (almost 40%). AFAIK, in the new Universal Analytics as soon as a user has a Referrer set a new session is started. So if a user is getting on my page, and creates an account using social auth (e.g. Google accounts) when being redirected back, will this create a new session? I guess this would explain that there are many conversions coming from accounts.google.com - is it safe to enter accounts.google.com into the Referral Exclusion List? And more - what about Facebook logins, those would show up as facebook.com, but i probably don't want to exclude facebook.com as referrer? Any ideas how to deal with UA referrers and social logins?", "Related to Meta Super User efforts: and Meta Server Fault efforts: We already auto-remove negatively voted unanswered old questions automatically after 30 days, network wide, with no human intervention required. I was thinking we might extend that to remove old, unanswered zero score questions... based on the following criteria: fewer than (question age in days * 1.5) views 0 score or lower, or 1 score or lower if the original author is deleted no answers 1 comment or fewer asked more than 1 year ago (thus based on creation date, not last activity date, so , or a user editing it, does not give a doomed question 365 more days of zombie &quot;life&quot;) See the results of this query on: (10509) | (787) | (650) This query has been refined based on the comments, and this is the final version that will roll out tonight. Every site in the network (except metas) will automatically delete old questions that meet this criteria from this point forward.", "How do I arrange selected vertices into a circular formation quickly? The other answers does not have the same title as my question. My question is direct and simple for younger beginner to search for results." ]

[ "How can I count unique selections from multiple selections in a drop down list (Excel) I would like to count the number of unique selections from a column that contains multiple selections from a drop down list. For example, column B3 contains, Monday, Tuesday, Wednesday The count function returns a value of 1 instead of 3 - is there any way to count the three days distinctly? Thank you! Multiple selections from a drop down list was made possible using the VBA code from:", "I have a requirement where a certain field can be edited without the validations firing for a particular user. Now I tried to write rule like LastModifiedId != '005000000000000AAA' but the validation was still firing. Then I realized that until the record saves, the LastModifiedId does not change and the validations still fire, as the LastModifiedId would not be updated to the exempted User. Is there any workaround or a way to check the Id of the User who is currently editing the record?", "It is often stated that the Lagrangian formalism and the Hamiltonian formalism are equivalent. We often hear people talk about eigenvalues of Hamiltonians but I have never ever heard a word about eigenvalues of Lagrangians. Why is this so? Is it not useful? is it not possible to do it?", "Scanf skips every other while loop in C", "Find $ P(Z>X+Y)$ where $X,Y,Z \\sim U(0,1)$ independently I'm trying to follow a line in a derivation for $P(Z&gt;X+Y)$ where $X,Y,Z$ are independent continuous random variables distributed uniformly on $(0,1)$. I've already derived the pdf of $X+Y$ using the convolution theorem, but there's a line in the answer that says: $P(Z&gt;X+Y) = \\mathbb{E}[\\ P(Z&gt;X+Y\\ |\\ X+Y )\\ ]$ where $\\mathbb{E}$ is the expectation. I'm not familiar with this result. Could anyone give a pointer to a similar result if one exists? Thanks.", "I've come across a small issue which occurs when a question has been closed but the question itself or one of its answers are being edited. Steps to reproduce: Visit a closed question. (even closed years ago) In a different tab or browser, edit the question or one of its answers. \"an edit has been made to this post; click to load\" message will appear above the edited post in the first tab/browser, click it. The .question-status div becomes hidden, which includes the closed notice below a question and, for a duplicate-closed question, the list of duplicates above the question body. This gives the appearance that the question is no longer closed (until you refresh). Some screenshots: I know it isn't common/important but it did confuse me when looking at a particularly bad question - I thought it had been reopened. Is this an intentional feature? If so, what was the thinking behind it? Another example Before After", "I am trying to update Xcode to 8.0. My OS is 10.11.6 El Capitan. However I am getting: We could not complete your update There is not enough disk space available to install the product. I have got 14.22 GB free space. How much do I need? UPDATE: I do not know the exact figure, though I did manage to update with 17.21 GB free space later on.", "Limit size of Queue in .NET? I have a Queue&lt;T&gt; object that I have initialised to a capacity of 2, but obviously that is just the capacity and it keeps expanding as I add items. Is there already an object that automatically dequeues an item when the limit is reached, or is the best solution to create my own inherited class?", "Distributing elements across a list of lists", "The Quotation Mark character in TeXworks editor has vanished Now, my version of TeXworks is 0.4.5r.1280 and I can't have the \" character on the keyboard. I have `` or '' instead. Why? And It's the same with Alt+034. I'm very disappointed with that.", "SEO (or other) problems with a 404?", "I posted a question recently regarding my Windows 10 upgrade which ended up with a black screen and cursor. I reverted back to Windows 8.1 using the \"Revert to previous build\" option in recovery, and all seems fine, except that Virtualisation is disabled. I tried to open BIOS settings but it just boots into Windows. I've tried the usual F2 key and Shift F2, all the other F keys, tried pressing B and Shift+B but no luck. I tried pressing the Lenovo key on the laptop when it is powered down, which shows a menu to either boot into BIOS, recovery, or show boot menu. I choose BIOS and it just boots into Windows. I tried going into advanced startup options from Windows (Shift+Restart) and choosing \"UEFI FIRMWARE SETTINGS\" but it just reboots back into Windows. Before the Windows 10 upgrade it was working perfectly. Lenovo G580 laptop - Core i3 with Intel 4000 graphics. 8GB of RAM and a Crucial MX100 512GB SSD (replaced the original hard drive with this SSD).", "How should I punctuate around quotes where the punctuation required by the quote interferes with the punctuation of the sentence? The American convention in quotations is (typically) to place punctuation inside quoted text. But I always run into situations where the punctuation of the quote interferes with the punctuation of the sentence. How would you punctuate this (American, non technical)? When my friends ask, \"What do you want for your birthday?\", I never know how to respond. It seems odd to place the last comma outside the quote simply because of the question mark. Is that the preferred (i.e. most often accepted) standard?", "Kinematic Viscosity", "How precisely do I need to post close to 7:00 (somewhere) to get hero of time?", "Ireland Transit Visa when flying from IND - Abu Dhabi - Dublin - US", "What is spin as it relates to subatomic particles?", "Python csv.reader: How do I return to the top of the file? When I'm moving through a file with a csv.reader, how do I return to the top of the file. If I were doing it with a normal file I could just do something like \"file.seek(0)\". Is there anything like that for the csv module? Thanks ahead of time ;)", "In Clash of Clans there was an update on 9/16 adding a Tie-breaker into the wars, can anybody explain in detail how this mechanism works?", "Do you pluralize the singular possessions of / items or people associated with individual members of a plural group?" ]

[ "I hear so many terms involving the word \"linear\". Linear function, linear equation, linear system, linear operator, linear transformation, linear mapping, linear space, linear algebra, linear electrical circuits, linear filters, linear electrical elements, linear approximation, linear optimization. I'm getting crazy trying to understand the application of the \"linear concept\" to all this aspects (function, equation, mapping, system, operator, transformation, algebra, etc.) and I wish to know the one essence that is to be linear. What something has to be to be linear? If I say something is linear, what do I know for sure about that something (no matter what the something is)? I heard a definition of linearity is by homogeinity (scaling the input results in a scaled output) and addition (summing the inputs results in summing the outputs). Can I apply this simple definition to all the branches (operator, mapping, system, transformation, algebra, ...) I mentioned ? Do they all behave like a line ? y = ax + b, for example, is a line but doesn't behave like a line because y is not linear.", "How to make a figure span on two columns in a scientific paper? If I just try to set the figure's size to 0.9\\textwidth my figure will just end up on the right column, sized to be two-columns wide. Has anyone done this before?", "Is there a noun for something that is \"out of place\" in space, like an anachronism is \"out of place\" in time? E.g., an old-timey barber shop in a chic neighborhood.", "Why are some of my screen-recording/capturing/sharing applications (or app features) not working in Ubuntu 17.10 (and later releases)? After upgrading to Ubuntu 17.10 I noticed some of my screencasting applications are not working, for example screencasting tools like SimpleScreenRecorder and vokoscreen. () Also I noticed features like screenshot from GIMP is not working properly, producing blank screenshots (). Shutter too is producing glitchy screenshots (). Screen-sharing option on Skype is also not working (). The issue occurs sometimes on later Ubuntu releases too. Why is this happening and how do I fix this?", "I'm in a numerical analysis course right now and it's pretty rigorous but I'm enjoying it a lot. I took a lower level course before that was more oriented towards implementation of numerical methods, so it's not my first time with the material. Anyway, my professor wrote his own course notes and they're fantastic but I wanted some reference material since I'm currently outlining my own notes. Just wondering what the big ones out there are edit: I would say I'm at an advanced undergraduate level", "Change the size of a math symbol How can I get something like in the figure, where G in the middle is larger than normal letters in math mode?", "What's the bad magic number error?", "Get e-mail addresses from Gmail messages received", "Sending Email in Android using JavaMail API without using the default/built-in app", "Different batteries connected in parallel If we have 2 batteries one of emf x and the other is of emf y and we connect them in series we get an effective emf of x+y. But what if we connect them in parallel, how to calculate the emf now?", "Can I force WordPress to use instead of ?", "I know from the that it is not possible to introduce direct abbreviations like \\newcommand{\\bal}{\\begin{align}} % doesn't work \\newcommand{\\eal}{\\end{align}} % doesn't work or \\newcommand{\\bal}{\\align} % doesn't work \\newcommand{\\eal}{\\endalign} % doesn't work What is puzzling me is that \\newenvironment{foo}{\\align}{\\endalign} does work, at least if one is well-behaved enough to diligently type \\begin{foo}...\\end{foo}, since \\foo...\\endfoo won't work either. I'd really appreciate some help to shed some light on what is going on behind the scenes :-)", "Let's say I have a (comparatively) lovely-looking document in LaTeX, full of lovingly typeset, (relatively) complex equations. Now, let's say some barbarians come along one day and decide that the document has to be put into Microsoft Word (2007). ...after the usual mourning period associated with such events, let's say I value my job (more specifically, the bread it provides) enough to get all the text and tables formatted and references organised into the Word document. –...related questions and – Now I'm looking at the equations with fear and dread. One option of course is to just lift screenshots from the original document, but this is painstaking if I need to refer to parts of the equation in the text. Also, I might need to edit equations on the fly. Anyone know of a free application which allows embedding LaTeX math into MS Word? I've looked at and which do roughly what I want... they build LaTeX images from source and embed them into the Word document, allowing to edit the source later... but both are commerical. ...any help in these troubling times will be greatly appreciated. EDIT: Just a note that offers a 30-day free trial and is working out really nicely... but still, it's not free. Might be a good solution for those with short-term needs, or money.", "Show that if $ab$ has finite order $n$, then $ba$ also has order $n$. - Fraleigh p. 47 6.46.", "How to retrieve a module's path? I want to detect whether module has changed. Now, using inotify is simple, you just need to know the directory you want to get notifications from. How do I retrieve a module's path in python?", "Profitable strategy in coin tossing?", "How come this is happening in java?", "Can we build capacitors on a PCB board?", "How to match all occurrences of a regex Is there a quick way to find every match of a regular expression in Ruby? I've looked through the Regex object in the Ruby STL and searched on Google to no avail.", "I am currently using 19.04 and I got \"No new release found for 19.10\"" ]

[ "How to deal with SQL column names that look like SQL keywords? One of my columns is called from. I can't change the name because I didn't make it. Am I allowed to do something like SELECT from FROM TableName or is there a special syntax to avoid the SQL Server being confused?", "Make file in linux readonly", "GLR Test for 2 samples from exponential distributions", "Custom DataTable using Vanilla Datables in LWC I'm trying to build a custom datable because I want the functionality to sort, search and paginate and also add action buttons in each row. Initially, my VF page was using but we have now decided to rebuild that page in LWC. I found a similar but it hasn't really worked for me. I then found (Javascript) and (ES2018) I have tried to implement Vanilla Datatables but I keep running into issues such as: TypeError: Cannot read property 'length' of undefined The above error is thrown because the library is unable to find the body of the table. My point is that I feel this library won't work because it's using document, window and so on. I was wondering if there is a way I could convert this library to something that is more suited to LWC basically have it \"export\" the modules. Since I'm not a JS expert I'm unable to put the pieces together. Just for some context, I'll post my code here: &lt;template&gt; &lt;table class=\"sobject-table slds-table slds-table_cell-buffer slds-table_bordered\"&gt; &lt;thead&gt; &lt;tr class=\"slds-line-height_reset\"&gt; &lt;template for:each={fieldSetData} for:item=\"field\"&gt; &lt;th key={field.apiName} title={field.fieldLabel} class=\"\" data-scope=\"col\"&gt; &lt;div class=\"slds-truncate\" title={field.fieldLabel}&gt;{field.fieldLabel}&lt;/div&gt; &lt;/th&gt; &lt;/template&gt; &lt;/tr&gt; &lt;/thead&gt; &lt;tbody&gt; &lt;template for:each={records} for:item=\"row\"&gt; &lt;tr key={row} class=\"slds-hint-parent\"&gt; &lt;template for:each={row} for:item=\"data\"&gt; &lt;td key={data.id} data-label=\"Name\" data-scope=\"row\"&gt;{data.value}&lt;/td&gt; &lt;/template&gt; &lt;/tr&gt; &lt;/template&gt; &lt;/tbody&gt; &lt;/table&gt; &lt;/template&gt; import {LightningElement, api, wire} from 'lwc'; import {processRecords} from 'c/recordGenerator'; import getFieldSetData from '@salesforce/apex/FieldSetData.getFieldSetData'; import getSobjectRecords from '@salesforce/apex/DeomoCTRL.getRecords'; import VanillaDatatable from '@salesforce/resourceUrl/VanillaDatatable'; import {loadScript, loadStyle} from 'lightning/platformResourceLoader'; export default class ManageSelectedIndicators extends LightningElement { @api recordId; records; fieldSetData; @wire( getFieldSetData, {objectName: 'SOBJECTName', fieldSet: 'FIELSETName'} ) wiredFieldSetData({error, data}) { console.log('wired called in Child') if (data) { this.fieldSetData = data; this.getData(); } } constructor() { super(); console.log('Constructor called in Child'); } connectedCallback() { console.log('Connected callback'); } renderedCallback() { console.log('Rendered callback'); Promise.all([ loadScript(this, VanillaDatatable + '/VanillaDataTables/src/vanilla-dataTables.js') ]).then(() =&gt; { const table = new DataTable( document.getElementsByClassName('.sobject-table'), //Also tried this.template.querySelector('.sobject-table'), {searchable: true, sortable : true} ); }) .catch(error =&gt; { console.log(error); }); } getData() { getSobjectRecords ({ sobjectId: this.recordId }) .then(response =&gt; { this.records= processRecords(response, this.fieldSetData); }) .catch((error) =&gt; { console.log(error); }); } } Edit: I have also tried lwc:dom=\"manual\" that didn't seem to work either. Is there any other way I could achieve these functionalities? Or do I have to write custom code to achieve this?", "A problem about wave equation", "Parenthesis vs brackets for matrices When I first learned linear algebra, both the professor and the book used brackets like [ and ] to enclose matrices. However, in my current differential equations textbook, matrices are enclosed by parenthesis, and I suddenly realize everybody else are using them too. So are brackets/parenthesis for enclosing matrices always totally interchangeable?", "How do I print a #defined constant in GDB?", "Pick random row from a file", "How to represent it with UNIQUE indexes and foreign keys? \"Group\" is a group of pupils. \"Topic\" is a topic of lessons. To every group corresponds exactly one topic. (So there may be multiple groups per topic.) To a pupil corresponds multiple groups, but maximum one group per topic. How to implement this in terms of UNIQUE indexes and foreign keys in MySQL?", "How to create a meta-package that automatically installs other packages? I'd like to be able to create a package that doesnt contain any code or programs itself, but instead installs other packages that exist in the repositories onto a computer, sort of how the ubuntu-restricted-extras package does?", "Find duplicate records in MySQL", "I really love Eclipse (PDT)... But i'm developing sites using HTML5 and CSS3 and it mark the HTML5 tags like &lt;nav&gt;, &lt;section&gt; and &lt;article&gt; as invalid tags (inexistent). How can I add those new tags to it? And what about CSS3 rules? I read something about remove the \"invalid tag\" check... and that's not what I want. :(", "What is the volatile keyword useful for?", "Proving the snake lemma without a diagram chase", "Do airlines have to check the visa status before selling a ticket?", "Does removing an iPhone from my icloud account also erase the data? I lost my iPhone 6S recently. I think it fell off my car and was crushed because it has been offline (according to Find My iPhone) ever since. I want to erase the phone and remove it from my iCloud account since the phone is gone. However, I can't erase the phone until it comes back online. I do have the option to remove the device from my iCloud account. If I remove the phone from my iCloud account, does that also erase the data? The phone has a password on it, will it continue to be locked in case someone finds it after I have removed it from my iCloud account?", "What rolls should players get to see? I'm a new DM and over the last few weeks I've been slowly learning the game and how it runs. My party consists of 5 PCs. One thing I have been wondering after our last two sessions is: What rolls should all the players see and which rolls shouldn't they see? Is there a comprehensive list of what rolls are public and which go behind the DM screen, or is it more down to house rules or personal preference?", "Top of answer covered by sticky top bar after clicking direct link With the introduction of the network-wide sticky top bar , I noticed a bug that's happening on every site (except for Stack Overflow). When you click on an answer link (of the form https://site.stackexchange.com/a/####), the very top of the answer and the upvote button are covered by the top bar: Stack Overflow shows the correct behavior:", "Guarding against cryptanalytic breakthroughs: combining multiple hash functions", "HP laptop F1-12 keys inverted with Fn I recently bought an HP laptop. I'm pleased with it, save for one thing. All the F1-12 keys are inverted. I mean the following: All the F-keys have a symbol on it. Normally you would press Fn + your to use it. On this laptop, it's reversed. The symbol is what you get when you press the button normally and you have to press Fn + F-key to get the usual action. So, if I want to refresh a webpage, instead of just F5, I have to do Fn + F5 I want to change this to regular behavior. Anybody know how I can do this? Running Win7 Home premium, 64-bit." ]

[ "Redirect based on country Let's say I have a site that has multiple versions for different countries, e.g.: www.example.com/us www.example.com/uk www.example.com/ca and I want to use IP geolocation to redirect users who go to www.example.com to the appropriate country version of the site. What is the best way to do that without confusing crawlers such as Googlebot or running into other SEO type trouble?", "A murder of crows? I love the subset of collective nouns known as the terms of venery. These are collective nouns specific to a particular group of animals. Some of the more inventive examples are: a murder of crows, a crash of rhinos, a mischief of mice, and a puddling of ducks (specifically swimming ducks). Is there a standard for these group names and is there a central reference for them as with other zoological taxonomy? I can see in the Wikipedia articles that the practice has its origins in Medieval Hunting tradition, but the Kangaroo (Mob), for instance would have been unknown at that time, so how do new collections come into being?", "After removing any part the rest can be split evenly. Consequences?", "I've never really understood why math induction is supposed to work. You have these 3 steps: Prove true for base case (n=0 or 1 or whatever) Assume true for n=k. Call this the induction hypothesis. Prove true for n=k+1, somewhere using the induction hypothesis in your proof. In my experience the proof is usually algebraic, and you just manipulate the problem until you get the induction hypothesis to appear. If you can do that and it works out, then you say the proof holds. Here's one I just worked out, Show $\\displaystyle\\lim_{x\\to\\infty} \\frac{(\\ln x)^n}{x} = 0$ So you go: Use L'Hospital's rule. $\\displaystyle\\lim_{x\\to\\infty} \\frac{\\ln x}{x} = 0$. Since that's $\\displaystyle\\lim_{x\\to\\infty} \\frac{1}{x} = 0$. Assume true for $n=k$. $\\displaystyle\\lim_{x\\to\\infty} \\frac{(\\ln x)^k}{x} = 0$. Prove true for $n=k+1$. You get $\\displaystyle\\lim_{x\\to\\infty} \\frac{(\\ln x)^{k+1}}{x} = 0.$ Use L'Hospital again: $\\displaystyle\\lim_{x\\to\\infty} \\frac{(k+1)(\\ln x)^{k}}{x} = 0$. Then you see the induction hypothesis appear, and you can say this is equal to $0$. What I'm not comfortable with is this idea that you can just assume something to be true ($n=k$), then based on that assumption, form a proof for $n=k+1$ case. I don't see how you can use something you've assumed to be true to prove something else to be true.", "Prove the summation: $$\\sum_{i=1}^n i! \\cdot i = (n+1)! - 1$$ using induction. base case: $n=1$: \\begin{align*} \\sum_{i=1}^1 i! \\cdot i &amp;= (1+1)! - 1 \\\\ 1 &amp;= 2 - 1 \\\\ 1 &amp;= 1 \\end{align*} This is a question from my test review packet, currently have the base case completed and I am a bit lost on where to go from there. Any help/hints are appreciated.", "Proving that orthogonal vectors are linearly independent I am trying to prove that $a_1$, $a_2$, $a_3$ are linearly independent. I am asked to use vector product and prove that if $c_{1}a_{1} + c_{2}a_{2} + c_{3}a_{3} = 0$ then $c_1 = c_2 = c_3 = 0$ I am completely stuck on where to go with this problem. I would think that linearly independent then the null space of the space can only be equal to $0$. Would this prove it?", "Why shouldn't I prefix my fields? I've never been a fan of Hungarian notation, I've always found it pretty useless unless you're doing some really low level programming, but in every C++ project I've worked on some kind of Hungarian notation policy was enforced, and with it the use of some 'not-really-Hungarian' prefixes as m_ for fields, s_ for statics, g_ for globals and so on. Soon I realized how much useless it was in C# and gradually started to drop all of my old habits... but the 'm_' thing. I still use the m_ prefix on private fields because I really find it very useful to being able to distinguish between parameters, locals and fields. The says I shouldn't, but it does not say why (the way e.g. Google's conventions generally tend to rationalize their prescriptions). Are there reasons why I shouldn't or is it only a matter of style. If it is the latter, are prefixes generally considered a bad style and can I expect negative reactions from other people working on the codebase?", "Potato Power. Self sustaining medium using a living potato plant possible?", "I can't destroy blocks in Minecraft Creative Mode (singleplayer)", "What happens if Superman is near a white dwarf star? With the Superman lore, we know that light from a yellow star gives him his powers, light from blue stars makes him stronger, and light from red stars weakens him. However, what happens if he is near a white dwarf, or a neutron star? Has there been any evidence of Superman visiting a star system that wasn't red/yellow/blue?", "Does removing an iPhone from my icloud account also erase the data?", "Can I run OSX applications?", "Command line option to check which filesystem I am using? Is there a command that will show which file system (ext3, ext4, FAT32, ...) the various partitions and disks are using? Similar to how sudo fdisk -l lists information about disks and partitions?", "PHP: running scheduled jobs (cron jobs) I have a site on my webhotel I would like to run some scheduled tasks on. What methods of achieving this would you recommend? What I’ve thought out so far is having a script included in the top of every page and then let this script check whether it’s time to run this job or not. This is just a quick example of what I was thinking about: if ($alreadyDone == 0 &amp;&amp; time() &gt; $timeToRunMaintainance) { runTask(); $timeToRunMaintainance = time() + $interval; } Anything else I should take into consideration or is there a better method than this?", "I can think of several examples of functions such that twice application of the function is equivalent to no application of it. Additive inverse Multiplicative inverse Fourier transform Complex conjugation Any group built up from $\\mathbb{Z}_2$, applying (one of) the $\\mathbb{Z}_2$ parts' operation. \"Idempotent\" came to mind, but that's wrong. It means $f(f(x)) = f(x)$, not $f(f(x))=x$. What is the word for this \"flip-flop\" property?", "What blueprints become available during story? As I progress, I realize that some blueprints open up throughout the story and don't have to be researched. Are these random or are they always the same and is there a list over those? Seems you can easily waste research point if you don't know that.", "Prolog count the number of times a predicate is true", "counting number of specific string in each row I have a SNP table looks like this A N N N N N N N N N N N N C N N N C N N N N N N N N N N N N N N N N N N N C N N N C N N N N N N N N N N N N N N N N N N C C N N N N N N N N N N C C N N N C C N N N N N N N N N N N N N N N N N I want to count total number of N in each row? any idea how to do that", "Calling C/C++ from Python?", "Cross tabulation of two categorical variables: recommended techniques" ]

[ "Frequent Write to Non-volatile Memory I am designing a device that automatically adjusts it's physical position as temperature changes. If the device it shut off or power is disconnected the device needs to remember it's last temperature and position. I have the ability to store these values in EEPROM but the problem is the position and temperature could be changing very rapidly. If I were to write the temp and pos to EEPROM after every time they changed that would (1) slow down the firmware a bit, and (2) likely kill the EEPROM after a year or two. So as I see it my options are as follows... 1) use a capacitor/battery to keep the device powered for a short time after power is lost so that I can write the values to EEPROM at that time only. I don't like this because the board is kinda power hungry and this would require a big cap. And I don't have a ton of free space. And I don't want the added cost of a battery and battery holder / or a big cap. 2) use F-RAM instead of EEPROM so that I can write to it trillions of times without wearing it out. I don't like this option because FRAM is quite a bit more expensive than EEPROM and this is for a production product (not just one). 3) Only write the position and temperature every 5 minutes or so. That way I always have a fairly recent position/temp recorded but I am not writing every second so my program is not slowed down and the EEPROM won't die as fast. This seems like my best option. Does anyone else have any suggestions that I'm not thinking of?", "As I found solutions on making site-to-site VPN between Azure and AWS using a software VPN server, I'm asking myself if it's possible to connect the VPN gateways (Azure VNET / AWS VPC) directly. Is there a limitation that forbids it ?", "Why do wet objects become darker?", "Update 02/02/2019 I appreciate all the responses and help but unfortunately i must have not seen the emails stating there were responses! I am now looking into a NEST thermostat and was curious if they too, use the same connections. Lastly, looking for a quick recommendation on which WiFi Compatible therms are preferred by the memebers that respond! Thanks again your knowledge is highly appreciated! Bob I Purchased the Honeywell WiFi Prog Thermostat to replace my Round Digital Honeywell Thermostat. I have separate Heating and Cooling (Heating is a Weil McLain Boiler for Hot water baseboard and Hot water(no tank) and Cooling is a separate unit that was added later.) Wires: RC Cool R Heat W Heat Y Cool G Cool 3 wires from AC unit and 2 from Heater. If I were to go the separate transformer route to power the thermostat, where would I land the 2 wires? C and ???", "During U-substitution, is the $du$ that we use as the infinitesimal in $\\int f(u) \\ du$ changing size? I am familiar and comfortable with the following definition of an integral (defined as the the Riemann Sum where n approaches infinity). I have circled in red two terms to emphasize a concept that I was taught: the $\\frac{b-a}{n}$ term effectively becomes the $dx$ term. This intuitively makes sense to me. Additionally, I am familiar with the following statement (as expressed here: ) However, I have boxed in red something that I find rather confusing when trying to interpret it through the understanding that $\\frac{b-a}{n}$ sorta kinda equals $dx$... Specifically, the $du$ value appears to be changing throughout the interval $[ g(a), g(b)]$. To reframe this in the \"Riemann Sum\" version,we would have something like: $\\text{ \"value that varies depending on where you are\"} * \\frac{g(b)-g(a)}{n}$ This is very confusing to me...because, if this is the correct interpretation, I'm not quite certain I understand why this is allowed.", "Autokey (autokey-qt) freezes and won't insert text", "Derivation of the formula for Ordinary Least Squares Linear Regression", "How do I convince gdal2tiles to output pngs with transparency?", "Ubuntu gets stuck in a login loop", "I am currently working to design a flash virtual tour, but I know little about how the photographs are taken. Ideally I'd like to be able to take a set of 6 shots from a single focal point, and be able to align them seamlessly into a cube form. The other solution is to take a special fisheye image, and stretch it dynamically in flash. I've seen examples of both as virtual tours, and ones formatted as a rotating cube are more responsive and have a higher image quality. The airbus and Cruden Homes are definitely in the cube format, I'm not entirely certain which format the New York VT uses: I have a set of questions, the first is the most important, the others may become separate questions if I don't get an answer here: How are those photos taken? Is there a specific mount that can be used? How long does it take to set up? How much post-processing is necessary on the images?", "How can one prove that $\\lim_{n \\to \\infty}a^{1/n}=1$ for every $a>0$?", "How to pass the password to su/sudo/ssh without overriding the TTY?", "I want to make a persistent live Ubuntu USB drive with more than 4GB of storage. I know there is an option of installing directly on the drive but I don't want to do this as it will restrict the drive from working on different computers. One option is to make an additional partition with extra space but if I do this how can I get newly installed software to be stored on this partition?", "Adding meta values to permalink I have publications and I want to simply add year and month to the permalink. Currently the year and month of publication is added to the post as a meta value. I've set up publications as a custom post type and created taxonomy for the specific title of the publication. I would like the permalink to be: publications/publication-title/year-published/month-published/name-of-post I simply want to add the meta values for the publication year and month to the permalink. So far, I've been able to pull the year and month published and add it to the url but unfortunately I keep getting a 404 when I try to access posts. I think I'm taking a wrong turn with one of my steps below ... Any help would be appreciated. These are the steps I did in the following order: Since I was adding publication-year and publication-month to the url, I was reading that I had to make WordPress aware of these custom querystring variables. I added the following functions to register these custom variables: function pubyear_register_rewrite_tag() { add_rewrite_tag( '%pubyear%', '([0-9]{4})'); } add_action( 'init', 'pubyear_register_rewrite_tag'); function pubmonth_register_rewrite_tag() { add_rewrite_tag( '%pubmonth%', '([0-9]{2}'); } add_action( 'init', 'pubmonth_register_rewrite_tag'); 2) Added the year and month to the permalink structure: add_filter('post_type_link', 'pub_term_permalink', 10, 4); function pub_term_permalink($permalink, $post, $leavename, $sample) { if ( false !== strpos( $permalink, '%publication-title%/%pubyear%/%pubmonth%' ) ) { //get the publication-title $publicationtype = get_the_terms( $post-&gt;ID, 'publication-type' ); //get the year of the publication $pubyear = date('Y', get_post_meta($post-&gt;ID, 'pub_date', true)); //get the month of the publication $pubmonth = date('m', get_post_meta($post-&gt;ID, 'pub_date', true)); $rewritecode = array( '%publication-type%', '%pubyear%', '%pubmonth%', $leavename? '' : '%postname%', ); $rewritereplace = array( array_pop($publicationtype)-&gt;slug, $pubyear, $pubmonth, $post-&gt;post_name ); $permalink = str_replace($rewritecode, $rewritereplace, $permalink); } return $permalink; } 3) Add rewrite rules: function pub_add_rewrite_rules() { add_rewrite_rule( '^([^/]*)/([0-9]{4})/([0-9]{2})/([^/]+)?', 'publications/index.php?pagename=$matches[3]', 'top' ); } add_action( 'init', 'pub_add_rewrite_rules' ); 4) Made sure the custom post type is registered and includes this rewrite array: 'rewrite' =&gt; array ( 'slug' =&gt; 'publications/%publication-type%/%pubyear%/%pubmonth%', 'with_front' =&gt; false ),", "I am from a physics background and my mathematics is not very good, so pardon my insolence with the question. Editing based on the comments : We know that $\\pi$ in decimal (i.e. base 10) is transcendental. Is it possible to have a radix base in which $\\pi$ can be rational in that base ? PS : My question is in general for any transcendental number.", "Cartoon with a young unicorn and a demon", "Let $A \\times \\emptyset = \\{(x,y)| x\\in A, y \\in \\emptyset \\}$. We know there is no element in $\\emptyset$. But how does it follow that $A \\times \\emptyset = \\emptyset $?", "Solution check: Let $f_n$ be fibonacci numbers. Prove: $\\sum_{k=0}^{n-1} \\binom{n+k}{2k+1} = f_{2n-1}$ and $\\sum_{k=0}^n \\binom{n+k}{2k} = f_{2n}$", "In his 1984 paper , Paul Holland raised one of the most fundamental questions in statistics: What can a statistical model say about causation? This led to his motto: NO CAUSATION WITHOUT MANIPULATION which emphasized the importance of restrictions around experiments that consider causation. Andrew Gelman makes : \"To find out what happens when you change something, it is necessary to change it.\"...There are things you learn from perturbing a system that you'll never find out from any amount of passive observation. His ideas are summarized in . What considerations should be made when making a causal inference from a statistical model?", "Package for drawing RDF graphs Is there some package to draw nice RDF graphs, such as the one below (taken from )? Can such a graph (with the same style) be produced in TikZ?" ]

[ "Cannot refer to a non-final variable inside an inner class defined in a different method", "Is there a way to have a copy of any message sent from a Gmail account sent to another address? I've got any messages coming to my address copied to another (see for one solution, setting up filters is another), but I haven't yet found a way to have outbound messages automatically copied. Is there a way?", "Difference between Session and HttpContext.Current.Session", "Why is my variable unaltered after I modify it inside of a function? - Asynchronous code reference", "Getting Started to Xetex for Devangari?", "I have seen some comments and speculations about the robot having an off switch or whatever. But I want to know if there is any source material or comment from the author on how they managed to pass the exam. I have only seen the actual author's comment on Mineta: But I was wondering if there are author notes for the other characters.", "Why is the company email still \"at stackoverflow\"", "How can one predict whether an individual infected with the SARS-CoV-2 virus will be asymptomatic? According to , half of the virus carriers show no symptoms. What are the biological factors that determine whether an infected individual will be asymptomatic or not?", "Another part of my daily on SE sites. When viewing a question and it's time to move on, I'll often simply click one of the tags in the question to bring me back to a list of questions with that tag. This doesn't work in the Android app. Obligitory screenshot. I tried to draw a finger that looked like it was tapping a tag, but it ended up looking like, well... something else, let's say.", "Can Java's NullPointerException be changed to report on which variable was null?", "Is the convex hull of a compact set compact? Let $V$ be a normed vector space and $K$ a compact subset of $V$. Is the convex hull of $K$ given by $$\\langle K \\rangle = \\left\\{\\sum_{i=1}^n t_i x_i\\mid x_i\\in K, t_i≥0\\text{ s.t. }\\sum_i t_i=1\\right\\}$$ again compact?", "I installed Linux Mint in 2 partitions: / and /home Windows 8 is under UEFI boot mode. How to hide those linux partitions in Explorer? When I click on them:", "How do you list the primary key of a SQL Server table?", "$\\Bbb Z^\\ast$ What is this notation? What does $\\Bbb Z^\\ast$ mean? I would think some subset of the integers but I cannot find a definition. Thank you.", "As the photo - Variable 'n' has already been declared. I've tried clearing my cache, as well as using a new user profile with no extensions, but it doesn't work. Might be useful to know so it can be fixed before more people are using Chrome (If it's SO's fault of course!)", "How do I use F3 to get my coordinates when my laptop makes F3 a special key?", "I am asked to complete my withdrawal transaction with COT fee of 1200 dollars I was marketed by a lady online on some investment packages in bitcoin. ($200 to become $2500 in one week of trade). I indicated interest in this. She took me to a trading website to sign up. I deposited $200 at the start. After trading for 2 days with earnings, they called me to upgrade the account with $450 which I did. They then traded for 1 week and the account balance became $6786. I requested to withdraw $6000 from my account and they told me to bring a COT fee of $1200 to complete my withdrawal. Please help me do a background check on them. Are they real or fake? Check the registration of the company if it is real. The marketer told me the company will pay her from the COT fee.", "Example of vector space such that $cv = 0$ where $c \\ne 0$ and $v \\ne \\vec{0}$ Is there an example of a vector space $V/F$ such that $0 \\ne c \\in F$, $\\vec{0} \\ne v \\in V$, but $c \\cdot v = 0 $? I couldn't think of an example.", "Ever since I upgraded to 13.10, the software updater does not show all the available updates. Some will appear and can be installed just fine, but once it claims that all software is up to date, using sudo apt-get upgrade shows that there are still more packages waiting to be updated. I can update them via the command line, but that only solves things temporarily. I'm not sure why some show up and others don't. How can I make Update Manager update all packages? Update-manager shows this: But apt-get shows this: Thanks!", "Sort Order on the User Filter is Surprising To Me When filling in the \"Type to Find Users\" , it seems to sort by exact match and then by reputation when I am on the reputation tab. For example, please consider the following search results: This threw me off since I thought that the sort order is reputation. I guess this often might give people what they want, but when picking a popular name is shows a lot of 0 rep users. Maybe adding a filter for low rep to the exact match might give more expected results, or just sorting on Rep?" ]

[ "Proving that $\\lim_{x \\to 0} \\frac{f(x)}{|x|}=1$ implies $f$ is not differentiable at $0$. $$\\lim_{x \\to 0} \\frac{f(x)}{|x|}=1$$ Then prove that $f$ is not differentiable at $0$. I was given this assignment and I'm not sure about my proof.. it feels like I'm assuming too much and not explaining with enough detail. Is there anything I need to add to make it sufficient? Assume toward contradiction that $f$ is differentiable at $0$. Then by definition we know that $f$ is continuous at $0$. Therefore $\\lim _{x\\to 0}f\\left(x\\right)=f\\left(0\\right)$ We know that $\\lim _{x\\to 0}\\frac{\\left(f\\left(x\\right)\\right)}{\\left|x\\right|}=1$ Therefore we can conclude $\\lim _{x\\to 0}\\frac{\\left(f\\left(x\\right)\\right)}{\\left|x\\right|}\\cdot \\left|x\\right|=1\\cdot 0=0$ But we can also rewrite this as $\\lim _{x\\to 0}\\left(f\\left(x\\right)\\right)\\cdot \\frac{\\left|x\\right|}{\\left|x\\right|}=f\\left(0\\right)\\cdot 1=0$ Therefore $f(0) = 0$. Since $f$ is differentiable at $0$ we have $\\lim _{x\\to 0}\\frac{\\left(f\\left(x\\right)-f\\left(0\\right)\\right)}{x-0}=\\lim _{x\\to 0}\\frac{\\left(f\\left(x\\right)-0\\right)}{x}=\\lim \\:_{x\\to \\:0}\\frac{\\left(f\\left(x\\right)\\right)}{x}\\cdot \\frac{\\left|x\\right|}{\\left|x\\right|}=\\lim \\:\\:_{x\\to 0}\\frac{\\left(f\\left(x\\right)\\right)}{\\left|x\\right|}\\cdot \\:\\frac{\\left|x\\right|}{x}$ Since the one sided limits of $\\frac{f\\left(x\\right)}{\\left|x\\right|}$ exist, and are both equal to 1, we have $\\lim \\:_{x\\to 0^+}\\frac{\\left(f\\left(x\\right)\\right)}{\\left|x\\right|}\\cdot \\:\\:\\frac{\\left|x\\right|}{x}=\\lim \\:_{x\\to \\:0^+}\\frac{\\left(f\\left(x\\right)\\right)}{x}\\cdot \\:\\:\\:\\frac{x}{x}=1\\cdot 1=1$ $\\lim \\:_{x\\to 0^-}\\frac{\\left(f\\left(x\\right)\\right)}{\\left|x\\right|}\\cdot \\:\\:\\frac{\\left|x\\right|}{x}=\\lim \\:_{x\\to \\:0^-}\\frac{\\left(f\\left(x\\right)\\right)}{-x}\\cdot \\:\\:\\:\\frac{-x}{x}=1\\cdot -1=-1$ Since the limit doesn't exist, we have a contradiction to the fact $f$ is differentiable at $0$. Therefore $f$ is not differentiable at 0.", "I am setting up a server where there are multiple developers working on multiple applications. I have figured out how to give certain developers shared access to the necessary application directories using the setgid bit and default ACLs to give anyone in a group access. Many of these applications run under a terminal while in development for easy access. When I work alone, I set up a user for an application and run screen as that user. This has the downside that every developer to use the screen session needs to know the password and it is harder to keep user and application accounts separate. One way that could work is using screen multiuser features. They do not work out-of-the-box however, screen complains about needing suid root. Does giving that have any downsides? I am pretty careful about using suid root anything. Maybe there is a reason why it isn't the default? Should I do it with screen or is there some other intelligent way of doing what I want?", "Why, oh why, don't the Weasleys \"conjure\" up some diamonds/gold/etc, sell 'em to Muggles, and get rich? They could buy a mansion (like the Malfoys), and live there happily ever after. I know there's that prohibits one from conjuring food (which doesn't make much sense to me, either). Even if it applied to gold, what about all the other elements/compounds/materials? Could the law really be 'don't let a wizard conjure something if it'll make them richer'? That's totally nonsensical. Why does Wizard society still have poor people, especially if they're talented?", "In $Sets$, the initial object is $0 = \\emptyset$. We have $C \\times \\emptyset = \\emptyset$ for any set $C$. As there are no maps to the empty set, we don't get much of the universal property of the product. I am now wondering what is special about arbitrary categories $\\mathscr{C}$ with $C \\times 0 \\cong 0$ for all objects $C$ of $\\mathscr{C}$, where $0$ is the initial object of $\\mathscr{C}$. From Sheaves in Geometry and Logic by MacLane (p.194), in any topos $\\mathscr{C}$, any arrow $k:C \\to 0$ is an isomorphism. The universal property of the product would then also not yield very much. Are there any categories of higher interest?", "Let's assume a very simplified situation. There is only one seller asking for 10$ and there is only one buyer bidding 20$. At what price would the transaction go? Some answers say it won't, because the ask price has to match the bid price. () Other answers say, that the time ordering is important. () Which answer is correct? What is the final price in the presented situation?", "How many actuations are \"too many actuations\"? When looking at used camera bodies, a question that comes up a lot, is \"how many shutter actuations, or clicks, does it have?\" What I am wondering is, how many is too many. In other words, is there a reference for knowing when a sensor is more likely to go? How should I judge a camera body with 20000 vs 5000? Is that a significant difference, or is that not even relevant. Obviously this might something that is dependent on model, so if there is some information based on model that would be even more interesting. One of the guys at Canon Tech Support said that this is completely irrelevant for the Rebel series cameras, but he is obviously slightly biased. :)", "Number of finite simple groups of given order is at most $2$ - is a classification-free proof possible?", "Entering Unicode characters in LaTeX How do I enter Unicode characters in LaTeX? What packages do I need to install and what escape sequence do I type to specify Unicode characters in an ASCII source file?", "How do I make the method return type generic? Consider this example (typical in OOP books): I have an Animal class, where each Animal can have many friends. And subclasses like Dog, Duck, Mouse etc which add specific behavior like bark(), quack() etc. Here's the Animal class: public class Animal { private Map&lt;String,Animal&gt; friends = new HashMap&lt;&gt;(); public void addFriend(String name, Animal animal){ friends.put(name,animal); } public Animal callFriend(String name){ return friends.get(name); } } And here's some code snippet with lots of typecasting: Mouse jerry = new Mouse(); jerry.addFriend(\"spike\", new Dog()); jerry.addFriend(\"quacker\", new Duck()); ((Dog) jerry.callFriend(\"spike\")).bark(); ((Duck) jerry.callFriend(\"quacker\")).quack(); Is there any way I can use generics for the return type to get rid of the typecasting, so that I can say jerry.callFriend(\"spike\").bark(); jerry.callFriend(\"quacker\").quack(); Here's some initial code with return type conveyed to the method as a parameter that's never used. public&lt;T extends Animal&gt; T callFriend(String name, T unusedTypeObj){ return (T)friends.get(name); } Is there a way to figure out the return type at runtime without the extra parameter using instanceof? Or at least by passing a class of the type instead of a dummy instance. I understand generics are for compile time type-checking, but is there a workaround for this?", "Can I change my Ubuntu Desktop into a different flavour (like Kubuntu)? Can I convert Ubuntu into another form of Ubuntu like Kubuntu or Ubuntu Studio and the system recognize itself as the new form? UPDATE: After getting an answer and talking with people, I managed to gain a lot of information on this topic. I then wrote an article about converting between Ubuntu systems -", "How to pass parameters to an alias? For bash script, I can use \"$@\" to access arguments. What's the equivalent when I use an alias?", "Set the size of pgf picture? I have a pgf picture which I insert with: \\input{m1.pgf} But the image is too big. Instead of regenerating a smaller image, I'd rather take advantage of vector graphics, and have XeLaTeX scale it. How do I set the width of pgf picture (keeping its aspect ratio)? MWE tex: \\documentclass{article} \\usepackage{fontspec} % enagles loading of OpenType fonts \\usepackage{polyglossia} % support for languages % fonts: \\defaultfontfeatures{Scale=MatchLowercase,Mapping=tex-text} % without this XeLaTeX won't turn \"--\" into dashes \\setmainfont{DejaVu Sans} \\setsansfont{DejaVu Sans} \\setmonofont{DejaVu Sans Mono} % pgf: \\usepackage{pgf} \\begin{document} \\input{m1.pgf} \\end{document} Sample pgf: (it's too big to cite it here, and I can't make much smaller).", "How to get directory size in PHP", "Some issues with timezones in PHP have been in the back of my mind for a while now, and I was wondering if there are better ways to handle it than what I'm currently doing. All of the issues revolve around reformating database stored dates: When dealing with a site that has to support multiple timezones (for users), to normalize the timezone offest of stored timestamps I always store it with the server timezone using the CURRENT_TIMESTAMP attribute or the NOW() function. This way I don't have to consider what timezone was set for PHP when the timestamp was entered (since PHP time functions are timezone aware). For each user, according to his preference I set the timezone somewhere in my bootstrap file using: date_default_timezone_set($timezone); When I'm looking to format dates with the php date() function, some form of conversion has to take place since MySQL currently stores timestamp in the format Y-m-d H:i:s. With no regard to timezone, you could simply run: $date = date($format,strtotime($dbTimestamp)); The problem with this is that date() and strtotime() are both timezone aware functions, meaning that if the PHP timezone is set differently from the server timezone, the timezone offset will apply twice (instead of once as we would like). To deal with this, I usually retrieve MySQL timestamps using the UNIX_TIMESTAMP() function which is not timezone aware, allowing my to apply date() directly on it - thereby applying the timezone offset only once. I don't really like this 'hack' as I can no longer retrieve those columns as I normally would, or use * to fetch all columns (sometimes it simplifies queries greatly). Also, sometimes it's simply not an option to use UNIX_TIMESTAMP() (especially when using with open-source packages without much abstraction for query composition). Another issue is when storing the timestamp, when usage of CURRENT_TIMESTAMP or NOW() is not an option - storing a PHP generated timestamp will store it with the timezone offset which I would like to avoid. I'm probably missing something really basic here, but so far I haven't been able to come up with a generic solution to handle those issues so I'm forced to treat them case-by-case. Your thoughts are very welcome", "What affects field upgrades in BF4?", "Any thoughts on a semidecadian badge for people with five years service and an average of N points per year? Given that Stack Overflow is close to its fifth birthday as a public site, has any thought been given to a 'semidecadian' badge for people who have: been registered with the site five years (a semi-decade, hence the name), scored more than N points per year on average (where N might be 1000). The idea behind 'average of N points per year' is to allow slow starters to gain the badge eventually, rather than ruling them out in year 1. The details are obviously subject to tweaking. This might be a gold badge (the platinum version would be the decadian badge, with a larger value of N required — and no-one eligible for another 5 years or so). These would complement the current Yearling badge (which is silver).", "What is the difference between $* and $@?", "A particle experiences an acceleration described by $$ a=kx^{-2} $$ where x is the displacement from the origin and k is an arbitrary constant. To what value does the velocity v of the particle converge to as x approaches infinity if the particle starts at some point x0? If I approach this problem with energy, then $$ W = \\int F \\mathrm{d}x $$ $$ = \\int_{x_0}^\\infty mkx^{-2} \\mathrm{d}x $$ $$ = mk(-\\infty^{-1}+{x_0}^{-1}) $$ $$ W = K = mk{x_0}^{-1} $$ $$ \\frac{1}{2}mv^2 = mk{x_0}^{-1} $$ $$ v = \\sqrt{2k{x_0}^{-1}} $$ How would I solve this problem with pure kinematics? (there appears to be some sort of cyclical dependency where acceleration affects velocity, velocity affects displacement, and displacement affects acceleration) Likewise, two particles experience accelerations described by $$ a_1=k_1x^{-2} $$ $$and $$ $$ a_2=-k_2x^{-2} $$ where x is the distance between the two particles What two velocities do the particles reach as x approaches infinity if the two particles are initially separated by some x0?", "Inserting data to lookup field using rest API In alert I am getting value in data.d.results[0](This is the value that I am getting from other list using rest).Subsystem.Title and also if I use only title column then the value is inserted in the list but when I use a lookup column i.e. Subsystem, then it goes to error function. $.ajax({ url: \"https://sharepoint.com/teams/_api/web/lists/GetByTitle('Features')/Items\", type: \"POST\", data: JSON.stringify({ '__metadata': { 'type': 'SP.Data.FeaturesListItem' }, 'Title': data.d.results[0].Title,'Subsystem':data.d.results[0].Subsystem.Title}), headers: { \"accept\": \"application/json;odata=verbose\", \"content-type\":\"application/json;odata=verbose\", \"X-RequestDigest\": $(\"#__REQUESTDIGEST\").val() }, success: function(d) {alert(\"Items Inserted!\"); //window.location.href=referrer; }, error: function() {alert(\"Failed to Insert Items!\");} });", "pygame installation issue in mac os" ]

[ "I kust realized that some other PC is also getting assigned a IP address (DHCP Lease) from my modem. I am sure this is not one of the PCs in my home. My modem was using WEP security. I know WEP is far less secure and WPA is better, but this actually is a borrowed modem, and I did not know that WEP was used. I immediately did the following : On My Modem Changed the encryption mode from WEP to WPA Changed the password After this I do not see the intruder PC on the DHCP list. On my Mac: Changed the permissions on the public folder to \"everyone - no access\" Turned off \"File Sharing\" in System Preferences (But I would want to turn it back on sometime) My mac is the one that is always on, Both the admin user and the user I normally use are password protected. Is the above sufficient? Should I do something more? Also, is WPA security sufficient? Should I take other steps?", "Capturing SOAP requests to an ASP.NET ASMX web service", "match first column of file a with paragraphs of file b I have 2 files. The first, fileA looks like TCONS_00000066 XLOC_000030 - u q1:XLOC_000030|TCONS_00000066|0|0.000000|0.000000|0.000000|0.000000|- TCONS_00000130 XLOC_000057 - u q1:XLOC_000057|TCONS_00000130|0|0.000000|0.000000|0.000000|0.000000|- TCONS_00000395 XLOC_000206 - u q1:XLOC_000204|TCONS_00000393|0|0.000000|0.000000|0.000000|0.000000|- FileB looks like: &gt;TCONS_00000001 gene=XLOC_000001 AGATGAGCTGGTGGGGATGCTCTAAGAGAACGAGAGAAGCACAGAGCAGATAAACCACACCCACAGGCAC CACCGTCCTTGTTGGTAATGAAGAAGACGAGACGACGACTTCCCCACTAGGAAACACGACGGAGGCGGAG ATGATCGACGGCGGAGAGAGCTACAGAAACATCGATGCCTCCTGTCCAATCCCCCCATCCCATTCGGTAG TTGGATTGAAGACTACCGAATAAGAGAAGCAGGCAGGCAGACAAACCCTTGAACCAAGGAGTCCTCGCTG AGGAAGCTTTGGATCCACGACGCAGCTATGGCCTCCCCGCCCACCAGGCCGCCAGCCACAACCAGCTGAC TAGGTCGCATGCATCATCAGATTTCAATCTCCCTTCGTTCCCTGTCCCTAATCCAATACCAATAGGGAGC AATCAGCTGCTCCTCGACGGCGAGGGAGATGTCGTCGGCCGCGGGCCAAGACAACGGAGATACCGCTGGG GACTACATCAAGTGGATGTGCGGCGCCGGTGGCCGTGCGGGCGGCGCCATGGCCAACCTCCAGCGCGGCG TTGGCTCCCTCGTCCGTGACATTGGCGACCCCTGCCTCAACCCATCCCCCGTTAAGGGGAGCAAAATGCT CAAACCGGAAAAATGGCACACATGTTTTGATAATGATGGAAAGGTCATAGGTTTCCGTAAAGCCCTAAAA TTCATTGTCTTAGGGGGTGTGGATCCCACTATTCGAGCTGAAGTTTGGGAATTTCTTCTTGGCTGCTATG CCTTGAGTAGTACCTCAGAGTATAGGAGGAAACTAAGAGCTGTTAGAAGGGAAAAATATCAAATTTTAGT TAGACAGTGCCAGAGCATGCACCCAAGCATTGGTACAGGTGAGCTTGCTTACGCTGTTGGATCAAAGCTA Now, fileA contains selected transcript numbers in the first column and fileB contains sequences of all transcripts. I want to scan fileB for the first column of fileA and print the trailing sequences of matching transcripts along with the transcript number.", "Typical Japanese style anime art, it was a series. It has been around for more than 6 years. I think it mixed fantasy and sci-fi. It was certainly not Isekai and it has no magic, it feels more like revered science. A boy gets a gem embedded into his arm after a terrorist attack and transforms into a white and orange humanoid being. There are more people able to transform into these beings. There is also a red flying ship with a dark yellow underbelly that throws boxes with parachutes. There is also this top-secret laboratory where the scientists study how to battle against the beings. There are some other flying ships of varying colors. If I remember correctly, the protagonist gets amnesia near the end of the plot.", "How to Change the Origin when moving a Collection Instance I have created an Collection Instance, when I try to move it, the origin(to snap at vertices or edges) is far away from the object, I want to set it. In the image, the Collection Instance is selected, the cross is far away from the object and I can´t set it using \"Set Origin to 3D Cursor\" What Am I missing?", "By taking courses, I have learned topic A. Through self-studying and discussion with others, I have explored topic B. I also study topic A outside the classroom. What I want to emphasis is that topic B is not in my curriculum, but I study it on my own. Extracurricular activities can include both activities contributed to academic study although outside the normal curriculum, but also activities not contributed to academic study such as sports, volunteer work, etc. I want to emphasis the former activities. Do you say \"outside classes\", when mentioning study by yourself, i.e. Outside classes, I have explored B. If it were you, how would you rewrite the first quote for the same meaning? Thanks!", "How to open Nautilus (File Manager) preferences?", "This fire image: As you can see, it has a black background, which I can't delete (because it would probably destroy the smooth-looking fire effect). I want to place some fire in a photo. However, I remember it was possible to take such images and do something in photoshop so that when you place them over a photo, the black is gone and the fire is perfectly blended there. But I can't remember what feature or option was it. Any ideas? Photoshop CS5.", "Sending signals to USB port using C I want to send a simple 5V signal to the usb port. The USB cabel's insulation will be removed and connected to a relay which is connected to an electric door system. I think I should write this code in C. Can somebody give me a hint?", "If $x$ is a positive rational but not an integer, is $x^x$ irrational?", "what are all the open subgroups of $(\\mathbb{R},+)$", "Should I be worried that yum update suddenly wants to update well over 100 packages on my CentOS 6 system?", "Is there a power saving application similar to Jupiter?", "How to determine an object's class? If class B and class C extend class A and I have an object of type B or C, how can I determine of which type it is an instance?", "Deriving the conditional distributions of a multivariate normal distribution", "How can I delete a (null) app in usage? In my usage list(settings>general>storage &amp; iCloud usage>manage storage), there is an app that registers as (null) with no icon, a version number that doesn't match anything I've previously downloaded, and it's taking up storage space. I first noticed it about a week or two ago. And no, I can't download recent apps to find the one that it is, because I downloaded multiple apps recently, and didn't notice the (null) app until my storage was critically low and I was looking to delete something. I am running iOS 9.2.1 on an iPhone 5C.", "Is it: My apples and orange are/is wrong? Simple question: My apples and orange are wrong or My apples and orange is wrong I am not a native English speaker, and I am having some trouble choosing between plural are or singular is for that kind of example.", "Spurious @ symbol at start of bash prompt in Debian Jessie", "Ch.3 #7. Prove that the convergence of $\\sum a_n$ implies the convergence of $$\\sum \\frac{\\sqrt{a_n}}{n},$$ if $a_n \\geq 0$. My attempt. If $\\sum a_n$ is convergent, then by the root test, $\\lim_{n \\rightarrow \\infty} sup \\sqrt[n]{|a_n|} &lt; 1$. This means $|a_n|^{1/n} &lt; 1$. Because $a_n \\geq 0$, this means $a_n ^{1/n} &lt; 1$. Now apply the root test to $\\sum \\frac{\\sqrt{a_n}}{n}$ by considering $$\\lim_{n \\to \\infty} sup \\sqrt[n]{|\\frac{\\sqrt{a_n}}{n}|}.$$ $$\\sqrt[n]{|\\frac{\\sqrt{a_n}}{n}|} = \\frac{\\sqrt{{a_n}^{\\frac{1}{n}}}}{\\sqrt[n]n}.$$ Because $a_n ^{1/n} &lt; 1$, certainly the numerator on the left-hand side of the equation above is $&lt;1$. And because $n$ tends to $\\infty$, and $n &gt; 1 \\rightarrow \\sqrt[n]n &gt; 1,$ the denominator is $&gt;1$. Therefore the limit is $&lt;1$ and the root test implies that $\\sum \\frac{\\sqrt{a_n}}{n}$ converges. If there are any errors in my proof, I think they come from 1) my assumption of the converse of the root test theorem and 2) my misunderstanding of $\\lim_{n\\to\\infty} sup$. Thanks in advance for your help.", "Performing deep learning land cover classification using R? I am really new to Deep Learning and, unfortunately, I can't find example codes on land cover classification other than where the author wrote a script in R for a large dataset. The main reason that I am asking is because recently I found a few papers on Remote Sensing Image classification using Deep Learning and I was wondering if there were any R examples on that subject. So, is there a code example, preferably a step-by-step, which I can use? I found several git repos like that can do Deep Learning classification with R, BUTT, I am still looking for a simple multi-spectral image segmentation method. An example of that can be found at and I also found a similar question in for which the answer is \"use something else other than R if you can\". If I find anything that works today I will be posting a working answer." ]

[ "Print programs with its proper syntax I have defined my own language whose syntax is very close to the one of Pascal. I would like to type the following program for instance. Many people use the packages algorithmicx or algorithm2e to print programs, but it seems that we have to use their specific keywords of its syntax like procedure, end while. I just want to indent spaces when needed, and bold some words when I want (sorry that I could not bold letters in the following figure). Do I have to use texttt for each line? Also, with verbatim, I could not bold words... Also, as the program is not large, I would need to put it on the left side of the page, and leave space for some explanasion text on its right hand side. So I guss I need to get them all together, and use multicols. Could anyone help? program test some text here var i : integer; ... b : boolean; begin i := 1; ... b := true; while i &lt; 15 do i := i + 1; b := not b some text here od end Edit1: Following @Werner's tabbing solution, I have made the code a minipage: \\begin{minipage}[t]{0.48\\linewidth}% \\begin{tabbing} Werner's solution \\end{tabbing} \\end{minipage}\\hfill \\begin{minipage}[t]{0.48\\linewidth} a paragraph \\end{minipage} Actually as the code shows, I want the texts to be another separated minipage on the right hand side of the code. I have then 2 questions: is it reasonable to make 0.48\\linewidth instead of 0.5\\linewidth? 0.48\\linewidth is a conventional choice? is it possible to make a frame around the code, and use \\caption and \\label to make it a reference (I prefer figures)?", "Would a Cup of Tea Be Hotter If you Add the Milk Before or After Boiling Water? This is a bit of dispute between work colleagues. An answer would be greatly appreciated. My argument is as follows: If you add X amount of milk at a temperature of M to a mug at room temperature R before adding X amount of water at temp W, the result would be a cooler cup of tea than if you'd added the hot water first. This would be due to the milk reducing the overall temperature of the mug in the time that has been in it resulting in the addition of boiling water having less of an effect and resulting in a slightly cooler cup of tea/coffee. Conversely, if you add the hot water first, due to the mug being heated, the effect of adding the cool milk will be less and therefore the end result will be a hotter cup of tea. My Colleagues arguement is simply that it would not make a difference but without any form of justification. If anyone can give real scientific light to this issue it would be greatly appreciated :)", "Can I switch the User-Agent header for only a single web site?", "Since upgrading to OS X El Capitan, I've noticed a change in the Terminal: Executed lines show an opening bracket on the left, and a closing bracket on the right, as shown in this screenshot: Similar questions have been asked here: Some of the questions are referring to these brackets as marks, and the Terminal's Edit menu has a couple of entries related to marks, for example: Edit > Marks > Mark as Prompt and Send Return Edit > Clear to Previous Mark Edit > Navigate > Jump to Previous Mark Is there a summary of what these marks can be used for? I have not seen any reference to this new feature in any of the El Capitan feature overviews.", "How to boot from iso with Grub2/Burg boot loader I'm using Ubuntu as my primary OS and alternative is Windows 7 for gaming, and another stuffs. I want to have menu to boot some live CD ISO. Is there anyway to make menu entry in Grub2/Burg to boot ISO file like the CD way? I see there are some ways to make it possible but almost method need specified boot arguments (kernel parameters). But I have mixed kind of Live OS wan to boot up using boot loader included: Linux, Unix, DOS (for recovery purpose)... I'm looking for more generic way to make it easy to discover and add to the menu config file.", "Why is the (free) neutron lifetime so long? A neutron outside the nucleus lives for about 15 minutes and decays mainly through weak decays (beta decay). Many other weakly decaying particles decay with lifetimes between $10^{-10}$ and $10^{-12}$ seconds, which is consistent with $\\alpha_W \\simeq 10^{-6}$. Why does the neutron lives so much longer than the others?", "My understanding is that in machine learning it can be a problem if your dataset has highly correlated features, as they effectively encode the same information. Recently someone pointed out that when you do one-hot encoding on a categorical variable you end up with correlated features, so you should drop one of them as a \"reference\". For example, encoding gender as two variables, is_male and is_female, produces two features which are perfectly negatively correlated, so they suggested just using one of them, effectively setting the baseline to say male, and then seeing if the is_female column is important in the predictive algorithm. That made sense to me but I haven't found anything online to suggest this may be the case, so is this wrong or am I missing something? Possible (unanswered) duplicate:", "How to calculate temperature in Wire? Let's say I have 1m of 2,5mm² copper wire, insulated with H07V-K. The wire carries 40A and environment temperature is 25°C. The wire is suspended in free air. How hot will the wire get? And how can I calculate it for other values? The use case is a 12V-230V AC converter I want to hook up to my car and determine the minimum wire thickness required. Because it's only used from time to time and not buried in a wall I suspect I can use thinner wires. This is a temporary thing and doesn't need to be up to code.", "I drew a parallelepiped that is spanned by three vectors, and we know the volume is given by the absolute value of the determinant of the matrix - with the three vectors arranged in rows (or columns, since $detA = detA^T$). How can I draw the tetrahedron from this parallelepiped to convince myself it is indeed 1/6th of the volume, i.e., 1/6 * |detA|? Thanks,", "I want to match a portion of a string using a and then access that parenthesized substring: var myString = \"something format_abc\"; // I want \"abc\" var arr = /(?:^|\\s)format_(.*?)(?:\\s|$)/.exec(myString); console.log(arr); // Prints: [\" format_abc\", \"abc\"] .. so far so good. console.log(arr[1]); // Prints: undefined (???) console.log(arr[0]); // Prints: format_undefined (!!!) What am I doing wrong? I've discovered that there was nothing wrong with the regular expression code above: the actual string which I was testing against was this: \"date format_%A\" Reporting that \"%A\" is undefined seems a very strange behaviour, but it is not directly related to this question, so I've opened a new one, . The issue was that console.log takes its parameters like a printf statement, and since the string I was logging (\"%A\") had a special value, it was trying to find the value of the next parameter.", "Finite Sets, Equal Cardinality, Injective $\\iff$ Surjective.", "Individual community preferences vs. SE network policy: who wins? In the recent question , the OP asks where the following question would be appropriate: What would be the best way to approach someone that works for me about bad odor? CHAOS team member Abby Miller by suggesting the proposal &#8212; which is in commitment as I'm writing this &#8212; because One of the up voted example questions there is about dealing with an irritating coworker. This question will be perfectly on topic for that site. In my opinion, qualifies for the not constructive close reason*, which applies to all sites in the network, and therefore, the question shouldn't be allowed, no matter how much it has to do with workplaces. I know Abby isn't the only one who disagrees with me about this. I once had a talk with a mod of some beta about the presence of poll/GTKY questions on his site. His position, in short, was that his community had different rules from SO and its members enjoyed such questions. I don't remember which site it was, it might even be graduated now, but I never did end up participating there. Anecdotal examples are nice and all, but here's the real question: to what extent can individual communities/sites override network policies? To what extend should they be able to do so? *: not constructive comes with the description \"This question is not a good fit to our Q&amp;A format. We expect answers to generally involve facts, references, or specific expertise; this question will likely solicit opinion, debate, arguments, polling, or extended discussion.\"", "Comparing mixed-effects and fixed-effects models (testing significance of random effects) Given three variables, y and x, which are positive continuous, and z, which is categorical, I have two candidate models given by: fit.me &lt;- lmer( y ~ 1 + x + ( 1 + x | factor(z) ) ) and fit.fe &lt;- lm( y ~ 1 + x ) I hope to compare these models to determine which model is more appropriate. It seems to me that in some sense fit.fe is nested within fit.me. Typically, when this general scenario holds, a chi-squared test can be performed. In R, we can perform this test with the following command, anova(fit.fe,fit.me) When both models contain random-effects (generated by lmer from the lme4 package), the anova() command works fine. Owing to boundary parameters, it is normally advisable to test the resulting Chi-Square statistic via simulation, nonetheless, we can still use the statistic in the simulation procedure. When both models contain only fixed-effects, this approach---and, the associated anova() command---work fine. However, when one model contains random effects and the reduced model contains only fixed-effects, as in the above scenario, the anova() command doesn't work. More specifically, I get the following error: &gt; anova(fit.fe, fit.me) Error: $ operator not defined for this S4 class Is there anything wrong with using the Chi-Square approach from above (with simulation)? Or is this simply a problem of anova() not knowing how to deal with linear models generated by different functions? In other words, would it be appropriate to manually generate the Chi-Square statistic derived from the models? If so, what are the appropriate degrees of freedom for comparing these models? By my reckoning: $$ F = \\frac{\\left((SSE_{reduced}-SSE_{full})/(p-k)\\right)}{\\left((SSE_{full})/(n-p-1)\\right)} \\sim F_{p-k,n-p-1} $$ We are estimating two parameters in the fixed effects model (slope and intercept) and two more parameters (variance parameters for the random slope and random intercept) in the mixed-effects model. Typically, the intercept parameter isn't counted in the degrees of freedom computation, so that implies that $k=1$ and $p=k+2=3$; having said that I'm not sure if the variance parameters for the random-effects parameters should be included in the degrees of freedom computation; the variance estimates for fixed-effect parameters are not considered, but I believe that to be because the parameter estimates for fixed effects are assumed to be unknown constants whilst they are considered to be unknowable random variables for mixed effects. I would appreciate some assistance on this issue. Finally, does anybody have a more appropriate (R-based) solution to comparing these models?", "If $$\\sin A + \\cos A + \\tan A + \\cot A + \\sec A + \\csc A = 7$$ then prove that $$\\sin 2A \\quad\\text{ is a root of }\\quad x^2 - 44x - 36 = 0$$ I have no idea how to solve it. Plz help.", "LINQ Select Distinct with Anonymous Types So I have a collection of objects. The exact type isn't important. From it I want to extract all the unique pairs of a pair of particular properties, thusly: myObjectCollection.Select(item=&gt;new { Alpha = item.propOne, Bravo = item.propTwo } ).Distinct(); So my question is: Will Distinct in this case use the default object equals (which will be useless to me, since each object is new) or can it be told to do a different equals (in this case, equal values of Alpha and Bravo => equal instances)? Is there any way to achieve that result, if this doesn't do it?", "What causes a java.lang.ArrayIndexOutOfBoundsException and how do I prevent it?", "Duplicate explanation should encourage improvement of original", "We know speedup brute-force attacks two times faster in block ciphers (e.g brute-forcing 128-bit keys take $2^{64}$ operations, not $2^{128}$). That explains why we are using 256-bit keys to encrypt top secrets. But on AES shows brute-forcing AES-256 take $2^{100}$ operations. Does this attack work with Grover's search to make AES cipher quantum unresistant?", "Let $x$ and $y$ be integers not congruent to $0$ modulo $p$ where $p$ is a prime. Prove that if $p \\equiv 3 \\pmod{4}$ then $x^2+y^2 \\not \\equiv 0 \\pmod{p}$. I thought about proving this algebraically and by contradiction. So we say $x^2+y^2 = pz$ and have to show this is impossible.", "Issue in using longtable within table environment I have an issue making a long list with wrapped text. The table can be several page long. I use longtable and assign the width for each column but as soon as I put it in the \\begin{table} \\end{table}, it does not work. It clips the table. I want to make a label for the table so I put it in the table environment. And is there a way to automatically adjust the width so that I don't need to assign the value manually? Thank you. Tung \\begin{table} \\centering \\begin{longtable}{|p{6.5cm}|p{2.5cm}|p{2.5cm}|p{2.5cm}|} \\hline Name &amp; Company &amp; Catalog Number &amp; Comments \\\\ \\hline Small DNA FRAG Extract Kit-100PR &amp; VWR &amp; 97060-558 &amp; \\\\ \\hline Acrylamide 40\\% solution 500 mL &amp; VWR &amp; 97064-522 &amp; \\\\ \\hline Bis-acrylamide 2\\% (w/v) solution 500 mL &amp; VWR &amp; 97063-948 &amp; \\\\ \\hline GeneRuler 100 bp DNA Ladder, 100-1,000 bp &amp; Fermentas &amp; SM0241 &amp; \\\\ \\hline Mini Vertical PAGE System &amp; VWR &amp; 89032-300 &amp; \\\\ \\hline \\end{longtable} \\label{tab:list} \\end{table}" ]

[ "Are unequal groups a problem for one-way ANOVA? I have data for three unequal groups: $N = 44$, $N = 354$ and $N = 347$. Is it possible to compare all three groups running a one-way ANOVA or is the first group too small?", "I declared random list using TikZ package and can get items randomly. But at same time I need to get all items in sequential order. How can I do it? Is it possible print \\mylist items declared in noncomma variat? \\documentclass[a4paper,14pt]{extreport} \\usepackage{tikz} \\def\\mylist{{one}{two}{three}{four}{five}} \\pgfmathdeclarerandomlist{mynum}{\\mylist} %Define the list \\begin{document} \\pgfmathrandomitem{\\mynum}{mynum} \\pgfmathresult~\\mynum\\\\ \\pgfmathrandomitem{\\mynum}{mynum} \\pgfmathresult~\\mynum\\\\ \\pgfmathrandomitem{\\mynum}{mynum} \\pgfmathresult~\\mynum\\\\ \\pgfmathrandomitem{\\mynum}{mynum} \\pgfmathresult~\\mynum\\\\ \\pgfmathrandomitem{\\mynum}{mynum} \\pgfmathresult~\\mynum\\\\ \\end{document}", "In an enumerate environment, I want a few (not all) of the items to have asterisks which appear before the number (I don't feel strongly about whether the number or the asterisk is horizontally aligned with the other numbers). Is there a less crufty way to do this than, say, using multiple lists (or &mdash; horrors &mdash; numbering manually)? I'm already using enumitem for an unrelated purpose, if that helps, although I didn't find a solution after a quick skim of its manual.", "Difference between Groovy Binary and Source release?", "I am trying to solve a problem from Stanley's book, it says: Fix $k,n \\in \\mathbb{P}$. Show that: \\begin{align} \\sum a_1 a_2 \\cdots a_k = \\binom{n+k-1}{2k-1} \\end{align} where the sum ranges over all compositions $(a_1 , a_2 , \\ldots , a_k)$ of $n$ into $k$ parts. I am trying to reason like this: we need to find the coefficient $c_n = \\sum a_1 a_2 \\cdots a_k$ from this generating function -- \\begin{align} \\sum_n c_n x^n &amp;= \\sum_n \\sum a_1 a_2 \\cdots a_k x^n \\\\ &amp;= \\sum_n \\sum a_1 a_2 \\cdots a_k x^{a_1 + a_2 + \\cdots + a_k}\\\\ &amp;= \\sum_n \\sum a_1x^{a_1} a_2x^{a_2} \\cdots a_kx^{a_k} \\end{align} after that, I have no clue, how do I solve this ? moreover, what is the range in the inner sum ? If we consider Mark Riedel's answer, and assume $n=4$, $k=2$; then the sum will be \\begin{align} \\sum (z + 2z^2)^2 = z^2 + 4z^3 + 4z^4 \\end{align} On the other hand the compositions will be $(1,3), (2,2), (3,1)$, therefore the above sum will be counted as: \\begin{align} (1.3)z^{1+3} + (2.2)z^{2+2} + (3.1)z^{3+1} &amp;= 1z^1.3z^3 + 2z^2.2z^2 + 3z^3.1z^1\\\\ &amp;= 3z^4 + 4z^4 + 3z^4 = 10z^4 \\end{align} what's going on? what am I missing?", "Pressure and weight? (hydrostatic paradox) Consider two different shaped containers having same area: one is cylinder, the other is like an inverted pyramid (roughly). Both have the same level of water, the weight of the inverted pyramidal container will therefore be greater than that of the cylinder. But I know from Pascal's law that the pressure should be same in both containers. If the base areas are the same then the force (weight as measured by a scale) should also be the same. Why are the weights different?", "80's pop song with lyric \"It's the story of my life if you wanna know\" I'm trying to identify a song by a female 80's pop group. Here are the lyrics I remember: It's the story of my life if you want to know a play where everything is meant to be you're the story of my life and I can't let you go", "Completeness and Incompleteness", "Crash adding comment", "Differential form is closed if the integral over a curve is rational number. The following problem comes from do Carmo's book Differential Forms and Applications, Chapter 2, Exercise 4: Let $\\omega$ be a differentiable 1-from defined on an open subset $U\\subset \\mathbb{R}^n$. Assume that for each closed differential curve $C$ in $C$, $\\int_C \\omega$ is a rational number. Prove that $\\omega$ is closed. Can anyone give some hints? My idea was that we could try to show the integral vanishes if the curve lies in $N_\\epsilon (p)$ (i.e. a small neighborhood around $p$) for any $p$ in $U$ and use the Poincare Lemma, but failed.", "Avoiding numerical cancellation question for $\\sin x -\\sin y$ for $x \\approx y$ When trying to avoid cancellation, one tries to reformulate the equation in order to avoid subtraction between almost equal terms. In $\\sin (x) - \\sin (y), x \\approx y$ the suggested solution is to reformulate it to $$2\\cos\\left(\\frac{x+y}{2}\\right)\\sin\\left(\\frac{x-y}{2}\\right)$$ But I don't understand how it is any better? The subtraction between $x, y$ remains. Is it because $\\lvert\\,\\sin(x)-\\sin(y)\\,\\rvert\\leq \\lvert\\,x-y\\,\\rvert$, so cancellation is less likely to happen between $x,y$ than the sines?", "Force.com IDE 35.0.0.201510211056 in Eclipse missing run test class option Force.com IDE 35.0.0.201510211056 and Force.com IDE Debugger 35.0.0.201510211056 in eclipse but it doesn't show this option to run test class, is their any way i can see it because it show the Apex_Test_Result panel but running a test class option is missing. plz help", "How do I clean up my dconf database?", "Kind of converse of Kolmogorov maximal inequality Let $S_n=\\zeta_1+...+\\zeta_n$ where $\\zeta_i$ are independent with $E\\zeta_i=0, E\\zeta_i^2=\\sigma_i^2&lt;\\infty, |\\zeta_i|&lt;K$. Then, $P(\\max_{1 \\leq m \\leq n}|S_m| \\leq x) \\leq (x+K)^2/\\operatorname{var}(S_n)$. How do we show this? The hint says that I should use the fact that $S_n^2-\\sum_{m \\leq n}\\sigma_m^2$ is a martingale. But I am totally clueless.... Any hint would be appreciated! Thanks and regards.", "How can I explain to people that the phrase “off of ” is grammatically incorrect? How can I explain to people that the phrase off of is grammatically incorrect? I‘ve heard this phrase used a lot, especially by Americans (though they aren't the only ones). In my understanding, off of should usually be replaced by off, as in, I took the book off the shelf as opposed to I took the book off of the shelf Am I wrong? Or is there perhaps some simple way I can explain this to most people?", "Make Firefox save new bookmarks in the Bookmarks Menu (not Other Bookmarks) Recently, Firefox has changed the default folder for newly created bookmarks (using Ctrl+D) from the Bookmarks Menu to \"Other Bookmarks\". Is there some way to change that back? Or some alternate method instead of Ctrl+D? EDIT A native way to do this (without an add-on) would be best.", "How to sort strings in JavaScript I have a list of objects I wish to sort based on a field attr of type string. I tried using - list.sort(function (a, b) { return a.attr - b.attr }) but found that - doesn't appear to work with strings in JavaScript. How can I sort a list of objects based on an attribute with type string?", "What is true for a ring with exactly two right ideals", "Good textbooks on homological algebra", "The usage of singular and plural has always been confusing for me. I often see sentences like these People are using cell phones. People are using a cell phone. Does the first sentence mean everyone has a phone and they are all using their own? Does the second sentence mean they are sharing one cell phone? If I see a group of people holding a cell phone in their hand(s), &lt;- even this is confusing for me, should I use the first sentence then? Another example: you see two men, and both of them are carrying a bag. Which sentence should I say/use? They are carrying backpacks They are carrying a backpack Could you please make it clear for me?" ]

[ "I have a Samsung Galaxy S2, running the latest CM10.1. I lost the app drawer icon on my Dock; I must have deleted it. The app drawer icon lets you go to the app list, and the widget list. How do I get the app drawer icon back? The icon looks like a circle with 6 dots inside it.", "A native speaker said: \"I have ever went to\" I heard a guy from Manchester, UK said &mdash; It was the best restaurant I have ever went to. And Google offers 23 million pages for the query \"have ever went to\", and only 3 millions for \"I have ever gone to\". Is this form correct? Has the grammar changed?", "How to show wifi password?", "HTML form readonly SELECT tag/input According to HTML specs, the select tag in HTML doesn't have a readonly attribute, only a disabled attribute. So if you want to keep the user from changing the dropdown, you have to use disabled. The only problem is that disabled HTML form inputs don't get included in the POST / GET data. What's the best way to emulate the readonly attribute for a select tag, and still get the POST data?", "Is it possible to create an shader in Cycles? Specifically for something like , , , etc..", "Over on Stackoverflow, I keep seeing questions wherein posters say: *I have an item named SoAndSo (a table, a file, etc.). Shouldn't it be: *I have an item called SoAndSo. Is \"named\" an acceptable word in this context? Are those words specific to a particular English speakers, e.g. UK vs. USA vs. Australia, etc.?", "Number of surjections from $\\{1,...,m\\}$ to $\\{1,...,n\\}$ Let $m,n$ be two integers such that, $m\\ge n$. Compute the number of surjections from $\\{1,...,m\\}$ to $\\{1,...,n\\}$ There are $n^m$ functions (total). we subtract from $n^m$ the number of non-surjective functions. There are $\\binom{n}{1}(n-1)^m$ functions missing one element. There are $\\binom{n}{2}(n-2)^m$ functions missing two elements, but how many times did we count this in the previous count ? Then we have to add this again by inclusion-exclusion but why is the difference always 1?", "Change bend angle and swap node position on arrow", "Providing command key-value arguments with commas in value When using commands that allow using key-value pairs, how can one provide an argument value that has commas in it? As an example, say I'm using the \\newacronym command from the glossaries package as below: \\newacronym[firstplural = Alphas, Bravos, and Charlies (ABCs), plural = ABCs]{ABC}{ABC}{Alpha, Bravo, Charlie} Unfortunately, the comma is used to separate key-value pairs so the Bravos, and Charlies (ABCs) portion doesn't get parsed correctly. Is there a way to overcome this?", "Sharepoint 2010 - Deploy webpart as Feature scope = web I want to create and deploy a web part as web-scoped feature. In Visual Studio 2010, when I make the feature scope=web, I cannot add the webpart to that feature as I am able to do when scope=site.", "If $$\\tan(\\frac{\\pi}{4}+\\frac{\\theta}{2})=\\tan^3(\\frac{\\pi}{4}+\\frac{\\alpha}{2})$$, then prove that $$\\sin \\theta=\\frac{3 \\sin \\alpha+\\sin^3 \\alpha}{1+3\\sin^2 \\alpha}$$ I tried using the fact that $\\frac{\\cos A}{1-\\sin A}=\\tan(\\frac{\\pi}{4}+\\frac{A}{2})$ but now not able to eliminate $\\cos \\alpha$ and $\\cos \\theta$. How should I proceed?", "How to find out what's accessing a particular hard drive on Windows?", "I'm trying to find the infinite sum that is defined by: $$ 3 \\cdot \\frac{9}{11} + 4 \\cdot \\left(\\frac{9}{11}\\right)^2 + 5 \\cdot \\left(\\frac{9}{11}\\right)^3 + \\cdots $$ However, I do not know of any known formula to do this. Am I missing something really simple? Thanks!", "Changing the size of the mouse pointer in Ubuntu MATE 18.04 does not work I have Ubuntu 18.04 with the gnome-desktop and parallel the Ubuntu MATE desktop installed. While I can easily change the size of the mouse pointer (DMZ-White) in the Gnome3 desktop , this does not work on the MATE desktop. I use for this the dconf-editor. Maybe someone knows a solution? Thanks a lot.", "Opinions on closing an older question as a duplicate of a newer question What's everyone's opinion on closing an older question as a duplicate of a newer one, if the newer one is clearly the better resource? I'm looking at a special case right now, where the two were posted by the same person; the was migrated to SU before a commenter pointed out it was a . Is it considered good practice to close the older as a duplicate of the newer? More generally, is it ok to do that for separate questions posted by different people, if the older question went unanswered but the newer has a good answer? (I should probably mention I saw , but I think this is separate)", "launch app, capture stdout and stderr in c++", "Version tags reloaded I'm getting sick of version numbers in tag names (aka version tags). Look, I just want them all to be just . They are all about JSF. I browse and answer questions about JSF. I don't want to browse in all those different tags. I don't want gold badges for both and . I can't hammer a duplicate question because I don't have a gold badge for that. Across years I observed that a version tag is usually only picked by the asker when a &quot;relatively new&quot; or &quot;relatively old&quot; version is being treated in the question. When the &quot;currently mainstream&quot; version is being treated, or when the asker is &quot;more proficient&quot; in the language, then askers often just pick the versionless . While moving in time, this may cause confusion by future readers when the version isn't explicitly specified anywhere in the question. I try to maintain them by adding/removing the version tag depending on its relevance, and by adding the versionless tag when it's absent. It only feels a neverending story. I'm sure other tag caretakers also have mixed feelings on this. I propose to normalize the version from the tag name: Ban version numbers in tag names in the model (not in the UI). Add an optional single-choice version field to the Tag entity in the model. Users with edit privileges (no suggested edits please) must be able to change versions. Users with gold tagbadges must be able to add and edit versions. I'd imagine the version edit thing to be reachable via that tag info popover (when you hover the tag). Tags themselves however should look exactly the same, the version just separated with e.g. a hyphen from the tag name. When in place, migration of existing version tags should be piece of cake. There's apparently already a script in place which recognizes version tags, it could be reused to re-match current tags and extract the version from it into the new version field. The alternative would be to automatically add the versionless tag when a version tag is being used. But this is IMO only tag pollution. I'm posting this on meta.se instead of meta.so because version numbers aren't only on SO a problem, but on basically all HW/SW related sites.", "Use grep to find content in files and move them if they match", "Which meta am I supposed to post on? I'm mostly active on and we have a separate . Most of my questions on IT Security meta have answers with links here. So my question is, where am I supposed to post what i.e. feature request, bug report, behavior questions?", "I saw the sentence like Donald Trump to run for president next month. in the newspaper on the internet. But I don't know why we have to use to instead of will. Is there any rule I don't know? Can anyone tell me the reason why we should use to in the news?" ]

[ "Is there a name for this layout?", "How to escape a single quote? This works fine: sed -i 's# @driver.find_element(:xpath, \"//a\\[contains(@href,##' temp_spec.rb against a source of @driver.find_element(:xpath, \"//a[contains(@href,'change_district')]\").click I am just left with: 'change_district')]\").click` but when I try to add a single quote at the end it fails: sed -i 's# @driver.find_element(:xpath, \"//a\\[contains(@href,\\'##' temp_spec.rb syntax error near unexpected token `(' I am using \\' to escape the single quote. Note that I am using a # as a delimiter instead of the normal / delimiter as there are /'s in the text.", "Number of elements of a finite field", "How big an RSA key is considered secure today? I think 1024 bit RSA keys were considered secure ~5 years ago, but I assume that's not true anymore. Can 2048 or 4096 keys still be relied upon, or have we gained too much computing power in the meanwhile? Edit: Lets assume an appropriate padding strategy. Also, I'm asking both about security of signatures and security of data encryption.", "When is the Killing form null?", "I am animating a Rubik's cube, and as soon as I get to the second rotation the blocks that have previously been rotated start tripping out even though it should have been reset. I tried making the graph linear which fixed a lagging issue I had, but the blocks still start to spin instead of rotating around a single axis.", "Is it a scam if the person only wants to deposit into my account, not make a withdrawal?", "Tracking disk I/O by application in Windows?", "Combining all the address fields into one?", "Dealing with a whole bunch of two-line config files, I'd like a way to exclude any files that have a different number of lines. So, something like: mv * destdir only if file contains exactly two lines Or: wc -l * | grep '^ *2' | xargs mv {} destdir Except that neither of those is actual working code. While writing this I realized I do have a way to do this, which is ugly as heck, and I've included it below as an answer. Is there an easy/clean way to do this?", "Design problem - Implement an approval process on case, which sends email to approver showing some additional info, which should not be visible to case owner/agent (who clicked on \"Submit for approval\" button). Possible solution - All that additional info will not be stored on Case (otherwise agent will also be able to see it). I am creating a child object to case, where all that additional info be stored. We can make sure agent does not have access to that child object (lets call it ChildObj). In the email template used, we can include info about that child object. From what i understand, standard email templates dont allow cross object reference. We probably need to use visualforce email templates. Questions - 1) Can anyone see/point out any issues with that design? 2) I am very new to salesforce. Can anyone give me any example of how i will access child record's field? I mean there won't be any lookup or anything to child object, right? How do i access a field on the child object? Any clue would be helpful", "How to disable gedit side panel? How do i disable this stupid side panel of gedit, that somehow appeared? There is nothing in the settings or plugins. Tried rm -r -f ~/.config/gedit as well, with no success. I don't have big screen and i find it totally useless and eating up what little free space for editing documents i have. See Screenshot", "Center Gravity in Unity", "Why is the application of probability in QM fundamentally different from application of probability in other areas?", "Prove the Radical of an Ideal is an Ideal I am given that $R$ is a commutative ring, $A$ is an ideal of $R$, and $N(A)=\\{x\\in R\\,|\\,x^n\\in A$ for some $n\\}$. I am studying with a group for our comprehensive exam and this problem has us stuck for two reasons. FIRST - We decided to assume $n\\in\\mathbb{Z}^+$ even though this restriction was not given. We decided $n\\ne 0$ because then $x^0=1$ and we are not guaranteed unity. We also decided $n\\notin\\mathbb{Z}^-$ because $x^{-1}$ has no meaning if there are no multiplicative inverses. Is this a valid argument? SECOND - We want to assume $x,\\,y\\in N(A)$ which means $x^m,\\,y^n\\in A$ and use the binomial theorem to expand $(x-y)^n$ which we have already proved is valid in a commutative ring and show that each term is in A so $x-y$ is in $N(A)$. The biggest problem is how to approach the $-y$ if we are not guaranteed unity. Does anyone have any suggestions? Thank you in advance for any insight.", "I ask this Question on behalf of my neighbor. Their 12 year old son saw his parents having sex. As there is only one room in their home we can't say its the parents' mistake... but now the question is how do they handle the situation?", "How does the CS:GO ranking system work?", "What is the meaning of colon (:) operator in \"uint isWidget : 1;\" in Qt?", "Installing an HP Laserjet 1000 I've already installed hplip, it printed a test page, but it won't print from any program. It shows the printer in the list of printers, and it's checked as the default printer. I've restarted a couple times. When I plugged the USB cable for the printer into the computer after installing hplip, it said printer detected. Then after a couple seconds it said the printer was ready for use. When I send something to the printer, a pop-up shows that a document was sent to the printer - but there's a triangle with an exclamation point in it next to the message. A few seconds another pop-up indicates that the printer has completed printing the job but it didn't print anything.", "How can I find out when Windows was last restarted? How can I know when my computer running Windows 7 was last restarted? I prefer a solution that doesn't involve searching the event log, but something like wmic or maybe cmd commands." ]

[ "Reputation graph not interactable with a touch screen", "How to disable GNOME keyring? I want to disable GNOME keyring globally on my machine. So I deleted the lines auth optional pam_gnome_keyring.so session optional pam_gnome_keyring.so auto_start in /etc/pam.d/gdm. It seems to me that this has no effect. When I lock in the syslog writes Aug 24 18:37:03 foobar gnome-screensaver-dialog: gkr-pam: unlocked login keyring and another user sees a menu window where he hs to enter his credentials. So what is the correct way to disable keyring for every user on that machine?", "Combining several static libraries into one using CMake", "Turning a cipher into a hashing function", "Is the universe fundamentally deterministic? I'm not sure if this is the right place to ask this question. I realise that this maybe a borderline philosophical question at this point in time, therefore feel free to close this question if you think that this is a duplicate or inappropriate for this forum. Anyway, I'm an electrical engineer and I have some basic knowledge of quantum mechanics. I know that Schrödinger's equation is deterministic. However, quantum mechanics is much deeper than that and I would like to learn more. If this question is not clearly answerable at this point than can anyone point out some recognized sources that try to answer this question. I would appreciate it if the source is scientific and more specifically, is related to quantum theory.", "Change web folders names with uppercase to lowercase or not?", "I'm quite new to neural networks and currently I'm trying to train a non convolutional neural network on the MNIST data set. I'm observing some behaviour I don't quite understand. This is the code written with keras as the library: # the data, split between train and test sets (x_train, y_train), (x_test, y_test) = fashion_mnist.load_data() y_train = keras.utils.to_categorical(y_train, 10) y_test = keras.utils.to_categorical(y_test, 10) model = Sequential() early_stopper = EarlyStopping(patience=3) model.add(Flatten(input_shape=(28,28))) model.add(Dense(128, activation=\"relu\")) model.add(Dense(128, activation=\"relu\")) model.add(Dense(10, activation=\"softmax\")) model.compile(loss=\"categorical_crossentropy\", optimizer=\"adam\", metrics=[\"accuracy\"]) model.fit(x_train, y_train, epochs=20, validation_data=(x_test, y_test), callbacks=[early_stopper]) This gives me a validation_acc of around 20%. The funny thing is, when I change the activation functions to \"sigmoid\", the loss function to \"mean_squared_error\" and the optimizer to \"sgd\" my performance improves to around 85% after 50 epochs. Having read I wonder what's the reason for the bad performance of the network I presented in the code. ReLU, cross-entropy and a dynamic optimizer like Adam all seem to improve on the idea of a very vanilla neural network with stochastic gradient optimization, mean squared error as loss and sigmoid activation functions. Yet I get a really bad performance and if I increase the number of nodes in the hidden layers I often get a network that doesn't learn at all. EDIT: I figured out it has something to do with me not normalizing the input to values between 0 and 1 ... but why is this the problem?", "How to make Portable QGIS 3", "It has been suggested by my employer that i should get the Hepatitis B vaccine to protect myself. I have had two of the three parts, but this is the first time i have had a vaccine in more than one session. The vaccine is in 3 doses, each around a month apart, followed up by a blood test. Why is the Hepatitis B vaccine split into 3, any what is the blood test for at the end?", "Magic quotes in PHP According to the , in order to make code more portable, they recommend using something like the following for escaping data: if (!get_magic_quotes_gpc()) { $lastname = addslashes($_POST['lastname']); } else { $lastname = $_POST['lastname']; } I have other validation checks that I will be performing, but how secure is the above strictly in terms of escaping data? I also saw that magic quotes will be deprecated in PHP 6. How will that affect the above code? I would prefer not to have to rely on a database-specific escaping function like mysql_real_escape_string().", "Gandalf (as with all the Istari) did not have a corporeal form before coming to Middle-earth and was essentially ageless. We also know that Gandalf did age, albeit very slowly, while on Middle Earth. By the end of the Third Age (before battling Durin's Bane), he had the appearance of an old human male (non-Númenórean, etc) in his 70's or 80's. This leads me to wonder: Is there any indication in Tolkien's writings that describes Gandalf's appearance (in human-looking years) when he arrived in Middle Earth? In other words, was Gandalf the Grey originally \"Gandalf the Tall Dark &amp; Handsome in his 20's\"? I'm not talking about his actual age, but rather his appearance in human years.", "Can I color text by using an image, so that the color isn't flat? I'm using tikz to attempt to make a book cover, and I have a \"wallpaper\" image that looks like leather (not that I've handled that many leather-bound books). I'm using the node command to place text over the top of it, but none of the colors I've experimented with look decent. Can I use an image of gold-leaf as the fill/stroke for the text? Or for that matter, for the path lines as well? I've tried googling for this, but I can't figure out a set of keywords non-generic enough to pull back useful results.", "When disconnecting from WebSphere MQ with C# client TCP connections are still in CLOSE_WAIT status", "Number theory in Physics As a Graduate Mathematics student, my interest lies in Number theory. I am curious to know if Number theory has any connections or applications to physics. I have never even heard of any applications of Number theory to physics. I have heard Applications of linear algebra and analysis to many branches of physics, but not number theory. Waiting forward in receiving interesting answers!", "Is it possible to import comments into a chat room without the link appearing? Question: For an answer on a stack exchange site with say 8 comments, how can I / is it possible to import the comments into a chat room? Background: I was helping with a and made several comments before I saw the link to auto-import comments into a chat room. This was awesome by the way!! Note that the person who asked the question left a link to the chat room in a comment. I wanted to make a similar chat room because I edited an answer which wasn't mine and added a paragraph. I wanted to chat with the answer's author @JonHopkins to say, 'hey feel free to remove my edit -- just wanted to add my $0.02' -- especially as the stack exchange engines said not to add an additional answer. HOWEVER, there was no link to auto-import the comments -- probably because I hadn't previously left one, but I'm not sure. So I ask here, Stack Exchange Gurus, could a static link be added to auto-import a series of comments into a chat session?", "I get the curvature tensor in General Relativity, it is “just” math. Does space-time REALLY curves as a tangible thing, or is Einstein proposing a mathematical abstraction? More naively, please allow, is space-time a real physical “something” like a “new ether”? If yes, does anyone have any idea what is it made off?", "Example 1) Let's say I have some random creature with protection from white, and my opponent plays , a white card with the effect \"Destroy all creatures.\" Can my creature with protection from white be destroyed by a white card that isn't actually targeting it specifically? Example 2) I was playing a match with a friend where I had on the field against his 3 zombies. Is he able to declare his zombies as blockers even though Elite Inquisitor has \"protection\" from zombies? If he can declare them as blockers, does protection mean that no damage is dealt by the zombies to Elite Inquisitor?", "Replace background while using HDRI for lighting? How can I replace the background of my scene, but keep the reflections and lighting generated from my HDRI?", "If $X$ and $Y$ are sets, their cartesian product $X\\times Y$ is a set. In ZFC set theory, every element object is a set. We know or feel that if $X$ and $Y$ are sets, their cartesian product $X\\times Y$ is a set. My question is: Why if $X$ and $Y$ are sets, their cartesian product $X\\times Y$ is a set?", "Apollonius circle, its radius and center" ]

[ "I started by Time Series Analysis by Hamilton, but I am lost hopelessly. This book is really too theoretical for me to learn by myself. Does anybody have a recommendation for a textbook on time series analysis that's suitable for self-study?", "Recovering from a move of /home when it's encrypted (ecryptfs) I had a 20GB / partition at work that dual-booted with Windows and it quickly ran out of space. I usually do 20GB / and 160GB (or whatever the rest of the hard drive is) as /home, so I intended on recovering the space Windows was taking up and turning that into /home. That went fine and I was able to mount the partition and rsync all my files over. However, I forgot that the partition was encrypted, so now all my files are sitting in /home/.ecrypt and /home/$USER is empty. How can I recover my files from /home/.ecrypt and move them to /home/$USER? I followed this tutorial:", "How do I reboot a Ubuntu Server from the command line? sudo reboot now never seems to work for me. Because its a server, I don't have a window manager installed, so I can't do it from a GUI (which always seems to work). I've had the problem for years on different versions of the operating system. It happens in virtual machines and on real metal. The same problem exists with sudo shutdown now, too. I've lived with it in the past. The difference now is I don't want to just hit the power button because I might lose data.", "I'm loading an XML document in my C# application with the following: XDocument xd1 = new XDocument(); xd1 = XDocument.Load(myfile); but before that, I do test to make sure the file exists with: File.Exists(myfile); But... is there an (easy) way to test the file before the XDocument.Load() to make sure it's a valid XML file? In other words, my user can accidentally click on a different file in the file browser and trying to load, say, a .php file causes an exception. The only way I can think of is to load it into a StreamWriter and simple do a text search on the first few characters to make sure they say \" Thanks! -Adeena", "QT MySql connectivity using Windows XP, Qt Creator 4.5.2(windows 32 bit)", "How can I remove these apps from my device?", "SEO for websites with very less content and a lot of images Let's say we have an image exhibition website that has got a lot of images but next to nothing content. The focus keyword for this website is \"Artistic wallpapers\". What would be the best approach w.r.t SEO for such a website. Here are a few things I can imagine: Submitting sitemaps ( image and web ) Having a good pagespeed score. Nice navigation Breadcrumbs sharing the website content on Social media. Having appropriate titles. Having worked on all these things, what can be done if Search engines are picking wrong keywords ( For example views, votes, ratings) Can anything be done so that Search engines don't track these specific items? Also, is it a good practice to have all the pages submitted to Search engines at once?", "using System; using System.Security.Permissions; using Microsoft.SharePoint; using Microsoft.SharePoint.Security; using Microsoft.SharePoint.Utilities; using Microsoft.SharePoint.Workflow; namespace Change_Title_Event.Change_Title { /// &lt;summary&gt; /// List Item Events /// &lt;/summary&gt; public class Change_Title : SPItemEventReceiver { /// &lt;summary&gt; /// An item is being added. /// &lt;/summary&gt; public override void ItemAdding(SPItemEventProperties properties) { properties.AfterProperties[\"Title\"] = \"Kevin: Changed by event receiver at\" + DateTime.Now.TimeOfDay.ToString(); base.ItemAdding(properties); } } } Where simple example, which works perfect on my local Sharepoint 2010. It is sandboxed. But when I package this solution, it do not work on Sharepoint Online. I does not give any Errors either. I think I am doing something wrong, something simple, but I can't simply find anything on Google about it. Here is another who asks on the MSDN forum, but gets a very wierd reply, that I do not understand.", "How can I get apt to use a mirror close to me, or choose a faster mirror?", "What IDE to use for Python?", "Continuous and preserves measurability $\\implies$ preserves null sets.", "Importance of Representation Theory Representation theory is a subject I want to like (it can be fun finding the representations of a group), but it's hard for me to see it as a subject that arises naturally or why it is important. I can think of two mathematical reasons for studying it: The character table of a group is packs a lot of information about the group and is concise. It is practically/computationally nice to have explicit matrices that model a group. But there must certainly be deeper things that I am missing. I can understand why one would want to study group actions (the axioms for a group beg you to think of elements as operators), but why look at group actions on vector spaces? Is it because linear algebra is so easy/well-known (when compared to just modules, say)? I am also told that representation theory is important in quantum mechanics. For example, physics should be $\\mathrm{SO}(3)$ invariant and when we represent this on a Hilbert space of wave-functions, we are led to information about angular momentum. But this seems to only trivially invoke representation theory since we already start with a subgroup of $\\mathrm{GL}(n)$ and then extend it to act on wave functions by $\\psi(x,t) \\mapsto \\psi(Ax,t)$ for $A$ in $\\mathrm{SO}(n)$. claims that if our physical system has $G$ as a symmetry group, then there is a correspondence between particles and representations of $G$. I'm not sure if I understand this correspondence since it seems to be saying that if we act an element of G on a state that corresponds to some particle, then this new state also corresponds to the same particle. So a particle is an orbit of the $G$ action? Anyone know of good sources that talk about this?", "From Every linear function on a finite-dimensional space is continuous. I was wondering what the domain and codomain of such linear function are? Are they any two topological vector spaces (not necessarily the same), as along as the domain is finite-dimensional? Can the codomain be a different normed space (and may not be finite-dimensional)? I asked this because I saw elsewhere the same statement except the domain is a finite-dimensional normed space, and am also not sure if the codomain can be a different normed space (and may not be finite-dimensional). Thanks and regards!", "Splitting a PDF document in two without purchasing a PDF editing tool Acrobat Reader allow us to easily save a copy of the PDF document. How can I save only from page 5 to 10 without purchasing a PDF editing tool?", "We're given a sequence defined by the recursive relation: $$a_n = \\sqrt{a_{n-1}a_{n-2}}$$ $a_1$ and $a_2$ are positive constants. We have to show the following: The sequences $\\{ b_n \\} = \\{ a_{2n-1} \\}$ and $\\{ c_n \\} = \\{ a_{2n} \\} $ are monotonic, and if one is increasing, the other is decreasing. The limit of the sequence $\\{ a_n \\} $ is $ \\left(a_1a_2^2\\right)^{\\frac13} $ Now, I have proved the first part. Besides that, I have also proved a few other things: If $a_1 &gt; a_2$, then: a. $ \\{ b_n \\} $ decreases, and $ \\{ c_n \\} $ increases. b. $ c_n &lt; b_n $ If $a_1 &lt; a_2$, we just flip $\\{ b_n \\}$ and $\\{c_n\\}$ Besides, I have also shown that both the sequences : $\\{b_n\\}$ and $\\{ c_n\\}$ have the same limit. What I don't know, is how to evaluate the limit.", "How do I create an Excel (.XLS and .XLSX) file in C# without installing Microsoft Office?", "How do I prevent yum from updating a particular RPM? For certain reasons I have to keep a slightly older version of a particular RPM installed on my box (Fedora 11). The problem is that every time I do a package update yum (or one of its GUI equivalents) wants to update this RPM to the latest version, which is annoying - especially when I update it by mistake. Is there a way to 'pin' this version so that yum knows to never try and update it?", "What's the difference between Wubi and a regular \"alongside Windows\" installation?", "I've noticed that Visual Studio 2008 is placing square brackets around column names in sql. Do the brackets offer any advantage? When I hand code T-SQL I've never bothered with them. Example: Visual Studio: SELECT [column1], [column2] etc... My own way: SELECT column1, column2 etc...", "Getting Joker from the existing groups in Rummikub I have a group of tiles made up of 3 fours and a joker: 4 4 4 Joker Now, if a player removes the joker, do they have to replace it with another 4?" ]

[ "What are your favorite English language tools? To prevent myself from asking an obvious, silly question multiple times: What are the English language tools you found most useful? I found extremely useful for looking up . Please, one tool per answer.", "IOS 5.1.1 Safemode problem I jailbroke my old iPod Touch 3rd Generation, with IOS 5.1.1, using the latest version of absynthe. It worked for several months, but then it randomly stopped. It went into safe mode, but the touch screen wouldn't work. It showed the lockscreen, but nothing worked at all, except for the physical buttons. The only way to reboot is to follow the same steps as DFU mode (Hold power button 3 sec, then home button AND power for 10, then just home for 8)... However, it always boots right back into Safe mode. I had to restore, and once rejailbroken, it worked fine, until I installed SBsettings. Then it did the EXACT same thing, and I had to restore and re-jailbreak AGAIN! The other day, I finished installing ALL of my extensive list of tweaks, and got it to about where I wanted it, when lo and behold, it booted to safe mode again. I have spent so much time on this, and I do not want to do it again. Does anybody here have any knowledge on the topic? Is there a program I can run from my computer to manually control the device or kick it out of safe mode? Is there some other method of doing this? I am looking for any solution OTHER than restoring. I have done that several times. Also, I know the problem isn't with my jailbreak. It worked for several months before, then one day stopped. Now, it has the problem within a day of rejailbreaking, OR instantly if I install SBsettings. I re-installed the jailbreak, and applied the new one as well, and that didn't work. I have given up, and don't want to go through the painful process of restoring, rejailbreaking, and re-installing all of those tweaks again. Also, because I can't get into my iPod, I can't provide a list of tweaks. I would if I could, but it just can't happen unless I can get in there.", "Free UML drawing library for .NET", "Convert NSDate to NSString How do I convert, NSDate to NSString so that only the year in @\"yyyy\" format is output to the string?", "Where can I find good literature for beginners? I am trying to find some database tutorials,books and similar, since I have started this course in college, and received some material, but it is really hard to manage through all the info on the net. I searched through the questions on the site but didn't find any. Thankfull for all your input.", "Identify duplicate lines in a file without deleting them? I have my references as a text file with a long list of entries and each has two (or more) fields. The first column is the reference's url; the second column is the title which may vary a bit depending on how the entry was made. Same for third field which may or may not be present. I want to identify but not remove entries that have the first field (reference url) identical. I know about sort -k1,1 -u but that will automatically (non-interactively) remove all but the first hit. Is there a way to just let me know so I can choose which to retain? In the extract below of three lines that have the same first field (http://unix.stackexchange.com/questions/49569/), I would like to keep line 2 because it has additional tags (sort, CLI) and delete lines #1 and #3: http://unix.stackexchange.com/questions/49569/ unique-lines-based-on-the-first-field http://unix.stackexchange.com/questions/49569/ Unique lines based on the first field sort, CLI http://unix.stackexchange.com/questions/49569/ Unique lines based on the first field Is there a program to help identify such \"duplicates\"? Then, I can manually clean up by personally deleting lines #1 and #3?", "Line breaks in listings Is there a way like wrap the line after at most 60 letters but it should not break inside some commands like listings does? Example: \\documentclass[a5paper]{article} \\usepackage[T1]{fontenc} \\usepackage[utf8]{inputenc} \\usepackage{listings} \\usepackage{xcolor} \\lstset{% language=[LaTeX]TeX, backgroundcolor=\\color{gray!25}, basicstyle=\\ttfamily, breaklines=true, columns=fullflexible } \\begin{document} \\begin{lstlisting} The roadrunner is the fastest running bird \\remark{Check this again with a zoologist!}. \\end{lstlisting} \\end{document} Output: The roadrunner is the fastest running bird remark{Check this again with a zoologist!}. That should not happen! In my eyes this problem is not discussed in .", "better Curve/Text to Mesh generation? The triangulation process of Text to Mesh or Curve to Mesh generates some nasty topology. I get why, but maybe it could be done a bit nicer? Since text is flat, have ngons instead of hundreds of triangles you'll need to modify anyway? Another issue is when you then want to use the text as a Volume for particles, which for some reason behave weird when you have unusual topology even though they should be using the volume, not vertex or face positions.", "Methods to compute $\\sum_{k=1}^nk^p$ without Faulhaber's formula", "What language is the Ubuntu Software Center written in? Just been wondering, since elementary AppCenter is written with Vala and Gtk+3. Also, what GUI wrapper does it use?", "I've got a project where I'm looking to tweak the standard lead conversion process. Triggers and lead conversion has always been funky in past projects so I was hoping to start the design off by reviewing the order of execution, but after a long google search I'm coming up empty handed. Anyone out there know the specific trigger order for lead conversion? Edit: I'm not asking about trigger execution order for any object, but all the objects created in the lead conversion process. I'd think it would be something like this: Lead Before Update Triggers (isConverted = false, convertedAccountId = null, convertContactId = null, convertedOpportunityId = null) Account Before Insert Triggers (not fired if merged with existing account) Account After Insert Triggers (not fired if merged with existing account) Contact Before Insert Triggers (not fired if merged with existing contact) Contact After Insert Triggers (not fired if merged with existing contact) Opportunity Before Insert Triggers (not fired if no opportunity) (OpportunityContactRoles null) Opportunity After Insert Triggers (not fired if no opportunity) (OpportunityContactRoles = convertedContactId) Lead After Update Triggers (isConverted = true, convertedAccountId = XXX, convertedContactId = XXX, convertedOpportunityId = XXX)", "What is the command to open the shutdown dialog?", "What are the “spam” and “rude or abusive” (offensive) flags, and how do they work?", "Do I have a virus on my phone? A message from an Android app says so I have just received a message from an Android app on my phone saying my phone has been infected with a virus and to click a link to fix the problem. I'm not sure I trust this, is it possible to have a virus on Android?", "I know you can select a tag and then click on unanswered to view the unanswered questions for that tag. But is there a way to view questions only for a certain set of tags > 1 tag? Mainly I'd like the union of tag1 with tag2 with tag3 with tag4. But also the intersection of tags would be nice as well.", "I accidentally rsynced .thunderbird to user@host instead of to user@host:/home/user. Where is .thunderbird now? Is there a good way to search for the folder?", "How do I size a UITextView to its content?", "What is the best way to copy text to the clipboard (multi-browser)? I have tried: function copyToClipboard(text) { if (window.clipboardData) { // Internet Explorer window.clipboardData.setData(&quot;Text&quot;, text); } else { unsafeWindow.netscape.security.PrivilegeManager.enablePrivilege(&quot;UniversalXPConnect&quot;); const clipboardHelper = Components.classes[&quot;@mozilla.org/widget/clipboardhelper;1&quot;].getService(Components.interfaces.nsIClipboardHelper); clipboardHelper.copyString(text); } } But in Internet Explorer it gives a syntax error. In Firefox, it says unsafeWindow is not defined. A nice trick without using :", "I'm hand-maintaining an HTML document, and I'm looking for a way to automatically insert a link around text in a table. Let me illustrate: &lt;table&gt;&lt;tr&gt;&lt;td class=\"case\"&gt;123456&lt;/td&gt;&lt;/tr&gt;&lt;/table&gt; I would like to automatically make every text in a TD with class \"case\" a link to that case in our bug tracking system (which, incidentally, is FogBugz). So I'd like that \"123456\" to be changed to a link of this form: &lt;a href=\"http://bugs.example.com/fogbugz/default.php?123456\"&gt;123456&lt;/a&gt; Is that possible? I've played with the :before and :after pseudo-elements, but there doesn't seem to be a way to repeat the case number.", "I normally dual-boot with 12.04 and Win XP pro sp3 on a Thinkpad R60. I needed to reinstall windows because of problems piling up, so I ran the computer's built-in hard-disk recovery software. I told it not to mess with the other partitions, but somehow it deleted the Linux partition. That's what I was using to backup all of my windows files, so now everything I have is gone. I just ran the USB setup with linux, and the partition is deleted - it just shows it as empty space. Is there ANY way to get all of my files back?" ]

[ "How to check whether a string contains a substring in JavaScript?", "Counter with 4 flip flops jk synchronous from 3 to 13! I have to create a counter with 4 flip flops jk synchronous. The counter shall count in this order: 3 to 13 and then to 3 to 13 and so on.. I have to use logisim simulator. Ok. So i think its solved. I realized that the circuit needs to start at 0 ou 1 and stabilize after the 13 and then it goes to 3. Thanks for your help. Hope this will help for somebody else too. Thank you all for your help!", "Change desktop background to a solid color (e.g. pitch black) in GNOME 3 I just installed Ubuntu 16.04 with GNOME and I would like to set the background color to black. If I right click in the background I can select a wallpaper or a photo or a color. But there are only a few colors available. How can I open a palette and select the #000000 color ?", "What are all the correct answers to the Squirrel's questions, and what is the reward when I get them all correct? I encountered The Squirrel at \"A tree.\" | | | | \" Hello, I'm The | | Squirrel. I can | | provide you candies, | | and lots of things. | I know how much you | _.-'''-, love candies. But I | .' `\\ feel alone in this | / / forest. \" | | / .--^_^ | | | / C ,,\\ | | | \\ _.) ___ | \\ | / \\ ____.----'.-' | '-, \\./ \\)\\) .-' -- __.-' | \\ `-/ );/ ___/ - _.-' | \\_________''--'-'________.-' -- / | - -- - - - __.-' - -- - -- -- / _________________________.-' He asks you some questions. What are the correct answers, and what is the reward for getting them correct?", "static variables in an inlined function I have a function that is declared and defined in a header file. This is a problem all by itself. When that function is not inlined, every translation unit that uses that header gets a copy of the function, and when they are linked together there are duplicated. I \"fixed\" that by making the function inline, but I'm afraid that this is a fragile solution because as far as I know, the compiler doesn't guarantee inlining, even when you specify the \"inline\" keyword. If this is not true, please correct me. Anyways, the real question is, what happens to static variables inside this function? How many copies do I end up with?", "Linear Discriminant Analysis for $p=1$ I'm studying 'Introduction to Statistical Learning' by James, Witten, Hastie, Tibshirani. In page 139, of their book, they began by introducing Bayes' Theorem $p_k(X)=P(Y=k|X=x) = \\dfrac{\\pi_kf_k(x)}{\\sum_{l=1}^k \\pi_l f_l(x)}$. $\\pi$ is not mathematical constant, but denotes the prior probability. Nothing is strange in this equation. The book claims that it wants to obtain an estimate for $f_k(x)$ that it can plug into the equation given above. To estimate $f_k(x)$, it assumes that is normal. In the one dimensional setting, $f_k(x)=\\dfrac{1}{\\sqrt{2\\pi}\\sigma}\\exp(-\\dfrac{1}{2\\sigma^2}(x-\\mu_k)^2)$, where $\\mu_k$ and $\\sigma^2_k$ are the mean and variance for the $k$th class. It is assumed that $\\sigma^2_1 = \\sigma^2_2 = \\cdots = \\sigma^2_K$. (I began to get confused from the last statement.) Plugging $f_k$ into $p_x$, you have this quite messy equation (1) : $$p_x(k)=\\dfrac{\\pi_k \\frac{1}{\\sqrt{2\\pi}\\sigma}\\exp(-\\frac{1}{2\\sigma^2}(x-\\mu_k)^2)}{\\sum_{l=1}^K \\pi_l \\frac{1}{\\sqrt{2\\pi}\\sigma}\\exp(-\\frac{1}{2\\sigma^2}(x-\\mu_l)^2)}. $$ Again, no surprises here since it is just substitution. The Bayes' Classifier involves assigning an observation to the class for which equation (1) is the largest. Taking the log of Equation (1) and rearranging terms, it is not hard to show that this is equivalent to assigning the observation to the class for which the following is the largest: $$\\delta_k(x)=x \\cdot \\dfrac{\\mu_k}{\\sigma^2} - \\dfrac{\\mu_k^2}{2\\sigma^2} + \\log(\\pi_k) $$ Question: I do not understand where this came from, and what it means. I tried doing the log of equation and it doesn't become this. Are we taking the derivative somewhere here, since this is the largest observation?", "I have video tutorials that I want to show in my presentation with beamer class. I don't want the video files get embedded to the PDF because they will make the PDF size very very huge. If you know how the videos can be played on the HTML with a reference rather than embedding the video file to the HTML file, I want something like this to be applied to my PDF presentation. I just want to reference the video URL from my PDF presentation. Shortly speaking, can we use media9 to show a video on a PDF but the video is not embedded to the PDF? Uploading those videos to a web server might be difficult for me because internet connection is very slow and sometimes not available in the presentation room. :-)", "I just need to check the reasoning in my proof is correct, I think it is valid although I'm not totally convinced because I can't follow the logic; does proving that $x$ is an integer prove that $ac|bd$? Theorem: Let $a$, $b$, $c$, $d$ be integers. If $a|b$ and $c|d$, then $ac|bd$. Proof: $aj=b$ and $ck=d$ for integers $j$, $k$. Then, $ac|bd$ implies $acx=ajck$ and thus $x=jk$ for some $x$. Since the product $jk$ is an integer, $x$ is an integer and thus $acx=ajck$ and thus $ac|bd$.", "How to completely disable auto-save and versions in Mac OS X Lion? I hate the automatic saving and versioning in Mac OS X Lion. Is there a way to completely turn it off? (This has been asked before , but the answer and the linked article are completely wrong, so I thought I'd try again.)", "I'm sure this is a newbie question, but I can't figure this out. I have tried to follow the advice here: and here: But I can not seem to be able to generate any font change. I either get no change or error messages. Here is the output of one failed attempt to change the font to Times using this command: \\rmfamily \\renewcommand{\\rmdefault}{ptm} Apparently I either don't have a correct package installed or... The output says \" Metric (TFM) file not found.\" but I am not sure where to go from there.", "If $|G/H|=4$ then $G$ is union of three proper subgroups Let $G$ be a finite group and $N$ a normal subgroup of $G$ of index $4$. Prove that $G$ has a subgroup of index $2$ (hence normal) and if $G/H$ is not cyclic then $G$ is equal to the union of three proper subgroups. I understand that $G/H$ is isomorphic to $\\mathbb{Z}_4$ or $\\mathbb{Z}_2\\times \\mathbb{Z}_2$. Let $K^*$ be a subgroup of $G/H$ of order $2$. Then $K^*\\cong K/H$ for some $K$ such that $H$ is normal in $K$ and hence $[G:K]=[G/H:K/H]=4/2=2$. If $G/H$ is not cyclic then $G/H\\cong \\mathbb{Z}_2\\times \\mathbb{Z}_2$. I don't know how to prove $G$ is the union of three subgroups. Could it be true that as $G/H$ is the union of three proper subgroups $K_1^*,K_2^*,K_3^*$ then the corresponding groups $K_1,K_2,K_3$ have union equal to $G$? Would anyone give me a hint to prove this? Thank you.", "Over the past few weeks, there have been a number of complaints about users making suggested edits en masse whose quality was at least questionable. Let an example of a low-quality edit be the addition of the web-frameworks tag to dozens of questions about the PHP web framework Laravel. No one is ever going to use it in a search, but Laravel is a framework, right? (If you disagree about this being a low-quality edit, please bear with me anyway - my point here is that the system through which such conflicts could be settled is broken.) Examples This is a toxic situation guaranteed to create strife because - The new user is happy to have found a way to participate and earn some rep; they may be genuinely feeling that they are improving the site. The reviewers greenlighting most of their suggestions confirms them in their belief. The reviewers usually see only one edit - and it's easy to see how they might go, \"meh, this isn't a terribly useful edit, but hey, maybe it helps someone, and it's a new user. No point discouraging them.\" The veteran users who check out the editor see dozens of what they perceive as low-quality edits, usually ignoring anything else that should be fixed in the post. To the veterans, the new user is systematically looking for excuses to make their pointless edits, creating a giant mess in order to gain some rep - a mess they have to clean up, while there are no consequences for the editor, who gets to keep their ill-gotten points. While a bad question or answer can be downvoted - usually leading to a change of behaviour eventually - the edit system looks like it's wide open for gaming. So tensions are high, and when there's dialog it can be angry. I'm not saying either side is completely right. I'm completely prepared to believe that many of these edits are in good faith, etc. But it's a mess because it's frustrating people. As said, there are no consequences for bad-faith mass editing; apart from commenting on some random post, there is no way to communicate with an editor. The outcome of a moderator flag is very much uncertain. The absence of a clear set of rules means there's plenty of room for heated arguments. Something needs to change here. Either We need super clear rules on what makes a good tag edit Tag-only edits should be allowed only for 2k+ users, or they should not gain 2 reputation points for &lt;2k users The possible 1000 rep gain for suggested edits needs to be rate-limited (say, 200 per month) (this is my favourite!) The possible 1000 rep gain for suggested edits needs to be lowered, say to 500 or 250 Rollbacks of suggested edits should result in annulment of the 2 points gained (this is terrible) There should be a system to vote on edits (yes, that's been suggested before) There should be a defined and officially sanctioned pathway, and ruleset, for moderator flags cast about these users ... or something else. But something needs to give.", "When going to any page of with a new reputation gain, the achievements dropdown keeps showing a new badge green highlight: And then trying to dismiss the notification by clicking on it gets rid of the green badge notification, but the +5 remains even after I've clicked away from the dropdown.", "I am trying to make a map where you have to make a village from scratch, and I need help. I'm trying to make a /clone command happen relative to where a mob that's named house is, and I cant figure it out. Any help?", "Gravatar profile image not showing sometimes It seems that with some profiles the Gravatar image is broken. I am not sure if this is an issue with SE or Gravatar, or both, so posting here. As an example, shows an error on , which shows a HTTP 500 on Gravatar. Profile image on SO: Image on Gravatar: Switching to the MSE profile of the user, the image is working (but has a different hash). Is this a bug on the SE side? Can anything be done to make Gravatar fix this? Update 2016-10-04: It happened to me again two times today. The last user profile was . Calling the service two or three times fixes the issue.", "Every subsequence of $x_n$ has a further subsequence which converges to $x$. Then the sequence $x_n$ converges to $x$.", "Table with actions per row", "How to confirm that mail has been delivered or not?", "Is there a easy way to test ubuntu on new notebooks before buying it?", "What class of Devil Fruit does the Gomu Gomu no Mi come under? Considering the three types of Devil Fruits that has been explained are 1. Paramecia Type - where the user can get super human abilities and change their body parts into weapons, etc. 2. Zoan type - where the use can turn into a particular animal and inherit its abilities 3. Logia Type - where the user's body inherits a particular element and the body becomes like air which cannot be touched or damaged by non Haki users. So what exactly is the type of Gomu Gomu no Mi? It cannot be Zoan or Logia. It's very close to a Paramecia but still doesn't have a logical explanation to be of Paramecia type! So is it some special type of Devil Fruit?" ]

[ "How can one prove that numbers of the form $4x^2+1$ can only be divided by primes of the form $4y+1$ (e.g. there is no $x$ for which $7$ divides $4x^2+1$)? On a quick lookup, the statement is given as the first comment in and of course, manual testing concurs with this", "How can I merge a guest post with a new account? I asked a question over at AskUbuntu(as a guest), and I'd like to be able to edit and comment on this new account. Is this possible?", "Names of higher-order derivatives Specific derivatives have specific names. First order is often called tangency/velocity, second order is curvature/acceleration. I've also come across words like Jerk, Yank, Jounce, Jolt, Surge and Lurch for 3rd and 4th order derivatives. Is there a widely agreed list of names for these? How many orders have specific names? In this case, I'm dealing with NURBs curves, so the \"tangency\" and \"curvature\" related words are to be preferred over \"velocity\" and \"acceleration\" words.", "When a ball is thrown onto a wall, the ball exerts a force onto the wall. According to Newton's Third Law, the wall will exert an equal and opposite force to the ball. Thus, how would the ball be able to bounce back? Shouldn't it just slide down the wall?", "Centering figure captions in IEEEtran I am working on a paper using the IEEEtran template in LyX. I have run into a problem: While the contents (in this case, a table) of the figure float are centered, the caption is aligned to the left (see screenshot below). How can I center the caption as well? This is generated by the following LyX document: What I've tried: Center the table (the table is centered) Center all the contents in the float (only the table is centered) Select the caption and center it (no effect) Technical details: LyX 2.0.5.1 Mac OS X 10.7.5 (Lion) All centering was performed by Right Click>Paragraph Settings>Align: Center", "You require a reputation of 50 to leave comments on others' questions/answers; the FAQ simply states this as a fact but does not explain it. I'm a new user and I have identified this as an issue very quickly through my own experiences so far. Looking at other questions seems to also provide justification against this 50 reputation requirement for comments on others' questions/answers. In my own experience, I've seen a few questions like \"how do I do x?\" then the same poster has answered with \"in the end I did it like this: ...\" where their solution was perfectly sensible, but there may be some gotchas to watch for - in this case I want to vote up their answer and/or comment on it to point out the potential gotchas, but I can do neither! To me all of the above seems justification against this rep requirement to comment, so what is the counter-argument and justification for it?", "How do I find this conditional expectation?", "Sci-fi book, blue critters than only some people can see, kids fight the critters as they feed off energy and are a threat", "By default indents with a hard tab character. How do I change it to spaces?", "After the performance problems we have run into with we've decided to make a change, we're moving the network on to . Here's where to get started: What works: All search operators should be in Many changes below from the old search behavior What's different: The new search is AND, adding a search term will narrow your results, not expand them. The look of search results is now more unified with the following differences between Q&amp;A: \"Q:\" or \"A:\" prefix Answer counts and tags will be present in questions. The answer count will be highlighted in green if it's accepted. (We may index other things later, that's why the results are more generic/google-y now.) It's faster, about 5-10x faster for almost all searches on large sites like Stack&nbsp;Overflow Quoted phrases are exact matches except for case-sensitivity, for example, or . If not in a quoted phrase, words will now be stemmed () Snippets for context will now be more relevant Excludes are now explicitly supported (like -term and -\"my phrase\") We don't roll up to the question anymore, if you searched for something that matched an answer, we'll show you the answer directly in search results The search per minute limit is effectively gone, it'll block a bot, but no one else should hit it... We'll be monitoring performance though infavorites:mine is back, with infavorites:12345 (any user id) added What needs work: What you tell us is broken... Do your worst. Testing, not yet final: New range support, here are some examples: answers:1..1 (exactly one answer) answers:10..20 (10 to 20 answers) created:2008..2009 (created between Jan 1st, 2008 and Dec 31, 2009) created:2010-04..2010-05 (created between April 1st, 2010 and May 31st, 2010) created:2011-01-05..2011-01-06 (to be clear: it goes to end-of-day) This range syntax applies to a new advanced operator: lastactive: and the other numerical ranges, views:, and score: Additionally, the above syntax is a bit more flexible if you forget it exactly (e.g. score:20-30) in an effort to be intuitive as possible, give it a try - tell us what you think. I'll try and improve the search as much as possible before it becomes default... At the very least we want it equivalent in relevance and functionality before the switch, but ideally much better. We won't switch until then. Please give it a try, tell us what you think here, and we'll continually improve it over the holidays as time allows. Bear in mind you may get a search offline page during this test if a change we're making for results necessitates a reindex, and even that should only last about two minutes here on Meta&nbsp;Stack&nbsp;Overflow. Give it your worst, compare results to the old search, tell us what's better and what's not. We look forward to the feedback. Update The new search is now the default across the network - we'll be monitoring things over the next few days and would appreciate reports of any crazy behavior you see here.", "The Challenge I have been trying to write a filter that applies (prepends a string) to (a) post titles of a certain post type and (b) to that same post type WordPress admin backend for use by an auto social sharing plugin. I've gotten really close. I've achieved: 1. prepending only to custom post_type post titles 2. prepending to custom_post type titles AND all nav menu items 3. prepending to ALL titles (post, page, nav menu, and backend auto-sharing plugin) The final, 3rd attempt got me very hopeful, but yet still, no matter the function, conditional statement, or combination I use, I can't get custom_post title AND backend social sharing plugin, but not nav menu items. My Code - what I've tried I've tried different conditionals, like is_admin() and !is_nav_menu with all nav menu IDs. I've also tried comparing the ID of the post to the ID of the menu. Finally, I've also tried adding the filter only to loop_start and that seems promising if combined with other statements. I will clean up my code for your review but I leave it this way for now in hopes it helps to see what I've tried and maybe where I went wrong with any of those methods. // , $id = NULL function append_album_review_to_title( $title ) { global $post; global $dont_apply_title_filter; $text = 'Album Review: '; $prepended_title = $text . $title; /* $nav_menus_obj = wp_get_nav_menus(); $nav_menu_ids = ''; foreach( $nav_menus_obj as $nav_menu ) { $nav_menu_ids .= $nav_menu-&gt;term_id . ','; } rtrim($nav_menu_ids, ','); */ // if ( get_post_type( $post-&gt;ID ) == 'album_review' &amp;&amp; in_the_loop() ){ // if ( get_post_type( $post-&gt;ID ) == 'album_review' &amp;&amp; $id == get_the_ID() ){ // if ( !is_nav_menu( '32057,32058,35135,32054,32056' ) ) { // if ( get_post_type( $post-&gt;ID ) == 'album_review' &amp;&amp; is_nav_menu( $id ) ) { if ( get_post_type( $post-&gt;ID ) == 'album_review' &amp;&amp; !$dont_apply_title_filter ) { //print_r( $nav_menu_ids ); //print_r( is_nav_menu( $nav_menu_ids ) ); return $prepended_title; /* } elseif ( get_post_type( $post-&gt;ID ) == 'album_review' ) { return $title; */ } else { return $title; }; } add_filter('the_title', 'append_album_review_to_title'); //add_action('save_post', 'custom_post_type_title', 100); /* function set_custom_title() { add_filter( 'the_title', 'append_album_review_to_title', 10, 2 ); } add_action( 'loop_start', 'set_custom_title' ); */", "Exporting PDF with Hyperlinked Attributes from ArcMap? I'm using ArcGIS 10.1 and would like to export a map to a pdf, preserving feature's attributes. I would like to be able to identify, for example, a point feature from the map on pdf with its underlying features (essentially hyperlink to a document or URL). I know one can export to such a pdf in ArcMap, with an advanced option of exporting features with attributes. I use Adobe Acrobat Pro v.10, and cannot seem to be able to find a way to bring these attributes up. Is this possible?", "QM and Renormalization (layman) I was reading Michio Kaku's Beyond Einstein. In it, I think, he explains that when physicsts treat a particle as a geometric point they end up with infinity when calculating the strength of the particle's field as you approach the particle. First, did I get that part right? Second, how does (in very simple terms) renormalization try to fix this in Quantum Mechanics? If you can include some type of word picture that would be great. Accepted answer will go to the clearest explanation. Update I got a little further in the book (lol) and Kaku talks about using symmetry to remove the divergences in the math. I'd appreciate an answer that incorporates this also. Thanks guys!", "What is the process for a moderator to request reinstatement or appeal a removal? Please leave any feedback or questions about this process on . From time to time, moderators will step down or be removed from their positions — they may have expressed their wish to step down due to time constraints or they may have had behaviors unfitting of a moderator and have been forcefully removed, along with a number of other possibilities that fall somewhere between those two. What is the process for evaluating moderator reinstatement or removal appeal requests? Note: Feedback on the original version of this post can still be found .", "Prove that $a^n-b^n = (a-b)(a^{n-1} + a^{n-2}b + \\cdots + b^{n-1})$. Exercise Prove that $a^n-b^n = (a-b)(a^{n-1} + a^{n-2}b + \\cdots + b^{n-1})$. I've posted my solution below. In case someone has a more clever solution, feel free to post it! (TBH, I was surprised that there was no question on Math.SE regarding this equation!)", "Actually I have installed the new Ubuntu 15.04 64bit, and when I'm trying to install Steam on it, there is a problem. In fact I have downloaded the deb package from steam website, installed it and when I start it nothing happens. I tried to start it from terminal and what I've got $ steam Running Steam on ubuntu 15.04 64-bit STEAM_RUNTIME is enabled automatically Installing breakpad exception handler for appid(steam)/version(0_client) libGL error: unable to load driver: r600_dri.so libGL error: driver pointer missing libGL error: failed to load driver: r600 libGL error: unable to load driver: swrast_dri.so libGL error: failed to load driver: swrast", "Best way to simulate \"group by\" from bash?", "CSS two divs next to each other I want to put two &lt;div&gt;s next to each other. The right &lt;div&gt; is about 200px; and the left &lt;div&gt; must fill up the rest of the screen width? How can I do this?", "In a 2-columned document, how do you get a table to stretch across the entire width? I'm working on a document that runs two columns of text down the page, like many scientific conference proceedings. However, I'd like for a table to run across the entire width of the page, as it is far too wide to fit into one column. How do I do this?", "Is it correct to say \"I slump/slumped on/onto the stool/barstool?\" I wrote this sentence: \"I buy a bottle of beer and slump on/onto the last stool.\" A native English speaker told me that \"slump\" doesn't work here. That you can't slump on a bar/barstool. Is this correct? If so, why?" ]

[ "I want to setup a new virtual machine with some specified packages (name and version), that are provided. For example apache2 in version 2.2.20-1ubuntu1 with all dependencies. Even if there is a new version of this package on the servers this one should be installed. The solution has to work/scale with multiple (n) \"setups\". Another virtual machine might need an older version of apache2. I currently know of some possibilities that install the exact packages, but do not scale that good: Copy all required *.deb to every virtual machine manually and enter: dpkg -i ... -> Could work, but it is very error prone. (Manual scripts etc.) Create and use a new Ubuntu repository for each setup. -> Does not work because I would need n repositories. Setup the machine once and copy the VM / create a snapshot. -> Does not work because I would need to store n VMs. My problem could be labeled as patch management, but I do not want to update my packages to the current version. My goal is to install old packages.", "I want to do this using the Math.Round function", "If $A\\subset\\mathbb{R^2}$ is countable, is $\\mathbb{R^2}\\setminus A$ path connected? Possible Duplicate: As the topic,if $A\\subset\\mathbb{R^2}$ is countable, does $\\mathbb{R^2}\\setminus A$ path connected??? I know the answer is it is path connected but not sure how to prove it.", "Duplicate explanation should encourage improvement of original The new closed-as-duplicate banner says: This question has been asked before and already has an answer. If those answers do not fully address your question, please . I think it should instead say This question has been asked before and already has an answer. If answers there do not fully address your question, please or to the pre-existing one. &mdash; to discourage re-re-asking the same question. (I also changed \"those answers\", which has no plural , to \"answers there\", which doesn't need one.) As of September 19, 2013, the original text quoted above has returned here.", "Expected number of siblings, given the expectation of children in a family The number of children in a family is a random variable $X$, where $ \\mathbb E(X) = 1.8 $ and $Var(X) = 0.36 $. If we randomly choose a child, which is the expected number of its siblings? (it is given that the answer $&gt; 0.8$) Let the number of a child's siblings be a random variable $Y$, so we are looking for $ \\mathbb E(Y) $. If found that, $$ \\mathbb E(Y) = \\sum_{k=0}^{\\infty}k \\; \\mathbb P(Y=k) = \\sum_{k=0}^{\\infty}k \\; \\mathbb P(X=k+1) = $$ $$ = \\sum_{k=0}^{\\infty}k \\; \\mathbb P(X=k)-\\sum_{k=0}^{\\infty}\\mathbb P(X=k) +\\mathbb P(X=0)= \\mathbb E(X)-1+\\mathbb P(X=0) $$ which is indeed greater than $0.8$, if $\\; \\mathbb P(X=0)&gt;0$. But, I don't know how to make use of the variance to find the final answer. Thank you in advance", "Simulate bad cell phone reception in the lab", "Partition of a set and Hall's theorem", "Make a computer act as a virtual USB device for other equipments", "Proving an identity for Bernoulli polynomials Consider the Bernoulli polynomials $B_n(x)$ given by the expansion $$\\frac{te^{xt}}{e^t-1} = \\sum\\limits_{n=0}^{\\infty}B_n(x)\\frac{t^n}{n!}.$$ I want to prove the identity $$B_n(1-x)=(-1)^nB_n(x).$$ This formula is given in a lot of books, but unfortunately without any proof. Therefore I'm wondering how to prove it. Do you have any idea? I tried for instance: $\\sum\\limits_{n=0}^{\\infty}B_n(1-x)\\frac{t^n}{n!}=\\frac{te^{-xt}}{e^t-1}e^t=\\left(\\sum\\limits_{n=0}^{\\infty}B_n(-x)\\frac{t^n}{n!}\\right)\\sum\\limits_{n=0}^{\\infty}\\frac{t^n}{n!}=\\sum\\limits_{n=0}^{\\infty}\\left(\\sum\\limits_{l=0}^n\\binom{n}{l}B_{l}(-x) \\right)\\frac{t^n}{n!}$. Hence $B_n(1-x)=\\sum\\limits_{l=0}^n\\binom{n}{l}B_{l}(-x)$. But I do not know how to proceed. On the other hand I know that $B_n(x+1)-B_n(x)=n x^{n-1}$. Hence $B_{n}(1-x)=B_{n}(-x)-n(-x)^{n-1}$. But again, I do not know how I can go further. Hopefully someone can help me. Best regards", "Whenever both my roommate and I use the wifi in a certain room in our apartment, it slows dramatically for me. It doesn't slow for him. If he uses it in another room, it's fine; if I use it in another room together with him, it's fine; it's just in this particular room. Does anyone know of a reason this could be?", "Attributing contributions to academic work that occur in Stack Exchange", "I want to install the on my iPhone. On the phone I have iOS 7. When I try to install the App, it tells me it needs at least version 8 of iOS. I do not want to upgrade my iOS version, especially for the sole purpose of installing an App. However, I do want to use it, it's kind of important. I searched for a while about how to do this, but I could only find solutions that would work if you installed the App before and it shows up on the \"Purchases\" page in iTunes or something like that. And this doesn't apply to this case. How can I install an older version of the App (one that requires \"only\" iOS 7) without having to upgrade the operating system on my iPhone ?", "Adding layers to GeoPackage using PyQGIS", "What exactly is a hat? I have seen a lot of people arguing the significance of hats and the limited edition hats. I know the hats are sort of linked to the Winterbash stuff, but what exactly is a hat, what does it do, how do I get one? Is there a full list of hats?", "Number of equivalence relations on a set", "Is \"Five dollars is all I have\" correct? I want to emphasize that I only have 5 dollars, so can I use the sentence: Five dollars is all I have. Or must it be: Five dollars are all I have. Please give the explanation as well.", "How to differentiate formally?", "How often is the password asked for sudo commands? Where can I set it up?", "Submitting a form by pressing enter without a submit button", "Does a creature with Lifelink provide lifegain equal to its power, or the defender's toughness?" ]

[ "Evaluating string \"3*(4+2)\" yield int 18", "How do I know the script file name in a Bash script? How can I determine the name of the Bash script file inside the script itself? Like if my script is in file runme.sh, then how would I make it to display \"You are running runme.sh\" message without hardcoding that?", "NEWID() In Joined Virtual Table Causes Unintended Cross Apply Behavior My actual work query was an inner join, but this simple example with cross join seems to nearly always reproduce the problem. SELECT * FROM ( SELECT 1 UNION ALL SELECT 2 ) AA ( A ) CROSS JOIN ( SELECT NEWID() TEST_ID ) BB ( B ) With my inner join I had many rows for which I added to each a GUID using the NEWID() function, and for about 9 out of 10 such rows the multiplication with the 2-row virtual table produced the expected results, just 2 copies of the same GUID, while 1 out of 10 would produce different results. This was unexpected to say the least and gave me a really hard time trying to find this bug in my test data generation script. If you take a look at the following queries using as well non-deterministic getdate and sysdatetime functions, you won't see this, I don't anyway-I always see the same datetime value in both final result rows. SELECT * FROM ( SELECT 1 UNION ALL SELECT 2 ) AA ( A ) CROSS JOIN ( SELECT GETDATE() TEST_ID ) BB ( B ) SELECT * FROM ( SELECT 1 UNION ALL SELECT 2 ) AA ( A ) CROSS JOIN ( SELECT SYSDATETIME() TEST_ID ) BB ( B ) I'm currently using SQL Server 2008 and my work around for now is to load my rows with GUIDs into a table variable before finishing out my random data generation script. Once I have them as values in a table as opposed to virtual table, the problem goes away. I have a workaround, but I'm looking for the ways to workaround without actual tables or table variables. While writing this I tried without success these possibilities: 1) placing the newid() into a nested virtual table: SELECT * FROM ( SELECT 1 UNION ALL SELECT 2 ) AA ( A ) CROSS JOIN ( SELECT TEST_ID FROM ( SELECT NEWID() TEST_ID ) TT ) BB ( B ) 2) wrapping the newid() within a cast expression such as: SELECT CAST(NEWID() AS VARCHAR(100)) TEST_ID 3) reversing the order of appearance of the virtual tables within the join expression SELECT * FROM ( SELECT NEWID() TEST_ID ) BB ( B ) CROSS JOIN ( SELECT 1 UNION ALL SELECT 2 ) AA ( A ) 4) using uncorrelated cross apply SELECT * FROM ( SELECT NEWID() TEST_ID ) BB ( B ) CROSS APPLY ( SELECT 1 UNION ALL SELECT 2 ) AA ( A ) Just before finally posting this question, now I tried this with success it seems, a correlated cross apply: SELECT * FROM ( SELECT NEWID() TEST_ID ) BB ( B ) CROSS APPLY ( SELECT A FROM ( SELECT 1 UNION ALL SELECT 2 ) TT ( A ) WHERE BB.B IS NOT NULL ) AA ( A ) Anyone have any other more elegant, simpler workaround? I really don't want to use cross apply or correlation for a simple row multiplication if I don't have to.", "Compute the integral $\\int\\frac{dx}{(x^2-x+1)\\sqrt{x^2+x+1}}$", "Kinetic energy is simple, right?! from the equation it seems as though if you know the speed and mass you'll know the work. Let's try to prove it. let's assume we know the acceleration and distance for now. $$w=mda$$ So the distance is $$d= 1/2 *at^2$$ Then $$t = \\sqrt{2d/a}$$ So $a*t$, which is the speed, is $$a*\\sqrt{2d/a} = a* \\sqrt{2d}/\\sqrt{a} = \\sqrt{2da} = \\sqrt{2w/m}$$ So regardless of the distance or acceleration, if you know the work and the mass, you can calculate the speed which is $$v=\\sqrt{2w/m}$$ What if you know the speed and the mass? You can easily calculate the work. $$v = \\sqrt{2w/m}$$ Then $$v^2 = 2w/m$$ That would mean $$m*1/2*v^2=W $$ Rearrange it and $$W= 1/2 *m *v^2$$ would be the equation. What if you have an initial speed and a new speed and want calculate the amount of work done after an initial speed to get the new speed? You'll just subtract the total work from the initial speeds work. $$1/2mv^2 - 1/2ms^2$$ where s is the initial speed and v is the new speed. However if you do it the other way which is $$d= 1/2at^2 + vt$$ and solve it the answer would be $$1/2ms^2 + 1/2msv$$ Why aren't they equal?", "Let $A$ be a commutative ring with $1$. Let $I$ and $J_k$, $k=1,\\dots,n$ be ideals of $A$ with $I\\subseteq \\cup _{k=1}^n J_k$. Then I have obtained the following: (1) If $J_k$, $k=1,\\dots,n$, are prime ideals, then there exists some $j$ such that $I\\subseteq J_j$. (2) If $A$ is a principal ideal ring, then there exists some $j$ such that $I\\subseteq J_j$. I want some counterexamples that for all $k=1,\\dots,n$, $I$ is not contained in $J_k$. How to get the counterexamples?", "I got a bunch of files in some directory (along with many other files) that I want to move. Luckily, all the files I want to move contain a certain identifier in their names, so I can ls | grep IDENTIFIER to get the exact list of files to move. But, how can I execute mv file /path/to/dest/folder/ at once, and not one by one (there's a lot of files to move)?", "How to find the frequency and type of my current RAM? How shall I find out the frequency and type of my current RAM? My OS is Ubuntu 12.04.", "Let $x*y=\\gcd(x,y)$ on $D_n=\\{x\\in \\mathbb N:x |n\\}$. I have to prove that $(D_n,*)$ is a commutative monoid and I have a problem when finding the identity element. $x*e=x$ So $gcd(x,e)=x \\to e=xk,k\\in \\mathbb N^*$ and $e \\leq n$ A good $e$ is $0$ but it's not in $D_n$", "How to compare dates in Java?", "Functional equation $f(r \\cos \\varphi)+f(r \\sin \\varphi)=f(r)$ Find all such monotonous function $f:[0,+\\infty)\\to \\mathbb R$, such that for any real $r\\ge0$ and $\\varphi \\in \\left[\\frac{\\pi}6, \\frac{\\pi}4\\right]$, $$f(r \\cos \\varphi)+f(r \\sin \\varphi)=f(r)\\text.$$ My work so far: If $\\varphi \\in \\left[\\frac{\\pi}6, \\frac{\\pi}4\\right]$ then $$\\frac{\\sqrt2}2\\le\\cos \\varphi\\le\\frac{\\sqrt3}2$$ $$\\frac12\\le\\sin \\varphi\\le\\frac{\\sqrt2}2$$ If $r=0$ then $f(0)=0$ If $\\varphi= \\frac{\\pi}{4}$ then $$f(r)=4f\\left(\\frac r2\\right)$$ $f(x)=cx^2$ for $x\\ge0$ and $c\\in\\mathbb R$", "Let users editing a question know if editing it would add it to the reopen queue This is sort of similar to , which was positively received, but was declined for technical reasons. I propose that users who are editing a post that was closed within the last five days be shown a notice on top of the edit form indicating that the post will be added to the reopen queue if edited, and that if one does not plan on editing the post into a state where it can be reopened, one should wait until five days after closure to make the edit. Closed questions are only added to the review queue once per closure by editing, and if a user comes by and makes a minor (yet benign) edit, the diff that reopen reviewers see is just that of the minor edit, and as such they dismiss the task as &quot;Leave Closed&quot;, which prevents it from being added to the queue again by another edit. This deprives the post author (and others interested in seeing the question reopened) of their chance to get the post reopened by editing. While some of these edits may be performed by users using (semi-)automated tools who would thus not see or overlook the warning, this will be a big help because 99%+ of users make edits solely manually and would thus see and possibly respond to such a notice. To help make this request more technically feasible, I propose that it instead only be loaded with the edit form, and that it should only be shown to users who can make binding edits. (Suggested edits occur at the time of approval, and the request to let the reviewers know has already been declined.) Here's an example of what I'm expecting: This question was recently [closed/marked as duplicate]. This question will be added to a queue for possible reopening if you make this edit. If you are not planning to edit this post into a state where it can be reopened, please wait until [date and time after 70 days] to make your edit. If you are only making edits to the question's tags, please ignore this notice.", "How can I define a 3D version of the built-in VoronoiDiagram (VoronoiMesh in V10) function?", "Why do you cast downvotes on answers? This is a question which started off with a , then turned into an , and now it's a question in its own right (as suggested by Jeff). I'm not sure where it could go from here :) It's obvious that different people cast downvotes for different reasons. (Upvotes are less controversial, generally.) Here are some possible reasons: Answer is wrong Answer is misleading (may be technically accurate, but will lead to readers making mistakes) Answer doesn't match the question (e.g. a C# answer to a question about Java) Answer doesn't really address the question, e.g. suggesting a completely different solution, even if the question specifies that there are good reasons why the current approach has to be followed Answer is okay, but not as good as another one which currently has fewer votes Answer appears to be plagiarised from existing answers. Answer is by someone I don't like. Answer is abusive (profanity, spam etc). No reason, I just felt like it. I'm a , and prefer down to up. Have you considered down? Ideological grounds: answer suggests a technology I don't like, or expresses a negative opinion of a technology I do like Personally I go with 1, 2 and 8 - although I'll add comments suggesting changes in various other situations. Have I missed anything? What do you do, and why? What are the net benefits (to you, the world in general, and the answerer) from your approach?", "How are answers with the same vote score sorted? When a new question is asked how are the answers sorted? I just answered a question and there were two other answers. All three answers have 0 votes and no edits. Immediately after I answered my answer appeared first. Now the order refreshed, it appears they are sorted by reputation.", "My Ubuntu 14.04 is stuck when trying to login my desktop. The screen goes black and soon after that the login screen comes back. I followed all steps in but the issue was not solved.", "How can I prepend a tag to the beginning of several files?", "\\textcite macro produces \"Author (year)\" correctly but colours first paren with hyperref I am using a custom \\textcite macro that I found somewhere. It works nicely except that it makes the opening paren of \"Author (year)\" part of the link (also colouring it blue) which is not desired. This is likely just a minor change to the definition of the macro, but the solution eludes me (I don't get where the opening paren is added at all). Opening paranthesis should not be part of link and should not be coloured. (M)WE: \\documentclass{scrartcl} \\usepackage{csquotes} \\usepackage[backend=biber, bibencoding=utf8, hyperref=true, natbib=true, minnames=1, %% prevent truncation to year-only backref=true, %% TODO REMOVE before final bibstyle=apa, citestyle=authoryear, ]{biblatex} \\DeclareLanguageMapping{english}{english-apa} \\addbibresource{bib.bib} \\DeclareCiteCommand{\\textcite} {\\boolfalse{cbx:parens}} {\\usebibmacro{citeindex}% \\printtext[bibhyperref]{\\usebibmacro{textcite}}} {\\ifbool{cbx:parens} {\\bibcloseparen\\global\\boolfalse{cbx:parens}} {}% \\multicitedelim} {\\usebibmacro{textcite:postnote}} \\usepackage[table,svgnames]{xcolor} \\definecolor{solblue}{HTML}{268BD2} \\usepackage[pdftex]{hyperref} \\hypersetup{ pdfhighlight = /P, colorlinks=true, urlcolor=solblue, filecolor=solblue, linkcolor=solblue, citecolor=solblue, raiselinks=true, breaklinks, unicode } \\begin{document} foobar \\textcite{thesis_pockrandt} foobar \\end{document} bib.bib: @phdthesis{thesis_pockrandt, author = {Christopher Maximilian Pockrandt}, title = {{Approximate String Matching: Improving Data Structures and Algorithms}}, year = {2019} }", "Installing Steam on Debian I have ran into some issues when it went down to install Steam on Debian. The console as well as Apper comes up with missing dependencies and the package isn't going to install.", "How many points in RSA, such that $m^e = m \\bmod n$ For every RSA-cryptosystem, there exist some messages $m$, for which it holds that $m^e \\equiv m \\pmod n$ As to the question, how many such messages exist, this question has already been asked and answered here: However, I do only understand the answer up to a certain point Suppose that $n$ is only 1 prime. Then it holds that the number of unconcealable messages is $\\gcd(e-1, p-1)+1$ This is because in $m^e \\equiv m \\pmod p$ , either $m = 0$ or $m \\not= 0$. In the latter case $m$ can be expressed as $g^t$, where $g$ is a Generator in $\\mathbb{Z_p}$ $g^{t*e} \\equiv g^t \\pmod p$ $g^{t(e-1) \\bmod p -1 } \\equiv g^{0 \\bmod p -1} \\pmod p$ $t(e-1) \\equiv 0 \\pmod {p-1} $ has exactly $\\gcd(e-1, p-1)$ solutions, so the total number of unconcealable messages is, together with $m=0$ , $\\gcd(e-1, p-1)+1$ When we now look at real RSA, which has two prime factors in its modulus, it holds that the number of unconcealable messages is $(\\gcd(e-1, p-1)+1)\\cdot(\\gcd(e-1, q-1)+1)$ Why is that so? I suppose it has to do with CRT, but I just cant understand why." ]

[ "How to terminate a script? I am aware of the die() command in PHP which exits a script early. How can I do this in Python?", "Don't impose delay loading Close dialog when you haven't just loaded it", "Apply for a Korean visa in Japan I'm a Vietnamese citizen and currently living in Japan. Can I apply for a South Korea tourist visa at the Korean embassy in Japan, or must I do it at the Korean embassy back in Vietnam?", "While attempting to delete a question which was answered by myself, and with no other answers, I got the following warning: Delete this answered question? We do not recommend deleting questions with answers because doing so deprives future readers of this knowledge. Repeated deletion of answered questions can result in your account being blocked from asking. Are you sure you wish to delete? I understand that deleting your question when someone else has answered it is effectively nullifying the effort that person put into that answer, which is bad. But is it bad if the only answer that's deleted along with your question is your own?", "What inspired Tauriel's story arc? I know Tauriel is a Jackson created character, but I wondered if anywhere in the legendarium there was fodder for the story arc between her and Kili. I do not have access to all my books for the time being and recall stories of love between men and elves in the Silmarillion and Appendices but don't remember any such stories between elves and dwarves and wondered if there was any basis of inspiration for this aspect of their relationship within Tolkien's works. This movie, of course, departs even further from the original than those made before it, but as a story unto itself, I can still appreciate the ride, so if there is no Tolkien basis, what inspired Jackson, Boyens, and Walsh to create this particular arc? Is there interview info or anything?", "How is the passage of time handled in Pokemon? I stopped following the Pokemon anime a while ago, but I know the series has had Ash go through many regions, including retreading at least one of them. When Ash was about to get his eight badge, Misty mentioned that they'd been on the road for a year at that point. I saw some recent episodes, and Ash looks nearly identical to when he first started as a trainer. Normally I'd attribute that to cartoon sitcom logic, where the characters never age; but in a series with continuity and references to earlier seasons, this makes no sense. What's the official word on a timeline for the Pokemon anime?", "One thing that seems to be missing in the Top&nbsp;Bar is a link to the Stack&nbsp;Exchange portal. It only displays under the \"Current&nbsp;Community\" section when you are in the community, but it disappears as soon as you go to another one. Would it be possible to add a link that would always be there no matter which community you are currently on?", "How to use siunitx with non numerical values? I understand that something like \\SI{5}{\\meter\\per\\second} defines a certain space between the number (5) and units (m/s). What should I use if instead of a numerical quantity I want a variable: R m/s? \\SI{R}{\\meter\\per\\second} fails because it expect a number in first parameter, and R \\si{\\meter\\per\\second} or $R$ \\si{\\meter\\per\\second} show different space. Which is the correct use? \\documentclass{standalone} \\usepackage{siunitx} \\sisetup{per-mode=symbol} \\begin{document} \\begin{tabular}{r} \\SI{5}{\\meter\\per\\second}\\\\ $R$ \\si{\\meter\\per\\second}\\\\ R \\si{\\meter\\per\\second}\\\\ \\end{tabular} \\end{document}", "Mobile SE sites not allowing edits to edits When you have less than 2K rep and your edit goes in a queue, you are usually allowed to revise your edit while it is being reviewed, by clicking the edit button again on the question page. However, when on mobile SE sites, the edit button disappears when you have submitted an edit for review. Editing by into the question: It seems that the cause of this is when the mobile site hides the edit link (when there is a pending edit), it doesn't check who is making the edit, which means that it hides it for your own as well as other's edits.", "Limit of a function with powers (L'Hopital doesnt work) I have a little problem with limit of this function: $\\lim_{x \\to \\infty} x^2(2017^{\\frac{1}{x}} - 2017^{\\frac{1}{x+1}})$ I have tried de L'Hopital rule twice, but it doesn't work. Now I have no idea how to do it.", "In some books the word \"if\" is used in definitions and it is not clear if they actually mean \"iff\" (i.e \"if and only if\"). I'd like to know if in mathematical literature in general \"if\" in definitions means \"iff\". For example I am reading \"Essential topology\" and the following definition is written: In a topological space $T$, a collection $B$ of open subsets of $T$ is said to form a basis for the topology on $T$ if every open subset of $T$ can be written as a union of sets in $B$. Should I assume the converse in such a case? Should I assume that given a basis $B$ for a topological space, every open set can be written as a union of sets in $B$? This is just an example, I am not asking specifically about this sentence.", "Conditional typesetting / build Let's say I have .tex file which is a set of problems and solutions, of which I want to make two pdf files, one which includes the solutions and one which doesn't. so I need to build the .tex file under two different modes, and specify that parts of the document be ignored under one of the modes. This is something common in programming context. e.g. in C++ i can code #ifdef DEBUG // do this additional stuff ... #endif How can I do something equivalent in latex?", "There is a problem with my logic and I cannot seem to point out where. There's a rocket ship travelling at close-to-c speed v without any acceleration (hypothetically), and there is an observer AA with a clock A on Earth, and there's another observer on the rocket BB with a clock B and these two clocks were initially in sync when the rocket was at rest with a FoR (frame of reference) attached to Earth. Now, this rocket's moving and AA tells us that B is running slower than A by a factor of$$ \\gamma = 1 /(1-v^2/c^2)^{1/2} $$ $$ t_A/t_B = \\gamma $$ where v is the relative 1d- velocity between the two i.e the earth and the rocket! That would mean the time elapsed on A is greater than that on B but this will happen only in the FoR of AA? So $t_B$ in this equation must be the time on B as observed by AA? Is this correct? What do the terms mean in the equations? If the symmetry holds and BB doesn't accelerate, then BB could say that $$ t_B/t_A = \\gamma $$ right? where $t_B$ and $t_A$ are the times on B and A with respect to FoR of BB? But I was solving this problem and I took the earth FoR of A, but the prof took the rocket FoR of B? Like how will I know which FoR to solve the problem from? It'd greatly help if the terms in all the above equations were laid down neatly! DO we even need these FoRs?? Because in all the solved problems the prof is't specifying any and is using random ones! Please help!!!! This is the question where I messed up. The first rocket bound for Alpha Centauri leaves Earth at a velocity (3/5)c. To commemorate the ten year anniversary of the launch, the nations of Earth hold a grand celebration in which they shoot a powerful laser, shaped like a peace sign, toward the ship. According to Earth clocks, how long after the launch (of the rocket) does the rocket crew first see the celebratory laser light? This must be 25 years. My reasoning is: If v = 3c/5 10v + vt = ct where t is time taken by the light to reach the rocket from Earth as calculated from Earth.. and I solved that for t. and added 10 years to that because the time starts at the launch of the rocket! According to clocks on the rocket, how long after the launch does the rocket crew first see the celebratory laser light? This is 20 years. Here, I say: If it takes 25 years as observed by clocks on earth for the laser to reach the rocket, what should be the corresponding time as seen on a clock on the rocket? Using the formula: 25 = $\\gamma$t where $\\gamma$= 5/4 solved for t! According to the rocket crew, how many years had elapsed on the rocket's clocks when the nations of Earth held the celebration? That is, based on the rocket crews' post-processing to determine when the events responsible for their observations took place, how many years have passed on the rocket's clocks when the nations of Earth hold the celebration? For this, I did the following: 10 years on earth = T years on rocket ship where T must be lesser than 10 as observed from Earth FoR! Therefore, T= 4(10)/5 years = 8 years! But, prof says, 10 years on Earth = T years in rocket ship where T must be GREATER than 10 as observed from the rocket FoR??? Therefore, T = 10(5/4) years = 12.5 years!! What does this question actually want?", "How do I add new wallpapers? I have Ubuntu 11.10 installed and want to download and install additional wallpapers on my desktop. How do I do this?", "variable access outside of if statement", "How to edit 'etc/hosts' file in non-rooted phone? I'm using LineageOS 14.1 and don't want nor need to root it. How can I remount /system rw and edit /system/etc/hosts? All answers in \"\" expect a rooted phone.", "Matlab - Function taking no arguments within a class", "my 4 week old daughter will not stop crying. We've tried everything from sucking, both on pacifiers and fingers to breastfeeding, white noise, movement, diaper is clean she doesn't seem to have a fever. We've tried everything we can read about and think of. We are both a little bit ill, the common cold and the baby may have gotten it and be upset but we are just at the end of our nerves when nothing helps our poor little one! Does anyone know anything we can do to help?", "Is better healthcare a bane to the long-term survival of the human race? The theory of natural selection has it that individuals with better genes tend to survive and reproduce, passing their genes to their offspring. This gradual process results in a population more adapted at survival. However, due to the advancement in medical science, humans with poorer genes tend to survive and reproduce just as well. For example, in the past, many people, excluding those with natural immunity due to some genetic mutations, would have succumbed to illnesses such as malaria and typhoid. But with better hygiene and medical treatment, these patients tend to survive. Now, imagine a future where all illnesses including cancer can be treated. How would it impact the survival of the human race? Would we become more and more vulnerable such that our survival hinges heavily on medical technology, analogous to how an astronaut's survival is dependent on his spacesuit?", "Retrieve Force.com registered domain" ]

[ "mysql database no space available", "Is it possible to make my laptop's screen act as a second monitor for my desktop computer?", "The age of the universe Many times I have read statements like, \"the age of the universe is 14 billion years\" . For example this wikipedia page . Now, my question is, which observers' are these time intervals? According to whom 14 billion years?", "Does a car use friction to move?", "Beamer: change header background color I have decided to switch from Powerpoint to Beamer, and for my first presentation I'd like to use the , and the same colors as in this goggle slide template: . I tried to do some research about it, the closest answers I found are the question and the . I tried this code: \\documentclass{beamer} \\usepackage[frenchb]{babel} \\usepackage[T1]{fontenc} \\usepackage[utf8]{inputenc} \\usetheme{metropolis} \\definecolor{bluegreen}{rgb}{3, 166, 155} \\definecolor{pitchblack}{rgb}{0, 0, 0} \\definecolor{lightbeige}{rgb}{255, 251, 241} \\definecolor{mediumgray}{rgb}{183, 183, 183} \\setbeamercolor{background canvas}{bg=pitchblack} \\setbeamercolor{normal text}{fg=lightbeige} \\setbeamercolor{headline}{bg=bluegreen, fg=mediumgray} \\begin{document} \\begin{frame} \\frametitle{The title} Lorem ipsum... \\end{frame} \\end{document} I does everything I want, except that the title bar's background color is lightbeige: What did I do wrong? Or what argument should I pass to \\setbeamercolor to get it right? Thanks in advance :-).", "I'm missing all the usual processing tools in the Vector menu in QGIS 2.16 (eg vector overlay, analysis, etc). They do appear in the processing toolbox but there's no sign of them in the Vector menu. Has anyone come across this issue?", "Registering a domain name with a trademark in it", "Deleted object would be re-saved by cascade (remove deleted object from associations)", "Is there any \"superlogarithm\" or something to solve $x^x$? Is there any \"superlogarithm\" or something to solve an equation like this: $$x^x = 10?$$", "In classical statistics, there is a definition that a statistic $T$ of a set of data $y_1, \\ldots, y_n$ is defined to be complete for a parameter $\\theta$ it is impossible to form an unbiased estimator of $0$ from it nontrivially. That is, the only way to have $E h(T (y )) = 0$ for all $\\theta$ is to have $h$ be $0$ almost surely. Is there a intuition behind this? Is seems like a rather mechanical way of defining this, I am aware this has been asked before, but was wondering if there was a very easy to understand intuition that would make introductory students have an easier time digesting the material.", "Flagged emails keep returning and won't synchronize between Apple Mail and Gmail I've had this problem before and can't recall how I managed to fix it last time. I use Apple Mail to access my Gmail and normally flagged emails show up correctly. Starred emails in Gmail equate to flagged emails in Apple Mail and I can unflag an email in either Gmail or Apple Mail and it works. But now I've got four emails that I can't unflag. They're not flagged in Gmail at all (although they used to be). When I see them in the Flagged folder in Apple Mail, they don't even have flag icons next to them but they're still counted in the number showing next to \"Flagged\". If I manually re-flag them and then unflag them, they disappear from the Flagged box. But then if I click into Inbox and then back into Flagged they show up again. Any ideas about how to make these guys disappear for good?!", "Is there a *simple* example showing that uncorrelated random variables need not be independent?", "Can we move \"Start a bounty\" to a more intuitive location?", "Combined flair not updating with badges I've got 28 bronze badges on Stack Overflow, 10 on Astronomy and 15 on Software Recommendations, making it a total of 53. Yet, my combined flair doesn't show that. It just shows the combined badges from my SO and Astronomy SE sites. The reputation has no problem. I can see the correct combined rep. Why is it happening? Is it because Software Recommendations is in private beta? Here are the flairs (Combined and that from Software Recommendations): The rep on my combined flair is the sum total of my rep from all three sites. But the badges aren't.", "UnboundLocalError on local variable when reassigned after first use The following code works as expected in both Python 2.5 and 3.0: a, b, c = (1, 2, 3) print(a, b, c) def test(): print(a) print(b) print(c) # (A) #c+=1 # (B) test() However, when I uncomment line (B), I get an UnboundLocalError: 'c' not assigned at line (A). The values of a and b are printed correctly. This has me completely baffled for two reasons: Why is there a runtime error thrown at line (A) because of a later statement on line (B)? Why are variables a and b printed as expected, while c raises an error? The only explanation I can come up with is that a local variable c is created by the assignment c+=1, which takes precedent over the \"global\" variable c even before the local variable is created. Of course, it doesn't make sense for a variable to \"steal\" scope before it exists. Could someone please explain this behavior?", "\"need to do\" vs \"need do\" Consider: I need to do this. I need do this. My English grammar knowledge tells me that &quot;need&quot; doesn't have the same status as the modal verbs &quot;may&quot;, &quot;can&quot;, &quot;should&quot; and what not. Hence the second usage where two verbs appear consecutively is incorrect. But yesterday, my native English speaking friends (Americans) told me that &quot;I need compute this.&quot; is a perfectly grammatical sentence, and one is simply omitting the &quot;to&quot;. How can this be? Is it a colloquial usage but grammatically incorrect, or is it grammatically correct? If it is grammatically correct, is it because &quot;need&quot; is a semi-modal verb? EDIT: in particular, is it okay to use &quot;need compute&quot; in a scientific paper? EDIT2: the exact phrase that raised the question was &quot;The advantage of this representation is that we need only compute sums and products&quot;", "I keep hearing a lot about functors in C++. Can someone give me an overview as to what they are and in what cases they would be useful?", "Prove that all cyclic groups of the same order are isomorphic I want to prove that 2 cyclic groups of the same order are always isomorph. So, let $G,H$ be cyclic groups with $|G| = |H|$. Then: I suspect the isomorphism would be the one that maps a generator g to a generator h. Thus, consider this function: $f: G \\rightarrow H$ defined by $f(g^k) = h^k$. I already showed that this mapping is surjective and a homomorphism, but I get stuck at the injectivity part. Can someone give a hint (my attempts: I tried to deduce whether the kernel is $e_G$ and I also used the definition of injectivity but I got stuck in both approaches)?", "Gamma Distribution out of sum of exponential random variables", "Checking via ArcPy if ArcMap is in edit session?" ]

[ "A certain element which makes functionals positive Suppose $X$ is a possibly non-separable Banach space and let $X^*$ be its dual. Also, let $(f_n)_{n=1}^\\infty$ be a sequence of [EDIT: linearly independent] norm-one functionals in $X^*$. Does there exist an element $x\\in X$ such that $f_n(x) \\in (0,\\infty)$ for all $n$?", "I am trying to pass a member function within a class to a function that takes a member function class pointer. The problem I am having is that I am not sure how to properly do this within the class using the this pointer. Does anyone have suggestions? Here is a copy of the class that is passing the member function: class testMenu : public MenuScreen{ public: bool draw; MenuButton&lt;testMenu&gt; x; testMenu():MenuScreen(\"testMenu\"){ x.SetButton(100,100,TEXT(\"buttonNormal.png\"),TEXT(\"buttonHover.png\"),TEXT(\"buttonPressed.png\"),100,40,&amp;this-&gt;test2); draw = false; } void test2(){ draw = true; } }; The function x.SetButton(...) is contained in another class, where \"object\" is a template. void SetButton(int xPos, int yPos, LPCWSTR normalFilePath, LPCWSTR hoverFilePath, LPCWSTR pressedFilePath, int Width, int Height, void (object::*ButtonFunc)()) { BUTTON::SetButton(xPos, yPos, normalFilePath, hoverFilePath, pressedFilePath, Width, Height); this-&gt;ButtonFunc = &amp;ButtonFunc; } If anyone has any advice on how I can properly send this function so that I can use it later.", "Induction and electromagnetic fields I've got a few questions on induction and electromagnetic fields. My current understanding of induction and electromagnetic fields is that, when electricity/current flows through a wire, it creates an electromagnetic field. If you twist that wire into a coil then you can concentrate that field. You can then induce current into a different coil by placing it inside of the electromagnetic field created by the first coil. So here are my questions: Q1. Does the electromagnetic field contain any energy? EDITED QUESTION Q2. Electromagnetic fields are the same as waves, so does that mean that when current is induced, they get the energy from electromagnetic waves being exchanged, or do they induce current directly from the electromagnetic field? Q3. If electromagnetic fields and waves are the same, then doesn't that mean that you can induce current from waves? Therefore transferring electricity over long distances? Q4. What spectrum of light are the electromagnetic waves that are in a field created by electricity? Q5. Finally, why is it not possible to induce current from the Earth's magnetic field? I thought Maxwell said that electric fields and magnetic fields were the same thing. Thank you to anyone who answers. Edited Q2: So my original question (although asked poorly) still stands. Where does the current that gets induced in the secondary coil come from? How does the electricity transfer from the primary coil to the secondary? For example, is it taken from the stored energy in the e.m field? Does the field just act as a bridge between the 2 coils? Or do the 2 coils exchange e.m waves which carry the electricity that is being transferred from coil 1 to coil 2? Or is it none of these things and something completely different?", "How can I stand on the ground? EM or/and Pauli? There is this famous example about the order difference between gravitational force and EM force. All the gravitational force of Earth is just countered by the electromagnetic force between the electrons on the surface of my feet and the ground. But also wave-function of electrons(fermions) do not overlap each other due to Pauli exclusion principle. So which one is the true reason of me not flopping inside the earth forever? Is it only one of them(my guess is Pauli exclusion) or is it both?", "What does string theory predict for the singularity inside a black hole? The usual explanation for what's going on inside a black hole goes something like \"General Relativity predicts a singularity with infinite curvature, but when matters gets so tightly compressed we should expect quantum effects to become important, so the singularity will probably be blurred\". Authors then proceed to say that we need a quantum theory of gravity to answer such things, and quickly abandon the subject. Well, while we don't have an experimentally confirmed quantum theory of gravity, we do have a speculative one, string theory. What does it say about singularities? Are they smeared out like the books say? Do they remain points (or rings for a rotating black hole) with infinite curvature and density? Do we not know?", "I'm looking to implement a phase lock in an FPGA without using any external components (other than the ADC). For simplicity locking to a simple binary pulse is adequate. The frequency of the signals is ~0.1-1% of the clock. I can't use the onboard clock PLL's because they are typically: Not configurable (set during synthesis). Jittery. Don't support the frequency I need. I've been sorting through the literature and found a few binary phase locked loops. Most notable a \"pulse steal\" design that I can post a link to if desired. I have implemented and synthesized with some success, but its jitter and lock range was not as good as advertised. I've also had success using a external DVCO, but I would prefer if I can implement everything on chip. A digital circuit design or even a hint in the right direction would be helpful (I've been banging my head against this for a while), a proven FPGA implementation would be wonderful but not expected. ADDED 10-27-2010 The actual DPLL design that I used has a \"Random Walk Filter\" as the loop filter (not the \"pulse steal\" described earlier, going through my notes that didn't work to well), which then drives the clock pulses to the DCO. The lock-in range is set via divider in the DCO. The sensitivity of the loop is established by varying the length of the random walk. The paper in which this is found is cited at the end of this post. After implementing parts of it myself, I found that it was actually already implemented on OpenCores, however it turns out that in the last few months the project was deleted but I have the Verilog files saved if anyone wants them. Yamamoto, H.; Mori, S.; , \"Performance of Binary Quantized All Digital Phase-Locked Loop with a New Class of Sequential Filter,\" Communications, IEEE Transactions on , vol.26, no.1, pp. 35- 45, Jan 1978 doi: 10.1109/TCOM.1978.1093972 URL:", "Let $x_1,x_2,\\ldots,x_n$ be the roots for $1+x+x^2+\\ldots+x^n=0$. Find the value of $$P(1)=\\frac{1}{x_1-1}+\\frac{1}{x_2-1}+\\ldots+\\frac{1}{x_n-1}$$ Source: IME entrance exam (Military Institute of Engineering, Brazil), date not provided (possibly from the 1950s) My attempt: Developing expression $P(1)$, replacing the 1 by $x$, follows $$P(x)=\\frac{(x_2-x)\\cdots (x_n-x)+\\ldots+(x_1-x)\\cdots (x_{n-1}-x)}{(x_1-x)(x_2-x)\\cdots (x_n-x)}$$ As $x_1,x_2,\\ldots,x_n$ are the roots, it must be true that $$Q(x)=(x-x_1)\\cdots(x-x_n)=1+x+x^2+\\ldots+x^n$$ and $$Q(1)=(1-x_1)\\cdots(1-x_n)=n+1$$ Therefore the denominator of $P(1)$ is $$(-1)^{n} (n+1).$$ But I could not find a way to simplify the numerator. Another fact that is probably useful is that $$1+x^{n+1}=(1-x)(x^n+x^{n-1}+\\ldots+x+1)$$ with roots that are 1 in addition of the given roots $x_1,x_2,\\ldots,x_n$ for the original equation, that is $$x_k=\\text{cis}(\\frac{2k\\pi}{n+1}),\\ \\ k=1,\\ldots,n.$$ This is as far as I could go... Hints and full answers are welcomed.", "Does a four-divergence extra term in a Lagrangian density matter to the field equations? Greiner in his book \"Field Quantization\" page 173, eq.(7.11) did this calculation: ${\\mathcal L}^\\prime=-\\frac{1}{2}\\partial_\\mu A_\\nu\\partial^\\mu A^\\nu+\\frac{1}{2}\\partial_\\mu A_\\nu\\partial^\\nu A^\\mu-\\frac{1}{2}\\partial_\\mu A^\\mu\\partial_\\nu A^\\nu $ $\\space\\space\\space\\space=-\\frac{1}{2}\\partial_\\mu A_\\nu\\partial^\\mu A^\\nu+\\frac{1}{2}\\partial_\\mu[A_\\nu(\\partial^\\nu A^\\mu)-(\\partial_\\nu A^\\nu) A^\\mu]$ The last term is a four-divergence which has no influence on the field equations. Thus the dynamics of the electromagnetic field (in the Lorentz gauge) can be described by the simple Lagrangian ${\\mathcal L}^{\\prime\\prime}=-\\frac{1}{2}\\partial_\\mu A_\\nu\\partial^\\mu A^\\nu$ Yes, if it is a four-divergence of a vector whose 0-component doesn't contain time derivatives of the field, indeed according to the variational principle this four-divergence will not influence the field equation. And actually I calculated the time-derivative dependence of 0-component of $[A_\\nu(\\partial^\\nu A^\\mu)-(\\partial_\\nu A^\\nu) A^\\mu]$, in which only $[A_0(\\partial^0 A^0)-(\\partial_0 A^0) A^0]$ could possibly contain time-derivative, which vanishes fortunately, so whatever the general case it doesn't matter in this present case. But how can he seem to claim that it holds for a general four-divergence term,The last term is a four-divergence which has no influence on the field equations? EDIT: I only assumed the boundary condition to be $A^\\mu=0$ at spatial infinity, not at time infinity. And the variation of the action $S = \\int_{t_1}^{t_2}L \\, dt$ is due to the variation of fields which vanish at time, $\\delta A^\\mu(\\mathbf x,t_1)=\\delta A^\\mu(\\mathbf x,t_2)=0$, not having the knowledge of $\\delta \\dot A^\\mu(\\mathbf x,t_1)$ and $\\delta \\dot A^\\mu(\\mathbf x,t_2)$, which don't vanish generally, so the four-divergence term will in general contribute to the action, $$\\delta S_j=\\delta \\int_{t_1}^{t_2}dt\\int d^3\\mathbf x \\partial_\\mu j(A(x),\\nabla A(x),\\dot A(x))^\\mu =\\delta \\int_{t_1}^{t_2}dt\\int d^3\\mathbf x \\dot j^0 =\\int d^3\\mathbf x [\\delta j(\\mathbf x, t_2)^0-\\delta j(\\mathbf x, t_1)^0]$$ which does not vanish in general!", "I am searching for [free] software that can produce nice looking graphical models, e.g. Any suggestions would be appreciated.", "Gravatar links on \"Filtered Questions\" page are not HTTPS", "Referencing equation counter value in custom float caption I have used the float package to create an equation float, eqfloat, so I can add captions to equations. Within the eqfloat I used the equation environment to typeset the math. I want to keep the right hand arabic numbering within parentheses that is added by the equation environment but I also would like the eqfloat caption below the equation to use the same number as the equation environment. The following code achieves this by making the eqfloat use the same counter as the equation environment and then manually adjusting the equation numbering within each eqfloat. Is there a better way to make the eqfloat caption reference the current value of the equation environment counter? Is it possible to prevent the custom float environment from increasing the counter and only to reference the current value of the equation counter? \\documentclass[a4paper]{article} \\usepackage[margin=25pt, labelfont=bf]{caption} \\usepackage{amsmath, amsfonts, pifont, float, color, url} \\usepackage[pdftex, plainpages=false, pdfpagelabels, bookmarks=true]{hyperref} \\newfloat{eqfloat}{h}{eqflts} \\floatname{eqfloat}{Equation} \\makeatletter \\let\\c@eqfloat\\c@equation \\makeatother \\begin{document} ... \\begin{eqfloat} \\begin{equation} E = mc^2 \\end{equation} \\addtocounter{equation}{-1} \\caption{Equation caption here.} \\label{eq:example} \\end{eqfloat} \\end{document}", "Export Track Markers to csv I am trying to export markers from the Blender motion tracker and found the following script that will do exactly that: for clip in D.movieclips: for track in clip.tracking.tracks: fn = 'data/tr_{0}_{1}.csv'.format(clip.name.split('.')[0], track.name) with open(fn, 'w') as f: frameno = 0 while True: markerAtFrame = track.markers.find_frame(frameno) if not markerAtFrame: break frameno += 1 coords = markerAtFrame.co.xy f.write('{0} {1}\\n'.format(coords[0], coords[1])) It works but I have two questions: How can I save the data on my Desktop rather than in folder in MacOS blender content where it saved right now. The following won't work: fn = '/User/me/Desktop/data/tr_{0}_{1}.csv'.format(clip.name.split('.')[0], track.name) The resulting values I get do not represent the more user friendly marker values in den Blender GUI. Instead of x/y coordinates in screen coordinates, I get a value between 0/1. How can I convert them to those screen coordinates ? Thanks for your help", "Android: Overlay on Android Camera Preview", "Passing list to viewparams variables in GeoServer SQL views?", "I just can't seem to figure this one out. I want to use the command line to connect to a MySQL database residing on another server. I went ahead and created the username and password for the user. I have also granted all privileges on that user for that database. When using the command: mysql -h &lt;hostname&gt; -u &lt;username&gt; -p, I get the following error: ERROR 1045 (28000): Access denied for user '&lt;username&gt;'@'&lt;local_machine_hostname&gt;' (using password: YES) The problem is that it keeps appending the current machine's hostname into the username. Obviously, that user@&lt;local_machine_hostname&gt; is not correct. It doesn't matter what I type. For instance, if I type: mysql -h &lt;hostname&gt; -u '&lt;username&gt;'@'&lt;hostname&gt;' -p It does the same, only in the error output, it says: Access denied for user '&lt;username&gt;@&lt;hostname&gt;'@'&lt;local_machine_hostname&gt;' Is there a setting in a configuration file which is allowing this to happen? It's really quite annoying. I need to set up a tikiwiki server, and it cannot connect because during the step where you set up mysql, it keeps appending the local machine's hostname to the mysql login name.", "Electromagnetic wave properties of light vs radio waves", "I'm trying to determine if there is a best practice for typesetting the \"evaluated at\" bar for derivatives. The three possibilities I'm thinking of are shown in the code excerpt below: \\begin{gather*} 5 + \\frac{df}{dt} \\Bigr\\rvert_{t = 0} \\\\ 5 + \\frac{df}{dt} \\biggr\\rvert_{t = 0} \\\\ 5 + \\left. \\frac{df}{dt} \\right\\rvert_{t = 0} \\\\ \\end{gather*} The \\Bigr option doesn't quite reach the top and bottom of the fraction. The \\biggr option overshoots the top and bottom of the fraction by a little bit. And the \\left...\\right option has the same height as the \\biggr option, but it introduces a little extra space between the + and the fraction. I'm having trouble deciding between these options. Is there a best practice for typesetting this?", "LibreOffice toolbar icons went blank after application hanged", "Cannot login to chat.meta.stackexchange.com; server error when trying to access chat homepage I just recreated my MSE account after having deleted it a few years ago. Now, I'm trying to log in to Meta Stack Exchange Chat, and whenever I try to do so, it just fails silently and I'm still logged out. Additionally, in the same browser session that I'm supposedly logged out, I get a server error when accessing the chat homepage or the chat profile page of any user. I don't get any errors when trying to access any of these pages in a private session. I also was able to sign in to Stack Exchange Chat and Stack Overflow Chat without problems, since my accounts on SO and my parent site for SE chat haven't been deleted. I think it might be because it's trying to sign me in to my old chat profile, which was not deleted, but that is associated to my old, deleted site account, which clash and thus cause it to fail.", "But when I try to run it using tar zxvf jre-8u151-linux-i586 I get tar (child): jre-8u151-linux-i586: Cannot open: No such file or directory tar (child): Error is not recoverable: exiting now tar: Child returned status 2 What is wrong? The name and place matches prefectly." ]

[ "How can I create a /dev/null-like \"blackhole\" directory? I would like to create a \"/dev/null\" directory (or a \"blackhole\" directory) such that any files written to it are not really written, but just disappear. I have an application that writes out large temporary files to a directory. I have no control over the name of the files and I don't really care about the content of these files. I could write a script that periodically clobbers these files, but the files are written out very quickly and fill my disk. I'm looking for something cleverer. I want the application to \"think\" that it is writing out these files, when in fact, the writes are just being discarded at the other end. Also see old related thread.", "$4x^2+1$ factors only into $4y+1$ primes", "Proof that Limit of the Log is the Log of the Limit Proof that Limit of the Log is the Log of the Limit. What is the intuition behind this statement?", "What is the difference between CentOS \"DVD\" vs \"Everything\" ISOs", "Listing feature classes with active domains?", "I think it would be very useful. I have a question that I have an open bounty on. Putting up said bounty brought my reputation below the point where I am allowed to comment on other peoples' posts. It's so frustrating not to be able to comment and give feedback on the answers given! Especially since it would be helpful, for them, me, and the readers, to know particularly what is good and isn't good about their answer, and therefore give some better guidelines to future answerers on how they can win the bounty.", "Syntax highlighting language hints Do you think it would be worthwhile to provide hints as to what language to use for the syntax highlighting? Sometimes I find the highlighting on SQL or VB.NET answers is more distracting than helpful; for example: to pick the two I've been looking at recently.", "How to reinstall kernels after accidental deletion with a separate boot partition and an encrypted LVM volume?", "How do I choose what shows up in PuTTY title bar from Linux? In the PuTTY configuration there's an option in Terminal &rarr; Features called Disable remote-controlled window title changing. Without that enabled, the title bar of PuTTY will change every time I press return in the console. I was thinking it'd be a more clean solution to set the title bar text from Linux than to specify one for every PuTTY client I have laying around. So where can I modify what Linux sets as the window title? $ uname -a Linux drevo 2.6.32-5-amd64 #1 SMP Mon Jan 16 16:22:28 UTC 2012 x86_64 GNU/Linux $ cat /etc/debian_version 6.0.4", "I asked that turned out to have multiple correct answers. How do I pick between them to determine which to accept? All of the answers were different. They were not the same answer given multiple times.", "Disable password access through SSH? I'm setting up a server for backing up my desktop box remotely. I want to prevent remote password access to the server, permitting only users with private keys (AKA my desktop box) to access it. How can I block remote password access while allowing physical password access to the server?", "I'm fairly new to DMing and so is my group, so we are all on a learning curve together. We're playing D&amp;D 5e. Last week a fighter in our group tamed a wolf with Animal Handling and then requested that he keep the wolf. I allowed this, but now I'm not sure about how to play the wolf. Specifically, how can he train the wolf to perform certain actions such as attacking? What other things might I need to be aware of with a PC owning a \"pet\"?", "How come such different methods result in the same number, $e$? I guess the proof of the identity $$ \\sum_{n = 0}^{\\infty} \\frac{1}{n!} \\equiv \\lim_{x \\to \\infty} \\left(1 + \\frac{1}{x}\\right)^x $$ explains the connection between such different calculations. How is it done?", "My motherboard currently supports both SATA II and III (3 Gb/s and 6Gb/s respectively), but after reading some online, it seems as though connecting a HDD to the 6 Gb/s is pretty much pointless. If this is the case I'm going to leave my two SATA III ports open for something that can actually use it (which at this point I'm not really sure what can). This is part of an article I read: In terms of everything else, we saw basically no difference from the same single drive being plugged into a SATA 6Gb/s or SATA 3Gb/s port. All of this is obviously due to the hard drive not being able to actually take advantage of the 6Gb/s bus. from .", "Most MTP () devices show up in Windows File Explorer under their device name or a GUID, but they don't have a drive letter assigned. How can I access the files on such devices from the command line? Using either cmd.exe or PowerShell.", "Correct use of will & would? What would be the correct use of will &amp; would in these sentences? 1) What will happen if I say to my boss that I will not come tomorrow? 2) What will happen if I would say to my boss that I will not come tomorrow? 3) What will happen if I will say to my boss that I will not come tomorrow? 4) What would happen if I would say to my boss that I will not come tomorrow? There are four sentences which one should I use and in which situation?", "How to create a Facebook page without a personal account In the past, Facebook used to let business create pages or apps without a personal account. This account created in the page/app creation process had limited capacities and could be switch to a full personal account after—if needed (irreversible). But today, if I want to create a page for a new brand, without having a Facebook account, it seems I can’t anymore. And I can’t find any communication from Facebook regarding this change. Anybody has any info? Is it still possible (in a new way maybe)?", "Theme Image Style for image located in module directory Probably coming at this from too much of a Drupal 6 view point but... How do I theme an image in a given image style when that image lives in a module folder? This is driving me batty and I know I'm just missing something simple. Here is some example code showing what I'm trying to do: $file_uri = 'public://sites/all/modules/my_module/logo.jpg'; $data['logo'] = theme('image_style', array('style_name' =&gt; 'medium', 'path' =&gt; $file_uri)); Even if I use file_build_uri(), I end up with a path to a file that doesn't exist. If I move the image to the files directory and change the $file_uri to 'public://logo.jpg', it works just fine. Do I need to copy the image to the files directory as part of the module code? If so, isn't this ridiculous? What am I missing? Is there documentation on how to do something like this? I've spent over an hour mining the Drupal documentation and came up completely dry.", "How to parse a date?", "After I deleted my Ubuntu partition, I rebooted my computer and I only get a prompt: grub rescue &gt; The command ls lists (hd0) (hd0,msdos5) (hd0,msdos3) (hd0,msdos2) (hd0,msdos1) (hd1) (hd1,msdos1) I check them one by one: ls (hd0,msdos5)/ ls (hd0,msdos1)/ But I cannot find the right partition." ]

[ "integral of $\\int_{0}^{1}\\frac{\\ln(x^{2}+1)}{x+1}dx$ using contour integration? I have an interest in contour integration. I am not that good at it, but I enjoy learning what I can about it. Here is a version of a rational log integral rarely encountered. $\\displaystyle \\int_{0}^{1}\\frac{\\ln(x^{2}+1)}{x+1}dx=\\frac{3}{4}\\ln^{2}(2)-\\frac{{\\pi}^{2}}{48}$ I can do this using real methods (via double integral and substitution). I can post my workings if anyone would be interested. My question is, can this be evaluated using contour integration due to the limits being $[0,1]$ instead of $[0,\\infty)$?. Contours may not be the most efficient way to go about it, but what is the course of action when the limits are 0 to 1 instead of 0 to infinity?.", "Why does a RegExp with global flag give wrong results?", "Setting PATH variable in /etc/environment vs .profile Where is the preferred place to set the PATH envvar? ~/.profile or /etc/environment? What is the case when PATH is set in both places? Is the end result a concatenation of both values set in those two places?", "How can I find the right lens cap for my lens? I own a Nikon D3000 Camera with the AF-S 18-55mm VR Kit Lens. Last week I lost the lens cap and now I want to buy a new one. But when I went to , I got confused with the different ranges of lens names — LC-62, LC-78, etc. My concern is what if I order one lens cap and it won't fit correctly on my lens? If you guys have an D3000, can you please let me know how to find the correct lens cap names?", "Prove that $\\int_0^\\infty \\frac{x\\,\\log x}{(1+x^2)^2} = 0$ I have been asked to prove that $$\\int_0^\\infty \\frac{x\\,\\log x}{(1+x^2)^2}\\,dx = 0$$ I tried proceeding as follows: \\begin{align} \\int_0^\\infty \\frac{x\\,\\log x}{(1+x^2)^2}\\,dx &amp;= \\int_0^1 \\frac{x\\,\\log x}{(1+x^2)^2}\\,dx + \\int_1^\\infty \\frac{x\\,\\log x}{(1+x^2)^2}\\,dx \\\\ &amp; = \\int_0^1 \\frac{x\\,\\log x}{(1+x^2)^2}\\,dx + \\int_{u=1}^0 \\frac{u\\,\\log u}{(1+u^2)^2}\\,du\\quad (\\text{where }u=1/x) \\\\ &amp;= \\int_0^1 \\frac{x\\,\\log x}{(1+x^2)^2}\\,dx - \\int_0^1 \\frac{u\\,\\log u}{(1+u^2)^2}\\,du \\\\ &amp;=^? \\int_0^1 0 \\,dx \\\\ &amp;= 0 \\end{align} But I think that I should first show that the improper integral $\\int_0^1 {x\\,\\log x}/{(1+x^2)^2}\\,dx$ is convergent. Do I need to show it? If yes, how to do so? (I have been taught basic methods such as comparison, limit comparison and Dirichlet test.)", "Derivation of survival copula $$ \\begin{align}F(x,y) &amp;= P(X\\leq x, Y\\leq y) \\\\ &amp;= C(F(x), F(y)) \\end{align}$$ The copula of a bivariate distribution is equal to its CDF, $C(u,v) = F(x,y)$. The density of the data's CDF therefore can be expressed as $$f(x,y) = c(u,v) \\times f_X(x) f_Y(y)$$ where $c(u,v)$ is the copula density and $f_X(x)$ is a marginal. If $\\hat{C}(u,v)$ is the survival copula for determining $$ \\begin{align}\\bar{F}(x,y) &amp;= P(X&gt; x, Y &gt; y) \\\\ &amp;= \\hat{C}(1-F(x), 1-F(y)) \\end{align}$$ how is the first equation of the ordinary copula, $C(u,v)$, linked to the survival copula as $$\\hat{C}(u,v) = u + v - 1 + C(1-u,1-v)$$ are $u$ and $v$ merely vectors containing the (ranked) observations of the uniform marginals? A derivation in integrals and probabilities (rather than $F$s) would be good.", "Repeatedly rolling a six sided die four times and summing the highest three results gives you a distribution with what mean and standard deviation? Repeatedly rolling a six sided die four times and summing the highest three results gives you a distribution with what mean and standard deviation? I've only taken AP statistics, but I would like to learn how to do this.", "Dual-boot boot menu does not show up after installing Ubuntu 15.10 alongside Windows 10", "Need intuition about independence of events Suppose that we have the situation as depicted in the figure: a random experiment which has 4 outcomes $x_1, ..., x_4$ and two events $A$ and $B$. Also assume that $P(x_i)=0.25$. Now, since $P(A \\cap B) = P(A)P(B) = 0.25$, by definition the events $A$ and $B$ are independent. This does not make sense to me. Why are they independent? Is there an intuitive explanation? Another thing is, suppose that there is a 5th outcome, $x_5$, outside of $A \\cup B$, in that case the events $A$ and $B$ are no longer independent since $P(A \\cap B) \\ne P(A)P(B)$. This result also does not make sense to me.", "Why do C# and Java bother with the \"new\" operator? Why does the exist in modern languages such as C# and Java? Is it purely a self documenting code feature, or does it serve any actual purpose? For instance the following example: Class1 obj = new Class1(); Class1 foo() { return new Class1(); } Is as easy to read as the more Pythonesque way of writing it: Class1 obj = Class1(); Class1 foo() { return Class1(); } EDIT: hit the nail on the head with the clarification of the question: Why did they choose this syntax?", "I am trying to install a Ralink wifi adapter in Ubuntu Desktop 14.04. The system is not detecting the wifi. lsusb lists the device as: Bus 002 Device 004: ID 148f:7601 Ralink Technology, Corp. I have the rt2800 USB driver listed in \"/etc/modules\"; Following some instructions on the web, I tried this command: echo 148F 7601 | sudo tee /sys/bus/usb/drivers/rt2800usb/new_i lsmod | grep rt2800 returns the following: rt2800usb 26581 0 rt2x00usb 20041 1 rt2800usb rt2800lib 83150 1 rt2800usb rt2x00lib 48886 3 rt2x00usb,rt2800lib,rt2800usb mac80211 545990 3 rt2x00lib,rt2x00usb,rt2800lib crc_ccitt 12627 1 rt2800lib", "I am trying to install reaver 1.4, but when I run ./configure ; make I get this message at the end int ret_val = EXIT_FAILURE, r = 0; I have searched a fair bit and cannot find an answer, any help would be appreciated. I apologize if this has been answered and I've just failed to find it.", "Plotting complex numbers as an Argand Diagram", "Why doesn't Mac OS X source ~/.bashrc?", "Checking to see if a user has a licence for a managed package So I'm aware that there is a method on UserInfo called isCurrentUserLicensed which lets you check if the user running the code has a licence for a namespace that you specify, i.e. for a particular managed package. What I want to know is whether there is a way I can test to see if some other user (assume I have their ID) has a licence for a particular package. Has anybody found a way to do this?", "How to get video duration, dimension and size in PHP?", "Should I use \"who\" or \"which\" when referring to a specific animal species? I'd like to know what option to use, specifically when referring to a species by its scientific name.", "Necessary condition for square integrable functions? I'm studying Quantum Mechanics and I came across this which I don't quite understand: For a vector space of functions $f(x)$ to be square integrable (i.e $\\int{|f(x)|^2dx &lt; \\infty)}$, the necessary condition is $\\lim_{|x| \\to \\infty}f(x) \\to 0$. Can someone help me understand why that must be the case? I sort of understand that it must not blow up at the infinities but can a (continuous or piece-wise continuous) function have a non-zero finite value at the infinities and still be square integrable?", "Is it possible/sensible to add a suspension fork to an old mountain bike? I have a ~1993 Giant mountain bike. It's not great, but I am a very new and casual rider. The bike has a solid fork and it makes for the predictable rough trail ride. The trails are generally fairly modest (I live in North Texas, a 100' change in altitude makes our ears pop here) and the surface is generally dirt (very few rocky areas). So, I am thinking that it would be very nice to have a suspension bike. And seeing that a modest fork can be purchased for a modest price, I am wondering if it makes sense to add a fork to this bike. asked about going the other direction, and there were some cautionary words about changing steering geometry. So, on balance, is this something that I would be best off to avoid? I suspect that if I have to replace a bunch of steering parts, the cost will quickly approach that of a new low end bike.", "Consider the curve $\\frac{1}{x}$ where $x \\geq 1$. Rotate this curve around the x-axis. One Dimension - Clearly this structure is infinitely long. Two Dimensions - Surface Area = $2\\pi\\int_∞^1\\frac{1}{x}dx = 2\\pi(\\ln ∞ - \\ln 1) = ∞$ Three Dimensions - Volume = $\\pi\\int_∞^1{x}^{-2}dx = \\pi(-\\frac{1}{∞} + \\frac{1}{1}) = \\pi$ So this structure has infinite length and infinite surface area. However it has finite volume, which just does not make sense. Even more interesting, the \"walls\" of this structure are infinitely thin. Since the volume is finite, we could fill this structure with a finite amount of paint. To fill the structure the paint would need to cover the complete surface area of the inside of this structure. Since the \"walls\" are infinitely thin, why would a finite amount of paint not be able to cover the outside of the \"walls\" too? Please help me make sense of this whole thing." ]

[ "How do I make Units efficiently? I just blew almost all my money on a really cool lookin' ship. How do I regain solvency without spending a lot of time fiddling around in my inventory? At the moment I've found a sequence of steps that'll turn 50 carbon and 100 Plutonium into ~5000 Units (by creating Suspension Fluid and then turning it into Electron Vapor). Are there better recipes or sequences of recipes I should look for? Or should I just drop the whole thing and go mine a particular mineral?", "I'd like to get a list of packages installed manually by apt or aptitude and be able to find out whether a foobar package was installed manually or automatically. Is there any neat way of doing that from the command line?", "The equals() method in Java works unexpectedly on Long data type", "Is there a saying or idiom for \"trying to get the truth from someone by lying\"? context Mary-Ann got home late from school. Asked where she had been, she said she had spent the afternoon at the library. Her father thinks she is lying and says: \"I know you haven’t been there because I was there myself\". He is lying because he thinks she will tell the truth if she realizes she has been caught. boyfriend – “your sister told me everything” (sister did nothing) - girlfriend – “Oh, did she? I’m gonna kill her. The rationale for doing this is to catch someone by surprise so he will admit having lied. Soemtimes, however, the person isn’t lying and the real liar will have to reap the consequences of his reproachable action, having to admit he was just/it was just ...........(saying or idiom).....", "Show that $\\sum_{n = 1}^\\infty n^qx^n$ is absolutely convergent, and that $\\lim_{n \\rightarrow \\infty}$ $n^qx^n = 0$ I'm having trouble with proving the following for my math study: Let $x$ be a real number with $|x| &lt; 1$, and $q$ be a real number. Show that the series $\\sum_{n = 1}^\\infty n^qx^n$ is absolutely convergent, and that $\\lim_{n \\rightarrow \\infty}$ $n^qx^n = 0$ I tried this: $\\sum_{n = 1}^\\infty n^qx^n$ = $x + 2^q + 3^qx^3 + ...$ $= x(1 + 2^qx + 3^qx^2 + ...)$ So far, I don't know how I have to do this, I tried to apply the root test on this, but for that I would need to compute the lim sup of the series, so I thought that was not correct. Could you explain me how to prove this? Thanks in advance!", "Batch renaming files I have a directory full of images: image0001.png image0002.png image0003.png ... And I would like a one-liner to rename them to (say). 0001.png 0002.png 0003.png ... How do I do this?", "Could humans choose to establish fibre digesting colonies in our guts? Humans don't digest fibre, and nor do any animals, but some creatures have micro-organisms (bacteria, I'm guessing) in their gut which digest fibre for them. My question is, could humans take some sort of pill and establish our own fibre-digesting colonies in our intestines? Has this been tried? Supposing it could be done, would you suppose it would have any negative effects on our health? (i.e.. would those whose gut digested fibre for them be stuck on a low-fibre diet?). Purpose of question: just wondering. It would be cool to be able to eat bark.", "Let $X$ be a space that satisfies the hypotheses used to construct a universal cover $\\overline{X}$. Let $\\pi = \\pi_1(X)$ and consider the action of the group $\\pi$ on the space $\\overline{X}$ given by the isomorphism of $\\pi$ with $\\text{Aut}(\\overline{X})$. Let $A$ be an abelian group and let $\\mathbb{Z}[\\pi]$ act trivially on $A$, $a \\cdot \\sigma = a$ for $\\sigma \\in \\pi$ and $a \\in A$. Now, assume that $X$ is a CW complex. How do I see that $\\overline{X}$ is a CW complex such that the action of $\\pi$ on $\\overline{X}$ induces an action of the group ring $\\mathbb{Z}[\\pi]$ on the cellular chain complex $C_*(\\overline{X})$ such that each $C_q(\\overline{X})$ is a free $\\mathbb{Z}[\\pi]$-module and$$C_*(X; A) \\cong A \\otimes_{\\mathbb{Z}[\\pi]} C_*(\\overline{X})?$$", "Show that $\\sum_{n=1}^{\\infty}(n^{3}\\sin\\left(\\frac{1}{n}\\right)-n^{2}+\\frac{1}{6})$ converges Let $t\\in \\mathbb R$. Prove that $\\displaystyle{\\sum_{n=1}^{\\infty}n^{3}\\sin\\left(\\frac{1}{n}\\right)-n^{2}+t}$ converges iff $t=\\frac{1}{6}$. While the $(\\Rightarrow)$ direction was fairly easy (as $a_n$ should converge to $0$, forcing $t=\\frac{1}{6}$), i'm facing some hard time trying to prove the second direction, that is $\\displaystyle{\\sum_{n=1}^{\\infty}(n^{3}\\sin\\left(\\frac{1}{n}\\right)-n^{2}+\\frac{1}{6})}$ converges. I did notice that $a_n=a_{-n}$ and tried to write this series as a Leibnitz series, but had no luck since the sequence doesn't decrease. I also tried to prove absolute convergence but then again, no luck. Thanks.", "How can I make focus follow the mouse cursor?", "Alright, I have been doing the following (variable names have been changed): FileInputStream fis = null; try { fis = new FileInputStream(file); ... process ... } catch (IOException e) { ... handle error ... } finally { if (fis != null) fis.close(); } Recently, I started using FindBugs, which suggests that I am not properly closing streams. I decide to see if there's anything that can be done with a finally{} block, and then I see, oh yeah, close() can throw IOException. What are people supposed to do here? The Java libraries throw too many checked exceptions.", "Let $m$ be a natural number. Define $f(m) = m + \\lfloor\\sqrt{m}\\rfloor$. Prove that at least one of the number among $m, f(m), f^2(m), \\ldots$ is a perfect square. Here $f^k(m)$ denotes the composition of $f$ over itself $k$ times. I tried the question, but the greatest integer along with square root is creating trouble.", "How do I show that all continuous periodic functions are bounded and uniform continuous? A function $f:\\mathbb{R}\\to \\mathbb{R}$ is periodic if there exits $p&gt;0$ such that $f(x+P)=f(x)$ for all $x\\in \\mathbb{R}$. Show that every continuous periodic function is bounded and uniformly continuous. For boundedness, I first tried to show that since the a periodic function is continuous, it is continuous for the closed interval $[x_0,x_0+P]$. I know that there is a theorem saying that if it is continuous on a closed interval, then it is bounded. However, I'm not allowed to state that theorem directly. Should I just aim for a contradiction by supposing f is not bounded on the interval stated above?", "Check differentiability of multivariable functions I am trying to determine if the following functions are (totally) differentiable at $(x,y)=(0,0)$. $$f(x,y)=\\sqrt{\\vert xy \\vert}$$ $$g(x,y)=e^{{{\\vert x \\vert}^3}y}$$ However I am not particularly sure where to start. The concept of the total derivative being the Jacobian matrix makes sense but I don't really understand how to work with functions that may not have a Jacobian matrix. Any help would be greatly appreciated!", "Real numbers equipped with the metric $ d (x,y) = | \\arctan(x) - \\arctan(y)| $ is an incomplete metric space I have to show that the real numbers equipped with the metric $ d (x,y) = | \\arctan(x) - \\arctan(y)| $ is an incomplete metric space. Certainly, I have to search for a Cauchy sequence of real numbers with respect to given metric that must not be convergent. But I am unable to figure out that. Can anybody help me with this. Thanks for helping me.", "Dual Canadian and British citizen - healthcare coverage in the UK? I want to know if I am entitled to medical assistance in the UK while visiting for 3 weeks in June. I am travelling on my Canadian passport since my UK one is outdated.", "After deleting all nodes, how do I reset the node ID to start from 1 again? I generated tons of dummy content for testing, and then deleted them all. As nid is auto-increment, newly created node will have a nid of last created nid +1. How can I make nid start from 1 again?", "Stopping users voting multiple times on a website I'm planning to add some vote up/vote down buttons to a website I run. This seems easy enough but I want to stop people voting multiple times. One solution would be to make them register before allowing them to vote but I'd prefer not to have to force them to register. Is there are a reasonably straightforward way of doing this? Checking the IP address doesn't seem like a good solution, since it's possible that multiple users may come from the same IP address. Cookies might be the answer, but a savvy user could delete the cookie. Any better ideas?", "Terminal only shows up as a black window", "I am travelling to Budapest and therefore have a Schengen Visa. I hold an Indian passport and a valid US visa. I'm travelling from Chicago-Heathrow-Budapest and returning by Budapest-Dublin-Chicago. Would I need a transit visa for UK/Ireland? UPDATE Hoping this will help someone someday. I was not allowed to board my return flight (BUD-DUB-ORD) because I do not hold an overnight Irish Transit Visa. They said I could have transited happily if the connecting flight was in the same day, but because I would have to originally land at 10 PM and catch the connecting flight next morning at 10 AM, I needed a transit visa. Well, I thought it was BS, but couldn't help comply with the rules. I booked another last minute ticket and flew via Warsaw via LOT." ]

[ "find a sequence converging to zero but not the element of lp space for every 1<_p<infinity", "More than one private key for RSA In an RSA-encryption scenario, Bob's public key pair $(n, e)$ is $(143, 43)$. An attacker Mallory tries brute-force and comes to $d = 7$ as the private key. The value of $φ(143) = 120$ is not known to Mallory. However from $43 \\cdot d \\equiv 1 \\bmod 120)$, one can calculate the first positive element $d = 67$ from multiplicative group $d = 120 + 67n$ and $n \\in \\mathbb{Z}$ $d = 7$ clearly doesn't fit in that multiplicative group, so how come it can successfully decrypt the encryption?", "Do lens hoods need to be matched to focal length? Is it true that not all generic lens hoods work on all lenses (provided the filter diameter matches, of course)? I read that the focal length plays a role in it - but I cannot find such readings on any lens hoods I see available online.", "Generating a DEM and DSM from correct LiDAR point classification I have downloaded classified LAS data from I am trying to generate accurate DEM and DSM for further analysis. I created a LAS dataset with a projected CRS of NAD_1983_UTM_Zone_19N in meters and the z CRS in meters as well. My question is on which classifications do I choose for the DEM and DSM. Here is the filter options I have in my dataset: According to unh LiDAR data report class 2 is ground. What I have done so far: DEM I chose the class 2 points and used the las dataset to raster. DSM In the predefined settings I chose first return and used the las dataset to raster tool. Is this an accurate way of generating these two rasters? Do I not have to take into account the the unassigned class 1, noise class 7, reserved 11, reserved 17, reserved 18? Additionally (I can ask this as a separate question if it gets requested to), when using the las dataset to raster tool the sampling value is defaulted to 10. I would like to change it to 2 or 3 (would be meters) to match the LiDAR resolution. I also plan on using the generated DEM and DSM for a least cost path analysis and I want them to be higher resolution. Will making the sampling_value 2 or 3 throw off the results or should I leave it at 10?", "In document class book, and package caption, creating index with makeidx. Index entries for the main text and for footnotes collate properly; but those for captions create their own entries. Example: for the tag \\index{New York!Custom House!\\textit{Cartouche}}, text and footnotes collate properly; but used in a caption, a new entry is created at the third level, and is also out-of-alphabetic-sequence. Note: the top level, and first sub are correct; only the second sub is duplicated. How to get the caption index entries under the same entry?", "Prove by induction. How do I prove $\\sum\\limits_{i=0}^n2^i=2^{n+1}-1$ with induction? $\\displaystyle\\sum_{i=0}^n2^i=2^{n+1}-1$. I don't understand induction so I could use some help.", "Function whose image of every open interval is $(-\\infty,\\infty)$ How to find a function from reals to reals such that the image of every open interval is the whole of R? Is there one which maps rationals to rationals?", "Solving a Diophantine equation with a large solution", "How to put terms in lexicographic order?", "I found presentation document by D. J. Bernstein. Is it possible to create it in latex? Screenshot", "As far as I know, it's possible to create a radially polarised ring magnet, where one pole is on the inside, and the field lines cross the circumference at right angles. So imagine if I made one which was shaped like a sector of a torus. Then I forced a load of these magnets into a complete torus. Clearly this magnet is impossible because there's no way for the field lines to get back into the middle. So what happens to the field in this case? Does it disappear completely? Do the magnets blow up?", "Do I have an SSD and a hard drive on my MacBook Pro?", "How can I get the HTML source of a given web address in C#?", "Why do we need to use int main and not void main in C++?", "\"Leave a comment\" link even when you can't On I disabled comments for \"USDCAD options vs CADUSD options arbitrage?\", but it still has a \"Leave a Comment\" link. Clicking the link takes you to where it, of course, shows that you can't leave a comment. The timeline page correctly does not show the 'comment' link: How to fix?", "How to make a bib entry appear also in the main document I have a reference which has a bib entry and appears in the bibliography. I want to be able to include the entire entry, exactly as it appears in the bibliography, somewhere else in the document. Is there any way to do that other than to manually write it and format it to look similar?", "Endow $S^3$ with its standard smooth structures from the stereographic projections, i.e. $$\\chi_1:S^3 \\setminus \\{(0,0,0,1) \\} \\to \\mathbb{R}^3, \\chi(x,y,z,t) = \\frac{1}{1-t}(x,y,z) $$ and $$\\chi_2: S^3 \\setminus \\{(0,0,0,-1) \\} \\to \\mathbb{R}^3, \\chi_2(x,y,z,t) = \\frac{1}{1+t}(x,y,z).$$ Do the same for $S^2$, call the charts $\\eta_1, \\eta_2$ (in the same order as the ones for $S^3$). Now, consider the complex projective space $\\mathbb{C} \\mathbb{P}^1$ endowed with the smooth structure given by the charts $\\{(U_0, \\varphi_0), (U_1, \\varphi_1)\\},$ $$U_0 = \\{[z_0:z_1] \\ \\mid \\ z_0 \\neq 0 \\} \\text{ and } U_1 = \\{[z_0: z_1] \\ \\mid \\ z_1 \\neq 0 \\},$$ where $[x:y]$ represents the complex line through the point $(x,y)$ and $0$ in $\\mathbb{C}^2$, and $$\\varphi_0([z_0: z_1]) = \\frac{z_1}{z_0} \\text{ and } \\varphi_1([z_0: z_1]) = \\frac{z_0}{z_1}. $$ Now define the Hopf maps: $$h: S^3 \\to S^2, h(x,y,z,t) = (x^2+y^2-z^2-t^2, 2(yz-xt), 2(xz+yt)) $$ and $$H:S^3 \\to \\mathbb{C} \\mathbb{P}^1, H(x,y,z,t) = [(x+iy):(z+it)]. $$ Is there an easier way to prove that $h$ is a well-defined smooth submersion and that $H$ is a smooth submersion (with respect to the respective smooth structures)? By this I mean we can of course compute $\\eta_i \\circ h \\circ \\chi_j^{-1}, \\forall i,j \\in \\{1,2 \\}$ and $\\varphi_k \\circ H \\circ \\chi_l^{-1}, \\forall k,l \\in \\{1,2 \\}$ and prove that they are smooth (in the classical real-analysis sense) and that they are submersions, but this is a very tedious process. So, are there easier ways to do this? Will this maybe be easier if we switch the smooth structure of the unit spheres from stereographic projections to, say, normal projections (though we increase the number of combinations of charts to verify from 4 to 48), since they induce the same smooth structure?", "My thinking: acceleration corresponds to a force which is instantaneous, so the acceleration of a rigid body can be rather spiky (non-smooth) velocity (angular velocity) describes the ratio of change of the distance(angle), so it is smooth in the real world. Conclusion, it makes sense to (e.g., simple averaging) a velocity signal (temporal velocity), but it does not make so much sense to do smoothing on acceleration signal. Am I right?", "Can someone remind me of the name of the author, the name of the hero and the name of the series if any? Adventure Sci-Fi books, short by today's epic standards ( = about same length as Heinlein's shorter youth books), probably published late 50s?, early 60s? by Bantam? or Del Rey? I think at least 30, possibly more than 40 books in the series. Not comic books. The author is not a well-known writer. At least, I don't remember seeing the name on any other books, ever. Subject: a man who can move and respond to threats extremely fast learns about a secret potion that allows a person to change bodies with someone else and thus control them. A powerful organization does not want the secret to be known, because they use the potion to control politicians on many planets. The organization's goons are people who had surgeries to remove their emotions, and function like organic computers. They can communicate over interstellar distances and follow and murder anyone who learns the secret. I remember the following detail about the potion: there are two nearly identical molecules that have to be assembled in a certain sequence. Two of the components had to be switched around and that determined who would be dominant and who would be controlled during the mind switch / body swap. Every book finds the hero on another planet with new adventures, and usually taking another deep-sleep-passage to another world, fleeing his pursuers. The background story about the secret potion is dished out little by little in each book. One book in the series starts like this: hero is on very hot planet, diving for valuable marine life, catches a deadly fungus disease and is rescued last moment in exchange for his catch... One of the themes that returns often is that the hero is an excellent knife fighter. Of course he's a womanizer. In the second (or close to 2nd) book in the series, he's involved with a woman who rules a planet. To travel to another world, he usually takes the cheapest dead-sleep passage, and there's always a 10-25% risk you won't wake up from that.", "Can I just change straightforward wheel axles to QR skewers?" ]

[ "Is Checksum to file back decoding possible? So, I was having this weird thought. If the checksums(MD5 or SHA...) are unique to any file and are modified if any part of the file is edited, why cant the checksums be decoded back to get the original file? That is if I want to send a large(say 700MB) video, instead I could send just the hash and the file be decoded locally in my friend's computer. I know the thought is stupid, but is it possible by any chance? Or am I missing some thing here? And forgive me if I'm wrong, I ain't a professional.", "I met this equation frequently in Guass-Newton optimizations. But I dont understand why the left and right side of the equation can be equal. Lets say the Jacobian is $2$ by $2$ and Hessian is $$\\begin{bmatrix}\\frac{\\partial^2f_1}{\\partial^2 x_1 } &amp; \\frac{\\partial^2f_1}{\\partial^2 x_2 } \\\\ \\frac{\\partial^2f_2}{\\partial^2 x_1 } &amp; \\frac{\\partial^2f_2}{\\partial^2 x_2 }\\end{bmatrix}$$ But the right hand side of the equation is $$J^TJ =\\begin{bmatrix} \\left( \\frac{\\partial f_1}{\\partial x_1} \\right)^2 + \\left( \\frac{\\partial f_2}{\\partial x_1} \\right)^2 &amp; \\frac{\\partial f_1}{\\partial x_1}\\frac{\\partial f_1}{\\partial x_2} +\\frac{\\partial f_2}{\\partial x_1}\\frac{\\partial f_2}{\\partial x_1}\\\\ \\frac{\\partial f_1}{\\partial x_1}\\frac{\\partial f_1}{\\partial x_2} +\\frac{\\partial f_2}{\\partial x_1}\\frac{\\partial f_2}{\\partial x_1} &amp;\\left( \\frac{\\partial f_1}{\\partial x_2} \\right)^2 + \\left( \\frac{\\partial f_2}{\\partial x_2} \\right)^2\\end{bmatrix} $$ Why can these two be equal as presented in papers?", "Prove if $|z| < 1$ and $ |w| < 1$, then $|1-zw^*| \\neq 0$ and $| {{z-w} \\over {1-zw^*}}| < 1$ Prove if $|z| &lt; 1$ and $ |w| &lt; 1$, then $|1-zw^*| \\neq 0$ and $| {{z-w} \\over {1-zw^*}}| &lt; 1$Given that $|1-zw^*|^2 - |z-w|^2 = (1-|z|^2)(1-|w|^2)$I think the first part can be proven by saying $|1-zw^*| = 0$ if and only if $zw^*$ = 1. And given the conditions that cannot be true. However I don't know if this part is right.", "I was trying to understand the internal structure of AES (Advanced Encryption Standard) The Standard order of steps within a round: Substitute Bytes Shift Rows Mix Columns Add Round Key Substitute Bytes, Shift Rows &amp; Mix Columns satisfies the two most important properties required for a secure cipher i.e confusion and diffusion Substitute Bytes provides Confusion i.e. that each binary digit (bit) of the ciphertext should depend on several parts of the key. Shift Rows along with Mix Column provides Diffusion i.e. if we change a single bit of the plaintext, then (statistically) half of the bits in the ciphertext should change Changing the order of Step 1 and Step 2 won't have any effect. But to what extent can we change the order of other steps? Does it weakens the security of AES, and if so, how?", "What's that ship in the opening credits of 'Star Trek: Enterprise'?", "Inductive proof of the closed formula for the Fibonacci sequence Fibonacci numbers $f(n)$ are defined recursively: $f(n) = f(n-1) +f(n-2)$ for $n &gt; 2$ and $f(1) = 1$, $f(2) = 1$. They also admit a simple closed form: $$\\sqrt 5 f( n ) = \\left(\\dfrac{1+ \\sqrt 5}{2}\\right)^n- \\left(\\dfrac{1 - \\sqrt 5}{2}\\right)^n \\tag1$$ How to prove (1) using induction? Remarks One could get (1) by the general method of solving recurrences: look for solutions of the form $f(n)=r^n$, then fit them to the initial values. But there should be a more concrete proof for this specific sequence, using the principle of mathematical induction.", "UK visit visa: What documents prove genuine relationship with the visitor?", "How can I create launcher icon for PhpStorm? I have PhpStorm on my PC, to launch it I have to go to phpstorm/bin/ and launch phpstorm.sh, how can I pin this to launcher so that I dont have to go into folders every time?", "Call blocking for iPhone? How do I block unwanted callers without jailbreaking?", "Custom post type - posts list - white screen of death i am getting a weird error - white screen in the list of posts for a specific Custom post type (just for that one) tried deactivating all the plugins tried checking for error (debugging = true) Still nothing the page just doesnt echos anything... (nothing in source too) I am talking about such a url in the admin: Here is register_post_type part i am using: function register_submodelcpt() { $labels = array( 'name' =&gt; __('Sub Models', THEME_NAME), 'singular_name' =&gt; __('Sub Models', THEME_NAME), 'add_new' =&gt; __('New Model', THEME_NAME), 'add_new_item' =&gt; __('Add new Model', THEME_NAME), 'edit_item' =&gt; __('Edit Model', THEME_NAME), 'new_item' =&gt; __('New Model', THEME_NAME), 'all_items' =&gt; __('All Sub Models', THEME_NAME), 'view_item' =&gt; __('Watch Model', THEME_NAME), 'search_items' =&gt; __('Search Models', THEME_NAME), 'not_found' =&gt; __('No Models found', THEME_NAME), 'not_found_in_trash' =&gt; __('No Models found in trash', THEME_NAME), 'parent_item_colon' =&gt; '', 'menu_name' =&gt; __('Sub Models', THEME_NAME), ); $args = array( 'labels' =&gt; $labels, 'public' =&gt; true, 'publicly_queryable' =&gt; true, 'show_ui' =&gt; true, 'show_in_menu' =&gt; true, 'query_var' =&gt; true, 'rewrite' =&gt; array('slug' =&gt; 'submodels'), 'capability_type' =&gt; 'post', 'has_archive' =&gt; true, 'hierarchical' =&gt; true, 'menu_position' =&gt; 5, 'menu_icon' =&gt; get_stylesheet_directory_uri().'/images/cpt/subcars.png', 'supports' =&gt; array('title', 'thumbnail', 'revisions', 'page-attributes') ); register_post_type('submodelscpt',$args); } add_action('init', 'register_submodelcpt'); Did anyone encounter such an issuse? can you think of a reason this might happen? Another weird thing when i change this: To this: The posts list loads correctly...", "What is the advantage of accepting the axiom of choice over other axioms (for e.g. axiom of determinacy)? It seems that there is no clear reason to prefer over other axioms.. Thanks for help.", "When will my device get the Android 4.4 update (KitKat)?", "Principled way of collapsing categorical variables with many levels? What techniques are available for collapsing (or pooling) many categories to a few, for the purpose of using them as an input (predictor) in a statistical model? Consider a variable like (discipline chosen by an undergraduate student). It is unordered and categorical, but it can potentially have dozens of distinct levels. Let's say I want to use major as a predictor in a regression model. Using these levels as-is for modeling leads to all sorts of issues because there are just so many. A lot of statistical precision would be thrown away to use them, and the results are hard to interpret. We're rarely interested in specific majors -- we're much more likely to be interested in broad categories (subgroups) of majors. But it isn't always clear how to divide up the levels into such higher-level categories, or even how many higher-level categories to use. For typical data I would be happy to use factor analysis, matrix factorization, or a discrete latent modeling technique. But majors are mutually exclusive categories, so I'm hesitant to exploit their covariance for anything. Furthermore I don't care about the major categories on their own. I care about producing higher-level categories that are coherent with respect to my regression outcome. In the binary outcome case, that suggests to me something like linear discriminant analysis (LDA) to generate higher-level categories that maximize discriminative performance. But LDA is a limited technique and that feels like dirty data dredging to me. Moreover any continuous solution will be hard to interpret. Meanwhile something based on covariances, like multiple correspondence analysis (MCA), seems suspect to me in this case because of the inherent dependence among mutually exclusive dummy variables -- they're better suited for studying multiple categorical variables, rather than multiple categories of the same variable. edit: to be clear, this is about collapsing categories (not selecting them), and the categories are predictors or independent variables. In hindsight, this problem seems like an appropriate time to \"regularize 'em all and let God sort 'em out\". Glad to see this question is interesting to so many people!", "Add a time limit before you can vote on a post", "this works in viewport but not in render. import bpy from math import * def frame_handler(scene): z = scene.objects['Lift'].location[2] scene.objects['Text'].data.body = str(floor(z / 4.0) - 2) bpy.app.handlers.frame_change_pre.clear() bpy.app.handlers.frame_change_pre.append(frame_handler) How to get it working in render? I've read and changed from \"bpy.data.objects\" to \"scene.objects\" as already seen in the script. What am I missing? Blender v. 2.81.16 Edit. Tried that depsgraph thing mentioned in comments and changed to frame_change_post: import bpy from bpy.app.handlers import persistent from math import * @persistent # maybe not relevant but doesn't harm anything? def frame_handler(scene, depsgraph): z = scene.objects['Lift'].evaluated_get(depsgraph).location[2] scene.objects['Text'].data.body = str(floor(z / 4.0) - 2) bpy.app.handlers.frame_change_pre.clear() bpy.app.handlers.frame_change_post.clear() bpy.app.handlers.frame_change_post.append(frame_handler) Now the Text doesn't show up at all in rendered (but works in viewport).", "In electromagnetism, why does nature prefer the right-hand rule over the left-hand rule?", "Evaluating $\\int_{I^n} \\left( \\min_{1\\le i \\le n}x_i \\right)^{\\alpha}\\,\\, dx$ Let $\\alpha \\in \\mathbb R$ and let's call $I:=[0,1]$. Evaluate $$ \\int_{I^n} \\left( \\min_{1\\le i \\le n}x_i \\right)^{\\alpha}\\,\\, dx. $$ Well, the case $n=1$ is easy and the integral equals $\\frac{1}{\\alpha+1}$, for every $\\mathbb R \\ni \\alpha \\ne - 1$. I've done also the case $n=2$ and, if I'm not wrong, it's $\\displaystyle \\frac{2}{(\\alpha+1)(\\alpha+2)}$. My big problem is that I cannot understand how to deal with the general case. Any ideas? Thanks in advance.", "How to change SQL Server collation", "In D&amp;D 4E as with many RPGs, characters have a fixed armour value or AC. When attacking, the attacker must roll a die to overcome the target's AC. In 4E offensive magic works the same way: the target has a fixed Fortitude/Reflex/Will defence determined by their stats, and in order to hit, the attacker rolls to overcome whichever defence is relevant. However it was not always like this. Some spells in 3E and now again in 5E work the opposite way. In those editions the target is the one who rolls against a fixed value determined by the caster's stats, in order to avoid spell-damage. Both methods compare the attacker and target's stats, and have an element of randomness. I personally like the 4E system as it simplifies combat without leaving anything out. Why was the decision made, when designing the early D&amp;D editions (and still when iterating upwards into (A)D&amp;D 1e&ndash;3e), to use saving throws to control spells? Answers should consist of designer quotes and not personal opinions.", "Why couldn't the Jedi detect Senator Palpatine as having powers? In Return of the Jedi, when trying to sneak into the base on a shuttle, Luke said he senses Darth Vader's presence and said he shouldn't have come lest he jeopardize the mission. Darth Vader also sensed Luke, but let him in anyways. Also, Yoda and Obi-Wan could detect the Force in young Anakin. So if Jedi and Sith can detect each other, why couldn't they detect Senator Palpatine to begin with? It seems like a giant plot hole." ]

[ "Examples of bijective map from $\\mathbb{R}^3\\rightarrow \\mathbb{R}$ Could any one give an example of a bijective map from $\\mathbb{R}^3\\rightarrow \\mathbb{R}$? Thank you.", "How to \"flatten\" a multi-dimensional array to simple one in PHP? It's probably beginner question but I'm going through documentation for longer time already and I can't find any solution. I thought I could use implode for each dimension and then put those strings back together with str_split to make new simple array. However I never know if the join pattern isn't also in values and so after doing str_split my original values could break. Is there something like combine($array1, $array2) for arrays inside of multi-dimensional array?", "Copy game data from one PS4 to another?", "Option clash for package xcolor", "MacBook Pro (15-inch, 2016) with 2 USB-C to HDMI adapters. The setup works great if I start up in that configuration. If I connect the adapters while the machine is running or simply sleeping, one of the monitors will never get a signal and stay in low power mode. The OS sees the monitor, it shows in the display arrangement settings and I can move the mouse into it, but until I restart, I can't see anything on it. Once I have restarted I can let the machine sleep or whatever, and the display still works unless I disconnect the adapter. As soon as I do that a restart is required to use it again. Using MacOS Sierra (10.12.4) Using this adapter:", "What did Auggie's father give to his wife in the movie Wonder? There is a scene roughly in the last third of Wonder where Auggie's parents Nate and Isabel (Owen Wilson and Julia Roberts) spend an evening together while the kids are out. Nate has a surprise gift for his wife. She opens the box just enough to see it, laughs, and closes it again. So I asked myself the question: What's in the box?", "Does a bad grade in one course (with otherwise OK record) affect graduate admissions? I'm currently an M. Phil student in Math and I failed a course last semester because I was not able to hand in a home work assignment (which was worth 40% of my grade) on time (I was 30 minutes late). Apart from that I'd say I'm a fairly decent student, I got an upper second class honours bachelors degree, I have a B+ and A's for all my other courses in my current programme and I'm almost finished with my first paper to be published. I've however been deeply worried about this failure as it would reflect poorly on my transcript if I were to apply to a Ph.D or another Master's programme. Will my failing grade affect my chances of getting into a competitive programme or greatly lower my chances of getting a scholarship?", "Why are all known distributions unimodal?", "How to read value of variable, where the name of variable is the value of another variable I think an example is in order. Consider I have these two environment variables setup (by a Continuous Delivery tool): PACKAGE_VER=1.2.3 and USE_VERSION_FROM=PACKAGE_VER. What I want now is a script that can't predict the name of the variable pointing out 1.2.3, only USE_VERSION_FROM. And so, I'm looking for a way to get my script to know the version to use (1.2.3) without knowing anything other than that USE_VERSION_FROM points out the name of the variable that holds the version number. My naïve non-working first attempt: #!/bin/bash VERSION_TO_USE=\"${${USE_VERSION_FROM}}\"", "DES — Can I recover the key when I have both ciphertext and the plaintext? Given a message and DES encrypted form of said message, is it possible to efficiently compute the key used to encrypt the data?", "I know Blender is free software and bugs happen. But my question is, is it good practice to update Blender every time there is an update? Even if a minor one? (i.e I'd consider 2.56 to 2.56b minor or even 2.63, no?) I haven't been updating very often for fear that updating frequently causes issues like broken settings, non-compatibility or lost user configs? Or is updating often recommended to keep up to date and adapted to the new changes, i.e like upgrades in the GUI and functionality?", "Which databases use real multidimensional indices? Is oracle ever using several indices to get data from tables, or will it always take the one that seems to have the highest selectivity? How about other dbms?", "Grub rescue - error: unknown filesystem", "I downloaded Heroku from Heroku toolbelt using wget -qO- https://toolbelt.heroku.com/install-ubuntu.sh | sh in the terminal, which they recommended on their site. My Ubuntu (14.04.1) didn't recognize the -q0-, so I took it out. It then seemed to download fine - I see the in the directory I was in when i downloaded it. Now, however, it still doesn't recognize heroku as a command. It also won't show me where it is with the 'whereis' command. But when I look in the current directory with ls -a, it shows up. It seems to be there. How do I install it?", "Proving $\\mathbb{Q}$ isn't homeomorphic to $\\mathbb{Z}$", "Bottom to top explanation of the Mahalanobis distance? I'm studying pattern recognition and statistics and almost every book I open on the subject I bump into the concept of Mahalanobis distance. The books give sort of intuitive explanations, but still not good enough ones for me to actually really understand what is going on. If someone would ask me \"What is the Mahalanobis distance?\" I could only answer: \"It's this nice thing, which measures distance of some kind\" :) The definitions usually also contain eigenvectors and eigenvalues, which I have a little trouble connecting to the Mahalanobis distance. I understand the definition of eigenvectors and eigenvalues, but how are they related to the Mahalanobis distance? Does it have something to do with changing the base in Linear Algebra etc.? I have also read these former questions on the subject: I have also read . The answers are good and pictures nice, but still I don't really get it...I have an idea but it's still in the dark. Can someone give a \"How would you explain it to your grandma\"-explanation so that I could finally wrap this up and never again wonder what the heck is a Mahalanobis distance? :) Where does it come from, what, why? UPDATE: Here is something which helps understanding the Mahalanobis formula:", "How to interleave the lines of two or more files? I have tried to get the 2 files output in a single file. I have tried below command: cat file1 file2 but here file2 data is appending to file1. What I need is file1 1st line followed by file2 first line, and file1 second line followed by file2 second line etc. Can anybody tell me how to do this in a simple way?", "When no model comparison, should I use REML vs ML? I'm running LMM, and I will make no comparison of models. Could I ask which one should I use between REML and ML?", "How do i prove invertibility of this linear transformation Let $T$ be a linear transformation from a vector space $V$ over reals into $V$ such that $T-T^2=I$. Show that $T$ is invertible", "How can I get Gnome3 to remember my session?" ]

[ "Highlight the difference between two strings in PHP What is the easiest way to highlight the difference between two strings in PHP? I'm thinking along the lines of the Stack Overflow edit history page, where new text is in green and removed text is in red. If there are any pre-written functions or classes available, that would be ideal.", "Intersect (analysis) of polygons generating empty output", "How to remove snap completely without losing the Chromium browser? I am wondering whether or not there is a way to completely remove snap from Ubuntu 19.10 without losing the ability to install important applications like Chromium. When I just recently updated to the newest Ubuntu release I realized that the installer programmatically reinstalled snap, although I had manually removed it before. Additionally the installer removed Chromium, which was installed via the repositories, and reinstalled it via snap. As I don't want snap to be installed on my machines for various reasons my question is if anybody knows a safe way to remove it, and to get the Chromium DEB back to the sources? Is there a PPA? Could I use a source of an Ubuntu flavor additionally, which didn't remove the Chromium Deb from its sources?", "Maximum power of $2$ which divides $3^{1024}-1$ What is the maximum power of $2$ which completely divides $3^{1024}-1$? I proceeded thus: $\\phi(2^n)=2^{n-1}$ for all $n\\ge1$ $$3^{1024}=3^{2^{10}}\\equiv1\\pmod {2^{11}}$$ $$3^{1024}-1\\equiv0\\pmod {2^{11}}$$ Since $\\phi(2^{11})=2^{10}$. So, maximum power of $2$ must be $11$. But the answer says it is $12$. Where am I wrong and how to solve it correctly?", "Not sure if someone else has already raised this - I've got eleven notifications that I've received a Caucus badge on English Language Learners. Perhaps one notification for each community that I'm a member of? I am a member of the community, and did visit the election. Also, the badge hasn't been awarded more that once (so I think it's just the notification that's at fault). Note that this seems to happen for other badges, it has been reported for: Caucus, Nice Answer, Enthusiast.", "I'm trying to find a movie with an underground facility with people wearing white suits. The people have been affected such that they show no curiosity. There is one person that does and asks one of his co-workers where a tube leads to. At the end there is an uprising where everyone gets to see the surface and sunlight. What is the name of this movie?", "The passive with \"let\"", "How can I use a variable in the replacement side of the Perl substitution operator? I would like to do the following: $find = &quot;start (.*) end&quot;; $replace = &quot;foo \\1 bar&quot;; $var = &quot;start middle end&quot;; $var =~ s/$find/$replace/; I would expect $var to contain &quot;foo middle bar&quot;, but it does not work. Neither does: $replace = 'foo \\1 bar'; Somehow I am missing something regarding the escaping.", "UK Visa has been refused for false document I applied for a marriage visitor visa, to get married to my boyfriend of 2 years. We met while we were students in the UK and have had vacations together in the two years but not in the U.K. With the application I had attached an offer letter from a company stating that I have a job offer open starting 3 months later. This however has been tagged as non genuine, although the company is registered and is run by someone I know. How can I appeal to this?", "Moving set of polygons in ArcGIS Pro? I am very new to mapping and I have loaded a set polygons from a shapefile into ArcGIS Pro. They appear correctly however they have clearly lost (or didn't have in the first place), their longitudinal and latitudinal information as they are currently placed in the middle of the ocean, which I believe is the 0 lat, 0 long position. I can manually move these polygons but it won't let me save the moves, so when I click 'select', it moves back to the original location. Both of the 'save' and 'discard' buttons are greyed out and cannot be clicked. If I click 'finish' on the move tool then it will snap back to the original location too. Does anybody have any ideas?", "Combinatorial Proof for Binomial Identity: $\\sum_{k = 0}^n \\binom{k}{p} = \\binom{n+1}{p+1}$ I am studying combinatorics and I came across the identity $$\\sum\\limits_{k=0}^n \\binom kp =\\binom {n+1}{p+1}.$$ I have read the algebraic proof and it does not appeal to me. Is there an elegant counting trick we can use to arrive at this identity?", "Windows Spotlight Source and Save locations?", "Problem. Assume that $U$ is an open and connected subset of $\\mathbb R^2$, and $\\gamma :[0,1]\\to U$ is a closed curve, which is not null-homotopic in $U$ and not necessarily simple closed. Show that there exists a simple closed curve, which is not null-homotopic in $U$. I am sure that this is a standard problem, and I am looking for an elegant, if possible, solution or a reference. I have in mind the following sketch of proof: a. Construct a polygonal closed curve $\\tilde\\gamma$ which is homotopic with $\\gamma$ in $U$. b. Construct $\\tilde\\gamma$ so that it intersects itself in finitely many points, and not whole segments. c. Use induction on the number of self–intersections of $\\tilde\\gamma$, in order to show that $\\tilde\\gamma$ is written as a product (in the fundamental group's sense) of simple closed polygonal curves.", "\"It looks straightforward, but actually it isn't\"", "How do you perform a left outer join using linq extension methods Assuming I have a left outer join as such: from f in Foo join b in Bar on f.Foo_Id equals b.Foo_Id into g from result in g.DefaultIfEmpty() select new { Foo = f, Bar = result } How would I express the same task using extension methods? E.g. Foo.GroupJoin(Bar, f =&gt; f.Foo_Id, b =&gt; b.Foo_Id, (f,b) =&gt; ???) .Select(???)", "Capturing console output from a .NET application (C#) How do I invoke a console application from my .NET application and capture all the output generated in the console? (Remember, I don't want to save the information first in a file and then relist as I would love to receive it as live.)", "Is the electric force a vector or a vector field?", "Trying to restart apache from terminal using following command: sudo service apache2 restart when executing that command getting below error: Job for apache2.service failed. See \"systemctl status apache2.service\" and \"journalctl -xe\" for details. On excuting \"systemctl status apache2.service\" got below output apache2.service - (null) Loaded: loaded (/etc/init.d/apache2) Active: failed (Result: exit-code) since Sat 2015-05-30 02:22:41 IST; 12s ago Docs: man:systemd-sysv-generator(8) Process: 4866 ExecStart=/etc/init.d/apache2 start (code=exited, status=1/FAILURE) apache error.log AH00489: Apache/2.4.12 (Unix) configured -- resuming normal operations AH00094: Command line: '/usr/local/apache2/bin/httpd'", "During Windows installation I accidentally typed an accented name for my user name and my profile name is named after it. I already renamed my user to not have an accented character, but the profile folder is an other topic. Basically I want this because I have some applications what have a problem with the accented character. Is there a way to rename it? I know I have to make a copy from my profile, but how can I perform a relocation itself? I wouldn't like touch any other profiles on the machine just mine.", "Two-Weapon Fighting & Bonus Actions" ]

[ "Changing local IP address with networksetup command on OSX? My computer routinely receives connection from another host in the local network. However, the router changes its ip address quite frequently, and maybe netsh's equivalent, networksetup, can help?", "One Time Pad Key Distribution For multiple OTP keys, why not do this: Key = Hash[(EC)DH Shared Secret + Counter] The counter will increase per message, and the output of the hash will be random for each new unique input into it. What are the problems or weaknesses with this design?? EDIT: For clarification: both parties will have the shared secret from an ECDH exchange, random numbers from Pythons os.urandom for generating the ECC key", "On the uniqueness of the Riemann-Christoffel tensor According to Section 6.2, Gravitation and Cosmology by Weinberg, the Riemann-Christoffel tensor is the only tensor that can be constructed out of the second (or lower) order derivatives of the metric tensor and is linear in the second order derivatives. The reasoning behind the same goes like this: In a class of frames where $\\Gamma^{\\lambda}_{\\mu\\nu} =0$, the transformation rule for $\\dfrac{\\partial \\Gamma^{\\lambda}_{\\mu\\nu}}{\\partial x^{\\kappa}}$ involves an inhomogeneous term which is symmetric in $\\mu$, $\\nu$, and $\\kappa$. Thus, if one is to construct a tensor which is a linear combination of the first order derivatives of the Christoffel symbol then the only way to do so is by eliminating the inhomogeneous part of the transformation and this could be done only by making the combination explicitly antisymmetric in $\\mu$ and $\\kappa$. Since in these frames, $R^{\\lambda}_{\\mu\\nu\\rho}$ $ = \\dfrac{\\partial \\Gamma^{\\lambda}_{\\mu\\nu}}{\\partial x^{\\rho}} - \\dfrac{\\partial \\Gamma^{\\lambda}_{\\mu\\rho}}{\\partial x^{\\kappa}} $, $R^{\\lambda}_{\\mu\\nu\\rho}$ is the only tensor that can be formulated using the second (or lower) order derivatives of the metric tensor and is linear in the second order derivatives. I think the presented argument can only suffice to prove that $R^{\\lambda}_{\\mu\\nu\\rho}$ is the only tensor that can be formulated from the first derivatives of the Christoffel symbol and is linear in them. I can't figure out why this suffices to assert that $R^{\\lambda}_{\\mu\\nu\\rho}$ is the only tensor that can be constructed out of the second (or lower) order derivatives of the metric tensor and is linear in the second order derivatives. Edit: As the metric is covariantly constant, $\\dfrac{\\partial g_{{\\mu}{\\nu}}}{\\partial x^{\\rho}} = \\Gamma^{\\kappa}_{{\\mu}{\\rho}}g_{{\\kappa}{\\nu}}+\\Gamma^{\\kappa}_{{\\nu}{\\rho}}g_{{\\kappa}{\\mu}}$. Therefore, $\\dfrac{\\partial^2 g_{{\\mu}{\\nu}}}{\\partial x^{\\xi}\\partial x^{\\rho}} = \\bigg(\\dfrac{\\partial \\Gamma^{\\sigma}_{{\\mu}{\\rho}}}{\\partial x^{\\xi}} + \\Gamma^{\\sigma_1}_{{\\mu}{\\rho}}\\Gamma^{\\sigma}_{{\\sigma_1}{\\xi}}\\bigg)g_{{\\sigma}{\\nu}}+\\bigg(\\dfrac{\\partial \\Gamma^{\\sigma}_{{\\nu}{\\rho}}}{\\partial x^{\\xi}} + \\Gamma^{\\sigma_1}_{{\\nu}{\\rho}}\\Gamma^{\\sigma}_{{\\sigma_1}{\\xi}}\\bigg)g_{{\\sigma}{\\mu}} + \\bigg(\\Gamma^{\\sigma}_{{\\mu}{\\rho}}\\Gamma^{\\sigma_1}_{{\\nu}{\\xi}}+\\Gamma^{\\sigma}_{{\\nu}{\\rho}}\\Gamma^{\\sigma_1}_{{\\mu}{\\xi}}\\bigg)g_{{\\sigma}{\\sigma_1}} $ Now, if I want to show that the Riemann-Christoffel tensor is the only (non-trivial and independent) tensor that can be formulated out of the linear combinations of the second order derivatives of the metric tensor then I can equivalently show that the above expansion can be expressed linearly in terms of the Riemann-Christoffel tensor. But I am stuck over how to do it. Also, I am a little bit unclear as to what a linear combination means in this context. The coefficient of the second order term can be only a scalar constant or can it be the metric or can it be the metric that is getting summed over any of the indices as well?", "AMD GPU Material in \"material preview mode\" and \"rendered mode\", is entirely gray as background. Only outline is displayed", "Electric Flux - What is the point? Electric flux is a defined quantity that is proportional to the no. of field lines passing through a given area element for a given electric field. It is not proportional to the relative density of field lines, which would supply information regarding the strength of the field at that point. Electric flux, it seems to me, does not supply us with any practical information. It seems to me that electric flux is a quantity defined and modeled specifically for Gauss' law, to introduce some kind of mathematical elegance to it and to introduce an additional visual aspect to the concept of electric fields. Perhaps this is why for symmetrical situations especially, Gauss' Law can be used to easily determine the electric field due to the given charge distribution. Am I wrong here? Is there a physical significance to electric flux that I do not understand?", "How do I edit my profile? This is probably a noob question, but I forgot how to edit my profile. Can anyone help me? There is no visible button for me.", "Fields - Proof that every multiple of zero equals zero This is one of my first proofs about fields. Please feed back and criticise in every way (including style and details). Let $(F, +, \\cdot)$ be a field. Non-trivially, $\\textit{associativity}$ implies that any parentheses are meaningless. Therefore, we will not use parentheses. Therefore, we will not use $\\textit{associativity}$ explicitly. By $\\textit{identity element}$, $F \\ne \\emptyset$. Now, let $a \\in F$. It remains to prove that $0a = 0$. \\begin{equation*} \\begin{split} 0a &amp;= 0a + 0 &amp;&amp; \\quad \\text{by }\\textit{identity element }(+ ) \\\\ &amp;= 0a + a + -a &amp;&amp; \\quad \\text{by }\\textit{inverse element }(+ ) \\\\ &amp;= 0a + 1a + -a &amp;&amp; \\quad \\text{by }\\textit{identity element }(\\cdot) \\\\ &amp;= (0 + 1)a + -a &amp;&amp; \\quad \\text{by }\\textit{distributivity } \\\\ &amp;= (1 + 0)a + -a &amp;&amp; \\quad \\text{by }\\textit{commutativity }(+ ) \\\\ &amp;= 1 a + -a &amp;&amp; \\quad \\text{by }\\textit{identity element }(+ ) \\\\ &amp;= a + -a &amp;&amp; \\quad \\text{by }\\textit{identity element }(\\cdot) \\\\ &amp;= 0 &amp;&amp; \\quad \\text{by }\\textit{inverse element }(+ ) \\end{split} \\end{equation*} QED PS: Is \"Let $(F, +, \\cdot)$ be a field.\" ok? Besides, I would not want to call $F$ a field, because $F$ is just a set. Also, what do you think about using adverbs like \"Now\"? How would you have said the associativity-thing?", "How do I get help for \"echo\" or other bash commands? man echo works. but out of curiosity, does echo have something similar to a --help flag/parameter?", "Windows 10 default programs keep changing Since the fall update last month, Windows 10 automatically keeps changing the default apps for certain types (mostly browser,pdf,mp3,jpg). I have tried changing them back from the Settings app as well as the Control Panel. I have observed that this happens mostly while unzipping files using WinZip. Windows changes the default programs back to Microsoft recommended programs such as Edge, Photos, Groove etc. Is there a way to restrict this from happening? Has anybody else encountered a similar situation? I couldn't find similar question anywhere so I'm asking this here.", "What are the rations Rey eats? In The Force Awakens, we see Rey pouring some flour-like polystarch rations into water so that the flour amazingly transforms into something that looks like bread. What are these rations? Is there any documentation of the fictional chemistry and biology that makes the starch rations behave as they do?", "When entering the US on an international flight, and then on to a connecting domestic flight, what is the exact order of the process that will take place? In other words, what happens first, second, third, etc.?", "On Mac, are there keyboard shortcuts to create a new Space? Or at least any way to automate this process with keyboard shortcuts? I want to not have to use the mouse to create Spaces. I want to use the keyboard for that.", "Currently i am using RF toolbox on MATLAB for a binary classification Problem Data Set: 50000 samples and more than 250 features So what should be the number of trees and randomly selected feature on each split to grow the trees? can any other parameter greatly affect the results?", "Why is integration so much harder than differentiation?", "Is it possible to make an underfull tabulary spread out? With this MWE \\documentclass{article} \\usepackage{tabulary} \\begin{document} \\hrule \\begin{center} \\begin{tabulary}{\\textwidth}{|L|L|L|} foo&amp;bar&amp;baz \\end{tabulary} \\end{center} \\hrule \\end{document} I get a table which is narrower than the page: But I'd like the table to be spread out to \\textwidth like tabularx would do. Is this possible? Or is there an alternative approach?", "For integers $a$ and $b$, $ab=\\text{lcm}(a,b)\\cdot\\text{hcf}(a,b)$ I was reading a text book and came across the following: Important Results (This comes immediately after LCM:) If 2 [integers] $a$ and $b$ are given, and their $LCM$ and $HCF$ are $L$ and $H$ respectively, then $L \\times H = a \\times b$ Can some please help me understand why the above result is true? Thanks in advance.", "Can anyone please help and tell me if this sentence is correct? &quot;A significant amount of zombies were detected in your city.&quot; In my opinion it should be &quot;A significant amount of zombies was detected in your city.&quot; because &quot;amount&quot; should be in agreement with &quot;was&quot; even though amount usually refers to something plural. Are both (was and were) acceptable in this case? Edit1: Yes, &quot;number&quot; would be the correct one in this case. So allow me to ask one more thing. &quot;A significant amount of purchases were detected...&quot; Does the use of &quot;number&quot; apply in this case also? As purchase is not exactly a thing/person. And if no, is it correct to say &quot;A significant amount of purchases were detected...&quot;? Edit2: So, please tell me what is the correct phrasing? &quot;A significant amount of purchases were detected...&quot; &quot;A significant amount of purchases was detected...&quot; Or, since purchases are countable, is the use of &quot;number&quot; instead of &quot;amount&quot; correct here, as in: &quot;A significant number of purchases were detected...&quot; &quot;A significant number of purchases was detected...&quot; Or would amount be correct since a purchase involves money and it refers to the amount of money? Would greatly appreciate an answer, and if possible a detailed explanation.", ": Not ten minutes ago, I received this error, twice: And also an &quot;Oops, something bad happened&quot; error. I'm also getting question posting errors. Can we fix this, please?", "Interpretation of mean absolute scaled error (MASE)", "Truncated trivariate normal - conditional expectation" ]

[ "How can we prove that every odd perfect square is congruent to $1$ modulo $8$?", "How can I run Debian stable but install some packages from testing? Say you're running a server and you don't want to upgrade to Testing (Squeeze) from Stable (Lenny) to just install a required package or two. What's the best way of installing only certain packages from Testing?", "Is there any difference in meaning between 'efficacy' and 'efficiency'?", "There was a foolish (in my opinion) question asked on Scifi.SE James bond keeps returning with a different face, albeit usually a similar one, and often operates with high-tech gadgetry that seem to be on par with the Doctor's sonic screw driver. In my opinion each new actor represents a reboot of the franchise using the new face, not a continuation of the story. Is there any continuity between versions of James Bond which change actors? I'm not talking about characters like M or Q, I'm talking about events or past advisories being referenced in a different Bond movie where the main actor was someone else.", "Where can I buy an Ubuntu Phone? I need to buy an Ubuntu phone, where can I buy it? It is unavailable everywhere.", "Is it possible to recover original content from an edited image file? OK possibly a random question here, but one that is relevant to the site and regarding a hot topic nowadays: privacy. If I load an image file (in my case a PNG photocopy of a document which contains some personal details) into Gimp, and I 'fill' with black (i.e. as if to redact) the areas of the image that contain sensitive information, and I then overwrite the original file, is there any way that the original untouched image can be recovered or gleamed? Such as low level bit analysis or...? If so what tools and techniques are behind that, and how can I mitigate this? Is it a simple case of not overwriting the original but simply creating a new file with the changes?", "Plain integer partitions of $n$ using $r$ parts Division of number $n$ on parts $a_1,...,a_r$ where $a_1 \\le ... \\le a_r$ we call a plain if $a_1 = 1$ and $a_i - a_{i-1} \\le 1$ for $2 \\le i \\le r$. Find enumerator (generating function) for plain divisions. my try The hint was to use bijection between plain divisions and some commonly know enumerator. I tried to use enumerator of divisions on different parts: $$ (1+x)(1+x^2)...(1+x^r)$$ where number of plain divisions is $$[x^n](1+x)(1+x^2)...(1+x^r) $$ let function $$f(n,r) = [x^n](1+x)(1+x^2)...(1+x^r) $$ For some first divisions it works. For example: $$f(4,3) = 1 $$ $$f(6,3) = 1 $$ $$f(11,5) = 2$$ But when I tried to find bijection, I failed. I found that this function isn't correct because $f(15,6) = 4$ but should be equal to $3$ because: $$15 = 1,1, 2, 3, 4, 4 \\\\ 15 = 1, 2, 2, 3, 3, 4\\\\ 15 = 1, 2, 3, 3, 3, 3 $$. There I stucked.", "Using Windows 10, I can't run certain commands from PowerShell but they all work correctly using cmd. PowerShell: node --version: node : The term 'node' is not recognized as the name of a cmdlet, function, script file, or operable program. Check the spelling of the name, or if a path was included, verify that the path is correct and try again. At line:1 char:1 + node --version + ~~~~ + CategoryInfo : ObjectNotFound: (node:String) [], CommandNotFoundException + FullyQualifiedErrorId : CommandNotFoundException node.exe --version: no output. node.exe: opens a new black console (node.exe application itself). Get-Host | Select-Object Version: Version ------- 5.1.19041.906 Get-Command node: The term 'node' is not recognized as the name of a cmdlet, function, script file, or operable program. Check the spelling of the name, or if a path was included, verify that the path is correct and try again. At line:1 char:1 + Get-Command node + ~~~~~~~~~~~~~~~~ + CategoryInfo : ObjectNotFound: (node:String) [Get-Command], CommandNotFoundException + FullyQualifiedErrorId : CommandNotFoundException,Microsoft.PowerShell.Commands.GetCommandCommand Get-Command node.exe: CommandType Name Version Source ----------- ---- ------- ------ Application node.exe 14.16.1.0 C:\\Program Files\\nodejs\\node.exe $env:Path output has nodejs &amp; git &amp; other paths. cmd: everything works fine with any command. I have git and nodejs in my PATH env variable. What's wrong with PowerShell, what a strange behavior is this and how to fix it?", "How to run a program without typing the full path? System utilities such as ls don't need to have the full path typed before executing them. However, to execute Netbeans, I have to type /home/chris/netbeans-7.0.1/bin/netbeans. How can I make it so that I only have to type netbeans?", "It seems Microsoft has tried to solve this problem . In Windows 7, there is no boundary between monitors and the mouse can move freely across the top of the screen between my 3 monitors, provided I had set their heights equal in display settings. Windows 8 introduced sticky corners. See . Windows 10 got sticky corners as well. There are a few pixels at the top corners of each display where the mouse cannot cross over onto the other display. One must move the cursor down to avoid this region in order to get to the next display. The image shows roughly the region where mouse movement is not permitted in Windows 10, but is allowed in Windows 7. Personally, I had no problem with unrestricted mouse movement across the top of my screens - I got used to \"aiming\" for the x, and the convenience of unrestricted cursor movement. Like all the people who wanted to disable it in W8, I'm wondering if there is a way to disable it in W10. Edit to address possible duplicate: Although the problem is identical to the one in , solutions to solve the problem in W8 involving editing the registry key MouseCornerClipLength do not work in W10, since that registry key is not present in W10. Also adding that key and setting the value doesn't work. I searched the entire registry and couldn't find it in another location. No other W10 keys in the node referenced in the W8 solution are obvious replacements. Edit to address possible solutions in comments harrymc's and that worked for for Windows 8.1 do not work in Windows 10.", "How to prove the midpoint of a chord is also the midpoint of the line segment defined by the points of intersection of other two chords with it?", "This picture is a part of a table i am using, the terms subcases are vertically written but i cant center them vertically also in the next columns terms like A, B, etc are also not vertically centered. I made this table using tabulary package a. My code is \\begin{table}[H] \\centering \\caption{Saturation Table} \\label{tab:5}% \\begin{tabulary}{1\\linewidth}{J J J J J J J J J J J J J} \\toprule &amp; \\textbf{Method} &amp; \\multicolumn{1}{c}{\\textbf{Parameters}} &amp; \\textbf{Step 0} &amp; \\textbf{Step 1} &amp; \\textbf{Step 2} &amp; \\textbf{Step 3} &amp; \\textbf{Step 4} &amp; \\textbf{Step 5} &amp; \\textbf{Step 6} &amp; \\textbf{Step 7} &amp; \\textbf{Step 8} &amp; \\textbf{Step 9} \\\\ \\midrule \\multirow{4}[4]{*}{\\begin{sideways}\\textbf{Subcase A}\\end{sideways}} &amp; \\multirow{2}[2]{*}{\\textbf{A}} &amp; \\textbf{No} &amp; 1 &amp; 2 &amp; 3 &amp; 4 &amp; 5 &amp; \\textbf{6} &amp; &amp; &amp; &amp; \\\\[1mm] &amp; &amp; \\textbf{Maximum Saturation {(\\%)}} &amp; 1 &amp; 2 &amp; 3 &amp; 4 &amp; 4 &amp; \\textbf{5} &amp; &amp; &amp; &amp; \\\\ \\cmidrule{2-13} &amp; \\multirow{2}[2]{*}{\\textbf{B}} &amp; \\textbf{No} &amp; 1 &amp; 2 &amp; 3 &amp; 4 &amp; 5 &amp; 6 &amp; 7 &amp; \\textbf{8} &amp; &amp; \\\\[1mm] &amp; &amp; \\textbf{Maximum Saturation {(\\%)}} &amp; 6 &amp; 6 &amp; 7 &amp; 8 &amp; 9 &amp; 9 &amp; 19 &amp; \\textbf{8} &amp; &amp; \\\\ \\bottomrule \\end{tabulary}% \\end{table}%", "I declared random list using TikZ package and can get items randomly. But at same time I need to get all items in sequential order. How can I do it? Is it possible print \\mylist items declared in noncomma variat? \\documentclass[a4paper,14pt]{extreport} \\usepackage{tikz} \\def\\mylist{{one}{two}{three}{four}{five}} \\pgfmathdeclarerandomlist{mynum}{\\mylist} %Define the list \\begin{document} \\pgfmathrandomitem{\\mynum}{mynum} \\pgfmathresult~\\mynum\\\\ \\pgfmathrandomitem{\\mynum}{mynum} \\pgfmathresult~\\mynum\\\\ \\pgfmathrandomitem{\\mynum}{mynum} \\pgfmathresult~\\mynum\\\\ \\pgfmathrandomitem{\\mynum}{mynum} \\pgfmathresult~\\mynum\\\\ \\pgfmathrandomitem{\\mynum}{mynum} \\pgfmathresult~\\mynum\\\\ \\end{document}", "Check synchronously if file/directory exists in Node.js", "Every element of a group has order $2$. Why, intuitively, is it abelian?", "How can I install Ubuntu encrypted with LUKS with dual-boot? The Ubuntu installation disk has an option to install Ubuntu encrypted using LUKS. However, there is no option to perform an encrypted installation along-side existing partitions for a dual-boot scenario. How can I install Ubuntu encrypted alongside another partition from the live disk?", "What's the purpose of the CIL nop opcode? I'm going through MSIL and noticing there are a lot of instructions in the MSIL. The MSDN article says they take no action and are used to fill space if the opcode is patched. They're used a lot more in debug builds than release builds. I know that these kinds of statements are used in assembly languages to align later instructions, but why are MSIL nops needed in MSIL? (Editor's note: the accepted answer is about machine-code NOPs, not MSIL/CIL NOPs which the question originally asked about.)", "Explicit norm on $\\mathcal{C}^0(\\mathbb{R},\\mathbb{R})$ Do you know an explicit norm on $\\mathcal{C}^0(\\mathbb{R},\\mathbb{R})$? Using the axiom of choice, every vector space admits a norm but have you an explicit formula on $\\mathcal{C}^0(\\mathbb{R},\\mathbb{R})$? A related question is: Can we proved that $\\mathcal{C}^0(\\mathbb{R},\\mathbb{R})$ has a norm without the axiom of choice?", "I'm using Dataloader to Upsert a Child Account to Parent Account using an external ID. When the Upsert is complete, the Child overwrites the parent, it's not not connecting the Child Account to the Parent Account. ((See Answer Below))", "Same gravatar is displayed for different users in stackexchange.com filters Same gravatar is displayed for different users in the stackexchange.com , under the Top Network Askers in the right side bar. The red circled image's source (&lt;img src=) are from https://www.gravatar.com/avatar/?s=18&amp;d=identicon&amp;r=PG&amp;s=30 ^ Seems the gravatar id is missing here in the image source. For an example from the list, the user gravatar id should be https://www.gravatar.com/avatar/66c66c4d97a7bc3859a85253f003e1fb?s=18&amp;d=identicon&amp;r=PG&amp;s=30 but it is mapped with https://www.gravatar.com/avatar/?s=18&amp;d=identicon&amp;r=PG&amp;s=30 which caused the display issue." ]

[ "is $\\sqrt{x}$ always positive?", "Where to get 2010 Census Block data? I would like to download 2010 Census Block Data for several towns and I can't seem to find it on American Factfinder. Is it there? And if not, does anyone know where I could find it?", "let $x,y,z,w&gt;0$,show that $$(x+y)^3+(y+z)^3+(z+w)^3+(w+x)^3\\ge 8(x^2y+y^2z+z^2w+w^2x)$$ it seem use AM-GM inequality to solve it,But I can't it,Thanks", "I resized the root partition with GParted, from 20 GB to 40 GB, but the filesystem still reports a size of 20 GB. How can I use all 40 GB? Update The resized partition was an LVM Physical Volume (/dev/sda2), and the boot partition is ext4 (/dev/sda1).", "Find the set of $x>0$ such that the series $\\sum\\limits_n x^{\\ln{n}}$ converges If $x&gt;0$, find the set of all values of $x$ such that series is convergent$$\\sum_{n=1}^{\\infty} x^{\\ln{n}}$$ My attempt:- I used Ratio test for finding the set of all values of $x$ such that series is convergent. $$\\lim_{x\\to\\infty}\\frac{x^{\\ln{n+1}}}{x^{\\ln{n}}}$$ $$=\\lim_{x\\to\\infty}x^{\\ln\\frac{n+1}{n}}$$ This quantity must be less than one for getting a convergent series, I am not able to judge. Can you please help me to find the interval of convergence?", "I am attempting to settle a friendly bet. Would a pendulum swing indefinitely in a hypothetical vacuum (i.e. no air resistance) having a hypothetical frictionless bearing (i.e. no energy lost due to friction) assuming the following The frictionless vacuum is on Earth (9.8 m/s^2). The pendulum is already in motion and no other external forces other than gravity act on the pendulum.", "How do I resize my partition in Ubuntu? I had Windows 8 installed on my system, which I screwed up, and now I run Ubuntu 12.04. While installing, Ubuntu used all the 461 GB of HDD space (one partition). Now I want to make a new partition of maybe 100 GB or so, in order to install Windows 7 alongside Ubuntu (with a dual-boot). But I can't even get a partition done. I can't change the partition in GParted either - the option is disabled.", "Clicking leave closed shows the reopen pop-up", "One word for things that would be nice to have, but not required to have?", "Grandi's Series; tends to $1/2$, but why is this considered a valid sum? Grandi's series, $$1+1-1+1-1+1-1+...$$ can be expressed as the below: $$\\sum_{n=0}^\\infty(-1)^n$$ Two valid sums that make sense to me are $1$, and $0$, depending on how you approach the series. $(1+1)-(1+1)-(1+1)-...=0$, and $1+(1-1)+(1-1)+(1-1)+...=1$. There is consensus, however, that the actual sum is $\\frac{1}{2}$. Why? I understand the approach of finding partial means of the series, and they do indeed tend to $\\frac{1}{2}$, but it seems unintuitive to assert that the sum is neither $1$ or $0$. A more convincing method I found was assuming the series is $S$, then shifting it such that $S-1 = S$, then through algebra finding $S = \\frac{1}{2}$, but again, it seems more intuitive answer is either $0$ or $1$. I say this strictly because adding and subtracting integers should equal an integer, never a fraction. Is this a characteristic of infinite series, which is not specific to Grandi's series?", "How to get back a declined Outlook invitation", "Is there a reliable way to determine the OS upgrade history leading to Windows 10 or if it was a fresh install?", "How to validate an email address using a regular expression?", "I cannot find these strings using Transifex: (name hidden from user) Regards, {site name} Moderation Team There is and it seems like this string does not work ok (it is translated and approved, but, unfortunately, not rendered on the site). All of the strings are taken from Moderator Private Messages interface. Could you please fix it?", "double perpendicular symbol (for independence) I found from that I could use the independence symbol: \\newcommand\\independent{\\protect\\mathpalette{\\protect\\independenT}{\\perp}} \\def\\independenT#1#2{\\mathrel{\\rlap{$#1#2$}\\mkern2mu{#1#2}}} I was wondering how this works. Can anybody explain? I don't know the commands mathpalette, rlap, and mkern2mu.", "Is speed of light and sound rational or irrational in nature? Just as circumference of circle will remain $\\pi$ for unit diameter, no matter what standard unit we take, are the speeds of light and sound irrational or rational in nature ? I'm talking about theoretical speeds and not empirical, which of course are rational numbers.", "Show that if $a \\neq b$ and a and b are positive then $\\frac{a}{b}+\\frac{b}{a}$ is never an integer", "I’m going to Germany for a semester exchange and I have a long-stay visa from Germany. Can I travel to the other Schengen states during this period with this visa or do I have to apply for a separate short stay Schengen visa? My visa is German national visa type D. It is for a duration of 4 months, i.e., longer than 90 days. It says on the visa that the long stay visa is valid in Deutschland, which is different from my earlier visa, which I had when I visited Germany earlier; that one was a short stay visa and said it was valid in Schengen Staten. Perhaps my current visa means that I can stay in Germany for a period of longer that 90 days can visit the other Schengen states if I don’t exceed the 90 day period.", "Introduce a \"general reference\" close reason There is a certain amount of questions that are absolutely trivial in nature: How to format a date, how to concatenate a string, et cetera. Questions that could be solved by taking a look into the manual. Random examples from the tags I frequent: What those OPs need is a link to the right manual, which we should give them. But the question serves no purpose. They don't even have a use by being searchable, because any sane search query would lead to the actual manual as the first hit. Jeff discusses the possibility of introducing a new close reason for this over at According to Robert's suggestion there, it could go like this: general reference: this question is too basic; the answer is indexed in any number of general internet reference sources designed specifically to find that type of information. Please please implement this. Add a field (like the \"enter duplicate ID here\" popup) for users to suggest the correct manual link: The suggested links would then be shown in a block in the top section of the question, like duplicate links. Also, the amount of reputation earnable from these trivial questions is appalling. I'm sure a great portion of most high-rep users' points (including mine) is from answering \"what was that function for replacing a string again?\" type questions. This dilutes the value of reputation as a measure of true expertise a great deal. I would suggest that answers to questions that get closed as \"general reference\" are made community wiki retroactively, taking away any reputation earned.", "Why do you cast downvotes on answers?" ]

[ "What is the \"last\" data that get's backed up, when running pg_dump on a live server? I'm wondering: If I start doing a pg_dump of a very large database (it would take hours), that is still running actively receiving writes, what is then the last data that goes into the backup? Is it: The data as-it-was, at the point in time where the pg_dump command was initiated. The last changes that it encountered at some point where it was dumping that individual record. Something else. Bonus question: If I'm trying to dump a database as part of trying to rescue it from corrupt data, will it then make any difference whether I use the directory format or the custom format?", "I just stumbled upon a : My wife and I's seafood collaboration dinner. How does it look? Sure enough, the top comment immediately points out that it should be \"my wife's and my\". However, a cross-post to the Grammar subreddit produced : It's fine as it is written. \"my wife and I\" is a noun phrase, functioning as a subjective pronoun in the singular and made possessive with the apostrophe. It is exactly the same as \"our\". It seems weird because you would never use \"I's\" on its own but it is not on its own here - it is part of a noun phrase. That's a rather intriguing argument. Does it hold any water?", "Create hexagonal mesh on 3D Parametric Plot and 3D spheres?", "How do I access a specific element in a vector of vectors clojure", "Which IP address do I use to access my server? I'm running a Samba server on my MacBook and I've also set up port forwarding to said server from my router. My public IP is 106.51.x.x (according to google and a few other services) and my Mac's local IP is 192.168.x.x, but when I head to my router's configuration page, it says my external IP is 10.242.x.x. This is what I don't understand, when connected to my home WiFi, using the 10.242.x.x address works just fine. But if I try to access the same over 4G, the connection times out. As for the public address, neither WiFi nor 4G works. Is there some setting on my Mac (I'm running MacOS Sierra) that I must alter to make it visible to the public?", "How to output HTML from JSP block? I just started learning JSP technology, and came across a wall. How do you output HTML from a method in &lt;%! ... %> JSP declaration block? This doesn't work: &lt;%! void someOutput() { out.println(\"Some Output\"); } %&gt; ... &lt;% someOutput(); %&gt; Server says there's no &ldquo;out&rdquo;. U: I do know how to rewrite code with this method returning a string, but is there a way to do this inside &lt;%! void () { } %> ? Though it may be non-optimal, it's still interesting.", "Possible Duplicate: I'm working on a website that displays distance to various locations to the nearest 1/10 mile. One of the developers (a non-native speaker) asked me an interesting question: If the distance is 1.0 mile(s), is that singular or plural? Clearly, anything other that 1.0 is plural, but is it: 1.0 miles away or 1.0 mile away The first option sounds more correct to my ear, but the voice of my elementary school language arts tells me that the latter option is correct. Edit: Added the word 'away' to the example. It doesn't change the question, but might provide clarity for the answer. Also, regarding numbers between 0 and 1, after more thought, I'm not sure that the answer is as clear as I originally thought. See .", "What does a \"CALLBACK\" declaration in C do? I was looking through some code from the library and came across a function declared like this: LRESULT CALLBACK WndProc(HWND hwnd, UINT msg, WPARAM wParam, LPARAM lParam) Now, I'm a Delphi coder. No hablo C muy bien, senor. But I remember enough syntax from my college courses to read it like this: Function name is WndProc. Argument list is pretty self-explanatory. Function return type is LRESULT. But what in the world is that \"CALLBACK\" doing there? In Delphi, any function can be used as a callback; you just need to pass the right type of function pointer. Is there any particular reason why C doesn't work that way? Or does it mean something different?", "Auto generate an Index Is there any way to auto-gererate an index for the makeidx package? I've written ~270 pages and didn't think of adding \\index{} everywhere. Do I really need to go over everything and add \\index{}?", "Why do the less than symbol () appear wrong as upside down exclamation (¡) or question mark (¿)?", "Adding values to a C# array", "I am building a blog type page, and I want to load items into the page as the user scrolls down, much like Google Reader, or Soup.io. How would you go about achieving this effect? I've seen some examples which read the height of the page, and have an onScroll even attached to the window so that as the user scrolls down we can test to see if they've scrolled down far enough to warrant loading more items. Soup.io's implementation seems to remove the old items as you scroll down so that the browser isn't dealing with an ever-increasingly large DOM tree. Which javascript libraries would be best suited to this task?", "The very common beginner mistake is when you try to use a class property \"statically\" without making an instance of that class. It leaves you with the mentioned error message: You can either make the non static method static or make an instance of that class to use its properties. Why? I am not asking for solutions. I would be grateful to know what is the reason behind it. The very core reason! private java.util.List&lt;String&gt; someMethod(){ /* Some Code */ return someList; } public static void main(String[] strArgs){ // The following statement causes the error. You know why.. java.util.List&lt;String&gt; someList = someMethod(); }", "How to set custom keyboard shortcuts from terminal?", "What does it mean for something to hold \"up to isomorphism\"?", "Is there a way to find out if I need a transit visa for Canada? I'm passing through Canada, on my way to somewhere else. I'm staying only a short time. Is there a website, or some other way of find out out if I need a visa?", "Prove $\\mathbb{P}(\\sup_{t \\geq 0} M_t > x \\mid \\mathcal{F}_0)= 1 \\wedge \\frac{M_0}{x}$ for a martingale $(M_t)_{t \\geq 0}$ Let $M$ be a positive, continuous martingale that converges a.s. to zero as $t$ tends to infinity. I now want to prove that for every $x&gt;0$ $$ P\\left( \\sup_{t \\geq 0 } M_t &gt; x \\mid \\mathcal{F}_0 \\right) = 1 \\wedge \\frac{M_0}{x}. $$ My approach: I thought that rewriting the conditional probability to an expectation would help so we obtain that we must prove: $$ \\mathbb{E} \\left[ 1_{\\sup_{t \\geq 0 } M_t &gt; x} \\mid \\mathcal{F}_0 \\right] = 1 \\wedge \\frac{M_0}{x}.$$ A hint to me was given that I should consider stopping the process when it gets above $x$. Thus a stopping time that would do this is $\\tau = \\inf\\{t\\geq 0 : M_t&gt;x\\}$. But now I'm stuck as I want to apply optional sampling results but we have an indicator which complicates things. How could I proceed from this? Any help is appreciated!", "Question is about Ubuntu release process. Are migrations from n to n+1 releases expected? Assuming we have server with installed Ubuntu 14.04 LTS. Will it be smoothly upgradable to Ubuntu 16.04 LTS via apt-get upgrade ? Assumptions: scope is software therefore we assume that given hardware is supported on both releases (upgrading from and to) that's why, always before upgrade you are asked to make backup to be able to revert in case of failure", "Wrong kernel version returned by uname Ubuntu 16.04.1 LT uname -a returns: Linux decebal-mobile 4.2.0-35-generic #40-Ubuntu SMP Tue Mar 15 22:15:45 UTC 2016 x86_64 x86_64 x86_64 GNU/Linux but E: Package 'linux-headers-4.2.0-35-generic' has no installation candidate and my machine says linux headers version is at linux-headers-4.4.0-21-generic. I have seen a similar problem described in a . How can I update that?", "What happens if both players have the ability to pump their creature an unlimited number of times? Say that both players each had 2 , 2 , and a . (Or any other way to get unlimited mana, and a Nantuko Shade). Player 1 attacks with his , and player 2 blocks with his . Before damage is assigned, each has chances to pump up their as much as they want. They can't just declare them to be \"infinite,\" but each can always one-up the other player. What happens? It seems there would be a loop of events, but would one player eventually be forced to break the loop as per rule 714.3? Is it considered the same game state after each player pumps their creature a bunch as it was before? This was discussed at length on the Draw3Cards Magic Q&amp;A site (which is no longer available), but no conclusion was reached. Some felt that the game would simply be a draw, others felt that the active player would be forced to make a different decision to break the loop. Others felt that you would just have to call a judge and see what he decides." ]

[ "Bash is not finding a program even though it's on my path I have a program on my path. The program runs when executed with a full path specified. But the program cannot be found when I run it with just its name. Essentially, I want to understand how the below output is possible, and how to fix it so that my program can actually be found without a full path specified: root:/usr/local/bin# ./siege **************************************************** siege: could not open /usr/local/bin/etc/siegerc run 'siege.config' to generate a new .siegerc file **************************************************** root:/usr/local/bin# echo $PATH /usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games root:/usr/local/bin# siege bash: /usr/bin/siege: No such file or directory root:/usr/local/bin# wtf!?!? I'm on Ubuntu 12.04 using bash. Also please note the warning output from siege is not relevant for the purposes of this question, as I am only interested in whether or not the program can be found and invoked.", "How should tiny $p$-values be reported? (and why does R put a minimum on 2.22e-16?) For some tests in R, there is a lower limit on the calculations of $2.22 \\cdot 10^{-16}$. I'm not sure why it's this number, if there is a good reason for it or if it's just arbitrary. A lot of other stats packages just go to 0.0001, so this is a much higher level of precision. But I haven't seen too many papers reporting $p &lt; 2.22\\cdot 10^{-16}$ or $p = 2.22\\cdot 10^{-16}$. Is it a common/best practice to report this computed value or is it more typical to report something else (like p &lt; 0.000000000000001)?", "I'm attempting to get a better understanding of cryptography and have run into some questions about bcrypt. Bcrypt relies on the blowfish cipher, which is a reversible method of encryption. But bcrypt is not reversible. How is that possible? Or am I mistaken? What does bcrypt do on top of blowfish to make it irreversible? Why does bcrypt use blowfish instead of twofish or threefish?", "The youngest person on Earth in a society of immortals The protagonist is the youngest person on Earth -- the only one to be born in many centuries. Terrestrial society is small but every individual is unique and multitalented, as they are all immortal and have lived for centuries. They live in flying habitats. No one knows how to raise children anymore; the protagonist wears diapers into adulthood because he was never potty-trained, and his education was haphazard. Consequently, he is quite lost in this advanced society, and only tolerated by the sophisticates around him. When the Earth is invaded, the immortals put up only a show of a fight, arriving at the scene of battle in a colorful flotilla of unarmed flying habitats. To the horror of the protagonist, they are wiped out by the invaders. He realizes that the immortals were weary of life and welcomed this end. This is probably a novel, though it might be a novella. It was written in English and I read it probably in the 1970s or 1980s.", "What is the difference between upstream and downstream when referring to who (or where) to go to as a developer or packager?", "Programmatically obtain the phone number of the Android phone", "Square root of an inverse gamma distributed random variable I work on the grouped t copula and try to replicate part of the following paper: &quot;The t copula with Multiple Parameters of Degrees of Freedom: Bivariate Characteristics and Application to Risk Management&quot;, Luo &amp; Shevchenko (2010). My Question: I need the distribution of the following random variable: $$ Y = \\sqrt{\\frac\\nu X} $$ where X is Chi square distributed with v degrees of freedom. I found out that the following random variabe Z is inverse gamma distributed with alpha = v/2 and beta = v/2, $$ Z = {\\frac\\nu X} $$ So, basically I am looking for the distribution of the square root of an inverse gamma distributed random variable. Do you have any ideas?", "How is stock price determined? Is stock price determined only by the last trade that takes place? For example, if a stock I own is trading at $3.42, and I place a Sell Limit order for $0.00, will the stock price temporarily dip to $0.00? Likewise, if I place a Buy Limit order for $100.00 for a stock that is trading at $1.23, will the price spike to $100.00? Is there some sort of \"average price\" that is reported on the stock ticker? Thanks for your help in understanding this!", "How do I check if a list is empty?", "I have a question about MediaWiki formatting. Since this is similar to LaTeX questions, I figured it would have a nice, happy home on Stack Overflow. I'm not quite sure if it's programmer related enough though. What does the community think?", "How to start Skype 4 with Ubuntu 12.10? I've installed Skype and it's running all OK but I want it to start automatically when I log with my user. How can I do that?", "How do I invoke a private static method using reflection (Java)?", "just wondering if anyone has ever tried embedding and actually integrating any js engine into the .net environment. I could find and actually use (after a LOT of pain and effort, since it's pretty outdated and not quite finished) spidermonkey-dotnet project. Anyone with experience in this area? Engines like SquirrelFish, V8.. Not that I'm not satisfied with Mozilla's Spidermonkey (using it for Rails-like miniframework for custom components inside the core ASP.NET application), but I'd still love to explore a bit further with the options. The command-line solutions are not what I'd need, I cannot rely on anything else than CLR, I need to call methods from/to JavaScript/C# objects. // c# class public class A { public string Hello(string msg) { return msg + \" whatewer\"; } } // js snippet var a = new A(); console.log(a.Hello('Call me')); // i have a console.log implemented, don't worry, it's not a client-side code :) Just to clarify - I'm not trying to actually program the application itself in server-side javascript. It's used solely for writing custom user subapplications (can be seen as some sort of DSL). It's much easier (and safer) to allow normal people programming in js than C#.", "When I use the , do I choose the monster to distract (and then the next ally to attack gets advantage) or do I choose the ally and the monster (so that only his attack against that target gets advantage)? Or something else? Help [...] Alternatively, you can aid a friendly creature in attacking a creature within 5 feet of you. You feint, distract the target, or in some other way team up to make your ally’s attack more effective. If your ally attacks the target before your next turn, the first attack roll is made with advantage.", "What happens with the force of gravity when the distance between two objects is 0? so I had my first approximation to the gravity equation \\begin{equation} F=GmM/r^2 \\end{equation} and some questions arose that my teacher couldnt respond: if r approximates to 0 with mM being constant, then the force should tend to infinity, right? so that being true, then if we would travel to the center of the earth, we would be crushed by gravity? if so, how can there be anything right in the center of the earth? wouldnt anything there be compressed and destroyed by the infinite force? having that in mind, my next question is as gravity force is measured from the center of an object, any part of the same object which is not at the center would be affected by the same object's gravity? if so, how can we differentiate between two objects that are not in a vacuum? my question originated thinking in us standing on the earth, in contact with it, are we, in a gravitational sense, one object? this lead to the last question, if gravity is a property of matter, then how applying the same logic as before, how does it work between two neutrons?(chose neutrons because i assumed it would be more difficult obtaining gravitational force if there was electrostatic forces from charges inbetween) do two newtrons in contact count as 1 gravitational object? and how thats its own gravity affect the newtron from center and out?", "I guess I can live with the fact that the changes size drastically when he transforms, but why does his shirt rip off and not his pants? I think that we need a little better answer than \"it keeps us tied to the fact that inside he's still human\".", "I'm playing around with height maps (bitmaps), trying to create some of my own in my game, and for that I need to implement some basic drawing methods. I've quickly realized that drawing straight lines isn't as basic as I thought. It simple's if your points share an X or Y coordinate, or if they are aligned so you can draw a perfectly diagonal line. But in all other cases its trickier. What algorithm do you use to determine what pixels need to be coloured for it to become a \"straight\" line ?", "Which version of NFS is my NFS server using? I'm mounting a NFS filesystem on my machine. How do I figure out what version of the NFS protocol the server uses? I don't have access to the NFS server machine, but I do have root on my client machine. Is there anything I can run on my client machine to identify what version of the NFS protocol is being used by the server, or what versions it supports? I wasn't able to find any useful information in /var/log/messages or kernel debugging output (dmesg). I have tried running nfsstat, but I'm not sure if it is giving me any useful information. However, when I run nfsstat -s to request information about the server, I don't see anything useful: # nfsstat -s Server rpc stats: calls badcalls badfmt badauth badclnt 0 0 0 0 0 When I run nfsstat -c to request information about the client, I do see some information about Client nfs v3, but I'm not sure how to interpret this. Does this tell me anything about the protocol being used between my client machine and the NFS server? Does it mean I am currently using v3 of the NFS protocol? Does it tell me anything about what versions of the NFS protocol the server supports, e.g., NFS v4?", "Probability of a painted cube being reassembled into itself Suppose 27 cubes are stacked together, suspended in the air, to form a larger cube. The cube is then painted on all the exposed surfaces and dried. The smaller cubes are then randomly permuted in both spatial position and spatial orientation to form another large cube. What is the probability that new larger cube is identical to the original? This is not homework, it was passed on by a friend who found it somewhere on the internet, and they do not remember where.", "Deleting my own question" ]

[ "What white point temperature should I set my LCD monitor to? I've got the Xrite Eye One Display 2, and tried the advanced calibration today for the first time. It asked what white point I wanted, and had a default of 6500K. I didn't realize that was up for discussion! I would have assumed the daylight temperature, around 5500K, would be desired. What temperature do I want my whites to be? Why can't white just be white?!", "In classical logic, why is $(p\\Rightarrow q)$ True if $p$ is False and $q$ is True? Provided we have this truth table where \"$p\\implies q$\" means \"if $p$ then $q$\": $$\\begin{array}{|c|c|c|} \\hline p&amp;q&amp;p\\implies q\\\\ \\hline T&amp;T&amp;T\\\\ T&amp;F&amp;F\\\\ F&amp;T&amp;T\\\\ F&amp;F&amp;T\\\\\\hline \\end{array}$$ My understanding is that \"$p\\implies q$\" means \"when there is $p$, there is q\". The second row in the truth table where $p$ is true and $q$ is false would then contradict \"$p\\implies q$\" because there is no $q$ when $p$ is present. Why then, does the third row of the truth table not contradict \"$p\\implies q$\"? If $q$ is true when $p$ is false, then $p$ is not a condition of $q$. I have not taken any logic class so please explain it in layman's terms. Administrative note. You may experience being directed here even though your question was actually about line 4 of the truth table instead. In that case, see the companion question And even if your original worry was about line 3, it might be useful to skim the other question anyway; many of the answers to either question attempt to explain both lines.", "Getting disk i/o statistics for single process in Linux", "I am sitting inside a closed room with a cement ceiling just above my head. The pressure of the atmosphere is exerted on the ceiling from above(outside). But solid cement not being a fluid does not transport that pressure into my room. But i still feel the atm pressure which has no way to be transported into the room.I do not boil to death or anything. How does this happen?", "$G/Z$ cannot be isomorphic to quaternion group", "Can't see a glass object through another glass object in Eevee", "Find $\\lim_{x \\to 0} (\\frac{\\tan(x)}{x})^{\\frac{1}{x}}$ Find $$\\lim_{x \\to 0} (\\frac{\\tan(x)}{x})^{\\frac{1}{x}}$$ My first idea to solve this was to try to evaluate it and then apply the L'Hospital's rule. This is what I managed to achieve: $$\\left(\\frac{\\tan(x)}{x}\\right)^\\frac{1}{x}=e^{\\frac{1}{x}\\ln\\left(\\frac {\\tan(x)}x \\right)} $$ However, this is problematic, because the L'Hospital's rule is not applicable in the exponent, therefore my transformation was not a good shot. What transformation should I apply to get the desired form?", "\"To work for\" vs. \"to work in\" vs. \"to work at\"", "solution :- $21= 3 \\times 7$ there is only one Sylow $3$ and Sylow $7$ subgroup so, Sylow $3$ and Sylow $7$ subgroup are normal in group $G$ so $G$ is cyclic group of order $21$. Am I right ? somebody told me that group of order $21$ is not cyclic. he gave me this . If group of order 21 is not cyclic, then can we understand it by Sylow method ?", "More than once I've accidentally run a number of commands and polluted my bash history. How do I close my terminal without saving my bash history? I'm using Fedora.", "Why can't enum's constructor access static fields? Why can't enum's constructor access static fields and methods? This is perfectly valid with a class, but is not allowed with an enum. What I'm trying to do is store my enum instances in a static Map. Consider this example code which allows lookup by abbreivation: public enum Day { Sunday(\"Sun\"), Monday(\"Mon\"), Tuesday(\"Tue\"), Wednesday(\"Wed\"), Thursday(\"Thu\"), Friday(\"Fri\"), Saturday(\"Sat\"); private final String abbreviation; private static final Map&lt;String, Day&gt; ABBREV_MAP = new HashMap&lt;String, Day&gt;(); private Day(String abbreviation) { this.abbreviation = abbreviation; ABBREV_MAP.put(abbreviation, this); // Not valid } public String getAbbreviation() { return abbreviation; } public static Day getByAbbreviation(String abbreviation) { return ABBREV_MAP.get(abbreviation); } } This will not work as enum doesn't allow static references in its constructor. It however works just find if implemented as a class: public static final Day SUNDAY = new Day(\"Sunday\", \"Sun\"); private Day(String name, String abbreviation) { this.name = name; this.abbreviation = abbreviation; ABBREV_MAP.put(abbreviation, this); // Valid }", "Check if partition is encrypted", "Add a time limit before you can vote on a post There needs to be a timer or something on upvoting/downvoting. I posted an answer to a question and as soon as the page loaded, my answer was already down voted. There is no way someone had the time to read the answer &lt; 10 seconds after it was posted.", "A linking verb is a verb which connects a subject to its predicate without expressing an action. A linking verb is used to re-identify or describe its subject. Ex: Alan is a beast. Alan seems drunk. But I would say that some linking verbs can be used with \"continuous tenses\" &amp; other linking verbs can not, but I am not sure. (linking verb) to experience a particular feeling or emotion Ex: I’m feeling a little better today. Do you still feel hungry? So, feel in this meaning can be used with continuous tenses But I would think this sentence \"Do you still feel hungry?\" does not make much sense because it uses \"simple present tense\" which expresses something that happens regularly. Noone would feel hungry regularly. So, that sentence \"you feel hungry\" would mean \"you always feel hungry\". (linking verb) (not used in the progressive tenses): to have a particular physical quality which you become aware of by touching adj. The water feels warm. Its skin feels really smooth. says \"Speakers sometimes use the Simple Present to express the idea that an action is happening or is not happening now. This can only be done with Non-Continuous Verbs and certain Mixed Verbs.\" so, \"The water feels warm.\" could mean \"The water is always warm\" (simple present expressing things that happen regularly - more or less permanent action) But \"The water feels warm.\" could mean \"The water is warm now\" (simple present with non-continuous verb expressing things that is happening now - a temporary action) : (linking verb) to seem; to appear adj. to look pale/happy/tired That book looks interesting. In dictionary, (linking verb) (not used in the progressive tenses): to give the impression of being or doing something adj. She didn't appear surprised at all. (to somebody) (to be) something (not used in the progressive tenses): to give the impression of being or doing something (synonym: appear) adj. You seem happy. So, we cannot say \"you are seeming happy\" or \"you are appearing happy\". But I am not sure I can say \"You are looking good\" (sounds right to my ears) or \"That book is looking interesting.\" (doesn't sound right to my ears) But we can say \"The future’s looking good.\" () So, some verbs has the same meaning but one can be used with \"continuous\" &amp; the other can not, right? Ex: \"you are looking happy\", but \"you seem happy\".", "How can I immediately detect when new files added to a folder within a script? I would like the script to process files as soon as they are created in the folder. Are there any methods aside from scheduling a job that checks for new files each minute or so?", "The symmetric cryptosystem one-time pad (OTP) seems to be very beautiful since it is perfectly secret according to Shannon. Many books, however, point out the main drawback: one must create a secret key the same length as the plaintext. For this reason, the concept of perfect secrecy has these days been abandoned, and we prefer other cryptosystems. Now, for example, suppose I want to encode my text message with the ASCII scheme, and moreover suppose that this plaintext is 10 gigabytes long, therefore (using an OTP) the key must be the same length, 10 gigabytes. I think, however, this is a ''sustainable price'' because I'm sure that the ciphertext can't be attacked. Practically, I don't understand why having such long keys with an OTP is a big disadvantage if we reach \"the dream\"-- namely, perfect secrecy. Nowadays the storage of information is very easy, so what is the real problem? I can, for example, share the \"long key\" in person.", "Determine all $f: \\mathbb{R} \\rightarrow \\mathbb{R}$ such that, for all $x, y \\in \\mathbb{R}$, $$f((x + 1) f(y)) = y (f(x) + 1).$$ Source: Vuong Lam Huy, on a Facebook group.", "Prove that $2xy\\mid x^2+y^2-x$ implies $x$ is a perfect square. Prove that $2xy\\mid x^2+y^2-x$ implies $x$ is a perfect square. My work: $2xy\\mid x^2+y^2-x \\implies x^2+y^2-x=2xy\\cdot k$ So,$x^2+y^2+2xy-x=(x+y)^2-x=2xy \\cdot (k+1)$ And,$x^2+y^2-2xy-x=(x-y)^2-x=2xy \\cdot (k-1)$ I found that for $x,y$ both odd, no solution exists. For $x$ even, and $y$ odd,no solution exists. Solution exists only for $x$ odd, $y$ even and $x$ even and $y$ even solution exists. Cannot do anything more. Please help!", "i just finished updating my Macbook pro to macOS Catalina and after the installation finished i got this error message that keeps reappearing. i do not know or have a file named \"qnmqkmkrqwfq\" (i tried searching for it) and when i press show in finder or ok it disappears for a second and then pops up again for no reason and i am not trying to open any files or apps. i searched and the only solution i found was setting \"Allow applications downloaded from: Anywhere\" but it did not work. Please Help.", "Does a creature with Lifelink provide lifegain equal to its power, or the defender's toughness?" ]

[ "How to perform orthogonal regression (total least squares) via PCA? I always use lm() in R to perform linear regression of $y$ on $x$. That function returns a coefficient $\\beta$ such that $$y = \\beta x.$$ Today I learned about total least squares and that princomp() function (principal component analysis, PCA) can be used to perform it. It should be good for me (more accurate). I have done some tests using princomp(), like: r &lt;- princomp( ~ x + y) My problem is: how to interpret its results? How can I get the regression coefficient? By \"coefficient\" I mean the number $\\beta$ that I have to use to multiply the $x$ value to give a number close to $y$.", "When do we not put a comma before \"because\"? In what situation do you put a comma before \"because\"? And, when do you not put a comma before \"because\"? I've always assumed that you put a comma, because the clause introduced by \"because\" will always be independent, because it cannot stand on its own, because it wouldn't make sense on its own. Is this the case? Could you think of an example where it doesn't take a comma?", "How to convert a factor to integer\\numeric without loss of information?", "How to set the close-laptop-lid-action?", "How can I make environment variables \"exported\" in a shell script stick around? I have multiple Amazon EC2 accounts and want to quickly be able to switch variables, such as $EC2_HOME, using a script. I have have a shell script set up like this: #!/bin/sh export EC2_HOME=/home/me/.ec2 echo $EC2_HOME When I run the script I know that EC2_HOME is set, but I thought that using export would make the variable stick around after the script completed. It does not, as running echo $EC_HOME does not show anything. I know this must be very rudimentary Linux scripting knowledge, but I don't know it. I tried looking for related questions without luck - so my apologies if this is a duplicate.", "Is verbatim copying several paragraphs of text with citation considered plagiarism? Is it plagiarism if I copy several paragraphs from another's source (let's say a CS paper) into my work and then footnote Source: ..., for example, as background information?", "Remember all opened files with split windows and their positions in Emacs", "How can I give other drives and partitions short, meaningful names in nautilus? In nautilus and Unity the external drive has a nice short descriptive name \"mcat\", but all partitions on the 4 internal drives are displayed as a size (834 GB filesystem) or a huge 32-character string form of a GUID: I'm guessing the external drive is nice, short, sweet and readable because that drive may have no partitions (well, just one I guess) and that name may be the drive label, whereas partitions usually don't have names. That may explain my problem, but doesn't solve it. Is there some way to give reasonable names to these partitions in nautilus and Unity?", "Can the most important information of reputation audit appear first? I regularly find myself having to scroll to the bottom of the reputation audit to find all the good stuff that appears last. On my computer this is a single key press, but on my mobile it takes 30 seconds of scrolling. Lord alone knows how long it would be for Jon Skeet! Since the principles of good user experience suggest putting the most important information first, why not do the same here? I never look at my first 5 days of rep gathering. But I often look at the current day, the true rep, days with 200 rep (hunting legendary badge!), trigger recalc etc. Pretty please, can we have it up top?", "How to make mesh lights work in Blender Eevee? The closest I can get to making mesh lights affect their environment in Blender Eevee is giving them an Emission material and turning on \"Bloom\". But this isn't emitting proper light, it just looks like it is, but it doesn't light the surroundings whatsoever. I would like to be able to light a scene with meshes without having to put point lamps everywhere just to make them emit light.", "Which one of these two statements is correct? Our staff do ... Our staff does ... And is staffs ever correct?", "How to vertically center content with variable height within a div?", "Is Cursed Child canon to the original story? From what I am hearing the stage-play called The Cursed Child is based on the characters from the Harry Potter series. It is set 19 years from the end of Deathly Hallows (i.e. When Harry's children are starting their time at Hogwarts). I have also seen the J.K. Rowling has had at least some involvement and been on the set and a part of rehearsals, etc. My question is has there been a statement given relating to the canon of the stage play to original series? If so, would any conflicting information be considered a retcon? Related: - but not dupe because this asking about in-universe information.", "Why are most of the main characters White/English in Game Of Thrones?", "How to run a server on port 80 as a normal user on Linux? I have Googled about a solution for quite some time, but couldn't find an answer. I am on Ubuntu Linux and want to run a server on port 80, but due to security mechanism of Ubuntu, I get the following error: java.net.BindException: Permission denied:80 I think it should be simple enough to either disable this security mechanism so that port 80 is available to all users or to assign required privileges to the current user to access port 80.", "We had a small widget that allowed customers to share records that were set to a private sharing model in our community. Everything was rather simple and it would simply allow them to select users that were visible via Sharing Sets and create an __Share record in APEX. I've been reported recently that an error is thrown but only on the community side of things. Nothing seems to be working where it was working. We are using Customer Community Plus licenses. The error being thrown is : System.TypeException: DML operation INSERT not allowed on &lt;Object&gt;__Share which seemed to indicate access not available on the object. That seems odd because they are able to interact with the object just fine in order to create/edit/delete them. I looked up the Sharing Model (its private both internally and externally), I looked at the profile and their access and the sharing sets in the community. Like I said, they seem to interact fine with the objects when it comes to seeing the records and their right. Additionally, standard license users can use the component fine and also share with community users without a problem. They also see the records as expected. Am I missing an update or something that seem to make it so this doesn't work anymore? Anyone having trouble with this or encountered the same problem?", "$E(|X-Y|)$ for $X$, $Y$ i.i.d and uniform on $[0,1]$ What is $E|X-Y|$ when $X$, $Y$ are i.i.d and uniform on $[0,1]$? I want to do something like $$ E(|X-Y|)=\\iint_{x&gt;y}(x-y)\\;dxdy+\\iint_{y&gt;x}(y-x)\\;dxdy=2\\iint_{x&gt;y} (x-y)\\;dxdy $$ But am not sure how to solve that last double integral or if this setup is right.", "Prove: $\\binom{n}{0}F_0+\\binom{n}{1}F_1+\\binom{n}{2}F_2+\\cdots+\\binom{n}{n}F_n=F_{2n}$ Prove: $\\binom{n}{0}F_0+\\binom{n}{1}F_1+\\binom{n}{2}F_2+\\cdots+\\binom{n}{n}F_n=F_{2n}$; I was stuck with this question for a while... Help me please!!! Thanks!!!", "What is this icon depicting a phone and Wi-Fi together?", "I have a 64-bit version of Ubuntu 13.10. I want to run a 32-bit version of a program. However I see ia32-libs is not included in 13.10. Is there a replacement package for this or what?" ]

[ "The product of all the elements of a finite abelian group I'm trying to prove the following statements. Let $G$ be a finite abelian group $G = \\{a_{1}, a_{2}, ..., a_{n}\\}$. If there is no element $x \\neq e$ in $G$ such that $x = x^{-1}$, then $a_{1}a_{2} \\cdot \\cdot \\cdot a_{n} = e$. Since the only element in $G$ that is an inverse of itself is the identity element $e$, for every other element $k$, it must have an inverse $a_{k}^{-1} = a_{j}$ where $k \\neq j$. Thus $a_{1}a_{1}^{-1}a_{2}a_{2}^{-1} \\cdot \\cdot \\cdot a_{n}a_{n}^{-1} = e$. If there is exactly one $x \\neq e$ in $G$ such that $x = x^{-1}$, then $a_{1}a_{2} \\cdot \\cdot \\cdot a_{n} = x$. This is stating that $x$ is not the identity element but is its own inverse. Then every other element $p$ must also have an inverse $a_{p}^{-1} = a_{w}$ where $p \\neq w$. Similarly to the first question, a rearrangement can be done: $a_{1}a_{1}^{-1}a_{2}a_{2}^{-1} \\cdot \\cdot \\cdot xx^{-1} \\cdot \\cdot \\cdot a_{n}a_{n}^{-1} = xx^{-1} = e$. And this is where I am stuck since I proved another statement. Any comments would be appreciated for both problems.", "Installing debian package through Synaptic I want to install a .deb file. After going through various questions, I came across these three options: dpkg, GDebi and Ubuntu Software Center. However, I want to install the. Deb file via Synaptic Package Manager only. Is there any method by which I can install. Deb file as well as all it's dependencies via Synaptic Package Manager?", "What is this \"answer your own question\" jazz? I showed up here to write a perfectly normal rant about misaligned pixels, and there's a big fat checkbox cluttering up the \"Ask\" page: WHAT THE EEEEK IS THIS NEW ABOMINATION?", "Understanding Join Attributes by Location in QGIS? I wonder if there is somewhere an explanation for the parameters that can be set when running the Algorithm \"Join Attributes by Location\" in QGIS 2.18. I had a look here: but there is no explanation. Any hints?", "Is it better in C++ to pass by value or pass by constant reference? I am wondering which is better practice. I realize that pass by constant reference should provide for better performance in the program because you are not making a copy of the variable.", "Here is a simple table. I want to merge 4 cells. I want to combine the three \"this\" cells area in this table. I thought I have to use multirow and multicolum at same time. However, I could not find how to use it. If possible, could you post the modified LaTeX source code? My LaTeX code: \\documentclass{article} \\usepackage{multirow}% http://ctan.org/pkg/multirow \\usepackage{hhline}% http://ctan.org/pkg/hhline \\begin{document} \\begin{table}[ph] \\begin{center} \\begin{tabular}{c|c|c|c|c} \\hline \\multirow{2}{*}{Raaa (k)} &amp; \\multicolumn{4}{c}{C ()} \\\\ \\hhline{~----} &amp; 3.3 &amp; 2.5 &amp; 1 &amp; 0.5 \\\\ \\hline \\multirow{2}{*}{Raaa (k)} &amp; \\multirow{2}{*}{this} &amp; this &amp; 0.5 &amp; 0.6\\\\ \\hhline{~~~--} &amp; &amp; this &amp; 0.7 &amp; 1.2 \\\\ \\hline \\end{tabular} \\caption{R, C ripple size} \\label{T:peak} \\end{center} \\end{table} \\end{document}", "filling area between 2 functions, with shading", "Creating Text Elements using ArcPy?", "Is $x^x=y$ solvable for $x$? Given that $x^x = y$; and given some value for $y$ is there a way to expressly solve that equation for $x$?", "Javascript - Change html tag type", "Coming from a programming background, where should I start to learn web design? I'm a web developer mainly working in front end developing. My main fields are HTML5, CSS3 and Flash ActionScript 3.0. Here in Iran, teamwork means nothing for most of the people, but I think it's the most important aspect of our work, especially in web design. I have poor skills in graphic design and UI design. I always have to work with graphic designers for my websites. They are usually good and skilled designers. But they are all print designers and unfortunately they know nothing about the web and designing for it. For example, one of the designers that I work with most of the time is a great designer and he won a couple awards for his logo and poster designs. However, he knows nothing about the web and most of my time is spent explaining to him how things work on the web, i.e. in what size he should work, using pixels instead of centimeters, and so on... After all he is a print designer, not a web designer. They often think everything is static and constant, not in motion. So the best way to work around this is to improve my skills in graphical designing. I just want to be able to design good layouts, make good color selections, and etc for my websites. I do not want to design illustrations and do heavy graphical works. Just design websites with no Photoshop illustrations like posters and etc. What do you do for your graphic works, and if you do them yourself, which books or references do you suggest I read? Where should I start?", "I'm practicing proofs and given the following statement: Let $\\Sigma$ be an alphabet, $\\epsilon$ the empty word and $\\sigma:\\Sigma^{*}\\rightarrow\\Sigma^{*}$ an operation which for $a\\in\\Sigma$ and $w\\in\\Sigma^{*}$ is defined as $$\\sigma(\\epsilon)=\\epsilon,\\\\\\sigma(wa)=a\\sigma(w).$$ I would like to prove through induction that $\\sigma$ is equal to the word reversal operation $rev$ meaning that $\\sigma(w)=rev(w)=w_{n}...w_{1}$ for every $w=w_{1}...w_{n}\\in\\Sigma^{*}$. My suggestion is as follows: For $w=\\epsilon$ we have $$\\sigma(w)=\\sigma(\\epsilon)=\\epsilon=rev(\\epsilon)=rev(w).$$ Let $w=xa$ with $x\\in\\Sigma^{*}$ and $a\\in\\Sigma$, then $$\\sigma(x)=x_{n}...x_{1}=rev(x).$$ Thus we also have $$\\sigma(w)=\\sigma(xa)=\\sigma(x_{1}...x_{n}a)=a\\sigma(x_{1}...x_{n})=ax_{n}\\sigma(x_{1}...x_{n-1})=...=ax_n...x_{1}=rev(x_{1}...x_{n}a)=rev(xa)=rev(w).$$ Does that constitute a correct and sufficient proof? If not, I would very much appreciate your feedback.", "Seriously, it was fun and all, but I can't and I don't want to stay married to the same woman for the rest of my life - one real life marriage is enough.. Is there a lawyer or process of some kind in the world of Skyrim, and if not, who could help me divorce her? If all else should fail, (sigh), do I have to take her to the backyard, thwack her head with the shovel and dig a shallow grave?", "Expandably change letter case and use inside \\csname, without a package I want to change the letter-case of a single character argument, and use that changed letter inside a \\csname. And I want to do it without an additional package. For example, I want to pass a macro the letter {S}, and have it execute the macro \\csname macros\\endcsname, or pass it the letter {T}, and have it execute the macro \\csname macrot\\endcsname. In my MWE, I show three approaches: I didn't expect \\lowercase to work, since I recall reading that it is not truly expanded until the last possible moment. Surprisingly, it goes into an \\edef okay, but it must not be truly expanded, because it breaks the \\csname. I also formulated an approach where I used \\numexpr to add 32 to the ASCII code of the argument and perform a \\char upon that result. Like \\lowercase, it gives the appearance of being expandable, but it also fails inside the \\csname. I finally achieve success with the stringstrings package. Having written the package, I know the conversion was not pretty... essentially, it is an exhaustive 26-fold check of the form \\if #1Aa\\else\\if #1Bb\\else\\if #1Cc\\else...\\fi\\fi\\fi, which has the virtue that it can be expandably placed into an \\edef, and so it works. There has to be a better way. The MWE works only because I use the inefficiently calculated \\tmp from METHOD 3 inside the \\csname. If I use \\tmp from either of the two earlier methods, it breaks. \\documentclass{article} \\usepackage{stringstrings} \\def\\macros{Expandably converted an S to a s} \\def\\macrot{Expandably converted a T to a t} \\newcommand\\convert[1]{% %MAKE THE ARGUMENT LOWER CASE 1) LOWERCASE\\\\ \\edef\\tmp{\\lowercase{#1}}% PRETENDS TO EXPAND, BUT FAILS IN \\csname Here is the ``expanded'' conversion: \\tmp\\\\ % OR 2) ASCII CONVERSION\\\\ \\edef\\tmp{\\expandafter\\char\\numexpr`#1+32\\relax}% PRETENDS TO EXPAND, BUT FAILS IN \\csname Here is the ``expanded'' conversion: \\tmp\\\\ % OR 3) STRINGSTRINGS PACKAGE\\\\ \\caselower[q]{#1}\\def\\tmp{\\thestring}% WORKS BUT USES A PACKAGE Here is the ``expanded'' conversion: \\tmp\\\\ % Now use it in a csname: \\csname macro\\tmp\\endcsname% } \\begin{document} \\convert{S}\\par \\convert{T} \\end{document} SUMMARY OF ANSWERS: I have added egreg's code snippets into this MWE to produce a document (and not just terminal output), showing the methods put forth to this point: \\documentclass{article} %%%%%%%%%%%%%%%%%%%%%%%%%%%% L3 APPROACH \\usepackage{expl3} \\ExplSyntaxOn \\cs_set_eq:NN \\Xexplower \\tl_expandable_lowercase:n \\ExplSyntaxOff %%%%%%%%%%%%%%%%%%%%%%%%%%%% EGREG'S LESS HACKY SOLUTION \\def\\explowerchar#1{% \\ifcase\\numexpr`#1-`A\\relax a\\or b\\or c\\or d\\or e\\or f\\or g\\or h\\or i\\or j\\or k\\or l\\or m\\or n\\or o\\or p\\or q\\or r\\or s\\or t\\or u\\or v\\or w\\or x\\or y\\or z\\else #1\\fi } \\def\\explower#1{% \\doexplowerchar#1\\relax } \\def\\doexplowerchar#1{% \\ifx#1\\relax \\else \\explowerchar{#1}\\expandafter\\doexplowerchar \\fi } %%%%%%%%%%%%%%%%%%%%%%%%%%%% STEVE'S HACKY PACKAGE APPROACH \\usepackage{stringstrings} %%%%%%%%%%%%%%%%%%%%%%%%%%%% \\def\\macros{Expandably converted an S to a s} \\def\\macrot{Expandably converted a T to a t} \\begin{document} \\textbf{Steve's hacky approach} \\caselower[q]{S}\\csname macro\\thestring\\endcsname\\par \\caselower[q]{T}\\csname macro\\thestring\\endcsname \\textbf{egreg's less hacky approach} \\edef\\lcstring{\\explowerchar{S}}\\csname macro\\lcstring\\endcsname\\par \\edef\\lcstring{\\explower{T}}\\csname macro\\lcstring\\endcsname \\textbf{L3 approach} \\edef\\lcstring{\\Xexplower{S}}\\csname macro\\lcstring\\endcsname\\par \\edef\\lcstring{\\Xexplower{T}}\\csname macro\\lcstring\\endcsname \\end{document}", "Why won't SparseArray let me store values with the head List?", "Where can I find historical data on arrival and departure times of a particular flight? Where can I find historical data on flights, specifically Delta international flights? I need to find out about cancellations, diversions and any other flight data pertaining on particular route at a given time. This source has to be official and stand up to legal scrutiny.", "How do you end with a single quote followed by a double quote?", "I have my A* pathfinding algorithm right now working such that given a graph it can find the route from one starting node to one goal node. This works well for many problems, but sometimes I find that multiple goal nodes are valid. For example, in a game, an NPC might have to go to a switch to shut a door. If there are multiple switches that shut the door in question, it doesn't matter which switch it goes to - it just needs to go to one of them. How can I augment my pathfinding algorithm to find the path to the best goal (the shortest path)? As in, the algorithm searches for multiple goals and when it finds just one, it returns the path to that one. One solution would be to run the algorithm as many times as there are valid goals, but you can guess why that might be inefficient.", "Use LaTeX to produce Epub", "If I have $f:\\mathbb{R}\\rightarrow\\mathbb{R}$ such that $f$ is onto and $f\\circ f\\circ f = f$, how can I prove that $f$ is bijective? I know that I only have to prove that it is 1-to-1 because I'm given the fact that it's onto, but how can I use the fact that $f\\circ f\\circ f=f$ to prove that it is 1-to-1? Thanks!" ]

[ "Find $\\lim_{n \\to \\infty} \\left[\\frac{(n+1)^{n + 1}}{n^n} - \\frac{n^{n}}{(n-1)^{n-1}} \\right]$ (a question asked at trivia) My friend's trivia league had this math question: $$\\lim_{n \\to \\infty} \\left[\\frac{(n+1)^{n + 1}}{n^n} - \\frac{n^{n}}{(n-1)^{n-1}} \\right]$$ After computing a few values, one could guess the answer is $e$ = 2.718...But how can we prove that is the limit? Someone offered up a hand-wavy proof like this: \\begin{align} \\lim_{n \\to \\infty} \\left[\\frac{(n+1)^{n + 1}}{n^n} - \\frac{n^{n}}{(n-1)^{n-1}} \\right] &amp; = \\lim_{n \\to \\infty} \\left[\\frac{(n+1)(n+1)^{n}}{n^n} - \\frac{n \\cdot n^{n-1}}{(n-1)^{n-1}} \\right] \\\\ &amp;= \\lim_{n \\to \\infty} \\left[(n+1)\\frac{(n+1)^{n}}{n^n} - n\\frac{n^{n-1}}{(n-1)^{n-1}} \\right] \\\\ &amp;= \\lim_{n \\to \\infty} \\left[(n+1)\\left(1 + \\frac{1}{n} \\right)^n - n\\left(\\frac{n - 1 + 1}{n-1} \\right)^{{n-1}} \\right] \\\\ &amp;= \\lim_{n \\to \\infty} \\left[(n+1)\\left(1 + \\frac{1}{n} \\right)^n - n\\left(1 + \\frac{1}{n-1} \\right)^{n-1} \\right] \\\\ &amp;= \\lim_{n \\to \\infty} \\left[(n+1)e - n \\cdot e \\right] \\\\ &amp;= \\lim_{n \\to \\infty} e \\\\ &amp;= e \\end{align} The part about substituting $e$ is hand-wavy since technically this is an indeterminate form of $\\infty - \\infty$. And using $e$ as as upper bound did not lead me to an easy proof either. Is there a way to rigorously prove the limit? I tried a few approaches: (a) sandwiching the limit--I could prove $e$ was a lower bound, but I could not find a suitable upper bound converging to $e$, (b) using L'Hopital's rule with no luck, (c) using the mean value theorem--but that also got complicated. So this is a pretty tough problem to ask at trivia! Is there a way to prove this limit formally? Sources Trivia question: Thread on trivia: Hand-wavy proof: Idea for mean value theorem:", "I really tried hard to do this on my own, but I keep failing ... Using multi-column and multi-row commands confused me. I know some of you might frown upon such a request but I really need help getting this table implemented .. So I'm sorry if I upset anyone. My preamble has : \\documentclass[12pt,a4paper]{report} \\usepackage[lmargin=3.81cm,tmargin=2.54cm,rmargin=2.54cm,bmargin=2.52cm]{geometry} \\linespread{1.5} Is there a way I can convert this from excel to LaTeX form ? I tried an add-in before but it didn't work for me. Also online generators cannot combine cells the way I want them (unless I didn't find a better table generator ? )", "Shows \"unable to locate package unzip\" error I have installed Ubuntu 12.04 server , shows E:unable to locate the package unzip the above error is also shown, if I try to install packages also. Can any one help me out to get out from this error.", "What is the preferred way to mention Stack Overflow from Twitter? I wanted to tweet something on the lines of \"Stack&nbsp;Overflow is awesome\". When I do this kind of stuff, I usually use a username (for example: ) or a hashtag () I found , but it seems it is from someone unrelated with Stack&nbsp;Overflow. Is there a Twitter account I can reference, or should I use a hash-tag? Should I just point to the site? Thanks! (Notice: I've seen lots of questions regarding Twitter and Stack&nbsp;Overflow, but those are mostly about integration/login with Twitter for the users accounts; I'm just asking for a single account for Stack&nbsp;Overflow; probably for announcements and PR, which is different)", "Using biblatex and Biber, I want my bibliography to say \"Ph.D. thesis\" (with periods) rather than \"PhD thesis\" (without). MWE: \\documentclass{article} \\usepackage{biblatex} \\addbibresource{refs.bib} \\begin{document} Hello \\cite{testphd} \\printbibliography \\end{document} and refs.bib: @thesis{testphd, title = {Thesis Title}, author = {Surname, Firstname}, date = {2010}, institution = {Faculty of X, University of Y}, type = {phdthesis}, location = {Somewhere}, } Output: What's the easiest way to do this? I don't want to change the .bib file ideally.", "A company is any form of business whether it is small or large. Generally the term &quot;company&quot; indicates a particular kind of business dealing in a specific product. An organisation is the larger form and generally comprises of a number of companies. Simply, a company is an organization, but an organization is not just a company. An industry is the combination of companies in same line of business. Firm, corporation and business are synonyms of &quot;company&quot;. An Agency is a particular kind of company, which serves as an intermediary between clients (other companies or individuals). Is this correct?", "Creating intuition about Laplace & Fourier transforms", "How can I convert my Java program to an .exe file? If I have a Java source file (*.java) or a class file (*.class), how can I convert it to a .exe file? I also need an installer for my program.", "Extend tourist visa stay in USA due to coronavirus and waive I-539 fee My mom has come to US on a tourist visa and her I-94 expires on the first week of May. Due to the coronavirus, travel restrictions have been imposed in our home country (India). Also we want to avoid the risk of traveling in flights at this time. Is there an easy way to to extend her stay in the US by one or two months? I am aware that we should fill out an to extend our stay. But in-order to submit the online application it requires a fee of $370. Is filing I-539 the easiest way to extend her stay at this time? If so, is it possible to waive the fee due to the coronavirus situation? After filing I-539 should she wait for an approval to continue her stay? Or is the receipt good enough? Can you please help me with these? Thanks! [Edit 1]: With the current situation of the virus, traveling anywhere sounds like a very risky operation, especially for elders. That is the main reason behind this question. If the US government will allow visitors to overstay until Covid-19 settles down!", "Calling Non-Static Method In Static Method In Java", "Has user testing found that the \"three horizontal bars\" for main menu on mobile is commonly understood? \"Three horizontal lines\" aka \"hamburger icon\" seems to be becoming a convention for the \"main menu\" button, especially on mobile sites: Has anyone done any user testing of this convention, or got any A/B testing results? (i.e. is there an increase in bounce rate compared to using the word \"Menu\"?) I did some quick user testing with wireframes featuring this icon for the main menu. 3 out of 6 people got it and used it. The others did not. One person in particular had a lot of trouble \"getting back to the top\" (i.e. restarting their navigation from the top level of the site) as they didn't know about the convention, or that the logo would link to the home page. I guess it will be different for different demographics - users of Facebook on mobile probably know it. Anyone got any findings they can share?", "How to compute the size of the allocated memory for a general type", "The only things I've found so far are a cart method (which ceased working in 1.6), a dispenser method (utilizing the decay on dropped items, but this requires occasional feeding), and a binary counter (which won't work for a single input but rather a fluctuating one). I want to have a circuit that when I apply an input signal, the output signal doesn't change for 2 to 5 minutes. When the input turns off, I again want a 2 to 5 minute delay. I could accomplish this with (roughly) 240 to 600 redstone repeaters, but this is far in excess of being useful. The only method I can think of, but would require a XOR gate (on the button-input and final output) to start and stop a clock attached to a binary counter. While I can make room for a device of this size, I was hoping for something simpler.", "Does the cross-entropy cost make sense in the context of regression? Does the cross-entropy cost make sense in the context of regression (as opposed to classification)? If so, could you give a toy example through TensorFlow? If not, why not? I was reading about cross-entropy in by Michael Nielsen and it seems like something that could naturally be used for regression as well as classification, but I don't understand how you'd apply it efficiently in TensorFlow since the loss functions take logits (which I don't really understand either) and they're listed under classification", "Proof of Frullani's theorem", "\"+-=,;...\" math characters in DejaVu Sans (with mathspec) the following MWE \\documentclass{minimal} \\usepackage{mathspec} \\setmainfont{DejaVu Sans} \\setmathsfont(Digits,Latin,Greek){DejaVu Sans} \\setmathrm{DejaVu Sans} \\begin{document} \\(\\mathrm{e}^{\\mathrm{i}\\pi}=-1\\) = -1 \\end{document} typesets with xelatex into How can I turn the = and - signs in math mode to DejaVu Sans ?", "I've noticed a MATCH SIMPLE and MATCH FULL, but I don't understand what they do. I see default is MATCH SIMPLE; but, how do the other MATCH clauses to the FOREIGN KEY constraint function?", "What about lowering the edit character limit for characters in code snippets? , to correct a misspelled library enum in an answer. Since the edit was only one character, I also had to add a superfluous sentence to get over the character limit required to edit a post. I've hit this problem before in other edits, always in code snippets. Since the edit limit exists to prevent trivial edits, and since there are many cases where one character code edits are not trivial (= to == etc), would it make sense to have a lower edit minimum inside code snippets?", "I read a very special book a few years back. We follow a boy who lives in a world where, if one moves far enough in a direction, that person gets distended and changed in size. The boy works on laying tracks for the train, on which his city is. The city has to continually keep moving or it also will get squashed. It's like a world like if one end is pinched and then dragged out like a piece of rubber string or bubble gum. The book is not older than 10 years I think. Hope I was clear enough...", "How to install MariaDB?" ]

[ "Motivation behind standard deviation?", "How to display a video in a web page using html,php", "How to format a USB drive?", "As far as I know, those are the only two. They should be pronounced Soogher and Soor, shouldn't they? I looked them up on Dictionary.com, and their etymologies reveal no trace of an SH, except where the listing for sugar had: Middle English sugre, sucre (noun) &lt; Middle French sucre &lt; Medieval Latin succārum &lt; Italian zucchero &lt; Arabic sukkar; obscurely akin to Persian shakar, Greek sákcharon I see an obscure kinship to shakar, but the word morphed so many times since then that the SH disappeared pretty much completely. And sure is even worse, with no sign of SH: Middle English sur ( e ) &lt; Middle French sur, Old French seur &lt; Latin sēcūrus Why are these the only two like this?", "Is there any substantial disadvantage to booking two one-way tickets, versus a round trip ticket? Booking vacation travel with family of four for winter, from Northeast US to Mexico. Round trip is pricy and no preferred travel times. Two one ways is slightly cheaper with much preferred timing. Different airlines there and back, both reputable national US carriers.", "\"He didn't know where New Jersey was\" I know the past tense carries the past tense in every dependent clause, but referring specifically to places or to things that are eternal, like the Earth, seems a bit weird and therefore we sometimes (I believe incorrectly) say He didn't know that New Jersey was actually on the East Coast. Because it still is. Or He thought the Earth was round. So is it square now? Logically speaking, would you consider the use of past tense here a bit confusing in a day-to-day speech in these examples? Would you instinctively opt for using the present tense?", "Difference between static class and singleton pattern?", "How to change the shadow color in Blender Cycles? I want to change the color of the shadow casting by a cube to green. While it's very easy to do it in Blender Internal (you select the lamp, go to the Lamp data header and change the shadow's color in the Shadow panel) in Cycles there're no such options. How to achieve it in Cycles?", "How to check if element is visible after scrolling? I'm loading elements via AJAX. Some of them are only visible if you scroll down the page. Is there any way I can know if an element is now in the visible part of the page?", "The conditions $a^2b^2=b^2a^2$ and $a^3b^3=b^3a^3$ make the group $G$ abelian?", "Do I need a passport to visit Edinburgh in Scotland from elsewhere in the UK? I'm visiting Scotland for the first time this week, Edinburgh. I've lived in the UK for over 10 years but my nationality is Spanish. I only have a Spanish passport. I'm also traveling by train. Do I need a passport to enter Scotland and stay in my booked hotel?", "After Windows 10 Fall Creators Update, a svchost.exe instance is constantly using CPU time Since installing the Windows 10 Fall Creators Update, I have a svchost.exe process that is constantly using about 14​ % of CPU time: This svchost.exe instance is responsible for hosting three services: The CPU time is consumed by a thread inside that process that cannot attribute to any of these three services: Given that these three services are considered critical system services, it's hard to do anything about them. These services cannot be stopped or disabled by services.msc, and terminating the process triggers a bugcheck (CRITICAL_PROCESS_DIED). Disabling the Windows Defender Firewall through the settings UI does not reduce CPU usage. I'm out of ideas. What could be causing this? How can I debug this further? Is there a workaround to stop these services? Update: After some debugging with , we've isolated this to the Windows Defender Firewall service. Process Monitor shows that it's constantly accessing the registry: A CSV export of a Process Monitor capture, filtered to that process, is available . I’m still looking for a way to stop that behavior. Update 2: Analysis with the Windows Performance Analyzer shows that most CPU time is consumed by code from rpcrt4.dll:", "Young Adult book about kids being bred for genetic purity in a world where races no longer exist I'm looking for a book I read in Junior High (probably) about a world where everyone was basically the same race. One genetically pure male and female teenager of each race still exists. They are transporting a genetically pure boy to meet his genetically pure female counterpart and accidentally introduce him to a genetically pure female of a different race. And, of course, chaos ensues. Any thoughts?", "I had a look at Knuth's The Art of Computer Programming, book 1. In chapter 1, section 1.2.2, exercise 25, he presents the following algorithm for calculating logarithm: given $x\\in[1,2)$, do the following: L1: [Initialize] Set $y\\leftarrow0$, $z\\leftarrow x/2$, $k\\leftarrow1$. L2: [Test for end] If $x=1$, stop. L3: [Compare] If $x-z&lt;1$, go to L5. L4: [Reduce values] Set $x\\leftarrow x-z$, $z\\leftarrow x/2^k$, $y\\leftarrow y+\\log_b(2^k/(2^k-1))$, and go to L2. L5: [Shift] Set $z\\leftarrow z/2$, $k\\leftarrow k+1$, and go to L2. (The algorithm needs an auxiliary table which stores $\\log_b2$, $\\log_b(4/3)$, and so on, to as many values as the precision of the computer. Then Knuth concludes: this exercise is to explain why the above algorithm will terminate and why it computes an approximation of $y=\\log_b x$. Well, I see that it works, but I am not able to explain why...", "Evaluate $\\lim_{n\\rightarrow\\infty} \\int_0^1 f(x^n) dx$", "In Windows 7, How to query times, when the computer was locked? Is there a way to get a list of the following times: whenever windows is locked (using windows+l combo) whenever windows is unlocked in the past week? I've tried poking in the event log, to no avail. Many thanks!", "Let $\\alpha, \\beta \\in \\mathbb{C}$, such that $\\alpha + \\beta$, and $\\alpha\\beta$ are algebraic. Show that $\\alpha$ and $\\beta$ are algebraic. Let $\\alpha, \\beta \\in \\mathbb{C}$, such that $\\alpha + \\beta$, and $\\alpha\\beta$ are algebraic. Show that $\\alpha$ and $\\beta$ are algebraic. attempt: Suppose $\\alpha, \\beta \\in \\mathbb{C}$ such that $\\alpha + \\beta$, and $\\alpha\\beta$ are algebraic. Let $\\alpha + \\beta$, $\\alpha\\beta$ are algebraic be algebraic over $F$. And let $\\alpha, \\beta \\in K$, where $K$ is an extension of $F$. then $\\alpha + \\beta $ and $\\alpha\\beta$ lie in the extension $K = F(\\alpha,\\beta)$, which is finite over $F$. so $[F(\\alpha, \\beta) : F] = [F(\\alpha, \\beta): F(\\alpha + \\beta, \\alpha\\beta)][F(\\alpha + \\beta, \\alpha\\beta) : F] \\leq 2[F(\\alpha + \\beta, \\alpha \\beta) : F] $, since $\\alpha + \\beta$ and $\\alpha \\beta$ are roots . So $[F(\\alpha + \\beta) : F]$ is finite and in the extension $F(\\alpha,\\beta)/F$ the elements must be algebraic over $F$, then $\\alpha , \\beta$ are algebraic. Can someone please verify this? Or help me give a better approach. Thank you!", "Let $a,b,c>0$ such that $a+b+c=3$, find max/min of $\\frac1{a^2+1}+\\frac1{b^2+1}+\\frac1{c^2+1}$", "Why don't I have this option? here's my disk layout sudo fdisk -l Disk /dev/sda: 640.1 GB, 640135028736 bytes 255 heads, 63 sectors/track, 77825 cylinders, total 1250263728 sectors Units = sectors of 1 * 512 = 512 bytes Sector size (logical/physical): 512 bytes / 512 bytes I/O size (minimum/optimal): 512 bytes / 512 bytes Disk identifier: 0x5b53cc54 Device Boot Start End Blocks Id System /dev/sda1 * 2048 409599 203776 7 HPFS/NTFS/exFAT /dev/sda2 409600 1153767021 576678711 7 HPFS/NTFS/exFAT /dev/sda3 1216962560 1250050047 16543744 7 HPFS/NTFS/exFAT /dev/sda4 1250050048 1250261679 105816 c W95 FAT32 (LBA) Disk /dev/sdb: 4005 MB, 4005527552 bytes 32 heads, 63 sectors/track, 3880 cylinders, total 7823296 sectors Units = sectors of 1 * 512 = 512 bytes Sector size (logical/physical): 512 bytes / 512 bytes I/O size (minimum/optimal): 512 bytes / 512 bytes Disk identifier: 0x20d8782d Device Boot Start End Blocks Id System /dev/sdb1 * 63 7822079 3911008+ c W95 FAT32 (LBA)", "QGIS: ESRI shapefile .shp no longer appears in list of file types under Add Vector Layer I recently installed QGIS 2.18.4 after using ArcMap for many years. I want to add several existing ESRI shapefiles (.shp) created in Arc, to a QGIS project. To add a new layer in QGIS, I select the \"Add Vector Layer\" button and then click \"Browse\" to go find the layer. Then I navigate to the proper folder. However, the drop down menu at the lower right of the \"Open an OGR Supported Vector Layer\" window does not include ESRI Shapefile on the list. The first one on the list is GeoJSON. Everything after \"G\" appears to be okay (all the way down to \"X-Plane/Flightgear\") but any file formats from A through F have been cut from the list. Since \"ESRI\" starts with \"E\" it does not show up on the list. Strange thing is when I first installed QGIS, ESRI Shapefile appeared on this list. So I must have accidently done something to change how that list is populated and I want to know how to change it back. If I type in the name of the ESRI shapefile that I know is in the folder, it and all other files starting with those letters appears in the prompt window that appears. And QGIS will correctly load the Shapefile. However, I want to be able to see all those ESRI Shapefiles without having to know and type in the first letter so it will appear in the prompt. I want it to appear in the file type drop down (or drop up?) menu." ]

[ "What are the strategies for getting feedback on articles? As an academic, one has to publish. Often, an article is drafted, and you need feedback of a colleague. I see that quite often some perspective articles are often written by long-term collaborating pairs of authors. What are some strategies people use to get feedback on their articles (outside of immediate boss; and in the case that none of the friends in the field of work in the specific domain of the article, and one needs specific (not general) feedback)? How do you approach a colleague to simply read your article. Or do you just mention it at a conference to the most suitable colleague - would you like to read an article and give me feedback? How do handle the co-authorship or acknowledgement? Do you establish the limits at the \"approach time\"? What are some strategies to establish a \"publishing\" duos (buddies).", "Why do \"df\" and \"du\" commands show different disk usage? I cannot access ubuntu system on my pc, the error message: \"the system is running in low graphics mode\" and I tried some commands I searched from internet. I found out a problems seems there is no available disk space. I used \"df\" and \"du\" commands to check, the results are as follow: du -j --max-depth=1 23G ./home 3.3G ./usr ...... 28G and df -Th filesystem Type size used available use% mounted on /dev/sda5 ext4 68G 68G 0 100% / how would I clean up the system for more disk space?", "For every $c\\in [0;2]$ determine whether the sequence $\\{a_n\\}_{n\\geq 1}$ which is defined as follows: $a_1=c$, $a_{n+1}=1+\\frac{(a_n-1)^2}{17}$ for $n\\geq 1$ is monotonic for sufficiently large $n$, and determine whether its limit exits and if it exists, give its value. I have no idea what to do with this problem. I was able to see that $a_{n+1}-a_n$ is a quadratic function and I also found ot that limit, if exists, is equal to either $1$ or $18$ (that's beacause if $a_n$ id convergent to $g$ then every subsequence is also convergent to $g$). So how to determine the limit for every $c\\in [0;2]$?", "Is the function $f(x)=|x|^{1/2}$ Lipschitz continuous near $0$? If yes, find a constant for some interval containing $0$. I think the answer is yes since I can find $L=1$ that satisfies Lipschitz continuity criteria in a interval close to $0$, am I right?", "Prove inequality $n<3^n$ using mathematical induction Prove that $n&lt;3^n$ where $n \\in \\mathbb N$, when $ n=1 $, I have proved it's true. And assumed when $n = p$ , $p&lt;3^p$ is true. Can any body help me in showing that it is true for $n =p+1$", "Open maps which are not continuous", "Let's say that I have a folder, within my Documents folder, that has files I want no one to access without a password. Is there a way to lock down that folder so that it's password protected / encrypted? In fact, is it possible to password-protect any individual folder?", "Prevent execution of parent event handler", "How to compare the differences between two PDF files on Windows?", "Can Hydrogen Fusion via CNO Cycle Occur in First Generation Stars CNO cycle requires the presence of carbon, nitrogen and oxygen to undergo hydrogen fusion. Does this mean that for first generation stars, no matter how big they are, can't undergo hydrogen fusion by CNO cycle because there is no carbon, nitrogen and oxygen present? I can't seem to find any website which mentions this. All they say is if a star is large enough, it will undergo hydrogen fusion via CNO cycle, they don't specifically mention it having to be a second generation star.", "I have a .txt file with numbers ordered like this (on the same row): 106849_01373 106849_01967 106850_00082 23025.7_01059 I would like to convert them like that: 106849_01373 106849_01967 106850_00082 23025.7_01059 I have no idea which command to use. Can somebody help me with this?", "Can anyone please help and tell me if this sentence is correct? &quot;A significant amount of zombies were detected in your city.&quot; In my opinion it should be &quot;A significant amount of zombies was detected in your city.&quot; because &quot;amount&quot; should be in agreement with &quot;was&quot; even though amount usually refers to something plural. Are both (was and were) acceptable in this case? Edit1: Yes, &quot;number&quot; would be the correct one in this case. So allow me to ask one more thing. &quot;A significant amount of purchases were detected...&quot; Does the use of &quot;number&quot; apply in this case also? As purchase is not exactly a thing/person. And if no, is it correct to say &quot;A significant amount of purchases were detected...&quot;? Edit2: So, please tell me what is the correct phrasing? &quot;A significant amount of purchases were detected...&quot; &quot;A significant amount of purchases was detected...&quot; Or, since purchases are countable, is the use of &quot;number&quot; instead of &quot;amount&quot; correct here, as in: &quot;A significant number of purchases were detected...&quot; &quot;A significant number of purchases was detected...&quot; Or would amount be correct since a purchase involves money and it refers to the amount of money? Would greatly appreciate an answer, and if possible a detailed explanation.", "Can I kill an indestructible creature with -X/-X and sufficient damage marked on it? Can I hit a 4/4 indestructible creature with a (3 damage) and give it -1/-1 with to kill it? (Does it matter which way around I cast those?) I read here and it says, damage is removed in cleanup step, so it should be on the creature still after both spells. 702.12. Indestructible 702.12a Indestructible is a static ability. 702.12b A permanent with indestructible can’t be destroyed. Such permanents aren’t destroyed by lethal damage, and they ignore the state-based action that checks for lethal damage (see rule 704.5g). 702.12c Multiple instances of indestructible on the same permanent are redundant.", "I'm reading Nano: The Essentials by T. Pradeep and I came upon this statement in the section explaining the basics of scanning electron microscopy. However, the equation breaks down when the electron velocity approaches the speed of light as mass increases. At such velocities, one needs to do relativistic correction to the mass so that it becomes[...] We all know about the famous theory of relativity, but I couldn't quite grasp the \"why\" of its concepts yet. This might shed new light on what I already know about time slowing down for me if I move faster. Why does the (relativistic) mass of an object increase when its speed approaches that of light?", "Sass Interpolation of Mixin, Function, and Variable names", "Compile error with \\href ToC and \\apacite I would like to edit my document but I have a compile error somewhere between the \\href and the apacite but can't locate it. I've tried blocking out code and taking out references, with varying results. \\documentclass[a4paper,12pt]{article} \\usepackage[english]{babel} \\usepackage[utf8]{inputenc} % TOC, Citations, Refereneces, and Appendicies \\usepackage{apacite} % \\cite{ref1,ref2} %Warning - unsupported tocstyle code \\usepackage[tocindentauto]{tocstyle} \\renewcommand{\\thesection}{\\Roman{section}} \\renewcommand{\\thesubsection}{\\arabic{subsection}.} \\renewcommand{\\thesubsubsection}{\\roman{subsubsection}.} %\\usepackage{hyperref} %\\urlstyle{same} %\\hypersetup{ % colorlinks=true, % urlcolor=cyan, % linkcolor=blue, % citecolor=green, % filecolor=magenta, % pdftitle={Sharelatex Example}, % pdfpagemode=FullScreen, %} \\usepackage[toc,page]{appendix} \\begin{document} ...to be installed \\cite{church13,hershkowits97}. \\bibliographystyle{apacite} \\bibliography{bibliography} \\end{document} Here are the bibliography.bib entries then @ARTICLE{church13, author = {K.H. Church and H. Tsang and R. Rodrigiguez and P. Defembaugh and R. Rumpf}, year = 2013, title = {Printed circuit structures, the evolution of printed circuit boards}, journal = {Circuit Insight}, volume = {}, number = {}, pages = {}, howpublished = {}, url = {http://www.808multimedia.com/winnt/kernel.htm}, } @ARTICLE{hershkowits97, author = {N. Hershkowits and R.A. Breun}, year = {1997}, title = {Diagnostics for plasma processing (etch plasmas) (invited)}, journal = {Review of Scientific Instrumentation}, volume = {68}, number = {1}, pages = {880--885}, howpublished = {}, }", "Find $n$ such that $n/2$ is a square, $n/3$ is a cube, and $n/5$ a fifth power", "Counting number of subsets which contain a specific element There is a set $x = \\{A,B,C,D,E,F,G\\}$ and the question ask for counting the number of subsets which contain $D$. And the answer is $2^6$. why would it be $2^6$? I know the total number of subsets is $2^{|x|}$ is it realated?", "What package should I use to typeset units? I know there are a few packages related to typesetting units: unitsdef units, which can be seen as a \"base package\" used by unitsdef SIunits siunitx, which is the successor to SIunits maybe others? like cjwunits and hepunits What is the difference between them? Do they also work inside Math mode? And, more importantly, which one should I use? Suggestion for people trying to answer this question: show some examples of how to typeset both simple and complex units. For instance, try typesetting these items: 100 Celsius 3 x 10^5 km/s gravitational constant is measured in N m^2/kg^2 10 kHz = 1 s^{-4} sin(x) meters I think these examples cover most needs when writing scientific texts: simple measurements (value + simple unit), values written in scientific notation, simple fractional units, complex fractional and squared units, units without any value accompanying them, units with arbitrary exponents, and arbitrary math code instead of a simple value.", "I have to prove by induction that $$\\sum_{r=0}^{n}\\begin{pmatrix}n \\\\ r \\end{pmatrix}=2^k$$, using the identity $\\begin{pmatrix}n \\\\ r-1 \\end{pmatrix}+\\begin{pmatrix}n \\\\ r \\end{pmatrix}=\\begin{pmatrix}n+1 \\\\ r \\end{pmatrix}$. I'm fine with everything except the inductive step, where I only managed to get as far as $$\\sum_{r=0}^{k+1}\\begin{pmatrix}n \\\\ r \\end{pmatrix}= \\sum_{r=0}^{k}\\begin{pmatrix}n \\\\ r \\end{pmatrix}+\\begin{pmatrix}n \\\\ k+1 \\end{pmatrix}$$ I tried to then use the identity and substitute $\\begin{pmatrix}n \\\\ r \\end{pmatrix}=\\begin{pmatrix}n+1 \\\\ r \\end{pmatrix}-\\begin{pmatrix}n \\\\ r-1 \\end{pmatrix}$ but all this did was just take me around in a circle. I also couldn't substitute $2^k$ for $\\sum_{r=0}^{k}\\begin{pmatrix}n \\\\ r \\end{pmatrix}$ since this didn't properly simplify to give $2^{k+1}$. However, I think that I have to obtain the expression $\\sum_{r=0}^{k}\\begin{pmatrix}n \\\\ r \\end{pmatrix}$ since it simplifies to $2^{k+1}$. But I've not been able to obtain this in anyway so I'm wondering if anyone can guide in what I need to or what direction I need to take to complete the inductive step." ]

[ "Make \"axis cs\" the default coordinate system in a PGFPlots plot I would like to know if there is a way to specify axis cs to be the default coordinate system inside a plot in PGFPlots, so I don't have to type axis cs: in front of every coordinate pair. Here's a MWE that shows what I mean (the actual plot is irrelevant). \\documentclass{article} \\usepackage{pgfplots} \\begin{document} \\begin{tikzpicture} \\begin{axis}[ xmin=0, xmax=80, ymin=0, ymax=80, grid=major, ] \\fill [green, opacity=0.5] (axis cs:14,14) -- (axis cs:80,47) -- (axis cs:80,80) -- (axis cs:47,80) -- cycle; \\fill [red, opacity=0.5] (0,0) -- (axis cs:80,0) -- (axis cs:80,47) -- (axis cs:14,14) -- (axis cs:47,80) -- (axis cs:0,80) -- cycle; \\draw [thick] (axis cs:47,80) -- (axis cs:14,14) -- (axis cs:80,47); \\end{axis} \\end{tikzpicture} \\end{document}", "What is the logical form of the definition of validity? My text book gives the definition of validity as \"An argument is valid IFF if the premises are true, then the conclusion must be true\". Using a conditional elimination on the RHS of the IFF yields \"An argument is valid IFF the premises are false or the conclusion is true\". Yet, this seems strange to me. Am I doing something incorrect with my manipulation or is this definition actually true? Surely the criteria for a valid argument goes beyond a false set of premises or a true conclusion.", "Why are some of my screen-recording/capturing/sharing applications (or app features) not working in Ubuntu 17.10 (and later releases)?", "We roll a six-sided die ten times. What is the probability that the total of all ten rolls is divisible by 6? So the question is really hard I think. I tried using a simple way by calculating the probability of each combination that makes a sum divisible by six, but it would take forever. Does anyone have any ideas? Suppose that we roll a six-sided die ten times. What is the probability that the total of all ten rolls is divisible by six?", "An integration question to be solved without using differentiation under the integral sign.", "Can I SSH into a specific directory?", "What is the difference of closing for duplicate and flagging for duplicate? When I encounter a duplicate, I have two choices: Vote closing because it is a duplicate, or flag it as a duplicate. What is the difference and should I do both?", "How is offside determined in football? The offside rule on the pitch is often unclear and called suddenly. How do I know if a player is offside?", "When you are viewing an app in Google Play store, it displays the following : Updated, Size, Installs, Current Version, Requires Android, and Rating. I am trying to do some research and figure out the initial release / publish dates of different apps. Is there a way to get this information from Google Play, or perhaps a website with this information?", "What inspired Tauriel's story arc? I know Tauriel is a Jackson created character, but I wondered if anywhere in the legendarium there was fodder for the story arc between her and Kili. I do not have access to all my books for the time being and recall stories of love between men and elves in the Silmarillion and Appendices but don't remember any such stories between elves and dwarves and wondered if there was any basis of inspiration for this aspect of their relationship within Tolkien's works. This movie, of course, departs even further from the original than those made before it, but as a story unto itself, I can still appreciate the ride, so if there is no Tolkien basis, what inspired Jackson, Boyens, and Walsh to create this particular arc? Is there interview info or anything?", "How can I prove that all rational numbers are either terminating decimal or repeating decimal numerals? I am trying to figure out how to prove that all rational numbers are either terminating decimal or repeating decimal numerals, but I am having a great difficulty in doing so. Any help will be greatly appreciated.", "Random matrix theory impact on covariance matrix analysis", "UITableView cells strangely disappearing", "What measures does Cognito Forms take to ensure Privacy/ Security Level for Completed Forms/ User Data? Some forms may contain confidential information - even something basic like where a person lives. What measures do Cognito Forms take to ensure that data stored within its site is secure?", "Following minimal document: \\documentclass{report} \\begin{document} \\renewcommand*\\thechapter{\\Roman{chapter}} \\tableofcontents \\setcounter{chapter}{6} % Problem starts at chapter 7 \\chapter{Seven} \\chapter{Eight} \\section{Eight-one} \\section{Eight-two} \\end{document} yields this output (cut to size for your convenience): Clearly, the chapter (and section) headings hang into the chapter (section) numbers. For the previous chapter numbers, this isn’t a problem since all chapter titles are aligned to the same column and the numbers I–VI are sufficiently narrow. (The same happens regardless of document type, I’m actually using scrreprt with the same result.) How can I prevent this?", "I am looking for a word that describes both of these activities, however the word coding does not seem to be suitable. Likewise with encryption and decryption, cryption does not work well.", "When we lie down, the \"back part of the body\" is in contact with the bed. It includes the heels, the calves, the backside, the back, and the back of the neck, and the back of the head etc. How do we refer to the entire \"back part\" of the body?", "Where to place log4j.xml", "In answer to the question \"why does the moon have the same rotation and revolution periods?\", we read: The mass and speed of rotation of the Earth influence the moon in that some of its rotational energy is actually transferred to the moon. (...) Many of the moons in the solar system have also reached this point of equilibrium. In Jupiter, the moons Amalthea, Thebe, Io, Ganymede, Callista, and Europa, all have identical rotational and revolutionary periods. My two questions are: Can we show the mechanics of this quantitatively? Does the system Earth-Sun experience the same phenomenon, in some measure? Will then the earth slow down its rotation speed until it will show always the same face to the sunlight? In this last case, on which timescale?", "Where is the pet store? I was playing sims freeplay on my iPod yesterday but could not find the pet store. Where is the pet store in the preteens are here update?" ]

[ "Is there a printable version of a reference manual for all TeX primitives?", "How can I send single file to multiple remote sites at the same time? Can scp be used to send a single file to multiple remote servers at the same time? If so, how? If not, what's the alternative?", "What alternative notation of subscripts/superscripts that are also treated as SYMBOLS in Mathematica?", "The documentation for the function states that you pass it a number, and the positions past the decimal to round. Thus it should do this: n = 5.59 round(n, 1) # 5.6 But, in actuality, good old floating point weirdness creeps in and you get: 5.5999999999999996 For the purposes of UI, I need to display 5.6. I poked around the Internet and found some that this is dependent on my implementation of Python. Unfortunately, this occurs on both my Windows dev machine and each Linux server I've tried. . Short of creating my own round library, is there any way around this?", "Can I cast a spell while another spell or ability is resolving? My opponent has a with scads of loyalty. I've got a and a on the battlefield. He activates Sorin's \"ultimate\" ability, targeting Gideon. -6: Destroy up to three target creatures and/or other planeswalkers. Return each card put into a graveyard this way to the battlefield under your control. Is there any way I can use the Spellbomb to prevent my opponent from stealing Gideon after he is sent to my graveyard?", "Compactness of Multiplication Operator on $L^2$ Suppose we have an bounded linear operator A that operates from $L^2([a,b]) \\mapsto L^2([a,b])$. Now suppose that $A(f)(t) = tf(t)$. Is A compact? Edit: I know $A = A^*$ but I'm not really sure how to start on this. It's not homework, just summer fun :D", "GOTO still considered harmful?", "Pokemon Go login issues after update I downloaded the July 30th update for Pokemon Go and when I open the app I'm prompted to login, But once I login, it redirects me to this page on Cookies:: If I click \"Done\" in the top left, it prompts me to login again! I've tried reinstalling the game, restarting my phone, etc. I can't much enable Cookies on the inline Safari browser. It doesn't make sense, and cookies are on in Safari (because I don't use Safari and they're enabled by default). How can I fix this?", "How can I sort a string of text followed by a number using LINQ", "How to select more layers with GIMP? In Adobe Photoshop I am able to select multiple layers at once with Shift+Click. How can I do that in GIMP?", "Make wifi preferable over wired connection in Ubuntu 14.04? How do I make Ubuntu choose wifi connection over wired connection when both are connected to internet? I edited the Ethernet connection to route using the preference \"Use this connection only for resources on this network\", which other people have reported having success with as a means of getting WiFi preferred, but it doesn't work for me. The issue persists. Ethernet is still being preferred for internet, and WiFi gets ignored. another thing, is it possible to use wired connection as fail over connection to wireless?", "Excel function that evaluates a string as if it were a formula? Suppose I have a text string like \"11+5\" or even \"=11+5\" stored in a cell. Is there a function in Excel that will allow me to actually evaluate that string as if it were a formula? This would be helpful for another project where I would like to be able to write 'dynamic' formulas in Excel.", "Proof of the uncountability of reals using the diagonal argument—problem?", "Hi currently Nagios sends notifications from [email protected], How do I go about configuring this? Thanks", "This question is in the spirit of , an example of an apparently non-deterministic system in Newtonian mechanics. Under certain restrictions, the guarantees the existence and uniqueness of solutions to differential equations with initial conditions. However, Norton's dome does not satisfy these restrictions. The ball may sit on top of the dome for an arbitrary period of time before sliding down in a particular trajectory, without violating Newton's laws of motion. Is there a plausible example of a system of interacting point-particles such that the equations of a point-particle are continuous but not , and therefore fail to have a unique solution?", "Say I had and I used on something, could I respond to Cloudshift bringing the creature back into play with or something similar?", "revoking apex managed sharing permission I'm using apex managed sharing to grant permissions very similar to how it is done in this example trigger: However, I also need the ability to revoke or delete this access and having it revert to private. The reason for this is my understanding is that there are only two access options for managed sharing access 'read' or 'edit' with no 3rd option of 'none' or 'private'. Reference: I've tried adding the shares to a list and deleting the list and I'm getting the error: DELETE_FAILED, cannot delete owner or rule share rows, I also noticed there is a field on the share object 'isDeleted' this field however is not writable. Does anyone have experience revoking or deleting these permissions once they've been created? Thanks!", "We know speedup brute-force attacks two times faster in block ciphers (e.g brute-forcing 128-bit keys take $2^{64}$ operations, not $2^{128}$). That explains why we are using 256-bit keys to encrypt top secrets. But on AES shows brute-forcing AES-256 take $2^{100}$ operations. Does this attack work with Grover's search to make AES cipher quantum unresistant?", "The spectral radius of normal operator", "How to run a command that involves redirecting or piping with sudo?" ]

[ "How do I get the browser to reask me to integrate with a website? I'm using and I accidentally clicked \"No\" when asked if I want to integrate with the website. How can I have Firefox or Chrome reask me to integrate the site with Ubuntu?", "Removing elements with Array.map in JavaScript I would like to filter an array of items by using the map() function. Here is a code snippet: var filteredItems = items.map(function(item) { if( ...some condition... ) { return item; } }); The problem is that filtered out items still uses space in the array and I would like to completely wipe them out. Any idea? EDIT: Thanks, I forgot about filter(), what I wanted is actually a filter() then a map(). EDIT2: Thanks for pointing that map() and filter() are not implemented in all browsers, although my specific code was not intended to run in a browser.", "Proof of \"the continuous image of a connected set is connected\" None of the existing questions is exactly answering my question so I'm posting a new question, but feel free to refer me to some already answered question! In Rudin Theorem 4.22, we know that If $f$ is a continuous mapping of a metric space $X$ into a metric space $Y$, and $E$ is a connected subset of $X$, then $f(E)$ is connected. In the proof, we started with consider $f(E) = A \\cup B$, where $A$ and $B$ are nonempty separated subsets. Then put $G = E \\cap f^{-1}(A)$ and $H = E \\cap f^{-1}(B)$. Then Rudin is claiming that $E = G \\cup H$. I'm a little suspicious about this. What if $f$ is non-surjective, then $f^{-1}(A) \\cup f^{-1}(B)$ is only a proper subset of $E$? Is there a property of $f$ being continuous that forces $f$ to be 1-1?", "Generators and relations for $\\text{PSL}(2, \\mathbb{F}_q)$ Is there a nice presentation for the group $\\text{PSL}(2,\\mathbb{F}_q)$, for every prime $q$? (I don't have any particular definition in mind for \"nice\", other than, say, a small number of generators and relations.)", "How to get the file name from a full path using JavaScript?", "Is it possible to write a template that changes behavior depending on if a certain member function is defined on a class? Here's a simple example of what I would want to write: template&lt;class T&gt; std::string optionalToString(T* obj) { if (FUNCTION_EXISTS(T-&gt;toString)) return obj-&gt;toString(); else return \"toString not defined\"; } So, if class T has toString() defined, then it uses it; otherwise, it doesn't. The magical part that I don't know how to do is the \"FUNCTION_EXISTS\" part.", "Least rank of a matrix Let $A$ be a $7\\times 7$ matrix such that it has rank $3$ and $a$ be $7\\times 1$ column vector. Then least possible rank of $A+(a a^T)$ is? ($a^T$ is transpose of the vector) Intuitively I think it's $2$ as $a a^T$ has rank $1$, and the most it could affect is one row of $A$.", "Find all integer roots of: $x^2(y-1)+y^2(x-1)=1$ Obviously $(2,1)$ and $(1,2)$ are two answers. But I was unable to manipulate the equation algebraically giving a useful form for finding all other possible answers! I also tried to view it as a quadratic equation in terms of $x$, but forming the Delta of that equation didn't help much other than if $y=1$ then certainly Delta would be a square and equation would have answer for $x$...", "I have written an essay last year, as a personal exercise. I now have a course at uni on the topic and could basically just hand in this essay now, the topic fits perfectly. I have also never submitted this essay to any other course or so. Could I just hand in this essay, or would I violate some rules with that? Is this maybe already self-plagiarism?", "Access user fields? $account = \\Drupal::currentUser() loads the user object into $account, but how do I access custom fields I've created on the user object (via the admin UI)? With dpm($account) I can't see any of my custom fields.", "Grub not showing on startup for Windows 8.1 Ubuntu 13.10 Dual boot", "this works in viewport but not in render. import bpy from math import * def frame_handler(scene): z = scene.objects['Lift'].location[2] scene.objects['Text'].data.body = str(floor(z / 4.0) - 2) bpy.app.handlers.frame_change_pre.clear() bpy.app.handlers.frame_change_pre.append(frame_handler) How to get it working in render? I've read and changed from \"bpy.data.objects\" to \"scene.objects\" as already seen in the script. What am I missing? Blender v. 2.81.16 Edit. Tried that depsgraph thing mentioned in comments and changed to frame_change_post: import bpy from bpy.app.handlers import persistent from math import * @persistent # maybe not relevant but doesn't harm anything? def frame_handler(scene, depsgraph): z = scene.objects['Lift'].evaluated_get(depsgraph).location[2] scene.objects['Text'].data.body = str(floor(z / 4.0) - 2) bpy.app.handlers.frame_change_pre.clear() bpy.app.handlers.frame_change_post.clear() bpy.app.handlers.frame_change_post.append(frame_handler) Now the Text doesn't show up at all in rendered (but works in viewport).", "How to downgrade a package via apt-get?", "How do I add a kernel boot parameter? I need to add the boot parameter foo=bar to my kernel. How can I do this once for testing, and permanently if testing was a success?", "I want to buy a new notebook in the near future to play games on it. I'm looking forward for the new Steam for Linux client. My question is that where does the Steam install the games, on the home partition, or in the usr folder, or somewhere else? I do not use pre-release (i.e. beta) versions of either Steam or Ubuntu.", "I would like to render an animation as a series of .png images with transparent backgrounds for use in a video. Is this possible?", "What is the sum of non-real roots of the polynomial equation?", "Resource for Blender addons?", "How to make bash put prompt on a new line after cat command? What I get: host:~ user$ cat example.txt some texthost:~ stas$ What I want to get: host:~ user$ cat example.txt some text host:~ stas$ Is there a way I can make cat behave like this? I'm using bash on Mac OS X.", "Interprocess communication in .NET I have a core .NET application that needs to spawn an abitrary number of sub processes. These processes need to be able to access some form of state object in the core application. What is the best technique? I'll be moving a large amount of data between processes (Bitmaps), so it needs to be fast." ]

[ "Bundling python library with addon I'm making an add-on that uses the websocket library from python. Is there a way to include it in the add-on .zip file? Or do I have to add it to the site packages folder in blenders included python folder?", "Prove $\\sum\\limits_{i=2}^{n}\\frac{1}{(i-1)i}$ = $\\frac{(n-1)}{n}$ using induction. I need to prove $\\sum\\limits_{i=2}^{n}\\frac{1}{(i-1)i}$ = $\\frac{(n-1)}{n}$ using induction. I am getting stuck midway through the inductive step. Here is what I have: $\\forall n\\geq 2$, where $n\\in\\mathbb{N}, P(n)$ is the statement \"$\\sum\\limits_{i=2}^{n}\\frac{1}{(i-1)i}$ = $\\frac{(n-1)}{n}$\". Base case: $\\sum\\limits_{i=2}^{2}\\frac{1}{(i-1)i}$ = $\\frac{1}{2}$ = $\\frac{(2-1)}{2}$ so $P(2)$ is true. Inductive assumption: Assume $P(n)$ is true. Need to show $\\sum\\limits_{i=2}^{n+1}\\frac{1}{(i-1)i}$ = $\\frac{((n+1)-1)}{(n+1)}$. $\\sum\\limits_{i=2}^{n}\\frac{1}{(i-1)i}$ + $\\frac{1}{n^{2}}$ = $\\frac{(n-1)}{n}$ + $\\frac{1}{n^{2}}$ = $\\frac{n(n-1) + 1}{n^{2}}$ = $\\frac{n^{2}-n+1}{n^{2}}$ I got stuck here and tried working backward from $\\frac{((n+1)-1)}{(n+1)}$, which gives me: $\\frac{((n+1)-1)}{(n+1)}$ = $\\frac{n}{(n+1)}$ Any suggestions on what to do next or where I may be going wrong?", "Setting DIV width and height in JavaScript", "Why ZSH ends a line with a highlighted percent symbol? I've noticed this on occasion with a variety of applications. I've often thought it was because the output was cancelled early (ctrl+c, for example) or something similar, and zsh is filling in a new line character. But now curiosity has gotten the best of me, since it doesn't seem to do this in bash. zsh bash The Sequence program is something I pulled from a book while reading on Java certifications and just wanted to see if it would compile and run. I did notice that it does not use the println() method from the System.out package/class. Instead it uses plain old print(). Is the lack of a new line character the reason I get this symbol?", "How can I undo git reset --hard HEAD~1?", "Relation between magnetic moment and angular momentum -- classic theory How do I prove the relation between the vectors of magnetic moment $\\vec\\mu$ and angular momentum $\\vec L$, $$\\vec\\mu=\\gamma\\vec L$$ ? Many text books and lecture notes about the principles of magnetism show the relation of $\\mu$ and $L$ as scalars only and then just state that the relation holds also for the vectors. An example: $$\\mu=I\\cdot A = \\frac{q}{t}\\pi r^2 = \\frac{qv}{2\\pi rm}m\\pi r^2$$ ($I=q/t$: current, $A$: area of a loop, $q$ charge, $t=2\\pi r/v$: time of 1 rotation, $v$: velocity of particle, $m$: mass ) The angular momentum is $\\vec L = \\vec r\\times\\vec p$ or $L=mrv$ and therefore $$\\Rightarrow \\mu = {\\frac{q}{2m}} L = \\gamma L.$$ Why is this also true for the vectors? Is there a general explication by classical physics without the need of quantum theory?", "Projection of a point onto a simple convex polytope I have a convex polytope described by the intersection of a hypercube and two parallel lower and upper hyperplanes cutting through the hypercube. I want to find the projection of a point onto the polytope. I read the question and see that the general problem of finding a projection onto a convex polytope can be solved with quadratic programming. However, taken alone, projection onto a hypercube or a hyperplane is trivial. For the hypercube, each dimension is defined by a lower+upper bounds and we just pull each dimension within those bounds, which take $O(n)$ time in $n$ dimensions. For the hyperplane just find the projection onto it. So I'm wondering whether there is simpler method for finding such a projection, maybe somehow combining the two independent projections.", "Definable real numbers", "Pdf bookmark error in beamer Hi. I've compiled a Persian language beamer file by both luapersian and persian babel package using LuaLaTex, and in both I've the same problem in pdf bookmark as shown in the figure (some strange characters are shown instead of correct characters).", "Can you transfer a Windows 7 XP-mode VHD to a new PC without the need for reactivation? At the moment I am running Vista 32 bit and use VPC 2007 a lot. I have several Windows 2000 Virtual Machines set up with complex software configurations. For me, one of the advantages of working with VPCs is that a Virtual Machine can easily be copied to another PC (like a notebook). Also, when I move to a new PC, I can immediately work with my existing Virtual Machines without the need to reinstall all applications. I am thinking about buying a new pc with Windows 7 64 bit pro, and using the XP-Mode Virtual Machine that comes with Windows 7. The advantages would be support for more memory (so being able to run more Virtual Machines simultaneously) and having a licenced XP Virtual Machine. I would like to know if you can transfer a VHD that is based on the XP-mode VHD to another machine without Activation issues. The other machine will of course, also be running Windows 7. I would guess that this would not be a problem. However, I did read about a guy who had to reinstall his Windows 7 because of a harddisk failure, and could not access his XP-mode VHD anymore because it demanded re-activation. So can you transfer a Windows 7 XP-mode VHD to a new PC without the need for reactivation?", "I have read answers to questions like but I couldn't find a general rule for using \"you\" or \"yourself\", \"him\" or \"himself\" that could explain things I see in some examples. For example, I think that one normally say (according to examples I see in ): You bring something with you. You have something in you. You have something on you. You pressed her to you. But on the other hand one would say: You draw attention to yourself. He killed himself. You can try it out for yourself. As a general rule, it seems that the reflexive pronoun is used when the object is the same as the subject of the verb. But for prepositional phrases, it seems more complicated. Do some prepositions (like \"with\", \"in\", \"on\") always come with the accusative form of the pronoun, and some other (like \"for\") don't? What about \"to\", that seems to be followed by both in different circumstances?", "How do I create a desktop wallpaper slideshow with my own set of images? With the images coming from a pictures folder, or pre-selected With the images displayed in order, or randomly With the images changing every few minutes, or after random periods of time", "Reverse Triangle Inequality in vector space I have already proved Triangle Inequality $\\lVert v+w\\rVert \\le \\lVert v \\rVert+\\lVert w \\rVert$ in vector space $\\mathbb{R}^n$. However, I'm having difficulties proving the Reverse Triangle Inequality in the vector space. I have started with $$\\lVert v \\rVert^2=v \\cdot v-w\\cdot w+w\\cdot w \\le \\lVert v-w \\rVert+\\lVert w \\rVert^2$$ $$\\lVert w \\rVert^2=w \\cdot w-v\\cdot v+v\\cdot v \\le \\lVert w-v \\rVert+\\lVert v \\rVert^2$$ based on the Triangle Inequality but I don't know if it is correct. If this is right, I think I can go on with proving it the same way I would the normal Reverse Triangle Inequality.", "How to remove trailing whitespaces with sed?", "Selecting and manipulating CSS pseudo-elements such as ::before and ::after using javascript (or jQuery)", "Add the Same Modifier to Multiple Objects at Once?", "I want to render an image as a background image via an inline style in twig. I created a field called bg_image and attached it to the standard plain page. After fiddling around for hours I was able to get the Image URL in node.html.twig {{ file_url(node.field_bg_image.0.entity.uri.value) }} but I could not get it to work inside field--field-bg_image.html.twig Can I get the node from there anyhow, so I can then get the image? How can I get the image URL to use as inline style? I thought maybe I can pass a variable from field--field-bg_image.html.twig to image.html.twig and then just render {{ uri }} instead of &lt;img{{ attributes.addClass(classes) }} /&gt; but I could not get it to pass the variable there unless I use includes {% include 'image.html.twig' with {'image': image, 'isFromField': isFromField} %} (isFromField is true, when it comes from the field--field-bg_image.html.twig) But that didn't work either. The Image was never rendered that way. Would be very glad if you can help - my php knowledge is very basic. Thanks", "ASP.NET MVC - Can't bind array to view model", "During the 'Hard Answers' Thieves Guild quest, Karliah asked me to meet her at the Ragged Flagon. However, it seems that she doesn't show up at the rendezvous point. Where do I find her?", "Which Stack Exchange sites use MathJax? As the title says, I could use an exhaustive list of all Stack Exchange sites that use MathJax. If the list included any site-specific customizations made to the MathJax configuration on each site, that would be even better." ]

[ "How can you get the names of method parameters? If I have a method such as: public void MyMethod(int arg1, string arg2) How would I go about getting the actual names of the arguments? I can't seem to find anything in the MethodInfo which will actually give me the name of the parameter. I would like to write a method which looks like this: public static string GetParamName(MethodInfo method, int index) So if I called this method with: string name = GetParamName(MyMethod, 0) it would return \"arg1\". Is this possible?", "How to Screen Sharing / VNC to an iMac without waking the display? I have an iMac mid 2011 at home. When I was not home, I may need to access my mac with Screen Sharing. However the iMac display will turn itself on when I connect via Screen Sharing. The problem is I don't want to scare my family at home (with the elders and kids) as the iMac \"turn itself on suddenly\". This is a problem specific for iMac. On MacBooks (Pro, Air, whatever) I can set the brightness to the lowest setting so the screen is black (i.e. the LED light is off). However on an iMac you cannot turn off the LED backlit by setting brightness. The display is still bright and everything is clearly visible even on lowest brightness setting. Therefore these solution are not working as the display will turn on as soon as you move your mouse or hit any key on the keyboard via Screen Sharing. Sleep Display (by Ctrl+Shift+Eject) Using the code listed on Question: Is the a way to keep the iMac display off entirely while you accessing it with Screen Sharing?", "Test if there are files matching a pattern in order to execute a script", "What does it mean to instantiate a trait?", "I'm wondering whether it's possible to downgrade sfdx-cli to use an earlier version? I'm trying to debug an issue with using it in pipeline scripts. When I run sfdx version --core I get sfdx-cli 7.28.7 (core) . If I run sfdx version I get sfdx-cli/7.28.7-7bceba6f24 darwin-x64 node-v10.15.3 . If I do cat package.json inside the actual package dir for sfdx-cli after doing npm install [email protected] I get \"sfdx-cli\": \"^7.26.0\" Why does it then show that the version is 7.28.7? How can I force the lower version to have preference? I do understand that this question is not really salesforce specific but hopefully someone has run into the same problem.", "Show that $Kf(x,y)=\\int_0^1k(x,y) f(y) \\,dy\\\\$ is linear and continuous Let $k:[0,1]\\times[0,1]\\rightarrow \\mathbb{R}$ continuous and $K:C[0,1]\\rightarrow C[0,1]$, given by $Kf(x,y)=\\int_0^1k(x,y) f(y) \\,dy\\\\$. Prove that $K$ is continuous. I try to see continuity in $0$, but i can't find $\\delta$.", "This is a homework problem for my real analysis class. It is problem 13.1 from Mattuck's Introdution to Analysis. The question reads: Suppose F(x) is continuous on some open interval I and c is a maximum point inside this interval. Is it true that f(x) must be increasing immediately to the left of c and decreasing immediately to the right of c? Proof or counterexample. (Note: A constant function is considered to be both increasing and decreasing.) My friend and I have been attempting to find a counterexample. We figured a function that begins oscillating infinitely many times near c but converges to c would work. We're having difficulty constructing such a function out of elementary functions so we think we will have to define it in another way, piece-wise using receding intervals. I have no clue how this would look. Any advice would be greatly appreciated.", "I wanted to remove and reinstall the software-center package. I removed it, but now I can't reinstall. I tried these commands without success: sudo apt-get update sudo apt-get install software-center How can I reinstall software-center? When I performed the install command this is what I got: $ sudo apt-get install software-center Reading package lists... Done Building dependency tree Reading state information... Done Package software-center is not available, but is referred to by another package. This may mean that the package is missing, has been obsoleted, or is only available from another source E: Package 'software-center' has no installation candidate", "Want to set a guest session password for login. How do you do this after skipping it at OS install?", "Best way to remove file extension from a string? So, I'm using a script I've made to convert videos to the webm format. A certain program calls the script, sending %f which is the full, absolute file name of the video, like this: converter.sh %f where %f has two possible extensions, .avi or .mpg. # /bin/bash ffmpeg -i $1 `dirname $1``basename $1 avi`webm &amp;&amp; rm $1 It currently works perfectly when $1 contains a .avi file, because basename removes the .avi extension. When $1 ends with .mpg instead, the result is .mpgwebm. How can I modify that script to be able to receive those two possible different formats? Resuming: If $1 is /somedir/video.avi, the script should do: ffmpeg -i /somedir/video.avi /somedir/video.webm And if $1 is /somedir/video.mpg, the script should do: ffmpeg -i /somedir/video.mpg /somedir/video.webm I know this might be fool for some people, but I'm kind of new with the bash.", "Access gnome-shell messaging tray using keyboard Is there a keyboard shortcut to access the gnome-shell messaging tray? E.g. For responding to incoming IM, etc.", "How can I create a Chatter File via Apex? From the Chatter tab I can go to 'Files' and then upload a file without attaching it to anything. I am wanting to know if there is a way to achieve the exact same thing via Apex?", "Emacs: Symbol's value as variable is void", "What does f-stop mean?", "There is a hint to show that if there were points in $\\mathbb{Q}$, then there would exist $r,s, t \\in \\mathbb{Z}$ with $\\gcd(r, t) = 1$ such that $2s^2 = t^4 - 17r^4$ , and then show that any prime dividing $s$ is a quadratic residue modulo $17$. I'm stuck on the first bit - if you suppose $\\left(\\frac{a}{b}, \\frac{c}{d}\\right)$ is a point on the curve in $\\mathbb{Q}$ (so $a, b, c, d \\in \\mathbb{Z}$) then you get to $2a^2d^4 = b^2c^4 - 17b^2d^4$, but I'm not sure where to go from here since you don't know that $b$ is a square?", "Inserting newlines in Rectangle Text elements via ArcPy causes overlap? I ran across an issue the other day when I tried to use ArcPy's mapping module to edit rectangle text elements with newlines (\\n) in an ArcMap document. Here's what the output looked like: Here's the code I used to generate that output. The first column are rectangle text elements Text1, Text2, Text3 going down; the second column are \"plain\" text elements Text4, Text5, and Text6 going down. import os import arcpy HomeDir = r\"C:\\Desktop\" arcpy.env.workspace = HomeDir CurrentMXD = arcpy.mapping.MapDocument(r\"C:\\Desktop\\TextTest.mxd\") OutputFilename = r\"C:\\Desktop\\TextTest.pdf\" if os.path.exists(OutputFilename): os.remove(OutputFilename) for TextElement in arcpy.mapping.ListLayoutElements(CurrentMXD, \"TEXT_ELEMENT\"): TextElementName = TextElement.name String1 = \"The quick brown fox jumped over the lazy dog.\\nShe sells sea shells by the sea shore.\" String2 = \"The quick brown fox \\njumped over the lazy dog.\\nShe sells sea shells by the sea shore.\" String3 = \"The quick brown fox jumped \\nover the lazy dog.\\nShe sells sea shells by the sea shore.\" if TextElementName == \"Text1\": TextElement.text = String1 if TextElementName == \"Text2\": TextElement.text = String2 if TextElementName == \"Text3\": TextElement.text = String3 if TextElementName == \"Text4\": TextElement.text = String1 if TextElementName == \"Text5\": TextElement.text = String2 if TextElementName == \"Text6\": TextElement.text = String3 arcpy.mapping.ExportToPDF(CurrentMXD, OutputFilename) So far, it looks like the presence of the messed up text depends on whether the line is longer enough to wrap, and whether the line before the newline is longer than the line after the newline. Any ideas about what could be going wrong? Is there a workaround? I could use plain text elements and worry about wrapping lines using Python, but I'm hoping I can figure something out.", "I have been looking at the plugin API a bit more in depth recently and I was wondering what real differences there were between action and filter hooks. They both are events that receive data as a parameter and they seem to both be able to do the same things. Obviously I see that actions are called when actions take place and filters are called when data is manipulated, but it seems to just be a semantic naming difference. Besides semantics and what they are used for, what real differences are there between them?", "I created a new profile for gnome-terminal and I can switch between &quot;Implicit&quot; profile and the new created profile as you can see in the below image: Now I wonder how can I switch between profiles using a command-line/script or maybe using a shortcut for this. Note: Solutions like: gnome-terminal --tab-with-profile=Implicit &amp;&amp; exit are excluded because I prefer not to close and open another terminal or get another terminal window in this process of changing the profile.", "I saw that it has been already reported that also they have earned courious badge but the badge has not been given. but their answers say that they must wait a day and the badge will be awarded. In my case its 8/5 and it was 5/5 long time ago and I have never received a message telling that I have earned it. its just telling me that the next badge to be awarded is Curious badge. this is my profile:", "If $R$ is an integral domain and a subring $S$ has identity $1_S$, how would you show that $1_S=1_R$ (here $1_R$ is the identity of the ring $R$)? I am unsure about what an integral domain really is and how the subring comes into play here." ]

[ "Windows 10 Search not loading, showing blank window", "I’m making a little movie with using multiple computers. I can't use the network so I've divided the frames of the animation over the computers. Unfortunately now there are frames missing. What I'd like to do is using 1 machine to render all the missing frames. For example: 4-24-35-64-143 but ideally in such a way that I don't have to re-start blender multiple times. Is this possible somehow?", "Concatenating string with space", "Prove that the equation $x^2-y^2 = 2002$ has no integer solution", "How can I install an app given only its APK file? I downloaded the APK file for an app to my PC. How can I install it on my phone?", "I'm working through Rotman (1994). It's the 2nd chapter where my curiosity lead me to a question that is not from the book. Here's the problem that inspired the question: 2.8. Imbed $S_n$ as a subgroup of $A_{n+2}$, but show, for $n\\ge2$, that $S_n$ cannot be imbedded in $A_{n+1}.$ Since the alternate subgroup has the property of even parity, I thought that a little investigation of parity for the second and third symmetric groups was in order. So I constructed a table for each of them, grouped by even and odd number of disjoint products. I'll forego writing the actual table and simply provide the answers. In symmetric groups with an even idegree, two even permutations come together under composition to produce an even permutation. Two odds also make an even. Two different parities produce odd elements. When the symmetric group has an odd degree, e.g. $S_3$, two odds make an odd, two evens make an odd, and two different parities make an even element. Exactly the opposite results from the symmetric groups with even index. Two questions: is this enough to prove the $A_{n+1}$ case? And can this be generalized modulo 2 e.g. $A_{2n+1}$?", "Intersection of Adiabatic curves Can paths of two adiabatic process intersect on a plot? This question is for both reversible and irreversible processes. There are some , but they mostly address only for reversible adiabatic processes. Also, I want a physical interpretation of the processes that is, if they don't intersect then why don't and what it would be like, physically for a system.", "Why not use the Lagrangian, instead of the Hamiltonian, in nonrelativistic QM?", "Why does HDD activity slow the whole System down (on Windows 7)? If I copy a large amount of data from on drive to another (physical) drive my whole system is running slow. I am using Windows 7 64bit version on an Intel Core 2 Duo 3 GHz. This is the situation: Very fast copying between two SATA disks. Resource Monitor shows 80MB/s read, 70MB/s writes and 150MB/s total The total CPU load is about 3% There is plenty (>2GB) of free physical RAM left All partitions have enough (>10gb, >10%) of free space left and show low fragmentation Anti-Virus software is not active This is the problem: No matter what I want to do while copying, it takes forever. Even tasks that do not need a lot of disk access (as they should work from RAM only), are extremely slow. The moment I stop the copying process, all the unfinished tasks finish at once. For example trying to open a new browser windows or explorer window will not work. If the copying is stopped 5 explorer windows popup at once. My question is: why? What resource is exhausted, if CPU and memory are idle? And what part of my computer hardware I need to upgrade to get better behavior? Also read Psycogeek's comment for further questions in this direction. If your answer is, that everything needs HDD Access, which is blocked by such an activity, then my question is: Is there a way to copy something on your system without rendering it unusable until its done? (which can be hours, if >500g have to be copied).", "How many attacks can a fighter with two-weapon fighting make at 5th level?", "Show that the Sorgenfrey line does not have a countable basis. I am trying to understand this proof from Munkres' book which shows that the Sorgenfrey line does not have a countable basis. His proof is: Let $\\beta$ be a basis for $\\mathbb{R}_l$. Choose for each $x$ an element $B_x \\in \\beta$ such that $x \\in B_x \\subset [x, x+1)$. If $y$ is not equal to $x$ then $B_y \\neq B_x$ since inf($B_x$) = $x$ and $y$ = inf($B_y$). Therefore $\\beta$ must be uncountable. I am new to topology so I am probably just missing a simple point but I do not see why $\\beta$ must be uncountable according to this argument. I agree that $B_y \\neq B_x$ but isn't it possible that $y \\in B_x$ (and thus the set $B_y$ is not needed as part of the basis)? Thanks in advance for your help.", "WI-FI Nic showing 3 different transport id {Device id} There was a problem with my network controller so i opened up cmd and started to check for interfaces. I noticed a strange thing that my Wifi network controller had 3 different Device ID (Transport id's) When i tried to disable the wifi card the different id's went away. On my other computer i tested the same thing and it only shows 1 id? Device\\NPF_{4A45A363-6346-48DA-8D28-13DD9C9C1E6A} Device\\NPF_{E6994972-C66C-4ABF-BE27-17BAC7C1C971} Device\\NPF_{B6394772-H66C-4ABF-HRE27-17JLC0H9C971} I am using snort to check for available interfaces. Can anybody explain why i am seeing this? WLC model: intel dual band wireless-ac 8265 running default settings on the adapter however i have hyper-v open", "Without using any non-standard (Windows included) utilities, is it possible to download using the Windows command line? The preferred version is Windows XP, but it's also interesting to know for newer versions. To further clarify my question: It has to be using HTTP The file needs to be saved Standard clean Windows install, no extra tools So basically, since everybody is screaming , I want simple Wget functionality, without using Wget.", "Using multiple wildcard parameters with arcpy.ListFeatureClasses I know there has to be a way to do this but I'm having trouble figuring out how to do so. I would like to create a list of feature classes to perform operations on however, I want to have the list contain feature classes which have 2 separate and distinct file name identifiers. The code would look something like: FCS = arcpy.ListFeatureClasses(\"X_*\" OR \"*_Y\") I know OR is incorrect however, is there some way to do this without having to re write code to work with the second wildcard. Thanks for helping gout, i know there is a selection method in the Select By Attributes which allows for multiple wildcard use using the OR statement.", "Explanation of terminal objects using limits I understand terminal objects, but I falter when trying to achieve them using the approach of diagrams, the category of constant diagrams $\\mathcal{C}^{\\mathcal{J}}$ and limits. I have the empty category 0, now I have a diagram $D: \\mathcal{J} \\to \\mathcal{C}$. However this diagrams image should be empty, because there are no objects or morphisms to map. At this point, I'm confused, because I can't get to the universal property $\\forall c \\in \\mathcal{C}. \\exists! f: c \\to T$ anymore, because I'm missing T. (EDIT: I get that this is how it is supposed to be) But continuing with the category of constant diagrams, even if I have a constant diagram mapping everything to one object / morphism, there is nothing to map, so the functors image is still empty. So now I'm missing both $T$, and any kind of $c$. EDIT: It seems to me, have I chosen 1, instead of 0, I would have come up with that is considered the definition of the terminal category. What am I missing?", "I am trying to get the Linux distro \"PIXEL\" to install some PPAS for Wine, and I have run into a issue where it will not install because of the following error: sudo: add-apt-repository: command not found I am trying to install wine using the PPA add-apt-repository ppa:ubuntu-wine/ppa and I would like some assistance doing so.", "Can't save batch file shortly after running it on Windows 7", "Is it correct to say user accounts or users account when referring to the accounts any user has on a site like this one? In general, in the case of a noun that is used as adjective for the noun that follows, is it better to use &lt;plural-noun&gt; &lt;singular-noun&gt; or &lt;singular-noun&gt; &lt;plural-noun&gt;?", "When are \"because\", \"since\",\"for\" and \"as\" interchangeable?", "How do I address unchecked cast warnings? Eclipse is giving me a warning of the following form: Type safety: Unchecked cast from Object to HashMap This is from a call to an API that I have no control over which returns Object: HashMap&lt;String, String&gt; getItems(javax.servlet.http.HttpSession session) { HashMap&lt;String, String&gt; theHash = (HashMap&lt;String, String&gt;)session.getAttribute(\"attributeKey\"); return theHash; } I'd like to avoid Eclipse warnings, if possible, since theoretically they indicate at least a potential code problem. I haven't found a good way to eliminate this one yet, though. I can extract the single line involved out to a method by itself and add @SuppressWarnings(\"unchecked\") to that method, thus limiting the impact of having a block of code where I ignore warnings. Any better options? I don't want to turn these warnings off in Eclipse. Before I came to the code, it was simpler, but still provoked warnings: HashMap getItems(javax.servlet.http.HttpSession session) { HashMap theHash = (HashMap)session.getAttribute(\"attributeKey\"); return theHash; } Problem was elsewhere when you tried to use the hash you'd get warnings: HashMap items = getItems(session); items.put(\"this\", \"that\"); Type safety: The method put(Object, Object) belongs to the raw type HashMap. References to generic type HashMap&lt;K,V&gt; should be parameterized." ]

[ "Natbib -- change author conjunction in citation call-out from 'and' to '&' I'm using natbib, german babel and natbib creates output of the form Foo and Bar (1337) I would like to get Foo &amp; Bar (1337) for citet and (Foo &amp; Bar 1337) respectively for citep.", "rsync two existing directories copying everything I have two file servers in two locations. Currently both have the same data, which generally is unmodified (used for read only access).When the second server was set up (the one I'm sshing to) the data was copied over LAN and has since been moved geographically. I'm trying to use rsync for the first time on the required directories. An example command; sudo rsync -avz --ignore-existing -P --dry-run /media/Storage/OSs/ user@mydomain:/mnt/Storage/OSs/ I've tried using -c -t -u (Additionally went on the remote server and updated the timestamps to today) also but every time I execute a dry run it wants to copy everything! Additionally the user is the same for both machines with the same UID. *Edit After playing around a bit more, I've found that rsync does not like the whitespace in the subdirectory names; For instance if I use ' to escape local shell &amp; \\ to escape remote shell sudo rsync -avz --ignore-existing -P '/media/Storage/OSs/Windows/Windows server 2011/' 'user@mydomain:/mnt/Storage/OSs/Windows/Windows\\ server\\ 2011/' Then all is well, my theory is then that rsync does not like the subdirectories with whitespaces. I have thousands of subdirectories; the only solution I can think of is to write a small python/shell script to run each sub directory separately but is undesirable.", "How to maximize any of the views in quad view? I am new to blender. Pressing &#9096; Ctrl&#9095; AltQ opens the quad view. How to maximize any one of the four views of the quad view?", "Text gets stretched or disappears when scrolling When scrolling in the Stack Exchange Android app, the text gets stretched vertically, code disappears, and sometimes the entire post content disappears. This doesn't make the app completely useless, but it's pretty close. Motorola Razr MAXX, Android 4.0.4.", "I am using Selenium 2/WebDriver for automation. I have a table and am trying to select a row in it. When the test runs, I can see the row become highlighted as if it is clicked, but then immediately I get the \"org.openqa.selenium.StaleElementReferenceException: Element is no longer attached to the DOM\" error and the test fails. The code is the following: @Test public void rowSelection() throws Exception { SeleniumHelper helper = new SeleniumHelper(); action = new SeleniumActionHelper(driver); helper.login(); String testUrl = navigateToUrl(\"option/listOptions.xhtml\"); driver.get(testUrl); WebElement table = findElementById(\"tableSection:dataTableWrapped_data\"); List&lt;WebElement&gt; allRows = table.findElements(By.tagName(\"tr\")); for (WebElement row : allRows) { List&lt;WebElement&gt; cells = row.findElements(By.tagName(\"td\")); for (WebElement cell : cells) { WebElement listName = cell.findElement(By.xpath(\"./* [text()='body_build']\")); listName.click(); } } } I have put a Thread.sleep(2000) in front and after the listName.click() action, but neither has helped. Any help would be greatly appreciated.", "I've read about how some publishers (e.g., Springer) allows authors to submit to arXiv before journal submission, but they make authors wait for a year after acceptance to submit to arXiv. My question is: Is it okay to submit to arXiv during the time when the paper is under consideration by the journal, for example after it has been \"revised and resubmitted\" but before final decision?", "Derangements with repetitive numbers I have a very simple problem. Lets assume that I have a well shuffled deck of 52 cards. I start drawing the top card always and when the card matches its rank I lose. J=11 Q=12 K=13. If there were only 13 cards I could easily use the $\\ \\frac{!n}{n!}$ for derangements in order to solve this. The problem is that there are 52 cards so when I pass 13 I start from 1 again so I don't know what is the probability to win. Example of the game 1st card: 4 - Continue 2nd Card: A - continue 3rd Card: K - Continue 4th Card: K - Continue 5th Card: 6 - Continue 6th Card: 9 - Continue 7th Card: 10 - Continue 8th Card: A - Continue 9th Card: J - Continue 10th Card: 3 - Continue 11th Card: 2 - Continue 12th Card: 8 - Continue 13th Card: A - Continue 1st card: 5 - Continue 2nd Card 2 LOSE So actually I have to count from 1 to 13 4 times and if I draw all 52 cards then I win. What's the probability?", "Suppress Chrome 'Failed to load resource' messages in console", "$N$-body simulation in General Relativity How would one perform an $N$-body simulation in General Relativity (GR) for something like galaxy formation or galactic dynamics? Suppose one wants to simulate the rotation curve $v(r)$ for galaxies with an $N$-body simulation, and wants to do it in the framework of GR / the Einstein equations.", "I know that the Windows copy dialog (in Windows&nbsp;XP) stores the copy in memory first, and it is still copying after the dialog closes, so the time is off, but why is the estimation of the time it will take to make a copy so inaccurate, even when memory copying has been disabled (in Vista and Windows&nbsp;7)? It seems so arbitrary! How does the whole copy procedure work, and why can't Windows estimate it correctly?", "A sequence of real numbers such that $\\lim_{n\\to+\\infty}|x_n-x_{n+1}|=0$ but it is not Cauchy", "How do I give myself an item that can only be placed on a block with a certain damage value?", "Expanding code in etoolbox's \\ifblank I am trying to use the etoolbox \\ifblank (and its cousin \\notblank), but I want to expand any macros in its test statement. For example: \\documentclass{article} \\usepackage{etoolbox} \\begin{document} \\newtoggle{longformt} \\newcommand{\\longform}{\\toggletrue{longformt}} \\newcommand{\\iflong}[2]{\\iftoggle{longformt}{#1}{#2}} \\newcommand{\\quoteifnotblank}[1]{% \\notblank{#1}{``#1''}{}% } % Try commenting this line. \\longform This should be completely blank if the form is short: \\quoteifnotblank{\\iflong{Some long quoted text}{}} \\end{document} The problem here is that \\notblank sees its argument of \\iflong{Some long quoted text}{} as a string, not as code to be expanded, so the quotes always appear. How do I expand arguments before they are passed to \\notblank?", "How to create a YouTube playlist from a list of links? I have very long lists of YouTube links/bookmarks. I want to create playlists for my YouTube channel with them. Is there any way to do it automatically without having to add each individual URL to a playlist?", "Prove continuous functions $f$ and $g$ are equal Suppose $f,g$: $\\Bbb R$ → $\\Bbb R$ are continuous functions such that $f(r) = g(r)$ for all $r$ in $\\Bbb Q$. That is to say, $f$ and $g$ are equal on the rational numbers. Prove that $f(x) = g(x)$ for all $x$ in $\\Bbb R$", "How to change background and maintain realistic effect? I have like 30 different photos to process like this, but I want to know key things to maintain realistic photo by changing it's background, or maybe just modify background so it would be more pleasing to eye.(If you know tutorial related to my problem, please do provide it to me) Here is the photo: Here is my step 2: Here is background: Here is the result: As you can see, it isn't any close to realistic feel. I fooled around with levels, but all I got was this and still it doesn't feels right. First try: Second try: Update Different background:", "We are currently working on a windows based application where users capture data. Some data is captured in a table where other data is captured in text blocks. Im currently faced with the dilemma of how to align contents specifically decimal values. Editable cells in a grid are indicated with a pencil icon which disappears once in edit mode. You will notice that the table consists of various field types, decimals and text. So what should I do and why? A> right align all cell content B> left align all cell content C> right align only decimal values in cells D> Whatever else you can suggest", "Cannot remove a repository that complains it has no public key", "How to use WiFi and Ethernet at the same time Brief Description: I need my Ethernet card (en0) to see all traffic under 192.168.2.xxx. However I also need to use WiFi card (en1) for all other traffic. OS: OS X Lion I am using a separate network location to deal with this specific use (since this is a for a robotics project that communicates via Ethernet). Ethernet (en0) had to be set up as a static IP (192.168.2.10) per the requirements for the device I am connecting to. All connections on the Ethernet card (en0) should be 192.168.2.xxx as specified above. WiFi (en1) is set up as DHCP to a router since their is no point in assigning it as a static for general purpose traffic. Ethernet (en0) is set up as priority over WiFi (en1). I would also like to keep this under the network location preferences if at all possible since I do not require this feature to be on all the time. I would really appreciate your help on this. No one I have talked to knows how to solve this.", "What does: Error Broken count >0 mean?" ]

[ "I need to run Firefox browser from terminal. Browser works fine, but terminal still waits for Firefox to return and if I do CTRL+C, it terminates Firefox. How to run command to make Firefox work independently from terminal?", "how to add xsl attribute", "It is a common practice to apply PCA (principal component analysis) before a clustering algorithm (such as k-means). It is believed that it improves the clustering results in practice (noise reduction). However I am interested in a comparative and in-depth study of the relationship between PCA and k-means. For example, Chris Ding and Xiaofeng He, 2004, showed that \"principal components are the continuous solutions to the discrete cluster membership indicators for K-means clustering\". However, I have hard time understanding this paper, and Wikipedia actually . Also, the results of the two methods are somewhat different in the sense that PCA helps to reduce the number of \"features\" while preserving the variance, whereas clustering reduces the number of \"data-points\" by summarizing several points by their expectations/means (in the case of k-means). So if the dataset consists in $N$ points with $T$ features each, PCA aims at compressing the $T$ features whereas clustering aims at compressing the $N$ data-points. I am looking for a layman explanation of the relations between these two techniques + some more technical papers relating the two techniques.", "How do I locate all files that include specific word as part of name and end with specific extension?", "From what I know, it is unknown whether $x_n=x_{n-1}^2 + 1$ has a closed form. Is there a recurrence relation which is known to have no closed form with a proof of inexistence? Assuming a closed form is a non recursive description using the elementary operations of addition multiplication and power, or, assuming any other good definition of \"closed form\". Edit There are similar questions out there, but the answers are a little bit going around the question. So is there one with proof or is it unknown? And if it depends on the definition of a closed form, then what are the (or some) options? How strong can a closed form definition be to still have a recursive relation that can be proved to not being able to have its form? Update Because it is a big question, and I don't want to open a new small one, I think a good representative small question about this subject is: Is there a recurrence relation with a domain of the natural numbers, described by elementary functions, which has no closed form defined as: A closed form of a recurrence relation with a domain of natural numbers is a function $f$ that can be described as a composition of a constant number of elementary functions without reccursion. i.e, $f(n) = f_1(f_2( \\dots (f_k(n))) \\dots) $ where $f_i$ is elementary for all $1 \\leq i \\leq k$ I think this definition is the most intuitive and basic. For example, the relation $x_n = x_{n-1}+1$ has a closed form in this sense: $$f(n) = f_1(f_2(f_3(f_4(n))))$$ Where $f_1$ is division, $f_2(n)=(n,2)$, $f_3$ is multiplication and $f_4(n) = (n,n+1)$ Is there a recurrence relation which has no closed form in this sense?", "How to make a film in black and white and add color to some objects? How is a movie made to show selective colors. For instance, in a sister and brother are transported to the universe of an old black and white TV show, and the movie switches to being B&amp;W. Then, as the protagonists cause the inhabitants to have 'real' emotions, like fright, anger, or love, things (people, places, etc.) start having color. In the middle of the movie, many objects are still B&amp;W, yet many more are now colorized. also used this effect (the whole film was initially shot in full color, and was converted to black-and-white. Colorization is used on certain subjects in a scene), for example. How is this effect achieved? Is it post-production editing? What techniques might a director employ to do this?", "Prove the following using epsilon-delta definition: Let $a \\in \\mathbb{R}$ and $f,g$ be defined on $\\mathbb{R}$. If $$\\lim_{x\\to a} f(x) = 647 \\tag 1$$ and $$\\lim_{x\\to a} g(x) = \\infty \\tag 2$$ then $$\\lim_{x\\to a} f(x) + g(x) = \\infty.$$ $$(1) \\implies\\forall \\epsilon &gt; 0, \\exists \\delta &gt; 0, s.t. |x-a|&lt;\\delta \\implies |f(x)-647| &lt; \\epsilon$$ $$(2) \\implies \\forall M &gt; 0, \\exists \\delta_2 &gt; 0, s.t. |x-a|&lt;\\delta_2 \\implies |g(x)| &gt; M$$ Not sure about this... I've set up the definitions. I believe we will have to take a minimum between the deltas for first two limits then use it in the third. Anyone have any clues?", "Wikipedia says \"In the mathematical discipline of linear algebra, a matrix decomposition or matrix factorization is a factorization of a matrix into a product of matrices. There are many different matrix decompositions; each finds use among a particular class of problems.\" But in my opinion decomposition term should be used to represent breaking a matrix in different sub-matrices or some new matrices created after some operation on original matrix which if used together and passed through some algorithm(not necessarily product), shall reproduce the original matrix. Is there some different terminology to represent what I am expecting to say?", "limit of integral $n\\int_{0}^{1} x^n f(x) \\text{d}x$ as $n\\rightarrow \\infty$ I am trying to solve the following problem at the level of a senior undergrad analysis level. So, the problem is as follows: We are given a function $f$ which is continuous on the interval $\\left [ 0,1 \\right ]$, and the question is to find the limit: $$\\lim_{n\\rightarrow \\infty}\\int_{0}^{1}x^{n}f(x)dx\\;.$$ The second part of the problem is to deduce the following limit: $$\\lim_{n\\rightarrow \\infty}n\\int_{0}^{1}x^{n}f(x)dx\\;.$$ For the first part: I just did the following: For every $0\\leq x&lt; 1$: $x\\leq M$, where $0&lt; M&lt; 1$. Then: $$\\int_{0}^{1}x^{n}f(x)dx\\leq M^{n}\\int_{0}^{1}f(x)dx\\;.$$ Then: $$\\lim_{n\\rightarrow \\infty }\\int_{0}^{1}x^{n}f(x)dx\\leq \\lim_{n\\rightarrow \\infty }M^{n}\\int_{0}^{1}f(x)dx= 0.\\int_{0}^{1}f(x)dx=0\\;,$$ so $$\\lim_{n\\rightarrow \\infty }\\int_{0}^{1}x^{n}f(x)dx=\\lim_{n\\rightarrow \\infty }f(1)\\int_{0}^{1}1dx=f(1)\\;.$$ Does that make sense? If not, please show me the correct one. As for the second part, I have no idea what to do. Any help?", "I am working on plugin to Drupal Commerce, and I started getting this error: DatabaseTransactionOutOfOrderException: in DatabaseConnection-&gt;rollback() (line 1058 of /Library/WebServer/Documents/includes/database/database.inc). Can anyone shed some light on what this error means? If I install a fresh drupal and reinstall my plugin, is that likely to clear things up? Any advice? Thanks!", "Prove $\\sup(f+g) \\le \\sup f + \\sup g$ Suppose $D$ is a nonempty bounded subset of reals. Let $f:D \\to \\mathbb R$ and $g:D \\to \\mathbb R$. Define $(f+g)(x)=f(x)+g(x)$. Prove $\\sup(f+g)(D) \\le \\sup f(D) + \\sup g(D)$ (also prove that $\\sup (f+g)$ exists). I understand why this is the case, just not how to prove it. Left side is pretty much $\\sup (f(x)+g(x))$ and right side is $\\sup (f(x) + g(y))$ for $x,\\,y \\in D$. Basically $f+g$ has to use the same variable and $f(D)+g(D)$ use different ones. But I don't know how to go about proving this. The second part of the question is to find a specific example where strict inequality holds. Let $D=\\{a,b\\}$ and $f: a \\to 1,\\, b\\to 0, \\,g: a \\to 0,\\, b\\to 1$. $\\sup f(D) = 1,\\, \\sup g(D) = 1,\\, \\sup f(D) + \\sup g(D) = 2.$ $\\sup (f+g)(D) = 1$ (if we choose a, $f+g = 1+0,\\, b,\\, f+g=0+1$).", "6-digit password - a special decoding method", "What is the life expectancy of a Wookiee? At lunch, my coworkers and I were discussing The Force Awakens, and started questioning Chewbacca's age. A quick check of and it says he is possibly about 230 years old as of Episode VII. Following the link on that page, Wookieepedia claims that they live to be 400 years old. Do we know from canon what the average life expectancy of a Wookiee is?", "How to change from German to English in the File Manager in Ubuntu 15.10? My months and days in my File Manager are in German, how do I change that? On the photo you see 'Dez' : It means Dezember (German for December). I also saw one day Mittwoch (German for Wednesday). How do I change that German issue? This is only my File Manager and not completly but partially. Weird.", "Grant group traversal rights on a folder", "Function with limits only at irrational points This is the starred example 5.1.8 in Krantz' Real Analysis and Foundations. Give an example of a function $f: \\mathbb{R} \\rightarrow \\mathbb{R}$ so that $\\lim_{x\\rightarrow c} f(x)$ exists when $c$ is irrational but does not exist when $c$ is rational. I'm aware of the Dirichlet and Thomae functions but this seems slightly different. I'm not even sure a solution exists. Thanks for any help!", "I'm looking for a story that was probably written somewhere from the 1940s to the 1960s. I think I read it in an anthology, possibly in the 1970s. A group of human explorers landed on a planet with primitive aliens, living in hunter-gatherer villages. They hoped to make a profit from trading our goods for—well, I'm not clear on what they wanted from the aliens. The native people learned the human language before the explorers could learn theirs. Then the natives suddenly started producing technological innovations far beyond what they originally used. I remember that wooden sailing ships suddenly replaced their canoes. All the natives had to do was hear a story once from the explorers before copying the technology in the story. Finally, the explorers realized that the natives were much, much smarter than us and that Earth faced a serious problem. I'm fairly certain that it wasn't a Heinlein story, but I remember that it had some qualities similar to his work.", "How does the double strike mechanic interact with other mechanics like lifelink or trample?", "Side effects of changing blackboard bold font with \\setmathfont", "Proving that $\\frac{1}{1\\cdot 2} + \\frac{1}{2\\cdot 3} + \\frac{1}{3 \\cdot 4} +\\ldots + \\frac{1}{n(n+1)} = \\frac{n}{n+1}$ How would we go about proving that $$\\frac{1}{1\\cdot 2} + \\frac{1}{2\\cdot 3} + \\frac{1}{3 \\cdot 4} +\\ldots +\\frac{1}{n(n+1)} = \\frac{n}{n+1}$$" ]

[ "How to get my own IP address and save it to a variable in a shell script? How can I get my own IP address and save it to a variable in a shell script?", "I'm trying to convert some strings that are in French Canadian and basically, I'd like to be able to take out the French accent marks in the letters while keeping the letter. (E.g. convert é to e, so crème brûlée would become creme brulee) What is the best method for achieving this?", "No more updates for Google Chrome 32-bit I am using Google Chrome 48.0 32-bit. Today when I launched Google Chrome, I got this message: This computer will soon stop receiving Google Chrome updates because this Linux system will no longer be supported I thought Ubuntu 14.04 is supported for five years, what's exactly happening here? And on 64-bit Ubuntu, I get an error from Update Manager and apt-get update: Failed to fetch http://dl.google.com/linux/chrome/deb/dists/stable/Release Unable to find expected entry 'main/binary-i386/Packages' in Release file (Wrong sources.list entry or malformed file) Some index files failed to download. They have been ignored, or old ones used instead.", "I have a Surface Pro 4 and an iMac (late 2019). I would like to connect my Surface Pro to the iMac to use the iMac screen as a second monitor. Is that possible? What are the requirements to use an iMac as a second screen?", "I got a paged loop that pulls in 4 posts per page from custom post type. It works great, with the only downside that the pagination wont go over the page/20 everything after that is 404, and the posts_nav_link won't show the next arrow at all. Like the pages just aren't there. In total there are 119 published posts in the custom post type. If I change posts_per_page to, say 6, then I get access to more of the posts from the end, but it also stops at the page/20. On the production site the pagination stops at 21, I guess because the live database has more entries. I got the \"Blog pages show at most\" setting set to 6. Here's the loop I'm using: &lt;?php $paged = get_query_var('paged') ? get_query_var('paged') : 1; $args = array( 'posts_per_page' =&gt; 4, 'orderby' =&gt; 'modified', 'post_type' =&gt; \"projekte\", 'paged' =&gt; $paged ); $custom_query = new WP_Query($args); $c = 0; while($custom_query-&gt;have_posts()) : $custom_query-&gt;the_post(); ?&gt; &lt;article&gt;...&lt;/article&gt; &lt;?php endwhile; wp_reset_postdata(); // reset the query ?&gt; I've gone through the functions.php a million times looking for a some limiting get_pre_posts filter but there's nothing I can see. I also got an error log setup and nothing is returned there, I've tested it that it works. Any suggestions?", "I am familiar with what partitions are, but I saw , and realised I didn't know what \"aligned partitions\" are. So what does it mean to \"align\" partitions? What are the benefits, and the downsides?", "Convert /etc/network/interfaces to netplan for floating IP I am new to the netplan on Ubuntu 18.04, just discovered it exists today. I have an interface that I am trying to add to create a floating IP on google cloud. It is based on this example: I tested the example, and it works, but now I try to do the same on ubuntu, and I don't know how to convert this: cat &lt;&lt; EOF &gt;&gt; /etc/network/interfaces auto eth0:0 iface eth0:0 inet static address 10.190.1.1 netmask 255.255.255.255 EOF to netplan. The output for ls /etc/netplan is '50-cloud-init.yaml'. and the output for cat /etc/netplan/*.yaml is: network: version: 2 ethernets: ens4: dhcp4: true match: macaddress: 42:01:0a:8e:00:3e set-name: ens4 my ifconfig: # ifconfig ens4 ens4: flags=4163&lt;UP,BROADCAST,RUNNING,MULTICAST&gt; mtu 1460 inet 10.142.0.62 netmask 255.255.255.255 broadcast 0.0.0.0 inet6 fe80::4001:aff:fe8e:3e prefixlen 64 scopeid 0x20&lt;link&gt; ether 42:01:0a:8e:00:3e txqueuelen 1000 (Ethernet) RX packets 9430 bytes 1635180 (1.6 MB) RX errors 0 dropped 0 overruns 0 frame 0 TX packets 13383 bytes 1513428 (1.5 MB) TX errors 0 dropped 0 overruns 0 carrier 0 collisions 0 What is the equivalent of what he said to put in the file, for netplan?", "I'm just wondering how it is possible that IGN.com has this in its title tag: Video Games, Cheats, Walkthroughs, Game Trailers, Reviews, News, Previews &amp; Videos at IGN while on Google its title is simply \"IGN\". How can one achieve such a thing? Does it use some special meta tag I can't see?", "How can I link to an external resource in a community-friendly way? I would like to help my fellow Stackizens, using material from my blog or other website. But external links are sometimes viewed as excessive promotion. From the FAQ: Be careful, because the community frowns on overt self-promotion and tends to vote it down and flag it as spam. Post good, relevant answers, and if they happen to be about your product or website, so be it. However, you must disclose your affiliation in your answers. Also, if a huge percentage of your posts include a mention of your product or website, you're probably here for the wrong reasons. I have tried posting answers that reference my blog, and I have followed the above rules, but my answers still get flagged as spam. How can I craft an answer that references my blog, website or other resource, but is still acceptable to the community?", "How to fix TikZ corners in 3D Am trying to draw a simple rectangle and there seems to be minor issue with two of the endpoints (f and d in the following). I tried line cap=rect as suggested by but that did not seem to work. The resulting image: \\documentclass{standalone} \\setlength\\PreviewBorder{5pt}% \\usepackage{tikz} \\newcommand*{\\Width}{2.0} \\newcommand*{\\Height}{3.0} \\newcommand*{\\Depth}{1.0} \\begin{document} \\begin{tikzpicture}% \\coordinate (A) at ( 0, 0, \\Depth);% \\coordinate (B) at (\\Height, 0, \\Depth);% \\coordinate (C) at (\\Height, 0, 0);% \\coordinate (D) at (\\Height, \\Width, 0);% \\coordinate (E) at ( 0, \\Width, 0);% \\coordinate (F) at ( 0, \\Width, \\Depth);% \\coordinate (G) at (\\Height, \\Width, \\Depth);% \\coordinate (H) at ( 0, 0, 0);% % \\draw [blue, ultra thick,line cap=rect]% (A) -- (B) -- (C) -- (D) -- (E) -- (F) -- cycle;% \\draw [blue, ultra thick,line cap=rect]% (B) -- (G) -- (F) -- (E) -- (D) -- (G) -- cycle;% \\path (D) [right] node {$d$};% Problem Point 1 \\path (F) [left ] node {$f$};% Problem Point 2 \\end{tikzpicture}% \\end{document} This problem about seems related, but I do not understand how to adapt that to my problem.", "Not sure this is something which people will know on here are not. We currently have a BI setup where we have Integration services on one SQL instance and the data warehouse database on a separate SQL Instance. My question is, as no users physically connect to the Integration services SQL instance and it is purely used to execute package from the integrations service catalog via SQL agent, do we need to License every user i.e. Cal's for that SQL instance. Basically i'm wanting to know if I could utilize SQL 2016 for an integration services instance and use features like Json manipulation etc and then load this data into the 2014 version instance...but what level of licensing will I need?", "What is your simplest explanation of string theory?", "Anyone know a way to immediately show the seconds of a file's date modified property in the GUI? So if you create a file, any file in any directory, right-click and choose Properties, the date modified (if it's recent) will say something like \"dd/mm/yyy hh:mm, one minute ago\" - reminder this is in Windows 7. Windows XP did it normally. Then they changed something. If you wait a while, eventually you'll see the seconds, I'm not sure how long a while is, but this is incredibly annoying if you want to troubleshoot something that relies on the seconds of timestamps... is there a setting? registry key I can change perhaps? I'm literally using Chrome, pasting in the path of the directory to be able to see the seconds quickly (as a workaround) but would be nice to be able to use Win7.", "Gluing Lemma for Closed Sets: Infinite Cover Counter-Example", "How do I put /home in a different partition? Yeah, so I have 2 hard drives, on with 2 partitions(backups and windows), and I have another that also has 2 partitions with only one used. I have Ubuntu on hard drive 2:partition one, but I have come to a point when the /home folder can't hold any more files, but the partition is only about 15% filled up. So I did some researching and figured out that you can put it on a separate partition, but most of the guides were vague on what I needed to do. Could someone give me step-by-step instructions on what I need to do, or even tell me a, easier or different way to fix this /home folder capacity problem?", "There are a number of services that will scan a website for vulnerabilities and allow the display of a trustmark image if the site passes their tests. This allegedly increases the level of trust a potential client feel toward the website and therefore makes them more likely to complete a purchase. McAfee claims it has studies which show significant increases in sales. Should I take their word for it? What sort of increase should I really expect, if any? Are these types of services worth the prices they charge?", "SEO regarding using separate tags for the logo and website name Is is true &lt;h1&gt; tag should not have more than 1 on every page for SEO? Every pages on the header, it includes and &lt;h1&gt; tag. Website Name which show an image from logo class, like this: &lt;div id=\"header\"&gt; &lt;h1 class=\"logo\"&gt; &lt;a href=\"#\"&gt;Website Name&lt;/a&gt; &lt;/h1&gt; &lt;/div&gt; and I also include &lt;h1&gt; on the contact page, help, etc and article page for example: &lt;h1&gt;Contact Us&lt;/h1&gt; &lt;h1&gt;Name of the Article Title here&lt;/h1&gt; On the homepage, it just has one &lt;h1&gt; for the logo Site Name... other pages have 2 &lt;h1&gt; tags", "How to create a cross-browser sub document with iframe or shadow dom?", "Javascript - Get Image height I need to display a bunch of images on a web page using AJAX. All of them have different dimensions, so I want to adjust their size before displaying them. Is there any way to do this in JavaScript? Using PHP's getimagesize() for each image causes an unnecessary performance hit since there will be many images.", "Find the sum to n terms as well as the sum to infinity of the series: Find the sum to $n$ terms as well as the sum to infinity of the series: $$\\frac{1}{3} + \\frac{1}{4\\cdot 2!} + \\frac{1}{5\\cdot 3!} +\\cdots.$$ I was trying this question many times but I didn't get the answer. I was using geometric series formula, but it was not applicable here...I don't know where I have to start, and I don't know any hint about this series.... If anybody helps me, I would be very thankful to him." ]

[ "Let $A$, $B$ be two reduced $k$-algebras. Then if an element of the form $$\\sum a_{i}\\otimes b_{j}$$ is nilpotent, we can compose it with any $k$-homomorphism $f$ from $A$ to $k$ to get a homomorphism from $A\\otimes B$ to $B$. This map's image is $$\\sum f(a_{i})\\otimes b_{j}$$must be nilpotent as well. So if we assume $b_{j}$ is linearly independent in the first place, we may reason that $f(a_{i})=0$. This showed that $a_{i}$ are in the Jacobson radical of $A$. However, we only know $\\mathrm{Nil}(A)=0$, and it is not clear to me how to pass from the Jacobson radical to the nilradical without using some commutative algebra machinery. Here is what I think that might work. If $A$ is of finite type, then by Nullstellensatz we can assert the above is true. But if $A$ is not of finite type, then I can write $A=k[x_{1},...,x_{n}][X]$, where $n$ is the transcendence degree of $k(A)$ and $k[X]$ is finite over $k$. Then I should be able to pass from $k[X]$ to $A$ by inductive argument on the transcendental degree of $k(A)$, since prime ideals are maximal in a UFD (I am working with $k[x]$ by introducing $[x]$). The proof I have for the case of finite type is not satisfying. Given $I\\subset k[X]$, using Nullstellensatz one can show that $$I_{X}V_{X}[I]=\\sqrt{I}$$ where $V_{X}[I]$ is the set of all points in $X$ on which $I$ vanishes, and $I_{X}(V_{X}[I])$ be the ideal in $k[X]$ which vanishes on $V_{X}[I]$. Granting this, let $I=(a_{i})$, then we want to show $I=0$, which is $V_{X}[I]=X$. This follows since if $U\\subset W$, then $V_{X}[U]\\supset V_{X}[W]$. Since $V_{X}[I]\\supset V_{X}[m_{x}]$ for all maximal ideal corresponding to points, it must be $X$. This proof is unnecessarily winding by using the ideal-variety correspondence. Ideally I should be able to construct a pure algebraic proof. The thing not clear to me is whether the above strategy really works. Namely I am not sure if I can really induct on the transcendental degree of $k(A)$. To make matters simple assume we showed the statement holds for $A$ with transdental degree $&lt;n$. For $A$ with transdental degree $n$ we can thus write it as $k[A'][x]$. Then any maximal ideal $m'$ of $k[A'][x]$ must correspond to a maximal ideal $m=m'\\cap k[A']$ in $k[A']$. But it seems not possible to show that any prime ideal is maximal. Indeed considering the simple example of $k[x,y]$, where $(x)$ is a prime ideal but not maximal since $k[x,y]/(x)=k[y]$ is not a field. The problem is in the inducting process the base ring is not neccessarily a field, and so this strategy cannot work. I am thinking maybe I can show $m'=m[f(x)]$ with $f(x)$ some irreducible polynomial in $k[A'][x]$. Because we know $k[A'][x]$ is noetherian by Hilbert's basis theorem, so in particular $m'$ must have a finite generating set. And we can reduce the number of irreducible polynomial to 1 since $m'$ is a maximal ideal. But I still do not know how to use this to finish the proof.", "What is the difference between /sbin/nologin and /bin/false? I have often heard it recommended that a user account should be disabled by setting its shell to /bin/false. But, on my existing Linux systems, I see that a great number of existing accounts (all of them service accounts) have a shell of /sbin/nologin instead. I see from the man page that /sbin/nologin prints a message to the user saying the account is disabled, and then exits. Presumably /bin/false would not print anything. I also see that /sbin/nologin is listed in /etc/shells, while /bin/false is not. The man page says that FTP will disable access for users with a shell not listed in /etc/shells and implies that other programs may do the same. Does that mean that somebody could FTP in with an account that has /sbin/nologin as its shell? What is the difference here? Which one of these should I use to disable a user account, and in what circumstances? What other effects does a listing in /etc/shells have?", "Let $G$ be a group. Show that a nonempty subset $H$ is a subgroup of $G$ if any only if $ab^{-1} \\in H $ for any $a,b \\in H$. The forward direction is quite easy. Suppose $H$ is a subgroup. Then by closure, $ab \\in H$ for any $a,b \\in H$. Every element has an inverse. Hence, if $b \\in H $, then $b^{-1} \\in H$. Hence, by closure again, $ab^{-1} \\in H$. Backward direction, suppose $ab^{-1} \\in H $ for any $a,b \\in H$. Let $a=b$. Then we have $bb^{-1}=1_H\\in H$. Let $a=1_H$ , we have $1_Hb^{-1}=b^{-1} \\in H$. I don't know how to show closure. Reference: Fraleigh p. 58 Question 5.45 in A First Course in Abstract Algebra", "I've installed phpmyadmin sudo apt-get install phpmyadmin. Of course, I have also mysql and a web server running properly. Now how can I reach it?", "AWS S3, Paperclip missing required :bucket option", "The server version of Ubuntu does not have the command. How can I add a (PPA) to the server without this command?", "How to check if a string contains a substring in Bash I have a string in Bash: string=&quot;My string&quot; How can I test if it contains another string? if [ $string ?? 'foo' ]; then echo &quot;It's there!&quot; fi Where ?? is my unknown operator. Do I use echo and grep? if echo &quot;$string&quot; | grep 'foo'; then echo &quot;It's there!&quot; fi That looks a bit clumsy.", "Formatting the union of sets In the example $\\cup^{i=1}_{\\infty}F_i$ How do you get the i=1 directly below the union symbol and the infinity directly above?", "19.10: Deactivate Alt Key From Triggering Applications' Menu Bar How can I stop the Alt key from triggering the menu bar of applications in Ubuntu 19.10? I know that there are these , , and , as well as but those solutions are no longer applicable. I did try searching for a similar option to the one in the answer of those questions but with no success.", "Beryllium Vacuum Sphere Boat/Aircraft Is it possible to make a solid rigid evacuated \"balloon\" out of Beryllium or other elements or alloys? The critical buckling pressure at which an evacuated sphere is given as $$ P_1=\\frac{2E\\cdot\\left(h/R\\right)^2}{\\sqrt{3\\left(1-\\nu^2\\right)}} $$ where $E$ is , $h$ the shell's thickness, $R$ the radius to the midsurface shell, and $\\nu$ is . Of course this is theoretical and experimental and literature values for submersibles hover around 1/4 of the theoretical pressure. Beryllium has the following properties: Density=1.85 g/cm$^3$ Young's Modulus=287*10$^9$ Pa Poisson Ratio=0.032 Calculating the upward force, buoyancy at 101.3 kPa atmospheric pressure and Radius of 10m gives 4.24*10$^8$ N. The weight of this sphere with shell thickness 1mm has 2.32*10$^7$ N downward force of Beryllium material, so it will theoretically float at ground level. Calculating the critical buckling stress of this beryllium sphere is 331.57 kPa, which is 3.27 times the atmospheric pressure of 101.3 kPa, so theoretically it won't buckle. But in experimentation done in earlier experiments as stated before, due to construction/material non-ideal situations, the critical buckling formula predicts about 4 times stronger than actual, so it would need about 400 kPa, not 331 kPa as Beryllium sphere with this specification would hold. Increasing the strength capability also increases weight and therefore lowers it's ability to float, but Beryllium is the closest element with this situation I have calculated that could work if ideal (I have only been using periodic table elements and household materials) Is it possible with an alloy of elements? Using the equations for buckling and buoyancy, the following is needed. What alloys/materials come to your mind? Material considerations: Material with larger Poisson ratio Material with larger Young's Modulus Less dense material Construction (is it possible) Material considerations affect on lift Thickness can be larger, increases strength by the squared. But also increases weight. If a material with lower density with similar structural properties as Beryllium is used, it would help. Radius can be lower for same reason, but also lowers buoyancy (volume) My other designs (don't worry about these just yet, just if you are curious is a vacuum sphere with a pressurized \"outer tube\" with spokes in tension (carbon fiber nanotubes maybe) to keep the 2 spheres in position. Another is a spherical truss out of carbon fiber nanotubes with a light membrane around. The truss prevents the outer membrane from collapsing due to the atmospheric pressure The \"point\" of this if you ask, as to why not use a traditional balloon is it can be used as a boat by filling the sphere with air, and then used as a aircraft at will by evacuating the sphere. An alternative mode of transportation for sea vessels etc.", "Spring Data JPA Update @Query not updating?", "How to make wget faster or multithreading? I've just upgraded my computer hardware(cpu + motherboard + graphic card + memory + hard disk), so that install a new OS is needed. I tried to download debian-6.0.6-amd64-netinst.iso with wget command but the speed is so slow that I could not bear. 4Kb/s ~ 17 Kb/s, slow like a running turtle, or even more slower if I use Chrome. I've read the help information of wget, it seems like there are no options could make it more faster. Is there anyway to make wget faster? Or is it possible to make it multi-threading download? PS: my bandwidth is 4M. I use this command: wget -c url http://hammurabi.acc.umu.se/debian-cd/6.0.6/amd64/iso-cd/debian-6.0.6-amd64-netinst.iso", "Is it true that if $A$ is a nonnegative primitive matrix, then $AA^T$ is also primitive? Obviously $A^T$ is primitive but in general product of primitive matrices is not primitive. Any hint?", "I play several games on Steam and I love the achievement system. It would be great to get an overview of all the achievements ever gained in Steam games. Does Steam support this? I haven't found such an overview. If such a feature does not exist, I would already be happy with an easy way to calculate the sum of all my achievements automatically. Edit: I stumbled upon an interesting website called today. Unfortunately it only works for XBox-Achievements. Does anyone know of a similar service for Steam? This would solve my question right away. Implementing my own solution based on the links posted in the answers didn't work because the APIs are not sufficient for my needs.", "Remove duplicates from a List in C# Anyone have a quick method for de-duplicating a generic List in C#?", "A theorem about Cesàro mean, related to Stolz-Cesàro theorem Original Title: Tauberian theorems and Cesàro sum Theorem (Landau-Hardy, From Rudin's Principle of Mathematical Analysis Exercise 3.14) $\\newcommand\\abs[1]{\\left\\lvert#1\\right\\rvert}$ If $\\{s_n\\}$ is a complex sequence, define its arithmetic means $\\sigma_n$ by $$\\sigma_n=\\frac{s_0+s_1+\\dotsb+s_n}{n+1}\\qquad(n=0,1,2,\\dotsc)$$ Put $a_n=s_n-s_{n-1}$ for $n\\ge1$. Assume $M&lt;+\\infty$ and $\\abs{na_n}\\le M$ for all $n$, and $\\lim_{n\\to\\infty}\\sigma_n=\\sigma$, then $\\lim_{n\\to\\infty}s_n=\\sigma$. The outline of the proof If $m&lt;n$, then $$s_n-\\sigma_n=\\frac{m+1}{n-m}(\\sigma_n-\\sigma_m)+\\frac1{n-m}\\sum_{k=m+1}^n(s_n-s_k)\\tag{*}$$ Notice that $\\abs{s_n-s_k}\\le(n-m-1)M\\,/\\,(m+2)$, fix $\\epsilon&gt;0$ and associate with each $n$ the integer $m$ that satisfies $$m\\le\\frac{n-\\epsilon}{1+\\epsilon}&lt;m+1$$ Then $(m+1)\\,/\\,(n-m)\\le1/\\epsilon$ and $\\abs{s_n-s_k}&lt;M\\epsilon$. Hence $$\\limsup_{n\\to\\infty}\\,\\abs{s_n-\\sigma}\\le M\\epsilon$$ Questions and thoughts It seems that the equation (*) comes out strangely. I wonder how to discover such kind of strange identities. So is there any observation, even deeper, to look through that equation? Thanks!", "describes how to get the changelog for a given package. However, it's the whole changelog. What I'd like is a way to see what will be changed in whatever I'm about to upgrade. For example, I was imagining something like: $ sudo apt-get upgrade --show-changelogs Reading package lists... Done Building dependency tree Reading state information... Done Calculating upgrade... Done The following packages will be upgraded: foo -- adds the bar feature for better snazziness -- removes the deprecated baz feature 1 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. Need to get 8,864 kB of archives. After this operation, 285 kB disk space will be freed. Do you want to continue [Y/n]? Unfortunately, I don't see anything like that in the man pages for apt-get. Does this or something similar exist? UPDATE: I've written a talking about apt-listchanges and Debian changelogs in a little more depth that incorporates some of the feedback in this question.", "$\\int_0^{\\infty } \\frac{\\log (x)}{e^x+1} \\, dx = -\\frac{1}{2} \\log ^2(2)$ How to show?", "Check if convergent in the end points of the convergence interval I have to find the radius of convergence for $\\displaystyle\\sum_{n=0}^{\\infty}\\frac{n}{n+1}x^n$, for x$\\in$R. I think it is $r^{-1}=\\lim_{n\\to\\infty}\\frac{a_{n+1}}{a_n}=\\lim_{n\\to\\infty}\\frac{ \\frac{n+1}{n+2} }{ \\frac{n}{n+1}}=1$ so r=1. Then I have to find out if $\\displaystyle\\sum_{n=0}^{\\infty}\\frac{n}{n+1}x^n$ is convergent in the end points of the convergence interval. I think I have to check for $|r|$. But we can't use ratio test (L=1) or integral test(not decreasing) for $\\displaystyle\\sum_{n=0}^{\\infty}\\frac{n}{n+1}$. How can I then check if it's convergent in the end points of the convergence interval?", "Triangle Inequality question with fractions Given $a, b \\in \\mathbb{R}$, prove that $$\\frac{|a + b|}{1 + |a + b|} \\le \\frac{|a|}{1 + |a|} + \\frac{|b|}{1+|b|}$$ When does equality hold? The only useful thing I could get (using the triangle inequality) is: $$\\begin{align}1 + \\left|\\left(a + \\frac{ab}{2}\\right) + \\left(b - \\frac{ab}{2}\\right)\\right| &amp;\\le 1 + \\left|a + \\frac{ab}{2}\\right| + \\left|b - \\frac{ab}{2}\\right|\\\\ &amp;\\le 1 + |a| + |b| + |ab|\\\\ &amp;=(1 + |a|)(1 + |b|)\\end{align}$$ But it seems to be inapplicable! Any ideas?" ]

[ "Schengen Visa Application: what are some helpful tips for preparing?", "I recently dismissed Dogmeat in favor of Codsworth, and I'm fairly sure I sent him to Sanctuary Hills. However, I've had a fairly detailed look around the place and I haven't found him yet. Does anyone know where he is?", "I will be attending a summer school which will last 10 days. I want to know: for applying for a Schengen visa, is the purpose of my trip considered as touristic or study?", "When you review papers submitted for publication, is there an “optimal” length for reviews? In my experience as an author and referee, I have seen a large range of review lengths (for reference, a paper in my field is typically between 3 and 8 printed pages): Zero length: for some of the papers I have authored, the reviewer just clicked the “accept as is” or “reject” checkmark on the review sheet, without adding any comment (at least, not any comment visible to me). It's not so common, but it has happened. Short length: a lot of time, I received reviews who consisted of a single paragraph. Medium: one full page, maybe two pages. Although I have never received any such long reviews, I have myself written on a few occasions reviews that exceed two pages, including once or twice a four or five-page review. These were cases where the paper was good, but could be (in my view) much improved and some of the aspects/consequences had escaped the authors' consideration. I am wondering how useful reviews of various length are to editors. I often consider that “unmotivated” reviews are useless, as they do not give any real insight about the paper to the editor. For example, if the editor gets two conflicting non motivated reviews, how is she to decide? On the other hand, although I write some from time to time, I have never received long reviews, so… is this something frowned upon?", "Why is it bad to log in as root? I've often come across posts on forums or other websites where you see people joking in such a manner about running/logging in as root as if it's something awful and everyone ought to know about it. However, there isn't much that a search reveals on the matter. It may be widely known to Linux experts, but I really don't know why. I remember always running as root when I first tried Linux years ago (Redhat and Mandrake) and don't remember running into any problems because of that. There are actually some distros that have a bright red background with alert signs all over it as wallpaper for the root user (SuSe?). I still use the \"Administrator\" account for regular use on my Windows installation and haven't ever run into any problems there either.", "Permalinks: custom post type -> custom taxonomy -> post I am having trouble working with WordPress rewrite rules, and could use some help. I have a custom post type called _shows_. All shows have a single custom taxonomy category _show-category_. A _show_ will never have more than one _show-category_. I would like my urls to route in this manner: www.mysite.com/shows/ =&gt; archive-shows.php www.mysite.com/shows/%category%/ =&gt; taxonomy-show-category.php www.mysite.com/shows/%category%/%postname%/ =&gt; single-shows.php So as a real world example, lets say we have a _show-category_ \"Foo\" and a _show_ post titled \"Bar\" that has \"Foo\" as it's _show-category_. I would expect my WordPress app to look like this: www.mysite.com/shows/foo/ =&gt; shows all posts under the foo category www.mysite.com/shows/foo/bar =&gt; shows the indivual post I try to avoid plugins when possible, but am open to any solution.", "How can I accept the Microsoft EULA agreement for ttf-mscorefonts-installer?", "Shadow Incorrect at Bottom of Edge In the images below, I have a cube that is sticking up about two thirds through a plane. But, despite the fact that the cube is not hovering over the plane, the shadow seems to indicate otherwise. How can I fix this shadow?", "How can I write a unit test to determine whether an object can be garbage collected?", "VBA array sort function? I'm looking for a decent sort implementation for arrays in VBA. A Quicksort would be preferred. Or any other other than bubble or merge would suffice. Please note that this is to work with MS Project 2003, so should avoid any of the Excel native functions and anything .net related.", "Best word for \"unable to change\"", "In a question on \"along\" vs \"alongside\", I have seen this question and the correct answer on the web site makes me confused. The question is: I enjoyed my walk _________________ the river. a) along b) alongside I selected \"...along the river\" as the correct answer, but on the web site it is shown as wrong and the correct answer is \"alongside\". How can that be? I still do not agree, because I have studied the difference between the two. \"along\" is just the right preposition for thin and long places like road, path, street, beach etc\". So, why would the correct answer be \"alongside\" which simply means \"next to\"? Do you not think \"along\" seems to be better fitting? Regards, Note: I would be more than gratefull, if somebody show it to me in a video, like \"a walk along the river\" and \"a walk alongside the river\". Maybe I can understand the how \"a walk along the river\" and \"a walk alongside the river\" would take place.", "Construct a Borel set on R such that it intersect every open interval with non-zero non-\"full\" measure", "Is an Otyugh's grapple different from a standard grapple? In 5e to escape a Grapple check, I know you roll athletics (str) or acrobatics (dex) opposed by an athletics (str) check. In the Otyugh entry in the Monster Manual it doesn't say there's any check, instead it assigns a set DC for an \"escape\" (DC 13... which is a str check with a 10 assigned as the \"roll\"). So the question is: Does the Otyugh actually make a roll in this instance (like the general rule) or does it have a set DC (for the specific case) OR is it just a poorly communicated version of the GENERAL rule being played out? A little clarification on this would be AWESOME. In the event of a \"specific vs general\" scenario, what actually is the \"escape\" roll? What modifier is applied? None?", "If $f \\in L_p \\cap L_q$, $1 \\leq p < r < q < \\infty$ then $f \\in L_r$. If $f \\in L_p \\cap L_q$ and $1 \\leq p &lt; r &lt; q &lt; \\infty$ then $f \\in L_r$. Proof: Let $E = \\{ x \\in X: \\left\\lvert f \\right\\rvert \\leq 1 \\}$. Then, $$\\int \\left\\lvert f \\right\\rvert^r \\mathrm{d}\\mu = \\int_E \\left\\lvert f \\right\\rvert^r \\mathrm{d}\\mu+\\int_{E^C} \\left\\lvert f \\right\\rvert^r \\mathrm{d}\\mu \\leq \\int_E \\left\\lvert f \\right\\rvert^p \\mathrm{d}\\mu+\\int_{E^C} \\left\\lvert f \\right\\rvert^q \\mathrm{d}\\mu$$ $$\\leq \\int \\left\\lvert f \\right\\rvert^p \\mathrm{d}\\mu+\\int \\left\\lvert f \\right\\rvert^q \\mathrm{d}\\mu &lt; \\infty.$$ Thus, $f \\in L_r$. I just want to make sure I am somehow not missing anything. Thanks", "Java: Sorting user-input array upon return", "How can you smooth the edge between two materials?", "I haven't played Magic: the Gathering since the days of Onslaught and Mirrodin, and I would like to try to catch back up. Since all my cards are quite dated now, I may be more interested in formats other than the most up-to-date one. Rather than ask what is currently legal in various formats (since that is likely too localized), I would rather pose the question of how can I tell which sets/cards are legal in each format.", "Android How to use MediaScannerConnection scanFile", "How to share the \"Look Back\" video from Facebook? On Facebook, there is a looking back on your Facebook history. Apparently, some people have shared this video with their friends, however I and someone else cannot figure out how to do so. This URL is not unique, it's a global URL which shows the video of who's logged in. People say there's supposed to be a \"share\" link, but there are no links whatsoever. And, I can't share the URL because it would show them their own videos. How do I share this video with friends on Facebook? without using a screen recorder to capture it" ]

[ "How to convert decimal to hexadecimal in JavaScript", "Java method dispatch with null argument", "How to SEO a Single-Page website", "Why do hard links exist?", "In Einstein's General Relativity, do the space-time dimensions curve? In Einstein's General Relativity, do the space-time dimensions curve according to the positions of stars, planets, and masses?", "How to restore original size and unboot my bootable USB pendrive I recently made my pen-drive bootable with Ubuntu 14.04. But I need to unboot my pen-drive now. I formatted my pen-drive once,But the size of the pen-drive still shows 2.25 MB. Whereas,this is an 8GB pen-drive. How can I get rid of this problem. I'm still using Windows 7.", "Should an adverb go before or after a verb? For example: The word rarely turns up outside of those contexts. The word turns up rarely outside of those contexts. Which one is correct and why?", "\"High response time\" warnings in Google Webmaster Tools In my Google Webmaster Tools account, there are warnings about my site. Some URLs listed in this sitemap have a high response time. This may indicate a problem with your server or with the content of the page. What is the solution?", "Lets say I have something like: \\[ Let x = number of cats \\] (This is a contrived example, but pretend we are actually inside a long align environment block...) \"Let\" and \"number of cats\" need to be written like normal text, while x= needs to be math type text. I've seen this: \\[ \\mbox{Let } x = \\mbox{ number of cats} \\] and this: \\[ \\textrm{Let } x = \\textrm{ number of cats} \\] They seem to produce equivalent output, but I'm not sure which is the \"correct\" one. Also, they are not ideal in that the extra space needs to be placed inside the text mode block, otherwise it is ignored as math mode and butts the text right up against the math. Ideally there would be some command which allowed embedding text into an equation, which correctly inserted leading and trailing space around the block as required without adding space inside the text block. How does one do that \"correctly\"?", "Optimizer not choosing index union plan Why is the following query slow? select count(*) from [dbo].[mt_dispatch_link] , [dbo].[_mt_dispatch] [_mt_dispatch] where (mt_dispatch_link.contract_id_1 = _mt_dispatch.contract_id and mt_dispatch_link.dispatch_id_1 = _mt_dispatch.dispatch_id) or (mt_dispatch_link.contract_id_2 = _mt_dispatch.contract_id and mt_dispatch_link.dispatch_id_2 = _mt_dispatch.dispatch_id) It takes over 10 minutes, and then I tend to stop it at that point. My question is more about how to make sense of the query plan. Looking at the query plan I can see that the bottom clustered index scan is returning about 250000 records, but the cost is 0% and it is being put into a temporary table. The top index scan is about 25000 records. But the cost of 95% comes from the nested join. What conclusions should I draw from this? The above query plan shows two index scans, does that mean it is doing 25000 + 250000 index scans, or does it mean that it is doing 25000 * 250000 index scans? If I change the query to this (adding FORCESEEK): select count(*) from [dbo].[mt_dispatch_link] , [dbo].[_mt_dispatch] [_mt_dispatch] WITH (FORCESEEK) where (mt_dispatch_link.contract_id_1 = _mt_dispatch.contract_id and mt_dispatch_link.dispatch_id_1 = _mt_dispatch.dispatch_id) or (mt_dispatch_link.contract_id_2 = _mt_dispatch.contract_id and mt_dispatch_link.dispatch_id_2 = _mt_dispatch.dispatch_id) I end up with a much better plan and the query runs instantly: I ran update statistics on both tables. Didn't fix it unfortunately. The table design is not very good, so I think SQL Server doesn't really understand and is thus coming up with a poor query plan. Some more info about the table design at . Why is the query optimiser not coming up with the optimum plan?", "One of the biggest issue with cluster analysis is that we may happen to have to derive different conclusion when base on different clustering methods used (including different linkage methods in hierarchical clustering). I would like to know your opinion on this - which method will you select, and how. One might say \"the best method of clustering is which gives you the right answer\"; but I may question in response that cluster analysis is supposed to be an unsupervised technique - so how do I know which method or linkage is the right answer? In general: is a clustering alone robust enough to rely on? Or we need a second method and get a shared result to be based on both? My question is not only about possible ways to validate / evaluate clustering performance, but is broader - on what basis do we select/prefer one clustering method/algorithm over another one. Also, is there common warnings that we should look around when we are selecting a method to cluster our data? I know that it is very general question and very difficult to answer. I only would like to know if you have any comment or any advise or any suggestion for me to learn more about this.", "How many actuations are \"too many actuations\"?", "How can I delete a node after, for example, 2 weeks it has been created?", "TikZ doesn't fill when node coordinates are used Can someone please explain me why the following code doesn't result in a fill? And why, sometimes, I get such \"very thin lines\" artifact (that's visibile in my picture)? \\begin{tikzpicture} \\node (A) at (0,0) {A}; \\node (B) at (1,0) {B}; \\node (C) at (1,1) {C}; \\fill[red] (A) -- (B) -- (C) --cycle; \\end{tikzpicture} Here's what I get:", "etoolbox and tabularx -- problem with `appto` I'm trying to print worksheets. I have already implemented an automatic numbering for subtasks. I use tabularx for my subtasks (see the MWE below). Yesterday, I tried to define a new macro called \\task that has one optional argument which is the amount of points you can obtain for this particular question. I would like these optional arguments to be gathered with etoolbox's \\appto command so that I can print them with my \\credits command. So far, this seems to be ind of struggling as tabularx is working on the tables several times. Every time tabularx calculates the width of X columns the points are appended to \\credits which leads to an incorrect list of points. Is there any way I can solve this problem? I'm currently stucked with this issue. Plus, I don't know why my \\task command does work. Why is the counter subtask not affected by tabularx's several trials? \\documentclass{scrartcl} \\usepackage[utf8]{inputenc} \\usepackage[T1]{fontenc} \\usepackage{etoolbox} \\usepackage{booktabs} \\usepackage{ltablex} \\usepackage{xifthen} \\def\\credits{} \\newcounter{subtask} \\setcounter{subtask}{1} \\renewcommand{\\thesubtask}{\\alph{subtask})} \\newcommand{\\task}[1][]{% \\ifthenelse{\\isempty{#1}}{% \\thesubtask% \\stepcounter{subtask}% }{% \\thesubtask% \\gappto\\credits{(#1)}% \\stepcounter{subtask}% }% } \\begin{document} \\begin{tabularx}{\\linewidth}[l]{l@{\\hspace*{1ex}}X} \\task[1] &amp; TEXT1\\\\ \\task &amp; TEXT2\\\\ \\task[3] &amp; TEXT3 \\end{tabularx} \\credits \\end{document} The solution given by David Carlisle below causes a table that is too wide. How can this be undone? \\documentclass{scrartcl} \\usepackage[utf8]{inputenc} \\usepackage[T1]{fontenc} \\usepackage[a6paper, showframe=true]{geometry} \\usepackage{etoolbox} \\usepackage{booktabs} \\usepackage{ltablex} \\usepackage{xifthen} \\def\\credits{} \\newcounter{subtask} \\setcounter{subtask}{1} \\renewcommand{\\thesubtask}{\\alph{subtask})} \\makeatletter \\newcommand{\\task}[1][]{% \\ifx\\hfuzz\\@tempdima% % % tabularx trial do nothing \\else% \\ifthenelse{\\isempty{#1}}{% \\thesubtask% \\stepcounter{subtask}% }{% \\thesubtask% \\gappto\\credits{(#1 BE)\\\\}% \\stepcounter{subtask}% }% \\fi } \\makeatother \\begin{document} \\begin{tabularx}{\\linewidth}[l]{l@{\\hspace*{1ex}}X} \\task[1] &amp; Some longer text that exceedes the line width.\\\\ \\task[4] &amp; TEXT2\\\\ \\task[3] &amp; TEXT3 \\end{tabularx} \\credits \\end{document}", "Motivation behind standard deviation? Let's take the numbers 0-10. Their mean is 5, and the individual deviations from 5 are -5, -4, -3, -2, -1, 0, 1, 2, 3, 4, 5 And so the average (magnitude of) deviation from the mean is $30/11 \\approx 2.72$. However, this is not the standard deviation. The standard deviation is $\\sqrt{10} \\approx 3.16$. The first mean-deviation is a simpler and by far more intuitive definition of the \"standard-deviation\", so I'm sure it's the first definition statisticians worked with. However, for some reason they decided to adopt the second definition instead. What is the reasoning behind that decision?", "Understanding the proof for showing that there are infinitely many $n\\in\\mathbb{Z}^+$ such that $n!+1$ is divisible by at least two distinct primes There is another post pertaining to this question; however, the other post does not address some specifics that concern me in the proof. Proof: Let $n=p-1, p \\geq 7$. Then $p|(p-1)!+1$. We will show that $(p-1)!+1=p^n$ has no solutions. Suppose not. Suppose $(p-1)! + 1 = p^n$ has a solution for $p\\geq 7$. Then $(p-1)! =p^n-1 = (p-1)(p^{n-1}+\\cdots+p+1)$. So $(p-2)!\\equiv n (\\mod p-1)$. Now suppose that $(p-1)|n$. Then $p-1\\leq n$. So $(p-1)!+1&lt;p^{p-1}\\leq p^n$. Hence, there are no solutions. It remains to show that $(p-1)|(p-2)!$. But $p-1=2m$ means $2m|(p-2)!$. QED Questions: My understanding is that at the start of the proof, Wilson's theorem is used to show that at least one prime divides $n!+1$. Why do we want to show that $(p-1)!+1=p^n$ has no solutions? The way I see it is that $p^n$ is composite, and we are basically saying that $p^n\\nmid (p-1)!+1$, so no composite number divides $n! +1$. But how and where in the proof do we actually show that another prime $q \\neq p$ divides $n!+1$? Thanks in advance.", "From what I understand, midi-chlorian count is a strong indicator of ability in the Force (though there are other factors as well). So it seems like when Anakin loses his arm or Luke loses his hand, their midi-chlorian counts (and thus their Force ability) should slightly diminish. Is this the case?", "How big an RSA key is considered secure today? I think 1024 bit RSA keys were considered secure ~5 years ago, but I assume that's not true anymore. Can 2048 or 4096 keys still be relied upon, or have we gained too much computing power in the meanwhile? Edit: Lets assume an appropriate padding strategy. Also, I'm asking both about security of signatures and security of data encryption.", "The value of a, b and c for this integral Find out the value of $a, b$ and $c$, for which $$ \\lim _{x\\to 0}\\:\\:\\frac{1}{x^5}\\left(\\int _0^x\\:\\left(a+b \\cos\\left(t\\right)+c \\cos\\left(2t\\right)\\right)dt\\right)=\\frac{1}{5} $$ My first thought was to separate the integral into multiple ones because i thought that it is pretty clear that each integral is a common one and a,b,c are constants and can be taken out . After I solved the integral, that's where I had the problem. I couldn't do the limit of the result that I've got in order to find out the value of $a,b$ and $c$ ." ]

[ "Shape gets distorted when adding stroke in Illustrator CS6 I very recently started learning how to use Adobe Illustrator (CS6), and just now I noticed something strange. When I add a 1pt stroke to my shape, it gets slightly distorted. This distortion does not disappear if I remove the stroke. (But only if I remove the stroke by setting its weight to 0. Using CTRL+Z does return the shape to its former state.) After adding and removing the stroke a few times, the difference becomes quite noticable: Am I doing something wrong? Is it a bug? I can't imagine this being the expected behaviour. EDIT: I think I figured it out. Appearantly, turning 'Align to pixel grid' off doesn't affect previous shapes. If I turn it off and then recreate my shape from scratch, the problem is fixed. However, I was wondering if their is a way to disable the effect for existing shapes. In other words, can I 'fix' the shapes I created while 'Align to pixel grid' was still on?", "Prove that $\\sum_{r=1}^nr(r+1)=\\frac{n(n+1)(n+2)}{3}$ using induction $$\\sum_{r=1}^nr(r+1)=\\frac{n(n+1)(n+2)}{3}$$ could you help me with how exactly I work this out?", "Hint: $a^2 -ab +b^2 = (a+b)^2 -3ab.$ I know we can say that there exists an $x,y$ such that $ax + by = 1$. So in this case, $(a+b)x + ((a+b)^2 -3ab)y =1.$ I thought setting $x = (a+b)$ and $y = -1$ would help but that gives me $3ab =1.$ Any suggestions?", "Can you benefit from the Dueling fighting style for one weapon, then draw a second weapon as part of Extra Attack to qualify for Two-Weapon Fighting?", "Ubuntu Wifi drivers not working after getting update", "How can I update all Snap packages? I know that I can update a snap package using sudo snap refresh &lt;package&gt; But is there a way to update all snaps, like sudo apt dist-upgrade", "Free ornaments font I'm looking for a free ornaments font. I know about and pifont. Where can I find more glyphs?", "My machine has a SSD (fairly small) and a Hard disk (large). I want to have windows and a couple of programs on the SSD but I want to have the documents folders (such as my documents and my downloads) on the HD. I also want the default install directory pointing at the larger HD. Can anyone advise or point me to a relevent guide? Thanks.", "How to add/subtract months from given date in Excel", "How do I see the extensions loaded by PHP?", "Fancy Chapter Headings Style I would like make a fancy chapter like the figure. However, i made this code \\documentclass[12pt,a4paper]{book} \\usepackage{lmodern} \\usepackage{titlesec} \\usepackage{microtype} \\usepackage{tikz} \\titleformat{\\chapter}[display] {\\normalfont\\bfseries\\color{black}} {%\\filleft% \\begin{tikzpicture} \\node[ outer sep=-10pt, text width=2.5cm, minimum height=3cm, fill=black, font=\\color{white}\\fontsize{80}{90}\\selectfont, align=center ] (num) {\\thechapter}; \\node[ rotate=0, anchor=south, font=\\color{black}\\Large\\normalfont ] at ([yshift=43pt,xshift=30]num.west) {\\textls[180]{\\textsc{\\chaptertitlename}}}; \\end{tikzpicture}% } {-90pt} {\\titlerule[2.5pt]\\vskip3pt\\titlerule\\vskip4pt\\LARGE\\sffamily \\raggedright } \\begin{document} \\chapter{The Singular Sturm-Liouville Problems in Spectral Parameter} \\end{document} that produces this one How can I produce the chapter like the First Figure?", "Sort a Map by values", "Export each image from a collection in Google Earth Engine I am trying to export each image in a filtered stack of Sentinel-1 images and cannot seem to get it right. suggests using imageCollection.map() and a custom function (such as a geometric clip). // Create a geometry representing an export region. var roi = ee.Geometry.Rectangle([-63.0, 9.2, -63.1, 9.3]); // Load the Sentinel-1 ImageCollection. var sentinel1 = ee.ImageCollection('COPERNICUS/S1_GRD'); // Filter by metadata properties. var IW_H = sentinel1 // Filter to get images with VV and VH dual polarization. .filter(ee.Filter.listContains('transmitterReceiverPolarisation', 'VV')) .filter(ee.Filter.listContains('transmitterReceiverPolarisation', 'VH')) // Filter to get images collected in interferometric wide swath mode. .filter(ee.Filter.eq('instrumentMode', 'IW')) // Filter IWs to get High res. .filter(ee.Filter.eq('resolution', 'H')) // Filter IW-Highs to get 10m res .filter(ee.Filter.eq('resolution_meters', 10)); // Filter to get images from different look angles var DescCollection = IW_H.filter(ee.Filter.eq('orbitProperties_pass', 'DESCENDING')); var ClipFunc = function(iImage, geom) { var iClip = clip(iImage, geom); return(iClip); }; imageCollection.map(ClipFunc(DescCollection, roi));", "I'm hoping someone can help me as this is driving me nuts! Context and Chronological info I'm trying to find the title/author of a short story that I read in some or other anthology ages ago. I couldn't give you an exact date but I'd say it was probably 50s/60s. Plot The human population has increased to the point where input and output of resources on Earth is in exact equilibrium. As such, no other living matter can be permitted to exist, as its use of resources would throw this equilibrium out of balance. One man in a vast tower block has managed to hide some flowers, and, I think, one or a few small animals - perhaps a mouse. These are detected by the relevant authorities, and the story ends when an official arrives at the apartment and requires the man to destroy them - the last non-human living things on Earth.", "Within my web application directory, how can I change all my folder permissions to rwxr-xr-x (755)? And how can I change all file permissions to rw-r--r-- (644)? I want to change all folders and files including sub-sub files and folders. I know the following command would change all files and folders but I want to discrimate between a file and a folder. chmod -R 755 ./my_web_app_project", "When I type \"[singular noun] and [singular noun]\" in Word 2010, I find some interesting things. Bread and butter is essential. (the auto-correction warns me of subject-verb disagreement.) Bread and butter are essential. (OK) A knife and fork is on the table. (OK) A knife and fork are on the table. (OK) The needle and thread is new. (OK) The needle and thread are new. (OK) Cost and revenue is directly linked. (OK) Cost and revenue are directly linked. (OK) I wonder how a native speaker would consider this phenomenon.", "Mass Lead Conversion - Programmatically or Using Data Loader", "Delay in approval leads to missing out on being awarded an \"Explainer\" badge", "Singular vs. Plural with Multiple Gerunds as Subject (IE: [Gerund] and [Gerund] are/is [something].) I'm trying to find out whether I should use a singular or plural verb when there are multiple gerunds as the subject of the sentence. For example: Running the correct course and keeping a steady pace are/is necessary in order to win. With either one of these by itself, &quot;is&quot; would be correct: Running the correct course is necessary in order to win. Keeping a steady pace is necessary in order to win. With both gerunds combined, I can't seem to figure out whether the verb should stay singular since each phrase is singular, or if it should become plural since there are two connected by &quot;and&quot;. If we just treat the gerunds as regular nouns, then obviously it would become &quot;are&quot;, but I'm not sure if gerunds have the exact same rules as regular nouns. I know that if the sentence was: Running the correct course and keeping a steady pace are both necessary. That &quot;are&quot; would be correct, but without the &quot;both&quot; it sounds incorrect to me. Does anyone know the official rule here?", "Why is the top bar not changed on Stack Exchange, Area 51 and Ask Ubuntu?" ]

[ "Whenever I try to do a fluid simulation, the fluid domain remains visible. I have tried:ctrl+a-scale, turn on/off visibility for render/viewport Here's a video demonstrating my problem: Here's the blend file in case I have messed up some settings: Thank you for any help!", "Interpretation of simple predictions to odds ratios in logistic regression I'm somewhat new to using logistic regression, and a bit confused by a discrepancy between my interpretations of the following values which I thought would be the same: exponentiated beta values predicted probability of the outcome using beta values. Here is a simplified version of the model I am using, where undernutrition and insurance are both binary, and wealth is continuous: Under.Nutrition ~ insurance + wealth My (actual) model returns an exponentiated beta value of .8 for insurance, which I would interpret as: \"The probability of being undernourished for an insured individual is .8 times the probability of being undernourished for an uninsured individual.\" However, when I calculate the difference in probabilities for individuals by putting in values of 0 and 1 into the insurance variable and the mean value for wealth, the difference in undernutrition is only .04. That is calculated as follows: Probability Undernourished = exp(β0 + β1*Insurance + β2*Wealth) / (1+exp(β0 + β1*Insurance + β2*wealth)) I would really appreciate it if someone could explain why these values are different, and what a better interpretation (particularly for the second value) might be. Further Clarification Edits As I understand it, the probability of being under-nourished for an uninsured person (where B1 corresponds to insurance) is: Prob(Unins) = exp(β0 + β1*0 + β2*Wealth) / (1+exp(β0 + β1*0+ β2*wealth)) While the Probability of being under-nourished for an insured person is: Prob(Ins)= exp(β0 + β1*1 + β2*Wealth) / (1+exp(β0 + β1*1+ β2*wealth)) The odds of being undernourished for an uninsured person compared to an insured person is: exp(B1) Is there a way to translate between these values (mathematically)? I'm still a bit confused by this equation (where I should probably be a different value on the RHS): Prob(Ins) - Prob(Unins) != exp(B) In layman's terms, the question is why doesn't insuring an individual change their probability of being under-nourished as much as the odds ratio indicates it does? In my data, Prob(Ins) - Prob(Unins) = .04, where the exponentiated beta value is .8 (so why is the difference not .2?)", "Can I let my fake flash USB drive get its real capacity through low level format? Recently, I bought an USB flash drive which has a cool design. The seller said it is 256GB however, I've already known that capacity would be fake. Anyway, I bought it cause of its cool design and want to use this USB flash drive anyway. What should I do? I've tried to find a proper tool(vid 1908 / pid 1320) but couldn't. Can I repair this through Low level format? Or partitioning this through Linux?", "I found two things peculiar in the common style of macro definitions: Ending lines in macro definitions with '%'; Not wrapping a macro name in braces. Example: \\newcommand\\examplemacro{% \\somecommand% \\othercommand% } Being a software engineer first and a LaTeX user a distant second, I would expect: \\newcommand{\\examplemacro}{ \\somecommand{} \\othercommand{} } Is there a reason for doing it the former way, or is it merely a matter of habit?", "I made a character, and its one of my first times texturing, and I saved my character into a new folder, and when I came back to the model ALL the textures were pink, I used to know what to do, but I stopped texturing, how do I bring my textures back?", "How can I manually install a package on MiKTeX (Windows)", "Asserting that Atheism and Theism are both faith based positions I am recently testing an assertion that I have concluded namely that atheism is a faith based position just like theism is a faith based position. The reason I arrived at this conclusion is that theists have no proof that God actually exists. It's purely a matter of faith. Yes, there maybe strong implicit proof that God exists in their opinion (scriptures, history, etc) but there is no concrete proof of God's existence. In my view, atheists also suffer from the same problem of providing a proof of their position. Specifically that they cannot prove that God is non-existent. The typical rebuttal I get is that the burden of proof is on the theists. But I view this as a cop out and they hide behind the wall of burden of proof which is just a bias in the debate. Given the above, I claim that both atheism and theism are positions based on faith. Would it be incorrect to claim that?", "I was amused by the expression \"Paid a penny and only farted\" (related by @FumbleFingers), which suggested a similar Japanese saying: 大山鳴動鼠一匹 - \"Find only a small mouse coming out after hearing rumblings and experiencing shaking of the big mountain.\" It’s humorous. I chuckled when I read it, and I wrote to the author that I love it. With that said, the word \"fart\" reminds me of another Japanese proverb, 百日の説法屁一つ- \"A fart ruins 100 days of sermons by the priest\", which means that a small mistake (the sound of a fart in front of the congregation) brings all his efforts to naught. It can’t happen in big Western churches. But it could well happen in a small wooden temple where a priest would preach to 30 – 50 provincial followers. Can you imagine how the proud priest being called 'the venerable' would be embarrased when his loud fart is heard by all his followers during his serious sermon and they start to giggle here and there in the hall? We also have a similar saying\" 九仞の功を一簣に欠く, which literally means \"Collapse a 9- meter sand tower with the last pile of sand.\" What is the English equivalent of the saying \"A fart ruins 100 days of sermons by the priest (bishop): a small mistake depreciates the value of (vitiates) all labor and effort to naught,\" preferably in such a humorous way?", "How do I read and parse an XML file in C#?", "C#: How to create an attribute on a method triggering an event when it is invoked?", "Train passport control from London to Paris I'm a non-EU citizen, I will be travelling from London to Paris next month, so I was wondering since most countries track entry and leave dates, if I use the train to switch these countries and they don't control it, my UK visa will seem like entry YES but no leaving. Same for the Schengen, I wouldn't have an entry date but I'll be leaving, Will it be trouble later? Are they controlling this on trains? If not is there anything I should do before?", "Double-column listing package Not too well up on LaTeX, but I want to use the listings package for listings spanning a two-column format. Unfortunately, asterisks cannot save me (like for figures/tables); this doesn't work: \\begin{lstlisting*} ... \\end{lstlisting*} I've Googled about, but got no satisfactory answer, and getting a bit desperate. Should be simple... hope I'm not missing something stupid. Perhaps it's possible to embed this into a separate spanning float? Help? (P.S., I've posted this on the main stackoverflow site as well... if this is considered a duplicate, please comment and I'll remove the other. Getting a bit desperate fighting a deadline.)", "Better way of saying \"those who are curious\"? I am writing a note in which I want to ask (curious) readers to refer another paper. The phrase curious minded comes to mind, but it seems somewhat awkward. Is there a better way to convey similar import?", "I was going through the topic \"formation of comparative and superlative\". The rule says When two objects are compared with each other, the latter term of comparison must exclude the former, as in \"Iron is more useful than any other metal\". If we say \"Iron is more useful than any metal\", that is the same thing as saying \"Iron is more useful than iron\", since iron is itself a metal. I am finding difficulty to relate the rule with example.", "Find a tangent to two quadratic bezier curves I have two quadratic bezier curves and I want to find whether they have a common tangent, and if so where it is. If the first bezier is defined by points $(x_1, y_1)$, $(x_2, y_2)$, $(x_3, y_3)$, then the points on the curve have coordinates: $x = (x_1 - 2x_2 + x_3)t^2 + (2x_2 - 2x_1)t + x_1 \\\\ y = (y_1 - 2y_2 + y_3)t^2 + (2y_2 - 2y_1)t + y_1$ Or to simplify things: $x = A_xt^2 + B_xt + C_x \\\\ y = A_yt^2 + B_yt + C_y$ Likewise, I can get an equation for the second bezier: $x = D_xs^2 + E_xs + F_x \\\\ y = D_ys^2 + E_ys + F_y$ The gradient of the tangent, $m$, to the first curve at $t$ is $\\dfrac{2A_yt + B_y}{2A_xt + B_x}$, which must be equal to the tangent to the second curve at $s$, $\\dfrac{2D_ys + E_y}{2D_xs + E_x}$. So $m = \\dfrac{2A_yt + B_y}{2A_xt + B_x} = \\dfrac{2D_ys + E_y}{2D_xs + E_x}$ Which I rearranged to get: $t = \\dfrac{2(B_yD_x - D_yB_x)s + B_yE_x - B_xE_y}{4(A_xD_y - A_yD_x)s + 2(A_xE_y - A_yE_x)}$ The gradient of the tangent is also equal to the difference in the y-coordinates over the difference in x-coordinates: $m = \\dfrac{D_ys^2 + E_ys + F_y - (A_yt^2 + B_yt + C_y)}{D_xs^2 + E_xs + F_x - (A_xt^2 + B_xt + C_x)}$ But that's as far as I got. The algebra looks too messy from here. Can anyone solve this, or is there a better approach?", "Why couldn't the Jedi detect Senator Palpatine as having powers? In Return of the Jedi, when trying to sneak into the base on a shuttle, Luke said he senses Darth Vader's presence and said he shouldn't have come lest he jeopardize the mission. Darth Vader also sensed Luke, but let him in anyways. Also, Yoda and Obi-Wan could detect the Force in young Anakin. So if Jedi and Sith can detect each other, why couldn't they detect Senator Palpatine to begin with? It seems like a giant plot hole.", "Proof about Graph with no triangle", "Alternative to Photoshop or Paint.NET I have been moving toward Ubuntu from a long time Windows development background. The one program I cannot seem to do without is a graphic editor. I have seen recommendations for programs, but they turn out to be directed at children or tailored to working with personal photographs. I am looking for something more for programming tasks like analysing colors, resizing, creating web graphics, etc. I have used Photoshop in the past and more recently have mostly used Paint.net for Windows. Is there a program for Ubuntu that covers this area?", "We have the following points: $$ (0,0)(1,51.8)(1.9,101.3)(2.8,148.4)(3.7,201.5)(4.7,251.1) \\\\ (5.6,302.3)(6.6,350.9)(7.5,397.1)(8.5,452.5)(9.3,496.3) $$ How can we find the best fitting line $y=ax$ through the points? My calculator has the option to find the best fitting line $y=ax+b$ through these points, which is: $$y = 53.28x + 0.37$$ How can I find the best fitting $y=ax$? It seems to me we can't just remove the $0.37$ without compensating in the $a$?", "I'm not too sure whether this is the right place to ask this (and please correct me if it is not), but I'm currently studying a course in Algebraic Number Theory and would like to be pointed in the direction of any solved problems that can assist in learning. I have the book Problems in Algebraic Number Theory by Murty and Esmonde, which is particularly good, but are there any further sources (inc. online) available that do a similar job? It is so often frustrating to be presented with an extensive list of practice questions, many of which form part of the exposition of the material (as in Number Fields by Marcus for example) and then to have no real way of knowing whether any solution you generate is correct and has not made any oversights. MSE is undoubtedly a good place to verify any answers and clear up issues, but question limits and the impracticality of going online every time a solution seems suspect (or the question is computational and lacks any result to check against) form a barrier. I suppose any ANT textbook that has an accompanying solutions manual or online published solutions is what I have in mind. Or failing that, links to institutions running a course in ANT with answers to homework exercises. Thanks in advance." ]

[ "Proving $\\frac{\\sin x}{x} =\\left(1-\\frac{x^2}{\\pi^2}\\right)\\left(1-\\frac{x^2}{2^2\\pi^2}\\right) \\left(1-\\frac{x^2}{3^2\\pi^2}\\right)\\cdots$", "Proof Verification : Prove -(-a)=a using only ordered field axioms I need to prove for all real numbers $a$, $-(-a) = a$ using only the following axioms: Thanks to many members of the Mathematics Stackexchange Community, I have the following proof worked out: Theorem: The Additive Inverse Identity is Unique $ ( \\forall a,b,c \\in \\mathbb{R} )(a+b=0) \\land (a+c=0) \\\\ ( \\forall a,b,c \\in \\mathbb{R} )(a+b=a+c) \\\\ ( \\forall a,b,c \\in \\mathbb{R} )(b=c) \\\\ \\text{QED} \\\\ $ Theorem $\\textbf{a} \\cdot \\textbf{0 = 0}$ $ \\begin{align} a \\cdot 0 &amp;= a \\cdot 0 \\\\ a \\cdot (0 + 0) &amp;= a \\cdot 0 \\\\ a \\cdot 0 + a \\cdot 0 &amp;= a \\cdot 0 \\\\ a \\cdot 0 + a \\cdot 0 + (-a) \\cdot 0 &amp;= a \\cdot 0 + (-a) \\cdot 0 \\\\ a \\cdot 0 &amp;= 0 \\\\ &amp;\\text{QED} \\\\ \\end{align} $ Theorem: $-\\textbf{1} \\cdot \\textbf{(a) = (}-\\textbf{a)}$ $ \\begin{align} a \\cdot 0 &amp;= 0 \\\\ a \\cdot \\left[ 1 + (-1) \\right] &amp;= a + (-a) \\\\ 1 \\cdot a + (-1) \\cdot a &amp;= a + (-a) \\\\ -1 \\cdot (a) &amp;= (-a) \\\\ &amp;\\text{QED} \\\\ \\end{align} $ Theorem: $-\\textbf{(}-\\textbf{a) = a}$ $ \\begin{align} 0 &amp;= 0 \\\\ -a \\cdot 0 &amp;= 0 \\\\ -a \\cdot \\left[ 1 + (-1) \\right] &amp;= 0 \\\\ -a \\cdot 1 + -a \\cdot (-1) &amp;= 0 \\\\ -a + \\left[ -(-a) \\right] &amp;= 0 \\\\ -(-a) &amp;= a \\\\ \\text{QED} \\\\ \\end{align} $ Does everything look alright? Have I missed anything? Also--why is it necessary to show that the additive inverse is unique? Many thanks in advance.", "What is the best solution for database connection pooling in python? I have developed some custom DAO-like classes to meet some very specialized requirements for my project that is a server-side process that does not run inside any kind of framework. The solution works great except that every time a new request is made, I open a new connection via MySQLdb.connect. What is the best \"drop in\" solution to switch this over to using connection pooling in python? I am imagining something like the commons DBCP solution for Java. The process is long running and has many threads that need to make requests, but not all at the same time... specifically they do quite a lot of work before brief bursts of writing out a chunk of their results. Edited to add: After some more searching I found which looks decent, but as I'm relatively new to python I guess I just want to make sure I'm not missing a more obvious/more idiomatic/better solution.", "Harry is a half-blood and Ginny is a pure-blood, so what does that make his children? I've been told it means they are pure-bloods but I can't be sure. What do you think?", "I have a residence permit (permesso di soggiorno) for Italy. I am currently in the Netherlands for an exchange. My permit expired on the 30th of November and I applied for a new one but I will get the card in January. I have the documents supporting that I have applied for the renewal of the permit. In the middle I want to travel to Italy for Christmas and come back to the Netherlands. Would this be a problem?", "Guarding against cryptanalytic breakthroughs: combining multiple hash functions", "iMessage doesn't say \"delivered\" or \"not delivered\" I sent an iMessage from my iPod touch to my friends iphone on Monday. It didn't say delivered or not delivered. It was just nothing. His phone is on (I know because my other friends are iMessaging him) and my friend said her messages don't say \"delivered\" at the bottom but they still talk. Mine always say delivered at the bottom. So is this an error, like it didn't go through, or is he just ignoring me?", "Linked server returned message \"Query timeout expired.\" We have two separate SQL Servers. On one server we have a data warehouse (DWH), on the other we have sales information database. Now on the DWH server there is an ETL job that collects the information from the sales server. The job runs daily after midnight. The DWH collects the information via linked server from the sales database. Now, the most time the ETL job runs without any problems. But sometimes it fails because of query timeout. We have found out, that there is a specific pattern: The failure happens every 11th day. So on the 11th day the ETL job fails to collect information. The following error occurs: SQLNCLI11 for linked server “my linked server” returned message “Query timeout expired.” Note: The job fails usually 10 minutes after start. We have searched everything and could not found out what this issue causes. Also we know that the amount of data is every time, almost the same. Also there is no any scheduled job that runs all 11 days or something. The remote query timeout on the linked server is set to 0. Our next step will be, to turn off the antivirus programm on the sales server, to check if this causes the problem. Does anyone have any clue or idea, where i can search further to find the problem?", "My Sophix tablet was working without the SD card, but now the camera will not work. I get the following error message: Insert a SD card before using.", "How should one maintain and update a MiKTeX installation?", "How to make horizontal lists? This might seem like a very simple question, but what is the easiest way to turn a normal vertical list into a horizontal one?", "How do I resolve samba share to IP address or host name I have a list of hosts in the network providing shares via SAMBA. How can I determine either IP address or the host name of one particular host, e.g. the one with the name “SASAK02”. The output of smbtree is as follows WORKGROUP \\\\SASAK02 \\\\SAURA-PC1 \\\\PC-VAN-DAMME", "How do i make my ubuntu server public? I want to know how to make my ubuntu server ip public. I'm not asking for a domain, if people would be able to access my website by ip, it would be great! (just for now) Does someone have an idea how to do this?", "Where can I find gedit's backup files and how to open them? So, I just finished off the first part of an important task for school and today when I was going to continue, the document with my notes were gone. The only fragment I've got left of my file is the back up file, which doesn't show in the folder where I saved the document, but I can search for it. Is there anyway which allows me to open the back up file, save it as a text file and continue my task? I don't really have the time for running restoring tools, which never has helped me in a satisfactory way anyway. I wrote the document in gedit and my version of Ubuntu is 12.10.", "Change the passphrase of an ecryptfs directory", "Why do I need multiple sites for the same property in Google Webmaster Tools? In researching the best practice for adding sites to the Search Console, I've often seen it suggested to add separate properties for different versions of the same website. Even in it states: \"Similarly, if your site has http:// and https:// versions, you should add each as a separate site.\" I've seen the same suggested for www/non-www. So if a site is accessible at all the variations of http/s and www/non-www we should have four properties. But what if the site is only accessible at one variant? i.e. https and www are forced via htaccess, so only can ever be accessed - should we still add all the variants? In essence, the problem is that I don't know why Google wants us to do this, so I can't work out if it'll be ok just to have one instance.", "I use ps -ef | grep catalina | grep -v grep to print the tomcat process running on the system: kshitiz 7099 1 0 May11 ? 00:02:29 /usr/lib/jvm/jdk1.8.0/bin/java -agentlib:jdwp=transport=dt_socket,suspend=y,address=localhost:38156 -Dcatalina.base=/home/kshitiz/Documents/workspaces/ggts/.metadata/.plugins/org.eclipse.wst.server.core/tmp1 -Dcatalina.home=/opt/tomcat-7.0.42 -Dwtp.deploy=/home/kshitiz/Documents/workspaces/ggts/.metadata/.plugins/org.eclipse.wst.server.core/tmp1/wtpwebapps -Djava.endorsed.dirs=/opt/tomcat-7.0.42/endorsed -Dfile.encoding=UTF-8 -classpath /opt/tomcat-7.0.42/bin/bootstrap.jar:/opt/tomcat-7.0.42/bin/tomcat-juli.jar:/usr/lib/jvm/jdk1.8.0/lib/tools.jar org.apache.catalina.startup.Bootstrap start Then I use ps -ef | grep catalina | grep -v grep | awk -F' ' '{print $2}' to extract the process id: 7099 But when I alias the whole command alias tomcat_id=\"ps -ef | grep catalina | grep -v grep | awk -F' ' '{print $2}'\" and use it via alias, it prints the whole text and awk doesn't seem to work. type tomcat_id gives: tomcat_id is aliased to `ps -ef | grep catalina | grep -v grep | awk -F' ' '{print }''", "Get Emacs to ignore contents of \\Sexpr{} command in Sweave document to prevent incorrect $-based syntax highlighting", "The following code uses the etoolbox package to convert a list a,b,c into an internal list (called \\mylist) and then typesets that with colons: a:b:c:. However, when I load the etextools package (by uncommenting the second line), I get no list output. \\documentclass{minimal} \\usepackage{etoolbox} %\\usepackage{etextools} \\begin{document} A list: \\def\\mylist{} \\forcsvlist{\\listadd\\mylist}{a,b,c} \\def\\do#1{#1:} \\dolistloop{\\mylist} \\end{document} I suspect it is is a bug since etextools claims to depend on etoolbox. Is this a bug or am I doing something wrong? In either case, how can I use \\dolistloop with etextools (which I want for goodies like \\expandnext)? Notes \\show\\mylist produces the same output a|b|c| in both cases, so the problem is with \\dolistloop which expands to \\forlistloop\\do The \\forlistloop command becomes substantially more complicated when etextools is used. might be relevant (but not obviously).", "After the performance problems we have run into with we've decided to make a change, we're moving the network on to . Here's where to get started: What works: All search operators should be in Many changes below from the old search behavior What's different: The new search is AND, adding a search term will narrow your results, not expand them. The look of search results is now more unified with the following differences between Q&amp;A: \"Q:\" or \"A:\" prefix Answer counts and tags will be present in questions. The answer count will be highlighted in green if it's accepted. (We may index other things later, that's why the results are more generic/google-y now.) It's faster, about 5-10x faster for almost all searches on large sites like Stack&nbsp;Overflow Quoted phrases are exact matches except for case-sensitivity, for example, or . If not in a quoted phrase, words will now be stemmed () Snippets for context will now be more relevant Excludes are now explicitly supported (like -term and -\"my phrase\") We don't roll up to the question anymore, if you searched for something that matched an answer, we'll show you the answer directly in search results The search per minute limit is effectively gone, it'll block a bot, but no one else should hit it... We'll be monitoring performance though infavorites:mine is back, with infavorites:12345 (any user id) added What needs work: What you tell us is broken... Do your worst. Testing, not yet final: New range support, here are some examples: answers:1..1 (exactly one answer) answers:10..20 (10 to 20 answers) created:2008..2009 (created between Jan 1st, 2008 and Dec 31, 2009) created:2010-04..2010-05 (created between April 1st, 2010 and May 31st, 2010) created:2011-01-05..2011-01-06 (to be clear: it goes to end-of-day) This range syntax applies to a new advanced operator: lastactive: and the other numerical ranges, views:, and score: Additionally, the above syntax is a bit more flexible if you forget it exactly (e.g. score:20-30) in an effort to be intuitive as possible, give it a try - tell us what you think. I'll try and improve the search as much as possible before it becomes default... At the very least we want it equivalent in relevance and functionality before the switch, but ideally much better. We won't switch until then. Please give it a try, tell us what you think here, and we'll continually improve it over the holidays as time allows. Bear in mind you may get a search offline page during this test if a change we're making for results necessitates a reindex, and even that should only last about two minutes here on Meta&nbsp;Stack&nbsp;Overflow. Give it your worst, compare results to the old search, tell us what's better and what's not. We look forward to the feedback. Update The new search is now the default across the network - we'll be monitoring things over the next few days and would appreciate reports of any crazy behavior you see here." ]

[ "How to move an element into another element?", "I am an Indian living in Italy and I am going to the UK for a leisurely family vacation for about 10 days. Please note, this application is not very straight forward. There are four applicants, one applicant is applying from India another two are applying from Singapore and I am applying from Italy. The checklist at the top has the statement all documents must be in English translated documents must be certified I got the proof of accommodation from my commune, but it is in Italian. Getting it translated, isn't such a big deal as the commune itself provides multi-lingual certificates. For the rest of the documents, this is an issue. Such as for &quot;Evidence of being in education&quot;, my university provides an online certificate for this purpose which is in Italian. Multiple acquaintances said that they provided their Italian house contract (in Italian) as proof of residency and no requirement came up for translation. Can anyone comment on how strict are they while enforcing the translational requirements of documents in respect to a short term visitor visa?", "Is it possible to test apex that relies on field history tracking?", "The gives the recoil force, $\\mathbf{F_{rad}}$, back on a charged particle $q$ when it emits electromagnetic radiation. It is given by: $$\\mathbf{F_{rad}} = \\frac{q^2}{6\\pi \\epsilon_0 c^3}\\mathbf{\\dot{a}},$$ where $\\mathbf{\\dot{a}}$ is the rate of change of acceleration. If a particle has a constant acceleration, $\\mathbf{\\dot{a}}=0$, then there is no reaction force acting on it. Therefore the particle does not lose energy. Does this mean that a constantly accelerating charged particle does not emit electromagnetic radiation?", "/usr/sbin/grub never finishes I did apt-get upgrade it never finishes at this point: Searching for GRUB installation directory ... found: /boot/grub Searching for default file ... found: /boot/grub/default Testing for an existing GRUB menu.lst file ... found: /boot/grub/menu.lst Searching for splash image ... none found, skipping ... Found kernel: /boot/vmlinuz-3.2.0-24-virtual Updating /boot/grub/menu.lst ... done You already have a NoLOADER configuration in /etc/grub.conf Running boot loader as requested Running /usr/sbin/grub ... The system does not freeze (Ctrl-Z works, I get my console back) just that that /usr/sbin/grub seems to never complete. What should I do?", "How much time is too much time playing educational computer games? I recently bought an iPad primarily for my 3-year-old daughter. I put nothing on it but educational apps and children's books. No YouTube, no Internet, no (non-educational) games. I've decided to let her use it as much as she wants, for now, and see how it goes. That was a few weeks ago. So far she's been using the iPad maybe 2 to 5 hours each day. She still enjoys other activities -- playing outside, playing with dolls and blocks, interacting with friends, being read to, etc. And I think she might be learning a thing or two from the apps. Still, several hours a day seems like a lot. How do I know if it's too much? I've searched the web, and there's lots of info on limiting TV time and video games, but I can't find any recommendations on limiting use if it's only educational games. Relevant:", "Multi armed bandit for general reward distribution", "unable to change php version on cli", "What is the correct way to show tiered possession? When there are multiple places where possession is shown, how are the words structured? A few examples: Greg's son's laptop is on fire. Mary's friends' boat is sinking. Thomas's neighbor's cat ate a mouse. Apple's Stock App's stats are useful. Microsoft's Xbox 360's games are fun. Are these the correct ways to express possession?", "Why is $5^{n+1}+2\\cdot 3^n+1$ a multiple of $8$ for every natural number $n$? I have to show by induction that this function is a multiple of 8. I have tried everything but I can only show that is multiple of 4, some hints? The function is $$5^{n+1}+2\\cdot 3^n+1 \\hspace{1cm}\\forall n\\ge 0$$, because it is a multiple of 8, you can say that$$5^{n+1}+2\\cdot 3^n+1=8\\cdot m \\hspace{1cm}\\forall m\\in\\mathbb{N}$$.", "Security importance of Key Schedule in Block Cipher", "Are $(x^3)^{1/3} $ and $\\sqrt{x^2}$ monomials? In mathematics, a is, roughly speaking, a polynomial which has only one term. Two different definitions of a monomial may be encountered: For the first definition, a monomial, also called power product, is a product of powers of variables with nonnegative integer exponents, or, in other words, a product of variables, possibly with repetitions. For the second definition, a monomial is a monomial in the first sense multiplied by a nonzero constant, called the coefficient of the monomial.", "The full prophecy by Trelawney, the part my question is about in bold: \"The one with the power to vanquish the Dark Lord approaches ... born to those who have thrice defied him, born as the seventh month dies ... and the Dark Lord will mark him as his equal, but he will have power the Dark Lord knows not ... and either must die at the hand of the other for neither can live while the other survives ... the one with the power to vanquish the Dark Lord will be born as the seventh month dies ...\" – Sybill Trelawney (to Dumbledore) I am interpreting for neither can live while the other survives as: Harry can't live while Voldemort survives and vice versa. But why? It clearly worked until the end of book 7. One could argue with Dumbledore's thery of the self-fulfilling prophecy. But clearly Voldemort was smart enough to see that there was no mechanism that would kill him just because Harry stayed alive. and either must die at the hand of the other Again: Why? If somebody else destroyed all Horcruxes and then killed Harry, Voldemort would be just as vulnerable and could be killed by anyone. On the other hand, Harry could have been killed by anyone - his mum's protection transferred to Voldemort by Harry's blood was only helping against Voldemort. I guess that I am interpreting this part of the prophecy in the wrong way or maybe there is an alternate, less obvious and more tricky one. So my question is: What exactly does the highlighted part of Trelawney's prophecy state?", "Good text on Clinical Trials? I'm an undergraduate statistics student looking for a good treatment of clinical trials analysis. The text should cover the fundamentals of experimental design, blocking, power analysis, latin squares design, and cluster randomization designs, among other topics. I have an undergraduate knowledge of mathematical statistics and real analysis, but if there's a fantastic text that requires a bit higher level of statistics or analysis, I can work up to it.", "What is the best way to clean the sensor on a interchangeable lens camera (mirrorless or digital SLR)?", "I'm running 12.04 - I installed kubuntu to try it out and realized that with all the bloatware applications that I didn't want it anymore - I was able to uninstall the kubuntu-desktop but there are still packages left over... How can I make sure I get rid of EVERYTHING Kubuntu installed - even the kde leftovers? Here's some of what's left when I ran sudo apt-get autoremove kde then \"tab\" it displayed this: kdeaccessibility kdepim-runtime kdeadmin kde-runtime kde-baseapps kde-runtime-data kde-baseapps-bin kdesdk-dolphin-plugins kde-baseapps-data kde-style-oxygen kde-config-cron kdesudo kde-config-gtk kdeutils kde-config-touchpad kde-wallpapers kdegames-card-data kde-wallpapers-default kdegames-card-data-extra kde-window-manager kde-icons-mono kde-window-manager-common kdelibs5-data kde-workspace kdelibs5-plugins kde-workspace-bin kdelibs-bin kde-workspace-data kdemultimedia-kio-plugins kde-workspace-data-extras kdenetwork kde-workspace-kgreet-plugins kdenetwork-filesharing kde-zeroconf kdepasswd kdf kdepim-kresources kdm kdepimlibs-kio-plugins kdoctools Those are all installed by kubuntu... correct? I just want to go back to my Ubuntu 12.04LTS with Gnome2-classic and without all the kubuntu extras. I started it off by just removing unnecessary apps that came with kubuntu-full - then realized I didnt want the whole thing at all and uninstalled kubuntu-full but it still says I have these as well: alex@griever:~$ sudo apt-get --purge remove kubuntu- kubuntu-debug-installer kubuntu-netbook-default-settings kubuntu-default-settings kubuntu-notification-helper kubuntu-firefox-installer kubuntu-web-shortcuts", "PCA on correlation or covariance?", "I have been using LaTeX for a long time now, and I find myself often going to this website to solve my problems. This often includes copy pasting codes which include \\newcommand, \\newenvironment and \\def. I think it is time I start to learn how to use them so I can solve my problems myself! It is always better if you actually know what is going on inside your code. I am wondering if there is any turtorial or book out there that handles how to use those commands. Or is the best way to learn to just mess with a random file? Thanks in advance! (Also this is my first time I post here after using this website for so long, I really appreciate everyone who posts and tries to help other people here!)", "I'm sure its a simple question and I suppose it was asked many times, but I just can't figure it out from other answers, sorry. I use recent versions of PostgreSQL and MySQL. I have 2 tables: CREATE TABLE authors ( id INT, name VARCHAR ) CREATE TABLE posts ( id INT, author_id INT, text VARCHAR, date DATE ) I need to select one most recent post for each author. Thanks! UPDATE Thanks, both links provide answers to my question with some exception. All the following queries give the same result (which one is the most efficient btw?) The issue is when there is more than one post from the same author with the same date. Then the returned result set contains all such posts. How should I modify these queries to return exactly one post per author? SELECT p1.* FROM posts p1 LEFT JOIN posts p2 ON p1.author_id = p2.author_id AND p1.date &lt; p2.date WHERE p2.author_id IS NULL ORDER BY p1.author_id; SELECT p1.* FROM posts p1 INNER JOIN ( SELECT author_id, MAX(date) AS max_date FROM posts GROUP BY author_id) p2 ON p1.author_id = p2.author_id AND p1.date = p2.max_date ORDER BY p1.author_id; SELECT * FROM posts p1 WHERE date = (SELECT MAX(p2.date) FROM posts p2 WHERE p1.author_id = p2.author_id) ORDER BY author_id; SELECT * FROM ( SELECT author_id, MAX(date) date FROM posts GROUP BY author_id ) p1 INNER JOIN posts p2 USING (author_id, date) ORDER BY author_id;", "Collinearity diagnostics problematic only when the interaction term is included" ]

[ "Black flakes from new cast iron pan I bought a brand new Lodge 12\" cast iron pan, washed it in soap and warm water and dried it with a paper towel thoroughly. Then I applied a thin layer of canola oil with a paper towel (paper towel was clean - not black after this application) and then heated the empty pan on my electric stove for 15-20 minutes. The oil on the pan smoked a bit, some parts of the pan turned slightly ashy (grey). Mostly everything looked OK. After I turned it off and cooled the pan, I now take a clean paper towel and rub the surface and I see black flakes! What is this? Is this the oil broken down? Can I cook in the pan or wash it with soap to eliminate the black flakes? Once washed and dried should I rub canola oil again? This is my first experience with cast iron. Any pointers will help.", "How can I convert string to datetime with format specification in JavaScript?", "Anime with a boy hiring a creature from a stone, meets a man named Dante and starts a journey to collect crystals", "Orbiting a specific point - Orbiting Camera", "Does creating an object using reflection rather than calling the class constructor result in any significant performance differences?", "I have this run.sh file, and I've create a symbolic link into my desktop. When I double-click on it the file the following dialog appearsr And I have to click on \"run\" each time. How can I create a link that runs by default?", "How do I make my textures show in cycles? I am admittedly new to Blender, and of course cycles. I am working on a scene and I have textures set to my objects that render with internal engine just fine. However, when I go into cycles, everything is greyish. I have two light sources that should be sufficient (I think), I just don't know what I'm doing wrong. This is a screenshot of the cycles result.", "I am trying to add a list into an another nested list before adding values of a list to nested list it is getting the correct value but after adding i am getting (already output) in debug log when i checked. public List&lt;String&gt; fieldName {get;set;} public List&lt;List&lt;String&gt;&gt; fileValuesXML; // To get the field values of xml for(Dom.XMLNode child : SalesforceObjecet.getChildElements()) { objecetName = child.getText(); system.debug('Object Name in XML field ' + objecetName ); for(Dom.XMLNode subchild : child.getChildElements()) { system.debug('Sub child ' + subchild.getText() ); for(Dom.XMLNode subchildfield : subchild.getChildElements()) { system.debug('Sub child Field ' + subchildfield ); fName = subchildfield.getText(); fieldName.add(fName); //fileValuesXML.add(fieldName); //system.debug('Filed Name in XML field ' + fieldName); } system.debug('Filed Name before affing to filevalueXML ' + fieldName); fileValuesXML.add(fieldName); fieldName.clear(); system.debug('Filed Name after affing to filevalueXML ' + fileValuesXML); } } I am getting values in debug log as: Filed Name before affing to filevalueXML (AccountSource, field3) Filed Name after affing to filevalueXML ((), (already output), (already output))", "Rewriting Triple Integral in different order How can I rewrite, say: $$\\int^1_0\\int^{z^2}_0\\int^y_0{f}dxdydz$$ In the orders $dzdxdy$ and $dydzdx$? Would I have to solve this triple integral all the way or is there a simple way to do this?", "I'm using Ubuntu 13.04 on a Lenovo X220. Why do I have so many .Xauthority.* files in my home directory? I.e .Xauthority .Xauthority.0JW6UW .Xauthority.2HWRVW .Xauthority.2TA6VW .Xauthority.49F8VW .Xauthority.4E27UW .Xauthority.7CLTVW .Xauthority.8JGGXW .Xauthority.96SAVW .Xauthority.AOUFVW .Xauthority.ASDOVW .Xauthority.CGVJXW .Xauthority.E0ZSVW .Xauthority.E5VZWW .Xauthority.FE64UW .Xauthority.FIHDWW .Xauthority.HL45VW .Xauthority.HYCCVW .Xauthority.ILUEWW .Xauthority.JXJHVW .Xauthority.K1QJXW .Xauthority.KXSOVW .Xauthority.LEKEVW .Xauthority.M48WVW .Xauthority.M6QTVW .Xauthority.MW6NWW .Xauthority.N57TWW .Xauthority.O5HAWW .Xauthority.OIC5VW .Xauthority.P2RPVW .Xauthority.Q0FRVW .Xauthority.QW01WW .Xauthority.RDW5WW .Xauthority.T0TLWW .Xauthority.TSO4WW .Xauthority.U6R9VW .Xauthority.V3KAWW .Xauthority.W8Z1WW .Xauthority.XDLGVW .Xauthority.XOOHWW.Xauthority.XUICVW They are all zero bytes except the first, with timestamps all over the place. What are these, and are they safe to delete?", "Is there any way to save the order of spaces in Mission Control?", "Why is the Java main method static? The method signature of a Java main() method is: public static void main(String[] args){ ... } Is there a reason for this method to be static?", "What does `:-` mean in a shell script I saw this in the end of an awesome shell script but I can't understand the login here because I think it's being short-handed for a longer command. spark ${@:-`cat`} This apears at the end of . Any ideas? + Marks for some one who extends it into a full segment of code, even if its slower (Better for explanation)", "Getting ssh to execute a command in the background on target machine", "I just recently completed a neutral run where I experimented seeing how the story would go on if I only killed certain characters (it was my second run, my first run was True Pacifist) and I ended up choosing to kill Flowey instead of letting him live. I planned to start a Genocide run after resetting the game, but Flowey was gone when i did. Flowey is basically the base for each story in undertale (pacifist and genocide) so I know I can't progress any further without him being here. I really just want to start anew and, without Flowey, I dont think I can access True Resets anymore. It may be possible if I did a genocide route, but then I'd have to fight Sans, and that would take FOREVER. Basically, I am wondering if I can erase all my progress somehow. I heard that True Resets don't erase everything entirely, so is there another way? Please respond, Undertale is the only game I have that's any fun and I don't want to have to buy another game.", "If I create just a basic hello.tex file an compile it using pdflatex hello.tex The pdflatex program is creating a plethora of file which is a little annoying. Currently it writes all those files about which I really don't care: hello.aux, hello.log, hello.nav, hello.out, hello.snm, hello.toc Is there a way to tell pdflatex to only write hello.pdf if the build is successful ? If not, can I specify the output directory of those files ? Maybe I could just write them in /tmp.", "Is there a continuous bijection from $[0,1]$ onto $[0,1] \\times [0,1]$? That is with $I=[0,1]$ and $S=[0,1] \\times [0,1]$, is there a continuous bijection $$ f: I \\to S? $$ I know there is a continuous bijection $g:C \\to I$ from the Cantor set $C$ to $[0,1]$. The square $S$ is compact so there is a continuous function $$ h: C \\to S. $$ But this leads nowhere. Is there a way to construct such an $f$? I ask because I have a continuous functional $F:S \\to \\mathbb R$. For numerical reason, I would like to convert it into the functional $$ G: I \\to \\mathbb R, \\\\ G = F \\circ f , $$ so that $G$ is continuous.", "How can I tell if an ETF is expensive? For stocks, I can easily look at the price/earnings ratio, and, according to The Intelligent Investor, stand clear of those with a ratio higher than 20. How can I tell if the current price of an ETF is a good price to buy it? Are there such simple metrics?", "This post has been locked; locked posts can't be voted on", "Extruding a circular shape from a non-circular object I need to extrude a circular shape from a surface that's basically just a grid of quads. What's the best practice to do this without screwing up the topology too much? I basically want to have a circular face I can extrude, in order to have a cylinder like protuberance on the object, something like this:" ]

[ "How to delay or slowly loop commands? I found 11 questions like this on gamingSE already, but none of them have proper and up-to-date answers. So I'm creating this Q&amp;A: How do you either activate a command x seconds/minutes/hours/… in the future or every x seconds/minutes/… in a loop? Repeating command blocks and ticking functions execute 20 times per second, redstone is in many situations and most of the extremely fancy solutions, like falling blocks in cobwebs, have broken over time or are needlessly complicated.", "I am trying to route a pic32 chip to a chip and having a bit of a hard time getting all 17 address lines and all 8 data lines connected. I am trying to tie the first 16 address pins to portB pins 0-15 and the data pins to portD 0-7. After thinking about it for a while I realized that I am probably making my life more difficult by trying to line up rb0 with a0, rb1 with a1, etc. All I really want to be able to do is write a 16 bit value to portB and have the majority of the address loaded and ready. If I make pin assignments based on ease of routing, the logical address will be different between the mcu and the ram, but it should at least be consistent. Since nothing else needs to communicate with the RAM, I don't think it will be a problem if the mcu asks for address 0x101 and the RAM gives it address 0x110. However, I wonder if it is a good idea. If there is some structure internal to the RAM designed to make sequential reads more efficient, or something like that, then I may want to go to the trouble of routing them 1:1. The pins arrangement on both chips fees somewhat random to me, so it would make it a lot easier on me if I could ignore the particular numbers. Is there any good reason why I should or should not do that?", "Square root of Positive Definite Matrix", "What is the probability that a shuffled standard deck of 52 cards has no two cards of the same rank together ? I am unable to get a handle on this problem, and wonder whether there is an analytical solution ?", "Does DTIME(O(n)) = REGULAR?", "Currently, when someone suggests an edit, they are unable to keep track of it without watching reputation levels or constantly refreshing the page. What I would like is a notification, that shows up like the notification where someone has edited your question, that shows whether a suggested edit has been approved or rejected after the last vote is cast. This way, the community can be notified when their edit has been rejected/approved, while focusing their efforts on another question/answer.", "How does one get the MinionPro \\qoppa? Since I have switched to the 2014 texlive, one issue is not working: the character \\qoppa. The command is defined in polutonikogreek in babel. It is an archaic greek letter, but was used also in classic times for the number 90. The glyph is available in the cmr font and in MinionPro and in the beautiful MinionMath font of Johannes Küster. I want the latter. In MinionPro/MinionMath, it is unicode character 03d9 (formerly u+03DE, it recently changed, as it turns out), see How do I get the glyph into latex? I tried \\def\\testqoppa{\\begingroup\\fontfamily{MinionPro}\\fontencoding{LGR}\\selectfont\\char19\\endgroup} and \\def\\testqoppab{\\begingroup\\fontfamily{minionmath}\\fontencoding{LGR}\\selectfont\\char19\\endgroup} But all this gives the cmr glyph, because latex complains LaTeX Font Warning: Font shape `LGR/MinionPro/m/n' undefined LaTeX Font Warning: Font shape `LGR/minionmath/m/n' undefined (Font) using `LGR/cmr/m/n' instead on input line 571. This seems like a beginner error from my side. Can somebody help me to get it right? I need \\qoppa only in two places, so a nasty trick is also sufficient. The MinionMath font is installed and is working for all other purposes. Here is an extract of the .cls file: \\usepackage[fullfamily,textlf, opticals, swash, onlytext]{MinionPro} \\usepackage[extraops,textcomp,withamsmath,amssymb]{minionmath} \\usepackage{amsmath} \\usepackage{minionamsmath} \\usepackage[polutonikogreek,greek,latin,french,italian,german,british]{babel}", "What is the difference between: Rooting, Jailbreak, ROM, Mod, etc.?", "Roast duck vs. roasted duck", "How do I separate hydraulic disc brake pads after pulling the brake while the wheel is off?", "Are these gerund sentences grammatically correct? I bought this book titled 2 Hari Taklukan Grammar, written by Edward Rahardian in Bahasa (Indonesian language) and mostly talk about gerund and infinitive. And these are some examples of the gerund sentences that I found. His mother suggested having lunch before we leave. I will try studying harder. The car needs washing. Your hair needs washing. My teacher disliked me coming late. Somehow those words sound unnatural for me because I've never heard those in daily conversations. As a learner, I only get exposed with English by watching TV series and any other entertainment resources. So in my thought, they sound more natural like this: His mother suggested to have lunch before we leave. I will try to study harder. The car needs to be washed. Your hair needs to be washed. My teacher disliked me to come late. Are those sentences in the first group grammatically correct? And, is it normal for one to say them in normal/daily conversations?", "Proving the identity $\\sum_{k=1}^n {k^3} = \\big(\\sum_{k=1}^n k\\big)^2$ without induction", "Can not find the tag library descriptor for “http://java.sun.com/jsp/jstl/core”", "What characters are valid in a Java class name? What other rules govern Java class names (for instance, Java class names cannot begin with a number)?", "How can I display only the unique values in one column in Excel? Is there a way to display the unique values in a column ONLY? Example: AAPL AAPL AAPL AAPL AKAM AMZN AMZN AMZN AMZN AMZN AMZN Expected result: AAPL AKAM AMZN I have already done a sort for multiple factors, and the first match for each is the best match. I'm not sure if this is a vlookup or something else.", "An example of a norm which can't be generated by an inner product I realize that every inner product defined on a vector space can give rise to a norm on that space. The converse, apparently is not true. I'd like an example of a norm which no inner product can generate.", "$ \\tan 1^\\circ \\cdot \\tan 2^\\circ \\cdot \\tan 3^\\circ \\cdots \\tan 89^\\circ$ How can I find the following product using elementary trigonometry? $$ \\tan 1^\\circ \\cdot \\tan 2^\\circ \\cdot \\tan 3^\\circ \\cdots \\tan 89^\\circ.$$ I have tried using a substitution, but nothing has worked.", "Is this NPN transistor AND logic gate practical?", "Mean Squared Error (MSE) of parameter $p$ in binomial distribution: intuition", "Reading JSON from a file?" ]

[ "Why is a (simple) mask not recommended for asymptomatic COVID-19 patients? Information about (simple) mask wearing (concerning covid19) is a complete mystery to me. On several official places it is not recommended for a person without symptoms to wear a mask. For example: (time 0:20) or here: However no explanation is given - which makes me wonder (and even angry). I think everybody should wear a mask because: Many persons feel ashamed wearing it, even those with symptoms. If everybody wears it, they do not feel ashamed and wear it. As far as I know, one is (wrt covid19) contagious before developing symptoms. So if everybody wears the mask also these people do. The two above points act as a collective protection. Simple mask certainly will lower \"getting / spreading illness\" probability. Of course the \"holes\" (in a simple mask) are too big to prevent completely virus to enter (or get out when coughing), but it lowers probability! Even if it lowers the transmission probability by e.g. 5%, it might be a lot. As a hypothetical example: it might reduce R0 from 1.02 to 0.97 and so stop the virus spread so fast. The videos are full of self-contradiction. In the same video time 0:50 the lady says I should wear a mask if I am in contact with an infected person... why if it is inefficient? Question: What are reasons for not recommending wearing a mask?", "How can I find and replace specific words in a text file using command line?", "How to fetch the columns of the synonyms for linked servers in SQL server I am using two servers local (SQL Server running on my system) and remote (SQL Server running on another system). I have created synonyms in my local server for a table which is located on the remote server. Synonym used- CREATE SYNONYM [dbo].[test] FOR remoteserver_name .[database_name].[schema_name].object_name Requirement I need to fetch the columns of the synonym. I can retrieve the columns of the synonym using below query in SQL server. select * from dbo.test where dbo is synonym created schema name (local server schema name) and test is synonym name. I have tried to retrieve the columns of the synonyms using below query, but I cannot fetch the columns SELECT sys.schemas.name AS SCHEMA_NAME, sys.synonyms.name AS view_name, sys.columns.name AS COL_NAME, sys.types.name AS data_typename FROM sys.columns INNER JOIN sys.synonyms ON OBJECT_ID(sys.synonyms.base_object_name) = sys.columns.object_id INNER JOIN sys.schemas ON sys.schemas.schema_id = sys.synonyms.schema_id LEFT OUTER JOIN sys.types ON sys.columns.system_type_id = sys.types.system_type_id WHERE sys.types.system_type_id = sys.types.user_type_id AND sys.schemas.name = N'scehmaname' AND sys.synonyms.name = N'synonymname' Can you please suggest some other way to retrieve the columns of the synonym or correct the above query?", "MCMC in a frequentist setting I have been trying to get a sense of the different problems in frequentist settings where MCMC is used. I am familiar that MCMC (or Monte Carlo) is used in fitting GLMMs and in maybe Monte Carlo EM algorithms. Are there more frequentist problems where MCMC is used?", "Find the Resistance between Two Terminals Let's say R = 49 ohms, and we want to find Req between a and d, how do we do that? Do we have to find Req for the whole circuit?", "I am trying to calculate the sum of this infinite series after having read the series chapter of my textbook: $$\\sum_{n=1}^{\\infty}\\frac{1}{4n^2-1}$$ my steps: $$\\sum_{n=1}^{\\infty}\\frac{1}{4n^2-1}=\\sum_{n=1}^{\\infty}\\frac{2}{4n^2-1}-\\sum_{n=1}^{\\infty}\\frac{1}{4n^2-1}=..help..=sum$$ I am lacking some important properties, I feel I am coming to the right step and cannot spit that out..", "Cold fusion is being mentioned a lot lately because of some new setup that apparently works. This is an unverified claim. See for example: ( of that last link in the Wayback Machine, given frequent from that page.) While we should give the scientific community time to evaluate the set up and eventually replicate the results, there is undoubtedly some skepticism that cold fusion would work at all, because the claim is quite extraordinary. In the past, after Fleischmann and Pons announced their cold fusion results, in perfectly good faith, they were proven wrong by subsequent experiments. What are the experimental realities that make Fleischmann and Pons style cold fusions experiments easy to get wrong? Would the same risks apply to this new set up?", "Distinct digits in a combination of 6 digits", "How should one maintain and update a MiKTeX installation? Every once in a while after updating MiKTeX, the installation gets into an inconsistent state. This might be a problem with the packages (an example is described in ), but sometimes packages are split or renamed. The cases I remember are when and when miktex-etex-base-2,9 was renamed to miktex-etex-base-2.9 (if I recall correctly; I am sure it was either that or something very similar). In each case the MiKTeX Update process suggested to remove the \"old\" packages but it didn't give the user any hints about him having to manually add the respective replacement packages back in the package manager to get one's MiKTeX installation back into a usable state. What are best practices for keeping MiKTeX up to date? Note that I'm not asking about installing new packages or fonts in general; there are other questions covering this area. In which order should one execute the Update process and the Synchronization of the repository? , it is recommended to check the MiKTeX homepage before updating. What else should one do? When and in which order (and why) should one execute the \"Refresh FNDB\" and \"Update Formats\" processes within the MiKTeX Options menu? What else can happen? Other advice?", "I have made a command \\newcommand{\\mysec}[2]{% \\textbf{#1} \\\\ #2 } I use it with \\mysec{A}{B}. But sometimes I also want a third parameter. I could make a whole new command for those situations where I need 3 parameters. But I thought if I could handle it with an optional parameter in my original command? So I have to check if the third parameter is set and how to print if it is set.", "Why do first years cross the lake to get to the castle? It makes sense to keep them together, and to have them arrive in the Great Hall separately from the rest of the school for the Sorting. But why the boats? The lake crossing is dramatic, but inefficient - as we see in book 4 when Dennis Creevey falls in the lake during the storm. Is there a canon (books/movies or JKR) explanation for why the first years come up from the train in boats instead of carriages?", "The nose of Tom Riddle (as a student) was fine, as I have seen in the movies. But, Voldemort's nose doesn't look like a normal human nose. What really happened?", "How can I disable the drag handle on the desktop?", "Difference between staticmethod and classmethod What is the difference between a function decorated with and one decorated with ?", "Given a set $\\{1,2,3,4\\}$, how is the following relation $R$ antisymmetric? $$R = \\{(1, 2), (2, 3), (3, 4)\\}$$ Note: Antisymmetric is the idea that if $(a,b)$ is in $R$ and $(b,a)$ is in $R$, then $a = b$. In my textbook it says the above is antisymmetric which isn't the case as whenever $(a,b)$ is in $R$, $(b,a)$ is not.", "Why do you need to change your position rather than just focal length to affect perspective? Why must you change your distance from an object to change your perspective of it? Why is it not sufficient to change the focal length of your lens (the zoom level) to change your perspective?", "Significance of assumption in competition inequality questions Refer to the problem below (IMO 2009 Shortlist) Let $a, b, c$ be positive real numbers such that $$\\frac{1}{a} + \\frac{1}{b} + \\frac{1}{c} = a + b+ c$$ Prove that $$\\frac{1}{(2a+b+c)^2} + \\frac{1}{(2a+b+c)^2} + \\frac{1}{(2a+b+c)^2} \\leqslant \\frac{3}{16} $$ In the solution given by the (Pg 16), it states that Without loss of generality, we choose $$a +b+c = 1$$. Thus, the problem becomes $$ \\frac{1}{(1 + a)^2} + \\frac{1}{(1 + b)^2} +\\frac{1}{(1 + b)^2} \\leqslant \\frac{3}{16}(\\frac{1}{a} + \\frac{1}{b} + \\frac{1}{c})$$ Applying Jensen’s inequality to the function $$f(x) = \\frac{x}{ (1+ x)^2}$$ ,which is concave for $0 ≤ x ≤ 2$ and increasing for $0 ≤ x ≤ 1$, we obtain $$α \\frac{a}{(1 + a)^2} + β \\frac{b}{(1 + b)^2} + γ \\frac{c}{(1 + c)^2} \\leqslant (α + β + γ) \\frac{A}{(1 + A)^2}$$ , where $A =\\frac{αa + βb + γc}{α + β + γ}.$ Choosing $α = \\frac{1}{a} , β =\\frac{1}{b},$ and $γ = \\frac{1}{c}$ , we can apply the harmonic-arithmetic-mean inequality $$A =\\frac{3}{\\frac{1}{a} + \\frac{1}{b} + \\frac{1}{c}} ≤ \\frac{a + b + c }{3} = \\frac{1}{3} &lt; 1$$ Finally we prove: $$ \\frac{1}{(1 + a)^2} + \\frac{1}{(1 + b)^2} +\\frac{1}{(1 + b)^2} \\leqslant ( \\frac{1}{a} + \\frac{1}{b} + \\frac{1}{c}) \\frac{A}{(1 + A)^2} \\leqslant ( \\frac{1}{a} + \\frac{1}{b} + \\frac{1}{c})\\frac{A}{(1 + \\frac{1}{3})^2} = \\frac{3}{16}(\\frac{1}{a} + \\frac{1}{b} + \\frac{1}{c}) $$ However, (Pg 4) differs by having $a +b+c=3$ and setting $f(x) = \\frac{1}{16x} - \\frac{1}{(x+3)^2}$ and allowing Jensen to resolve the rest. The questions are as follows; How do you choose before hand which $a + b+ c =$ to choose? Why particularly does the assumption differ between the 2 solutions? How does one know before hand the choosing of $α = \\frac{1}{a} , β =\\frac{1}{b},$ and $γ = \\frac{1}{c}$? Where and how did $A =\\frac{αa + βb + γc}{α + β + γ}$ come from? Any help would be much appreciated.", "How do I tunnel and browse the server webpage on my laptop? I run a web app in one of my lab servers, and I have already setup X11 Forwarding on those machines. Other lab members can tunnel through SSH, and browse that web app on their local browser at home. I can't. Last time I checked with them, there is almost nothing I need to do. When I type 192.168.1.113/webapp I get nothing. Any tips? THanks. I ended up using the second method :) ssh -L 8080:&lt;server-ip-address&gt;:80 &lt;username&gt;@&lt;remote-addr&gt; -N", "How can I restrict various roles with limit in creating nodes of a particular content type How can I restrict various roles with limit in creating nodes of a particular content type?", "Why are loops always compiled into \"do...while\" style (tail jump)?" ]