text
stringlengths 24
30.8k
|
|---|
Can/what happens if a nuclear powered submarine’s reacor melts down?
There's not going to be any hole melting in the submarine. If you've ever seen someone boil water in a paper cup, that's why. There's a lot of ocean and there's no way the reactor has enough mass to heat steel hot enough or fast enough to either go through the containment vessel or the hull. TL;DR the interior of the reactor melts and stays inside the pressure vessel. A reactor has fuel plates, which are shaped like flat bar stock, like 1" wide and 3/16" thick (or thicker..but not too thick. Heat is generated from the inside out so too thick would make the center of the fuel meat melt, which is no bueno) and vary in length depending on the size of the reactor. They are stacked with spacers, and mounted in big cells. Water flows down the length of the cells. There is a lot of heat generated, which would rapidly cause steam bubbles to form around the fuel, so the entire system is pressurized to a very high pressure. Higher pressure and the water can get very hot without turning to steam. USN reactors are all classified as "pressurized water reactors". Steam doesn't transfer heat efficiently, so there are a lot of things with the system to prevent steam forming in the core. If you get steam in the core, you get a meltdown (Three Mile Island, Fukishima). If the pressure of the system gets low, due to a leak or something else, or if the coolant stops flowing, the fuel plates are still generating heat. Depending on what power the reactor had been running at before flow stopped or pressure was lost, there is either going to be a lot of heat, leading to the fuel plates melting, or a little heat that might make the fuel plates crack (not a good thing). In either case, ambient losses through the hull will prevent it from doing that much. In fact, the thickness of the reactor containment vessel is based on preventing melted fuel from getting out, based on a worse case power level with instant loss of pressure and/or flow. Radioactivity in the ship would be bad, likely lethal, as the majority of the reactivity is supposed to stay in the reactor vessel. The pressure vessel has some serious shielding. If radioactive particles get out of the core and are pumped around unshielded piping or vented inside the reactor compartment (the room with the reactor in it, with no ventilation ports and able to withstand a massive amount of atmospheric pressure) the radioactivity near the bulkheads would be lethal in relatively quick order, but only to people inside the sub. Realistically, it would be mostly contained and would give the crew time to get out and shut the hatches. After that, it would be cooled by the surrounding ocean. There are a ton of redundant systems on naval reactors and they have designs that are rugged as hell. Civilian power plants don't change angles and aren't designed to continue operating after nearby explosions. The reactors on warships are. |
A rise or fall in elevation causes a persons ears to hurt. What other effects are caused to the human body from a fall or rise in elevation?
A rise or fall in elevation causes a persons ear to hurt due to changes in pressure. Other side effects would be gasses that are usually dispersed in water ( like the co2 in your coke ) to become gas again. Imagine if you had a pipeline full of coke and all of a sudden the pressure drops, all the co2 in the coke releases and the pipeline basicly bursts. This can happen to your blood aswell. The co2 in your blood becomes gas again and you can get embolisms. ( This happens more than commenly with divers) |
If I tied a incredibly long string around a rock and lowered into the Marianas Trench from a boat, would the rock become heavier? What would happen to my string?
The rock would become lighter because the water would become more dense (by about 3%), and there would be a greater force of buoyancy acting on the rock. |
Black holes are alway illustrated with their accretion disks around their equators. Is this necessarily the case?
I know there have been a lot of black hole questions lately but now the megathreads are gone, I have another one! Here is a typical black hole render: Like most renderings we see the accretion disk in a neatish ring and the energetic jets shooting out perpendicular to it. For a rotating black hole, is the accretion disk always around the equator, and the jets always emanating from the poles? I know that in Newtonian celestial mechanics, rings are a lower energy and more stable configuration than a spherical shell, which is why you end up with planetary rings rather than spherical shells, but in planet formation scenarios I had thought the only reason these rings (and Moons) tend to be at or near the equator of the planet is because of angular momentum preserved from the original dust cloud that formed the system (correct me if I'm wrong on this!). Presuming that matter can approach a black hole from nearly any angle, if accretion disks are indeed generally around a rotating black hole's equator, what forces are causing this? Is there some Newtonian answer I'm missing, or is it something related to frame dragging or some other effect in general relativity?
It's both. So yeah, you get discs everywhere in astronomy, because that's what happens if you have (a) dissipation, and (b) angular momentum. The gas particles can bump into each other and convert kinetic energy into internal wibbles, and that wibbly energy can be spat out as light - so you can cool down, and get rid of random motions, until you settle into the lowest energy configuration. However, you can't get rid of angular momentum so easily, so you end up with the lowest energy thing that's still spinning, i.e. a disc. I think you've got one small misconception with that though. The angular momentum doesn't have to come from a single spinning object. If you have multiple inflows, they're still going to add up to having some sort of spin - it would be an incredible coincidence for all the rotation to exactly cancel out. This is why galaxies can be flat too. Galaxies are the result of lots of converging flows, and lots of mergers of other galaxies. But the gas always settles down into a disc, because it can still lose energy, and still have angular momentum. (Note that the don't settle into a disc, because stars don't lose their kinetic energy so well - same with dark matter. The reason the stars are in a disc in the Milky Way is that they formed from gas that was in a disc). So, classically, a compact object that's got inflows from all over the place should still end up with a nice accretion disc. However, with black holes we do have also have a "frame-dragging" effect, where a rotating black hole can drag around the nearby gas. Inflows can produce a disc that have the same rotation axis as the black hole, and this means that the black hole and the disc are applying a torque (a rotational force) on each other - the accretion disc can change the spin of the black hole, as well as the black hole changing the spin of the disc. This can end up with the spins getting aligned, but you can also end up with a kind of resonance making them - i.e. they have the same axis of rotation, but the disc is spinning in the opposite direction to the black hole. It comes out more complex than you'd expect. |
Novice Question: I often hear references to events, planets or phenomena occurring "millions of light-years" away. This confuses me - how is such a distance even measurable, and with that, wouldn't these events have been occurring millions of years ago and not currently?
You might read up on this: http://en.wikipedia.org/wiki/Cosmic_distance_ladder For nearby objects (stars in our part of the galaxy) we can measure distances directly using trigonometry. Think back to geometry class. Two angles and a length will allow you to calculate all the other measurements of a triangle. We know the size of the Earth's orbit. This is our length. At two different times of the year, measure the angle between the Earth and the distant star. You need very precise equipment to do it, but you can actually measure the difference in angles. This allows you to calculate the distance to all the nearby stars. Beyond that, there's a whole host of techniques which you can read up on. Basically you look for "standard candles." A standard candle is something that produces the same or nearly the same amount of light, regardless of where in the universe it occurs. An example of this is a type Ia supernova. If a white dwarf is gathering mass from another source, say by feeding off a large red giant, it will get larger. However, the way white dwarves are supported, they are only stable up to 1.38 solar masses, the Chandrasekhar limit. After this, they experience runaway fusion and literally blow themselves apart in a massive explosion visible across the universe. Ia supernova aren't the only or even the most violent events in the universe, but they're useful because of how identical they are. Each one explodes at right about the same mass. They are nearly identical. So, if you know how much energy something releases, what kind of light it will give off, you can determine it's absolute magnitude. We can measure how bright a 1a supernova is from Earth and determine it's distance through elementary calculation. There are many ways to measure cosmic distance. The 1a supernova is probably the easiest to understand. |
Did epicanthic folds evolve separately in different parts of the planet or were they spread from a certain focal point?
I asked this question here because of the ridiculously low amount of information on the subject available on Wikipedia. Hopefully someone will provide a better elaborated response. |
If 1/4 of the world was blown away by nuclear explosion, could the other 3/4 of the world survive?
An explosion strong enough to eject 1/4th of the planet earth into space would kill everything on earth and turn the earth into molten rubble. Remember that cataclysmic events like the asteroid that wiped out the dinosaurs were merely big enough to make a (by comparison to the earth small) dent into the earth. |
If I was standing in one of Jupiter's moons, would I feel lighter when facing Jupiter?
Copying and pasting my answer from the last time this was asked: There would be a difference in weight depending on where you are standing, but it's not quite like you think. Jupiter's moons are in orbit around Jupiter, which means they are continuously in freefall in Jupiter's gravity, but because of their forward momentum they are constantly missing the planet and maintaining their distance. If you are on a moon you are in a similar freefall motion around Jupiter as the moon, so you don't perceive most of Juptiter's gravity when you step on a scale. However because you are stuck to the surface of the moon away from its center, it may be pushing you a bit off of the orbit around Jupiter you would otherwise be taking, or Jupiter may be pulling you a different amount than the center of the moon. These effects will cause differences in the weight you feel standing on the moon depending on where you are on the moon relative to Jupiter. This effect is called the "tidal force" , because it is exactly the same thing that causes the tides of Earth's oceans. The Earth and Moon are orbiting each other, but the oceans are held off at a distance from that ideal orbit so get sloshed around a bit as the Earth rotates relative to the Moon. Now perhaps counterintuitively, you'll feel lighter not only when Jupiter is over your head, but also when you are on the opposite side of the moon! You'll feel heavier when you are near the poles above or below the moon's orbital plane. The perceived forces look like this. Why is this? Free orbits are faster the closer they are to the body they're orbiting. If you are on the side of the moon facing Jupiter, you are in the of a smaller faster orbit than the moon's center of gravity, but you are stuck at the moon's slower of its higher orbit. Thus you aren't going fast enough to maintain your orbit around Jupiter and so "should" be falling closer to the planet, and feel like you're getting pulled off the moon's surface a little bit. Similarly if you are on the far side, you are in the position of a larger orbit, but are moving too fast and feel like you are being flung off the moon. If you are on the north pole you're going the right speed, but have an orbital inclination. That is, because you're in a different orbital plane than the center of the moon, you should be weaving up and down relative to the moon once each orbit. The moon has to hold you up to prevent that from happening, so you feel heavier. |
Question about antimatter...
Say (hypothetically) that we could create stable anti-matter particles in mass quantities. Would it be possible to combine different anti-particles (anti-oxygen and anti-hydrogen for example) to create the anti-version of substances we commonly have on earth (like a kind of anti-water)? Also, if this is in anyway possible, how would the anti-substance behave differently when interacting with normal everyday matter? (Other than obliterating any of its positively charged counterparts it encounters, of course.) I saw this basic question posted as a comment in another thread and thought it deserved its own post since it's an interesting thought experiment... At least i think it is. It IS 3:45am and I'm 15 beers deep though so i may just be drunk and missing the obvious point. if so down vote me and disregard... tldr; Would the anti-version of common substances act any differently than their positive counterparts in a normal earth environment? is it even possible to combine anti-particles into structured arrangements and make anti-elements? Would it be possible in the foreseeable future?
We could make a whole anti-you, just don't shake hands. Though interestingly, this brings up the larger point of symmetry in the universe. Can you in fact make a mirror version of something (with everything being reversed) and still have it operate identically? Well ideally yes, but because of certain problems with observation, it seems that the universe does at a certain level favor one dichotomy over another. One example is the absence what should have been a half antimatter universe, but instead we see a singularly matter dominated one which suggests that in some way antimatter does behave differently then normal matter in a way which is less stable. So the symmetry is only partial. I suggest you read Richard Feynman's The Character of Physical Law, one chapter really delves into what your asking. |
Why is the wheel damage on the Curiosity rover so bad compared to Opportunity?
Recently in the news has been a subject of worry. I have yet to see a concise explanation as to why exactly the wheel damage is so bad compared to the 13 year old curiosity rover. Why is that, whats different between the two rovers or the two terrains?
Oppurtunity weighs 174kg, while curiosity weighs 900kg. Also Oppurtunity top speed is 0.1miles/h while curiosity does 3.35miles/h. I have a feeling you are underestimating curiosity's size, check out these pictures https://marsmobile.jpl.nasa.gov/images/Evans_Mars_Yard.jpg |
My bottle of isopropyl alcohol has an expiration date. What is happening chemically that makes it "expire"?
It's possible they're worried about peroxide formation. Oxygen radical oxidation at the methyne position would lead to a peroxide hydrate, which would be in equilibrium with acetone and hydrogen peroxide. Any organic solvent + peroxide is considered a risk so they advocate periodic disposal. How serious this risk actually is, I have no idea, but autoxidation if alcohols isn't usually that fast. This might be a better safe than sorry scenario. |
Weird permanent thing in the sky?
A few months ago, my dad and I were camping in the middle of nowhere in Queensland, Australia. There was no major light pollution for at least 60 kilometres, so we could see a lot of the stars and astronomical stuff. Around 9 pm, we were sitting there looking at it all, and I noticed a cloud; nothing strange, so I took no notice of it. It was a moderately windy night, so when I looked back at it 20 minutes later and it hasn't moved, I was naturally curious. I asked him if it was one of those huge masses of gas in space, and he said it probably wasn't, and he wasn't exactly sure what it was. He did a lot of science and mathematics in university, so I trusted him. I am also relatively knowledgeable in physics (brag), but I couldn't think of what it could be. I forgot about it, and then we went to bed (tent?) at 11 pm-ish. At 3 am, I got up to go pee, and it was in the exact same spot as when I saw it hours ago, even though the rest of the starts and gas masses had shifted around. At that point I realised that it had to be in our atmosphere, or spinning with the earth at least, because it hadn't moved. It also definitely couldn't have been a cloud or anything physically light because at that time it was insanely windy at sea level, so I couldn't imagine what it would be like that far up. Still now, months later, I have no idea what it could have been. Does anyone in the entire community have an idea? It's been killing me ever since I saw it.
Probably the Large Magellanic Cloud. There are two dwarf galaxies visible from the Southern Hemisphere - the Large and Small Magellanic Clouds. You can see the Large Magellanic Cloud quite well from any reasonably dark area - I can see it from my parent's house on the outskirts of Tauranga - but the Small Magellanic Cloud is a bit trickier to see. They do stay in the same spot in the sky. The sky rotates around the "southern celestial pole", which is the extension of the southern pole into the sky. The Magellanic Clouds are close to the southern celestial pole, so if you're far enough south, they just go in circles in the sky, and never cross the horizon. They'll always be roughly south. Were you in southern Queensland, i.e. near Brisbane? The further south you are, the easier they are to see. Australia does extend far enough north that the northern regions will see the Magellanic Clouds cross the horizon. The further south you are, the higher they'll be. |
Modeling the Zombie Apocalypse: AKA Help me with Differential Equations
Hello everybody, For a project I am presenting a simple model of a zombie infectious disease. I am modeling it somewhat like a chemical equation, so that the rate of infection is proportional to the population of zombies and the population of humans. Note that L, Z, and D represent the living, zombie, and dead population. Hopefully everything else is explained by my notes, but don't hesitate to ask me any questions. I am having difficulty figuring out how to solve these equations explicitly for Z and L in terms of time. Do I need to simplify my model, or is there a way to solve this that I am not aware of. Thanks a lot :D
Assuming a, b, c, d and j are all constants (that is they aren't functions of time), and L, Z, and D = L(t), Z(t), and D(t) respectively, you have a system of coupled first order ordinary differential equations. You have three equations, and three unknowns. Solve them the same way you would solve any algebraic system: substitute equations, add/subtract them, and isolate your variables. Matrices might help you out. I would just do it numerically, using Python or Matlab. Here is some more info on ODE systems.
http://tutorial.math.lamar.edu/Classes/DE/SystemsDE.aspx Also, maybe this is just the physicist in me, but time derivatives are typically represented by dots, while spacial derivatives are represented by primes. EDIT: This is a non-linear system, since you have cross terms (z*L). You will most likely have to solve this numerically. EDIT 2: I'm going to work this out via computer. I'll let you know what your model looks like. EDIT 3: I tried your model and I could not get results. Either I don't understand it correctly or there are some flaws. Maybe you can better explain the parameters to me? However, I did find another model online (Munz 2009) and worked it out in Python. Basically, you assume there is an outbreak and that some small percentage of people that die naturally resurrect as zombies. You also have as parameters the chance of transmission (alive people become zombies), chance of zombies/people being killed, and the birth rate. Also, no matter how one dies, they still have a chance to resurrect as a zombie. Once you get one zombie, the situation rapidly deteriorates, and the zombies soon take over (in a matter of days). For a small town, with a population of 500 people, here are my results:
http://imgur.com/a/IcrQ0 Even a huge 10 daily births can't fend off the Zombies! |
Does a material's ability to transmit electricity correlate to it's ability to conduct heat?
I guess I was thinking of metal as an example, it seems to do both well. I bet there are examples where one material can only do one or the other but is it more likely that if a material can conduct one it can also conduct the other?
They are different properties. However, you are correct that in metals, the thermal and electric conductivities tend to track well together. That is because in metals both heat and electricity are carried through valence electrons. (see Wiedemann-Franz Law) This does not hold in other materials. For example, diamond is a famous example an electric insulator but has very good thermal conduction properties. Materials with good electric conductivity but poor thermal conductivity are much harder to find. You could argue that some superconductors fit this, since the electrical conductivity is infinite, but the thermal conductivity is not. |
How much of the brain can be damaged / Which damaged parts reduce what functionality? Based on the awesome scenario of a brain-eating worm!
This question is too broad. There are many kinds of disorders that can arise as a result of brain damage. I recommend doing some background reading and coming back with a more specific question. |
Do electric cars use electrical energy from the battery more efficiently than gasoline/diesel cars use heat energy from their fuel?
Simple question: In terms of total Joules of energy transmitted to the crankshaft (...or whatever electric cars connect to the drivetrain), which is the most efficient, strictly speaking?
Yes. By a very large margin. A heat engine like a gas engine converts between 20-30% of its thermal energy into kinetic motion at the crankshaft. An electrical motor can convert over 90% of the energy within a battery into kinetic motion given the right motor sizing. So if we have 1000KJ within a battery vs 1000KJ within a gas tank the Electric motor will allow the car use much more of that energy, and waste much less heat than a gas engine. |
Why is the benchmark for fevers 37.5 degree celsius?
Typically, a fever of above 37.5 degrees is considered a red flag. Is this experimentally derived, or merely arbitrary? Is there anything that prevents another number from being the standard?
We consider medically significant fevers to be >38 degrees Celsius. This, like normal values for any vital sign or blood test, was arrived at by taking (presumptively) healthy people and seeing what range 95% of them have as values. When we set abnormal values, we try to find the right balance between not missing people with truly abnormal values and picking up too many people with normal variants. In other words, if we set the fever number to be 37.6, we would probably catch most people who truly have an infection, but we would suspect infection in a lot of people who were healthy. If we set thefever threshold to 38.6, we would probably only catch people who were infected, but we would miss a lot of people who had an infection with a lower temperature. 38 degrees seems to strike the right balance between not suspecting infection in everybody and not missing little who were infected. |
Can we make small, lab-sized, analyzable nuclear explosions?
Depends on the size of the lab? But for a "classical" nuclear explosion to occour you need a "critical mass". This the minimum mass of nuclear material that can go critical (explode). Assuming you're not using any special technology to encourage criticality other than high explosives like in a classical nuclear bomb; then no you can not create a "lab" sized nuclear explosion unless you count something like the Nevada testing Fields as a lab. However most nuclear physics and experiments even those related to nuclear bombs do not require a full explosion for testing. You can test aspects in reactors, Lazer ignition facilities, and simulators with out the boom |
Are there a lot of gasses floating around in outerspace? Which ones, and in what quantities?
Basically I am curious as to what actually makes up "space". I have a hard time fathoming the idea of there being a such thing as "nothing". Also what happens when oxygen is sucked out of a spaceship, like can you make concentrated "community" of gas in space? This was originally posted here:
Careful, the concentrations of other gases and elements are not only measurable, but routinely measured through absorption lines of starlight or other sources of light that pass through these clouds of gas, getting preferentially absorbed at certain frequencies that correspond to atomic transitions of these elements and molecules. |
If isotopes like uranium undergo alpha-decay (which can be easily shielded), why are nuclear disasters like the one in Chernobyl so insanely hazardous?
Is it because of the air maybe? Or is there beta radiation involved as well?
Uranium, on its own, isn't that dangerous. It's a fairly weak alpha emitter, and its daughter products give off some (but not much) gamma/beta radiation. You could stand next to a fresh uranium fuel bundle, and not be in any danger. But as the fuel spends time in the reactor, other things are formed. When uranium splits, it forms two new atoms - fission products. And due to the nature of nuclear stability, these fission products tend to be highly radioactive (with short half-lives). So inside a reactor, you have the buildup of things like cesium-137, iodine-131, or strontium-90, which all decay by beta/gamma emission and can pose a danger to people in high enough quantities. |
Why don't normal wires do a good job of conducting high frequency signals?
As signal frequency increases, normal wires no longer do the trick. You need coax cables, and eventually a waveguide or an optical fiber. I'm assuming this is because normal conductors would begin to act as antennas and radiate EM waves rather than conducting electricity? What is the intuitive explanation for why this happens?
You have to think of it as a transmission line, a distributed inductance/capacitance network. For a plain wire in air, where is the capacitance? It's zero. So the transmission line degrades to an inductor. Inductors become higher impedance at higher frequencies. Investigating what the best impedance for max power transfer and lowest loss is useful - it's been a long time since I did that math. |
How unique are individual animals of the same species?
There are 7 billion homo sapiens, and each one is fairly unique in genotype and phenotype (excluding twins). There is also a great variety amongst humans that is not typically found in other species. But why aren't other animals as individually unique? And what advantage did it give humans to be so?
There is also a great variety amongst humans that is not typically found in other species. That's just because you don't notice the difference in other species as much as you do in humans. It's "all Asians look the same" syndrome. |
Does our Universe have infinite mass?
I have seen comments and questions on AskScience about the Universe being infinite. When I think of the Universe as infinite, I think of infinite stars, solar systems, planets, etc. Is this what scientists think? That our Universe has an infinite amount of stars, solar systems, galaxies, and planets?
If our current cosmological models are correct and the universe is infinite, then the quantity of massive objects in the universe will be infinite. Whether or not this is actually the case remains an open question. |
If i had a rope on an intergalactic scale, would the rope break due to the metric expansion of the universe?
So, we know the universe is expanding due to the metric expansion of the universe. On small scales, the expansion is so small that we don't notice it: all the forces we are used to (gravitation, the electrical force of chemical bonds, ect) "compensate" for the minute changes. Lets say I have a rope or pole that is impossibly long, my intergalactic rope. The rope at any point would not see its neighboring sections moving away, so it would seem that the instantaneous strain on the rope should be pretty small. But over all, the rope cannot maintain the same length without the ends moving towards the center. So here are my questions:
It depends on where the ends of the rope are. If it's out in free space in a flat gravitational potential, it won't experience any expansion force, because it will just be held together. However, if the ends of the rope are, say, in the gravity wells of two receding galaxies, the ends of the rope will be pulled apart and it will eventually either snap or get pulled out of the gravity wells. More likely snap. |
Hot days feel hotter if they are humid, but a damp cold feels colder than a dry cold. At what temperature in the middle do wet and dry days feel exactly the same?
This isn’t really an equilibrium thing it has more to do with conductivity. Wet air is essentially a mixture of dry air and water, and water has more thermal capacity and is a better conductor than dry air. So the wetter the air the better it will conduct the air temperature to your body. There is also the interaction of humidity and your sweat evaporating that makes wet heat feel hotter. It’s more like how hot metal will feel hotter than air at the same temperature and cold metal will also feel colder than air at the same temperature. |
In the liver, if blood from the sinusoids can enter the central vein, why doesn't the blood just constantly bleed out of it too?
There are different types of liver failure but I assume you are talking about chronic liver damage leading to cirrhosis. When a healthy liver undergoes prolonged damage (alcohol, hepatitis C, autoimmune disorders, iron) the cells are eventually replaced by scarring as they die off. This causes difficulty for the blood to filter through the liver thus increasing back-pressure in the portal venous system (the venous system going from the GI to the liver) which is separate from the systemic system. The portal hypertension engorges veins in the stomach and esophagus which greatly increases their risk of bursting and bleeding. On top of the mechanical pressure, the liver is also responsible for synthesizing many proteins including clotting factors and thrombopoetin (stimulates platelets). Loss of these proteins from cellular damage also greatly increases general bleeding risk. People who have cirrhosis from alcohol consumption also generally have damage to their GI system from alcohol itself increasing bleeding risk. |
Why does the Fluorine anion in toothpaste strengthen tooth enamel (Hydroxyl apatite) but the Fluorine anion in hydrofluoric acid hate the human skeleton (also hydroxyl apatite)?
Is it just a concentration issue? Is this a question wrongly asked? related: apatite mineral (in rocks) Ca5(PO4)3(F,Cl,OH) hydroxyl apatite: Ca5(PO4)3(OH) carbonated hydroxyl apatite (bone and teeth)
hydrofluoric acid is an acid (pKa = 3.14) with high tissue penetrance. Acidity (availability of hydrogen / hydronium ions) leads to decomposition of the hydroxyl apatite crystals, which is a concept physiologically employed during bone resorption (osteoclasts secrete hydronium ions to attack the mineral structure, which leads to a release in calcium and phosphate ions). Additionally, all other side effects of local acidity in tissue occur. Tooth paste contains fluoride salts which are practically non-acidic, so they are not inherently destructive towards hydroxyl apatite. The fluoride ions from the fluoride salts get integrated into the apatite mineral structure to form fluoride apatite. However, ingestion and/or resorption of higher amounts of fluoride ions (way too low amounts in tooth paste or drinking water, but sufficient amounts in case of hydrofluoric acid toxification) leads to disturbances in calcium and magnesium metabolism because of inhibition of crucial enzymes as well as disturbances in the central nervous system. EDIT: What I forgot to mention is that fluoride ions in sufficient concentrations will form insoluble salts with calcium ions, which is even more apparent in case of hydrofluoric acid because of the relatively low pKa and the fact that calcium ions get released from bone tissue in higher acidity. This is also the reason why hydrofluoric acid is so corrosive towards biological tissue - virtually all cells in your body depend on calcium ion signaling and the forming salt crystals are mechanically destructive towards cells as well. I also suspect that the acidity influences the insolubleness of these salts. |
If a blind person were to consume a hallucinogenic drug, would they get visual hallucinations?
I also ask this for any lack of a sense. Would the Synesthesia hear sounds/see colors still apply for one who is deaf? or blind? If one became blind in life, having been able to see before, would they get visuals? (I am asking with LSD in mind, but any other hallucinogen is still in question)
Depends on how long they were blind . People blind from birth didn't see anything, people who had lost their vision later in life did. |
When I hear that computers will exceed the computing power of the human mind, what exactly does that mean?
I'm only confused by this because computers quite obviously aren't and won't soon be capable of human level sentience.
When people refer to computing power, they are referring to the number of operations or calculations per second . When they say that computers will exceed the computing power of the brain, they mean to say that a computer will be able to more in a single second than we can. This point has already been reached in many situations, such as basic math. A calculator will be able to do any function you give it (generally) faster than a person could. |
Why do computers get slower over time?
I've always wondered this, and wanted a good answer. So, why is it that a brand new computer will outperform an older one with the same specs? Does it have to do with memory?
So, why is it that a brand new computer will outperform an older one with the same specs? Does it have to do with memory? If they truly have the same specs and the same software installed in the same way, then there will be no difference. I do find it a bit odd that you would replace an older computer with an equivalent one, since the price per performance for computers is steadily dropping. There are some seemingly trivial hardware changes, such as a solid state hard drive instead of a standard magnetic disk, that can have dramatic performance differences. I'm not quite sure to what you are referring with 'memory'. Hard drive data fragmentation could be an issue that slows a computer down. If a computer has been in use for a while, the copying and deletion of data can eventually force the computer to store data less sequentially, but I somewhat doubt that this effect would entirely account for the slowdown you are referring. Unless your hard drive is or was rather full, this shouldn't be a major factor and is easily fixable by using a defragmentation tool. Another possible factor is background programs and spyware. As you install software onto your computer, there is sometimes a component that is constantly running in the background even if the program isn't open. Individually, this program is insignificant, but after a few years of software, they can build up and together will noticeably slow the computer down. A fresh computer lacks these, and thus will run faster. I believe that this is most likely what you are seeing. |
When does interbreeding fail? Can a human's sperm enter and fertilize a goat's egg? Will something start to grow, and die soon after, or will it not even get that far?
Interbreeding fails when organisms are sufficiently different, the more closely related they are, the better chance they have. Typically the organisms have to be within 2 chromosomes of each other in terms of total chromosome count. Humans have 46 chromosomes, goats have 60. Also, if the animals are of different genera it is quite unlikely that they will interbreed successfully. Goats are most closely related to sheep, and sheep only have 54 chromosomes, and are a different genus. Hybrids of these are stillborn usually. The degree to which a potential offspring can grow in utero is quite different depending on how related the animals are. Some will be stillborn, others won't be able to conceive at all (such as humans and goats). There is no real way to broadly generalize the level of potential development. Edit: lost a word. |
Apple seeds contain Amygdalin, a substance that can lead to cyanide poisoning.
Does anyone know how poisonous it is and how many seeds you would have to eat before it became dangerous? Does this substance build up in the body or is it easily flushed out? Got curious after seeing a few posts over in and couldn't find any good information via google.
I asked this question a month ago. Here ya go Apparently ~0.6 mg per gram of seeds which is a decent amount. Amygdalin is the most prominent sugar present in the seed itself. Though it's must easier to get cyanide poisoning from improperly cooked cassava roots, though apparently eating (and chewing) a cup of apple seeds would be harmful and there is a death on record because of it. |
Could somebody explain me how TALEN-missions work on an example task?
I just don't understand that, but I hope I will, if you have explained it .) I'm new to Biochemistry so could you explain it like I'm.. 10, maybe 18? I found this task in the world of the internet and got interested in it, but I don't go through it: First of all it's about TALEN (you already know it, but to make it clear: Transcription Activator-Like Effector Nukleasen). Let's start: There are 2 TALENs that want to cut throught a sequence that goes like that. 5’-CAGCCAGACTGCCTTCCGGGTCACTGCCATGGA GGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCT GAGTCAGGAAACATTTTCAGACCTAT-3’ (Question on the side, what does the 5' and -3' mean? Wikipedia told me nothing, or I'm just too blind for it) and for the amino acid on place 12 and 13 NI = A; NG = T; NN = G; HD = C The TALEN-Pair should start at the start codon -That I have to find first, the DNA binding are 15 base, the cut is 5 basepairs away from the bindingpoint. Then -that's the end of the first number: Identify the start codon and say where the both binding-positions are (the 15-Base thing).. Then I should translate the 15 + 15 base (the binding pairs) into the RVD -That's i think the: NI = A; NG = T; NN = G; HD = C Then I should define the binding and cutting-point of the restriction enzyme Bsal and EcoRI (-The english wiki has more information about that than the german one) And the last thing is to decide which enzyme (Bsal or EcoRI) is better to get sticky ends in the sequence up there after the PCR and "restriction cut". That should happen throught ligation for 5 different DNA sequences. I'm sorry for this text-wall, but happy for every answer, if you understand what I want from you, because.. myself doesn't understand it.
The ' (prime) number refers to the points on the sugar ring on the individual base. When strung together in DNA, the 3' (3 prime) carbon of one base is attached to the phosphate chain on the next base. The phosphate chain on the next base is attached to the 5' carbon on its sugar ring. When you chop out a length of DNA, you release this 5'C - P - 3'C bond at either end. (This diagram might help: http://bioap.wikispaces.com/file/view/08P-210-DNA-5-3.jpg/207075400/345x384/08P-210-DNA-5-3.jpg ) This means you can refer to either end of a DNA molecule, one has a bare unattached 5' carbon and the other has a bare unattached 3' carbon. This is important as, by convention, you always write the DNA sequence in the 5' to 3' direction. That is, in the sequence you've given, you would always write it: 5’-CAGCCAGACTGCCTTCCGGGTCACTGCCATGGA
GGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCT
GAGTCAGGAAACATTTTCAGACCTAT-3’ and not: 3'-ATAGGTCTGAAAATGTTTCCTGACTCAGAGGGGGCTCGACGCTAGGATCTGACTGCGGCTCCTCCATGGCAGTGACCCGGAAGGCAGTCTGGCTG-5' Which is also technically correct (though on the opposite strand). This just makes sure, when you're dealing with DNA sequences, that everyone reading the same thing from a pretty abstract sequence of letters. |
Why doesn't water rise and compress the air in an upside-down cup lowered into water?
I just put a cup upside down in a pool of water but every bit inside of it was dry afterwards. I thought the air would get heavily compressed by the water, but why doesn't it?
It does. You just didn't push the cup down far enough. As a bonus, as you compress the air it gets denser so the bouancy of the air decreases. If you push it down far enough the air won't be bouyant enough to keep the cup floating. |
Could "dark matter" be hiding in black holes?
I watched an episode of Nova: Science Now where they were searching for dark matter. The way they explained it, the biggest evidence for dark matter is that galaxies are spinning so fast that there must be more gravity holding them together than that which can be accounted for by the stars/novas/planets etc that can be seen. Then they jump to a scientist saying that dark matter is not like regular matter (i.e. non-baryonic matter). I don't understand how they make that leap. Why couldn't the "missing" matter be normal matter either in the form of A) cold gasses spread throughout galaxies/between galaxies, B) in lots of black holes all over, or C) in massive black holes which I've heard are thought to possibly exist in the center of galaxies? I just read about , and it seems that they don't see the lensing which would be indicative of option B, so I guess they can rule out objects between 0.00000001 solar masses to 100 solar masses, but what about option "A" (particles/objects below that range) or "C" (black holes above that range)? EDIT: Why the downvotes? I'm seriously looking for an answer, does no one know why scientists have made the leap to assuming there must be non-baryonic dark matter out there?
Ah, well we think that dark matter is this. We have examples of similar particles in fact, neutrinos. Neutrinos pass through you and the earth and so on, huge numbers of them every second (I can't remember the exact count). But think about it, if they only interact gravitationally (and by the weak force) what's to stop them at the earth's center. All the energy they've gained from falling to the center of the earth is then lost on the path back out of the earth on the other side. We expect dark matter to behave like neutrinos, only interacting gravitationally and weakly. Except that it has to be much heavier than neutrinos are. Neutrinos are so light they're almost always flitting about at very nearly the speed of light. And again, nothing to slow them down. But dark matter doesn't seem to behave like particles moving at the speed of light, it seems to be "cold", relatively slow. We strongly suspect that the particles are neutralinos , the lightest supersymmetric partners of the gauge bosons. the LHC may find evidence of their existence. |
Why do rainbows form in such specific halfcircular shapes?
They don't. Rainbows are circular but a little less than half is normally covered by the horizon. They form that way due to them being light bouncing through rain drops at a particular angle relative to your eyes. |
How does evolutionary science explain how fresh water fish ended up in inland lakes?
EDIT: Thanks for all the responses. I'm not arguing against evolution (I believe in it), I'm wondering because I live in a glacial lakes area (with many lakes) and it kind of makes me wonder, where did all these sunfish, walleye, northern pike, etc come from? Are they all descendants (that have evolved) from ocean species, or did they end up in fresh water lakes some other way?
There are a large variety of fish that can live in both freshwater and saltwater. Some of these fish include salmon, bull sharks, and striped bass. All three species mostly come into freshwater to spawn. (There are other fish that leave freshwater to spawn in the ocean) There are incidences where man-made dams prevented fish from returning to the ocean. They are now 100% freshwater fish. As Pangea became the continents, it trapped some species and that could explain how some fish went from saltwater fish to freshwater fish. Another explanations would be flooding. An area becoming flooded and previously barren lakes trapping fish when the flood waters dissipate. |
Which Came First, the Virus or the Cell?
Was the virus around before the first cell and the cell evolved either from or independently of the virus? Or did the cell evolve first and the virus evolved either from or independently of the cell?
No one can tell you for sure. However, since a virus cannot reproduce without a cell to infect, it stands to reason cells would have come first. |
Intuitive explanation of digital signal reconstruction?
We know we can reconstruct a discretely sampled signal (let’s say we are working with audio range) as long as the sampling rate is at least twice that of the highest frequency in the signal. To physically reconstruct this signal, we output the samples as a train of impulses in time to the sampling frequency. I understand that, because of the Shannon / Nyquist theories, (since we sampled twice our highest frequency) we can reconstruct the signal without loss of information. I saw a great visual not too long ago about how the reconstructed signal is just a collection of sinc waveforms in time, where the sinc ripples (in the frequency domain) sum together to recreate the information between samples. What I do not understand is how this physically, intuitively, transpires- what about an impulse voltage output correctly creates the frequency information between samples? What constitutes an impulse output? Is it strictly the amount of time the output remains on? Furthermore, I know there is filtering that can be done to remove higher frequencies / artifacts that may occur, but I am not sure if the filter is necessary component? Please forgive any misconceptions, and let me know if I’ve made any mistakes or grand assumptions. Thank you!
I am a little bit confused about the second last section of your question. Specifically the part "what about an impulse voltage output correctly creates the frequency information between the samples? What do you mean by an 'impulse output'? Do you mean the dirac delta function? https://en.wikipedia.org/wiki/Dirac_delta_function Lets reexamine the situation to see if this clears it up. If you have a band limited signal below lets say 20kHz. Then by sampling at 40ksps, you can perfectly reconstruct the information 'within the band' of the original signal in the 'continues time'. If you simply put impulses on the time marks where you sampled the original signal, you will not have an actual reconstruction of the signal. The original signal, even though it was band limited, had information in between the sample points. As you mentioned these intermediate points can only be correctly reconstructed by convolving the impulses (dirac delta pulse in continuous time) with the sinc-function. This is because the sinc function's frequency domain representation is a perfect low-pass filter. On an intuitive level you can think of it as following. Assume you have a continuous time domain signal bandlimited to fmax. This implies that all the information in between discrete sample points at 2 fmax is redundant. The math works out as following. Start with signal x(t) band limited to fmax. x(t) can be sampled at 2 omega) = 1/(2 pi*fmax) The original signal is then a convolution between the sinc function and x'(t) which is: x'(t) = sum n=1 to N of x[n] 1/(2*fmax)) I might have made some math mistakes here and there. |
Is it possible to trap static electricity in a mason jar?
Is it possible to trap static electricity in a mason jar? If so how long can it stay "trapped" in there? I am helping my daughter with a science experiment.
If you coat the inside and the outside with different pieces of metal (e.g. aluminum foil). This is called a Leyden Jar, and was one of the first methods of controlling electricity. https://en.wikipedia.org/wiki/Leyden_jar |
Why is owning a large carnivorous animal (lion, tiger) from infancy more dangerous than owning a dog?
Dogs have been selectively bred over the course of many generations. One of the criteria that breeders have used to select which dogs to use for breeding is aggression. Some breeds, like Rottweilers, pitbull terriers, etc., were bred to have high aggression toward perceived threats, but almost all dogs were bred so that they are not aggressive toward their master(s). |
Geothermal energy: Are there any dangers/concerns in accelerating the rate of heat loss from the crust?
I am not sure what they would be. I can imagine over a very long and not-scary amount of time we would dampen the depth of brittle rheology, which may increase seismic hazards. That's all I can speculate on though, are there any identified risks of geothermal energy as the main source of energy for a large population over a foreseeable amount of time?
There are some concerns with geothermal energy, but they don't really have to do with accelerated heat loss from the earth. With respect to accelerating heat-loss from the crust, there is not much to be concerned about. It's easy to forget how large the entire earth is as a system, especially when we only think about the crust. There is ~6000 kilometers of extremely hot material between us and the core, which collectively holds massive amounts of energy as heat. Some concerns with geothermal energy on a commercial scale, where we use heat from the earth to generate steam, are: 1) The use of hot water from the ground (hydrothermal fluids) in large quantities can change the dynamics of the groundwater system and water table of the region. Just like when an aquifer is over-pumped for drinking water, overuse of hydrothermal fluids can lead to land subsidence, and also sometimes an increase in geothermal activity due to pressure relief. (I can go into further detail if necessary, but you should look at Wairakei Power Station for an example. 2) Hydrothermal fluids aren't 'regular water' in that they have higher concentrations of metals which could (and generally are) be above the safe limit for human and animal consumption or contact. Hydrothermal fluids can be rich in dissolved arsenic, cadmium, thallium, etc. nasty stuff! The issue is what to do with the water once it's been used, and what will the effects of using a lot of this water be on the existing hydrogeological systems, particularly the ones in use for potable water. There are other types of geothermal systems which are 'single user' or can be installed in your backyard. On the most basic level, you dig a huge pit, make a huge network of PVC pipe that will loop water underground for as long as you can manage (based on the size of the pit) before bringing it into your home to be heated by a boiler. The premise is that the ground acts as a great insulator from cold in the winter, and at a certain depth (location dependant) the subsurface will be warmer. Additionally, taking advantage of the geothermal gradient (an increase of 25ºC/km depth) is a small component. The idea is that boiling water that is say, 20º or 25ºC uses less energy than having to heat water from 5ºC - which is an average temperature of tap water in the winter. Incidentally these systems are more about using the ground as a heat sink for a large heat pump, but I guess you could still call it geothermal energy. Wikipedia has a very nice description of what's going on. |
Why is it justified to use just even one "free" parameter in theories in the physical sciences?
Why is it okay to tune a free parameter (or maybe a few free parameters) in order to get the results you are aiming for?
Because it is necessary. As long as the number of different observations you can describe with the theory is much larger than the number of free parameters this is still a successful theory. As an example, Newtonian gravity has the gravitational constant as free parameter. We can measure it with devices in the lab, but the same constant also applies for Earth and the Moon, for planets orbiting the Sun and so on. |
How is it that there is a height difference between Pacific and Atlantic ocean?
I just can’t figure out why, if they are interconnected by the strait of magellan at Kap Hoorn, why do they have to change height in the panama channel? Edit:
There are two things to consider, (1) ocean surface topography (which plays a pretty minor role in the case of the Panama canal, but is important in a more general interpretation of the question in your title) and (2) tidal range (which is the much larger factor for the Panama canal specifically). For the first, at a global scale there are a variety of causes for sea surface topography , i.e., there is on the order of ~100 cm difference between "mean sea level" in different places . This changes on a short term basis as well, e.g. this video . Ocean currents are a large control on these height differences, e.g. this graphic , where generally areas of high surface ocean topography are areas where currents are flowing toward and low surface ocean topography are areas where currents are flowing from. Changes in these currents on a daily to seasonal basis in turn will turn change the ocean surface topography. Similarly, smaller variations from changes in from atmospheric pressure can cause short term changes. On longer time-scales, variation in Earth's gravitational field also influence the ocean surface topography (i.e., the geoid ). Ultimately, for the Panama canal, these differences are going to be pretty minor (on the order of a few cm to a few tens of cm at maximum). Of larger issue is tidal range. For tidal range , i.e., the difference between low and high tides in a location, the primary influence between different places is the bathymetry/geography (there are also seasonal and other controls as well). Bays are especially notorious for amplifying tidal ranges (e.g., the Bay of Fundy ). With specific reference to the Panama canal, looking at map of tidal range we can begin to see that this is a particular concern as the tidal range on the Pacific side is large, in excess of 5 m, where as the tidal range on the Caribbean side is virtually zero. This is incorporated into the design of the locks system . |
I recently heard that the player who chooses White in chess has a 5% increase of winning if then they choose black. Why is this? Don't both players have same chance?
If you look at the averages of maths, white almost always leads by 5% p, give or take a few .somethings-somethings. Why is this? Both players have the same pieces, same rules, same board, etc. Why does white get a more statical advantage? Why not black?
The game is not completely symmetric. White moves first, which is generally an advantage. While I cannot answer the specifics for chess, I can provide examples in other games. In League of Legends, one of the most popular online games right now, the blue team has a great advantage if you check the win rates. While the game is designed to be as symmetric as possible, there are minute differences. Players attribute the win rate difference to the UI placement and the placements of the baron and the dragon on the map, but we can't know for sure. A better comparison might be Go , in which the legendary player Honinbo Shusaku boldly claims that he never loses when he plays black, which goes first. This makes sense, as in his era people didn't realize what a great advantage it was to go first. In modern rules, white gets komi, free 6.5 points, to compensate for going second. Komi didn't exist in Shusaku's era. I suspect that, without the komi, black will have an abnormally high win rate in modern tournaments. Why does black get an advantage? In Go, there's the concept of sente and gote . Sente means taking the initiative: you go where you want to go. Gote means you have to respond to your opponent; basically, you're playing on the terms of the player who has sente, because if you don't respond, you can lose the game. The player with sente "forces" the opponent to make certain moves. Going first puts you with many more opportunities to make sente moves. Now, I don't know much about chess, but I suspect the same thing happens in chess. The player who goes first decides on the first move of the game, and that restricts the moves of the player who goes second. The white player has more opportunities for sente than the black player. I am not sure if this post is considered anecdotal or not, but I did try my best providing sources and explanations. |
Would it be possible to get the optic nerve to send messages to a machine so we can see exactly what the person sees?
I know nothing about optical science just wondering
Broadly speaking, yes. Not with current technology, but I imagine we'll get there. We already record from the brain using a variety of invasive (e.g. implanted electrodes, or 2-photon microscopy with calcium imaging) and noninvasive (e.g. EEG, fMRI) methods. From a practical stand point, the optic nerve is hard to access - before the signal reaches the cortex (the outermost layers of the brain, where "high level" processing happens), it goes straight to the middle of the brain. In that light, it's easier to record from the visual cortex, which is at the back of your head. You're still reading visual information there, but it has gone through more processing by then, which means it's more representative of what you actually perceive than the (less processed) information carried by the optic nerve. The next step is to take the signals you've recorded, and find out what the eye was seeing. This is also an area of active research, especially if you include all efforts to extract information from any area of the brain - many people are looking at the sensory areas (auditory, visual, tactile, etc), but also memory, navigation, motor areas, and so on, figuring out how information is represented in those areas. We have a ways to go before we can reconstruct a full scene, but we're getting there. It's cool stuff. I think this question really breaks down into two somewhat different questions: 1) Can we record information from the optic nerve, and extract information about the scene from the signal? (discussed above) 2) How does that information relate to what the person perceives? "Perception" and "sensory input" are not quite the same thing - perception would be how your brain interprets sensory input. The input is a rather more mechanical, deterministic quantity. That is, some kind of sensor - mechanoreceptors in the skin, hair cells in your cochlea, etc - is acted on by a stimulus - brushing against something, sound waves traveling through the air - and sends a pulse of spikes to the brain. At that point, it's only a physical stimulus. If we talk about perception, we're usually talking about a person's subjective experience of the stimulus. Knowing what signals your sensors (like your eyes) are outputting is not necessarily the same as knowing what you are perceiving. We'll get there. We can currently record directly from the brain or nerves, and extract a certain amount of information from those signals, but not at this scale. An easier solution to the same problem would be to track a person's eye movements (which we can do well), stick a camera next to their head, and have the camera point at the same thing that the person is looking at ;-) |
Do you think that communication by quantum entanglement will ever be feasible?
Even if it is in the distant future when we know so much more. Is there any possibility of this ever happening?
You can't communicate with what we know as quantum entanglement. It's not just unfeasible, it's not possible even in principle. Nobody can say that in the future, what we know won't be proven wrong or very different from what we now know. But if it is, then they'll use a different term for it, since it's fundamentally different. So I'd say there's no possibility of it ever happening, since you'd have to be talking about a different theory that explained what we currently know as entanglement, not entanglement itself. |
Does sleep ever go to waste? f.e.If I sleep 14hrs instead of just 8.
As someone who has been studying biology and physiology for many years I can say that though there are many theories about the function of sleep, they are simply guesses. To answer your question properly we would first need to know the purpose of sleep and why we must do it which we do not currently definitely know. |
Is a pine tree that has cut and placed as a Christmas tree still alive?
I placed this year's Christmas tree in the traditional base holder and have been placing water in the base daily; I am replacing about 0.5 liters of water daily, which suggests there is an active process of assimilating the water into the tree.
First, as a minor point: The most popular trees are various species of fir and spruce, but some species of pine are used as Christmas trees. (It's mostly regional.) And yes, you are correct. If your tree is green and using water, it's still alive. Photosynthesis is still happening in the leaves. Some eco-friendly trees are even sold with root balls so they can be returned to nature after the holidays. |
How does a computer communicate with another one behind NAT?
I was learning about NAT and I think I understand how it works. You have a private IP. When you send a request to a computer on another network, the router changes the packet's source address so that the router receives the response, and then it forwards the response back to you ("you" being another computer). But this only happens when you initially send a request. How does a computer on a different network send you a packet if you didn't send it a request first? Assuming you are not the only device connected to your network, and it can't just send a packet to your private IP address, how can this communication occur?
NAT traversal and STUN is what you're looking for. The is both peers tell a third party who and where they are (some identifier and the public IP:port as seen from the outside. The third party transmits that info to the peers. The peers then talk directly to each other. Here is a detailed description of the problem and a solution for hosts behind many NATs and when both peers are behind their own NAT. https://tailscale.com/blog/how-nat-traversal-works/ |
Why is the apparent magnitude scale used to measure the brightness of stars backwards?
While /u/varialectio is right that the system is logarithmic, there's no reason it couldn't be logarithmic in the other direction, with the brightest stars having the biggest numbers. Historically, for the ancient Greeks, magnitude was a semi-arbitrary scale where "first magnitude" was like "first class" or "first place", the brightest stars. "Second magnitude" stars were less bright and important, and so on, down to sixth magnitude which was the limit of human vision. With the invention of photography we were able to measure brightness accurately, and we chose a logarithmic scale to fit the ancient system, because as it turns out the human eye measures brightness logarithmically. https://en.wikipedia.org/wiki/Apparent_magnitude#History |
Should I take Feynman's view of quantum electrodynamics at face value?
Hi! This is a good question for our sister subreddit, /r/AskScienceDiscussion . All our panelists have flair over there as well. |
What is neuroplasticity?
I know what the basic idea is but I am still a bit unsure. So if possible could I have a simplified and maybe a more in depth version of what neuroplasticity is.
Rewiring of the brain. When I think plasticity, I think of how moldable the brain is. For example, if you introduce a certain drug to the brain constantly, like nicotine, the chronic stimulation of nicotinic acetylcholine receptors may result in a down regulation of the receptors, or a decrease in the amount of receptors in response to this constant stimuli. Therefore, the brain is less responsive to nicotine. So it is essentially rewiring of the brain due to some kind of stimuli. It is some kind of response as a result of something occurring to the brain |
How much would you weigh if Earth stopped rotating on its axis?
No, centripetal acceleration. It's due to gravity of course, but 0.034 ms of it is needed to keep you on the earth's surface, the rest you feel as your weight. |
Was the cosmic microwave background once visible light?
From what I understand of the CMB it was initially very high energy and high frequency and as the universe cooled and expanded the light was shifted down to microwave radiation. Does that mean that at some point in the history of the universe the night sky was lit up in a specific color of light that we would be able to see? And going further was that point in time a time when there were solid planets and the universe pretty much as we know it now?
Shortly after the Recombination era - the era from which cosmic background radiation originates - the cmb was bright orange. To understand what exactly happened, let's backtrack a bit.
Until 380 000 years after the big bang, the universe was too hot to form neutral atoms. Electrons and protons whizzed through space which such high speeds, that electromagnetic attraction wasn't strong enough to bind them together. Thus, space was filled with a hot plasma, that gave off thermal radiation. During this time, the universe was opaque to photons. Photons would bump into electrons frequently. This scattering of photons results in a mostly in-transparent universe with a visibility of a few thousand lightyears at most. (Which sounds a lot but is very small at cosmic scales) Due to the expansion of the universe, this plasma finally cooled down to around 3000K. Which is cool enough to form neutral atoms around 400 000 years after the big bang. Since neutral atoms don't interact with photons that willingly, the universe became transparent. Thus, the thermal radiation of the plasma in the recombination era was emitted into all directions and from all points in space. And since the plasma was around 3000K at that time, and the black body radiation at that temperature is orangy, the hole universe was filled with orange light for a few million years. The universe during the first few million years after the big bang saw the first stars being formed, but during this time, the only radiation emitted was the hydrogen line. Over time, as the universe continued to expand, the cmb got redshifted. Now, ~13 billion years later, the cmb is redshifted down to around 2.7K, which is in the microwave part of the spectrum. |
Why is it that the east coast of the United States is lined with barrier island while they are sparsely seen on the west coast?
There are many processes that aid in the formation of barrier islands, but before getting into those, take a look at the bathymetry reliefs of the continental shelfs around each coast You'll see that land slopes steeply into the ocean in the west coast and gets deep very quickly whereas in the east coast, the shallow continental shelf extends quite far out into the ocean before it slopes down to the typical ocean floor depth. This allows for the dynamics of prevailing winds, coastal currents, outflowing rivers, and nearby eroding land to create stable barrier islands... which aren't really possible in the much deeper coasts out west. |
Why does evolution result in distinct species?
The Wiki on speciation has more depth, as well as more than just one mechanism of speciation (mutatron described allopatric speciation, but there are other types!). |
Do orbits of planets in a solar system have to be on the same plane?
Currently, I see models of our solar system where the planets are all located on 1 plane. Is it possible for a solar system to exist where planets orbit on multiple planes?
In principle there is nothing to prevent planets from orbiting on multiple planes. That is, if some super advanced civilization was to come to our solar system and move some planets around to orbit on another plane, that would work. The reason that our solar system, and by extension other solar systems, orbits more or less on the same plane is due to conservation of angular momentum. Our solar system started out as a large rotating cloud of gas. Under influence of gravity, this cloud contracted to a disk, but the angular momentum of the cloud remained the same throughout this process. The denser parts of the disk then started to attract even more mass and this caused the formation of the sun and other celestial bodies. From the start of the formation process, everything rotated pretty much around a single axis. For part of the matter to instead rotate around another axis, an external source would have had to jolt it in the right way. But lacking such as external source, everything stayed more or less on the same plane. |
Why don't the Mars Rovers have wipers for their solar panels?
I know they were intended for a much shorter mission than the one they have undertaken, and that wipers would add some mechanical complexities that take away from space away from other systems, but does that preclude the possibility of having solar panel wipers in future missions?
The problem is that wipers would add significantly to cost, weight, and complexity for a small improvement in function. "Significantly" because the wipers would have to be a long as the panels are wide, and they would have to be powered by extra motors and gears. Then, when all is said and done, what's to prevent the wipers from getting coated with dust themselves, thus reducing their ability to clean the panels? Or from failing because of accumulated dust in their gears, levers and unfolding mechanism? When in use, the wipers would have to stretch across the panels. When not in use, the wipers would have to fold up and be out of the way, otherwise they might block the sunlight that is the entire point of the panels. The folding scheme wold be another failure mode, both for the wipers and the panels. I say this because I spent years thinking about issues like this during my time as an engineer on the NASA Space Shuttle project . |
Would moving the ISS to GSO for future salvage be practical?
Seems like it would make for really good parts salvage whenever manufacturing in space becomes an industry. Putting it at GSO and abonding it would mean basically no maintenance costs wouldn't it?
First, low earth orbit, where the ISS is, is about 160 km above the Earth's surface The ISS is usually between 300-400km above the surface. On top of everything, even if we did manage to boost the ISS into GSO, we actually don't have any rockets that can send a crewed capsule to GSO anyways. Yet. Falcon Heavy and SLS will have this capability in about 5 years. it took 15 separate launches from Earth to assemble the ISS It actually took about 50, depending on when you consider the ISS to be complete. and it will take a greater amount of effort to push all that mass into GSO Not at all. It takes about 10km/s delta-v to get from Earth to LEO. It would require a boost of about 4km/s to get from LEO to GEO. The initial boost from Earth to LEO requires using rockets with a high thrust and low ISP, so they are pretty inefficient. The trip from LEO to GEO could use the VASIMR engine that will be installed on the ISS soon. It can use the energy from the ISS solar array to boost the orbit using tiny amounts of xenon or argon gas. 20-30 tons of fuel should be enough to move the ISS to GEO. |
Is every instance of your immune system's successful response to an infection passed down to your children?
Immunological memory cells travel throughout the body and are what help you mount an immune reaction to a pathogen you have been previously exposed to. Sperm cells are a separate cell line formed in the testes. The only way I can think of a sperm cell DNA to deviate from it's original form is by some sort of viral infection directly effecting spermatozoa DNA, or any other cause of DNA damage. To answer your question, yes, the body records how to fight off certain infections but, no, this information is not transferred to your spermatozoa. |
Do centrifugal forces still apply in a zero-gravity environment like space?
Centrifugal forces are basically pseudo forces. Unless you construct your system in a rotating reference frame, there is no centrifugal force term. What we percieve as centrifugal forces (or centripetal forces by symmetry) are changes in the magnitude of force components due to a torque.
So unless the torque is provided by gravity itself, then there is no reason why what we would call a centrifugal force should disappear. So if I have a cup attached to a tether, and I shoot a bullet into the cup the cup will spin. If the bullet is always in equilibrium with the cup for simplicity, and if there is no gravity the forces involved are the force from the cup impinging on the tether, and the tension in the tether.
The cup always wants to move in a straight line, and the tether wants to keep its length the same. The centrifugal force in this scenario is the cup pulling on the tether. The centripetal force is the tension of the tether pulling the cup.
Even if there is no gravity, these will still exist. In fact, this is the very reason why in 2001: 'A Space Odyssey' the ship is shaped like a ring, to create an artificial gravity environment. |
How do you derive the formula for the modulus of a complex number?
It's a definition. A useful one. It is the same as you would get if you consider the complex plane a regular 2D plane. In other words: if you draw the complex plane on paper the complex modulus will be the same as the distance from the origin to which ever complex number you're talking about. |
I live on 3rd floor, I leave some food for a few days.. suddenly there are ants. How the hell do ants locate the food and they know to come? Do they have scouts in every building?
Yes, the ants have scouts. Foraging ants will go out from the colony to scout for sources of food. When an ant finds a food source, it will turn around and return to the colony, leaving a trail of pheromones. These pheromones allow other ants to pick up the trail and find the food source. With every ant that uses the trail to get to the food source and back again, the level of pheromones is increased, making the trail more and more noticable for other ants in the colony. If the path becomes blocked or the food runs out, the ants return without food and don't leave any pheromones, which causes the trail to slowly dissipate. This collective pathfinding behaviour of ants is quite fascinating. It also has applications in fields such as computer science. The so-called "Ant Colony Optimization" algorithm is an algorithm that mimics the behaviour of an ant colony that is trying to find the best path to a food source in order to solve pathfindings problems (or problems that can be translated into a pathfinding problem). |
Where does nature break down and choice of movement begin in microscopic creatures?
On the atomic level, everything is just chemical reactions. At what point do these start turning into choices. For instance, On the cellular level, do they choose how their flagella spin to move? Do Viruses choose which cells to invade? Do they actually control their movements at that small of a scale or what?
I'm going to share some of what I picked up in two quarters of biochemistry. The TL;DR is that when you're talking about things like cells, viruses, even organ systems, it's about feedback and feedback loops. A happens, A causes B, B causes C through G. On a cellular level, there is guidance to what happens, but not perfect control, and not conscious control. Proteins have sequences that fold in predictable manners governed by thermodynamics. These proteins can be changed by reactions with other proteins, processed and altered, but reactions in the cell are still chemical reactions that depend on energy sources and favored directions of reaction. A lot of these things are controlled by moving compounds around in the cell, but again this is accomplished with specific pathways. Keep in mind that all of these processes are not accomplished by conscious choice, but by proteins, membranes, and other molecules that function according to the laws of physics. Our genetic code orchestrates all of this, but you can be sure that a strand of DNA isn't thinking, it's simply being read and transcribed. Our bodies do a magnificent job of keeping us from reaching equilibrium, but the cells make no choices about it. Viruses don't choose what cells to infect, they move around the body and then they come in contact with the right type of cell and they attack. Your stomach doesn't choose to digest certain proteins, it releases enzymes that degrade the proteins that they contact. |
If I were standing on Mars, would I be able to see the Earth and the Moon as two separate celestial bodies?
Assuming that Earth is about the closest to Mars it can get. And if it wouldn't be possible , how strong would my telescope have to be to see them separately? Edit: I mean with the naked eye
There's a lot of non-answers on here, so let me step in. The distance from the Earth to the Moon is 385,000 km. According to Wikipedia, the closest Earth and Mars get in a given orbit is between 54 and 103 million km. Let's take the close value, 54 million. The angular distance between the Earth and Moon in the Martian sky is therefore artan(385000/54000000)=24.28' arcminutes. The full moon is between 29 and 34 arcminutes depending on some factors. So, the distance between the Earth and the Moon, as seen from Mars, is just a bit under the diameter of the full Moon as seen from Earth - certainly far enough apart to distinguish them in the night sky. And yes, they would absolutely both be visible, just as Mercury is visible from Earth, even though it's similar to the Moon. |
Why would 1.5 billion year old zircon crystals contain more helium than expected in radiometric dating tests?
This is a and I decided to hold off for a few days to save it for my cake day. Please avoid having this turn into a religion vs science debate so that the wonderful mods don't get mad at me. The research from the group Radioisotopes and the Age of The Earth (RATE) makes the claim that far more Helium is found in 1.5 billion year old zircon crystals in granite than expected when performing Uranium based radiometric dating. Suggesting ages more along the lines of 6,000 years. Is there too much Helium found in Uranium dating? If so, why?
Yay I do research on zircons so allow me to take a stab at answering this question: The reason Uranium-Lead dating works so particularly well in zircons is because when the zircon forms it will take (practically) zero lead into its structure because lead is so uncomfortable in the crystal lattice. It does however love to take on Uranium so there is enough to produce a date. This leads us to a simple point independent of helium production and systematics. If you have a zircon with some lead in it there is really only one way for that lead to get there and that is via radioactive decay. Uranium-Lead dating is no longer used to refer to just one dating scheme but usually 3. When we do U-Pb dating in our lab we produce data that allows for 206Pb/238U ages, 207Pb/235U ages, and 207Pb/206Pb ages. In a zircon that has not been exposed to high temperatures (which means little to no lead loss) those three ages will agree. That means if the decay constants are wrong and Earth is 6000 years old those decay constants would have to be wrong by exact amounts in order for those ages to work out correctly. Also we do not measure He when doing U-Pb dating because there are better ways to error check our results without using He (also measuring He is tricky our instrument (a SIMS) can't even measure it). Now you might say well what about lead that is contaminating your zircon or formed in it for some unlikely reason, do you have a way to say how much there is of that? Yes it's called a common lead correction and it uses the isotope of lead that is not produced by radioactive decay (204Pb). Just looking at some data I took last week most of my samples had 99%+ of their lead from radioactive decay so this correction is usually not a huge deal. Now if you're wondering why I've spent so much time not talking about helium it's because helium is really complicated to talk about and U-Pb dating can be defended without even considering it. Helium is indeed a small atom that likes to diffuse but that diffusion is dependent on temperature and the distance it has to go is a function of crystal size and location of the atom from which it decayed. Now the reason for higher retentivity could be A) lower temperatures or B) a larger zircon. Pb losses do not happen until really high temperatures (north of 700C) and He will be lost earlier so if it is not this suggests the sample sat at low temperatures it will retain more He. The big gripe I have however is that calculating total U and Pb in order to calculate how many decays happen is difficult because measuring the volume of a zircon is usually not done. The volume is usually assumed based off the length and width and the best shape that fits it. This usually works out OK for regularly shaped samples (ie nicely grown zircons) but it introduces some fairly large error bars in the estimated total He generated which would cast doubt on a simple interpretation. It also does not work and presents problems if the grains get broken up or have a very irregular shape! Finally, I sort of hinted at it above but there is actually a thermometer called (U-Th)/He thermochronology which gets you the temperature and length of a heating event (with some assumptions). I can post a link to a paper on this if anyone is interested. Just as a side comment finding an issue in one sample of zircons is not an impressive feat. I would guess U-Pb dating zircons is one of the most popular things for geochronologists to do and every year over 100k get dated. The issue I've left out of course is if this specific sample had some problem because I would need to read more about it. I hope that helps. |
You have been transported to a planet somewhere else in the Milky Way. Is it possible to deduce where you are in relation to Earth? If so, how would you do it, and what equipment would you need?
Yep! By using pulsars as beacons. Each pulsar has a very particular spin period, no two are exactly the same and we know them to very precise values. We know accurate distances to relatively few of them, but enough that by identifying the positions of these pulsars on the sky, we could accurately determine our 3D position in the Milky Way by triangulation. This idea has been tested by NASA already (but only locally). |
When someone is diabetic, does that mean their bodies don't have the ability to produce insulin or is it their brains that don't give the signal to produce insulin?
Roughly speaking, type 1 generally means that their pancreas does not produce enough insulin and type 2 generally means that the body cells are resistant to insulin. Brain signals aren't part of the hormone regulation. |
How does your adrenal gland "know" that you are scared and that it should release epinephrine?
Edit: Sure, the brain sends a signal to the adrenal gland. But how does the gland "know" that this signal means "oh, you should release more adrenaline now"?
The section of the adrenal gland that secretes adrenaline is the adrenal medulla. The adrenaline-releasing cells there are the chromaffin cells. Nerve cells from the central nervous system (brain and spinal cord) extend to the medulla and "synapse" with the chromaffin cells ("synapse" just means that the end of the nerve cell is next to the chromaffin cell). When an action potential (i.e. a "signal" or "impulse") travels along these nerve cells, it causes a chemical called ACh to be released at the synapses. This chemical then binds to receptors on the outside of the chromaffin cells, causing them to release adrenaline into the blood. Sorry if this explanation is a bit ELI5 - alternatively feel free to ask if it's not ELI5 enough! |
Why are there more incidences of cancer in developed nations.
Source:
Better medical care means better documentation of cancer. It's not that developing nations don't get cancer, it's that, with all the shit going on there, knowing who has cancer is the least of their worries. |
When someone donates a pint of blood, how long does the body take to replace it? Are there any health advantages to donating blood? Does it lower blood pressure directly afterwards?
Are there any health advantages to donating blood? One of my uncles has to attend an outpatients clinic once a month to have a pint of blood taken from him. He suffers from a condition known as haemochromatosis which means the iron levels in his blood are higher than in an average person. The treatment help to mitigate the negative effects. The blood is unsuitable for transfusions though as AFAIK it's destroyed. |
Did whales and hippos inherit aquatic birth from a common ancestor, or did they each evolve it separately? And why do some marine mammals, like sea otters, have aquatic birth, but others, like seals and sea lions, don't?
Did whales and hippos inherit aquatic birth from a common ancestor, or did they each evolve it separately? They come by it seperately And why do some marine mammals, like sea otters, have aquatic birth, but others, like seals and sea lions, don't? This is going to come down to some combination of physiology and ecology: is it safer to give birth on land or in the water? Are you of giving birth on land or in the water? I'll note that sea otters are capable of giving birth on both land and in the kelp. |
What happens when water condenses on a hydrophobically coated object?
E.g. Spray a bottle of beer with neverwet, stick it in the fridge for a while then take it out in a high humidity climate. Does the water precipitate on the bottom and slide off quickly? Edit: It might behoove me to ask if the shape of the object matters e.g. a glass sphere vs something irregular like a small metal statue.
Hydrophoby is related to wetting angle, it is not pushing water away like magnet pushing metal. If the object is very hydrophobic, water forms more round droplets rather than splashes, and so it would form droplets and very likely fall/roll off the surface. This is how some plants leaves, such as aloe, are cleaned.
You can find more abt it here:
https://en.wikipedia.org/wiki/Superhydrophobe |
Does modern day cryogenics keep the body intact, or does it irreparably destroy the body?
modern day cryogenics is, sadly, something used to steal money from rich people such as Walt Disney. Like throwawydow has said, cells are damaged by freezing. In the laboratory we have products such as DMSO and glycerol which we use to stop cells from freezing conventionally when at very very low temperatures (such as -80°C) but when you are unfreezing mammalian cells, about 80%-90% of them die. Also DMSO is not good for you so we can't really put that in people or they will get sick. Plus it smells like rotten cabbage. (I don't think it is 100% toxic, but it certainly does make dangerous chemicals which would otherwise be safe, much more permeable to our skin). Tl;dr yes it appears to irreparably destroy the body. |
If inflammation is the body's immune response to an injury--why is it recommended to reduce inflammation with ice/NSAIDS?
Pretty much all in the title. When I injure a muscle or tendon the first recommendation I come across is to ice the area / take a non-steroidal anti-inflammatory drug (ibuprofen!). Are these simply to reduce the symptoms of pain? or do they actually promote healing?
Tendons and ligaments tend to have very little blood supply naturally (which is part of why they take so long to heal). Inflammation can create pressure which hampers what blood supply there is and can lead to a further hypoxic injury of the tissue. As for why we have evolved this way, I could only speculate, so I won't. I hope someone else might be able to explain what benefit the inflammation response to trauma gives us. Reduction of blood loss? I promised I wouldn't... |
What type of hardware is used to render amazing CGI projects like Avatar: Way of the Water? Are these beefed up computers, or are they made special just for this line of work?
I have previously worked in video effects post-production but I have had no involvement in the production of either 'Avatar' movie and have not seen 'Avatar 2': Fundamentally you could use any sort of commodity computer to render these effects, but the more powerful it is the quicker it can work. Even for the most powerful computers with the best graphics ability available you may still be looking at it taking many hours to render a single frame. If your movie is 24 frames a second and it takes, say 20 hours to render a frame, you can see that it soon becomes impractical to make and tweak a good visual storyline in a reasonable amount of time. Enter the render farm: here you have a render farm and a job manager that can split the work out and send different parts of it to different computers. You might even split each single frame into different pieces for rendering on different computers. This way you can parallelize your work, so if you split your frame into 10 pieces, rather than it taking 20 hours to render it will take 2. Your job manager also needs to take account of what software, with what plugins, and what licences is available on each available node (computer in your render farm) and collating the output into a finished file. If you have a lot of video effects in your movie, you are going to need a lot of computer time to render them, and for something that's almost entirely computer generated, you're going to need a massive amount of resources. Typically you will want to do this on a Linux farm if you can because it's so much simpler to manage at scale. If you want to find out more about some of the software commonly used, you could look up: nuke studio Maya Houdini Deadline These are just examples, and there are alternatives to all of them but Maya and Houdini would commonly be run on both workstations and render nodes to do the same job |
If a person loses their dominant hand, will their other hand ever gain the dexterity of the lost limb?
On a related note, if somebody is born without the hand that would otherwise be dominant due to a birth defect, will their remaining hand be clumsier than normal? Does that question even make any sense? Thanks, experts!
this is an empirical question, not a theoretical one, because dexterity is defined empirically. and because of the limited number of people to which it applies, anecdotal evidence is appropriate. a friend of mine had his right arm badly injured in a car accident when he was a kid. so he had to start doing almost everything left-handed. a decade later, he was very proficient, but you could still clearly tell that he wasn't as dexterous (even as, say, an 8 year old using their natural hand). writing, typing, eating, you name it. of course practice makes you much better. but to me this is explicit evidence that one does not fully gain the dexterity of their original dominant hand. no amount of other people who might have gotten slightly better can disprove this empirical observation. edit: to the mods: unless you understand why it's inappropriate to use a fixed effect statistical analysis on data of this nature, you shouldn't be removing this comment for being anecdotal. |
Is it possible to reverse the reaction in a glow stick so you could make one that was reusable?
In principle, sure. There's no reason a reversible chemiluminescent system can't be developed. However, I don't know of any that lend themselves to easy regeneration after the light-producing reaction has occurred. |
Is there a smallest unit of time?
I was thinking about time, and how we are affected by things around us like gravity, and how everything happens in "realtime" Is there a shortest period of time that something (anything) can happen? Edit: I understand Plankt time now. But am still very curious if there is a "smaller" period of time that something can happen in. That a force (like gravity) can affect something. Or if it is all truly in real time.
No - not as far as we know. The Planck time is often mentioned in this context - that is roughly the scale at which our understanding of physics breaks down. We aren't sure what, if anything, happens during time intervals that short. But there is no consensus on whether it is the shortest time interval . |
When astrophysicists say that a planet is the same size as Earth, do they mean in terms of mass or in terms of diameter?
Well, you probably won't catch an astrophysicist using a term as vague as "size," particularly not in a research paper - scientists will be specific when talking about radius, mass etc. But when these things get reported out and covered outside the primary literature, the word "size" can indeed mean different things. Ultimately, you have to read the context to see what they're talking about. There's another term that might give you context, though: "Earth-like." If a planet is referred to as Earth-like, or something similar, it generally means it's comparable to Earth. The makeup (rocky, like Earth, not gaseous like Jupiter), density and diameter will be comparable to that of Earth. They might call it a "heavy" Earth, which means it's comparable in density, but with significantly more mass, which means it's going to have a higher diameter. |
How is it that pathogens with very high mortality rate don't go extinct simply by the fact that they kill their victims before they can spread it to others?
If it still exists it means it was able to find new hosts. Some are very contagious and able to contaminate others before the death, others can spread from cadavers, others can survive in the environment (air, water, ground...) and many have animal hosts. Rabies have animal hosts, for example. Tetanus survive on the ground, cholera spreads via water, Yersinia pestis (the plague) and anthrax have survival forms wich helps them survive without hosts for decades. |
What determines a sapphire color?
Sapphire is made up of a lattice of aluminum atoms and oxygen atoms, but it's really hard to get a pure lattice, and sometimes other metal atoms get mixed in. All these metals interact with light in different ways, and the result is a variety of colors. If there's chromium, then the stone will appear red. If there's vanadium, then the stone will appear purple. If there's titanium, then the stone will be colorless. If there's iron, then the stone will be pale yellow to green. Surprisingly enough, if both titanium and iron impurities are present together in the right proportions, the stone will be deep blue! |
Why do NSAIDS antagonize THC effects?
By personal experience, anecdotical evidence and I know that Non steroidal anti inflammatory drugs like aspirin and iboprufen antagonize THC effects. In other words they sober you up very fast. Can anyone here explain me why they do it? Thanks, guys.
I'm going to try and make this is as coherent as possible...but it's tricky. THC does its thing by binding to a cannabinoid receptor (CB1), which is where most of the high comes from. The reason why you have cannabinoid receptors in the first place is that you have an endogenous cannabinoid system, with anandamide being the main poster child of that. Anandamide is derived from phospholipds (arachadonic acid). NSAIDs block the enzyme cyclooxygenase (COX), which normally makes prostaglandins that have roles in inflammation/fever/etc. Prostaglandins are derived from arachadonic acid, similar to anandamide. Therefore, the systems definitely share a common denominator and probably have lots of complicated interactions. Your article linkes to this: study . Apparently cannabinoids like THC cause induction of arachidonic acid and create prostaglandins and somehow they aid in the 'high'. This article says that chronic THC alters the cyclooxygenase system, decreasing the potency and efficacy of NSAIDs used. I'm assuming this works in reverse, but it's most likely a very, very complicated interaction depending on how often you smoke. |
Where does breastmilk come from and where does it come out of on the nipple?
Breast tissue contains specialized cells calls lactocytes that take in nutrients from the blood, and secrete milk into a spongy network of tubules (very similar in structure to your lungs' network of bronchioles and alveoli, but in reverse) that store and transport milk. These tubules all meet up at the nipple, via approximately 20 milk ducts per nipple. The ducts themselves don't do anything unusual, although they do have protective cells nearby (Montgomery glands) to keep them plugged and lubricated with an antibacterial oil when not in use. Edit: Need to buy a thesaurus. |
Without an alarm or other external source for waking us up, what prevents our brains from being asleep forever?
You have a really complicated internal clock called your circadian rythym that helps you know when to sleep and wake up. In short you have neurons that run in a loop, activating and deactivating themselves (a bit like a Redstone clock actually if you play minecraft), and similar proteins too that inhibit their own production so they come in waves. Essentially, using these complicated systems and synchronizing them frequently with light and other stimuli, your body can determine when to sleep, when to wake up, how to regulate temperature, and so on. This system would wake us up after about eight hours of sleep by stopping melatonin, and increasing seratonin, dopamine, acetylcholine, and norepinephrine production. Without the external cues though our body has a tendency to drift from 24 sleep cycles to slightly longer cycles (anywhere from 15 minutes to several hours longer, depending on the study.) |
AskScience AMA Series: I'm Kevin Esvelt, head of the Sculpting Evolution group at the MIT Media Lab and an inventor of CRISPR gene drive - AMA!
Hi, my name's Kevin Esvelt and I'm a scientist working on molecular, evolutionary, and ecological engineering. I played a very minor role in developing CRISPR genome editing and was evidently the first to realize it could be used to build gene drive systems capable of engineering populations of wild organisms. If you haven't read about gene drive - and even if you have - I highly recommend reading this by Dylan Matthews of Vox. Relatedly, I'm a strong advocate of more open science, beginning with as a small and high-profile field trial of pre-registration in tech development. Finally, we in try to carefully consider our and publicly . We'll be on at 2pm eastern (19 UT) - AMA! EDIT: Last Week Tonight with John Oliver did a about this just last night! EDIT #2: Our guest needs to take a break, but will be back later tonight to answer many more questions.
What are your thoughts on the movement to make all scientific publications open to the general public? Would this be useful or does a lack of contextual knowledge make it better to force inclusion of experts/scientists? What should a scientists role become if all publications were made freely available? |
How much time will it take for the CMBR to cool to radiowave frequencies? Won't this have an effect on free electron spins?
If free electron spin is affected by radiowaves, then won't they be affected by what is at some point a cosmic radiowave background radiation?
There isn't really that sharp of a line microwaves and radio waves - the EM spectrum is a continuum. CMB peaks at 160 GHz, RF generally speaking extends from 300 GHz down to a few kHz. In this sense, the CMB is already 'radio waves.' But maybe if you want to call anything above 3 GHz a microwave, then you'll have to cool the universe by another factor of 50ish. Let's make a really rough estimate for how long this takes, assuming a constant expansion rate. It took 13 billion years for the universe to expand to its current size, so it will take another 13 billion to double in size, thus cutting the CMB temperature and (frequency) in half. As an approximate rule of the of thumb, this means that every time you double the age you cut the frequency in half. Since 2 ~ 50, then we will need to wait about 5.5 times the current age of the universe for the CMB to shift down by a factor of 50. That's an ~70 billion year wait. Don't hold your breath. |
Can we actually see electrons, or do we just see the air being heated up when we see electricity?
Whenever you see something, what is happening is that the object is emitting a photon that hits your eye. So if by "seeing" the electrons you mean seeing the photons emitted by electrons then yes we do see electrons. However, its worth noting that basically everything you see in your daily life is from photons being emitted by electrons. For instance, how a mirror works is a photon will hit a silver atom and transfer it's energy into one of the valence electrons. However this excited state is unstable and the excited electron will release that extra energy by emitting another photon. So the light that we say is "reflected" by a mirror is really just photons being emitted by electrons on the mirror. |
A Brotherly Debate 1: How do I explain evolution to my stubborn brother.
http://www.talkorigins.org/faqs/evolution-fact.html is a good source for highlighting the difference between facts and theories if he is hung up on that definition. If he doesn't understand the mechanism of gradual change, I've found this to be a helpful visual aid. http://4.bp.blogspot.com/-i94qZqIJolY/TcNdIM9emkI/AAAAAAAAALY/8dACHdxg6MM/s1600/the+difference+between+micro+and+macro+evolution.jpg |
When you taste something sweet after eating another sweet thing, the second thing doesn’t taste as sweet. Is that due to the taste receptors themselves not firing as often or is it your brain filtering out the signal?
Also when you eat something salty and then other flavors are more intense, is that physiological or psychological?
By "psychological" I'm assuming you mean further upstream in the sensory pathways. On this timeframe, it's mostly sensory adaptation. Which is physiological. The receptor cells essentially get fatigued and don't respond as strongly to a second stimulus. On a longer timeframe, it would be more psychological. For example, if you eat a lot of salty food for a few weeks, you would habituate to salt. So a salty stimulus would not taste as salty as before your salt binge. I'm not sure you could rule out some contribution from sensory adaptation in this case though. There could well be longer term changes at the receptor level too. |
How likely is it that we will be able to manipulate/create wormholes for space travel?
I feel like it's the only solution to the fact that we can't travel faster than light.
There are two ways to solve the Einstein field equation. You can either start with a description of the matter, energy, momentum, fields and so forth over a region of spacetime then solve for the resulting geometry, or you can start with an arbitrary geometry and solve for the stress-energy tensor. Wormholes arise when you do the second thing: start with an arbitrary geometry and interrogate the equation to see what configuration of stress-energy could produce it. In this case, the answer to that question is "none." There is no possible configuration of stress-energy that could lead to a wormhole geometry. Wormhole solutions are interesting mathematically, not physically. In other words, no. |
Why does my biology teacher tell us that the formation of bonds between atoms stores energy and the breaking of them releases it, when my chemistry teacher tells us the opposite?
The chemistry teacher just says that the biology teacher is wrong, but there has to be a reason why it's taught.
The chemistry teacher is 100% right, and the biology professor is half-right. Regardless of the bond (meaning, an attraction between atomic fragments), breaking it will require an energy expenditure and forming it will release energy. It is true that you can store energy in the form of high-energy (less stable) bonds, but breaking them doesn't release the energy. The energy release comes from the net chemical reaction that produces , more stable bonds to replace the less stable ones in the starting materials. Despite being one the most fundamental concepts in chemistry, it is generally not appreciated by people who likely only took general and organic chemistry (which includes most biologists). This tends to propagate the misconception that ATP releases energy when the phosphoester is broken. |
What was the atmosphere like when dinosaurs existed? Could humans have breathed the air?
There are no direct measures of atmospheric oxygen from that period. There are a few ideas out there about potential ways to determine atmospheric O2 concentration that far back in time. They are: Stomatal density of fossil leaves; stable carbon isotope ratios of soil carbonates (pedogenic carbonate); stable carbon isotope ratios of fossilized amber; and numerical mass balance modeling. There's a pretty decent review of all these here (Tappert et al., 2013). The proxy record of oxygen history (with big, big error bars and caveats in mind) is that atmospheric O2 was ~10% (% of the atmosphere, today it is 21%) until 70 million years ago, when it jumped to 15%. Around 50 million years ago it fell rapidly to 10% again, before slowly increasing over the past 50 million years to the present value of ~21%. The mass balance model indicates that atmospheric O2 began slowly increasing from 10% to modern values about 140 million years ago. So, at the beginning of the Cretaceous, oxygen was 10%, and at the end of the Cretaceous, oxygen would have been close to 15%-17%. I'm not sure what human tolerance for oxygen is (not very scientific google searching revealed 19.5% as the minimum amount for breathing, but I don't know if that's right!). Hope this helps! |
Will humans one day be able to create a robot with ai that is conscious and self aware?
I've been reading up on articles such as the simulation argument, and wonder if we will get to the point where we will fully understand the workings of the human brain. I've seen plenty of statistics that say in years to come we will have the ability to create computers with greater computing power than the human brain but this says nothing for being self aware or having conscious thought |
Can elastic deformation become plastic with time?
For example, if a straight metal bar was deflected so that it was elastically deformed, is there any process that could lead to the bar not returning fully to its original state if it had been left deflected like that for a large period of time? I'm interested in both reasonably common external factors, and internal factors (imagining that the bar was kept in a perfectly controlled environment at standard pressure, temperature, etc).
Materials can suffer "creep", which is slow plastic deformation over time. Rate of creep is mostly governed by temperature (and stress, of course). Most metals don't show appreciable creep at room temperature, and need to be heated to a significant fraction of their melting temperature before it becomes a problem. Thermoplastic plastics will creep at low temperatures, thermoset and heavily crosslinked rubbers will generally not. |
Why is cancer dangerous? Whats the problem with having uncontrolled division of cells? How does that pose a problem?
It depends on the organ and location of cancer. Keep in mind "cancer" is not a single disease but many different kinds, with different mortality rates. The danger can be from mechanical compression, metabolic changes, or combination of both. Brain cancer, for example, expands in a confined space, and will cause increased intracranial pressure. Compression on other parts of the brain can cause neurological, neuromuscular changes. Leukemia is a cancer of white blood cells where immature and non-functioning white blood cells proliferate and crowd out the bone marrow. The person becomes susceptible to infections due to lack of functioning immune cells. Because red blood cell and platelet productions are also affected, there will be anemia, bruising/bleeding as well. Liver cancer causes a whole slew of metabolic issues because of the many important functions of normal liver in our body. Normal liver metabolizes chemicals (we often say it "detoxifies"), produces proteins that help blood clot, produces bile that helps digestion of fat, and stores glycogen for regulating blood sugar level. As cancer progresses, all these functions are lost. If cancer is advanced and metastasis occurs where cancer cells break off from original location and seed in distant organs, now you have multiple non-functioning organs. |
Why do we believe that a planet needs to have water for aliens to survive?
I know this might sound a bit crazy but. Why is it that we are always looking for water or oxygen? Surely there must be a way for an organism to live without these two blocks and they may be able to substitute for them. I don't understand the saying "without water there is no life on other planets" Getting PMs that are saying only ignorant people say this well reddit your hero says it as well : What renders a planet, indeed, suitable for life? Well, clearly, you want a planet that has some water on it, because water is the cocktail mixer that allows the chemistry of our bodies to even work. : If we want a planet with liquid water, then it can't be too close to its star; that would make it too hot, and the water would boil away. And it shouldn't be too far away, either; too cold, and you'll likely get an ice ball.What everybody really wants to find is a little rocky planet, whose distance from its star is juuust right, a "Goldilocks" planet with oceans of liquid water. But hunting down a planet just like ours has been a daunting task. In fact, not long ago, we hadn't found any planets beyond our solar system, none at all. They're so far away and so dim, they get lost in the glare of their own suns, the stars they orbit. Source :
We don't believe that a planet needs to have water for aliens to survive. We do know that all lifeforms we have ever encountered need water to survive. We therefore (with only one piece of data) look for what we know. Say, as an analogy, you found an unlabeled cardboard box on the street and somebody told you that there was at least one apple in it. Would you guess that the box contained mostly apples or at least mostly fruit or foodstuff, or would you guess that the box contained lightbulbs or pencils or and someone just happened to drop an apple in? This is why we look for apples and things like apples (i.e. water) instead of looking for something we don't even know what it looks like. |
Do plug-in electric vehicles have a smaller carbon footprint than hybrid vehicles?
Except that burning fossil fuels at one large, efficient plant generates less carbon than burning fossil fuels in many small, inefficient plants. |
If temperature is the average speed of particles, why is there "wind chill" and not "wind warmth"?
Forgive my ignorance, but I would think that if it were windy, that would mean that you would be feeling particles hitting you at a much faster average speed than if there were no wind. So why does it actually feel colder, instead of warmer? And does this effect only apply to air that's already cold? If hot enough air blows at you, will it feel warmer than it would if it were stationary, for instance?
From a previous post : When it's windy, it feels colder because normally in still air your body will heat up air that is semi-trapped around your skin; the more the air heats up, the less heat you are losing and the warmer you feel. When it's windy, the air doesn't linger around your skin, and is constantly replaced by cool air. Therefore, you are always losing heat and do not manage to warm the air up. Also, there might be an effect of greater evaporative cooling; most quickly moving air would prevent a local saturation of water vapor and allow you to lose more heat through increased evaporative cooling. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.