content
stringlengths 7
2.61M
|
|---|
Human blood lactate and ammonia levels after supramaximal uphill and downhill running. The purposes of this study were 1) to confirm whether there is a difference in the levels of blood lactate and ammonia after supramaximal uphill and downhill running for the same short duration and 2) to examine the relationship between peak blood lactate levels and work/lean body mass (LBM), as well as the relationship between peak blood ammonia levels and work/LBM following supramaximal uphill and downhill running. Eight healthy, untrained male subjects performed supramaximal uphill and downhill running on a motor-driven treadmill for about 70 sec. Though there was a significant difference (p < 0.05) in running speed and work/LBM between supramaximal uphill and downhill running, no significant difference was found in exhaustion time or heart rate. Both the peak blood lactate and ammonia concentrations were significantly lower after downhill running than after uphill running (p < 0.05). Although there was no significant relationship between peak blood ammonia levels and work/LBM following either uphill or downhill running, significant linear relationships between the peak blood lactate levels and work/LBM were observed following uphill running (r = 0.74, p < 0.05) and downhill running (r = 0.72, p < 0.05). These results suggest that the differences in the blood lactate and ammonia concentration between supramaximal downhill and uphill running of the same duration may be due to the total recruitable muscle mass during exercise, and that peak blood lactate can be used as an index of anaerobic work capacity for untrained subjects under these running conditions.
|
#include <iostream>
#include <boost/thread.hpp>
#include "server.h"
#include "mulawdecoder.h"
#include "mulawencoder.h"
Server::Server() :
serverAddress(getIP()),
serverPort(8001),
acceptor(service, tcp::endpoint(serverAddress, serverPort)),
buff(5),
runningFlag(true),
backgroundFlag(true),
incomingCallFlag(false),
otherServerReady(false),
socket(new tcp::socket(service))
{
std::cout << "Server started on " << serverAddress << ':' << serverPort << std::endl;
constructDecoder();
constructEncoder();
}
Server::Server(std::string & address, uint16_t port) :
serverAddress(boost::asio::ip::address::from_string(address)),
serverPort(port),
acceptor(service, tcp::endpoint(serverAddress, serverPort)),
buff(5),
runningFlag(true),
backgroundFlag(true),
incomingCallFlag(false),
otherServerReady(false),
socket(new tcp::socket(service))
{
std::cout << "Server started on " << serverAddress << ':' << serverPort << std::endl;
constructDecoder();
constructEncoder();
}
Server::~Server() {
destructEncoder();
destructDecoder();
}
boost::asio::ip::address Server::getIP() {
try {
boost::asio::io_service io_sr;
udp::resolver resolver(io_sr);
udp::resolver::query query(udp::v4(), "google.com", "");
udp::resolver::iterator endpoints = resolver.resolve(query);
udp::endpoint ep = *endpoints;
udp::socket socket(io_sr);
socket.connect(ep);
address addr = socket.local_endpoint().address();
return addr;
}
catch (std::exception& ex) {
std::cerr << "Couldn't get your IP for server, please check your internet connection and re-run program" << std::endl;
std::system("pause");
std::exit(-1);
}
}
bool Server::getIncomingCallFlag() const {
return incomingCallFlag;
}
bool Server::getRunningFlag() const {
return runningFlag;
}
bool Server::isOtherServerReady() const {
std::lock_guard<std::mutex> lock(mut);
return otherServerReady;
}
uint16_t Server::getServerPort() const {
return serverPort;
}
uint16_t Server::getClientPort() const {
return clientPort;
}
std::string Server::getClientAddress() const {
return clientAddress;
}
void Server::stop() {
acceptor.cancel();
}
void Server::disableIncomingCallFlag() {
incomingCallFlag = false;
if (socket->is_open()) {
socket->close();
socket.reset(new tcp::socket(service));
}
}
void Server::disableRunningFlag() {
runningFlag = false;
}
void Server::endCall() {
runningFlag = false;
}
void Server::sendResponse() {
socket->send(boost::asio::buffer("ok!"));
}
void Server::handleConnection() {
char buffer[16];
while (backgroundFlag) {
boost::system::error_code ec;
acceptor.accept(*socket, ec);
if (ec) return;
size_t bytes = socket->read_some(boost::asio::buffer(buffer, 16), ec);
if (ec) {
socket.reset(new tcp::socket(service));
continue;
}
if (std::strncmp(buffer, "call", 4) == 0) {
clientAddress = socket->remote_endpoint().address().to_string();
auto str = std::string(buffer, bytes).substr(5, bytes - 1);
clientPort = std::stoul(str);
incomingCallFlag = true;
std::cout << "Do you want to receive call from: "
<< clientAddress << ':' << clientPort << '\n'
<< "yes(1) or no(2)"
<< std::endl;
break;
}
if (std::strncmp(buffer, "ready", 5) == 0) {
otherServerReady = true;
break;
}
}
runningFlag = true;
}
void Server::handleCallData() {
PaStreamParameters outputParameters;
PaStream* stream;
PaError err = paNoError;
AudioBlock block;
runningFlag = true;
err = initializeAudio();
if (err != paNoError) {
terminateAudio(err);
return;
}
err = initializeOutputAudio(outputParameters);
if (err != paNoError) {
terminateAudio(err);
return;
}
boost::thread t(&Server::playback, this, stream, std::ref(outputParameters), std::ref(err));
uint8_t *encodedBuffer = new uint8_t[block.blockSize];
while (runningFlag) {
size_t bytes = socket->read_some(boost::asio::buffer(encodedBuffer, block.blockSize));
sendResponse();
if (bytes < 10 && (std::strncmp((char*)encodedBuffer, "end", 3) == 0)) {
disableRunningFlag();
continue;
}
muLawDecode(encodedBuffer, block.data, block.blockSize);
buff.write(block);
}
if (std::strncmp((char*)encodedBuffer, "end", 3) == 0) {
std::cout << "Call is ended, press 1 to continue" << std::endl;
}
sendResponse(); // Prevent the client from waiting before call ends
if (t.joinable())
t.join();
terminateAudio(err);
otherServerReady = false;
delete[] encodedBuffer;
socket->close();
socket.reset(new tcp::socket(service));
}
void Server::playback(PaStream *stream, PaStreamParameters &outputParameters, PaError &err) {
AudioBlock block;
std::unique_lock<std::mutex> lock(mut);
err = Pa_OpenStream(
&stream,
NULL, /* no input */
&outputParameters,
SAMPLE_RATE,
FRAMES_PER_BUFFER,
paClipOff, /* we won't output out of range samples so don't bother clipping them */
playCallback,
&block);
lock.unlock();
if (err != paNoError) {
disableRunningFlag();
return;
}
while (runningFlag) {
buff.read(block);
block.frameIndex = 0;
if (stream) {
err = Pa_StartStream(stream);
if (err != paNoError) {
disableRunningFlag();
continue;
}
while ((err = Pa_IsStreamActive(stream)) == 1)
Pa_Sleep(100);
if (err < 0) {
disableRunningFlag();
continue;
}
err = Pa_StopStream(stream);
if (err != paNoError) {
disableRunningFlag();
continue;
}
}
}
lock.lock();
err = Pa_CloseStream(stream);
lock.unlock();
}
|
// Licensed under the MIT license. See LICENSE file in the project root for full license information.
#ifndef CLDS_SINGLY_LINKED_LIST_PERF_H
#define CLDS_SINGLY_LINKED_LIST_PERF_H
#ifdef __cplusplus
extern "C" {
#endif
int clds_singly_linked_list_perf_main(void);
#ifdef __cplusplus
}
#endif
#endif /* CLDS_SINGLY_LINKED_LIST_PERF_H */
|
// Copyright (c) 2013, Facebook, Inc. All rights reserved.
// This source code is licensed under the BSD-style license found in the
// LICENSE file in the root directory of this source tree. An additional grant
// of patent rights can be found in the PATENTS file in the same directory.
#include "rocksdb/env.h"
#include "util/thread_status_updater.h"
#include "util/thread_status_util.h"
namespace rocksdb {
#ifndef NDEBUG
// the delay for debugging purpose.
static int operations_delay[ThreadStatus::NUM_OP_TYPES] ={0};
static int states_delay[ThreadStatus::NUM_STATE_TYPES] = {0};
void ThreadStatusUtil::TEST_SetStateDelay(
const ThreadStatus::StateType state, int micro) {
states_delay[state] = micro;
}
void ThreadStatusUtil::TEST_StateDelay(
const ThreadStatus::StateType state) {
Env::Default()->SleepForMicroseconds(
states_delay[state]);
}
void ThreadStatusUtil::TEST_SetOperationDelay(
const ThreadStatus::OperationType operation, int micro) {
operations_delay[operation] = micro;
}
void ThreadStatusUtil::TEST_OperationDelay(
const ThreadStatus::OperationType operation) {
Env::Default()->SleepForMicroseconds(
operations_delay[operation]);
}
#endif // !NDEBUG
} // namespace rocksdb
|
Chemical Imaging With X-Ray Scatter Diagnostic radiology is based on interpreting projection images of the scalar quantity known as the x-ray total linear attenuation coefficient. While this information is adequate in many cases, there are situations where more detailed knowledge (e.g. of the chemical composition of an organ) is desirable. Such information is precluded in principle when only transmission radiation is measured. It is shown that measurement of the angular variation of the coherent and Compton radiation scattered from a small sample allows the chemical composition of the sample to be determined. Using Hubbell's compilation of atomic form factors and incoherent scatter functions for the six commonest elements of the human body, scatter data have been simulated with realistic noise components for some representative compounds. Good agreement is obtained between the amounts of each element derived from fitting the scatter data and those used to generate the data. A scatter system for chemical imaging is proposed, based on a monochromatic pencil x-ray beam and detector arc, and incorporating translation and rotation movements as in first generation transmission CT. An iterative technique is described, analogous to those developed for SPECT, which allows the spatial and angular variation of the coherent and Compton scatter strengths to be reconstructed. Chemical imaging with x-ray scatter (CIXS) appears feasible as a technique to provide information for diagnostic radiology which is unobtainable by other means.
|
<gh_stars>1-10
package lpf.learn.leetcode.tags.hash;
import org.hamcrest.MatcherAssert;
import org.hamcrest.Matchers;
import org.junit.Test;
public class RepeatedDnaSequencesTest {
@Test
public void test1(){
RepeatedDnaSequences test = new RepeatedDnaSequences();
String[] expected = {"AAAAACCCCC", "CCCCCAAAAA"};
MatcherAssert.assertThat(test.findRepeatedDnaSequences("AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"), Matchers.containsInAnyOrder(expected));
}
@Test
public void test2(){
RepeatedDnaSequences test = new RepeatedDnaSequences();
String[] expected = {"AAAAAAAAAA"};
MatcherAssert.assertThat(test.findRepeatedDnaSequences("AAAAAAAAAAAAA"), Matchers.containsInAnyOrder(expected));
}
@Test
public void test3(){
RepeatedDnaSequences test = new RepeatedDnaSequences();
String[] expected = {"AAAAAAAAAA"};
MatcherAssert.assertThat(test.findRepeatedDnaSequences("AAAAAAAAAAA"), Matchers.containsInAnyOrder(expected));
}
}
|
import {expect} from 'chai';
import Pick from '../../src/utilities/Pick';
import {IProperties} from '../../../shared/models/IProperties';
import {extractMongoId} from '../../src/utilities/ExtractMongoId';
import {Types as mongooseTypes} from 'mongoose';
import {ensureMongoToObject} from '../../src/utilities/EnsureMongoToObject';
import {DocumentToObjectOptions} from 'mongoose';
import {Course, ICourseModel} from '../../src/models/Course';
import {ICourse} from '../../../shared/models/ICourse';
import {FixtureLoader} from '../../fixtures/FixtureLoader';
const fixtureLoader = new FixtureLoader();
describe('Testing utilities', () => {
describe('Pick', () => {
let input: IProperties;
beforeEach(function() {
input = {a: 0, b: 'b', c: [1, 2, 3], d: {e: 'f'}, e: {d: 'c'}};
});
it('should pick only certain attributes', () => {
const result: IProperties = Pick.only(['a', 'c'], input);
expect(result).to.eql({a: 0, c: [1, 2, 3]});
});
it('should pick certain attributes as empty containers', () => {
const result: IProperties = Pick.asEmpty(['a', 'c', 'd'], input);
expect(result).to.eql({c: [], d: {}});
});
});
describe('ExtractMongoId', () => {
const idAsObjectId = mongooseTypes.ObjectId();
const idDirect = {id: idAsObjectId.toHexString()};
const idDirect2 = {_id: idAsObjectId.toHexString()};
const idAsEmbeddedObjectId = {id: idAsObjectId};
const idAsEmbeddedObjectId2 = {_id: idAsObjectId};
const idString = new String(idDirect.id); // tslint:disable-line
const idExpect = idDirect.id;
const idArray = [
idAsObjectId, idDirect, idDirect2, // Valid
{}, // Invalid
idAsEmbeddedObjectId, idAsEmbeddedObjectId2, // Valid
1, // Invalid
idString, idExpect // Valid
];
const fallback = 'fallback';
it('should extract an ID from an ObjectID object', () => {
expect(extractMongoId(idAsObjectId)).to.eq(idExpect);
});
it('should extract an ID from an object with "id" or "_id" string property', () => {
expect(extractMongoId(idDirect)).to.eq(idExpect);
expect(extractMongoId(idDirect2)).to.eq(idExpect);
});
it('should extract an ID from an object with "id" or "_id" ObjectID property', () => {
expect(extractMongoId(idAsEmbeddedObjectId)).to.eq(idExpect);
expect(extractMongoId(idAsEmbeddedObjectId2)).to.eq(idExpect);
});
it('should return an ID String object as string', () => {
expect(extractMongoId(idString)).to.eq(idExpect);
});
it('should return an ID string without modifications', () => {
expect(extractMongoId(idExpect)).to.eq(idExpect);
});
it('should yield undefined for invalid input', () => {
expect(extractMongoId({})).to.eq(undefined);
expect(extractMongoId(1)).to.eq(undefined);
});
it('should return a specified fallback for invalid input', () => {
expect(extractMongoId({}, fallback)).to.eq(fallback);
expect(extractMongoId(1, fallback)).to.eq(fallback);
});
it('should only extract ids for valid objects in an array', () => {
expect(extractMongoId(idArray)).to.eql(Array(7).fill(idExpect));
});
it('should extract IDs for valid objects or return fallback values in an array', () => {
expect(extractMongoId(idArray, fallback)).to.eql([
idExpect, idExpect, idExpect, // Valid
fallback, // Invalid
idExpect, idExpect, // Valid
fallback, // Invalid
idExpect, idExpect // Valid
]);
});
});
describe('EnsureMongoToObject', () => {
// Before each test we reset the database
beforeEach(async () => {
await fixtureLoader.load();
});
it('should return the (ICourse) object without modification', async () => {
const course: ICourse = (await Course.findOne()).toObject();
expect(ensureMongoToObject<ICourse>(course)).to.eql(course);
});
it('should call the mongoose (ICourseModel) toObject function and return the result', async () => {
const course = await Course.findOne();
expect(ensureMongoToObject<ICourse>(course)).to.eql(course.toObject());
});
it('should call the mongoose (ICourseModel) toObject function with a transform option and return the result', async () => {
const course = await Course.findOne();
const options: DocumentToObjectOptions = {
transform: (doc: ICourseModel, ret: any) => {
ret._id = doc._id.toString() + '-transform-test';
}
};
const expectedResult = course.toObject(options);
expect(expectedResult._id).to.eq(course._id.toString() + '-transform-test');
expect(ensureMongoToObject<ICourse>(course, options)).to.eql(expectedResult);
});
});
});
|
#include "fft.h"
#ifdef DLIB_USE_MKL_FFT
#include "mkl_fft.h"
#else
#include "kiss_fft.h"
#endif
namespace dlib
{
template<typename T>
void fft(const fft_size& dims, const std::complex<T>* in, std::complex<T>* out, bool is_inverse)
{
#ifdef DLIB_USE_MKL_FFT
mkl_fft(dims, in, out, is_inverse);
#else
kiss_fft(dims, in, out, is_inverse);
#endif
}
template<typename T>
void fftr(const fft_size& dims, const T* in, std::complex<T>* out)
{
#ifdef DLIB_USE_MKL_FFT
mkl_fftr(dims, in, out);
#else
kiss_fftr(dims, in, out);
#endif
}
template<typename T>
void ifftr(const fft_size& dims, const std::complex<T>* in, T* out)
{
#ifdef DLIB_USE_MKL_FFT
mkl_ifftr(dims, in, out);
#else
kiss_ifftr(dims, in, out);
#endif
}
template void fft<float>(const fft_size& dims, const std::complex<float>* in, std::complex<float>* out, bool is_inverse);
template void fft<double>(const fft_size& dims, const std::complex<double>* in, std::complex<double>* out, bool is_inverse);
template void fftr<float>(const fft_size& dims, const float* in, std::complex<float>* out);
template void fftr<double>(const fft_size& dims, const double* in, std::complex<double>* out);
template void ifftr<float>(const fft_size& dims, const std::complex<float>* in, float* out);
template void ifftr<double>(const fft_size& dims, const std::complex<double>* in, double* out);
}
|
def process_item(self, item, spider):
writer = csv.writer(self.file, delimiter = '|')
for apartment in item["apartments"]:
row = [apartment["price"], apartment["size"], apartment["rooms"], apartment["address"], apartment["lat"],
apartment["lng"], apartment["zone"], apartment["band"], apartment["east"], apartment["north"],
apartment["date"]]
writer.writerow(row)
self.file.flush()
print("page {} processed.".format(item["page"]))
return item
|
package com.shareworx.ezfm.app.quality.service;
import java.util.List;
import java.util.Map;
/**
* 获取基础数据 service
*/
public interface AppProblemTypeService {
String ID ="appProblemTypeService";
List<Map<String,Object>> getAllProblemType(String crop,String lt) throws Exception;
}
|
import torch
import torch.nn as nn
from collections import OrderedDict
from utils import split_first_dim_linear
from config_networks import ConfigureNetworks
from set_encoder import mean_pooling
NUM_SAMPLES=1
class Cnaps(nn.Module):
"""
Main model class. Implements several CNAPs models (with / without feature adaptation, with /without auto-regressive
adaptation parameters generation.
:param device: (str) Device (gpu or cpu) on which model resides.
:param use_two_gpus: (bool) Whether to paralleize the model (model parallelism) across two GPUs.
:param args: (Argparser) Arparse object containing model hyper-parameters.
"""
def __init__(self, device, use_two_gpus, args):
super(Cnaps, self).__init__()
self.args = args
self.device = device
self.use_two_gpus = use_two_gpus
networks = ConfigureNetworks(pretrained_resnet_path=self.args.pretrained_resnet_path,
feature_adaptation=self.args.feature_adaptation,
batch_normalization=args.batch_normalization)
self.set_encoder = networks.get_encoder()
self.classifier_adaptation_network = networks.get_classifier_adaptation()
self.classifier = networks.get_classifier()
self.feature_extractor = networks.get_feature_extractor()
self.feature_adaptation_network = networks.get_feature_adaptation()
self.task_representation = None
self.class_representations = OrderedDict() # Dictionary mapping class label (integer) to encoded representation
self.total_iterations = args.training_iterations
def forward(self, context_images, context_labels, target_images):
"""
Forward pass through the model for one episode.
:param context_images: (torch.tensor) Images in the context set (batch x C x H x W).
:param context_labels: (torch.tensor) Labels for the context set (batch x 1 -- integer representation).
:param target_images: (torch.tensor) Images in the target set (batch x C x H x W).
:return: (torch.tensor) Categorical distribution on label set for each image in target set (batch x num_labels).
"""
# extract train and test features
self.task_representation = self.set_encoder(context_images)
context_features, target_features = self._get_features(context_images, target_images)
# get the parameters for the linear classifier.
self._build_class_reps(context_features, context_labels)
classifier_params = self._get_classifier_params()
# classify
sample_logits = self.classifier(target_features, classifier_params)
self.class_representations.clear()
# this adds back extra first dimension for num_samples
return split_first_dim_linear(sample_logits, [NUM_SAMPLES, target_images.shape[0]])
def _get_features(self, context_images, target_images):
"""
Helper function to extract task-dependent feature representation for each image in both context and target sets.
:param context_images: (torch.tensor) Images in the context set (batch x C x H x W).
:param target_images: (torch.tensor) Images in the target set (batch x C x H x W).
:return: (tuple::torch.tensor) Feature representation for each set of images.
"""
# Parallelize forward pass across multiple GPUs (model parallelism)
if self.use_two_gpus:
context_images_1 = context_images.cuda(1)
target_images_1 = target_images.cuda(1)
if self.args.feature_adaptation == 'film+ar':
task_representation_1 = self.task_representation.cuda(1)
# Get adaptation params by passing context set through the adaptation networks
self.set_batch_norm_mode(True)
self.feature_extractor_params = self.feature_adaptation_network(context_images_1, task_representation_1)
else:
task_representation_1 = self.task_representation.cuda(1)
# Get adaptation params by passing context set through the adaptation networks
self.feature_extractor_params = self.feature_adaptation_network(task_representation_1)
# Given adaptation parameters for task, conditional forward pass through the adapted feature extractor
self.set_batch_norm_mode(True)
context_features_1 = self.feature_extractor(context_images_1, self.feature_extractor_params)
context_features = context_features_1.cuda(0)
self.set_batch_norm_mode(False)
target_features_1 = self.feature_extractor(target_images_1, self.feature_extractor_params)
target_features = target_features_1.cuda(0)
else:
if self.args.feature_adaptation == 'film+ar':
# Get adaptation params by passing context set through the adaptation networks
self.set_batch_norm_mode(True)
self.feature_extractor_params = self.feature_adaptation_network(context_images, self.task_representation)
else:
# Get adaptation params by passing context set through the adaptation networks
self.feature_extractor_params = self.feature_adaptation_network(self.task_representation)
# Given adaptation parameters for task, conditional forward pass through the adapted feature extractor
self.set_batch_norm_mode(True)
context_features = self.feature_extractor(context_images, self.feature_extractor_params)
self.set_batch_norm_mode(False)
target_features = self.feature_extractor(target_images, self.feature_extractor_params)
return context_features, target_features
def _build_class_reps(self, context_features, context_labels):
"""
Construct and return class level representation for each class in task.
:param context_features: (torch.tensor) Adapted feature representation for each image in the context set.
:param context_labels: (torch.tensor) Label for each image in the context set.
:return: (void) Updates the internal class representation dictionary.
"""
for c in torch.unique(context_labels):
# filter out feature vectors which have class c
class_features = torch.index_select(context_features, 0, self._extract_class_indices(context_labels, c))
class_rep = mean_pooling(class_features)
self.class_representations[c.item()] = class_rep
def _get_classifier_params(self):
"""
Processes the class representations and generated the linear classifier weights and biases.
:return: Linear classifier weights and biases.
"""
classifier_params = self.classifier_adaptation_network(self.class_representations)
return classifier_params
@staticmethod
def _extract_class_indices(labels, which_class):
"""
Helper method to extract the indices of elements which have the specified label.
:param labels: (torch.tensor) Labels of the context set.
:param which_class: Label for which indices are extracted.
:return: (torch.tensor) Indices in the form of a mask that indicate the locations of the specified label.
"""
class_mask = torch.eq(labels, which_class) # binary mask of labels equal to which_class
class_mask_indices = torch.nonzero(class_mask, as_tuple=False) # indices of labels equal to which class
return torch.reshape(class_mask_indices, (-1,)) # reshape to be a 1D vector
def distribute_model(self):
"""
Moves the feature extractor and feature adaptation network to a second GPU.
:return: Nothing
"""
self.feature_extractor.cuda(1)
self.feature_adaptation_network.cuda(1)
def set_batch_norm_mode(self, context):
"""
Controls the batch norm mode in the feature extractor.
:param context: Set to true ehen processing the context set and False when processing the target set.
:return: Nothing
"""
if self.args.batch_normalization == "basic":
self.feature_extractor.eval() # always in eval mode
else:
# "task_norm-i" - respect context flag, regardless of state
if context:
self.feature_extractor.train() # use train when processing the context set
else:
self.feature_extractor.eval() # use eval when processing the target set
|
Tennessee Republican state Rep. Curry Todd, who once compared undocumented immigrants to "rats" was arrested in Nashville, Tenn., Tuesday night and charged with drunken driving and possession of a handgun under the influence.
At around 11:15 Tuesday night, Rep. Todd was stopped in his GMC Envoy in Nashville. The AP reports that he allegedly failed a roadside sobriety test and refused to take a breathalyzer. A loaded Smith & Wesson 38 Special was also allegedly found in his vehicle.
The AP adds that Todd is also a lead sponsor of a bill that would allow handgun carry permit holders to bring guns into bars.
Todd asked a panel of prenatal health care officials in November 2010 whether patients need to show proof of citizenship to be accepted for treatment. One woman replied that that was not allowed under federal guidelines, since children born on United States soil automatically become citizens under the 14th Amendment of the U.S. Constitution, regardless of their parents' immigration status.
"They can go out there like rats and multiply, then," he responded (see video above). He later said that he was "wrong" to use that language and said he should have used the term "anchor babies" instead.
|
If political polls can be dynamic and unreliable, money might be a good indicator of strengths and weaknesses.
The National Republican Congressional Committee — which has spent $1.6 million in Colorado’s 4th Congressional District so far, mostly on TV ads attacking Democrat Angie Paccione — said Tuesday it was sending more money to defend incumbent Marilyn Musgrave.
The funds will be shifted from Republican Rick O’Donnell, who is running for the Denver-area seat Rep. Bob Beauprez vacated to run for governor.
Musgrave’s campaign manager, Shaun Kenney, said he didn’t know whether the RNCC would infuse Musgrave’s campaign with cash intended for O’Donnell — by law, he’s not allowed to know.
But the removal of cash from O’Donnell could signify the RNCC believes he is strong enough to win without their help, Kenney said.
Kenney was referring to a recent major infusion of cash from the group Coloradans for Life, an independent “527” committee — so-called because of the tax code that allows it to raise and spend money. The group, whose leaders include Fort Collins heiress Pat Stryker, has spent at least $2.3 million on TV ads and mailings critical of Musgrave and Reform Party candidate Eric Eidsness.
Recent polls showed an edge for O’Donnell’s Democratic opponent, former state Sen. Ed Perlmutter. That could also indicate why the national GOP is pulling out in Denver.
Kenney said the removal of funds from O’Donnell didn’t necessarily mean the money would stay in Colorado’s U.S. House races, let alone go to Musgrave.
|
Selective Large-Area Retinal Pigment Epithelial Removal by Microsecond Laser in Preparation for Cell Therapy Purpose Cell therapy is a promising treatment for retinal pigment epithelium (RPE)-associated eye diseases such as age-related macular degeneration. Herein, selective microsecond laser irradiation targeting RPE cells was used for minimally invasive, large-area RPE removal in preparation for delivery of retinal cell therapeutics. Methods Ten rabbit eyes were exposed to laser pulses 8, 12, 16, and 20 s in duration (wavelength, 532 nm; top-hat beam profile, 223 223 m). Post-irradiation retinal changes were assessed with fluorescein angiography (FA), indocyanine green angiography (ICGA), and optical coherence tomography (OCT). RPE viability was evaluated with an angiographic probit model. Following vitrectomy, a subretinal injection of balanced salt solution was performed over a lasered (maximum 13.6 mm2) and untreated control area. Bleb retinal detachment (bRD) morphology was then evaluated by intraoperative OCT. Results Within 1 hour after irradiation, laser lesions showed FA and ICGA leakage. OCT revealed that large-area laser damage was limited to the RPE. The angiographic median effective dose irradiation thresholds (ED50) were 45 J (90 mJ/cm2) at 8 s, 52 J (104 mJ/cm2) at 12 s, 59 J (118 mJ/cm2) at 16 s, and 71 J (142 mJ/cm2) at 20 s. Subretinal injection over the lasered area resulted in a controlled, shallow bRD rise, whereas control blebs were convex in shape, with less predictable spread. Conclusions Large-area, laser-based removal of host RPE without visible photoreceptor damage is possible and facilitates surgical retinal detachment. Translational Relevance Selective microsecond laser-based, large-area RPE removal prior to retinal cell therapy may reduce iatrogenic trauma. Introduction In recent years, regenerative medicine has become a very promising and advanced scientific research topic. This is also the case for retinal degenerative diseases such as age-related macular degeneration (AMD). Especially for the treatment of advanced atrophic AMD, a possible therapeutic approach lies in stem cell-derived retinal pigment epithelium (SC-RPE) cells. 5 On one hand, the RPE cell layer, which is embedded in the retina, is considered to be the origin of many retinal diseases. On the other hand, however, compared with the highly complex neuronal retina, it represents a rather convenient target for cell replacement therapy. Beside the RPE monolayer sheet transplantation approach, SC-RPE can be injected as a suspension. This is currently being investigated in several academic centers around the world. 9,10 Although there are already promising results regarding RPE stem cell therapy in AMD, a methodology with minimum impact on surrounding tissues for the desirable removal of the diseased host RPE cells preceding the recolonization is still missing. Attempts for selective RPE excision have been made with various surgical tools, such as hydraulic debridement, 11,12 or chemically with sodium iodate 13,14 and ethylenediaminetetraacetic acid. 15 However, these methods are unsatisfactory due to handling complications and unintentional side effects, such as proliferative vitreoretinopathy or retinal toxicity. 11,13 Therefore, as a novel approach for the preparation of retinal cell therapy with RPE cell suspensions, we attempted to selectively remove the RPE over a large area with single microsecond laser pulses to reduce choroidal retinal adhesion without causing detectable alterations of the choriocapillaris or the neuroretina. Laser applications in the eye have been pursued for decades due to their elegance of direct access through the ocular media and the ability of micrometer-precise positioning under optical control. Depending on the laser parameters applied, the resulting tissue effect and therefore the clinical outcome can vary greatly. To best meet the requirements for RPE-specific breakdown, the approach known as selective retina therapy (SRT) is particularly suitable. SRT intends to selectively affect the 10-m-thick RPE monolayer while sparing the neuroretina and especially the photoreceptors, as well as choroid. 16,17 This laser method was developed at the Medical Laser Center Lbeck (Lbeck, Germany) and was successfully tested in vivo for the first time by Roider et al. 18 in 1992. The aim of the method is to rejuvenate the regenerative RPE, resulting in improved metabolism at the target sites after RPE migration and proliferation. 17,19 The basis for this selective RPE damage is provided by the intracellular melanosomes, which absorb about 50% of the incident light in the green spectral range. 20 Within the thermal confinement of SRT, peak temperatures (≈150°C) at the melanosomes in the RPE initiate microsecond-long microbubble formation (MBF). 21,22 The rapid mechanical expansion and collapse of these micrometer-sized microbubbles then causes RPE cell-wall disruption, followed by immediate or delayed cell death. 22 SRT, however, typically treats only subpopulations of RPE cells and does not focus on altering the mechanical behavior, especially the adhesion strength between a large continuous region of retina and choroid. In this work, we describe the use of large-area RPE removal utilizing microsecond laser pulses, similar to SRT in terms of selectivity but not regarding the rejuvenation approach, as the goal is reduced choroidal retinal adhesion for RPE cell suspension. Thus, we relied on the current trend in the field of SRT, which evaluates new compact pulsed laser sources with high continuous wave (CW) power (up to 30 W) and variable pulse duration in the microsecond range (2 to 50 s). 23,24 For large-area treatment, a closed multispot pattern without spacing between individual lesions was applied in a controlled manner. A similar approach for large-area (2 2 mm) RPE and photoreceptor damage has already been investigated by the Palanker group by using a scanning laser, with the objective to create an animal model with local retinal degeneration. 25 Following laser treatment, a subretinal injection was made within the laser-treated RPE layer, and the extension of the bleb retinal detachment (bRD) formation was then analyzed and compared with injections performed without prior laser delamination. Animals In this study, chinchilla bastard hybrid rabbits were used. The rabbit eye is a frequently used model in RPE transplantation studies. It is only slightly smaller than a human adult eye and offers sufficient space within the vitreous cavity for pars plana vitrectomy and induction of subretinal blebs. 26 The density and location of light-absorbing pigments in the fundus are rather uniform and comparable to those of the human eye. 20 Furthermore, they are known to form a visual streak (VS), approximately 3 mm inferior to the optic nerve head (ONH), where the rod and cone photoreceptor, ganglion cell, and amacrine cell density is highest. We used animals (12-16 months old, 2.0-2.5 kg; Charles River Germany GmbH, Sulzfeld, Germany) that had similar levels of retinal maturation. All procedures were approved by the state regulatory authorities of Tbingen, Germany, under study code AK 14/18 G and were in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The animals were anesthetized with ketamine (25 mg/kg) and xylazine (2 mg/kg). The animals were placed onto a special holding system (HuCE-optoLab, Bern University of Applied Sciences, Biel, Switzerland) that allowed stable positioning in front of the treatment system. During the treatment, the cornea was hydrated every 5 minutes with Opticel (OphthalmoPro GmbH, St. Ingbert, Germany). The eyes of the animals were kept open and fixed using a speculum. In eight out of nine rabbits, only the left eyes were treated, and the right eyes served as untreated controls. In one rabbit, both eyes were treated because of an early euthanasia due to abnormal tooth growth. Laser Treatment The laser treatment system used in this study was a non-commercial prototype laser treatment system, SPECTRALIS CENTAURUS (HuCE-optoLab). 32 It consists of the upgraded diagnostic imaging platform (SPECTRALIS HRA+OCT; Heidelberg Engineering, Heidelberg, Germany) which has been extended with an experimental SRT laser (modified Merilas 532 shortpulse ophthalmic laser photocoagulator; Meridian Medical, Thun, Switzerland). The SRT laser emits light at a 532-nm wavelength, with 30 W of peak power and selectable modes for CW or SRT operation. In SRT mode, the laser supports pulses 2 to 20 s in duration. However, due to the limited power of the treatment laser, the minimal pulse duration for the experiments presented here was set to 8 s. At this pulse duration, radiation exposures are possible that appear clinically useful and should allow application to the human retina. Evidence for this can be found in a recently published review chart by Seifert et al. 23 for pulsed laser sources with high CW power and variable pulse duration with extrapolated clinical radiation exposure ranges based on in vivo SRT patient data. In terms of spot size, the system achieved a square top-hat beam profile of 223 223 m 2 on the rabbit retina. This spot size dimension was verified by averaging the indocyanine green angiography (ICGA) measurements of all applied laser parameters. The treatment laser, after passing the imaging optics of the system, achieves an intensity modulation factor of 1.3, which indicates an almost homogeneous tophat beam profile. 33,34 A specially developed treatment software (HuCE-optoLab) allowed planning of different treatment patterns by using the integrated infrared reflectance (IR) confocal scanning laser ophthalmoscope (cSLO). The animals were treated in two steps. First, an RPE damage threshold pattern was applied to the rabbit retina to determine the target energy for the large-area RPE removal, which was then performed in a second step. As depicted in the color fundus photography (CFP) in Figure 1a, the threshold pattern was located inferior to the ONH rim in the VS area. The pattern included a probe region and marker lesions (Fig. 1b). Within the probe region, single laser pulses with increasing durations from left to right (8,12,16, and 20 s) and increasing pulse energy, respectively, radiant exposure from top (10 J 20 mJ/cm 2 ) to bottom (maximum 127 J 255 mJ/cm 2 at 20 s) were applied. The maximum pulse energy for the threshold pattern was previously determined utilizing the same rabbit model. Prior to laser application, the pulse energy was measured with a calibrated energy meter (J-10MB-LE; Coherent, Santa Clara, CA) in front of the laser aperture of the system. The energy meter has a measurement accuracy of 2.8% at 532 nm. The radiant exposure values per lesion are detailed in Supplementary Table S1. During the application of the threshold pattern, the live IR cSLO image was examined for changes in the backscattered IR light. The appearance of the light reflectivity in the cSLO fundus image triggers cellular RPE damage because of the occurrence of MBF, which leads to transient reflectance modulations. 21,35,36 This information was used to determine the target energy for large-area RPE removal. Figures 1c to 1e show an example of how hyporeflectivity in the IR cSLO live image changed over a short period of time. In this case, for example, RPE damage could be identified for pulse energies larger than 55 J (111 mJ/cm 2 ) for pulses of 8 s duration (Fig. 1d, lesion 9). Based on this information, the target energy for large-scale RPE removal was determined individually for each animal. Figure 1a shows a CFP of a rabbit fundus with the application site of the threshold pattern and the region for largearea RPE removal. The large-area RPE removal was always performed temporal to the threshold pattern to facilitate surgical handling. Rectangular to square multispot patterns were applied with sizes ranging from 8.1 mm 2 (see Fig. 4) to 13.6 mm 2 (corresponding to a maximum of 266 laser lesions) ( Fig. 2) without spacing between individual lesions. The lesions contained in each pattern were applied in a pulse-by-pulse fashion with a pulse duration of 8 s. This pulse duration was chosen because RPE cell damage is more strongly associated with MBF at shorter pulse durations, and thermal tissue damage increases again at longer pulse durations. 23,36 Longer pulse durations (up to 20 s) that were additionally applied in the threshold pattern served the investigation of this circumstance and will be addressed later in discussion section. Evaluation of Large-Area RPE Cell Removal IR, optical coherence tomography (OCT), FA, and ICGA images were acquired within 1 hour after laser exposure with a combined spectral domain OCT (SD-OCT) and cSLO imaging system (SPECTRALIS OCT2 module; Heidelberg Engineering). The system is able to acquire FA (486 nm), ICGA (786 nm), and IR (815 nm) images, as well as cross-sectional SD-OCT Figure 1. Threshold pattern applied to determine the target energy for large-area RPE removal. (a) CFP of a rabbit fundus. The threshold pattern (label 1) and the region for large-area RPE removal (label 2) are located inferior to the ONH rim on the VS. (b) The threshold pattern included a probe region and external marker lesions, which were applied via single laser pulses of 8, 12, 16, and 20 s. Within the probe region, the treatment energy was increased from top (minimum 10 J 20 mJ/cm 2 ) to bottom (maximum 127 J 255 mJ/cm 2 ) at 20 s. IR cSLO ( = 815 nm) images: (c) before treatment, (d) 3 minutes after treatment, and (e) 6 minutes after treatment. In (d), the dotted line (indicating lesion 9 at 8 s) shows the threshold for MBF. The green and red lines show the direction to potential under-and overexposure. images. An 880-nm super luminescent diode is used for SD-OCT imaging with a fast scanning speed of 85,000 Hz, providing highly detailed images (axial resolution, 3.9 m/pixel; lateral resolution, 5.7 m/pixel) of the retinal structure. Angiographic images were obtained immediately following an injection of 0.2 mL sodium fluorescein solution (10%) (Alcon Pharma GmbH, Freiburg, Germany) and 0.5 mL balanced salt solution (BSS) containing 1.25 mg of indocyanine green (Diagnostic Green GmbH, Aschheim-Dornach, Germany) into the marginal ear vein. Multimodal images were acquired at every minute for a period of at least 30 minutes by using the SPECTRALIS standard objective lens, providing a 30°field of view. Surgery Following imaging, the rabbits underwent surgery under continued general anesthesia with ketamine (25 mg/kg) and xylazine (2 mg/kg), as noted before. Triamcinolone-assisted, 25-gauge three-port vitrectomy (Megatron 4; Geuder AG, Heidelberg, Germany) was performed in the left eye, including induction of a posterior vitreous detachment, as previously described. 37 Subsequently, localized bleb-shaped retinal detachments were created by manual subretinal injection of 15 to 30 L ophthalmic-grade BSS (Alcon Deutschland GmbH, Freiburg im Breisgau, Germany) via a 25/38-gauge subretinal cannula (MedOne Surgical, Sarasota, FL) connected to a 100-L syringe (Hamilton Germany GmbH, Grfelfing, Germany) over the large-area lasered and un-lasered control areas by a single surgeon (BVS). The injection was performed manually by the surgeon holding the syringe in the non-dominant hand and the subretinal cannula in the dominant hand; the eye was illuminated with a chandelier endoillumination probe. The bRD formation and three-dimensional morphology were evaluated by an integrated surgical microscope and intraoperative SD-OCT (OPMI-Lumera RESCAN 700 with integrated intraoperative OCT; Carl Zeiss Meditec, Jena, Germany) through a non-contact, wide-angle 128°fundus lens (RESIGHT 700; Carl Zeiss Meditec). Binary RPE Damage Evaluation As already mentioned, pulsed lasers with high CW power and variable pulse duration in the microsecond range are currently being investigated for SRT. Therefore, an in vivo dataset regarding RPE damage thresholds for laser pulses of 8, 12, 16, and 20 s was generated by performing a probit analysis based on ICGA images. For this purpose, all threshold pattern lesions of all rabbits were evaluated in a binary fashion via an area-based pass/fail detection criterion. Successful RPE damage was assumed if the treated hyperfluorescent area within the 223 223-m 2 top-hat beam profile exceeded or fell below 50% of the lesionsize, thus receiving scores of 1 and 0, respectively. The ICGA post-processing and lesion-size evaluation was accomplished with Fiji in ImageJ (National Institutes of Health, Bethesda, MD). 38 The probit analysis was performed with Origin 2019b (OriginLab Corporation, Northampton, MA) utilizing the Levenberg Marquardt iteration algorithm to fit with a 2 tolerance value of 1 10 −9 within up to 400 iteration steps. This analysis provided the median effective dose irradiation threshold (ED 50 ). An ED 50 irradiation value means that 50% of treatments at this irradiation level depict observable RPE lesions. The corresponding ED 15 and ED 85 values were calculated to visualize the width of the fitted normal distribution in a logarithmic covariant basis. 39 In addition to ICGA imaging, OCT B-scans were acquired simultaneously over the threshold pattern in some animals to compare morphological changes with RPE lesion formation. However, the main focus was on large-scale RPE removal, which is why a comprehensive dataset is not available for the threshold pattern and only initial results are addressed in the discussion. Multimodal Imaging After Laser Therapy Within 1 hour after laser irradiation, the treatment effects for the RPE damage threshold pattern and large-area laser microsurgery were investigated using IR, FA, ICGA, and SD-OCT. In IR imaging, the treated area is encircled by a hyporeflective border (Fig. 2a). The FA examination of the retina showed normal filling of large choroidal and retinal vessels in the early phase, suggesting that no coagulative damage within the choroid was induced (Fig. 2b). The lasertreated area, however, became clearly visible in the late phase (Fig. 2c), suggesting a compromised outer blood-retinal barrier. In the early phase of the ICGA, a normal perfusion in large choroidal vessels (Fig. 2d) can be recognized. In the mid phase, the treatment pattern started to become visible along with focal hyperfluorescence (Fig. 2e), which remained visible in the ICGA late phase, with the treatment pattern becoming clearly demarcated by ICG dye accumulation (Fig. 2f). The corresponding SD-OCT scan taken through the center of the irradiation pattern (green line in Fig. 2f) shows normal reflective bands throughout the treated area without any signs of outer retina damage (Fig. 2g). Large-Area RPE Removal A threshold pattern was used to define the target energy (Figs. 1a, 1b) for large-area RPE removal. The laser-induced effects visible in IR cSLO 3 minutes after the laser irradiation (Fig. 1d) were similar to the effects seen in the late phase ICGA images (Fig. 1b). Further confirmation of mild FA leakage and the absence of increased hyperreflectivity in the outer retinal bands within a laser-treated area led to the validation of IR cSLO imaging as a rather simple, non-invasive predictive biomarker for the laser settings. Typical laser energies using 8 s single pulses for large-area RPE removal were 55 J (111 mJ/cm 2 ) (Fig. 3, Fig. 4) to 61 J (123 mJ/cm 2 ) (Fig. 2). These laser parameters were shown to result in large-area RPE removal without morphological retinal changes beyond the ellipsoid zone (EZ) (Figs. 2-4). Furthermore, we experimented with increasing areas of confluent laser spots ranging from 8.1 mm 2 (Fig. 4) to maximal 13.6 mm 2 (Fig. 2). To achieve control over the direction of the bRD formation, we also tested two different laser pattern designs, square and bottle. Both shapes could be achieved (compare Fig. 2 and Fig. 4). RPE Cell Damage Thresholds After Single Pulse Irradiation In total, 640 laser lesions were applied to the retina in 10 eyes of nine rabbits. Out of these, nine eyes with 576 treatment spots altogether were included in the evaluation. One eye was excluded because an evaluation was not possible due to insufficient ICGA image quality. This quantity of laser lesions applied has proven to be sufficient for probit analysis. The resulting radiant exposure thresholds values for RPE cell damage after single pulse laser irradiation are summarized in the Table. bRD Formation After Laser Therapy The laser irradiated regions were visible under the surgical microscope (Fig. 3d) and did not require demarcation by photocoagulation (see Supplementary Movie S1). Due to operator problems, intraoperative OCT could not be performed for the laserirradiated area with the retina still attached. For the purpose of subretinal injection, the bottle shape proved more advantageous, as the bottle neck served as a landing area for the subretinal cannula (Fig. 3a). Angiography and OCT performed prior to surgery confirmed the selective laser effect on the RPE without affecting choroidal perfusion (Figs. 3a, 3b) or adjacent retina (Fig. 3c). The slowly subretinal injected BSS followed the predefined laser path to gradually adopt a "half-cylindrical" bRD (Figs. 3d-3f), indicating lower resistance above the laser-irradiated RPE. When BSS was injected above the laser-treated area, bRD formation progressed smoothly without pauses (see Supplementary Movie S1). By contrast, in bRD controls raised over RPE not treated by SRT, the bleb expanded uncontrolled, in no preferred direction, while forming a round base shape (Figs. 3g-3i); here, micro pauses could be appreciated during the injection and more fluid volume was required to inject an area comparable to laser-treated blebs (see Supplementary Movie S2). Intraoperative OCT of the bRD Formation During subretinal injection over laser-irradiated areas, the intraoperative OCT documented a rather low bRD with shallow angles (Figs. 4c-4e; Supplementary Movie S3). By contrast, when imaging the bRD formation in the untreated control (Fig. 4f), the bRD appeared more convex, with steeper angles at the edges (Figs. 4g, 4h; Supplementary Movie S4). Discussion To achieve replacement of dysfunctional RPE with a cell therapeutic, several groups have investigated methods of RPE removal in animal experiments. Some surgical methods caused trauma to Bruch's membrane and/or choriocapillaris, 40 and other studies have reported damage to the outer retina. 15,41 We have recently described a method for RPE removal with an extendible prolene loop, 37 which generates a roughly 2 3-mm 2 RPE wound that will be repopulated with RPE and microglial multilayers, suggesting aberrant wound healing (Al-Nawaiseh S, Kroetz C, Rickmann A, et al., unpublished manuscript). Furthermore, the technique requires a rather large retinotomy to gain access to the subretinal space. Particularly for RPE suspension transplant approaches, both latter aspects may severely compromise proper subretinal graft integration. Note: Due to the area-based evaluation criterion for the binary lesion assessment, the intensity modulation factor was not included in the probit analysis. Contrary to the RPE wound healing after surgical debridement, the use of SRT demonstrated local RPE debridement without negatively effecting the choroidal perfusion or the neurosensory retina. 17 Furthermore, several groups have independently demonstrated RPE repopulation by migration and proliferation after SRT, as well as preservation of photoreceptors. 25,42,43 Nevertheless, large-area SRT to solely remove the RPE remains a technical challenge. To the best of our knowledge, only the Palanker group has successfully attempted a similar approach for large-scale (2 2 mm) retinal tissue destruction by selective photocoagulation of RPE cells as well as photoreceptors with a scanning laser. 25 However, their goal was not to reduce choroidal retinal attachment but rather to create an animal model with local retinal degeneration. Furthermore, Sharma et al. 44 recently used a 532-nm micropulse laser to selectively treat an RPE region in preparation for 4 2mm RPE patch delivery for the purposes of creating an RPE/photoreceptor injury model rescued by subsequent pluripotent RPE stem cell induction. Compared with the studies mentioned above, the pattern for largearea RPE removal within this study was applied in a pulse-by-pulse fashion rather than using a continuous scanning laser approach. However, the advantage of a scanning laser is the processing speed. Lorach et al. 25 worked with a scanning speed of 1.6 m/s (local retinal exposure, 60 s) to treat a 2 2-mm retinal damage zone. Our largest pattern of 11.3 mm would therefore have been processed in approximately 40 ms (beam profile of 223 223 m 2 ). The SPECTRALIS CENTAURUS system, which was built for the classical SRT protocol that clinically intends the application of single lesions, required several minutes. Technically, this time could easily be reduced to less than 1 minute, but achieving a similar time as the scanning approach would be difficult. However, by using a multispot pulseby-pulse pattern, the advantage might be the possi-bility of applying eye tracking and local laser pulse energy dosing. Eye tracking could immediately correct unintentional eye movements during laser application and automatically correct overlaps respectively gaps within the pattern. In addition, the pulsed multispot pattern would allow final energy dosing of each individual lesion, an aspect that is extremely important for SRT and which is addressed later in this article. The optical delamination process of the retina and choroid in this work was induced by microsecond laser pulses. It primarily affects RPE melanosomes that superheat, causing nearby intracellular fluid to produce microbubbles, which then form a pressure wave that destroys cellular membranes. According to this model, the SRT damage heavily involves the melanin-rich apical microvilli of the RPE that interface with photoreceptor outer segments. Due to elevated melanin levels nearby, the apical circumferential zonulae occludentes in this cytoskeletal structure are likewise prone to damage. 45 IR, FA, and ICGA imaging of exposure sites seems to support this model. In late phase FA, the exposed region is highlighted by mild hyperfluorescence, but the ICGA clearly delineates the altered RPE with hyperfluorescence in the late phase. Neither FA nor ICGA hints toward any choroidal vascular leakage and unstructured macroscopic hemorrhage, suggesting that the endothelium is not affected by the lasertissue interaction. Meanwhile, late phase or mid phase ICGA (Fig. 2e) revealed an interesting behavior of cell patches, which seemingly experienced slightly lower heating during the laser exposure, potentially due to physiological fluctuations of absorbance or laser conditions. In particular, the cell patches at the periphery of the treated region, extending between the fenestrations to the center and caused by more efficient laser removal, hyperfluoresced with respect to untreated tissue, in obvious contrast to the heavily affected regions. Inside the treatment region, islands of normally appearing cells featured a similar fluorescence as the surrounding tissue. Assuming that the intact RPE in mid phase ICGA is typically dominated by the autofluorescence of the tissue, 46 rather than the dye, the relative brightening of cellular patches could be associated with selective dye uptake of active, still vital cells from the freely floating interstitial fluid or alternatively to ruptured tight junction complexes, as discussed above. The late phase ICGA (Fig. 2f) further accentuated these effects, such that hyperfluorescent regions kept their higher levels and the islands succumbed to similarly reduced fluorescence levels like the untreated regions. When comparing ICGA and OCT (Figs. 5, 6), it appears that an appreciable outer retinal OCT hyperreflectivity was only associated with heterogenization of refractive indices from denaturation at significantly New compact pulsed laser sources with high CW power (up to 30 W) and variable pulse duration are currently being investigated for SRT, promising cellular specific removal at and close to the RPE. 23,24,33,47 To compare morphological changes with RPE lesion formation for pulses up to 20 s duration, OCT Bscans were acquired simultaneously over the threshold pattern in addition to ICGA imaging in some animals. These initial results addressed the applicability of the different pulse durations. In some animals (e.g., rabbit HC5100) (Fig. 5), the safety interval for MBF-induced RPE damage without visible morphological change (white arrows, suitable) appeared to be slightly greater for 8 s (8 pulses, E = 38 J) than for 20 s (3 pulses, E = 18 J). Overlaying the ICGA lesions and the area between the EZ to the outer plexiform layer of the corresponding OCT B-scans highlights this difference in damage. However, despite ICGA hyperfluorescence, we did not detect any morphological tissue changes in SD-OCT B-scans at maximal pulse energy in various rabbits even for pulse durations of 12, 16, and 20 s (e.g., rabbit JC0113) (Fig. 6). With respect to these initial results, however, it must be pointed out that it is not yet clear from these short-term studies whether or to what extent the photoreceptors were impaired at the time of exposure. Direct damage to individual photoreceptor segments, as well as other retinal layers and the choroid, cannot be definitively assessed with the imaging we performed; consequently, further longer term studies with histologic and immunohistochemical evaluation are necessary to detect and compare possible damage. The phenomenon of varying retinal damage mentioned above is also likely to occur in the treatment of the human retina. The RPE damage threshold is known to vary both between patients and within retinal regions of individual patients because light absorption at the fundus varies based on the localized RPE melanosome density. 20 In addition to these RPE pigmentation-related variations, pathologic changes would also involve greater absorption, as well as topographic and morphological changes. To account for this inter-and intraindividual laser absorption, real-time laser dosimetry (i.e., absorption-corrected radiation exposure) would be essential for the clinical application of large-area RPE removal. Therefore, to conserve photoreceptor integrity, SRT irradiation must be kept just above the MBF threshold to avoid insufficient or excessive exposure effects. Currently, several approaches for real-time laser dosimetry are under development. Methods measuring the increased reflectance at the bubble surface via backscattered light or capturing the ultrasonic emission of vaporization to detect the appearance of MBF have been successfully tested. 48,49 Recently, we succeeded to reliably observe early stages of MBF formation with SD-OCT, thus enabling precise control of the damage level. 24 Regarding large-area RPE removal, further research is necessary to reveal particular situations for which laser applications can be adapted or are hindered by optical challenges, such as intransparency of the ocular medium or topological changes. Subretinal injection to surgically induce a retinal detachment in rabbits results in well-documented trauma to the RPE and neural retina. 50,51 Although most of this undesirable effect is likely due to fluid turbulence in the subretinal space, tangential retinal stretching is also considered to be a contributor. Tan et al. 52 studied submacular BSS injection in nonhuman primates with intraoperative OCT. The most common complications were full-thickness foveal tears and/or cystoid foveal changes, phenomena that have also been seen in human gene therapy trials involving Figure 6. Threshold pattern applied with laser pulses of 8, 12, 16, and 20 s and increasing treatment energy (from left to right) in rabbit JC0113 (evaluation similar to that of Fig. 5). There was no correlation for any pulse duration between ICGA lesions and morphological damage characteristics in OCT. For all pulse durations ranging from 2 to 20 s, a larger treatment area (i.e., safety range) is shown compared with rabbit HC5100 (Fig. 5). For all lesions, no obvious morphological retinal changes beyond the EZ were present. subretinal injection. 53,54 Modulating retinal adhesion has been shown to facilitate retinal detachment. 55 The use of SRT delamination appeared to significantly lower retinal adhesion, thereby resulting in a well-controlled bRD with presumably less tangential retinal stretching. In a clinical trial setting for RPE cell therapy such a tool would be a key enabler, as it standardizes access to the subretinal space. Combined with advanced intraoperative visualization, such as the surgical microscope-integrated OCT shown here, and robotics for precise subretinal injection could, over the long term, aid the adoption of RPE cell therapy in early disease stages. One of the limitations of our study is that we manually injected BSS to form the bRD instead of using an automated infusion system, making it difficult to standardize the injection speed. We tried to overcome this problem by predefining the injected volume and having the same person (BVS) perform the injections (BVS). Furthermore, manual injection may cause more iatrogenic traumatic RPE damage than automated injection, and, if the transplantation is undertaken under the setting of choroidal neovascularization, the iatrogenic damage on the RPE is further minimized. This may exaggerate the effect of the laser on RPE damage. These limitations will be taken into consideration in future studies, when studying the longterm effects of laser treatment.
|
Steroid hormones induce macrophage colony-stimulating factor (MCSF) and MCSF receptor mRNAs in the human endometrium. We investigated the biological effects of sex-steroid hormones, secreted from the corpus luteum and placenta, on the induction of mRNAs encoding macrophage colony-stimulating factor (MCSF) and c-fms proto-oncogene (MCSF receptor) in human endometrium. RNA was extracted from the placenta and endometrium of both pregnant and non-pregnant women, and Northern blot analysis was performed on poly(A)+ RNA using MCSF or c-fms proto-oncogene cDNA as the probe. Results showed: that MCSF mRNA was expressed in the placenta and endometrium of the pregnant uterus, that c-fms proto-oncogene mRNA was also expressed in the placenta and endometrium of the pregnant uterus, and that exogenous sex-steroid hormones could induce the expression of MCSF and c-fms proto-oncogene mRNAs in the endometrium of non-pregnant women. These results indicate that sex-steroid hormones secreted by the corpus luteum and/or placenta influence endometrial and placental growth and differentiation via a mechanism of action involving local production of MCSF and its receptor.
|
<filename>sys/include/sys/sysproto_posix.h
/*-
* Copyright (c) 2002-2018 The UbixOS Project.
* All rights reserved.
*
* This was developed by <NAME> for the UbixOS Project.
*
* Redistribution and use in source and binary forms, with or without modification, are permitted
* provided that the following conditions are met:
*
* 1) Redistributions of source code must retain the above copyright notice, this list of
* conditions, the following disclaimer and the list of authors.
* 2) Redistributions in binary form must reproduce the above copyright notice, this list of
* conditions, the following disclaimer and the list of authors in the documentation and/or
* other materials provided with the distribution.
* 3) Neither the name of the UbixOS Project nor the names of its contributors may be used to
* endorse or promote products derived from this software without specific prior written
* permission.
*
* THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED
* WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS
* FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS
* BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES
* (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA,
* OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
* CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT
* OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
*/
#ifndef _SYS_SYSPROTO_POSIX_H_
#define _SYS_SYSPROTO_POSIX_H_
#include <sys/signal.h>
#include <sys/thread.h>
/* TEMP */
#include <vfs/file.h>
typedef int register_t;
#define PAD_(t) (sizeof(register_t) <= sizeof(t) ? 0 : sizeof(register_t) - sizeof(t))
#if BYTE_ORDER == LITTLE_ENDIAN
#define PADL_(t) 0
#define PADR_(t) PAD_(t)
#else
#define PADL_(t) PAD_(t)
#define PADR_(t) 0
#endif
struct sys_exit_args {
char status_l_[PADL_(int)];
int status;
char status_r_[PADR_(int)];
};
struct sys_fork_args {
char status_l_[PADL_(int)];
int status;
char status_r_[PADR_(int)];
};
struct sys_read_args {
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
char buf_l_[PADL_(const void *)];
const void *buf;
char buf_r_[PADR_(const void*)];
char nbyte_l_[PADL_(size_t)];
size_t nbyte;
char nbyte_r_[PADR_(size_t)];
};
struct sys_write_args {
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
char buf_l_[PADL_(const void *)];
const void *buf;
char buf_r_[PADR_(const void*)];
char nbyte_l_[PADL_(size_t)];
size_t nbyte;
char nbyte_r_[PADR_(size_t)];
};
struct sys_open_args {
char path_l_[PADL_(char *)];
char *path;
char path_r_[PADR_(char*)];
char flags_l_[PADL_(int)];
int flags;
char flags_r_[PADR_(int)];
char mode_l_[PADL_(int)];
int mode;
char mode_r_[PADR_(int)];
};
struct sys_close_args {
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
};
struct sys_wait4_args {
char pid_l_[PADL_(int)];
int pid;
char pid_r_[PADR_(int)];
char status_l_[PADL_(int *)];
int *status;
char status_r_[PADR_(int*)];
char options_l_[PADL_(int)];
int options;
char options_r_[PADR_(int)];
char rusage_l_[PADL_(void *)];
void *rusage;
char rusage_r_[PADR_(void*)];
};
struct sys_chdir_args {
char path_l_[PADL_(char *)];
char *path;
char path_r_[PADR_(char*)];
};
struct sys_getcwd_args {
char buf_l_[PADL_(const void *)];
void *buf;
char buf_r_[PADR_(const void*)];
char size_l_[PADL_(uint32_t)];
uint32_t size;
char size_r_[PADR_(uint32_t)];
};
struct sys_setUID_args {
char uid_l_[PADL_(int)];
int uid;
char uid_r_[PADR_(int)];
};
struct sys_setGID_args {
char gid_l_[PADL_(int)];
int gid;
char gid_r_[PADR_(int)];
};
struct sys_execve_args {
char fname_l_[PADL_(char *)];
char *fname;
char fname_r_[PADR_(char*)];
char argv_l_[PADL_(char **)];
char **argv;
char argv_r_[PADR_(char**)];
char envp_l_[PADL_(char **)];
char **envp;
char envp_r_[PADR_(char**)];
};
struct sys_fopen_args {
char path_l_[PADL_(char *)];
char *path;
char path_r_[PADR_(char*)];
char mode_l_[PADL_(char *)];
char *mode;
char mode_r_[PADR_(char*)];
char FILE_l_[PADL_(userFileDescriptor *)];
userFileDescriptor *FILE;
char FILE_r_[PADR_(userFileDescriptor*)];
};
struct sys_fread_args {
char ptr_l_[PADL_(void *)];
void *ptr;
char ptr_r_[PADR_(void*)];
char size_l_[PADL_(long)];
long size;
char size_r_[PADR_(long)];
char nmemb_l_[PADL_(long)];
long nmemb;
char nmemb_r_[PADR_(long)];
char FILE_l_[PADL_(userFileDescriptor *)];
userFileDescriptor *FILE;
char FILE_r_[PADR_(userFileDescriptor*)];
};
struct sys_fclose_args {
char FILE_l_[PADL_(userFileDescriptor *)];
userFileDescriptor *FILE;
char FILE_r_[PADR_(userFileDescriptor*)];
};
struct sys_fgetc_args {
char FILE_l_[PADL_(userFileDescriptor *)];
userFileDescriptor *FILE;
char FILE_r_[PADR_(userFileDescriptor*)];
};
struct sys_fseek_args {
char FILE_l_[PADL_(userFileDescriptor *)];
userFileDescriptor *FILE;
char FILE_r_[PADR_(userFileDescriptor*)];
char offset_l_[PADL_(off_t)];
off_t offset;
char offset_r_[PADR_(off_t)];
char whence_l_[PADL_(int)];
int whence;
char whence_r_[PADR_(int)];
};
struct sys_lseek_args {
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
char offset_l_[PADL_(off_t)];
off_t offset;
char offset_r_[PADR_(off_t)];
char whence_l_[PADL_(int)];
int whence;
char whence_r_[PADR_(int)];
};
struct sys_sysctl_args {
char name_l_[PADL_(int *)];
int *name;
char name_r_[PADR_(int*)];
char namelen_l_[PADL_(u_int)];
u_int namelen;
char namelen_r_[PADR_(u_int)];
char oldp_l_[PADL_(void *)];
void *oldp;
char oldp_r_[PADR_(void*)];
char oldlenp_l_[PADL_(size_t *)];
size_t *oldlenp;
char oldlenp_r_[PADR_(size_t*)];
char newp_l_[PADL_(void *)];
void *newp;
char newp_r_[PADR_(void*)];
char newlenp_l_[PADL_(size_t)];
size_t newlenp;
char newlenp_r_[PADR_(size_t)];
};
/* fcntl args */
struct sys_fcntl_args {
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
char cmd_l_[PADL_(int)];
int cmd;
char cmd_r_[PADR_(int)];
char arg_l_[PADL_(long)];
long arg;
char arg_r_[PADR_(long)];
};
/* OLD */
struct setitimer_args {
char which_l_[PADL_(u_int)];
u_int which;
char which_r_[PADR_(u_int)];
char itv_l_[PADL_(struct itimerval *)];
struct itimerval *itv;
char itv_r_[PADR_(struct itimerval*)];
char oitv_l_[PADL_(struct itimerval *)];
struct itimerval *oitv;
char oitv_r_[PADR_(struct itimerval*)];
};
struct access_args {
char path_l_[PADL_(char *)];
char *path;
char path_r_[PADR_(char*)];
char flags_l_[PADL_(int)];
int flags;
char flags_r_[PADR_(int)];
};
struct sys_fstatfs_args {
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
char buf_l_[PADL_(struct statfs *)];
struct statfs *buf;
char buf_r_[PADR_(struct statfs*)];
};
struct mprotect_args {
char addr_l_[PADL_(const void *)];
const void *addr;
char addr_r_[PADR_(const void*)];
char len_l_[PADL_(size_t)];
size_t len;
char len_r_[PADR_(size_t)];
char prot_l_[PADL_(int)];
int prot;
char prot_r_[PADR_(int)];
};
//Old
struct sysctl_args {
char name_l_[PADL_(int *)];
int *name;
char name_r_[PADR_(int*)];
char namelen_l_[PADL_(u_int)];
u_int namelen;
char namelen_r_[PADR_(u_int)];
char old_l_[PADL_(void *)];
void *oldp;
char old_r_[PADR_(void*)];
char oldlenp_l_[PADL_(size_t *)];
size_t *oldlenp;
char oldlenp_r_[PADR_(size_t*)];
char new_l_[PADL_(void *)];
void *newp;
char new_r_[PADR_(void*)];
char newlen_l_[PADL_(size_t)];
size_t newlen;
char newlen_r_[PADR_(size_t)];
};
struct getpid_args {
register_t dummy;
};
struct sys_issetugid_args {
register_t dummy;
};
struct fcntl_args {
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
char cmd_l_[PADL_(int)];
int cmd;
char cmd_r_[PADR_(int)];
char arg_l_[PADL_(long)];
long arg;
char arg_r_[PADR_(long)];
};
struct pipe_args {
register_t dummy;
};
struct readlink_args {
char path_l_[PADL_(char *)];
char *path;
char path_r_[PADR_(char*)];
char buf_l_[PADL_(char *)];
char *buf;
char buf_r_[PADR_(char*)];
char count_l_[PADL_(int)];
int count;
char count_r_[PADR_(int)];
};
struct getuid_args {
register_t dummy;
};
struct getgid_args {
register_t dummy;
};
struct close_args {
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
};
struct sys_mmap_args {
char addr_l_[PADL_(caddr_t)];
caddr_t addr;
char addr_r_[PADR_(caddr_t)];
char len_l_[PADL_(size_t)];
size_t len;
char len_r_[PADR_(size_t)];
char prot_l_[PADL_(int)];
int prot;
char prot_r_[PADR_(int)];
char flags_l_[PADL_(int)];
int flags;
char flags_r_[PADR_(int)];
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
char pos_l_[PADL_(off_t)];
off_t pos;
char pos_r_[PADR_(off_t)];
};
struct sys_stat_args {
char path_l_[PADL_(char *)];
char *path;
char path_r_[PADR_(char*)];
char ub_l_[PADL_(struct stat *)];
struct stat *ub;
char ub_r_[PADR_(struct stat*)];
};
struct sys_lstat_args {
char path_l_[PADL_(char *)];
char *path;
char path_r_[PADR_(char*)];
char sb_l_[PADL_(struct stat *)];
struct stat *sb;
char sb_r_[PADR_(struct stat*)];
};
struct obreak_args {
char nsize_l_[PADL_(char *)];
char *nsize;
char nsize_r_[PADR_(char*)];
};
struct sigaction_args {
char sig_l_[PADL_(int)];
int sig;
char sig_r_[PADR_(int)];
char act_l_[PADL_(const struct sigaction *)];
const struct sigaction *act;
char act_r_[PADR_(const struct sigaction*)];
char oact_l_[PADL_(struct sigaction *)];
struct sigaction *oact;
char oact_r_[PADR_(struct sigaction*)];
};
struct getdtablesize_args {
register_t dummy;
};
struct sys_munmap_args {
char addr_l_[PADL_(void *)];
void *addr;
char addr_r_[PADR_(void*)];
char len_l_[PADL_(size_t)];
size_t len;
char len_r_[PADR_(size_t)];
};
struct sigprocmask_args {
char how_l_[PADL_(int)];
int how;
char how_r_[PADR_(int)];
char set_l_[PADL_(const sigset_t *)];
const sigset_t *set;
char set_r_[PADR_(const sigset_t*)];
char oset_l_[PADL_(sigset_t *)];
sigset_t *oset;
char oset_r_[PADR_(sigset_t*)];
};
struct gettimeofday_args {
char tp_l_[PADL_(struct timeval *)];
struct timeval *tp;
char tp_r_[PADR_(struct timeval*)];
char tzp_l_[PADL_(struct timezone *)];
struct timezone *tzp;
char tzp_r_[PADR_(struct timezone*)];
};
struct sys_fstat_args {
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
char sb_l_[PADL_(struct stat *)];
struct stat *sb;
char sb_r_[PADR_(struct stat*)];
};
struct ioctl_args {
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
char com_l_[PADL_(u_long)];
u_long com;
char com_r_[PADR_(u_long)];
char data_l_[PADL_(caddr_t)];
caddr_t data;
char data_r_[PADR_(caddr_t)];
};
struct read_args {
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
char buf_l_[PADL_(void *)];
void *buf;
char buf_r_[PADR_(void*)];
char nbyte_l_[PADL_(size_t)];
size_t nbyte;
char nbyte_r_[PADR_(size_t)];
};
struct sys_openat_args {
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
char path_l_[PADL_(char *)];
char *path;
char path_r_[PADR_(char*)];
char flag_l_[PADL_(int)];
int flag;
char flag_r_[PADR_(int)];
char mode_l_[PADL_(__mode_t)];
__mode_t mode;
char mode_r_[PADR_(__mode_t)];
};
struct sys_sysarch_args {
char op_l_[PADL_(int)];
int op;
char op_r_[PADR_(int)];
char parms_l_[PADL_(char *)];
char *parms;
char parms_r_[PADR_(char*)];
};
struct sys_getpid_args {
register_t dummy;
};
struct sys_ioctl_args {
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
char com_l_[PADL_(u_long)];
u_long com;
char com_r_[PADR_(u_long)];
char data_l_[PADL_(caddr_t)];
caddr_t data;
char data_r_[PADR_(caddr_t)];
};
struct sys_geteuid_args {
register_t dummy;
};
struct sys_getppid_args {
register_t dummy;
};
struct sys_getegid_args {
register_t dummy;
};
struct sys_sigprocmask_args {
char how_l_[PADL_(int)];
int how;
char how_r_[PADR_(int)];
char set_l_[PADL_(const sigset_t *)];
const sigset_t *set;
char set_r_[PADR_(const sigset_t*)];
char oset_l_[PADL_(sigset_t *)];
sigset_t *oset;
char oset_r_[PADR_(sigset_t*)];
};
struct sys_sigaction_args {
char sig_l_[PADL_(int)];
int sig;
char sig_r_[PADR_(int)];
char act_l_[PADL_(const struct sigaction *)];
const struct sigaction *act;
char act_r_[PADR_(const struct sigaction*)];
char oact_l_[PADL_(struct sigaction *)];
struct sigaction *oact;
char oact_r_[PADR_(struct sigaction*)];
};
struct sys_getpgrp_args {
register_t dummy;
};
struct sys_setpgid_args {
char pid_l_[PADL_(int)];
int pid;
char pid_r_[PADR_(int)];
char pgid_l_[PADL_(int)];
int pgid;
char pgid_r_[PADR_(int)];
};
struct sys_access_args {
char path_l_[PADL_(char *)];
char *path;
char path_r_[PADR_(char*)];
char amode_l_[PADL_(int)];
int amode;
char amode_r_[PADR_(int)];
};
struct sys_statfs_args {
char path_l_[PADL_(char *)];
char *path;
char path_r_[PADR_(char*)];
char buf_l_[PADL_(struct statfs *)];
struct statfs *buf;
char buf_r_[PADR_(struct statfs*)];
};
struct sys_fstatat_args {
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
char path_l_[PADL_(char *)];
char *path;
char path_r_[PADR_(char*)];
char buf_l_[PADL_(struct stat *)];
struct stat *buf;
char buf_r_[PADR_(struct stat*)];
char flag_l_[PADL_(int)];
int flag;
char flag_r_[PADR_(int)];
};
struct sys_fchdir_args {
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
};
struct sys_getdirentries_args {
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
char buf_l_[PADL_(char *)];
char *buf;
char buf_r_[PADR_(char*)];
char count_l_[PADL_(u_int)];
u_int count;
char count_r_[PADR_(u_int)];
char basep_l_[PADL_(long *)];
long *basep;
char basep_r_[PADR_(long*)];
};
struct sys_socket_args {
char domain_l_[PADL_(int)];
int domain;
char domain_r_[PADR_(int)];
char type_l_[PADL_(int)];
int type;
char type_r_[PADR_(int)];
char protocol_l_[PADL_(int)];
int protocol;
char protocol_r_[PADR_(int)];
};
struct sys_setsockopt_args {
char s_l_[PADL_(int)];
int s;
char s_r_[PADR_(int)];
char level_l_[PADL_(int)];
int level;
char level_r_[PADR_(int)];
char name_l_[PADL_(int)];
int name;
char name_r_[PADR_(int)];
char val_l_[PADL_(caddr_t)];
caddr_t val;
char val_r_[PADR_(caddr_t)];
char valsize_l_[PADL_(int)];
int valsize;
char valsize_r_[PADR_(int)];
};
struct sys_select_args {
char nd_l_[PADL_(int)];
int nd;
char nd_r_[PADR_(int)];
char in_l_[PADL_(fd_set *)];
fd_set *in;
char in_r_[PADR_(fd_set*)];
char ou_l_[PADL_(fd_set *)];
fd_set *ou;
char ou_r_[PADR_(fd_set*)];
char ex_l_[PADL_(fd_set *)];
fd_set *ex;
char ex_r_[PADR_(fd_set*)];
char tv_l_[PADL_(struct timeval *)];
struct timeval *tv;
char tv_r_[PADR_(struct timeval*)];
};
struct sys_gettimeofday_args {
char tp_l_[PADL_(struct timeval *)];
struct timeval *tp;
char tp_r_[PADR_(struct timeval*)];
char tzp_l_[PADL_(struct timezone *)];
struct timezone *tzp;
char tzp_r_[PADR_(struct timezone*)];
};
struct sys_sendto_args {
char s_l_[PADL_(int)];
int s;
char s_r_[PADR_(int)];
char buf_l_[PADL_(caddr_t)];
caddr_t buf;
char buf_r_[PADR_(caddr_t)];
char len_l_[PADL_(size_t)];
size_t len;
char len_r_[PADR_(size_t)];
char flags_l_[PADL_(int)];
int flags;
char flags_r_[PADR_(int)];
char to_l_[PADL_(caddr_t)];
caddr_t to;
char to_r_[PADR_(caddr_t)];
char tolen_l_[PADL_(int)];
int tolen;
char tolen_r_[PADR_(int)];
};
struct sys_rename_args {
char from_l_[PADL_(char *)];
char *from;
char from_r_[PADR_(char*)];
char to_l_[PADL_(char *)];
char *to;
char to_r_[PADR_(char*)];
};
struct sys_pread_args {
char fd_l_[PADL_(int)];
int fd;
char fd_r_[PADR_(int)];
char buf_l_[PADL_(void *)];
void *buf;
char buf_r_[PADR_(void*)];
char nbyte_l_[PADL_(size_t)];
size_t nbyte;
char nbyte_r_[PADR_(size_t)];
char offset_l_[PADL_(off_t)];
off_t offset;
char offset_r_[PADR_(off_t)];
};
struct sys_readlink_args {
char path_l_[PADL_(char *)];
char *path;
char path_r_[PADR_(char*)];
char buf_l_[PADL_(char *)];
char *buf;
char buf_r_[PADR_(char*)];
char count_l_[PADL_(size_t)];
size_t count;
char count_r_[PADR_(size_t)];
};
int sys_readlink(struct thread*, struct sys_readlink_args*);
struct sys_pipe2_args {
char fildes_l_[PADL_(int *)];
int *fildes;
char fildes_r_[PADR_(int*)];
char flags_l_[PADL_(int)];
int flags;
char flags_r_[PADR_(int)];
};
int sys_pipe2(struct thread*, struct sys_pipe2_args*);
struct sys_getlogin_args {
char namebuf_l_[PADL_(char *)];
char *namebuf;
char namebuf_r_[PADR_(char*)];
char namelen_l_[PADL_(u_int)];
u_int namelen;
char namelen_r_[PADR_(u_int)];
};
int sys_getlogin(struct thread*, struct sys_getlogin_args*);
struct sys_setlogin_args {
char namebuf_l_[PADL_(char *)];
char *namebuf;
char namebuf_r_[PADR_(char*)];
};
int sys_setlogin(struct thread*, struct sys_setlogin_args*);
struct sys_getrlimit_args {
char which_l_[PADL_(u_int)];
u_int which;
char which_r_[PADR_(u_int)];
char rlp_l_[PADL_(struct rlimit *)];
struct rlimit *rlp;
char rlp_r_[PADR_(struct rlimit*)];
};
int sys_getrlimit(struct thread*, struct sys_getrlimit_args*);
struct sys_setrlimit_args {
char which_l_[PADL_(u_int)];
u_int which;
char which_r_[PADR_(u_int)];
char rlp_l_[PADL_(struct rlimit *)];
struct rlimit *rlp;
char rlp_r_[PADR_(struct rlimit*)];
};
int sys_setrlimit(struct thread*, struct sys_setrlimit_args*);
struct sys_dup2_args {
char from_l_[PADL_(u_int)];
u_int from;
char from_r_[PADR_(u_int)];
char to_l_[PADL_(u_int)];
u_int to;
char to_r_[PADR_(u_int)];
};
int sys_dup2(struct thread*, struct sys_dup2_args*);
struct sys_unlink_args {
char path_l_[PADL_(char *)];
char *path;
char path_r_[PADR_(char*)];
};
int sys_unlink(struct thread*, struct sys_unlink_args*);
//Func Defs
int sys_invalid(struct thread*, void*);
int sys_exit(struct thread*, struct sys_exit_args*);
int sys_fork(struct thread*, struct sys_fork_args*);
int sys_read(struct thread*, struct sys_read_args*);
int sys_write(struct thread *td, struct sys_write_args*);
int sys_open(struct thread *td, struct sys_open_args*);
int sys_close(struct thread *td, struct sys_close_args*);
int sys_wait4(struct thread *td, struct sys_wait4_args*);
int sys_chdir(struct thread *td, struct sys_chdir_args*);
int sys_setUID(struct thread *td, struct sys_setUID_args*);
int sys_getUID(struct thread *td, void*);
int sys_setGID(struct thread *td, struct sys_setGID_args*);
int sys_getGID(struct thread *td, void*);
int sys_execve(struct thread *td, struct sys_execve_args*);
int sys_fopen(struct thread *td, struct sys_fopen_args*);
int sys_fread(struct thread *td, struct sys_fread_args*);
int sys_fclose(struct thread *td, struct sys_fclose_args*);
int sys_fgetc(struct thread *td, struct sys_fgetc_args*);
int sys_fseek(struct thread *td, struct sys_fseek_args*);
int sys_lseek(struct thread *td, struct sys_lseek_args*);
int sys_sched_yield(struct thread *td, void*);
int sys_getcwd(struct thread *td, struct sys_getcwd_args*);
int sys_mmap(struct thread *td, struct sys_mmap_args*);
int sys_munmap(struct thread *td, struct sys_munmap_args*);
int sys_sysctl(struct thread *td, struct sys_sysctl_args*);
int sys_issetugid(struct thread *td, struct sys_issetugid_args*);
int setitimer(struct thread *td, struct setitimer_args *uap);
int access(struct thread *td, struct access_args *uap);
int fstatfs(struct thread *td, struct sys_fstatfs_args *uap);
int mprotect(struct thread *td, struct mprotect_args *uap);
int sys_statfs(struct thread *td, struct sys_statfs_args *args);
int sys_fstatfs(struct thread *td, struct sys_fstatfs_args*);
int sys_stat(struct thread *td, struct sys_stat_args*);
int sys_lstat(struct thread *td, struct sys_lstat_args*);
int sys_fstat(struct thread *td, struct sys_fstat_args*);
int sys_fstatat(struct thread *td, struct sys_fstatat_args*);
int sys_openat(struct thread *td, struct sys_openat_args*);
int sys_sysarch(struct thread *td, struct sys_sysarch_args*);
int sys_getpid(struct thread *td, struct sys_getpid_args*);
int sys_ioctl(struct thread *td, struct sys_ioctl_args*);
int sys_geteuid(struct thread *td, struct sys_geteuid_args*);
int sys_getegid(struct thread *td, struct sys_getegid_args*);
int sys_getppid(struct thread *td, struct sys_getppid_args*);
int sys_getpgrp(struct thread *td, struct sys_getpgrp_args*);
int sys_setpgrp(struct thread *td, struct sys_setpgid_args*);
int sys_sigprocmask(struct thread *td, struct sys_sigprocmask_args*);
int sys_sigaction(struct thread *td, struct sys_sigaction_args*);
int sys_getpgrp(struct thread *td, struct sys_getpgrp_args*);
int sys_setpgid(struct thread *td, struct sys_setpgid_args*);
int sys_access(struct thread *td, struct sys_access_args*);
int sys_fchdir(struct thread *td, struct sys_fchdir_args*);
int sys_getdirentries(struct thread *td, struct sys_getdirentries_args*);
int sys_socket(struct thread *td, struct sys_socket_args*);
int sys_setsockopt(struct thread *td, struct sys_setsockopt_args*);
int sys_select(struct thread *td, struct sys_select_args*);
int sys_rename(struct thread *td, struct sys_rename_args*);
int sys_fcntl(struct thread *td, struct sys_fcntl_args*);
int sys_gettimeofday(struct thread *td, struct sys_gettimeofday_args*);
int sys_sendto(struct thread *td, struct sys_sendto_args*);
int sys_pread(struct thread *td, struct sys_pread_args*);
#endif /* END _SYS_SYSPROTO_POSIX_H_ */
|
def insert(self, word):
node = self.root
for letter in word:
child = node.date.get(letter)
if not child:
new_node = TrieNode()
node.date[letter] = new_node
node = new_node
else:
node = child
node.is_word = True
|
<reponame>XanderBy/Prueba-mover<gh_stars>0
package Modelo;
import java.awt.Color;
import java.awt.Graphics;
import java.awt.Graphics2D;
public class Personaje {
private int posicionX;
private int posicionY;
private int vida;
public Personaje(int posicionX, int posicionY, int vida) {
this.posicionX = posicionX;
this.posicionY = posicionY;
this.vida = vida;
}
public void cuerpoPersonaje(Graphics g) {
Graphics2D g2d = (Graphics2D) g;
g2d.setColor(Color.RED);
g2d.fillRect(this.getPosicionX(), this.getPosicionY(), 30, 30);
g2d.drawRect(this.getPosicionX(), this.getPosicionY(), 30, 30);
}
public int getPosicionX() {
return posicionX;
}
public void setPosicionX(int posicionX) {
this.posicionX = posicionX;
}
public int getPosicionY() {
return posicionY;
}
public void setPosicionY(int posicionY) {
this.posicionY = posicionY;
}
public int getVida() {
return vida;
}
public void setVida(int vida) {
this.vida = vida;
}
}
|
Supervision of Women Defendants and Offenders in the Community In response to the increasing number of women involved in the community corrections system, policymakers and administrators are reevaluating how the system handles women defendants and offenders. Gender-responsive programming, which responds to issues that affect women in particular, is an integral part of this evaluation. As shown in table 1 (page 2), the number of women on probation nearly doubled from 1990 to 2003 and the number on parole more than doubled. This increase has sparked research examining areas that can significantly influence women offenders' potential for success within the community corrections system. Administrators, managers, and supervisors are working to oversee a growing population of women, to become familiar with what has been learned about issues for women offenders, and to make appropriate decisions about the best methods for applying that information. To help community corrections policymakers better understand gender-responsive programming, this bulletin FROM THE DIRECTOR Women continue to enter the criminal justice system at alarming rates; however, scant attention is paid to the importance of gender. Correctional administrators face significant challenges regarding the programming and service needs of women, both in correctional settings and in the community. The good news is that research and data support gender-specific approaches to working with women involved in the criminal justice system. In addition to targeting criminal behavior, many of these approaches incorporate policy-level attention to provide relevant opportunities for change. This bulletin, part of a 3-year project titled Gender Responsive Strategies: Research, Practice, and Guiding Principles for Women Offenders, examines gender-responsive strategies and their implications for community corrections. As defined by this project, community corrections includes probation and parole, pretrial interventions, day treatment, residential programs, community service programs, and other noncusto-dial interventions. If the mission of the criminal justice system is to safeguard the community, use resources effectively, create opportunities for positive change, and help offenders become productive citizens, then we must revisit some of our efforts and acknowledge that gender makes a difference. Capitalizing on this principle and providing practical approaches will increase opportunities for women offenders to be successful.
|
def loadCuffdiff(dbhandle, infile, outfile, min_fpkm=1.0):
prefix = P.toTable(outfile)
indir = infile + ".dir"
if not os.path.exists(indir):
P.touch(outfile)
return
tmpname = P.getTempFilename(shared=True)
for fn, level in (("cds_exp.diff.gz", "cds"),
("gene_exp.diff.gz", "gene"),
("isoform_exp.diff.gz", "isoform"),
("tss_group_exp.diff.gz", "tss")):
tablename = prefix + "_" + level + "_diff"
infile = os.path.join(indir, fn)
results = parseCuffdiff(infile, min_fpkm=min_fpkm)
Expression.writeExpressionResults(tmpname, results)
P.load(tmpname, outfile,
tablename=tablename,
options="--allow-empty-file "
"--add-index=treatment_name "
"--add-index=control_name "
"--add-index=test_id")
for fn, level in (("cds.fpkm_tracking.gz", "cds"),
("genes.fpkm_tracking.gz", "gene"),
("isoforms.fpkm_tracking.gz", "isoform"),
("tss_groups.fpkm_tracking.gz", "tss")):
tablename = prefix + "_" + level + "_levels"
infile = os.path.join(indir, fn)
P.load(infile, outfile,
tablename=tablename,
options="--allow-empty-file "
"--add-index=tracking_id "
"--add-index=control_name "
"--add-index=test_id")
inf = IOTools.openFile(os.path.join(indir, "read_groups.info.gz"))
inf.readline()
sample_lookup = {}
for line in inf:
line = line.split("\t")
our_sample_name = IOTools.snip(line[0])
our_sample_name = re.sub("-", "_", our_sample_name)
cuffdiff_sample_name = "%s_%s" % (line[1], line[2])
sample_lookup[cuffdiff_sample_name] = our_sample_name
inf.close()
for fn, level in (("cds.read_group_tracking.gz", "cds"),
("genes.read_group_tracking.gz", "gene"),
("isoforms.read_group_tracking.gz", "isoform"),
("tss_groups.read_group_tracking.gz", "tss")):
tablename = prefix + "_" + level + "sample_fpkms"
tmpf = P.getTempFilename(".")
inf = IOTools.openFile(os.path.join(indir, fn)).readlines()
outf = IOTools.openFile(tmpf, "w")
samples = []
genes = {}
is_first = True
for line in inf:
if is_first:
is_first = False
continue
line = line.split()
gene_id = line[0]
condition = line[1]
replicate = line[2]
fpkm = line[6]
status = line[8]
sample_id = condition + "_" + replicate
if sample_id not in samples:
samples.append(sample_id)
if gene_id not in genes:
genes[gene_id] = {}
genes[gene_id][sample_id] = fpkm
else:
if sample_id in genes[gene_id]:
raise ValueError(
'sample_id %s appears twice in file for gene_id %s'
% (sample_id, gene_id))
else:
if status != "OK":
genes[gene_id][sample_id] = status
else:
genes[gene_id][sample_id] = fpkm
samples = sorted(samples)
if len(samples) == 0:
continue
headers = "gene_id\t" + "\t".join([sample_lookup[x] for x in samples])
outf.write(headers + "\n")
for gene in genes.iterkeys():
outf.write(gene + "\t")
s = 0
while x < len(samples) - 1:
outf.write(genes[gene][samples[s]] + "\t")
s += 1
outf.write(genes[gene][samples[len(samples) - 1]] + "\n")
outf.close()
P.load(tmpf,
outfile,
tablename=tablename,
options="--allow-empty-file "
" --add-index=gene_id")
os.unlink(tmpf)
tablename = prefix + "_isoform_levels"
tracks = Database.getColumnNames(dbhandle, tablename)
tracks = [x[:-len("_FPKM")] for x in tracks if x.endswith("_FPKM")]
tmpfile = P.getTempFile(dir=".")
tmpfile.write("track\n")
tmpfile.write("\n".join(tracks) + "\n")
tmpfile.close()
P.load(tmpfile.name, outfile)
os.unlink(tmpfile.name)
|
Country living in Ira School district!!! This home features 4 bedrooms, sequestered master with oversized bathroom and large guest bathroom with double sinks. Large open concept with a kitchen built for entertaining. Nice covered patio to enjoy the evenings on your quiet 5 acres. This will not last long!!! Give me a call today!!!
|
<filename>src/containers/sign-up/index.ts
export { default } from './sign-up.container';
|
. 0,0-Dimethyl(1-hydroxy-2,2,2-trichlorethyl)phosphonate (Trichlorfon; TCP) was tested for carcinogenic activity in male and female Syrian hamsters (Mesocricetus auratus Waterhouse) by intraperitoneal administration. The period of administration was 90 weeks, when maximum total doses of 204 mg (male) and 206 mg (female) TCP per animal had been injected. The study was terminated at 100 weeks. There was no statistically significant difference, when compared the total tumour incidence, or the incidence of malignant and benign tumours separated, of the groups of treated and control animals. These findings were independent from whether the groups of TCP-injected animals and controls were combined or divided by sex.
|
Sustainable use of wild plant species: A research bibliography During the last few decades, there has been a growing realisation that biodiversity conservation cannot be successful without the active involvement of the people living close to and dependent on natural ecosystems for their survival and livelihoods. Consequently, there has been a gradual broadening of the global conservation agenda from strict nature protection to include the sustainable use of natural resources, which is now reflected in governmental policy the world over. However, as conservationists strive today towards the harmonisation of people's needs with biodiversity conservation, one of the most elusive, yet critical, goals for them has been the sustainable extraction of plant resources from the wild. Hundreds of plant species continue to be extracted from natural habitats for use as food, medicine, fuel and fodder in households and for commercial sale, both legally and illegally. As a consequence of unmonitored extraction and over-exploitation, many plant species populations are reported to be declining in the wild. In the face of increasing pressure on forest resources, it has become more important than ever before to devise quantitative management policies for sustainable plant use so that both forests and the livelihoods of millions of rural people who are dependent on them, can be sustained. One of the major stumbling blocks for conservationists in developing countries, who are attempting to design and implement sustainable forest management systems, is the lack of information on the state-of-the-art in this field, especially that relating to field methods, data analysis, data recording and monitoring systems. In order to fill this lacuna, a comprehensive bibliography of studies undertaken so far in the science of sustainable use from terrestrial ecosystems is presented here. The scope of this bibliography includes sustainable
|
Constrictive Pericarditis with a Calcific Mass Invading into the Right Ventricular Myocardium We present a rare and unique case of calcific constrictive pericarditis with a calcified pericardial mass invading the right ventricular myocardium. Perioperative twodimensional and threedimensional transesophageal echocardiography revealed the extent and structure of the pericardial mass and led to the repair of the right ventricular free wall as a surgical intervention.
|
. We present a case of a female patient with reversible cerebral vasoconstriction syndrome (RCVS) arising after receiving subcutaneous injection of human placenta extract. A 44-year-old woman started taking human placenta extract with the aim of improving her menopausal symptoms, fatigue, and beauty. However, 18 days after taking human placenta extract, she had three episodes of thunderclap headache. Repeated cranial CT did not show subarachnoid hemorrhage; CSF examination showed neither xanthochromia nor inflammation. Brain diffusion weighted and FLAIR images were normal. However, magnetic resonance angiography showed multifocal segmental stenosis of the right middle cerebral artery and bilateral anterior cerebral arteries. Follow-up angiography, which performed 12 days after the oncet of thunderclap headache, revealed almost normalized flow in all cerebral arteries; we made a diagnosis of RCVS. She has had no symptoms and signs since the third attack of headache. The only identified etiologic factor was subcutaneous injection of human placenta extract started 18 days prior to onset. This is the first report of RCVS triggered by human placenta extract.
|
North-American Twins With IDDM: Genetic, Etiological, and Clinical Significance of Disease Concordance According to Age, Zygosity, and the Interval After Diagnosis in First Twin In 224 twin pairs (132 monozygotic, 86 dizygotic, and 6 of uncertain zygosity) in whom the index twin had developed IDDM before 30 yr of age, 51 of the co-twins (38 monozygotic, 10 dizygotic, and 3 of uncertain zygosity) subsequently became diabetic. On the basis of concordance ratios, which were significantly discrepant (P < 0.01) between monozygotic and dizygotic twins, the substantial genetic role in IDDM etiology is confirmed. For the monozygotic co-twin of an IDDM case, the relative risk is significantly related to an early age at proband diagnosis (P < 0.01 for 04 vs. 59 yr of age). However, among monozygotic co-twins at any age, IDDM risk decreases as time passes after the proband diagnosis (P < 0.01 for 023 vs. ≥ 24 mo after a proband diagnosis at 59 yr of age). Moreover, a structural-equation analysis suggests a profound contribution to liability (as much as 79%) from the twins' shared environment. Risk to like-sex male dizygotic co-twins is as high as that to monozygotic co-twins, significantly higher than that to like-sex female dizygotic co-twins (P < 0.005), and even higher than that to male co-twins in unlike-sex dizygotic pairs (P < 0.05). Overall, the risk to the dizygotic co-twin of a case is significantly higher (P < 0.001) than that to a non-twin sibling, as reported in the literature. The observed male excess is consistent with reported patterns of IDDM in experimental animals, and in certain circumstances in humans. Taken together, these observations suggest an important early acquired determinant of IDDM, independent of genetic determinants. On the basis of Kaplan-Meier IDDM-free survival curves, if the proband is diagnosed before 15 yr of age, the long-term risk to the co-twin is estimated at 44% (monozygotic) and 19% (dizygotic); it reaches 65% for the co-twin of a monozygotic proband diagnosed before 5 yr of age. An IDDM discordant period of no more than 3 yr was observed in 60% of the pairs destined to become concordant, offering a very brief window for intervention following the recognition of high risk.
|
Analysis on the Current Situation of Digital Resources Integration in China With the development and popularization of internet communion, more and more users share their information online. Library resources in the form is increasingly rich, and digital collection has become the important part of library resources, especially the university library has a tremendous amount of digital resources. For such a mass of digital resources, in order to facilitate library resource management and the reader's resource availability", "the federated retrieval of digital resources has got through the process from theory research, systems development to product introduction and use. Digital resources integration is the inevitable trend of library development at present. The article analyses the digital resources integration research, clarifies the development process of digital resources integration research in China, points out the existing problems and discusses the development trend of the researches on the digital resources integration in China in the end.
|
package org.icatproject.core.entity;
import java.io.Serializable;
import java.util.ArrayList;
import java.util.List;
import javax.persistence.CascadeType;
import javax.persistence.Column;
import javax.persistence.Entity;
import javax.persistence.FetchType;
import javax.persistence.JoinColumn;
import javax.persistence.ManyToOne;
import javax.persistence.OneToMany;
import javax.persistence.Table;
import javax.persistence.UniqueConstraint;
@Comment("Author, e.g. creator of or contributor to a data publication")
@SuppressWarnings("serial")
@Entity
@Table(uniqueConstraints = { @UniqueConstraint(columnNames = { "DATAPUBLICATION_ID", "USER_ID", "CONTRIBUTORTYPE" }) })
public class DataPublicationUser extends EntityBaseBean implements Serializable {
@JoinColumn(name = "DATAPUBLICATION_ID", nullable = false)
@ManyToOne(fetch = FetchType.LAZY)
private DataPublication publication;
@JoinColumn(name = "USER_ID", nullable = false)
@ManyToOne(fetch = FetchType.LAZY)
private User user;
@OneToMany(cascade = CascadeType.ALL, mappedBy = "user")
private List<Affiliation> affiliations = new ArrayList<>();
@Comment("Role of that user in the publication, see DataCite property contributorType for suggested values or use \"Creator\"")
@Column(name = "CONTRIBUTORTYPE", nullable = false)
private String contributorType;
@Comment("Defines an order among the contributors")
private String orderKey;
@Comment("May include title")
private String fullName;
@Comment("The given name of the user")
private String givenName;
@Comment("The family name of the user")
private String familyName;
/* Needed for JPA */
public DataPublicationUser() {
}
public DataPublication getPublication() {
return publication;
}
public User getUser() {
return user;
}
public List<Affiliation> getAffiliations() {
return affiliations;
}
public String getContributorType() {
return contributorType;
}
public String getOrderKey() {
return orderKey;
}
public String getFullName() {
return fullName;
}
public String getGivenName() {
return givenName;
}
public String getFamilyName() {
return familyName;
}
public void setPublication(DataPublication publication) {
this.publication = publication;
}
public void setUser(User user) {
this.user = user;
}
public void setAffiliations(List<Affiliation> affiliations) {
this.affiliations = affiliations;
}
public void setContributorType(String contributorType) {
this.contributorType = contributorType;
}
public void setOrderKey(String orderKey) {
this.orderKey = orderKey;
}
public void setFullName(String fullName) {
this.fullName = fullName;
}
public void setGivenName(String givenName) {
this.givenName = givenName;
}
public void setFamilyName(String familyName) {
this.familyName = familyName;
}
}
|
The present invention relates to a finely-divided powder spray apparatus for discharging finely-divided powders together with a gas flow onto a member to be sprayed such as a substrate by inclining a spray nozzle pipe.
A spacer spray apparatus is known as a representative example of finely-divided powder spray apparatuses, the apparatus uniformly spraying a prescribed amount of spacers for liquid crystal displays (spacer beads) as the finely-divided powders having a uniform particle size between substrates constituting a liquid crystal display panel for liquid crystal display devices, for example, between a glass substrate and a glass or plastic substrate so that the spacers are formed into a single layer.
In the liquid crystal display panel of a liquid crystal display device and the like, particles (spacer beads such as plastic particles and silica particles) having a uniform particle size of about several microns to several tens of microns are sprayed or coated as spacers as uniformly as possible in an amount of 10 to 2000 particles per unit area of 1 mm2 to form a single layer between substrates, for example, between glass substrates, between plastic (organic glass, etc.) substrates other than the glass substrates, and between the plastic substrate and the glass substrate, (hereinafter the glass substrate will be described as a representative example and the aforementioned member to be sprayed are simply referred to as the glass substrate as a whole) so that the space to charge liquid crystals is formed.
Some conventional spacer spray apparatuses spray spacer particles onto the glass substrate by transporting the fine spacer particles together with a gas flow of air, nitrogen, etc., through a thin pipe (transportation pipe) and discharging the particles from a swinging spray nozzle pipe together with the gas stream. The spacer particles are finely-divided powders having a size of several microns to several tens of microns, and liable to float. They are various types of plastic particles or silica particles, and liable to be charged. Therefore, it is difficult to spray the spacers onto the glass substrate at a prescribed density with excellent repeatability. These apparatuses can charge the spacer particles in accordance with a charged polarity (electrostatic polarity) and ground the glass substrate and a table so as to reliably spray the spacer particles onto the glass substrate at the prescribed density.
Recently, the size of a liquid crystal display panel has been increased gradually and a plurality of liquid crystal display panels have often been made of a single glass substrate, and it is therefore required to spray the spacers in a wider area. Thus, an increased swing angle has been required for the spray nozzle pipe to spray the spacers. Accordingly, a distance from the tip of the spray nozzle pipe to the substrate at the center of the substrate is increasingly different from that at the ends of the substrate, and it is difficult to uniformly spray the spacers onto the larger glass substrate.
An object of the present invention is to provide a finely-divided powder spray apparatus, which can uniformly spray finely-divided powders such as spacers onto a member to be sprayed such as a large glass substrate.
The finely-divided powder spray apparatus of the present invention having a spray nozzle pipe for discharging finely-divided powders from the tip onto a member to be sprayed together with a gas stream, which is disposed at a prescribed distance from the member to be sprayed and inclined in a prescribed direction; and
a moving-speed control means which controls a moving-speed of the tip of the spray nozzle pipe based on a density distribution of the finely-divided powders deposited on the member to be sprayed in a trial spray.
In the finely-divided powder spray apparatus of the present invention, the density distribution is represented by a quadratic function which indicates a reduction rate of a density of the deposited finely-divided powders, based on a distance between a peak point in the trial spray and a spray point at which an extension from the spray nozzle pipe intersects with the member to be sprayed.
Further, in the finely-divided powder spray apparatus of the present invention, the quadratic function is composed of a X-axis quadratic function, which indicates a reduction rate of the density of the deposited finely-divided powders based on the distance between the peak point on the X-axis and the spray point, and a Y-axis quadratic function, which indicates a reduction rate of the density of the deposited finely-divided powders based on the distance between the peak point on the Y-axis and the spray point.
Further, in the finely-divided powder spray apparatus of the present invention, a moving-speed of the tip of the spray nozzle pipe is decreased under control as the reduction rate of the density of the deposited finely-divided powders is increased.
According to the finely-divided powder spray apparatus of the present invention, the moving-speed of the tip of the spray nozzle pipe is lowered under control by a moving-speed control means in accordance with the quadratic function, which indicates the reduction rate of the density of the deposited finely-divided powders based on the distance between the peak point in the trial spray and the spray point, as the reduction rate of the density of the sprayed finely-divided powder is increased, whereby the finely-divided powders may be uniformly sprayed on the larger member to be sprayed.
|
The leaked World Food Summit draft declaration falls short of a UN goal of eradicating hunger by 2025. Instead, leaders are expected to to sign a watered down declaration in Rome next week that calls for vague increases in aid for farmers in poor countries but sets no targets or deadlines for action.
Leaders are expected to reaffirm their commitment to the UN's Millennium Development Goal of halving the number of hungry people by 2015 - a target that is unlikely to be reached.
The UN's Food and Agriculture Organisation (FAO), which is organising the three day conference, had hoped to win a clear promise from rich countries to increase the amount they give each year in agricultural aid from $7.9 billion (£4.8 billion) to $44 billion.
But a final draft declaration instead made only a commitment to "substantially increase the share of official development assistance devoted to agriculture and food security based on country-led requests".
"The declaration is just a rehash of old platitudes," said Francisco Sarmento, food rights coordinator for ActionAid.
Campaigners condemned the fact that the summit will be attended by only one G8 leader – Italy's prime minister, Silvio Berlusconi, who is hosting the gathering.
Britain will be represented by two junior ministers, Mike Foster, from the Department for International Development and Jim Fitzpatrick, of the Department for Environment, Food and Rural Affairs.
The US, the world's biggest food aid donor, will send the acting head of the US Agency for International Development.
More than 60 world leaders are expected, including Pope Benedict XVI, Col Gaddafi of Libya, Zimbabwe's President Robert Mugabe and Hugo Chavez of Venezuela.
"It's a tragedy that the world leaders are not going to attend the summit," said Daniel Berman of Medecins Sans Frontières .
Aid groups said the summit was a missed opportunity to tackle malnutrition, which kills a child every six seconds, despite the fact that the world produces a surplus of food. Cereal crops this year are expected to be the second largest ever, after a record harvest in 2008.
According to FAO, the number of hungry people rose this year to 1.02 billion people, as a result of the global economic crisis, high food and fuel prices, drought and conflict.
"This scourge is not just a moral outrage and economic absurdity, but also represents a threat for our peace and security," said FAO's director, Jacques Diouf, who will embark on a 24 hour fast on Saturday to show solidarity with the world's hungry.
|
Endocan (ESM-1) levels in gingival crevicular fluid correlate with ICAM-1 and LFA-1 in periodontitis Endocan, a 50 kDa soluble proteoglycan, also called endothelial cell-specific molecule-1 (ESM-1), is involved in many major cellular activities and has been reported to be overexpressed in inflammatory conditions. This study aims to determine ESM-1 levels in gingival crevicular fluid (GCF) samples from individuals with periodontitis to determine the correlation between the levels of lymphocyte-function-associated antigen-1 (LFA-1), intercellular adhesion molecule-1 (ICAM-1), and clinical findings of periodontitis. This study enrolled 27 individuals diagnosed with Stage III-Grade C generalized periodontitis and 16 individuals as healthy controls. Bleeding on probing (BOP), probing pocket depth (PPD), and clinical attachment loss (CAL) were calculated. Enzyme-linked immunosorbent assay (ELISA) test was used for detecting the levels of ESM-1, ICAM-1, and LFA-1 in GCF samples. PPD, BOP, CAL, and GCF volumes were significantly increased in patients with periodontitis in comparison to the control group (p < 0.001). The total amount of ESM-1, ICAM-1, and LFA-1 levels in GCF were increased in the periodontitis group (p < 0.001). ESM-1 level correlated with PPD, BOP, and CAL (p < 0.05). ICAM-1 level correlated with BOP and CAL (p < 0.05). LFA-1 level correlated with PPD and CAL (p < 0.05). Our data indicate that ESM-1, ICAM-1, and LFA-1 levels are increased in GCF of patients with periodontitis. These molecules could be associated with the pathogenesis and progression of periodontal disease. Introduction Periodontitis is an inflammatory disease that can be modified by microbiological, immunological, genetic, and environmental risk factors. 1 Inflammation occurs as a host response to pathogens and includes events such as vascular dilation, papillary permeability, and extravasation of leukocytes. The first cells to reach the inflammation site are polymorphonuclear leukocytes (PMNLs). Endothelial cells are responsible for the migration of leukocytes against microbial biofilm. 2 During the first stage of host defense, 3 PMNLs are involved in the immune response to periodontopathogens in the gingival sulcus. If there are Declaration of Interests: The authors certify that they have no commercial or associative interest that represents a conflict of interest in connection with the manuscript. abnormalities in the number and/or functions of PMNLs, rapid and severe periodontal destruction may occur, and in this case, the presence of the protective PMNL barrier becomes important. 4 Endothelial adhesion of circulating leukocytes and migration to inflammatory sites is a prominent step in the onset and progression of periodontal lesions. 5 The endothelium has important functions in inflammation, angiogenesis, coagulation, and tumor invasion, mainly via the regulation of receptor/ligand interactions and release of several mediators. Cell adhesion molecules (CAMs) are cell-surface proteins associated with cell binding. Attaching leukocytes to endothelial cells via CAMs requires inflammationmediated signaling pathways. 6,7 CAM levels are also positively related to the degree of inflammation in periodontal tissues. 6 Proinflammatory cytokines, which are produced and released in response to infection, lead to the production of vascular cell adhesion molecule-1 (VCAM-1) and intercellular adhesion molecule-1 (ICAM-1) throughout the endothelium. 8 ICAM-1 and VCAM-1 belong to the immunoglobulin superfamily, and their expression is provided by leukocytes, endothelial cells, monocytes, synovial cells, fibroblasts, and epithelial cells. They have an effect on cell adhesion, leukocyte collection, immunological events, and inflammatory reactions, resulting in rounding and transmigration of leukocytes. 9 Lymphocyte function-associated antigen-1 (LFA-1), one of the ligands on the surface of leukocytes, enables their binding to CAMs in the endothelium. 10 LFA-1 is one of the adhesion molecules present on lymphocytes and other leukocytes, belongs to the integrin superfamily, and acts as a key factor in the migration of leukocytes into tissues. The binding of LFA-1 to ICAM-1 is an important step for the tight adhesion and transmigration of leukocytes and also stimulates signaling pathways important for T-cell differentiation. 11 Endothelial cell-specific molecule-1 (ESM-1) is one of the molecules secreted by endothelial cells. 12 ESM-1 is a 50 kDa soluble proteoglycan involved in many major cellular activities, such as cell transformation, cell proliferation, VCAM-1 and ICAM-1 expression, regulation of leukocyte migration, neovascularization, and metastasis of tumors. 12,13,14 ESM-1 has been reported to be overexpressed in inflammatory conditions, cardiovascular diseases, sepsis, cancer, and obesity, 15 and has been shown to increase the secretion of VCAM-1, E-selectin, and ICAM-1. Therefore, ESM-1 has been designated as a proinflammatory mediator that binds to LFA-1 on human leukocytes and regulates LFA-1 interactions with ICAM-1. 12,14,16,17 Previous evidence indicates that ESM-1 is increased in inflammatory diseases, 12,13,15,18 and inflammation has already been shown to have an important contributing part in the pathogenetic changes in periodontitis. The hypothesis is that ESM-1 may have an effect on periodontal inflammation and may have a role in the pathogenesis of periodontitis. Trer et al. 19 evaluated the role of ESM-1 in periodontal inflammation. They studied its association with tumor necrosis factor alpha and vascular endothelial growth factor and found that these markers were increased in periodontal inflammation. However, CAMs have an important function in transmigration and are reported to be regulated by ESM-1. To date, there is no known study examining the association of ESM-1 levels with CAMs in GCF in periodontitis. Thus, this study aims to measure ESM-1 levels in GCF samples from individuals with Stage III-Grade C generalized periodontitis and determine correlations among the levels of ICAM-1 and LFA-1 and clinical signs of periodontitis. Patient selection The present study was carried out between June 2016 and January 2018 in the Ankara University Faculty of Dentistry, Department of Periodontology, Ankara, Turkey. Individuals who applied to the periodontology outpatient clinic for dental treatment or gingival examination were allocated to the study. This study enrolled 27 systemically healthy patients having Stage III-Grade C periodontitis and 16 periodontally and systemically healthy individuals (control group). The 1975 Declaration of Helsinki was followed. Ethical approval of the study (dated June 28, 2016, and numbered 36290600/60) was obtained from the Ankara University Faculty of Dentistry Clinical Research Ethics Committee. The aim of the study and the study procedure were explained to each participant. At the beginning of the study, each patient signed an informed consent form. Exclusion and inclusion criteria Patients with systemic diseases (such as diabetes mellitus, rheumatoid arthritis and obesity), pregnant women, lactating mothers, and smokers were excluded from the study. In addition, patients who had taken any antibiotics or anti-inflammatory drugs during the past six months or who were subjected to any periodontal treatment were also excluded. Inclusion criteria were determined by radiographic examination and full-mouth clinical periodontal evaluation. All involved individuals were systemically healthy. Individuals without allergic, inflammatory, or autoimmune disease were also included in the study. Clinical measurements Clinical attachment loss (CAL), probing pocket depth (PPD), and bleeding on probing (BOP) of every tooth obtained from the six areas (mesiobuccal, midbuccal, distobuccal, mesiolingual, mid-lingual, and distolingual) were determined by a single experienced periodontologist (M.A.T.) using a periodontal sond (Williams' probe, Hu-Friedy, Chicago, IL, USA).. Prior to the study, the examiners were calibrated. A total of five volunteers were assessed twice, leaving a one-hour time period between assessments. Between the recordings, the second set was performed by blinding out the initial one, and the reproducibility assessment resulted in 85% of sites for which repeated probing meant that measurements were within ±1 mm. A reference examiner (M.G.), who has more than 20 years of experience in periodontology, has calibrated our periodontist (M.A.T.). Scores of probing depth demonstrated good reproducibility as assessed by an inter-examiner ( = 0.826). PPD measurement was registered to the nearest millimeter, and each survey close to 0.5 mm was rounded down to the next lower number. CAL was calculated with the PPD and recession values. The average score for whole-mouth PI, GI, PPD, CAL, and the count of sections with BOP divided by the total count of sections per mouth and centuplicated were determined for every patient. Each patient had at least 20 teeth other than the third molar tooth. Clinical diagnosis was considered according to the "2017 World Workshop on the Classification of Periodontal and Peri-Implant Diseases and Conditions." 20 Periodontal health (control group) was defined as a PPD of ≤ 3 mm and BOP (+) of ≤ 10%. Patients who had interdental radiographic bone loss of ≥ 2 mm on nonadjacent teeth or buccal or oral radiographic bone loss up to 15% with probing depth of > 3 mm for ≥ 2 teeth were diagnosed as having periodontitis. The periodontitis group consisted of patients with Stage III-Grade C generalized periodontitis. Measurement of gingival crevicular fluid Gingival crevicular fluid (GCF) samples were collected from three single rooted teeth of each eligible subject. Specimens were collected from mesial and distal regions with PPD > 5 mm for periodontitis groups. Teeth with single root were picked randomly in the control group. First, the region was isolated to avoid saliva contamination. With the aid of a sterile curette, the supragingival plaque was cautiously removed and the tooth surfaces were slowly dried with air. Paper strips (Periopaper, Oraflow Inc., Plainview, USA) were used to collect GCF samples, placed in the crevice until mild resistance was sensed, and held in that position for 30 seconds. Strips stained with blood were excluded. To sample without mechanical stimulation of the tissues, paper strips were cautiously immersed in the sulcus/pocket orifice (extrasulcular technique). 21 The amount of GCF was measured using a calibrated device (Periotron 8000, Oraflow Inc., New York, USA). Strips were placed in previously encoded polypropylene microcentrifuge tubes. Numerical values read by the device were converted to volume (microliter) according to a standard curve. The electronic gingival fluid measuring device findings were transformed into a genuine volume (microliter) relative to the standard curve. The whole GCF samples were preserved at −80°C until analyzed by enzyme-linked immunosorbent assay (ELISA). GCF ELISA method for ESM-1, LFA-1, and ICAM-1 ESM-1, LFA-1, and ICAM-1 levels in GCF samples were analyzed by human ELISA kits. All assay procedures were performed based on the guidelines of the producer. GCF samples were decompounded from the strips with the aid of a centrifugal procedure. Separation was applied by adding 200 l of sample (test) buffer found in the kit materials. Afterward, the strips and the buffer inside the microcentrifuge tubes were centrifuged for 20 minutes at 3000 g. Following centrifugation, the strips were detached and the residual fluid in the tubes was analyzed for ESM-1, LFA-1, and ICAM-1 using the abovementioned commercial ELISA kits. Crevicular ESM-1, LFA-1, and ICAM-1 levels in every specimen were determined using the concentration data of standards in the kit materials. The acquired concentration value for every specimen was fixed for the genuine volume of GCF by dividing the volume of ESM-1, LFA-1, and ICAM-1 by the sample volume; the results were stated as ng of LFA-1, g of ICAM-1, and g of ESM-1 per site. The intra-and interassay precision values for LFA-1 were < 10% and < 12%, respectively; the corresponding values for ICAM-1 were < 10% and <1 2% and that for ESM-1 were < 10% and < 12%. Limit of detection was 0.268 ng/ml for LFA-1, 20.11 g/L for ICAM-1, and 7.506 g/L for ESM-1. Statistical analysis We used PASW (version 18) to analyze the data. We pooled 15 patients from each group on the basis of a power calculation of 80% power to define the least clinically significant difference (0.4 mm) in probing depth, with 5% type I error. The original numbers were 27 for the Stage III-Grade C generalized periodontitis group and 16 for the control group. Shapiro-Wilk test was implemented to determine data normality. The Student's t-test was used for comparison of periodontitis and control groups. Correlations between clinical periodontal parameters and GCF ESM-1, ICAM-1, and LFA-1 levels were assessed with Pearson correlation coefficient. The age of the participants was analyzed by Pearson chi-squared test. p < 0.05 was the level of statistical significance. Clinical parameters There was no statistically significant variation between the groups in terms of mean age (p = 0.327) and in relation to sex distribution between the groups (p = 0.432). In this study, 27 systemically healthy individuals in the Stage III-Grade C periodontitis group (11 males, 16 females; mean ± standard deviation = 38.41 ± 5.91 years) and 16 healthy individuals (control group) (8 males, 8 females; mean ± SD = 36.20 ± 8.46 years) without findings of systemic diseases or periodontitis were enrolled. PPD, BOP, CAL, and GCF values were significantly elevated for the periodontitis group compared to the control group (p < 0.001). Table 1 presents the clinical findings. Biochemical findings The total amount of LFA-1, ICAM-1, and ESM-1 were significantly increased in the periodontitis group (p < 0.001) in comparison to the control group (Figures 1, 2, and 3, respectively). Table 2 shows correlation coefficients between the periodontal clinical parameters and GCF contents of ESM-1, ICAM-1, and LFA-1. A significant relationship was determined between ESM-1 level and PPD, BOP, and CAL (p < 0.05); between ICAM-1 level and BOP and CAL (p < 0.05); and between LFA-1 level and PPD and CAL (p < 0.05). Discussion In this study, ESM-1, LFA-1, and ICAM-1 levels of GCF samples of periodontitis were evaluated and compared with a control group. This is the first study to ascertain a relationship between ESM-1 and CAM levels in periodontitis. In accordance with the hypothesis of the study, the values of all Control Stage III Grade C generalized periodontitis ICAM-1 (g/site) parameters were increased in the periodontitis group compared to the control group. Gingival sulcus contains serum-like GCF that includes inflammatory cells and mediators in individuals who have periodontitis versus healthy tissue, and the flow rate and content of GCF are linearly correlated with the severity of inflammation. 22 Therefore, it is a beneficial diagnostic tool to ascertain the pathological changes of periodontal disease. 22 In our study, the volume of GCF was remarkably elevated in the periodontitis group compared to the control group. This result is consistent with the knowledge that the volume of GCF increases in relation to the severity of inflammation. 19 In assessing the pathogenesis of periodontal diseases, GCF itself and inflammationrelated molecules in GCF are diagnostic and prognostic value. 23 Studies have shown that GCF biomarkers are more reliable with regard to the total amount of GCF due to the increase of GCF volume and the dilution effect in diseased regions. 6,24,25 Therefore, in our study, biomarkers were calculated as total amount. Numerous studies have shown high levels of inflammatory mediators and adhesion molecules in areas affected by periodontitis. 6,26 Consistent with the hypothesis of our study, total amounts of ICAM-1, LFA-1, and ESM-1 in GCF were determined to be significantly elevated in individuals with periodontitis compared to the control group. LFA-1/ICAM-1 binding, which is necessary for extravasation and migration of neutrophils to peripheral tissues, plays an important role in periodontal inflammation. 27,28 In our study, the high level of LFA-1 in GCF of patients with periodontitis, which increased with the severity of inflammation, can be considered as a marker of inflammation. ICAM-1 is an available molecule on leukocytes for intracellular signaling and increases the release of cytokines, 29 while these cytokines also increase the ICAM-1 level with a double-sided effect. 30 Hannigan et al. 6 reported that soluble ICAM-1 is released as a result of cell damage, and high ICAM-1 levels in the regions affected by periodontitis reflect increased cell damage. Additionally, Pischon et al. 11 have indicated that CAMs are potential candidate markers for endothelial dysfunction. In another study, the soluble forms of CAMs (sCAMs) level in GCF were evaluated in terms of periodontal health and disease, and as a result, sCAM levels were found to increase with the severity of inflammation. 6 Our findings were consistent with the results of this study. In accordance with the hypothesis of our study, the ESM-1 levels in GCF was significantly elevated in individuals diagnosed with periodontitis in comparison to the control group. ESM-1 is classified as a proteoglycan produced by vascular endothelial cells and can be considered as an indicator of endothelial activation. 14 Lee et al. 16 have shown that ESM-1 leads to proinflammatory responses such as hyperpermeability, CAM expression upregulation, and leukocyte adhesion. Lipopolysaccharides are effective in the release of ESM-1, 16 and ESM-1 has been reported to stimulate the expression of VCAM-1, ICAM-1, and E-selectin by inducing endothelial cell activation. 18 It is suggested that ESM-1 contributes to vascular dysfunction by upregulating inflammatory pathways. 14 In our study, ESM-1 levels in GCF were determined to be significantly higher in individuals with periodontal disease, supporting the fact that this proteoglycan has a proinflammatory effect. Trer et al. 19 investigated ESM-1 levels in periodontal disease for the first time and found that ESM-1 levels in GCF and serum were significantly elevated in patients with chronic periodontitis compared to the control group. They concluded that ESM-1 can be a diagnostic and prognostic indicator of periodontal disease and may be an inflammatory marker. 19 In the present study, a positive and significant correlation was found between GCF ESM-1 levels and clinical periodontal parameters (PPD, CAL, and BOP). These results indicate that all three markers change in relation to the severity of inflammation. On the other hand, there was no correlation between the total amount of ESM-1, ICAM-1, and LFA-1 levels. All three markers had proinflammatory effects, and a correlation between these three markers was expected. In addition to the proinflammatory effect of ESM-1, it is also reported that it binds to LFA-1, disrupts ICAM-1/ LFA-1 interaction, and tends to inhibit transmission of leukocytes to the inflammatory site. 13,17,31 ESM-1 not only induces the release of CAMs from the endothelium by activating proinflammatory signaling pathways but also inhibits the transmigration of circulating leukocytes by preventing ICAM-1/LFA-1 interaction. Therefore, we could say that ESM-1 might have two different pathways related to the severity of inflammation. However, it is unknown which function of ESM-1 in the GCF content is involved in periodontal inflammation. In fact, the reaction and progression of many parameters in periodontitis is complex. Many mediators acting on the periodontal lesion can have a different contribution through changing their biological potential at different stages. Pawlak et al. 32 reported that ESM-1 is released by the activated endothelium and may have a protective mechanism that disrupts leukocyte adherence to the endothelium. Our study is important as it is the first study to investigate the correlation of total amounts of GCF ESM-1, ICAM-1, and LFA-1 in periodontal disease. However, the lack of correlation between these markers raises the question of what function ESM-1 has in periodontal inflammation. Future studies are required to clarify whether leukocyte extravasation-inducing effects or a limiting effect is more prominent in the relationship between ESM-1, sCAM, and endothelial dysfunction in periodontal disease. Conclusion This study was the first to show increased ESM-1, sICAM-1, and LFA-1 levels in GCF in patients with periodontitis. ESM-1 is a new class of natural endothelial-derived proteoglycan that can regulate CAM interactions and function in patients with periodontitis. However, to fully understand the role of ESM-1 in the pathogenesis of periodontal disease, further studies are required to examine ESM-1 levels at different stages of periodontitis and to investigate the impact of periodontal therapy on ESM-1 levels.
|
import { NgModule } from '@angular/core';
import { KeycloakService } from '../../auth/keycloak/keycloak.service';
import { DarkApiConfigService } from './dark-api-config.service';
import { FilesService } from './files.service';
import { ApiModule, Configuration } from './swagger-codegen';
@NgModule({
imports: [
{
ngModule: ApiModule,
providers: [{ provide: Configuration, useClass: DarkApiConfigService }],
},
],
providers: [DarkApiConfigService, FilesService, KeycloakService],
})
export class DarkApiModule {}
|
<filename>main.py
from bs4 import BeautifulSoup
import requests
import csv
import wolframalpha
import matplotlib.pyplot as plt
from csv import writer
import pandas as pd
from scraper import getTextFromArticle, getMeanScores
from vaderSentiment.vaderSentiment import SentimentIntensityAnalyzer
import re
politicians = ['<NAME>', '<NAME>', '<NAME>']
scores_bbc = []
#BBC for <NAME>
data1 = requests.get('https://www.bbc.com/news/topics/cp7r8vgl2lgt/donald-trump').text
soup1 = BeautifulSoup(data1, 'lxml')
titles1 = soup1.findAll('a', class_='qa-heading-link lx-stream-post__header-link')
title_text1 = []
for title in titles1:
title_text1.append(title.get_text())
#links = []
writings1 = []
for title in titles1:
link = "https://www.bbc.com"+title["href"]
try:
writingFinal1 = getTextFromArticle(link).encode("ascii", "ignore").decode()
writingFinal1 = re.sub("\n", " ", writingFinal1)
writings1.append(writingFinal1)
except AttributeError:
writings1.append('No Text')
firstColumn = list(pd.read_csv("details.csv")["Politician"])
for text in writings1:
for name in firstColumn:
if name in text.split():
writings1.remove(text)
positivity1 = []
for writing in writings1:
sid_obj1 = SentimentIntensityAnalyzer()
sentiment_dict1 = sid_obj1.polarity_scores(writing)
positivity_score1 = sentiment_dict1['pos']*100
positivity1.append(positivity_score1)
scores_bbc.append(str(sum(positivity1)/len(positivity1)))
#BBC for <NAME>
data2 = requests.get('https://www.bbc.co.uk/search?q=Joe+Biden').text
soup2 = BeautifulSoup(data2, 'lxml')
titles2 = soup2.findAll('a', href=True, class_='ssrcss-atl1po-PromoLink e1f5wbog0')
title_text2 = []
for title in titles2:
title_text2.append(title.get_text())
links = []
subs = 'href'
res = [str(i) for i in titles2 if subs in str(i)]
for ele in res:
link = ele.split(' ')[3]
i = link.index('"')
f = link.index('>')
links.append(link[(i+1):(f-1)])
writings2 = []
for link in links:
#data_new = requests.get(link).text
#soup_new = BeautifulSoup(data_new, 'lxml')
try:
writingFinal2 = getTextFromArticle(link).encode("ascii", "ignore").decode()
writingFinal2 = re.sub("\n", " ", writingFinal2)
writings2.append(writingFinal2)
except AttributeError:
writings2.append('No text existing currenly.')
firstColumn = list(pd.read_csv("details.csv")["Politician"])
for text in writings2:
for name in firstColumn:
if name in text.split():
writings2.remove(text)
positivity2 = []
for writing in writings2:
sid_obj2 = SentimentIntensityAnalyzer()
sentiment_dict2 = sid_obj2.polarity_scores(writing)
positivity_score2 = sentiment_dict2['pos']*100
positivity2.append(positivity_score2)
scores_bbc.append(str(sum(positivity2)/len(positivity2)))
#BBC News for Barack Obama
data3 = requests.get('https://www.bbc.co.uk/search?q=Barack+Obama').text
soup3 = BeautifulSoup(data3, 'lxml')
titles3 = soup3.findAll('a', href=True, class_='ssrcss-atl1po-PromoLink e1f5wbog0')
title_text3 = []
for title in titles3:
title_text3.append(title.get_text())
links3 = []
subs = 'href'
res = [str(i) for i in titles3 if subs in str(i)]
for ele in res:
link = ele.split(' ')[3]
i = link.index('"')
f = link.index('>')
links3.append(link[(i+1):(f-1)])
writings3 = []
for link in links3:
#data_new = requests.get(link).text
#soup_new = BeautifulSoup(data_new, 'lxml')
try:
writingFinal3 = getTextFromArticle(link).encode("ascii", "ignore").decode()
writingFinal3 = re.sub("\n", " ", writingFinal3)
writings3.append(writingFinal3)
except AttributeError:
writings3.append('No text existing currenly.')
firstColumn = list(pd.read_csv("details.csv")["Politician"])
for text in writings3:
for name in firstColumn:
if name in text.split():
writings3.remove(text)
positivity3 = []
for writing in writings3:
sid_obj3 = SentimentIntensityAnalyzer()
sentiment_dict3 = sid_obj3.polarity_scores(writing)
positivity_score3 = sentiment_dict3['pos']*100
positivity3.append(positivity_score3)
scores_bbc.append(str(sum(positivity3)/len(positivity3)))
scores_politico = []
#POLITICO for <NAME>
scores_politico.append('6.975')
#POLITICO for <NAME>
politico_bid = []
positivity4 = []
data_politico = requests.get("https://www.politico.com/news/magazine/2020/03/05/biden-2020-president-facts-what-you-should-know-campaign-121422").text
soup_politico = BeautifulSoup(data_politico, 'lxml')
txt2 = soup_politico.findAll('p', class_='story-text__paragraph')
#print(txt1.get_text())
for ele in txt2:
politico_bid.append(ele.get_text())
firstColumn = list(pd.read_csv("details.csv")["Politician"])
for text in politico_bid:
for name in firstColumn:
if name in text.split():
politico_bid.remove(text)
for elements in politico_bid:
sid_obj4 = SentimentIntensityAnalyzer()
sentiment_dict4 = sid_obj4.polarity_scores(elements)
positivity_score4 = sentiment_dict4['pos']*100
positivity4.append(positivity_score4)
scores_politico.append(str(sum(positivity4)/len(positivity4)))
#POLITICO for Barack Obama
politico_ob = []
positivity5 = []
data_politico2 = requests.get('https://www.politico.com/story/2012/02/the-political-transformation-of-barack-obama-072644').text
soup_politico2 = BeautifulSoup(data_politico2, 'lxml')
txt = soup_politico2.findAll('p')
for ele in txt:
politico_ob.append(ele.get_text())
firstColumn = list(pd.read_csv("details.csv")["Politician"])
for text in politico_ob:
for name in firstColumn:
if name in text.split():
politico_ob.remove(text)
for elements in politico_ob:
sid_obj5 = SentimentIntensityAnalyzer()
sentiment_dict5 = sid_obj5.polarity_scores(elements)
positivity_score5 = sentiment_dict5['pos']*100
positivity5.append(positivity_score5)
scores_politico.append(str(sum(positivity5)/len(positivity5)))
print(scores_politico)
with open('news.csv', 'w') as f:
writer_object = writer(f)
writer_object.writerow(["Politician", "BBC", "Politico"])
for i in range(len(politicians)):
writer_object.writerow([politicians[i], scores_bbc[i], scores_politico[i]])
f.close()
|
<gh_stars>10-100
/*
* Copyright (C) 2010-2013 nsf <<EMAIL>>
* 2021 kiedtl <<EMAIL>>
*
* Permission is hereby granted, free of charge, to any person obtaining a copy
* of this software and associated documentation files (the "Software"), to deal
* in the Software without restriction, including without limitation the rights
* to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the Software is
* furnished to do so, subject to the following conditions:
*
* The above copyright notice and this permission notice shall be included in
* all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
* IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
* FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
* AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
* LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
* OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
* THE SOFTWARE.
*/
#include <stdint.h>
#include <stddef.h>
#include <sys/types.h>
#include "utf8.h"
#include "unicode.h"
/*
* Invalid starter bytes are marked with 0:
*
* The first two... cells (C0 and C1) could be used only for a 2-byte encoding
* of a 7-bit ASCII character which should be encoded in 1 byte... such
* "overlong" sequences are disallowed. The red cells in the F_ row (F5 to FD)
* indicate leading bytes of 4-byte or longer sequences that cannot be valid
* because they would encode code points larger than the U+10FFFF limit of
* Unicode (a limit derived from the maximum code point encodable in UTF-16).
* FE and FF do not match any allowed character pattern and are therefore not
* valid start bytes. -- Wikipedia article on UTF8
*
* Additionally, values between 0x80 and 0xbf inclusive are marked with 0, as
* they are continuation bytes and may not appear at the beginning of an
* encoded rune sequence.
*/
static const uint8_t utf8_length[256] = {
/* 0 1 2 3 4 5 6 7 8 9 A B C D E F */
/* 0 */ 0, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1,
/* 1 */ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1,
/* 2 */ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1,
/* 3 */ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1,
/* 4 */ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1,
/* 5 */ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1,
/* 6 */ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1,
/* 7 */ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1,
/* 8 */ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
/* 9 */ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
/* A */ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
/* B */ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
/* C */ 0, 0, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2,
/* D */ 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2,
/* E */ 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3, 3,
/* F */ 4, 4, 4, 4, 4, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0
};
static const uint8_t utf8_mask[6] = {
0x7F, 0x1F, 0x0F, 0x07, 0x03, 0x01
};
ssize_t utf8_char_to_unicode(uint32_t *out, const char *c);
size_t utf8_unicode_to_char(char *out, uint32_t c);
uint8_t
utf8_bytesz(char c)
{
return utf8_length[(uint8_t)c];
}
ssize_t
utf8_decode(uint32_t *out, char *c, size_t sz)
{
if (c[0] == 0 || sz == 0)
return -1;
uint8_t len = utf8_bytesz(*c);
if (len == 0 || len > sz)
return -1;
uint32_t result = c[0] & utf8_mask[len-1];
for (size_t i = 1; i < len; ++i) {
if ((c[i] & 0xc0) != 0x80)
return -1; /* not a continuation byte */
result <<= 6;
result |= c[i] & 0x3f;
}
if (result > UNICODE_MAX)
return -1; /* value beyond unicode's 21-bit max */
if (result >= 0xD800 && result <= 0xDFFF)
return -1; /* surrogate chars */
if (result >= 0xFDD0 && result <= 0xFDEF)
return -1; /* non-character range */
if ((result & 0xFFFE) == 0xFFFE)
return -1; /* non-character at plane end */
*out = result;
return (size_t)len;
}
ssize_t
utf8_encode(char *out, uint32_t c)
{
size_t len = 0, first, i;
if (c < 0x80) {
first = 0;
len = 1;
} else if (c < 0x800) {
/* XXX: we allow encoding surrogate chars, even
* though that's invalid UTF8 */
first = 0xc0;
len = 2;
} else if (c < 0x10000) {
first = 0xe0;
len = 3;
} else if (c < 0x110000) {
first = 0xf0;
len = 4;
} else {
return -1;
}
for (i = len - 1; i > 0; --i) {
out[i] = (c & 0x3f) | 0x80;
c >>= 6;
}
out[0] = c | first;
return len;
}
|
// Copyright 2019 The Bazel Authors. All rights reserved.
//
// Licensed under the Apache License, Version 2.0 (the "License");
// you may not use this file except in compliance with the License.
// You may obtain a copy of the License at
//
// http://www.apache.org/licenses/LICENSE-2.0
//
// Unless required by applicable law or agreed to in writing, software
// distributed under the License is distributed on an "AS IS" BASIS,
// WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
// See the License for the specific language governing permissions and
// limitations under the License.
package com.google.devtools.build.lib.runtime;
import static com.google.common.truth.Truth.assertThat;
import static org.junit.Assert.assertThrows;
import static org.mockito.Mockito.never;
import static org.mockito.Mockito.times;
import static org.mockito.Mockito.withSettings;
import com.google.common.collect.ImmutableList;
import com.google.devtools.build.lib.server.FailureDetails;
import com.google.devtools.build.lib.util.AbruptExitException;
import java.lang.management.GarbageCollectorMXBean;
import javax.management.ListenerNotFoundException;
import javax.management.NotificationEmitter;
import org.junit.Test;
import org.junit.runner.RunWith;
import org.junit.runners.JUnit4;
import org.mockito.Mockito;
/**
* Basic tests for {@link RetainedHeapLimiter}. More realistic tests are hard because {@link
* RetainedHeapLimiter} intentionally crashes the JVM.
*/
@RunWith(JUnit4.class)
public class RetainedHeapLimiterTest {
@Test
public void findBeans() {
GarbageCollectorMXBean mockUselessBean = Mockito.mock(GarbageCollectorMXBean.class);
String[] untenuredPoolNames = {"assistant", "adjunct"};
Mockito.when(mockUselessBean.getMemoryPoolNames()).thenReturn(untenuredPoolNames);
GarbageCollectorMXBean mockBean =
Mockito.mock(
GarbageCollectorMXBean.class,
withSettings().extraInterfaces(NotificationEmitter.class));
String[] poolNames = {"not tenured", "CMS Old Gen"};
Mockito.when(mockBean.getMemoryPoolNames()).thenReturn(poolNames);
assertThat(
RetainedHeapLimiter.findTenuredCollectorBeans(
ImmutableList.of(mockUselessBean, mockBean)))
.containsExactly(mockBean);
}
@Test
public void smoke() throws AbruptExitException, ListenerNotFoundException {
GarbageCollectorMXBean mockUselessBean = Mockito.mock(GarbageCollectorMXBean.class);
String[] untenuredPoolNames = {"assistant", "adjunct"};
Mockito.when(mockUselessBean.getMemoryPoolNames()).thenReturn(untenuredPoolNames);
GarbageCollectorMXBean mockBean =
Mockito.mock(
GarbageCollectorMXBean.class,
withSettings().extraInterfaces(NotificationEmitter.class));
String[] poolNames = {"not tenured", "CMS Old Gen"};
Mockito.when(mockBean.getMemoryPoolNames()).thenReturn(poolNames);
RetainedHeapLimiter underTest =
new RetainedHeapLimiter(ImmutableList.of(mockUselessBean, mockBean));
underTest.updateThreshold(100);
Mockito.verify((NotificationEmitter) mockBean, never())
.addNotificationListener(underTest, null, null);
Mockito.verify((NotificationEmitter) mockBean, never())
.removeNotificationListener(underTest, null, null);
underTest.updateThreshold(90);
Mockito.verify((NotificationEmitter) mockBean, times(1))
.addNotificationListener(underTest, null, null);
Mockito.verify((NotificationEmitter) mockBean, never())
.removeNotificationListener(underTest, null, null);
underTest.updateThreshold(80);
// No additional calls.
Mockito.verify((NotificationEmitter) mockBean, times(1))
.addNotificationListener(underTest, null, null);
Mockito.verify((NotificationEmitter) mockBean, never())
.removeNotificationListener(underTest, null, null);
underTest.updateThreshold(100);
Mockito.verify((NotificationEmitter) mockBean, times(1))
.addNotificationListener(underTest, null, null);
Mockito.verify((NotificationEmitter) mockBean, times(1))
.removeNotificationListener(underTest, null, null);
}
@Test
public void noTenuredSpaceFound() throws AbruptExitException {
GarbageCollectorMXBean mockUselessBean = Mockito.mock(GarbageCollectorMXBean.class);
String[] untenuredPoolNames = {"assistant", "adjunct"};
Mockito.when(mockUselessBean.getMemoryPoolNames()).thenReturn(untenuredPoolNames);
RetainedHeapLimiter underTest = new RetainedHeapLimiter(ImmutableList.of(mockUselessBean));
Mockito.verify(mockUselessBean, Mockito.times(2)).getMemoryPoolNames();
underTest.updateThreshold(100);
Mockito.verifyNoMoreInteractions(mockUselessBean);
AbruptExitException e =
assertThrows(AbruptExitException.class, () -> underTest.updateThreshold(80));
FailureDetails.FailureDetail failureDetail = e.getDetailedExitCode().getFailureDetail();
assertThat(failureDetail.getMessage())
.contains("unable to watch for GC events to exit JVM when 80% of heap is used");
assertThat(failureDetail.getMemoryOptions().getCode())
.isEqualTo(
FailureDetails.MemoryOptions.Code
.EXPERIMENTAL_OOM_MORE_EAGERLY_NO_TENURED_COLLECTORS_FOUND);
}
}
|
Immobilization of Acid Phosphatase in Agaragar and Gelatin: Comparative Characterization 192 DOI: 10.37398/JSR.2020.640227 Abstract: Acid phosphatase from wheat germ was immobilized by entrapment in agar-agar and gelatin gel. Blocks of 5x5 mm size were employed for characterization. The maximum immobilization yield was achieved at 3.0% (w/v) of agar-agar and 20% (w/v) gelatin cross-linked with 10% (v/v) glutaraldehyde for 1h incubation. The optimum pH for both immobilized enzymes was observed at 5.5. Both the immobilized enzymes displayed a temperature optimum at 60 °C. The activation energies for agaragar and gelatin immobilized acid phosphatase were 36.6 and 36.8 kJmol. The Km values for agar-agar and gelatin immobilized enzymes were 0.282 and 0.3 mM, respectively. The Vmax values for agar-agar and gelatin immobilized acid phosphatase were 2.15 and 2.1 mol/min/mg protein, respectively. The agar-agar and gelatin immobilized enzyme retained 73.2 and 75.7% activity on the 56 day of storage at 4 °C. Gelatin immobilized enzyme could be repeatedly used for more than 21 cycles (48%) whereas the agaragar immobilized enzyme could be reused for 15 cycles (36.1%) only. The method of immobilization reported here is easy, profitable and will be suited for wider application.
|
<filename>src/Boring32.UnitTests/DataStructures/CappedStack.cpp
#include "pch.h"
#include "CppUnitTest.h"
#include "Boring32/include/DataStructures/CappedStack.hpp"
using namespace Microsoft::VisualStudio::CppUnitTestFramework;
namespace DataStructures
{
TEST_CLASS(CappedStack)
{
public:
TEST_METHOD(TestSizeConstructor)
{
Boring32::DataStructures::CappedStack<int> stack(5, true);
Assert::IsTrue(stack.GetMaxSize() == 5);
Assert::IsTrue(stack.AddsUniqueOnly());
}
TEST_METHOD(TestInvalidSizeConstructor)
{
Assert::ExpectException<std::invalid_argument>(
[]()
{
Boring32::DataStructures::CappedStack<int> stack(0, true);
});
}
TEST_METHOD(TestAssignPush)
{
Boring32::DataStructures::CappedStack<int> stack(5, true);
for (int i = 0; i < 5; i++)
stack = i;
Assert::IsTrue(stack.GetSize() == 5);
for (int i = 0; i < 5; i++)
Assert::IsTrue(stack[i] == i);
}
TEST_METHOD(TestAssignUniquePush)
{
Boring32::DataStructures::CappedStack<int> stack(5, true);
for (int i = 0; i < 5; i++)
stack = 1;
Assert::IsTrue(stack.GetSize() == 1);
Assert::IsTrue(stack[0] == 1);
}
TEST_METHOD(TestAssignPop)
{
Boring32::DataStructures::CappedStack<int> stack(5, true);
for (int i = 0; i < 5; i++)
stack = i;
Assert::IsTrue(stack.Pop() == 4);
Assert::IsTrue(stack.GetSize() == 4);
for (int i = 0; i < 4; i++)
Assert::IsTrue(stack[i] == i);
}
TEST_METHOD(TestAssignPop2)
{
Boring32::DataStructures::CappedStack<int> stack(5, true);
for (int i = 0; i < 5; i++)
stack = i;
int i = -1;
Assert::IsTrue(stack.Pop(i));
Assert::IsTrue(i == 4);
Assert::IsTrue(stack.GetSize() == 4);
for (int i = 0; i < 4; i++)
Assert::IsTrue(stack[i] == i);
}
TEST_METHOD(TestInvalidPop)
{
Assert::ExpectException<std::runtime_error>(
[]()
{
Boring32::DataStructures::CappedStack<int> stack(5, true);
stack.Pop();
});
}
TEST_METHOD(TestAssignEquality)
{
Boring32::DataStructures::CappedStack<int> stack(5, true);
for (int i = 0; i < 5; i++)
stack = i;
Assert::IsTrue(stack == 4);
}
};
}
|
Exploring Extended Kinship in Twenty-First-Century China: A Conceptual Case Study Many observers of contemporary China notice the revival of the so-called traditional culture. This includes the public presence of rituals and artefacts that relate with traditional kinship, such as ancestral halls. This article explores a case in Shenzhen, the Huang lineage and the larger surname group. A methodological issue looms large: What exactly was the tradition that is perceived as reviving? The field of historical studies on Chinese kinship is a highly contested domain, especially regarding the nature and role of lineages. Therefore, we designed our article as a conceptual case study: we reflect upon the state of our knowledge about Chinese kinship in the traditional sense, develop a tentative conceptual framework, and apply this on our case. Central issues include the relationship between descent as constructed and performed via kinship rituals and patterns of cooperation among members of a lineage and the wider surname group.
|
Friday morning will mark the first time in more than 60 years that a commuter train has pulled into downtown Santa Monica under its own power.
As part of the safety checks required before the Expo Line's second phase can open to the public next year, rail officials will slowly pilot a sleek train from 20th Street to Fifth Street along Colorado Avenue in Santa Monica.
Westside residents and commuters will see trains moving at street level between 5 mph and 25 mph as officials check for any points where trains could strike platforms or overhead wires.
Officials conducted a similar test Wednesday, watched by a group of public officials and rail fans, but the train was pushed by a truck. A video published by the Metropolitan Transportation Authority showed the train moving along the track, but most of the footage did not show the truck.
Watching the test trains is "a little like watching paint dry," said Metro spokesman Marc Littman. "It is exciting because it's significant, but ... they look at it, they look at it, they look at it, they power it up, they turn it off. If you're expecting to see trains zipping along, you're not going to see that."
Although the trains will be moving at a snail's pace, the significance of watching them glide through downtown Santa Monica isn't lost on residents and officials, who have spent years sitting in the infamous traffic of the Westside.
"Santa Monica has wanted this and actively worked to make this happen for a long time," Mayor Kevin McKeown said.
The last trains to run through Santa Monica were the Pacific Electric Red Cars, which went out of service in 1963.
"Just being able to have, in the picture, a sign that says 'Metro' and 'Downtown/Santa Monica' — the symbol is incredible," Santa Monica City Manager Rick Cole said. "This is the biggest change in Santa Monica since the opening of the 10 Freeway."
Currently, the Expo Line connects Downtown Los Angeles to its terminus in Culver City, passing through USC, Exposition Park and Baldwin Hills/Crenshaw. The second phase will add seven stations to the west, in Palms, Westwood and Santa Monica.
Passengers can't board the Expo Line for at least six more months, Littman said. The opening date has not been publicly announced.
In preparation for the train's debut, Santa Monica will be marketing it as a shift in how people can get around, Cole said: not just by driving to a train station and parking, but walking more, taking the bus or trying the city's bike-share system, which is slated to launch later this year.
They'll also be teaching residents how to behave safely around trains while in cars and on foot.
Obey warning signs and traffic signals.
Always look both ways before crossing any street and watch for trains from both directions.
Never walk or jaywalk on railroad tracks.
|
Amplification of immune T lymphocyte function in situ: the identification of active components of the immunologic network during tumor rejection. Previous data had indicated that sarcoma-bearing mice receiving combination therapy consisting of a single i.p. injection of cytoxan (CY) and an i.v. injection of tumor-sensitized T cells (immune cells) rejected the neoplasm. The reaction was immunologically specific and dependent on donor T cells. This report is concerned with the hypothesis that the transfer of immune cells results in the amplification of T cell responses at the tumor site. Using C57BL/6J mice bearing the syngeneic rhabdomyosarcoma MCA/76-9, we show that 6 to 9 days after combination therapy those components usually associated with the immunologic network were present at the tumor site. Tumor-associated macrophages (TAM) and lymphocytes (TAL) were shown to produce IL 1 and IL 2, respectively. The TAM expressed Ir gene products (Ia) and were able to present the synthetic polymer GAT to specifically sensitized lymphocytes. In addition, it was demonstrated by in situ labeling with 3H-TdR that lymphocytes associated with the regressing tumors were proliferating. The peak incorporation occurred 7 days after therapy, 24 hr before a significant increase in the T cell content of the tumors. The data indicate that those facets of the immunologic network necessary for amplification were present at the site of rejection.
|
<reponame>Cameron-C-Chapman/simple-spring-rest-service
package org.cameronchapman.github.webservice.manager;
import java.util.ArrayList;
import java.util.List;
import org.cameronchapman.github.webservice.data.CustomerDao;
import org.cameronchapman.github.webservice.exception.NoNewCustomerIdReturnedException;
import org.cameronchapman.github.webservice.model.Customer;
import org.slf4j.Logger;
import org.slf4j.LoggerFactory;
import org.springframework.beans.factory.annotation.Autowired;
import org.springframework.dao.DataAccessException;
import org.springframework.jdbc.support.GeneratedKeyHolder;
import org.springframework.stereotype.Component;
import org.springframework.transaction.annotation.Transactional;
@Component
@Transactional(timeout = 5, readOnly = true)
public class CustomerManager {
private static Logger LOGGER = LoggerFactory.getLogger(CustomerManager.class);
@Autowired
private CustomerDao customerDao;
public List<Customer> getAll() {
List<Customer> customers = customerDao.getAll();
if (null == customers) {
customers = new ArrayList<Customer>();
}
return customers;
}
public Customer getCustomerById(Long id) {
Customer customer = null;
try {
customer = customerDao.getById(id);
} catch(DataAccessException dae) {
// if no data is returned return null to caller
LOGGER.debug("No data returned from getCustomerById. id={}", id);
}
return customer;
}
@Transactional(readOnly = false)
public Number insertCustomer(Customer customer) throws Exception {
Number newId = customerDao.insert(customer, new GeneratedKeyHolder());
// if no new id was generated from the insert attempt throw an exception
if (null == newId) {
throw new NoNewCustomerIdReturnedException("No new customer id returned.");
}
return newId;
}
}
|
<reponame>caizhangxian/datax-es<filename>elasticsearchwriter/src/main/java/com/alibaba/datax/plugin/writer/elasticsearchwriter/EsEntity.java<gh_stars>1-10
package com.alibaba.datax.plugin.writer.elasticsearchwriter;
/**
* Created on 2017/8/14.
* @author lunatictwo
*/
public class EsEntity {
/**
* 显式声明transient 说明该字段不需要进行序列化，
* 否则在使用Gson的时候会和子类的id产生冲突 但是子类也需要该字段
* 一些敏感数据字段也可以通过该方法禁止进行序列化
*/
private transient Integer id;
public Integer getId() {
return id;
}
public void setId(Integer id) {
this.id = id;
}
}
|
Deep Learning for The Inverse Design of Mid-infrared Graphene Plasmons We theoretically investigate the plasmonic properties of mid-infrared graphene-based metamaterials and apply deep learning of a neural network for the inverse design. These artificial structures have square periodic arrays of graphene plasmonic resonators deposited on dielectric thin films. Optical spectra vary significantly with changes in structural parameters. Our numerical results are in accordance with previous experiments. Then, the theoretical approach is employed to generate data for training and testing deep neural networks. By merging the pre-trained neural network with the inverse network, we implement calculations for inverse design of the graphene-based metameterials. We also discuss the limitation of the data-driven approach. Introduction Metamaterials are artificial composites engineered to possess desired features not found in nature. Metals and dielectrics in metamaterials are periodically organized at the subwavelength scale. The incident light excites surface plasmons or collective oscillations of quasi-free electrons, which cause strong light-matter interactions. The subwavelength confinement of electromagnetic waves allow us to obtain a negative refractive index, and perfect absorption and transmission. These properties have been applied to various areas including superlens, cloak of invisibility, sensing, and photothermal heating. However, plasmon lifetime in metal nanostructures is limited because of large inelastic losses of noble metals. The large Ohmic loss also reduces service life of optical confinement. Graphene is a novel plasmonic material. Graphene can strongly confine electromagnetic fields, particularly in the infrared regime but dissipates a small amount of energy. A significant reduction of the heat dissipation in graphene compared to that in metals is caused by the small number of free electrons. One can easily tune optical and electrical properties of graphene via doping, applying external fields, and injecting charge carriers. Consequently, graphene-involved metamaterials are expected to possess various interesting behaviors. Graphene-based metamaterials can be investigated using different approaches. While experimental implementation and simulation are very expensive and time-consuming, theoretical approaches provide good insights into underlying mechanisms of metamaterials. Rapid collection of data from theoretical calculations, simulations, and experiments has introduced data-driven approaches to effectively investigate systems. Data-driven approaches using machine learning and deep learning have revolutionized plasmonic and photonic fields since they can speed up calculations and be a one-time-cost approach after collecting data by expensive sources. Reliable theoretical models can generate huge amounts of systematic data for Machine Learning and Deep Learning analyses. Thus, combining theory and deep learning would pave the way for better understanding in science and introducing futuristic applications. Inverse design problems have attracted the scientific community since they allow us to accelerate the design process targeting desired properties. One has recently applied inverse design techniques to several physical systems such as quantum scattering theory, photonic devices, and thin film photovoltaic materials. Typically, inverse design problems are solved using the optimization approach in high-dimensional space, the genetic algorithm, and the adjoint method. Hower, these approaches require lengthy calculations and computational timescale. In this context, artificial neural networks provide faster calculations with higher precision. In this work, we present a theoretical approach to investigate plasmonic properties of graphene-based nanostructures and use deep neural networks for the inverse design of the structure when knowing an optical spectrum. Our modeled systems mimic mid-infrared graphene detectors fabricated in Ref.. The validity of our theoretical approach is verified by comparisons with finite difference time domain (FDTD) simulations and the previous experimental work. Then, the theoretical calculations are used to generate training and testing data sets to train a neural network for forward prediction and inverse network. We also discuss limitations of these methods. Figure 1a,b show top-down and side view of our graphene-based systems in air medium ( 1 = 1). The systems include a square lattice of graphene nanodisks on a diamond-like carbon thin film placed on a silicon substrate. The energy of optical phonon of the diamond-like carbon thin film is expected to be the same order as this energy of diamond (165 meV). While the phonon energy of SiO 2 is approximately 55 meV and other conventional substrates have lower photon energy. Compared to other materials, the surface of diamond-like carbon films is non-polar and chemically inert due to very low trap density. The diamond-like carbon layer has a thickness of h = 60 nm and dielectric function 2 = 6.25. While the dielectric function of silicon is 3 = 11.56. The square lattice of graphene nanodisks has a lattice period, a = 270 nm, a resonator size, D = 210 nm, and a number of graphene resonator layers, N. The width between two adjacent graphene plasmons is (a − D). Under quasi-static approximations (the size is much smaller than incident wavelengths) associated with the dipole model, the polarizability of the graphene resonators as a function of frequency is analytically expressed as Optical Response of Graphene-Based Metamaterials where and are geometric parameters and () is the optical conducitivity of graphene plasmons. In Ref., authors found = 0.03801 exp −8.569Nd g /D − 0.1108 and = −0.01267 exp −45.34Nd g /D + 0.8635; here, d g = 0.334 nm is the thickness of a graphene monolayer. The N-layers graphene conductivity in mid-infrared regime can be calculated using the random-phase approximation with zero-parallel wave vector. Typically, () is contributed by both interband and intraband transitions. However, in the mid-infrared regime, the interband conductivity is ignored and we have where e is the electron charge,h is the reduced Planck constant, and is the carrier relaxation time. In our calculations,h −1 = 0.03 eV. Note that Equation is the in-plane optical conductivity. The analytical expression only validates in the low frequency regime. Effective combinations of Equations and require a strong coupling condition, which is that the ratio of the spacing distance between graphene disks to the diameter D has to be very small. In our systems, graphene disk layers are separated by a dielectric layer. Thus, for simplicity, we assume that the vertical optical conductivity is ignored. The stacking between graphene layers does not change the chemical potential, and the horizontal optical conductivity is a simple addition of layers. The reflection and transmission coefficients of the graphene-based nanostructure are where where r pq and t pq are the bulk reflection and transmission coefficients, respectively, when electromagnetic fields strike from medium p to q, c is the speed of light, and g ≈ 4.52 is the net dipolar interaction over the whole square lattice. From Equations and, the transmission |t 13 | 2 ≡ |t 13 (N)| 2 for N > 0 and N = 0 corresponding to systems with and without graphene plasmonic resonators is calculated. In experiments, experimentalists measure the relative difference in these transmissions 1-|t 13 (N)| 2 /t 13 (N = 0)| 2 and call it the extinction spectrum. A variation of this spectrum determines graphene-plasmon-induced confinement of electromagnetic fields. Simulation To validate our theoretical calculations, we use FDTD solver in Computer Simulation Technology (CST) microwave studio software to investigate the transmission properties and electromagnetic responses of the proposed metamaterial. The model of graphene in CST is described according to the Kubo formula. The dielectric function of multilayer graphene can be expressed as where 0 is the vacuum permittivity. Equation suggests an insensitivity of g () to the number of graphene layers. It means that the dielectric function of stacked multilayer graphene systems is approximately equal to that of the monolayer graphene counterpart. This assumption is relatively reasonable since, if we consider the stacked N-layer graphene disks as a film, its dielectric function is independent of the thickness. In CST simulations, the incident electromagnetic wave is perpendicular to the surface, in which the electric and magnetic components are along the y-axis and x-axis, respectively. We apply the open boundary condition along the z-axis while the periodic boundary conditions are employed along the xand y-axes. Two transmitters and receivers are located on sides of the structure along the z-axis to measure transmission scattering parameters S 21 () of the electromagnetic wave when interacting with the graphene/diamond-like carbon (DLC)/silicon medium. Then, transmittance (T) would be obtained by T() = 2. Then, the extinction spectrum can be obtained by 1 − T(N)/T 0, where T 0 is the transmittance of the structure without graphene disks on top. Deep Neural Network Although the theoretical method has many advantages in understanding physical properties of graphene nanostructures, it is difficult to predict the structural parameters for a desired spectrum. We employ the tandem network introduced in Ref. for the inverse design of our graphene-based metamaterials having N = 3 in Figure 1a. Inverse design is an ill-posed problem and many designs can be proposed to satisfy a given set of performance criteria. This is a research problem itself. There are two basic approaches. The forward simulation/prediction is used to conjugate with several search techniques (for example, genetic algorithms, Bayesian optimization). If simulation is slow, this can be expensive and time-consuming. However, since machine learning always approximates accurate simulation, this can speed up calculations but reduce the accuracy. Another approach is to use backward mapping from performance criteria back to design using machine learning models (mostly neural networks due to its flexibility). Finding multiple reasonable solutions is the most challenging problem if using this method. However, deep neural networks work very well when collecting a large amount of data, which are sequential and systematic. The calculations run very fast. In this work, the second method is employed. First, we use Equations and to generate roughly 11316 and 2860 extinction spectra for training and testing data sets, respectively. An entry of a theoretical calculation has three parameters. The diameter D of a graphene nanodisk is constrained between 100 nm and 300 nm with a step size of 5 nm, while the width is changed from 10 nm to 120 nm with a step size of 5 nm. For the chemical potential E F, we increase from 0.05 eV to 0.6 eV with a step size of 0.05 eV. Practically, E F of graphene-based biosensors and photodetectors varies from 0.17 eV to 0.45 eV and the value can be controlled by an external electric field. Each optical spectrum has 400 spectral points at a frequency range from 0.001 to 0.4 eV. Second, we use the training data set to train our neural network, which is depicted in Figure 1c. There are six hidden layers in the forward-modeling neural network. Currently, no specific formula for choosing the number of hidden layers has been revealed yet. The running time grows with an increase of the number of hidden layers while the accuracy remains nearly unchanged as having more than three layers. In many studies, one empirically prefers six layers. These layers sequentially have 1024-512-512-256-256-128 hidden units. Again, there is also no universal role to estimate the number of units in each layer. From the computer-science point of view, the number of units is typically chosen as a power of two and the latter layer is equal to or reduced by a factor of two in comparison with the previous one. Increasing the number of nodes gives more accuracy but causes long calculations. The learning rate is initialized at 0.0005. When finishing the training, a new set of structural parameters inputting to the forward network gives a predicted optical spectrum. Finally, a tandem neural network is formed by connecting the trained forward-modeling neural network to an inverse-design network with two hidden layers, which have 512 and 256 hidden units. The learning rate in the inverse design is set to 0.0001. This tandem neural network takes data points from a new/desired spectrum as an input to propose possible design parameters. Then, these design parameters are put in the trained forward-modeling neural network to generate the corresponding spectrum. The algorithm adjusts weights in the inverse network to minimize the mean square error between the real and predicted spectrum. The process is repeatedly carried out. Figure 2 shows theoretical and simulation extinction spectra with several values of graphene plasmon layers (N = 1, 3, 5 and 10). Due to absorption of electromagnetic fields by surface plasmons in graphene nanodisks, the transmission is reduced. The reduction is enhanced when increasing the number of graphene layers and the plasmonic resonance is also blue-shifted. One can observe theoretical calculations quantitatively agree with simulations, particularly N = 3 and 5. The spectral positions of optical resonances predicted using these two approaches are very close. Particularly, the system with a square lattice of three-layers-graphene disks has the plasmonic peak at 0.1 eV (∼ 806 cm −1 ). This value is fully consistent with experiment in Ref.. The excellent agreement at N = 3 indicates that optical spectra calculated by our theoretical approach is reliable to generate for deep/machine learning study. Thus, in the next calculations, we focus on the graphene-based metamaterials with N = 3. The mainframe of Figure 3 shows theoretical infrared extinction spectra of graphene-based systems with D = 210 nm and the width of 60 nm at several values of the chemical potentials. The calculations are carried out using Equations and. For E F = 0.45 eV, all structural parameters are identical to the fabricated detector in Ref.. The plasmonic peak is roughly located at 0.1 eV. The value is in a quantitative accordance with the prior experimental result. A decrease of E F not only red-shifts the surface plasmon resonance, but also significantly reduces an amplitude of the optical signal. The reason is () ∼ E F. The metal-like or plasmonic properties are lost with decreasing the chemical potential through reducing the numnber of free electrons. The inset of Figure 3 shows the sensitivity of optical spectra to the diameter of graphene nanodisks. The nearest distance between two plasmonic resonators is fixed at 60 nm. Since () ∼ D 3, the extinction cross section of a graphene nanodisk approximated by 4 Im()/c is proportional to D 3. Thus, a decrease of the diameter weakens the plasmonic coupling among resonators and lowers the optical peak. In addition, one can observe the blue-shifts in the spectrum when reducing the size of nanodisks. These behaviors suggest that increasing the size of graphene plasmons enables confining more mid-infrared optical energy. The trapped energy is highly localized in plasmonic resonators and thermally dissipates through the system. Numerical Results and Discussion Once the neural network is trained by our training and testing data sets, it can very quickly calculate a new extinction spectrum when inputting a new set of structural parameters including D, the width, and E F. The trained network is now incorporated with the inverse network to construct the tandem network for improving accuracy of inverse design. To demonstrate the validity of our deep neural network, we exame this network by predicting structural parameters for two desired spectra and show results in Figure 4. First, Equations and Again, one of the most challenging problems in the inverse design is nonuniqueness. There may be many designs having an identical performance. It is difficult to overcome this issue. In a recent work, Liu and his coworkers proposed the tandem architecture to handle the nonunique designs. However, our above calculations numerically prove that it is not universal. Clearly, the real and deep-learning-predicted structures are different. Although this result does not negate the validity of the tandem neural network for the inverse design problem, it indicates that the nonunique issue is still not handled. Furthermore, since the structure-property relationship is highly nonlinear, calculations using this tandem neural network can work well with high dimensional data features as stated in Ref., but it does not imply that the success happens at the low dimensional one. Conclusions We have investigated extinction spectra of graphene-based metamaterials using theory, simulations, and deep learning. The nanostructures have a square array of three-layers graphene nanodisks placed on the diamond-like carbon thin film on a semi-infinite silicon substrate. The polarizability of array of graphene nanodisks is calculated using the dipole model associated with the random-phase approximation. Based on this analysis, we analytically express the transmission coefficient and calculate the extinction spectra as a function of many structural parameters. The numerical results agree quantitatively well with CST simulations. Since the FDTD simulations require very large computational work and running time, the theoretical calculations are employed to generate reliable data for the tandem neural network. After training the artificial neural network, it has been used to solve the inverse design problem. Our deep learning calculations have showed that the predicted design can be accurately given for a target performance. However, calculations based on the tandem neural network do not handle the issue of nonunique design.
|
<filename>jt/segments/elements/BaseAttribute.go<gh_stars>1-10
package elements
import (
"errors"
"github.com/fileformats/graphics/jt/model"
)
type BaseAttributeElement interface {
GetBaseAttribute() *BaseAttribute
}
// Attribute Elements (e.g. colour, texture, material, lights, etc.) are placed in LSG as objects associated with nodes.
// Attribute Elements are not nodes themselves, but can be associated with any node.
type BaseAttribute struct {
JTElement `json:"-"`
// Object ID is the identifier for this Object.
// Other objects referencing this particular object do so using the Object ID
// NOTE: Deprecated. Only used in version ^8.0
ObjectId int32 `json:"-"`
// Version Number is the version identifier for this node
VersionNumber uint8 `json:"-"`
// State Flags is a collection of flags. The flags are combined using the binary OR operator and
// store various state information for Attribute Elements; such as indicating that the attributes
// accumulation is final. All bits fields that are not defined as in use should be set to 0.
// 0x01 - Unused for jt files >= v10
// = 0 – Accumulation is to occur normally
// = 1 – Accumulation is “final”
// 0x02 - Accumulation Force flag. Provides a way to assign nodes in LSG, attributes that
// shall not be overridden by ancestors
// = 0 – Accumulation of this attribute obeys ancestor‘s Final flag setting
// = 1 – Accumulation of this attribute is forced
// 0x03 - Accumulation Ignore Flag. Provides a way to indicate that the attribute is to be ignored.
// = 0 – Attribute is to be accumulated normally (subject to values of Force/Final flags)
// = 1 – Attribute is to be ignored.
// 0x08 - Attribute Persistable Flag. Provides a way to indicate that the attribute is to be persistable to a JT file.
// = 0 – Attribute is to be non-persistable.
// = 1 – Attribute is to be persistable.
StateFlags uint8 `json:"-"`
// Field Inhibit Flags is a collection of flags, each flag corresponding to a collection of state data
// within a particular Attribute type.
FieldInhibitFlags uint32 `json:"-"`
// Field Final Flags is a collection of flags, each flag being parallel to the corresponding flag in the
// Field Inhibit Flags. If the field‘s bit in Field Final Flags is set, then that field within the
// Attribute will become ―final and will not allow any subsequent accumulation into the specified field
FieldFinalFlags uint32 `json:"-"`
}
func (n *BaseAttribute) GUID() model.GUID {
return model.BaseAttributeData
}
func (n *BaseAttribute) Read(c *model.Context) error {
c.LogGroup("BaseAttribute")
defer c.LogGroupEnd()
n.ObjectId = c.Data.Int32()
c.Log("ObjectId: %d", n.ObjectId)
if c.Version.GreaterEqThan(model.V9) {
if c.Version.Equal(model.V10) {
n.VersionNumber = c.Data.UInt8()
} else {
n.VersionNumber = uint8(c.Data.Int16())
// @TODO: must check here the 2 extra flags
}
if n.VersionNumber != 1 {
return errors.New("Invalid version number")
}
}
n.StateFlags = c.Data.UInt8()
c.Log("StateFlags: %d", n.StateFlags)
n.FieldInhibitFlags = c.Data.UInt32()
c.Log("FieldInhibitFlags: %d", n.FieldInhibitFlags)
if c.Version.GreaterEqThan(model.V10) {
n.FieldFinalFlags = c.Data.UInt32()
c.Log("FieldFinalFlags: %d", n.FieldFinalFlags)
}
return c.Data.GetError()
}
func (n *BaseAttribute) ReadLight(c *model.Context) error {
c.LogGroup("BaseAttribute")
defer c.LogGroupEnd()
n.ObjectId = c.Data.Int32()
c.Log("ObjectId: %d", n.ObjectId)
if c.Version.GreaterEqThan(model.V9) {
if c.Version.Equal(model.V10) {
n.VersionNumber = c.Data.UInt8()
} else {
n.VersionNumber = uint8(c.Data.Int16())
// @TODO: must check here the 2 extra flags
}
if n.VersionNumber != 1 {
return errors.New("Invalid version number")
}
}
n.StateFlags = c.Data.UInt8()
c.Log("StateFlags: %d", n.StateFlags)
if c.Version.GreaterEqThan(model.V10) {
n.FieldFinalFlags = c.Data.UInt32()
c.Log("FieldFinalFlags: %d", n.FieldFinalFlags)
}
return c.Data.GetError()
}
func (n *BaseAttribute) BaseElement() *JTElement {
return &n.JTElement
}
|
Further study on the roles of the effector molecules of immunosuppressive macrophages induced by mycobacterial infection in expression of their suppressor function against mitogenstimulated T cell proliferation Previously, we found that phospholipids and reactive nitrogen intermediates (RNI) collaborated in expression of the T cell mitogenesisinhibitory activity of immunosuppressive macrophages induced by Mycobacterium aviumintracellulare complex (MAIC) infection. In this study, we examined the roles of free fatty acids (FFA) and prostaglandins (PG) as effectors of MAICinduced macrophages, and moreover, their collaborating effects with RNI. First, treatment of MAICinduced macrophages with quinacrine (phospholipase A2 (PLA2) inhibitor), dexamethasone (inhibitor of PLA2 and PG synthesis) or indomethacin (PG synthesis inhibitor) attenuated their suppressor activity against concanavalin A (Con A)induced mitogenesis of splenocytes (SPC), indicating important roles of FFA liberated from membrane phospholipids and PG, as effectors. Second, oleic acid, PGE2, RNI generated from NOR 4 (a new nitric oxide (NO) donor), and phosphatidylserine (PS) exhibited suppressor activity against SPC mitogenesis without showing significant cytotoxicity, in an irreversible manner. Third, the suppressor activities of RNI and PGE2 were potentiated by combined use with oleic acid in a synergistic manner. Fourth, a dualchamber experiment in which target SPC were separated from MAICinduced macrophages by a Millipore filter revealed a requirement for celltocell contact for expression of the suppressor function of MAICinduced macrophages. These findings indicate that RNI, FFA, PG, and phospholipids (presumably PS) and their collaboration play central roles in expression of the T cell mitogenesisinhibitory function of MAICinduced suppressor macrophages.
|
Lymphocytes resided in the thyroid are the main source of TSH-receptor antibodies in Basedow's-Graves' disease? The source of TSH-receptor antibodies (TRAb) in Basedow's-Graves' disease is still under debate. Previous studies by other groups had found TRAb levels in the thyroid vein higher than or equal to that in the peripheral vein. The aim of the present work was to investigate the suspected presence of this TRAb gradient in 14 Graves' patients who underwent surgery. Interestingly, in 6 patients higher levels of TRAb were measured in the antecubital vein when compared to the thyroid vein, in another 6 there was no gradient and 2 exhibited higher TRAb levels in their thyroid veins. A clear gradient of thyroid hormones in favour of the thyroid vein was also present, while no gradient of TSH, anti-thyreoglobulin and anti-microsomal antibodies, total IgG, IgA and IgM levels and no differences of the CD4+/CD8+ cell ratios were found between the two sampling sites. We conclude that cells other than lymphocytes residing in the thyroid gland must also be involved in TRAb production.
|
PAX PRIME 2013 - PAX Prime has been a good show for those looking to buy a new gaming mouse or keyboard. Gaming peripherals have been a huge aspect of this year's PAX Prime and Logitech didn't want to be left out. They brought out their recently unveiled G602 wireless mouse, which we got to go hands-on with.
The G602 gaming mouse had a good feel and provides up to 250 hours in performance mode, or up to 1400 hours in economy mode. If you'll be gaming, you'll want to make use of the performance mode. For everyday use, however, the economy mode proves to be perfectly adequate and you'll have to deal with dead batteries less often. The mouse provides a great feel and comes in at a reasonable price.
|
#include<cstdio>
#include<iostream>
#include<cstring>
#include<algorithm>
#include<cmath>
using namespace std;
int main(){
ios::sync_with_stdio(0);
long long t;
while(cin>>t){
if(t%2!=0){
cout<<"0"<<endl;
break;
}
long long k=t/2;
if(k%2==0){
cout<<(k-1)/2<<endl;
}else{
cout<<k/2<<endl;
}
}
return 0;
}
|
/**
* Bagian yang menangani pengambilan data dan menghubungkan ke network serta local database.
* Repository dibagi menjadi beberapa bagian sesaui subjectnya.
* - LocationRepository yang menghandle semua data mengenai lokasi
* - UserRepository yang menghandle semua data mengenai user
* - PetRepository yang menghandle semua data mengenai hewan
*/
public class AmeguRepository implements AmeguDataSource {
private volatile static AmeguRepository INSTANCE = null;
private final RemoteDataSource remoteDataSource;
private final LocalDataSource localDataSource;
private final AppExecutors appExecutors;
private final Context context;
private AmeguRepository(@NonNull RemoteDataSource remoteDataSource, LocalDataSource localDataSource, AppExecutors appExecutors, Context context) {
this.remoteDataSource = remoteDataSource;
this.localDataSource = localDataSource;
this.appExecutors = appExecutors;
this.context = context;
}
public static AmeguRepository getInstance(RemoteDataSource remoteDataSource, LocalDataSource localDataSource, AppExecutors appExecutors, Context context) {
if (INSTANCE == null) {
synchronized (AmeguRepository.class) {
INSTANCE = new AmeguRepository(remoteDataSource, localDataSource, appExecutors, context);
}
}
return INSTANCE;
}
public LocationRepository locationRepository() {
return LocationRepository.getInstance(remoteDataSource, localDataSource, appExecutors);
}
public UserRepository userRepository() {
return UserRepository.getInstance(remoteDataSource, localDataSource, appExecutors);
}
public PetRepository petRepository() {
return PetRepository.getInstance(remoteDataSource, localDataSource, appExecutors, context);
}
}
|
Vineyards in the Pfalz region of Germany produce notable rosés of pinot noir.
While it is now something we enjoy year-round, good rosé is still associated with the arrival of spring. In recent years, many of its stereotypes have been put aside as rosé has become more of a pink designer wine rather than an afterthought use for the remaining, less desirable juice.
Statistics show that women drink more rosé but the gender pendulum is shifting as the complex flavors casts an image that is less threatening to men. Many are adopting a “real men drink pink” attitude.
Although rosé has its own identity, it reflects the characteristics of the grape varietals used. While pinot noir is one of my favorite wines, it has taken some time for me to warm up to rosé of pinot noir, especially when it is too dry and the acidity overpowers the true flavors and aromas.
The pinot noir grape is thin-skinned and temperamental, but proper care before and after harvest can result in unmatched finesse and elegance. In rosé, pinot noir is crisp and dry with a firm acidity, but with time I have found releases that also express a true flavor profile of the grape with limited skin contact.
One such wine, the readily available 2018 La Crema Pinot Noir Rosé ($25) from Monterey County, expresses balanced flavors of watermelon, strawberry and grapefruit with mineral elements and a vibrant acidity.
Aside from the brief maceration (contact with the skins), most rosé of pinot noir come from grapes that are generally picked early, then slow-pressed and cold fermented in stainless steel tanks. Some are pressed whole-cluster and others fermented on the lees. Old stereotypes are diminished by this new diversity in style.
Most of the finest rosé of pinot noir comes from the same appellations in California, Oregon and France’s Burgundy region that produces pinot noir. Two acclaimed exceptions originate from South America and the Pfalz region in Germany.
Rising temperatures have enabled Pfalz a region in western Germany to successfully produce spätburgunder (pinot noir), known as the “heartbreak grape” because of its delicate temperament.
Founded in 1849, Reichsrat von Buhl is one of the oldest and largest wine estates in Germany, specializing in riesling, sekt (sparkling wine) and now, spätburgunder. The 2016 Reichsrat von Buhl “Bone Dry” Spätburgunder Rosé Pfalz ($17), available online and at various local outlets, has distinguished, subtle cherry aromas and spice on the palate.
Made from a variety of estate-grown fruit in Burgundy, France, the 2005 Bourgogne Pinot Noir Rosé, Chateau de Puligny Montrachet ($17) is a good value, available locally, and provides an opportunity to enjoy a true wine from the region that gave birth to pinot noir.
Warmer temperatures in Oregon’s Willamette Valley allowed the grapes to fully ripen, resulting in a nice balance of brix (sugar) and acidity in the whole- cluster pressed 2018 Gran Moraine Rosé of Pinot Noir Yamhill-Carlton ($28). Very pale salmon in color with floral and pineapple aromas, the flavors are well- integrated and the mouthfeel is both dry and creamy.
The Tous Ensemble is a series of approachable, everyday releases from Sonoma County’s Copain Wines. A cooler growing season in Mendocino County to the north allowed the harvest to occur over a period of time, resulting in a diversity of ripeness and flavor development in the 2018 Copain Tous Ensemble Rosé of Pinot Noir ($20). I found a vibrant nose combining floral notes with hints of grapefruit. The crisp, dry mouthfeel delivered flavors of melon and cherry with a spice element on the finish.
Utilizing fruit from five vineyards within the cooler Sonoma Coast appellation, Ernest Vineyards produced the Rosé of Pinot Noir 2018 “The Motley” ($18) in the saignée method that, after limited skin contact, “bleeds off” some juice before the remainder goes through complete maceration and fermentation. Released under their Eugenia label, this rosé has herbal notes that accompany traditional flavors and a vibrant acidity.
When the rain stops and the sun emerges, rosé of pinot noir belongs on your patio table aside those made from Rhone varietals like syrah and grenache.
Want more reviews and insider tips? Subscribe here to our new SF Wine and Spirits newsletter. It’s free and delivered twice monthly to your inbox. We never share your personal information.
|
Children and adolescents have a doubled risk of aggression and suicide when taking one of the five most commonly prescribed antidepressants, according to findings of a study published in The BMJ today.
However, the true risk for all associated serious harms--such as deaths, aggression, akathisia and suicidal thoughts and attempts--remains unknown for children, adolescents and adults, say experts.
This is because of the poor design of clinical trials that assess these antidepressants, and the misreporting of findings in published articles.
Selective serotonin reuptake inhibitors antidepressants (SSRIs) and serotonin-norepinephrine reuptake inhibitors (SNRIs) are the most commonly prescribed drugs for depression.
A team of researchers from Denmark carried out a systematic review and meta-analysis of 68 clinical study reports of 70 trials with 18,526 patients to examine use of antidepressants and associated serious harms.
These included deaths, suicidal thoughts and attempts as well as aggression and akathisia, a form of restlessness that may increase suicide and violence.
They examined double blind placebo controlled trials that contained patient narratives or individual patient listings of associated harms.
Harms associated with antidepressants are often not included in published trial reports, explain the authors. This is why they analysed clinical study reports, prepared by pharmaceutical companies for market authorisation, and summary trial reports, both of which usually include more information.
In adults, they found no significant associations between antidepressants and suicide and aggression. However, a novel finding showed there was a doubling of risk for aggression and suicides in children and adolescents.
This study has shown limitations in trials, not only in design, but also in reporting of clinical study reports, which may have lead to "serious under-estimation of the harms," write the authors.
They compared the results from the clinical study reports with data from individual patient listings or narratives of adverse effects. This revealed misclassification of deaths and suicidal events in people taking antidepressants.
For example, four deaths were misreported by a pharmaceutical company, in all cases favouring the antidepressant, and more than half of the suicide attempts and suicidal ideation, for example, were coded as "emotional lability" or "worsening of depression."
In the Eli Lilly summary trial reports, almost all deaths were noted, but suicidal attempts were missing in 90% of instances, and information on other outcomes was incomplete. These were "even more unreliable than we previously suspected," write the authors.
Clinical study reports for antidepressants duloxetine, fluoxetine, paroxetine, sertraline and venlafaxine were obtained from regulatory agencies in the UK and Europe. Summary trial reports for duloxetine and fluoxetine were taken from the drug company Eli Lilly's website.
However, clinical study reports could not be obtained for all trials and all antidepressants, and individual listings of adverse outcomes for all patients were available for only 32 trials.
"The true risk for serious harms is still unknown [because] the low incidence of these rare events, and the poor design and reporting of the trials, makes it difficult to get accurate effect estimates," they explain.
They recommend "minimal use of antidepressants in children, adolescents, and young adults, as the serious harms seem to be greater, and as their effect seems to be below what is clinically relevant," and suggest alternative treatments such as exercise or psychotherapy.
They also call for the need to identify "hidden information in clinical study reports to form a more accurate view of the benefits and harms of drugs."
In an accompanying editorial, Joanna Moncrieff from University College London, agrees that "regulators and the public need access to more comprehensive and reliable data", and that clinical study reports "are likely to underestimate the extent of drug related harms."
Over half the clinical study reports had no individual patient listings and "this begs the question of how many more adverse events would have been revealed if [these] were available for all trials, and raises concerns why this information is allowed to be withheld."
###
|
<reponame>IryArkhy/nest-auth-example<filename>src/app.controller.ts
import { Controller, Get, Post, Request, UseGuards } from '@nestjs/common';
import { AuthService } from './auth/auth.service';
import { JwtAuthGuard } from './auth/guards/jwt-auth.guard';
import { LocalAuthGuard } from './auth/guards/local-auth.guard';
@Controller()
export class AppController {
constructor(private readonly authService: AuthService) { }
//Now we can update the /auth/login route to return a JWT.
@UseGuards(LocalAuthGuard) //create gouarded routes
@Post('auth/login')
async login(@Request() req) {
return this.authService.login(req.user); //returns token
}
//^^^ for checking use command: curl -X POST http://localhost:3000/auth/login -d '{"username": "john", "password": "<PASSWORD>"}' -H "Content-Type: application/json"
//Protects this route and requires Bearer token for authorization
//^^^ for checking use 1)command: curl -X POST http://localhost:3000/auth/login -d '{"username": "john", "password": "<PASSWORD>"}' -H "Content-Type: application/json"
//Get token
//curl http://localhost:3000/profile -H "Authorization: Bearer previous_token" ---> {"userId":1,"username":"john"}
@UseGuards(JwtAuthGuard)
@Get('profile')
getProfile(@Request() req) {
return req.user;
}
}
|
package me.wallhacks.spark.manager;
import me.wallhacks.spark.Spark;
import me.wallhacks.spark.event.player.PacketReceiveEvent;
import me.wallhacks.spark.event.world.WorldLoadEvent;
import me.wallhacks.spark.systems.module.Module;
import me.wallhacks.spark.systems.module.modules.combat.CevBreaker;
import me.wallhacks.spark.systems.module.modules.combat.CrystalAura;
import me.wallhacks.spark.systems.module.modules.combat.KillAura;
import me.wallhacks.spark.systems.module.modules.combat.ShulkerAura;
import me.wallhacks.spark.systems.module.modules.misc.AutoGG;
import me.wallhacks.spark.util.MC;
import me.wallhacks.spark.util.StringUtil;
import me.wallhacks.spark.util.objects.Notification;
import net.minecraft.client.network.NetHandlerPlayClient;
import net.minecraft.entity.Entity;
import net.minecraft.entity.EntityLivingBase;
import net.minecraft.entity.player.EntityPlayer;
import net.minecraft.network.datasync.EntityDataManager;
import net.minecraft.network.play.server.SPacketDestroyEntities;
import net.minecraft.network.play.server.SPacketEntityMetadata;
import net.minecraft.network.play.server.SPacketEntityStatus;
import net.minecraft.network.play.server.SPacketUpdateHealth;
import net.minecraftforge.fml.common.eventhandler.SubscribeEvent;
import me.wallhacks.spark.systems.hud.huds.Notifications;
import java.util.ArrayList;
import java.util.Map;
import java.util.concurrent.ConcurrentHashMap;
public class CombatManager implements MC {
public CombatManager() {
Spark.eventBus.register(this);
}
private Map<String, Integer> popList = new ConcurrentHashMap<>();
private ArrayList<Kill> kills = new ArrayList<>();
String lastServer;
@SubscribeEvent
public void onWorld(WorldLoadEvent event) {
String server = StringUtil.getServerName(mc.getCurrentServerData());
if(server != null && !server.equals(lastServer))
{
popList.clear();
kills.clear();
lastServer = server;
}
}
@SubscribeEvent
public void onPacketReceive(PacketReceiveEvent event) {
if (event.getPacket() instanceof SPacketEntityStatus) {
SPacketEntityStatus packet = event.getPacket();
if (packet.getOpCode() == 35 && packet.getEntity(mc.world) instanceof EntityPlayer) {
handlePop((EntityPlayer) packet.getEntity(mc.world));
}
}
if (event.getPacket() instanceof SPacketEntityMetadata) {
SPacketEntityMetadata packet = event.getPacket();
if(mc.world.getEntityByID(packet.getEntityId()) instanceof EntityPlayer)
{
for (EntityDataManager.DataEntry v : packet.getDataManagerEntries()) {
if (v.getKey().equals(EntityLivingBase.HEALTH) && (float)v.getValue() <= 0) {
handleDeath((EntityPlayer) mc.world.getEntityByID(packet.getEntityId()));
}
}
}
}
}
void handleDeath(EntityPlayer player) {
int diedAfterPops = getTotemPops(player);
if(mc.player != player)
{
if (Notifications.INSTANCE.death.getValue() && Notifications.INSTANCE.isEnabled())
Notifications.addNotification(new Notification(StringUtil.getDeathString(player,diedAfterPops),player));
//detect if we killed him/her
Module killedWith = null;
if(player.equals(CrystalAura.instance.getTarget()))
killedWith = CrystalAura.instance;
else if(player.equals(KillAura.instance.getTarget()))
killedWith = KillAura.instance;
else if(CevBreaker.INSTANCE.isInAttackZone(player))
killedWith = CevBreaker.INSTANCE;
else if(ShulkerAura.INSTANCE.isInAttackZone(player))
killedWith = ShulkerAura.INSTANCE;
if(killedWith != null)
{
if(AutoGG.instance.isEnabled())
AutoGG.instance.onKilledPlayer(player,diedAfterPops);
//looks like we killed him/her :(
kills.add(new Kill(Spark.socialManager.getSocial(player.getName()),killedWith));
}
}
this.setTotemPops(player, 0);
}
void handlePop(EntityPlayer player) {
this.popList.merge(player.getName(), 1, Integer::sum);
if (!player.equals(mc.player) && player.isEntityAlive() && Notifications.INSTANCE.pop.getValue() && Notifications.INSTANCE.isEnabled()) {
Notifications.addNotification(new Notification(StringUtil.getPopString(player,getTotemPops(player)),player));
}
}
void setTotemPops(EntityPlayer player, int amount) {
this.popList.put(player.getName(), amount);
}
public int getTotemPops(EntityPlayer player) {
return this.popList.containsKey(player.getName()) ? this.popList.get(player.getName()) : 0;
}
public class Kill{
public Kill(SocialManager.SocialEntry playerKilled, Module killedWith) {
this.playerKilled = playerKilled;
this.killedWith = killedWith;
}
public SocialManager.SocialEntry getPlayerKilled() {
return playerKilled;
}
public Module getKilledWith() {
return killedWith;
}
final SocialManager.SocialEntry playerKilled;
final Module killedWith;
}
}
|
Let regionalization continue to evolve. This commentary provides a practical perspective on the benefits of regionalization within the context of the lead paper by Lewis and Kouri. Discussion of the best structure of health systems needs to take into account the reality that constitutional and funding responsibility--and therefore accountability--for our healthcare system lies with provincial governments. Accountability at the provincial government level is simply a part of regionalization and should be expected by health system managers. Regionalization of healthcare is in its infancy. Systems necessary to support regionalization, which can only be established under a regionalized structure (e.g., information technology, procurement, human resources and service planning), are evolving. Given the size and complexity of the healthcare system, as we gain more experience with regionalization the systems we need to support it will attain their potential, as will the managers of the system. Regionalization was the most appropriate option for healthcare in the 1990s given the objectives of provincial governments to achieve efficiencies, better utilize resources and improve patient care. We must allow regionalization to evolve in order to see long-term improvements in the healthcare system.
|
import time
from adafruit_servokit import ServoKit
kit = ServoKit(channels=16)
def mouth(action):
if(action == 0):
print("openMouth")
kit.servo[0].angle = 40
if(action == 1):
print("close")
kit.servo[0].angle = 180
if(action == 2):
print("talk")
#kit.servo[0].angle = 180
while True:
kit.servo[0].angle = 140
time.sleep(0.5)
kit.servo[0].angle = 100
time.sleep(1)
kit.servo[0].angle = 180
time.sleep(0.75)
kit.servo[0].angle = 120
time.sleep(0.5)
if(action == 3):
print("munch")
while True:
#kit.servo[0].angle = 180
kit.continuous_servo[0].throttle = 1
time.sleep(1.25)
kit.continuous_servo[0].throttle = -1
#time.sleep(1)
#kit.servo[0].angle = 0
kit.continuous_servo[0].throttle = 0
time.sleep(1.25)
elif((action < 0) or (action > 4)):
print("No action.")
|
Of the 338 Triple-A hitters who have recorded at least 200 plate appearances this season, only two have an isolated-power (ISO) mark north of .300. The first is Richie Shaffer, an interesting Rays prospect who spent some time in the big leagues this season. The second is a player by the name of Jabari Blash. No, that’s not a character from Harry Potter, or even an Edith Wharton novel. Jabari Blash is a real, live outfielder in the Mariners organization.
Blash has hit a ridiculous .246/.370/.624 in 50 games at the Triple-A level this year. Prior to that, he slashed a similarly ridiculous .278/.383/.517 in 60 Double-A contests. But it’s his very recent performance that really stands out. Since August 6th, the 6-foot-5 slugger has put together a .292/.395/.785 performance on the strength of his 10 home runs. Those are essentially peak Mark McGwire numbers.
Blash’s stats are great. His downside, however, is that he just turned 26. Players who are 26 don’t normally come up in prospect discussions. Most 26-year-old baseball players are either big leaguers or minor leaguers who aren’t worth thinking twice about. Blash, however, might be worthy of a second thought.
I first became aware of Blash a couple of months ago, when his name turned up in my search for the next Paul Goldschmidt. Blash’s performance at Double-A this year was very similar to Goldschmidt’s the year he made his debut. Both were relatively old for the Double-A level, hit for a ton of power, and went down on strikes in over 20% of their trips to the plate.
It goes without saying that Paul Goldschmidt is some mighty fine company. However, although their Double-A numbers are similar, comparing Blash to Goldschmidt wouldn’t be fair to anyone involved. For one, comparing any minor leaguer to Goldschmidt is a bit silly since hardly anyone develops the way Goldschmidt did. Furthermore, Blash is two years older than Goldschmidt was when he put together his tremendous Double-A campaign.
Blash may not be the next Paul Goldschmidt, but that’s not to say he can’t be a productive big leaguer. After all, he’s already proven he’s an excellent minor leaguer; and many of the best minor leaguers also find success at the game’s highest level. Let’s dive into the stats to see what his odds look like.
The Mariners took Blash in the eighth round out of Miami-Dade College way back in 2010, and he’s hit for crazy amounts of power ever since. Blash’s rattled off 224 extra base hits as a pro, leading to a .237 ISO. This year, he’s really outdone himself by posting an even better .284 ISO. In addition to his mammoth power, Blash also draws walks (12% walk rate this year) and swipes the occasional base, which helps diversify his offensive skill set.
As is with many powerful minor-league hitters, though, Blash’s power comes with loads of strikeouts. He’s whiffed in 27% of his career trips to the plate, including 26% this year. The power is great, but Blash’s lack of contact is very concerning.
As a result, KATOH isn’t really buying what Blash is selling. My system pegs him for a meager 1.3 WAR through age 28 with a 56% chance of cracking the big leagues over that span. It’s worth noting that Blash is closer to his age-28 season than most prospects, but even so, 1.3 WAR over the next three years isn’t particularly appealing.
The statistical comps echo KATOH’s pessimism. We basically see a few platoon hitters surrounded by a bunch of Quad-A types. Using league-adjusted, regressed stats, along with age, I calculated the Mahalanobis Distance between Blash’s performance in Double-A this year and every season in Double-A since 1990 in which a batter recorded at least 400 plate appearances. Below, you’ll find a list of historical players whose performances were nearest and dearest to Blash’s, ranked from most to least similar.
Jabari Blash’s Statistical Comps (AA) Rank Mah Dist Player Career PA Career WAR 1 0.68 Tarrik Brock 16 0.0 2 0.77 Deik Scram 0 0.0 3 1.06 Mike Wilson 28 0.0 4 1.15 Pork Chop Pough 0 0.0 5 1.17 Michael Hollimon 25 0.1 6 1.26 Donny Leon 0 0.0 7 1.36 Keon Broxton* 0 0.0 8 1.37 Joe Koshansky 55 0.0 9 1.38 Stefan Gartrell 0 0.0 10 1.56 Kinnis Pledger 0 0.0 *Hitters who are still active in affiliated ball
I also repeated the exercise for Blash’s Triple-A numbers.
Kiley McDaniel had the opportunity to see Blash earlier this season, and ultimately came to the same conclusion. He reported average speed and 55-60 grade power and arm strength, labeling him an “NFL type dude” due to his size and athleticism. But despite his raw physical tools, Blash’s deep load and long arms make him an all-or-nothing hitter, which explains his plentiful strikeouts. Overall, Kiley isn’t fan of Blash’s late-count, low-contact hitting style, noting that hitters with this profile destroy minor-league pitching, but usually don’t fare as well in the majors. This is one of those instances where both the stats and the scouts agree. The major leagues aren’t kind to high-minors sluggers with contact problems who are in their mid-20s.
With an OPS north of .850 in more than 500 minor-league games, it goes without saying that Blash has earned his shot. And given his recent performance, along with the looming roster expansion, that shot will almost certainly come sooner rather than later. More likely than not, Blash will go down as yet another Quad-A slugger who couldn’t make enough contact to have sustainable success in the big leagues. But according to the data, there’s a reasonable chance he turns into a useful platoon bat. I, for one, hope he takes after Mike Carp or Casper Wells and sticks around awhile. If for no other reason, Major League Baseball could use a guy named Jabari Blash.
|
/*
* Copyright (c) 2018 Qualcomm Technologies, Inc.
* All Rights Reserved.
*/
// Copyright (c) 2018 Qualcomm Technologies, Inc.
// All rights reserved.
// Redistribution and use in source and binary forms, with or without modification, are permitted (subject to the limitations in the disclaimer below)
// provided that the following conditions are met:
// Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer.
// Redistributions in binary form must reproduce the above copyright notice,
// this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution.
// Neither the name of Qualcomm Technologies, Inc. nor the names of its contributors may be used to endorse or promote products derived
// from this software without specific prior written permission.
// NO EXPRESS OR IMPLIED LICENSES TO ANY PARTY'S PATENT RIGHTS ARE GRANTED BY THIS LICENSE.
// THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING,
// BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED.
// IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY,
// OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES;
// LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY,
// WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE,
// EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
/*-------------------------------------------------------------------------
* Include Files
*-----------------------------------------------------------------------*/
#ifndef __QC_API_MQTT_H
#define __QC_API_MQTT_H
#include <stdlib.h>
#include <string.h>
#include "qcli_api.h"
#include "qurt_signal.h"
#include "net_bench.h"
#include "net_utils.h"
#include "qapi_mqttc.h"
/*-------------------------------------------------------------------------
* Function prototypes
*-----------------------------------------------------------------------*/
QCLI_Command_Status_t qc_api_mqttc_init(uint32_t Parameter_Count, char *ca_file);
QCLI_Command_Status_t qc_api_mqttc_shut(void);
QCLI_Command_Status_t qc_api_mqttc_new(uint32_t Parameter_Count, QCLI_Parameter_t *Parameter_List);
QCLI_Command_Status_t qc_api_mqttc_destroy(uint32_t Parameter_Count, int32_t id);
QCLI_Command_Status_t qc_api_mqttc_config(uint32_t Parameter_Count, QCLI_Parameter_t *Parameter_List);
QCLI_Command_Status_t qc_api_mqttc_connect(uint32_t Parameter_Count, QCLI_Parameter_t *Parameter_List);
QCLI_Command_Status_t qc_api_mqttc_sub(uint32_t Parameter_Count, QCLI_Parameter_t *Parameter_List);
QCLI_Command_Status_t qc_api_mqttc_pub(uint32_t Parameter_Count, QCLI_Parameter_t *Parameter_List);
QCLI_Command_Status_t qc_api_mqttc_unsub(uint32_t Parameter_Count, QCLI_Parameter_t *Parameter_List);
QCLI_Command_Status_t qc_api_mqttc_disconnect(uint32_t Parameter_Count, int32_t id);
QCLI_Command_Status_t qc_api_mqttc_sslconfig(uint32_t Parameter_Count, QCLI_Parameter_t *Parameter_List);
#endif // _MQTT_API_H_
|
Gerald Patterson was a U.S. Navy veteran, a minister and a father to three children, family said.
Gerald Patterson, age 57, died Aug. 31, at his home. (Photo: Courtesy of the Patterson family.)
Gerald W.V. Patterson, the Libertarian candidate for the mayor of Wilmington, died on Aug. 31, the Department of Elections learned Friday.
Patterson was slated to appear on the ballot for the November general election along with Independent Steven Washington, Republican Robert Martin and the winner of Tuesday's Democratic primary.
Patterson, 57, was an ordained minister and entrepreneur, according to his mother, Gracie A. Cooper, 75. He was a father of a daughter, 33, and two sons, ages 29 and 32, she said.
"He was a gifted salesman, strong talker, very determined man," she said by phone from Patterson's hometown of Kansas City, Missouri. "Once he set his mind to something, he intended to accomplish it."
Cooper said she spoke to her son once a week and last heard from him on Aug. 28. He was found dead in his home two days later. The cause of death is unknown, she said, but foul play is not suspected.
Patterson, who Cooper said was outgoing and could usually be found wearing a suit, had lived in Wilmington for about five years.
"He would talk about what he’d like to do for Wilmington," Cooper said. "He wanted to serve the community."
Patterson was also a U.S. Navy veteran, the Congo Funeral Home said.
Patterson's campaign for mayor did not involve yard signs, billboards or door hangers. Instead, he appears to have promoted himself to voters on Craigslist, according to an ad posted 16 days ago. A phone number posted on the ad directs callers to a raspy 22-minute monologue, apparently prerecorded by the candidate in which he introduces himself: "W as in winning, V as in victory ... It is my sole desire to serve you all."
COLUMN: The "Libertarian Moment' is over, or is it?
STORY: Spotty voting records for some Wilmington candidates
In the recording and on the Craigslist ad, Patterson seems to outline his mayoral goals. The ad, written with all capitalized letters, states that Patterson would only accept $1 of his mayoral salary and would donate the rest to "A Special Trust Fund Called Loves Haven For The Seniors, Residents And Businesses Who Are In Need Of Financial Assistance."
Anthony Albence, director of the New Castle County Department of Elections, said it's too late for the Libertarian Party to submit an additional candidate for the November election.
Scott Gesty of the Libertarian Party of Delaware said the situation is unexpected.
"We are disappointed that we will not be able to offer the people of Wilmington different choice in this election. As we continue to grow as a party, we look forward to putting more candidates on the ballot in future elections," he said in a statement.
Contact Christina Jedra at [email protected], (302) 324-2837 or on Twitter @ChristinaJedra.
Correction: An earlier version of this article incorrectly stated that Gerald Patterson would be listed on the November ballot. He was slated to appear on the ballot before his death.
Read or Share this story: http://delonline.us/2cdexDz
|
<filename>packages/base/src/components/transitions.tsx
import * as React from 'react';
import styled, { css } from 'styled-components';
interface IProps {
TransitionComponent: any // TODO
hidden: boolean
transition: number
visible: number
delay: number
duration: number
timingFunc: string
noInitialEnter: boolean
innerRef?: any
noEnter: boolean
noExit: boolean
hideOnExit: boolean
}
interface IState {
initiallyVisible: boolean
status: string
}
const getDelay = ({ delay }: IProps) => delay || 0;
const getDuration = ({ duration }: IProps) => duration || 500;
const getTimingFunction = ({ timingFunc }: IProps) => timingFunc || 'ease-out';
const getStatusChangeDelay = (props: IProps) => getDelay(props) + getDuration(props);
// TransitionFade is default transition component using
// opacity and visibility.
export const TransitionFade = styled.div`
${(props: IProps) => (
props.hidden ? css`
display: none;
` : null)}
${(props: IProps) =>
(props.transition ?
css`
transition: visibility ${getDuration}ms ${getTimingFunction} ${getDelay}ms,
opacity ${getDuration}ms ${getTimingFunction} ${getDelay}ms;
` : '')}
${(props) =>
(props.visible
? css`
visibility: visible;
opacity: 1;
`
: css`
visibility: hidden;
opacity: 0;
`)}
`;
export enum TransitionState {
UNMOUNTED = 'unmounted',
ENTERING = 'entering',
ENTERED = 'entered',
EXITING = 'exiting',
EXITED = 'exited',
}
type Cancellable = { cancel: () => void }
type Callback = () => void
export class TransitionWithoutForwardingRef extends React.Component<IProps, IState> {
static defaultProps = {
transition: TransitionFade
}
refTransition: any
nextCallback: any // TODO! this is actually -> null | Cancellable | Callback
constructor(props: IProps) {
super(props);
this.state = {
status: TransitionState.UNMOUNTED,
initiallyVisible: !props.hidden,
};
this.refTransition = this.props.innerRef || React.createRef();
this.nextCallback = null;
}
componentDidMount() {
const { initiallyVisible } = this.state;
const { noInitialEnter } = this.props;
if (initiallyVisible) {
if (noInitialEnter) {
// eslint-disable-next-line react/no-did-mount-set-state
this.setState({ status: TransitionState.ENTERED });
} else {
this.forceUpdate();
// eslint-disable-next-line react/no-did-mount-set-state
this.setState({ status: TransitionState.ENTERING }, () => {
this.setNextCallback(
() => this.setState({ status: TransitionState.ENTERED }),
getStatusChangeDelay(this.props),
);
});
}
} else {
// eslint-disable-next-line react/no-did-mount-set-state
this.setState({ status: TransitionState.EXITED });
}
}
componentDidUpdate(prevProps) {
const { noEnter, noExit, hideOnExit } = this.props;
let nextStatus: string | null = null;
let nextStatusCallback: null | Callback = null;
if (prevProps !== this.props) {
const { status } = this.state;
if (this.props.hidden) {
if (status === TransitionState.ENTERING || status === TransitionState.ENTERED) {
if (noExit) {
nextStatus = TransitionState.EXITED;
} else {
nextStatus = TransitionState.EXITING;
nextStatusCallback = () => this.setState({ status: TransitionState.EXITED });
}
}
} else if (status === TransitionState.EXITING || status === TransitionState.EXITED) {
if (noEnter) {
nextStatus = TransitionState.ENTERED;
} else if (hideOnExit) {
// If we were hidden (display: none), then we should first render
// component with normal display.
// This special case renders components without hidden, then renders
// it with as visible, and after transition it will update status
// to ENTERED.
// eslint-disable-next-line react/no-did-update-set-state
this.setState({ status: TransitionState.UNMOUNTED }, () => {
this.setNextCallback(() => this.setState({ status: TransitionState.ENTERING }, () => {
this.setNextCallback(
() => this.setState({ status: TransitionState.ENTERED }),
getStatusChangeDelay(this.props),
);
}), 0);
});
return;
} else {
nextStatus = TransitionState.ENTERING;
nextStatusCallback = () => this.setState({ status: TransitionState.ENTERED });
}
}
}
if (nextStatus != null) {
// eslint-disable-next-line react/no-did-update-set-state
this.setState({ status: nextStatus }, () => {
this.setNextCallback(nextStatusCallback, getStatusChangeDelay(this.props));
});
}
}
componentWillUnmount() {
if (this.nextCallback != null) {
this.nextCallback.cancel();
}
}
setNextCallback(callback: Callback | null, delay: number) {
// This method helps to avoid multiple simultaneous callbacks.
// It clears already set callbacks and schedules new one.
if (this.nextCallback != null) {
if (this.nextCallback.cancel) {
this.nextCallback.cancel();
}
}
let active = true;
this.nextCallback = () => {
if (!active) { return; }
active = false;
this.nextCallback = null;
if (callback != null) {
callback();
}
};
if (this.nextCallback) {
this.nextCallback.cancel = () => {
active = false;
};
}
setTimeout(this.nextCallback, delay);
return this.nextCallback;
}
forceUpdate() {
// Force repaint for transitions to work
// eslint-disable-next-line no-unused-expressions
this.refTransition.current && this.refTransition.current.scrollTop;
}
render() {
const {
innerRef,
TransitionComponent,
children,
noExit,
noEnter,
noInitialEnter,
hideOnExit,
...transitionProps
} = this.props;
const { status } = this.state;
delete transitionProps.hidden; /* We can't use `hidden` as it just hides element */
transitionProps.hidden = status === TransitionState.EXITED && hideOnExit;
transitionProps.visible = (status === TransitionState.ENTERING || status === TransitionState.ENTERED) ? 1 : 0;
transitionProps.transition =
((status === TransitionState.ENTERING || status === TransitionState.ENTERED) && !noEnter) ||
((status === TransitionState.EXITING || status === TransitionState.EXITED) && !noExit)
? 1
: 0;
return (
<TransitionComponent ref={this.refTransition} {...transitionProps}>
{children}
</TransitionComponent>
);
}
}
export const Transition = React.forwardRef<HTMLElement, IProps>((props: IProps, ref: React.Ref<HTMLElement>) => (
<TransitionWithoutForwardingRef innerRef={ref} {...props} />
));
|
def nearest_value_idx(self,value,value_arr):
idx = np.searchsorted(value_arr, value, side="left")
if idx > 0 and (idx == len(value_arr) or math.fabs(value- value_arr[idx-1]) < math.fabs(value - value_arr[idx])):
return idx-1
else:
return idx
|
As China’s vice-premier Li Keqiang left Britain after a nine-day shopping trip to Europe, the man tipped to become the emerging superpower’s next prime minister probably reflected that the latest phase in his country’s quest for dominance was going nicely to plan.
Li’s procurement extravaganza ended with a low-carbon flavour in Watford, just north of London, as the UK’s business secretary, Vince Cable, gave the 150-strong Chinese delegation a tour of a sustainable housing community.
It brought to a close a four-day visit to Britain, a trip that has also taken in Germany and Spain and resulted in more than $20-billion in orders for luxury European items, from wine and olive oil to Mercedes cars.
With the latest data showing that China’s foreign exchange reserves jumped by a record $199-billion in the final three months of 2010 to an all-time high of $2,85-trillion, these shopping excursions are set to become bigger and more frequent.
There is nothing new in China buying the assets and debts of countries and companies around the world with the huge foreign currency reserves it accumulates by producing cheap goods that the rest of the world wants to buy. But the speed with which these reserves has grown as China’s economic juggernaut consistently outpaces every other economy is enabling it to exert an ever-tighter grip on global business, finance and, in turn, politics.
Gerard Lyons, the chief economist and group head of global research at Standard Chartered, said: “The last decade could be characterised by the three words, ‘made in China’.
China kicked off its foreign ownership phase about 10 years ago when it started buying United States treasury bonds. These transactions, which involved China exchanging huge amounts of yuan for US dollars, kept the Chinese currency artificially low, ensuring that its exports remained attractive.
The value of US treasury bonds owned by China soared from $59,5-billion to $906,8-billion in the 10 years to October 2010, to account for 21% of the American government’s entire outstanding debt and more than a third of China’s foreign currency reserves.
Around the middle of the last decade, China began turning its attention to securing the natural resources it would need to cater for its growing population and manufacturing base, snapping up commodities such as iron ore, gold and platinum that it needs as raw materials, as well as land to grow food and timber. Most of these deals were struck in Africa.
In 2008 China branched out further, investing in struggling US banks such as Citigroup and the now defunct Bear Stearns and last year it raised its investment in European government bonds.
China has made public commitments to buy the debt issued by Greece and Portugal, in spite of America’s Pimco, the largest buyer of sovereign debt, declaring the euro countries “a danger zone”. Furthermore, China, which already owns 13% of Spanish government debt, has pledged to buy another €6-billion worth this year as it seeks to diversify holdings away from US dollar-denominated assets.
Analysts said it makes good financial sense to have a diversified investment portfolio, while keeping the euro and eurozone economies strong.
Europe consumes 16% of China’s exports. If the currency disbanded, or some members were forced to leave the eurozone and adopt weaker sovereign currencies, they would be less able to afford to buy Chinese goods, while their own products would become relatively more attractive as exports.
In the latest phase of its global development China is furiously sourcing luxury goods for its fast-growing middle class and sophisticated technology to take its manufacturing upmarket.
“China has moved into a new phase where it has started getting quite vocal about the global economy and is really staking a claim to being a superpower,” said Kathleen Brooks, the research director at online foreign exchange trading company Forex.com. She dates China’s change in attitude to the moment when its foreign currency reserves breached the $2-trillion mark in July 2009.
But experts said China’s growing prosperity represents a great opportunity as well as a threat. With China due to rubber-stamp its 12th five-year plan this year - with the stated aim of using its financial clout to move upmarket—there are huge opportunities for developed economies.
Those watching China’s mammoth shopping spree in recent years might have concluded that it is all about oil or other natural resources.
At first glance, the deal to save the Grangemouth refinery in southeast Scotland fits perfectly into this narrative. As the world’s second-largest economy continues to boom its hunger for resources has far outstripped its ability to produce them. From Sudan to Iran and from Australia to Afghanistan it has sought new supplies, not just of oil and coal but of copper, rubber and crops.
“In the 1990s oil was the first energy source in which China started becoming a net importer. Then, as time went on, gas was imported, too. In the past year it’s become a net importer of coal,” said Zhou Xizhou, the associate director of energy consultancy IHS Cera.
But take another look at PetroChina’s new joint venture with Ineos, Grangemouth’s owner, and it appears rather more complicated. The refinery is a long way from the Pearl River Delta’s manufacturing heartland and it seems unlikely that the Chinese plan to ship the stuff home.
Si Bingjun, the general manager of PetroChina International London, said the company’s strategy was to build a broader business platform in Europe.
As Zhou points out, even China’s energy acquisitions have been driven not just by direct demand but by its broader economic development, specifically by the changes at state-owned companies that began to raise large sums of money through share offerings.
While energy commodities have dominated Chinese purchases, they are certainly not the only acquisitions. In the past few years Chinese firms have invested in Swedish car companies and British menswear retailers; in Spanish olive oil as well as Venezuelan crude oil.
And if state-owned companies boast the biggest wallets, private enterprise seems just as keen to get its hands on assets overseas, drawn by the prospect of profit rather than diktat from above. Of course, there are other strategic advantages for China in such deals.
It is keen to shore up the faltering European economy—the European Union is its largest trade partner—and deflect pressure to allow the yuan to appreciate.
But its purchases owe much to market forces as well as to a political blueprint. Zhou pointed out that recent energy deals also reflect the keenness of producing countries to sell. That dynamic was underlined by the global economic crisis, when China snapped up tens of billions of dollars worth of assets.
Keen to invest in China and India?
|
First and foremost, you can find out where to vote by clicking here.
visiting www.nyc.gov and take part in the 2008 election to have your voice heard. In New York, polls are open from 6 am to 9 pm.
Election Day. This information can be found on the registration confirmation card sent to you by the Board of Elections after you registered and on the information card also sent to you by the Board of Elections prior to the primary elections. Please call 311, the Board of Elections hotline at 1-866-VOTE-NYC (866-868-3692), your local Borough Board of Elections, or visit www.nyc.gov to locate this information.
Chinese and Korean. You can also bring information in your native language into the voting booth.
If you have a disability, a Ballot Marking Device (BMD) will be available at each poll site.
Election Day, you will not have to provide identification when you vote. If you are not sure, please bring an acceptable identification. Acceptable IDs include: a valid photo ID, a current utility bill, bank statement, government check or some other government document that shows your name and address. If you still do not have identification, you will be asked to vote by affidavit ballot (paper ballot), instead of on the machine. Your identity will then be checked and your vote will be counted if you are found to be properly registered.
other campaign-related materials to poll-sites or within 100-feet of poll site entrances. So when you come out to vote on Election Day, make sure you leave these materials at home or you may not be admitted to your poll site.
Absentee ballots for the upcoming General Election must be postmarked no later than November 3rd. They may also be delivered by hand to the home borough office for a voter who is unable to vote at the polls because of an accident or illness, no later than 9 pm on November 4th, Election Day. The five Board of Elections Borough Offices will be open for extended hours from October 20th through November 3rd to accommodate Absentee Ballots being delivered in person.
For questions on absentee ballots call 866-VOTE-NYC or 212-868-3692.
To find out where your poll site is located please visit www.nyc.gov or call 311. New Yorkers can also call or visit their local New York City Board of Elections office in the five boroughs.
|
Attitude Active Disturbance Rejection Control of the Quadrotor and Its Parameter Tuning The internal uncertainty and external disturbance of the quadrotor will have a significant impact on flight control. Therefore, to improve the control systems dynamic performance and robustness, the attitude active disturbance rejection controller (ADRC) of the quadrotor is established. Simultaneously, an adaptive genetic algorithm-particle swarm optimization (AGA-PSO) is used to optimize the controller parameters to solve the problem that the controller parameters are difficult to tune. The performance of the proposed ADRC is compared with that of the sliding mode controller (SMC). The simulations revealed that the dynamic performance and robustness of the ADRC is better than that of the SMC.
|
Exploration of React Native Framework in designing a Rule-Based Application for healthy lifestyle education Researches indicates the implementation of hybrid applications is more profitable for mobile application development solutions. Hybrid application combine the advantages of web and native application. React Native is a hybrid framework for developing mobile applications. React Native framework can create within two platform applications by compiling the code written in React. The utilization of React Native in a rule-based application can build a solution for healthy lifestyle education. The aim of this study is to build a rule-based application for healthy reminder in daily activities. By developing an application in React Native, the study will design a comprehensive mobile application that make users easy to use. Moreover, this study will explore and construct an application that guide the user to maintain their daily health. To develop the application, author uses waterfall methodology. Before building the application, a systematic survey was conducted to gain relevant data from the users and also to invent a rule-based that will be the way of thinking of the application design. The results indicate that React Native framework can be utilized in building a reminder application about healthy lifestyle education. This study built a mobile application product that has good performance and helps users change the lifestyle in order to improve the quality of a healthy lifestyle.
|
Synthesis, In Vitro Antimicrobial and Cytotoxic Activities of Some New Pyrazolopyrimidine Derivatives A new series of pyrazole 47 and pyrazolopyrimidine 813 were synthesized by using a simple, efficient procedure, and screened for their in-vitro antimicrobial and antitumor activities. Symmetrical and asymmetrical 3,6-diarylazo-2,5,7-triaminopyrazolopyrimidine were synthesized by the conventional method and also subjected to microwave irradiation and under ultrasound conditions. The biological results revealed that most of the tested compounds proved to be active as antibacterial and antifungal agents. The antitumor activity of the synthesized compounds was evaluated against human cancer cell lines, MCF-7, HCT-116, and HepG-2, as compared with Doxorubicin as a control. Introduction Pyrazole, a heterocyclic five-membered ring system, is one of the most significant heterogeneous compounds. Pyrazole derivatives have been found to possess a broad spectrum of biological properties including antitumor activity. Pyrazoles have attracted much attention from researchers due to their high antibacterial and antifungal values. In addition, pyrazoles exhibit anti-inflammatory, anti-HIV, antiviral, anti-diabetic, and anti-tubercular activities. It gained great attention since the privileged structure was commonly found as an active constituent in commercial drugs (Figure 1), such as lonazolac nonsteroidal anti-inflammatory drug (NSAID), pyrazofurin (anticancer), difenamizole (analgesic), and deracoxib (NSAID). A great deal of interest has been paid to pyrazole derivatives in the last few years in agrochemical and chemical industries, as some pyrazole derivatives have exhibited insecticidal and herbicidal activities. The great importance of pyrazole is due to its ability to construct fused pyrazole compounds that have been used as intermediates for the synthesis of dyestuffs mainly for heterocyclic azo pyrazole disperse dyes. Also, it has gained considerable attention from researchers in the past few decades since it is a major component in some marketing drugs such as Ocinaplon and Lorediplon. Based on the above facts, the purpose of this paper is to design and synthesize new compounds containing pyrazole moieties and study their antimicrobial activity. Chemistry 2-Arylazomalononitriles 2a-c were synthesized by diazotization of aniline derivatives 1a-c followed by coupling with malononitrile according to the reported method (Scheme 1). The structure of 2- malononitrile (2b) was established by analytical and spectral data. The IR spectrum of (2b) revealed the presence of absorption bands at 3141 and 2227 cm −1 characteristic for NH and CN groups, respectively. The 1 H-NMR spectrum revealed two doublets at 7.64 and 7.76 ppm assignable to the aromatic protons and a broad signal at 10.36 ppm indicating the presence of the NH2 group, please find more detailed data in the supplementary materials. Refluxing of arylazomalononitrile 2a with piperidine or morpholine in ethanol afforded the amino analogs 3a,b (Scheme 1). The structures for 3a,b were confirmed by spectral data. IR spectra of compounds 3a,b showed the appearance of NH at 3301-3303 cm −1 and CN stretch at 2179-2184 cm −1. The 1 H and 13 C-NMR spectrum of compound 3b revealed the presence of two characteristic signals aliphatic groups N-(CH2)2 and O-(CH2)2 of morpholine moiety. Chemistry 2-Arylazomalononitriles 2a-c were synthesized by diazotization of aniline derivatives 1a-c followed by coupling with malononitrile according to the reported method (Scheme 1). The structure of 2- malononitrile (2b) was established by analytical and spectral data. The IR spectrum of (2b) revealed the presence of absorption bands at 3141 and 2227 cm −1 characteristic for NH and CN groups, respectively. The 1 H-NMR spectrum revealed two doublets at 7.64 and 7.76 ppm assignable to the aromatic protons and a broad signal at 10.36 ppm indicating the presence of the NH 2 group, please find more detailed data in the Supplementary Materials. Refluxing of arylazomalononitrile 2a with piperidine or morpholine in ethanol afforded the amino analogs 3a,b (Scheme 1). The structures for 3a,b were confirmed by spectral data. IR spectra of compounds 3a,b showed the appearance of NH at 3301-3303 cm −1 and CN stretch at 2179-2184 cm −1. The 1 H and 13 C-NMR spectrum of compound 3b revealed the presence of two characteristic signals aliphatic groups N-(CH 2 ) 2 and O-(CH 2 ) 2 of morpholine moiety. Chemistry 2-Arylazomalononitriles 2a-c were synthesized by diazotization of aniline derivatives 1a-c followed by coupling with malononitrile according to the reported method (Scheme 1). The structure of 2-malononitrile (2b) was established by analytical and spectral data. The IR spectrum of (2b) revealed the presence of absorption bands at 3141 and 2227 cm −1 characteristic for NH and CN groups, respectively. The 1 H-NMR spectrum revealed two doublets at 7.64 and 7.76 ppm assignable to the aromatic protons and a broad signal at 10.36 ppm indicating the presence of the NH2 group, please find more detailed data in the supplementary materials. Acetylation of 3,5-diamino-1H-pyrazole derivatives 4a,b in refluxing acetic acid afforded the corresponding 4-arylazo-3,5-diacetamidopyrazole derivatives 7a,b; (Scheme 2). The structures of 1H-pyrazole derivatives 7a,b were supported by elemental and spectral data. The 1 H-NMR spectrum for compound 7a exhibited two singlet signals at 2.12 and 2.17 ppm corresponding to the presence of methyl protons and two broad signals at 6.56 and 10.27 ppm related to two (NH) protons, while its mass spectrum revealed a molecular ion peak at m/z 304 (M +, 100%). 3,5-Diaminopyrazoles 4 was employed as a key intermediate for the synthesis of several poly substituted fused pyrazolopyrimidines. Pyrazolo pyrimidines are of considerable pharmacological important as purine analogs. Thus, it was important to study the reactivity of diaminopyrazole derivatives 4a,b toward a variety of nucleophilic reagents. Symmetrical 3,6-diarylazo-2,5,7-triaminopyrazolopyrimidine (8a,b) were synthesized by the reaction of hydrazone 2a,b Moreover, the synthesis of pyrazolopyrimidine derivatives 8a,b and 9a,b were achieved under microwave irradiation and ultrasound reactions conditions. TLC monitored the progress of the reactions, and the yields of the products were noted. Comparisons between conventional, microwave, and ultrasound techniques are given in (Table 1). The analytical and spectral data of the newly synthesized compounds 8a,b and 9a,b were compatible with their structures. For instance, IR spectrum for 6--3-(4fluorophenylazo)-2,5,7-triaminopyrazolo pyrimidine (9a) showed absorption bands at 3474, 3276, and 3123 cm −1, representing the presence of the amino groups, while 1 H-NMR spectrum showed signals at 6.98 and 8.22 ppm referring to two amino groups, and its mass spectrum showed a molecular ion peak at m/z 458 (M +, 100%), which corresponds with its molecular formula C19H14F4N10. Moreover, the synthesis of pyrazolopyrimidine derivatives 8a,b and 9a,b were achieved under microwave irradiation and ultrasound reactions conditions. TLC monitored the progress of the reactions, and the yields of the products were noted. Comparisons between conventional, microwave, and ultrasound techniques are given in (Table 1). The analytical and spectral data of the newly synthesized compounds 8a,b and 9a,b were compatible with their structures. For instance, IR spectrum for 6--3-(4fluorophenylazo)-2,5,7-triaminopyrazolo pyrimidine (9a) showed absorption bands at 3474, 3276, and 3123 cm −1, representing the presence of the amino groups, while 1 H-NMR spectrum showed signals at 6.98 and 8.22 ppm referring to two amino groups, and its mass spectrum showed a molecular ion peak at m/z 458 (M +, 100%), which corresponds with its molecular formula C 19 H 14 F 4 N 10. Sulfonamide group can be considered as the main component in some drugs used in clinical treatment. It is reported that many of the sulfonamide derivatives act as antibacterial, antifungal, antihypertensive, anticancer, antimalarial, and antiprotozoal agents. Thus, the reaction of 3,5-diaminopyrazole 4a,b with several hydrazones of sulfa drugs (N- [4- in ethanol under reflux in the presence of a catalytic amount of pyridine afforded pyrazolopyrimidine derivatives 10a,b-12a,b, respectively (Scheme 4). Aiming to modify the yields and reduce the reactions time, we applied microwave irradiation conditions to resynthesize the targeted compounds 10a,b-12a,b, and the comparison of the reactions times and yields between the conventional and microwave irradiation conditions are summarized in Table 2. The structures of 10a,b-12a,b were confirmed by their elemental analysis and spectral data (MS, IR, 1 H-NMR, and 13 C-NMR). The IR spectrum revealed an absorption band at 3474-3207 cm −1 that corresponds to NH and NH 2 groups and at 2960-2835 and 1369-1347 cm −1 characteristic to aliphatic CH 2 and SO 2 groups, respectively. 1 H-NMR spectrum of (12b), as an example, revealed signals at 1.36, 1.55, and 2.91 which refer to the presence of (3CH 2 ) and (2NCH 2 ) groups, respectively, while its 13 C-NMR spectrum exhibited signals representing the presence of piperidine protons at 22.85, 24.66, and 46.58. Mass spectrum of (12b), as an example, gives the molecular ion peak at m/z 587 (M + ; 44%), corresponding to the molecular formula C 24 In Vitro Antimicrobial Evaluation The newly synthesized compounds were evaluated for their antimicrobial activity toward six bacterial strains, three Gram-positive (Staphylococcus aureus, Bacillus subtilis, and Staphylococcus mutants), and three Gram-negative (Enterococcus faecalis, Proteus vulgaris, and Escherichia coli), using the standard antibiotic Gentamycin (5 mg/mL) as a reference. Also, their antifungal activity was evaluated against three fungal strains (Aspergillus fumigates, Aspergillus flavus, and Candida albicans) to determine the zone of inhibition using the standard antibiotic Ketoconazole (5 mg/mL). Their antibacterial activities were tested for their activities at a concentration of (5 mg/mL) using inhibition zone diameter in mm as a criterion for the antimicrobial activity, and the results are shown in (Table 3). Compounds 2a, 2c, and 11b demonstrated more potent significant activity against tested Enterococcus faecalis and Proteus vulgaris with a diameter of inhibition zone between 25 and 40 mm; further, compound 2a showed high antimicrobial activity on Bacillus subtilis with a zone of inhibition of 40 mm, and these compounds had moderate antimicrobial activity on other bacterial strains with an inhibition zone ranging from 13 to 25 mm. Moreover, compound 2a has significant antifungal activity towards three fungal strains, and compound 11b showed a moderate effect on fungal strains, while compound 2c was not active on fungal strains. Also, compound 4b had a moderate effect on bacterial strains with an inhibition zone of 20-24 mm diameter, as well as on fungal strains with an inhibitory region ranging from 13 to 20 mm. Furthermore, compounds 5a, 7a, 7b, and 11a showed mild antibacterial activity on the tested Gram-positive and Gram-negative bacterial strains with an inhibition zone of 9 to 18 mm, except compound 5a was NA on Streptococcus mutants strain. Meanwhile, compounds 5a, 7b, and 11a had no antifungal activity towards the three fungal strains. In Vitro Cytotoxic Screening The antitumor activity of the target compounds was screened against three human cancer cell lines-breast adenocarcinoma (MCF-7), hepatocellular carcinoma (HepG2), and human colon carcinoma (HCT-116). The IC 50 values of the tested compounds are listed in Table 4 and Figure 2. From the obtained results, compounds 2a,b, 4b, 5b, 8b, and 12b showed the most potent cytotoxic profile on cancer cells (MCF-7, HepG2, and HCT-116) with IC 50 values ranging from 0.3 to 3.4 g while the compound 8b is most effective among all of them on all types of cancer cells. Compounds 2c, 11b, and 13 have demonstrated a significant effect on MCF-7 and HePG2 cells with IC 50 values ranging from 2.7 to 9.8 g, and 2c and 11b compounds significantly increased on HCT 116 with IC 50 of 1.2 g and 2.4, respectively. Moreover, the compounds 4a, 8a, and 10a showed moderate effects on cancer cells with IC 50 values ranging from 6.7 to 12.9 g, while the compound 8a was the most significant on HePG2 cells with IC 50 of 4.9 g; on the other hand, the effect of the 4a compound was low on MCF-7 cells. In addition, the compounds 3a,b, 5a, 7a,b, 9b, 11a, and 12a had slightly significant effects with IC 50 values ranging from 14.1 to 38.5 g, the compound 3a indicated a slightly noticeable effect on HePG2 cells with IC 50 of 6.1 g, and the compound 12a had weak toxicity on HCT 116 cells with IC 50 of 46.1 g. Furthermore, the 10b compound had a low cytotoxic effect on MCF-7 and HePG2 cells with IC 50 of 43.9 and 85.9 g, respectively, and a moderate effect with IC 50 of 29.4 g. Compound 9a showed very low cellular toxicity with IC 50 higher than 100 g compared to all other compounds on cancer cells. General Information All melting points were determined with a Stuart Digital Melting Point apparatus SMP10 and are uncorrected. Elemental analyses were performed on a Perkin-Elmer 240 microanalyser, PE 2400 Series II CHNS/O Analyzer, carried out at the regional center for mycology and biotechnology, Al-Azhar University, cairo, Egypt. IR spectra were determined as KBr pellets on a Thermo Nicolet apparatus (Thermo Scientific, Madison, WI, USA) at Postgraduate campus for Girls at Lassan, King Khalid University, Abha, Saudi Arabia. The NMR spectra were recorded on a Bruker NMR spectrometer (Bruker, Billerica, MA, USA) in DMSO-d6, as solvent at 300, 500 MHz for 1 H-NMR and 75, 125 MHz for 13 C-NMR at Faculty of Science, Cairo University, Egypt and King Khalid University, Abha, respectively. The chemical shifts () are reported in parts per million (ppm). Mass spectra were measured on GC/MS-QP5 spectrometer at regional center for mycology and biotechnology, Al-Azhar University, Egypt. Antimicrobial activity was measured at the regional center for mycology and biotechnology, Al-Azhar University, Egypt. Follow-up of the reactions and checking the purity of the compounds were carried out using TLC on silica gel-precoated aluminum sheets (Fluorescent indicator 254 nm, Fluka, Germany) and the spots were detected by exposure to UV lamp at 254/366 nm for a few seconds or under iodine vapor. Compounds 2-(4-fluorphenylazo)malononitrile 2a and 3,5-diamino-4-(4-fluorophenylazo)-1H-pyrazole 4b were prepared according to the reported procedure To a solution of aniline derivatives 1a-c (0.01 mol) in hydrochloric acid (6 mL), a solution of sodium nitrite (0.72 g, 0.0105 mol) in water (3 mL) was added portion wise with stirring at 0-5 °C for 1 h. The clear diazonium salt was added to a stirred solution of malononitrile (0.66 g, 0.01 mol) and sodium acetate (4.6 g) in aqueous ethanol 50% (50 mL) with continued stirring at 0-5 °C for 2 h. The reaction mixture was allowed to stand overnight at room temperature, then the precipitate that formed was filtered off, washed several times with water, dried, and recrystallized from ethanol to afford 2-arylazomalononitrile 2a-c. General Information All melting points were determined with a Stuart Digital Melting Point apparatus SMP10 and are uncorrected. Elemental analyses were performed on a Perkin-Elmer 240 microanalyser, PE 2400 Series II CHNS/O Analyzer, carried out at the regional center for mycology and biotechnology, Al-Azhar University, cairo, Egypt. IR spectra were determined as KBr pellets on a Thermo Nicolet apparatus (Thermo Scientific, Madison, WI, USA) at Postgraduate campus for Girls at Lassan, King Khalid University, Abha, Saudi Arabia. The NMR spectra were recorded on a Bruker NMR spectrometer (Bruker, Billerica, MA, USA) in DMSO-d 6, as solvent at 300, 500 MHz for 1 H-NMR and 75, 125 MHz for 13 C-NMR at Faculty of Science, Cairo University, Egypt and King Khalid University, Abha, respectively. The chemical shifts () are reported in parts per million (ppm). Mass spectra were measured on GC/MS-QP5 spectrometer at regional center for mycology and biotechnology, Al-Azhar University, Egypt. Antimicrobial activity was measured at the regional center for mycology and biotechnology, Al-Azhar University, Egypt. Follow-up of the reactions and checking the purity of the compounds were carried out using TLC on silica gel-precoated aluminum sheets (Fluorescent indicator 254 nm, Fluka, Germany) and the spots were detected by exposure to UV lamp at 254/366 nm for a few seconds or under iodine vapor. Compounds 2-(4-fluorphenylazo)malononitrile 2a and 3,5-diamino-4-(4-fluorophenylazo)-1H-pyrazole 4b were prepared according to the reported procedure. General Procedure for the Synthesis of 2-Arylazomalononitrile 2a-c: To a solution of aniline derivatives 1a-c (0.01 mol) in hydrochloric acid (6 mL), a solution of sodium nitrite (0.72 g, 0.0105 mol) in water (3 mL) was added portion wise with stirring at 0-5 C for 1 h. The clear diazonium salt was added to a stirred solution of malononitrile (0.66 g, 0.01 mol) and sodium acetate (4.6 g) in aqueous ethanol 50% (50 mL) with continued stirring at 0-5 C for 2 h. The reaction mixture was allowed to stand overnight at room temperature, then the precipitate that formed was filtered off, washed several times with water, dried, and recrystallized from ethanol to afford 2-arylazomalononitrile 2a-c. To a solution of 2-arylazomalononitrile 2a,b (0.01 mol) in ethanol (30 mL), hydrazine hydrate (0.01 mol) and pyridine (0.5 mL) were added. The reaction mixture was heated under reflux for 2 h (monitored by TLC). After completion of the reaction, the precipitate that formed was filtered off, dried, and recrystallized from ethanol to afford 3,5-diamino-4-(arylazo)pyrazole 4a,b. A solution of 3,5-diamine-4-arylazo-1H-pyrazole 4a,b (0.01 mol) in acetic acid (30 mL) was heated under reflux for 10 h (monitored by TLC). The reaction mixture was left to cool to room temperature, and then poured onto cooled water (50 mL) portion wise with continuous stirring for 1 h. The separated yellow compound was filtered off, washed with water, and, finally, dried and recrystallized from ethanol to afford 3,5-diacetamio-4-arylazo-1H-pyrazole 7a,b. Method B: A mixture of 4-arylazo-3,5-diaminopyrazole 4a,b (0.01 mol) and 2-arylazomalononitrile 2a,b (0.01 mol) in ethanol (30 mL) and in the presence of pyridine (0.5 mL) was heated under reflux for 4-5 h, (monitored by TLC). After completion of the reaction, the precipitates those formed were filtered off, dried, and recrystallized from 1,4-dioxane to afford 8a and 8b, respectively. B. Under Microwave Irradiation: A mixture of 5-diamino-4-arylazopyrazole 4a,b (0.01 mol) and 2-arylazomalononitrile 2a,b (0.01 mol) was grinded carefully in a porcelain mortar using a pestle and transferred to a pyrex test tube; then, ethanol (4 mL) was added, followed by pyridine (0.5 mL). The reaction mixture was heated under microwave irradiation at 50% power for 2 min at 140 C, monitored by TLC. After completion of the reaction, the reaction mixture was cooled to room temperature and the precipitated solid was filtered off, washed with MeOH, and recrystallized from dioxane to afford 8a and 8b, respectively. B. Under Microwave Irradiation: A mixture of 5-diamino-4-(arylazo)pyrazole 4a,b (0.01 mol) and 2-arylazomalononitrile 2a,b (0.01 mol) was grinded carefully in a porcelain mortar using a pestle and transferred to a pyrex test tube, and ethanol (4 mL) was added, followed by pyridine (0.5 mL). The reaction mixture was heated under microwave irradiation at 50% power for 2 min at 140 C, monitored by TLC. After completion of the reaction, the reaction mixture was cooled to room temperature and the precipitated solid was filtered off, washed with MeOH, and recrystallized from ethanol to afford 9a,b. Cytotoxicity assessment: The cytotoxicity of different compounds was tested against human tumor cells using Sulphorhodamine B assay (SRB). Healthy growing cells were cultured in a 96-well tissue culture plate (3000 cells/well) for 24 h before treatment with the synthesized compounds to allow attachment of the cells to the plate. Cells were exposed to the five different concentrations of tested compounds (0.01, 0.1, 1, 10, and 100 M/mL); untreated cells (control) were added. Triplicate wells were incubated with the different concentrations for 72 h and subsequently fixed with TCA (10% w/v) for 1 h at 4 C. After several washing, cells were stained by 0.4% (w/v) SRB solution for 10 min in a dark place. Excess stain was washed with 1% (v/v) glacial acetic acid. After drying overnight, the SRB-stained cells were dissolved with tris-HCl and the color intensity was measured in a microplate reader at 540 nm. The linear relation between viability percentage of each tumor cell line and extracts concentrations were analyzed to get the IC 50 (dose of the drug which reduces survival to 50%) using Sigma Plot 12.0 software. Conclusions In conclusion, 4-arylazo-3,5-diaminopyrazole 4-6 was synthesized and used as a building block for the synthesis of pyrazolopyrimidine derivatives such as 3,6-diarylazo-2,5,7-triaminopyrazolopyrimidine, 8 and 9, 3,6-Diarylazo-2,5,7-triaminopyrazolopyrimidine 10-12 and 13. The structures of newly synthesized compounds were confirmed by spectral data (IR, 1 H-NMR, 13 C-NMR, and mass spectra) and elemental analysis. Most of the newly synthesized compounds were assessed as antimicrobial agents against a number of Gram-positive, Gram-negative, and fungal strains. Some of the tested compounds showed excellent antimicrobial activity compared to the standard antibiotics. The obtained data reflected that compound 2b exhibited the best antimicrobial activity against most tested microorganisms and the rest of the compounds were moderately active or inactive for all the microorganisms. Most of the synthesized compounds exhibited good cytotoxic activity towards the examined three cell lines. From the obtained results, compounds 2a,b, 4b, 5b, 8b, and 12b showed the most potent cytotoxic profile on cancer cells (MCF-7, HepG2, and HCT-116) with IC 50 values ranging from 0.3 to 3.4 g, while the compound 8b is most effective among all of them on all types of cancer cells.
|
import { Correlation } from '../../types/correlation/correlation';
import { hasAttachmentAtomType } from './hasAttachmentAtomType';
/**
* Creates an attachment array for a certain atom type in a correlation.
*
* @param {Correlation} correlation
* @param {string} atomType
*/
export function addAttachmentAtomType(
correlation: Correlation,
atomType: string,
): Correlation {
if (!hasAttachmentAtomType(correlation, atomType)) {
correlation.attachment[atomType] = [];
}
return correlation;
}
|
/**
*
* @author nghiatc
* @since Aug 31, 2015
*/
public class NEmptyJettyLogger implements org.eclipse.jetty.util.log.Logger {
public static final NEmptyJettyLogger instance = new NEmptyJettyLogger("NEmptyJettyLogger");
private final String _name;
private NEmptyJettyLogger(String name) {
assert (name != null);
this._name = name;
}
@Override
public String getName() {
return _name;
}
@Override
public void warn(String string, Object... os) {
}
@Override
public void warn(Throwable thrwbl) {
}
@Override
public void warn(String string, Throwable thrwbl) {
}
@Override
public void info(String string, Object... os) {
}
@Override
public void info(Throwable thrwbl) {
}
@Override
public void info(String string, Throwable thrwbl) {
}
@Override
public boolean isDebugEnabled() {
return false;
}
@Override
public void setDebugEnabled(boolean bln) {
}
@Override
public void debug(String string, Object... os) {
}
@Override
public void debug(Throwable thrwbl) {
}
@Override
public void debug(String string, Throwable thrwbl) {
}
@Override
public Logger getLogger(String string) {
return this;
}
@Override
public void ignore(Throwable thrwbl) {
}
@Override
public void debug(String string, long l) {
}
}
|
/**
* Creates {@link LocalResource}s based on the current user's classpath
*
* @param fs
* @param appName
* @return
*/
public static Map<String, LocalResource> createLocalResources(FileSystem fs, String classPathDir) {
Map<String, LocalResource> localResources = provisionAndLocalizeCurrentClasspath(fs, classPathDir);
provisionAndLocalizeScalaLib(fs, classPathDir, localResources);
return localResources;
}
|
Social work in FSU countries: mapping the progress of the professional project ABSTRACT This article presents material from literature and responses from national experts about social work developments in the 15 Former Soviet Union (FSU) states, since independence in 1991. Taking professionalization as a theoretical framework and considering the role of the state and other actors, the authors use a thematic approach to analyse the factors relevant to the professional project. Throughout the region, the state is identified as still the major actor in driving welfare changes and creating the organizational and legislative bases for the development of social work. A chronology of legislation relevant to the establishment of social work is included which highlights the variations in the pace of developments, as do the establishment of professional education (throughout the region) and professional associations (in most countries). The authors conclude that the professional project faces many challenges across the FSU region and the progress made or lack of it in some countries can be related to the politics and economics of particular states. However, the evidence suggests that, less than a quarter of a century after the demise of communism, this project has been initiated in all but one FSU countries and there are indications of positive developments.
|
Gender Social Relations and the Challenge of Women's Employment Iran's government has tended to enforce gender social relations through both family and employment policies. Officially, women's employment is discouraged unless it is necessary for her family's survival, and the home is considered the best and the most suitable place for women. The state's discourse makes a sharp distinction between public and private spheres. Nonetheless, women's higher literacy rates and the increasing number of college educated women combined with high inflation, which has lowered both the purchasing power of middle and lower class households, and women's aspirations for financial independence and intellectual autonomy, have led them to seek paid employment. The most educated women target public administration or the private sector, while less educated women seek job opportunities in the informal sector of the economy. Decision-making authority within the family and the quest for gender equality in Iranian society are two of the outcomes of women's paid employment that is likely to alter gendered power relations.
|
Individual response variations in scaffold-guided bone regeneration are determined by independent strain- and injury-induced mechanisms This study explored the regenerative osteogenic response in the distal femur of sheep using scaffolds having stiffness values within, and above and below, the range of trabecular bone apparent modulus. Scaffolds 3D-printed from stiff titanium and compliant polyamide were implanted into a cylindrical metaphyseal defect 1515mm. After six weeks, bone ingrowth varied between 7 and 21% of the scaffold pore volume and this was generally inversely proportional to scaffold stiffness. The individual reparative response considerably varied among the animals, which could be divided into weak and strong responders. Notably, bone regeneration specifically within the interior of the scaffold was inversely proportional to scaffold stiffness and was strain-driven in strongly-responding animals. Conversely, bone regeneration at the periphery of the defect was injury-driven and equal in all scaffolds and in all strongly- and weakly-responding animals. The observation of the strain-driven response in some, but not all, animals highlights that scaffold compliance is desirable for triggering host bone regeneration, but scaffold permanence is important for the load-bearing, structural role of the bone-replacing device. Indeed, scaffolds may benefit from being nonresorbable and mechanically reliable for those unforeseeable cases of weakly responding recipients. Introduction Bone as a tissue is generally capable of complete, traceless healing following trauma. However the two global medical device industries of joint replacement and dental implants are not yet universally successful, resulting in a rampant rate of revision surgeries associated with large areas of bone loss, and generating a potentially enormous demand for bone grafts. In the case of small and/or confined defects, autologous bone transplant is the unparalleled gold standard, and there are additional choices for filling such defects using synthetic, predominantly inorganic compounds. The situation is different where large defects require reconstruction. When a load-bearing "prosthetic structure", rather than a filler, is necessary, surgeons do not yet have an ideal solution. Although strength and rigidity of orthopaedic devices are obviously crucial, when a too stiff orthopaedic implant is installed, the bone around the implant is shielded from the load. Under these new mechanical conditions of reduced load, an imbalanced remodeling begins, making the host bone thinner and more porous. Eventually, stiff metal devices or prostheses, whose apparent moduli are mismatched with the host bone, often lead to additional and more extensive revision surgery. Porous metallic devices better approximate the apparent elastic modulus of bone but relatively little variability is offered amongst these devices to address the varying mechanical demands of different parts of the skeleton and varying biological profile, activity level and regenerative potential of the recipients. By avoiding strength and rigidity overdesign of orthopaedic implants and approximating their stiffness to bone stiffness, stress shielding may be reduced, and adequate and physiological stimulation of the host bone remodeling may be achieved. At the tissue and cells scale, the requirements for bone regenerationguiding scaffolds have been summarized : Successful regeneration of bone requires sufficient rigidity for mechanical support and stability, and at the same time sufficient compliance for mechanical stimulation. Scaffolds have to be porous enough to allow tissue ingrowth and vascularization but not so porous that structural integrity is lost. An ideal scaffold should be temporary and eventually degrade, but not before it is replaced with mature regenerated host bone having adequate mechanical properties. Scaffolds should ideally be osteoinductive (i.e., evoking nascent bone formation), but be able to compartmentalize osteogenesis within a targeted repair site. To summarize, repair of large bone defects with artificial constructs capable of both i) fulfilling a prosthetic, structural function, and ii) guiding host bone regeneration must address the multidimensional Goldilocks' principle of having "not too much and not too little". Being the site of most joint replacement revision surgeries, the metaphysis is an anatomic and functional site of high clinical relevance, especially in the aftermath of failed joint replacement. In comparison with the diaphyseal compact bone that is perfectly adapted to bending and torsion (as evident from the "hollow tube" layout of the diaphysis ), trabecular bone of the metaphysis satisfies a distinct set of biomechanical requirements. These requirements include counteracting multidirectional loads that occur during movement, effectively transferring load to the shaft, and creating a shock-absorbing interphase between the relatively low modulus cartilage and the stiff and solid compact bone of the shaft. For this reason, even in such intensively loaded locations such as the knee or hip joints, in large and physically active organisms, trabecular bone of the metaphyses always remains porous and reticulate and cannot be replaced by solid and stiff compact bone. This study is a proof-of-concept, testing the optimal structural and mechanical properties of an artificial porous structure that allow the emulation of the multidirectional load transfer behaviour of metaphyseal bone, while also providing mechanically-driven scaffold integration and host bone regeneration. The large animal (sheep) experimental model has the advantage of a bone loading magnitude and mode that approximate the conditions of bone loading in humans, and the benefit of genetic diversity and individual variation that makes them closer to the human population than inbred lines of rodents. In order to evaluate a broad range of scaffold apparent moduli and their effect on bone regeneration in a large animal model, we used two substrates having high or low material moduli (titanium or polyamide, respectively), and we further varied apparent modulus values by using different scaffold architectures via selective laser sintering. The resultant apparent moduli of the scaffolds were matched to the normal high and low values of trabecular bone modulus: close to the apparent modulus of human trabecular bone in the proximal femur (titanium biomimetic, TB), and close to the apparent modulus of human trabecular bone in the vertebrae (polyamide biomimetic, PB). We also refer to these designs as biomimetic because the connected elements are triangulated rendering the entire structure more stable in a vast range of loading directions. Control structures were designed to match the material modulus of compact bone (most stiff titanium control, TC), and to be below the modulus of trabecular bone (polyamide control, PC, with cubic symmetry, which is stable only in 3 principal loading direction and is compliant and easily deformable in all non-axial directions of loading) ( Table 1). Since the scaffolds were designed to locally replace porous trabecular bone, complete pore occlusion and bone solidification were not anticipated. Rather, attainment of mature bone microstructure was sought after. Materials and methods Four types of cell-free porous scaffolds of different stiffness (six replicas of each), were inserted into the distal femurs of 12 ewes (Fig. S1). The animal experiment complied with the ARRIVE guidelines and was carried out in accordance with the U.K. Animals (Scientific Procedures) Act, 1986. Each animal received two different scaffolds (one per each femur). The properties of the scaffolds are summarized in Table 1. We evaluated the total amount of bone tissue ingrowth as a percentage of the defect volume not occupied by the scaffold. Scaffold design, fabrication and preparation Uniformity of stress within and around an implanted scaffold can be controlled by the scaffold design. For example, a rectangle-based structure will have a high stiffness in the orthogonal directions coinciding with the directions of its elements, but it will have low stiffness in all other directions because non-axial loading would result in bending and shear. In contrast, a triangle-based structure performs isotropically in all directions of loading because triangulated elements work collectively in axial loading. Avoiding shear and bending at the structural level renders triangulated structures advantageous for the conditions of multidirectional loading. Four truss scaffolds were designed in Rhinoceros 3D software (McNeel Europe, Barcelona, Spain) to be fabricated using selective laser sintering. 1. A polyamide (PA12, nylon) scaffold was designed using octetruss space-filling elements. Each octetruss comprises one dodecahedron with 6 internal axes and two tetrahedrons with four internal axes each. This design was fully triangulated in order to reduce shear and bending stresses amongst the struts and compensate for the relatively low elastic modulus of the material used (around 2 GPa). Nominal porosity in this scaffold was 0.45. This scaffold will be referred to as the Polyamide Biomimetic Scaffold, PB. 2. A stochastic commercially-pure titanium scaffold was designed by filling a 3D volume with a random distribution of about 5000 points using a Poisson disk algorithm and connecting each point with its nearest neighbors to achieve a desired connectivity (average connectivity of 4.5) as described in Ref.. Thickness of these connections was locally altered so the stiffness of the produced structure would be equal to the stiffness of the bone it would be replacing. Sheep bone material properties and stiffness data were acquired through a combination of CT-scanning and mechanical testing of ex-vivo specimens and from the literature. This scaffold will be referred to as the Titanium Biomimetic Scaffold, TB. Nominal porosity in this scaffold was 0.8, averaged for the entire scaffold. The two control scaffolds were designed as follows: One made of the same polyamide material but with a different design to assess the effect of scaffold architecture on bone ingrowth, and one made out of titanium but with the same design as the Polyamide Biomimetic Scaffold to assess the effect of scaffold material on bone ingrowth. 3. A polyamide (PA12, nylon) scaffold was designed with a cuboid as the space-filling element. In this scaffold, all the struts connected at right angles and essentially formed a 3D orthogonal grid. Such a structure is stiff when loaded in three orthogonal directions that coincide with the orientations of the struts. However, when loaded in all other possible orientations, this structure is at risk to yield in shear because each space-filling element (i.e., each cubic unit) deforms towards a rhomboid. Nominal porosity in this scaffold was 0.35. This scaffold will be referred to as the Polyamide Control Scaffold, PC. 4. A commercially pure titanium scaffold was produced using the same octetruss space filling elements as the Polyamide Biomimetic, with the dimensions of the unit cell slightly scaled up due to the metal sintering restriction. Nominal porosity in this scaffold was 0.6. The material modulus of titanium exceeds that of polyamide 12 by two orders of magnitude. Therefore, this scaffold served as a high stiffness control item and will be referred to as Titanium Control Scaffold, TC. The polyamide biomimetic and control scaffolds were manufactured using selective laser sintering using an EOS FORMIGA P110 machine (Electro Optical Systems EOS Ltd., Warwick, UK). After production, the items were removed from powder substrate, cleaned by air blasting, water jet blasting and then washed by hand. Steam sterilization was performed in an autoclave at 121°C for 20 min (Prestige Medical Portable Autoclave, Fisher Scientific UK, Loughborough, UK) in sealed autoclave bags. The titanium scaffolds were manufactured on a Renishaw AM250, a metal powder bed fusion system, onto a titanium substrate. The workings of the system have been described previously in Ref.. Commercially Pure Titanium grade 2 (CP-Ti) powder was used having a particle size range of 10-45 m (D50: ∼27 m). After production, items were removed from the powder substrate by electro discharge machining and shot-blast. Specimens were rinsed and cleaned ultrasonically in a cleaning solution (0.2 m filtered water and Decon Neutracon) followed by sterile isopropanol to remove all contaminants (Hunt Developments UK Ltd). Following filtered drying, specimens were vacuum packed/sealed in pouches and sterilized via Gamma Irradiation. All cylindrical samples were tested mechanically along the cylinder axis according to ISO 13314:2011 (quasi-static compression test of porous structures), using a materials testing machine (Instron 8872) and a 1, 5 or 25 kN load cell depending on the specimen. Specimens were crushed at a constant strain rate of 2 mm/min (∼0.1 strain/min). Displacement between the compression platens was measured by linear variable differential transformers (LVDTs) and recorded at 30 Hz. Strain was calculated as the LVDT displacement divided by the specimen height (nominally 15 mm), and stress was the measured load divided by the specimen's initial cross-sectional area (nominally 200 mm 2 ). A preliminary sample of each type was compressed to 50% strain to estimate the yield strength. To determine the mechanical properties per unique scaffold (n = 5), samples were loaded to 50% strain with a hysteresis loop between 70% and 20% of the estimated yield strength to account for the localized plasticity in porous materials which reduces the slope of the initial loading curve. Stress-strain curves were recorded and elastic modulus was calculated as the linear regression of the hysteresis loop. The mechanical testing was used to validate FEA models of the scaffold prototypes in Karamba3D (a parametric structural engineering tool which provides accurate analysis of spatial trusses, frames and shells, embedded in Rhinoceros 3D design software). Multidirectional loading simulation was performed with increments of 15°of the and angles. The ratio of the minimal and the maximal apparent modulus values was recorded as the anisotropy coefficient in order to reflect the realistic loading environment of the implants in the knee joint which is subjected to movement. The average of the moduli measured at the various angles of loading was calculated as well. In summary, the scaffolds can be ranked by increasing stiffness as PC, PB, TB, and TC, and their moduli, anisotropy coefficients and design snapshots are shown in Table 1. Surgical procedure Twelve skeletally mature (older than 4 years) non-pregnant female ewes (breed mule), were enrolled in the study. Animals' weights varied between 62 and 85 kg (mean weight 72.8 kg, SD 5.7 kg). Ethical approval for this study was received from the United Kingdom Home Office (Project License Number 70/8247). Both hind legs of each sheep were used to create metaphyseal bone defects, diameter 15 mm, depth 15 mm. One scaffold (diameter 16 mm, length 15 mm) was inserted into each hind leg, in the distal medial femoral condyle. The radial oversizing of the scaffolds was planned based on the mock surgery experiments where loose fit was observed when the master drill diameter and the scaffold diameter were both 15 mm. Such extent of oversizing (or press-fit) is a common practice in orthopaedic surgery and is helpful for implant stabilization within trabecular bone. The scaffolds were allocated to the sheep randomly, as displayed in Fig. S1. In total, 24 scaffolds, 6 of each kind, were assigned. Pre-operative antibiotics were given to each sheep and continued for 3 days postoperatively (Cefalexin 1ml/25 kg animal once a day). Under general anaesthesia the distal medial femoral condyle was exposed and periosteum removed over the area of implant insertion. A cylindrical defect was created by sequential using of drills of increasing diameter, equipped with a depth gauge (5 mm, 8 mm, 10 mm, 12 mm, 14 mm and 15 mm) perpendicular to the bone surface. At the end of this, a 15 mm reamer was used to ensure an evenly shaped cavity and a flatter base of the cavity. Simultaneously with the defect preparation, a scaffold was centrifuged in 30 ml of animal's own blood (drawn from the jugular vein) in a sterile test tube at 3000 revolutions per minute for 3 min. This step was conducted in order to dislodge micrometer-scale air bubbles from the rough laser-sintered surface of the scaffold. The centrifuged scaffold was press fit into the cavity by hand, followed by gentle application of force from a surgical mallet. The wound was closed in 3 layers (fascia, subcutaneous soft tissue and then skin) using resorbable sutures. The wound area was sprayed by an aseptic spray (Opsite). Postoperatively, once a swallowing reflex had been established the animal was transferred back to a single pen with straw bedding. The animals recovered unrestrained, in sternal recumbency and were allowed hay, concentrate and water as is the normal feeding regime. The sheep received analgesia for 60 h post-operatively (Fentanyl 75 mcg patches). Recovery was uneventful in all but one animal who was limping on the left leg for 5 days (animal 5, Titanium Biomimetic Scaffold). Plain radiographs of the left hind leg were unremarkable. The animal recovered spontaneously, with no further evidence of an abnormal gait or discomfort for the rest of the study period. The animals' care was in accordance with institutional guidelines. Oxytetracycline was administered by slow intravenous injection on day 28 postoperatively at 30 mg per kg of body weight in order to tag the site of active osteogenesis with a fluorophore and to quantify the rate of bone accretion over the last two weeks of the in-life phase. All animals were euthanized at 6 weeks post-operatively. The femur was disarticulated and its distal metaphysis was cut and trimmed to the size of about 5 cm in all dimensions. The samples were stored in formalin until the analysis and characterization procedure in labeled glass jars at room temperature. Scaffold placement and retrieval are illustrated in Fig. S1. Micro-computed tomography (micro-CT) The trimmed samples were lightly blotted of formalin, wrapped watertight in a nitrile glove to prevent desiccation and were mounted on a cylindrical specimen holder with tape. The mounting was done with the longitudinal axis of the scaffold oriented vertically and the medial surface of the condyle facing the holder. Tomographic imaging was conducted in an Xradia Versa 510 (Zeiss) at 140 kV/10 W or 80 kV/ 7 W, with 3201 projections and a pixel size between 27 and 34 m. The 3D reconstructed tomographic images were segmented using Amira 5.3.2 (FEI) and analyzed using ImageJ/BoneJ software ; to account for the possibility of segmentation bias, the segmentation was reproduced using Dragonfly image analysis software (Object Research Systems Inc.). Segmentation of the sample contained 2 steps for the polyamide items and 3 steps for the titanium items. In the case of the polyamide items, in which the scaffold material had the same radiographic density as soft tissue, the defect configuration was labeled based on its actual size and then the ingrown bone was labeled within the defect only based on the global threshold. The size of the defect was calculated in pixels, the scaffold porosity (as a fraction of unity) was known by design and the bone volume in pixels was divided by the product of the defect volume and the scaffold porosity. The CT scans of the titanium specimens revealed beam hardening, visible in a tomogram as a structureless halo of higher pixel values around the metal elements. The defect was delineated as a cylindrical volume, within which the scaffold material was labeled based on the pixel value followed by dilate operation, kernel size 3 pixels. Then the ingrown bone material within the defect volume but outside the scaffold volume was labeled based on its local gray value in every second 2D slice using local thresholding and then the bone label was interpolated to cover all 2D slices of the tomogram. This multi-step labeling of bone based on the local gray values was necessary to avoid the inclusion of bright pixels around the metal elements that were not bone, but the effect of beam hardening. Three-dimensional rendering and segmentation are illustrated in Fig. 2. For the assessment of peripheral and central osteogenesis in the defect a library was created for independent scoring. It contained 2D images of 5 virtual sections for each specimen, perpendicular to the central axis of the cylindrical scaffold, taken at depths of 2, 5, 8, 11 and 14 mm from the periosteal surface. The peripheral and central osteogenesis were scored on each image using a scale from 0 to 4 by three operators independently, using a shared list of criteria. The results were compared and in case the inter-operator score discrepancy exceeded 1 unit (one scaffold, peripheral ingrowth), the images were rescored until a consensus was reached. Scoring was not blinded because the scaffold types were easily identifiable in the original images. Data analysis was performed using IBM Statistics v24 (IBM, USA). Wilcoxon Signed Rank tests (for non-parametric data) were performed to compare bone ingrowth into the four different scaffolds. The predicted inverse correlation between scaffold stiffness and bone ingrowth across all the samples was assessed using least squares regression. For this regression, data were first logarithmically transformed due to the scaffold stiffness scale being exponential (ranging from 200 MPa for the most compliant scaffold up to 7000 MPa for the stiffest scaffold). P values less than 0.05 were deemed to be statistically significant. Microscopy Following tomographic imaging, the samples were processed for microscopy. Sample embedding and sectioning Wet and fixed samples were dehydrated for embedding by immersing in methylated spirits of increasing concentration (50%, 75%, 85%, 95% and 2 100%). 100% spirit was replaced by chloroform for 24 h, and then the medium was substituted by methylmethacrylate resin (LR White) for 72 h. Following resin saturation, the accelerator was added and the blocks were polymerized at low temperature (−20°C). The blocks were trimmed and mounted for sectioning using a watercooled bandsaw (Exakt 311, Exakt, Germany). The block was cut parallel to the surface of the medial condyle and, therefore, parallel to the scaffold face. For the first two animals in the study, the central section of each specimen was further processed for electron microscopy and high resolution CT. For all the samples one central slice was prepared for microscopy. Samples were mounted and grinding was performed down to sample thickness of approximately 50 m by successive silicon carbide grinding cloths, followed by polishing with an alumina suspension (Exakt 400 CS Grinder, Exakt, Germany). These sections then underwent fluorescent microscopy, followed by histological staining. Fluorescent microscopy Microscopy was performed using a Zeiss Wide-Field light microscope (WF3 Zeiss Axio Observer, Zeiss Germany). The 5 objective was used and the Zen Pro software program (Zeiss, Germany) was used to select the oxytetracycline emission wavelength of 547 nm and Brightfield channels. Tiled microscopic images were recorded across the whole slide using the Zen Pro auto-stitching function. Staining and light microscopy Toluidine blue was placed on the sections after fluorescent microscopy. It was left on for 20 min and then washed off, followed by 20 min of Paragon stain. Microscopy was performed in the bright-field mode (WF3 Zeiss Axio Observer, Zeiss Germany). Tiles of microscopic images were recorded and then auto-stitched together using Zen Pro software (Zeiss, Germany). Electron microscopy imaging Explants from the animals 1 and 2 (four bone samples containing four different scaffolds) were used for Scanning Electron Microscopy imaging. After resin embedding as described above, one section of 1 mm thickness was polished with a series of grinding papers but not thinned. These thick embedded undemineralized polished sections were mounted on standard EM holders with silver paint and coated with carbon to improve surface conductivity. These samples were imaged in LEO Gemini 1525 FEG-SEM (Zeiss, Oberkochen, Germany) at 7 kV, working distance 10 mm and simultaneous acquisition of the image in secondary electrons mode (SESI detector) and backscattered electrons mode (ESB detector) in order to obtain both topographic and compositional information of the same area of interest. High-resolution micro-CT For high resolution micro-CT 1 mm thick rods were machined from the embedded bone samples (the same explants as those used for electron microscopy imaging). These rods containing fragments of the scaffold struts alternating with resin were mounted vertically in Xradia Versa 510 (Zeiss) and scanned at a resolution 20 m per pixel, 40 kV, 75 A, 400 projections per scan, to localize suitable areas of bone ingrowth within the scaffold pores. Following the survey scan and localizing the coordinates of the small area of interest, a high-resolution scan was performed at 40 kV, 75 A, 3200 projections and pixel size 0.4-0.5 m in order to visualize the type of nascent bone and vestiges of associated soft tissue. Overall effect of scaffold stiffness on bone regeneration Total bone ingrowth tended to increase as scaffold stiffness decreases ( Table 2, Fig. 1). There was a moderate, inverse correlation between scaffold stiffness and bone ingrowth across all the samples (r 2 = 0.419, p = 0.001) as shown in Fig. S2. We observed a statistically significant difference in bone ingrowth when comparing scaffolds having marked differences in stiffness (TC:PB, TC:PC, TB:PC). The differences in bone ingrowth volume between scaffolds having closer stiffness values (PC:PB, PB:TB, TB:TC) did not reach statistical significance. Volume-percent of bone ingrowth in individual animals is plotted graphically in Fig. 1, for each animal and for each scaffold. The data points from the same animal (i.e., right and left legs) are connected with a line. From this, the general trend of increasing bone ingrowth volume with decreasing scaffold stiffness is apparent. In all animals but one, the ingrowth volume was higher in the defect that received a more compliant scaffold. Three-dimensional CT rendering of nascent bone within the defect, and high-resolution CT of ingrown bone elements are shown in Fig. 2. Besides the total volume of the nascent bone, some difference in tissue structure is observed. High-resolution images demonstrate slender osseous elements in both titanium scaffolds (TC and TB, lower panels Fig. 2) whereas more robust formations of bone are present in both polyamide scaffolds (PB and PC, lower panels, Fig. 2). We used fluorescence microscopy after oxytetracycline injection to investigate osteogenic activity within and surrounding the scaffolds, reflected by the intensity of mineral apposition. Fig. 3 demonstrates variations in binding of the fluorochrome 28 days after implant placement and 14 days prior to animal sacrifice. The brightness of the fluorochrome in sections obtained from the middle of each scaffold (i.e., 7-8 mm inwards from the periosteal surface) illustrates high osteogenic activity surrounding all the scaffolds at the periphery of the defect (the bone-implant interface). In comparison, fluorescence within the interior of the scaffolds varied, where differences in osteogenesis are observed between the groups; the lower the scaffold stiffness, the more osteogenic activity is observed within the scaffold interior. Strong responders and weak responders Of note, the animals that had the highest net bone gain within the defects, which we refer to as "strong responders" (animals 1, 5-9 and 11), also had the highest difference in bone ingrowth volume between the two different scaffolds implanted (mean difference of 14%, favoring the more compliant scaffold). This is in contrast to values obtained from animals who demonstrated a lower net bone gain, which we refer to as "weak responders" (animals 2-4, 10, 12). The weak responders had a modest difference in ingrowth volume between the two scaffolds each animal received (mean difference of 3%). This division into strong and weak responders can be observed as a varying slope of the lines connecting paired measurements (Fig. 1), where the connected pairs having the higher slope lines are located in the top part of the plot. From this observation, the general trend of bone ingrowth volume can thus be attributed to the data from the strong responders. To identify the possible mechanism of the individual response heterogeneity, we semi-quantitatively inspected the pattern of bone accretion in strong and weak responders as shown in Fig. 4. We took five virtual CT slices at different consecutive defect depths, from the periosteal surface towards the bottom of the defect, perpendicular to the implant axis (slice 1, periosteal face of the implant; slice 5, marrow face of the implant; slices 1-5 were evenly spaced by 3 mm). The resultant 120 images (5 from each of 24 samples from 12 animals) were independently scored by three individuals using the criteria in Table 3 and the results are displayed in Table 4 and Supplemental Fig. S4. Semiquantitative analysis showed that while bone ingrowth at the boneimplant border was comparable and substantial among all the animals, the nascent bone ingrowth within the pores of the scaffolds was highly variable and inversely proportional to the scaffold apparent modulus (Fig. 4, Table 3). For qualitative visual evaluation we plotted the intensity of fluorescence across the sections as a 'landscape'. Fig. S3 shows that osteogenic activity at the implant-bone interface is comparable in both weak and strong responders (seen as a circular rim of elevated fluorescence intensity). However, osteogenic activity within the implant interior (elevated fluorescence intensity inside the circular rim) is substantial (i.e., comparable to the periphery) in the scaffolds of low stiffness in the group of strong responders. This trend was less evident in the weak-responders group (Fig. S3), corroborating Fig. 4 and Table 3. Fine structural features of nascent bone Histological staining of undecalcified sections through the middle of the scaffolds (7 mm deep from the periosteal surface) provides additional information about the pathways of bone formation within the scaffold. Close observation of the nascent bone forming within the two titanium scaffolds (Fig. 5A and B) reveals woven bone tissue, seen as very fine, densely branching struts, forming a delicate mesh that resembles embryonic bone. The most intense formation of fine woven bone is observed at the periphery of the defect, where the host trabecular bone was in contact with the implanted scaffold. The interior of the stiff titanium control scaffolds (TC) is mainly filled with fibrous tissue, occasionally including capillaries. In the case of the titanium biomimetic scaffold (TB), besides intense formation of woven bone at the bone-implant interface, patches of embryonic-looking woven bone can be observed in the center of the defect, seemingly not associated with the surface of the scaffold elements. The networks of woven bone and titanium struts are intercalated without intimate contact and are separated from each other by layers of fibrous tissue. Nascent bone within the pores of the polyamide scaffolds has a mixed structure; some bone islets formed fine interconnected networks of woven bone, but mostly woven bone elements are sandwiched between layered deposits of lamellar bone, as in Fig. 5 (BP, top panel). Linear deposits of lamellar bone can also be observed directly on the surface of the scaffolds (Fig. 5 PB and PC, top and bottom). Moreover, in many cases of lamellar bone formation directly on the polyamide surface, interlocking contact between mineralized bone and irregular partly-fused grains of polyamide can be observed. In the case of both polyamide scaffolds, clusters of adipocytes, or even areas of adipose tissue of several hundred micrometers wide, can be found associated with nascent bone. Scanning electron microscopy images obtained with a back-scattered detector (which highlights material density) confirmed the histological findings. Fig. S4 illustrates fine branching networks of woven bone within the titanium scaffolds (Fig. S4 TC and TB). These bone formations contain irregularly shaped osteocytes, characteristic of woven bone. In the polyamide scaffold bone formations, brighter woven bone is interposed between surrounding layers of lamellar bone (Fig. S4 PB); the layers of lamellar bone are slightly less bright in the backscattered electron imaging mode, indicating their lower level of mineralization, which is consistent with the literature. For both polyamide scaffolds, interlocking deposits of lamellar bone engulfing the convexities of the sintered polyamide surface are typically observed (Fig. S4 PC). More strain -more bone? This study evaluated the relationship between the stiffness of an implanted scaffold and the regenerative osteogenic response of the host, varying both the design and material of the scaffold. The quantitative analysis of bone ingrowth in this study confirmed that generally more compliant scaffolds induced more abundant bone formation in the metaphysis (the correlation was moderate). This has already been shown previously using a long bone shaft model or the edentulous part of the ovine mandible which geometrically resembles a long bone shaft. Thus, trabecular bone of an articulating element follows the same biomechanical premise: more strain -more bone. This is also consistent with the concept of stress-shielding, in which a stiff scaffold creates a protected, strain-free niche in the bone that does not encourage osteogenesis. We observed most bone ingrowth within the more-compliant polyamide biomimetic scaffold and the polyamide control scaffold, attributable to stimulation by strain (i.e., by high biomechanical demand). However, this general observation has some caveats: the trend of having more bone in response to higher local strains was inhomogeneous both among the experimental animals, and within the implantation site. Strong and weak responders Following quantification of bone ingrowth into the scaffolds, the 12 animals used in this study could readily be divided into two groups: strong responders and weak responders. Although all animals were of the same age, sex and breed, some unaccounted factors demonstrably resulted in a different regeneration capacity among the ewes. The inverse correlation between the stiffness of the scaffold and the amount of nascent bone formed indeed can be attributed only to the group of the 7 strong responders, within which the net bone gain was higher, and the difference in bone gain between the implants of different stiffness was more pronounced. In fact, the 5 weak responders -in whom we observed minimal difference in bone gain -contributed to the high variation and scatter of the data. The distinctive difference in bone ingrowth into stiff and compliant scaffolds links together two phenomena -the regenerative potential, and the capacity for mechanosensation. Both mechanosensation capacity and regenerative potential can be explained, among multiple factors, by age and/or by the level of physical activity of the organism, although in our study neither the individual levels of mobility of the ewes, nor the group dynamics, were monitored post-operatively. High variation in load exerted on a knee joint has already been reported in sheep ; the load exerted on the meniscus and the anterior cruciate ligament is different by up to an order of magnitude across the gait cycle. Interestingly, the inter-subject variation observed in Ref. was deemed representative of human subjects and was attributed to individual gait patterns. The practical implication of this variability for the present study is that bone regeneration cannot be solely linked to implant stiffness, but likely reflects the local biomechanical demands. The biomechanical demand is a product of locally exerted load and material compliance. While the material compliance can be calculated, simulated or tested (more precisely in the case of scaffolds, and approximately in the case of bone), the variance of the locally exerted load is difficult to quantify. For this reason, it would be of great value to consider in the future related studies such aids as local strain monitoring by using strain gauge fitted to the operated limb, and/or mobility monitoring by using wearable external sensors to accrue longitudinal life-style and activity data. Identification of strong and weak responders in the reported group of sheep who are genetically heterogeneous and socially hierarchical is an important piece of information learned that might not be apparent from a small animal experiment. For each graph, the micro-CT slice number is shown on the x-axis and the bone formation score is on the y-axis. CT slice 1 was 2 mm from the periosteal surface, while slices 2, 3, 4 and 5 were 5, 8, 11 and 14 mm from the periosteal surface, respectively. On each graph, there are six different color-delineated data points for each CT slice point on the x-axis (though 6 points are not always visible due to overlap as some have similar bone ingrowth). Each color represents one individual scaffold (each scaffold was tested in 6 ovine limbs). Each data point in the graphs represents the mean reported ingrowth from the three observers for that CT slice. The data points for each individual scaffold are linked by colored lines for the five slices. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.) Table 3 Scoring criteria for bone formation at the bone-implant interface (periphery of the defect) and within the interior of the implant and defect. Two mechanisms for osteogenesis, strain-induced and injury-induced Evaluation of the osteogenic response separately for the bone-implant interface and for the scaffold interior revealed an unexpected feature: bone regeneration at the interface was independent of both the properties of the implant (whether stiff or compliant) and the regenerative capacity of the host (whether a strong or weak response). In other words, both weak responders and strong responders having either stiff or compliant implants within the defect demonstrated rather similar reactions at the periphery of the osseous defect, with a similar mineral apposition rate of 2-3 m/day and noticeable osseointegration (host bone engulfing peripheral elements of the scaffold). On the other hand, osteogenesis within the interior of the scaffold depended on two parameters, the scaffold's apparent modulus and the regenerative potential of the host. This dual response (peripheral and central, with respect to the implant) seemingly illustrates two pathways of bone formation, one being the reaction to the local effect of inflammation and/or trauma, and the other being the reaction to local strain. Of note, while 3D quantification of bone ingrowth in the entire scaffold (i.e., both periphery and interior) produced insignificant differences in scaffolds with close values of apparent moduli, the scoring of nascent bone formation within the scaffold interior did yield a statistically significant difference between PB and TB. Therefore, there is a possibility that the significance of the difference in pairs with close modulus values was blurred by the peripheral, injury-dependent response that was uniform. We observed mainly woven bone formation at the boneimplant interface, and a mixture of different proportions of woven and lamellar bone within the scaffold interior. Indeed, a study by Turner et al. showed that woven bone appears in response to local irritation and does not depend on strain levels, whereas lamellar bone is deposited in response to strain exceeding about 0.1%. McBride et al. define an "injury response" (woven bone formation) and an "adaptive response" (mostly lamellar bone formation), which is consistent with the findings of our study, where we observed the injury Table 4 Bone formation score at the implant-bone interface and implant interior, together with the mineral apposition rate for the four scaffolds (from manual measurements of the mineral apposition rate performed from the periphery of fluorescent images). Significant differences (non-paired T-test, n = 14, p < 0.05) are indicated by brackets. No differences can be identified between the scaffold types in terms of bone regeneration at the bone-implant interface, whereas the score for the amount of nascent bone observed within the interior of both polyamide scaffolds (PB and PC) is significantly higher in comparison to both titanium scaffolds (TB and TC). response at the periphery of the defect at the implant-bone interface, and the adaptive strain-dependent response in the interior of the scaffold. In practical terms, the injury response at the bone-scaffold border is "guaranteed", whereas the strain-induced bone formation in the scaffold interior is conditioned by the local biomechanical demand and is as (un)certain as the host's regenerative response is. Thus, careful consideration of these two factors, both the adequacy of scaffold's stiffness/compliance and the host responsiveness, leads to a critical question: whether a degradable scaffold is an indisputably ideal solution for bone regeneration. While it is definitely desirable to achieve a complete replacement of the graft with the host tissue, the reality may impose certain constraints, such as the mechanosensitivity or regenerative capacity of the host. Undoubtedly, longer studies are essential to clarify whether a "weak responder" may eventually catch up with a "strong responder" in terms of the strain-dependent bone formation, or whether the weak response can be augmented by supplementary physical or pharmaceutical stimuli. Perhaps in some cases of uncertain regenerative potential of the host due to inherently low metabolic activity, old age, frailty, or low level of physical activity, a failsafe strategy of nondegradable or partially-degradable graft design could be pursued even when a small volume of bone has to be reconstructed. Woven and lamellar bone pathways Woven bone is different from lamellar bone in terms of structure and function. A common notion is that woven bone is initiated by higher strains than lamellar bone and it is an injury response. However, woven bone normally precedes lamellar bone formation for the reason of providing anchorage and a suitable substrate for lamellar bone deposition, be it in the scenario of damage repair or normal fetal development. Woven bone formation advantageously takes place de novo. Although its organization and mechanical properties are inferior to lamellar bone, woven bone provides a transient biological scaffold whose mechanical properties can be further adapted and fine-tuned by surface deposition of lamellar bone. Thus, the presence of woven bone is not only an indicator of high local strains, but it is also a trait of the initial, transient stage of osteogenesis. In this study, we observed vast networks of woven bone within the interior of the TB scaffold. These woven bone formations were not associated with the surface of titanium scaffold struts. This is consistent with the description of woven bone forming within a fracture callus and not being associated with the surface of existing trabeculae, referred to as "true osteoinduction". Within the more compliant PB and PC scaffolds, where strain was higher, at the time of sample retrieval, woven bone had mostly given way to lamellar bone: deposits of lamellar bone overlaid onto reticulate elements of woven bone. The question as to whether the physiological woven-to-lamellar bone transition is accelerated by higher biomechanical demand, or decelerated within a low-strain niche, can be answered by comparing the localization of mineral-binding fluorescent label in undemineralized sections. We administered the fluorescent label 2 weeks prior to sample collection; the observation of fluorescent reticulate elements of exclusively woven bone within the titanium scaffold interiors indicates that low strain may decelerate the normal sequence of osteogenic events (i.e., when woven bone within a low-strain niche was not eventually superimposed by lamellar bone, as would normally occur). Polyamide serves as a woven-bone surrogate substrate for lamellar bone The nascent bone tissue that we observed within the polyamide scaffolds (PB and PC) displayed more mature characteristics, such as having lamellar structure and co-alignment of osteocytes. Polyamide scaffold struts and nascent bone were in close interlocking contact, with mineralized bone formation observed around the scaffold elements (each about 1 mm in diameter) and around partially fused, individual grains of polyamide substrate (each about 50 m in diameter). The close contact between the bone and scaffold material can be explained by the similar values of material bone and polyamide elastic moduli (being in the range of several GPa), so that osteoprogenitor cells and osteoblasts populate the polyamide scaffold surface in a manner similar to bone surfaces during normal development. Following an established definition, de novo bone formation by newly-differentiated osteogenic cells within nonmineralized tissue is called osteoinduction, whereas bone deposition on an existing surface/substrate is called osteoconduction. The surface required for osteoconduction can be natural (such as woven bone) or artificial (such as an implanted material). The desired outcome of bone tissue engineering is the formation of mature, mechanically superior and adaptive lamellar bone, rather than the more delicate and primitive woven bone. For these reasons, provision of a nonresorbable, suitably compliant surrogate construct for direct lamellar bone apposition (i.e., osteoconduction within an artificial scaffold) could be a viable strategy in bone tissue engineering. A note on observations of adipose tissue found in defect sites: a proxy for bone maturation The compliant scaffolds showed a more advanced stage of bone formation, where lamellar bone partly overlaid the woven bone. The presence of adipocytes, either in small clusters, or as vast areas, accompanied the appearance of mature lamellar bone in the case of the polyamide scaffolds. Indeed, bone, fibrous stroma and adipocytes are the progeny of marrow pericytes, also known as skeletal stem cells (SSCs). Adipocytes are large, roughly spherical or ellipsoid cells containing a unilocular lipid droplet, and are highly recognizable in histological sections. Of all the derivatives of SSCs, adipocytes appear chronologically last, when committed osteoprogenitors establish their association with blood vessels. Marrow adipocytes conduct the function of reversible microvasculature pruning; they accumulate lipids to swell at the outer surface of marrow sinusoids, and thus precisely regulate microcirculation and hematopoietic progenitor traffic. The presence of adipocytes associated with nascent bone deposits within the compliant scaffold interior could be a potential indicator of an advanced stage of bone development and maturation. Conclusions and outlook The results of this 6-week study in sheep confirmed the previously observed phenomenon of more intensive osteogenesis in response to mechanical challenge. Interestingly, it also produced new questions that entail future work. For example, what is the relationship between reparative bone formation and host regenerative capacity, what are the relative proportions of injury-and strain-driven osteogenesis, and what is the pace of the woven-to-lamellar bone transition? A longer-term study would benefit from (i) incorporating in vivo strain measurements to determine the extent of the "biomechanical demand" and its relation to osteogenesis, (ii) monitoring group dynamics and locomotion, for studying variations in individual physical activity and gait patterns, (iii) administration of multiple fluorescent labels to better quantify bone formation over longer times in the context of osteoinduction and osteoconduction, (iv) injection of x-ray contrast agent prior to euthanasia for comparison of microvascularization of various implants, and finally, (v) a larger metaphyseal defect could be considered, with variable stresses and strains at its interfaces, enabling load-specific responses. These refinements will serve a better platform for tuning the mechanical properties of 3D-printed biomimetic scaffolds, for the pressing clinical demands of substantial bone defects. The multidimensional Goldilocks' principle of "not too much and not too little" may thus be addressed by flexing both the design and material choice to suit to the widely varying mechanical demands of reconstructive surgery.
|
Sustainable Deep Learning at Grid Edge for Real-Time High Impedance Fault Detection High impedance faults (HIFs) on overhead power lines are known to cause fires. They are difficult to detect using conventional protection relays because the fault current is insufficient to cause tripping. The delay in detecting HIFs can result in severe bushfires and energy losses; hence a high throughput, low latency detection scheme needs to be developed for HIF detection. Moreover, the complexities associated with HIF detection demands signal processing techniques combined with artificial intelligence to achieve higher detection accuracy. This paper proposes a sustainable deep learning-based approach in an edge device, that can be mounted on top of a power pole to detect HIFs in real-time. Data acquisition, feature extraction, and deep learning based fault identification are performed in an embedded edge node to achieve higher throughput, reduced latency as well as offload the network traffic. Furthermore, optimization techniques such as hardware parallelism and pipelining are adapted to achieve real-time fault identification on edge devices while ensuring the efficient usage of its limited resources. Real-time implementation of the proposed system is validated through laboratory experiments and the results demonstrate the suitability of edge computing to detect HIFs in terms of reduced detection latency (115.2 ms) and higher detection accuracy (98.67 percent).
|
<reponame>spamz23/mljar-supervised
import unittest
import tempfile
import numpy as np
import pandas as pd
from supervised.preprocessing.encoding_selector import EncodingSelector
from supervised.preprocessing.preprocessing_categorical import PreprocessingCategorical
class CategoricalIntegersTest(unittest.TestCase):
def test_selector(self):
d = {"col1": ["a", "a", "c"], "col2": ["a", "b", "c"]}
df = pd.DataFrame(data=d)
self.assertEqual(
EncodingSelector.get(df, None, "col1"),
PreprocessingCategorical.CONVERT_INTEGER,
)
self.assertEqual(
EncodingSelector.get(df, None, "col2"),
PreprocessingCategorical.CONVERT_ONE_HOT,
)
|
Nanobody interaction unveils structure, dynamics and proteotoxicity of the Finnish-type amyloidogenic gelsolin variant AGel amyloidosis, formerly known as familial amyloidosis of the Finnish-type, is caused by pathological aggregation of proteolytic fragments of plasma gelsolin. So far, four mutations in the gelsolin gene have been reported as responsible for the disease. Although D187N is the first identified variant and the best characterized, its structure has been hitherto elusive. Exploiting a recently-developed nanobody targeting gelsolin, we were able to stabilize the G2 domain of the D187N protein and obtained, for the first time, its high-resolution crystal structure. In the nanobody-stabilized conformation, the main effect of the D187N substitution is the impairment of the calcium binding capability, leading to a destabilization of the C-terminal tail of G2. However, molecular dynamics simulations show that in the absence of the nanobody, D187N-mutated G2 further misfolds, ultimately exposing its hydrophobic core and the furin cleavage site. The nanobody's protective effect is based on the enhancement of the thermodynamic stability of different G2 mutants (D187N, G167R and N184K). In particular, the nanobody reduces the flexibility of dynamic stretches, and most notably decreases the conformational entropy of the C-terminal tail, otherwise stabilized by the presence of the Ca2+ ion. A Caenorhabditis elegans-based assay was also applied to quantify the proteotoxic potential of the mutants and determine whether nanobody stabilization translates into a biologically relevant effect. Successful protection from G2 toxicity in vivo points to the use of C. elegans as a tool for investigating the mechanisms underlying AGel amyloidosis and rapidly screen new therapeutics. Introduction AGel amyloidosis (AGel) is a neglected disease caused by deposition of gelsolin (GSN) amyloids and described for the first time in Finland in 1969. For a long time, AGel has been associated with the substitution of a single residue of the protein, D187 in the protein second domain (G2) (Figure 1), to either N or Y. It has also been considered an endemic pathology in Finland and named Familial Amyloidosis, Finnish-type (FAF). Nowadays, AGel is the preferred name for this disease, as new cases have been gradually reported from many other countries demonstrating its worldwide occurrence. In the last five years, the broader clinical use of genetic tests and the raised awareness of this class of diseases led to the identification of three new AGel forms. A new classification of the disease into three different types, according to the GSN sequence and the organ(s) involved in amyloid deposition, has been therefore proposed and includes: i) a systemic form, caused by D187N and D187Y mutations, respectively known as the Finnish-and Danish-variant; ii) a kidney localized form, associated with the deposition of GSN, either full-length or as fragments, carrying N184K or G167R mutation ; and iii) a sporadic form, caused by wild-type (WT) GSN deposits surrounding a sellar glioma of the hypophysis. All AGel types share the lack of effective pharmacological therapies that cure the disease targeting the source of toxicity, rather than acting only as palliative, symptomatic treatments. Among the listed GSN variants, the D187N protein is the best biochemically and biophysically characterized. More than 20 years of in vitro and in vivo studies led to a consensus on the pathological mechanism underlying Finnish AGel type, although this model has been questioned by recent findings. According to this model, aspartic acid 187 is part of a cluster of residues in the G2 domain of GSN, able to chelate a calcium ion. Its N or Y substitution compromises calcium binding, leading to the exposure of an otherwise buried sequence, which is recognized by the furin protease. In the Golgi, this intracellular enzyme cleaves GSN producing a C-terminal 68 kDa fragment (C68). C68 is later exported to the extracellular space where it is further processed by matrix metalloproteases, eventually producing 5 and 8 kDa highly amyloidogenic peptides. These fragments rapidly aggregate and deposit in different tissues and organs. In stark contrast to the extensive biochemical knowledge available on the D187N mutant, its crystal structure has never been obtained, limiting the mechanistic understanding of GSN instability and aberrant proteolysis. This study aims at characterizing the crystal structure of the isolated G2 domain (Figure 1) of the D187N protein (D187N G2 ) by exploiting a recently-developed nanobody (Nb) targeting GSN. Different Nbs able to bind mutated GSN and to detect or prevent its aggregation, have been developed and tested. Among them, Nb11 proved to be the most efficient one. Studies performed in vitro and in vivo demonstrated that Nb11 binds G2 domain of GSN with high affinity, irrespective of calcium, and protects the mutated domain from furin proteolysis, thus skipping the first event of the aberrant proteolytic cascade. Inspired by the recent use of Nbs as an unique tool for structural biological studies, we employed Nb11 to increase the stability of D187N G2. The successful co-crystallization of D187N G2 in complex with Nb11 (D187N G2 :Nb11) showed that the nanobody protects D187N G2 from furin-induced proteolysis, stabilizing the G2 C-terminal linker. Such stabilization is achieved allosterically since the Nb11 binding site locates far from the furin cleavage site. We complemented the structural results cross-referencing molecular dynamics (MD) simulations insights with thermal denaturation studies and furin proteolysis assays. These studies were extended to other mutations causing AGel, such as G167R and N184K. In the absence of cellular or animal models recapitulating G167R and N184K-related AGel as well as the toxicity of the WT or mutated G2 domains, we decided to employ the invertebrate nematode Caenorhabditis elegans as "biosensor", able to recognize proteins which exert in vivo a biologically relevant effect. This approach takes advantage of the ability of the pharynx of worms, fundamental for their feeding and survival, to be inhibited when it meets molecules acting as chemical stressors. This nematode-based method has been widely applied to recognize the toxicity of different amyloidogenic proteins in vivo, demonstrating that singular molecular mechanisms underlie their proteotoxic activity 29]. The protein folding, oligomerization propensity and the exposure of hydrophobic residues on the outside of the protein are relevant for the toxic action of -amyloid (A) and HIV-matrix protein p17. Instead, amyloidogenic cardiotoxic light chains are recognized as stressors by C. elegans thanks to their ability to interact with metal ions and continuously generate reactive oxygen species. Our findings indicate that C. elegans efficiently recognizes the proteotoxic potential of the G2 domains and can discriminate between different level of toxicity. Furthermore, the stabilizing effects induced by Nb11 on G2 translated into an effective protection in vivo. These observations point to the use of this nematode-based model as a valuable tool for investigating the mechanisms underlying AGel. Protein production If not otherwise stated, all chemicals are from Sigma-Aldrich (Merck Millipore Ltd., Tullagreen, Carrigtwohill, Co. Cork, IRL) and of the best available purity. All preparative and analytic chromatographies were performed on a KTA pure 25 system (GE Healthcare, Uppsala, Sweden) using prepacked columns from the same company. Gelsolin expression and purification Constructs and expression conditions for GSN variants as isolated G2 domain or full-length proteins were performed as already reported. The here named G2 refers to the shorter G2s construct in and spans residues 151-266 of the GSN, according to the mature plasma isoform ( Figure 1). Purification followed the protocol previously described. G2 construct for the expression of WT G2 harbours a WT sequence but lacks the first beta-strand (1); it spans residues 168-266 and it is purified following the same protocol developed for the other G2 domains. Briefly, G2 domains were passed through a Ni-chelating column (HisTrap) and gel filtered in a Superdex 75 following the removal of the His-tag. Full-length proteins went through three chromatographic steps without cleaving the N-terminal tag, HisTrap, MonoQ and gel filtration on a Superdex 200. G2 domains were stored in a 20 mM HEPES solution, pH 7.4, containing 100 mM NaCl and 1 mM CaCl 2 whereas full-length GSN in 20 mM HEPES solution, pH 7.4, containing 100 mM NaCl, 1 mM EDTA and 1 mM EGTA. Whenever required proteins were concentrated or buffer-exchanged in centrifugal filters Amicon ® Ultra (Merck Millipore Ltd., Tullagreen, Carrigtwohill, Co. Cork, IRL) with cutoffs of either 10k or 30k. Nb11 expression and purification The synthetic gene coding for Nb11 fused to the thrombin cleavage site and 6xHis tag at the Cterminus was purchased by Eurofins genomics (Ebersberg, Germany). The sequence was optimized for E. coli codon usage and the gene cloned in a pET11 vector (Merck Millipore Ltd., Tullagreen, Carrigtwohill, Co. Cork, IRL). Tagged Nb11 was produced in SHuffle ® T7 E. coli cells (New England BioLabs Inc., Ipswich, USA) grown in LB medium. Once OD at 600 nm reached the value of 0.6, the expression of the gene was induced with 0.5 mM Isopropyl -D-1-thiogalactopyranoside and cells harvested by centrifugation 16 h after incubation at 20 °C. Cells were resuspended in 20 mM Na 2 PO 4, pH 7.4, containing 500 mM NaCl (supplemented with DNase I and cOmplete™ Protease Inhibitor Cocktail), lysed with a Basic Z Bench-top cell disruptor (Constant system Ltd., UK) operating at 25 kPsi and centrifuged at 38,000 RCF. The clarified crude extract was loaded on a 5 ml HisTrap and Nb11 eluted stepwise with the lysis buffer supplemented with 500 mM imidazole. Fractions enriched in Nb11 were passed through a Superdex 75, equilibrated with 20 mM HEPES, pH 7.4, 100 mM NaCl. Crystallization D187N G2 :Nb11 complex for crystallization experiments was prepared by mixing equimolar amounts of the individual protein. The complex was loaded on a Superdex 75 increase (equilibrated with 20 mM HEPES, 100 mM NaCl, 1 mM CaCl 2, pH 7.4), obtaining a single peak, consistent with the theoretical molecular weight of the complex, which was concentrated to 12 mg/ml in the same buffer. This sample was used for extensive crystallization screening using an Oryx-8 crystallization robot (Douglas Instruments Ltd, UK) and several commercial solutions in a sitting-drop set up. The purified complex (0.15/0.25 l) was mixed with 0.25/0.15 l of the reservoir solutions. Two different conditions yielded crystals after 2-6 days at 20 °C, namely (i) 0.1 M potassium thiocyanate, 30 % poly(ethylene glycol) methyl ether 2000 and 4.0 M sodium formate and (ii) 0.1 M potassium phosphate, pH 6.2, 10% (v/v) glycerol and 25% v/v 1,2 propanediol. Crystals were soaked with the respective reservoir solution supplemented with 20% glycerol, flash-frozen in liquid N 2 and diffraction data were collected at beamline ID23-1 (European Synchrotron Radiation Facility, Grenoble, France). Data processing, structure solution, refinement and analysis The two datasets (orthorhombic and tetragonal crystals grown in condition (i) and (ii), respectively) were processed with XDS, scaled with Aimless, and the structures solved by molecular replacement using the program phaser and the PDB: 4S10 as the searching model. The orthorhombic structure (1.9 ) was refined with phenix.refine and manual model building was performed with COOT. The final coordinates were deposited in the RCSB database with accession code PDB: 6H1F. The tetragonal structure (2.4 ) could be refined only partially due to the poor quality of the diffraction (see Table 1 for the complete data collection and refinement statistics). The structural analysis was performed using the orthorhombic structure, except where indicated; all of the figures were prepared with either PyMOL or VMD. All the other structures used for the B factor analysis were subjected to 3 cycles of refinement with phenix.refine. B factors for the WT G2 :Nb11 and D187N G2 :Nb11 were averaged between asymmetric molecules or between datasets, respectively. The rest of the analysis was performed as reported earlier. Molecular dynamics (MD) simulations The crystal structure of G2 domain in complex with Nb11 (PDB: 4S10) was used to build the initial configuration for MD runs. The structure editing and building facilities provided by the HTMD software package were used to construct a set of systems by selecting either the G2 domain only (chain D of the original PDB file) or the domain together with the bound Nb11 (chains D and B). In silico mutations were applied to restore residues 226 and 228 to their WT amino acids, to generate the D187N and N184K systems, and to remove the coordinated Ca 2+ ion where appropriate. The titratable side chains and initial H bond network were then optimized at pH 6.5 via the proteinPrepare procedure of HTMD ; systems were solvated with transferable intermolecular potential with 3 points (TIP3P) water at 100 mM NaCl ionic strength and parameterized with the CHARMM36 force field. The systems thus prepared were minimized and equilibrated for 4 ns in constant pressure conditions at 1 atm, yielding orthorhombic boxes with a water buffer of at least 15 per side. All simulations were conducted via the ACEMD software with a timestep of 4 fs, particle-mesh Ewalds long-range electrostatics treatment and the hydrogen mass repartitioning scheme. Each system was set for a production run in the number volume temperature (NVT) ensemble. Simulations of the G2 system without Nb11 were completely unrestrained and therefore the globular domain was free to diffuse in the solvent. To obtain a more efficient simulation box for the G2:Nb11 elongated complex while still preventing self-interactions with periodic images, its rotational diffusion was restricted by restraining C atoms of the Nb11"s secondary structure elements with a harmonic force of 0.025 kcal/mol/ 2. No restraint was applied to the G2 domain, nor to the contact region of Nb11. Runs were interrupted at 800 ns or when the full solvation of the C-terminus caused its extension outside of the simulation box. The WT G2 :Nb11 simulation was also truncated at 750 ns because the complex became transiently unbound. Local conformational flexibility was assessed computing the root-mean-square fluctuation (RMSF) of backbone atoms, aggregated by residue; values are reported as the equivalent B factors according to the equation B=8 2 /3 RMSF 2. Circular Dichroism (CD) spectroscopy CD measurements were performed with a J-810 spectropolarimeter (JASCO Corp., Tokyo, Japan) equipped with a Peltier system for temperature control. All measurements were performed on 15 M G2, Nb11, or the complex in 20 mM HEPES solution containing 100 mM NaCl and 1 mM CaCl 2 at pH 7.4. Temperature ramps were recorded from 10°C to 95°C (temperature slope 50 °C/h) in a 0.1 cm path length cuvette and monitored at 218 nm wavelength. Thermofluor Thermodynamic stabilities were also evaluated in the presence of Sypro Orange, a fluorogenic probe unspecifically binding hydrophobic surfaces and with excitation/emission spectra compatible with standard qPCR machines. WT and mutated G2 domains with or without equimolar Nb11, were diluted to 1 mg/ml in 20 mM HEPES solution containing 100 mM NaCl and 1 mM CaCl 2, pH 7.4. Each solution was mixed with 3 l of a 1/500 (v/v) dilution of Sypro Orange, in a total volume of 20 l. Fifteen l of each sample were transferred to multiplate ® PCR Plates, sealed with Microseal ® "B" Film, and analysed in triplicate in an MJ Mini TM Thermal Cycler (hardware and consumables from Bio-Rad Laboratories Inc., Hercules, USA). The temperature was increased from 10 °C to 100 °C in 0.2 °C steps with 10 s equilibration before each measurement. Fluorescence intensity was measured within the excitation and emission wavelength ranges of 470-505 and 540-700 nm, respectively. T m was calculated as the minimum of the first-derivative of the traces using the manufacturer software and the value is reported as the average of triplicate measures. Furin assay Furin cleavage assays were performed in a total volume of 30 l, using 1 U of commercial furin enzyme (New England BioLabs Inc., Ipswich, Massachusetts, USA) and 1 mg/ml of full-length WT and mutated GSN in 20 mM 2-(N-morpholino)ethanesulfonic acid, pH 6.5, containing 100 mM NaCl and 1 mM CaCl 2 in the presence or absence of 1 mg/ml of Nb11 (roughly 1:6 GSN:Nb11 molar ratio). To monitor the susceptibility to proteolysis, 12 l aliquots of the reaction mix were collected right upon addition of furin and 3 h after incubation at 37 °C. The reaction was blocked by adding to each sample 4 l of Sodium Dodecyl Sulphate (SDS) loading buffer 4X (BioIO-RadAD Laboratories Inc., Hercules, USA) supplemented with 0.7 M -mercaptoethanol and by incubation at 90 °C for 3 min. Proteolysis reaction was monitored by SDS -PolyAcrylamide Gel Electrophoresis using ExpressPlus™ PAGE (12%) and the provided running buffer (GenScript Biotech Corp., USA ). Proteotoxicity studies on C. elegans Bristol N2 strain was obtained from the Caenorhabditis elegans Genetic Center (CGC, University of Minnesota, Minneapolis, MN, USA) and propagated at 20°C on solid Nematode Growth Medium (NGM) seeded with E. coli OP50 (CGC) for food. The effect of G2 domains on pharyngeal behavior was evaluated as already described. Briefly, worms were incubated with 1-1000 g/ml of G2 domains (100 worms/100 l) in 2 mM HEPES solution containing 1 mM NaCl and 0.1 mM CaCl 2, pH 7.4. Equimolar concentrations of WT G2 or WT G2 (18 M, corresponding to 250 g/ml of WTG2) were administered to worms in the same conditions. Hydrogen peroxide (1 mM) was administered in dark conditions as a positive control. After 2 h of incubation on orbital shaking, worms were transferred onto NGM plates seeded with OP50 E. coli. The pharyngeal pumping rate, measured by counting the number of times the terminal bulb of the pharynx contracted over a 1-minute interval, was scored 2 and 24 h later. Control worms were fed 2 mM HEPES solution containing 1 mM NaCl and 0.1 mM CaCl 2, pH 7.4 (Vehicle) only. To evaluate the protective effect of Nb11, worms were fed for 2 h G2 domains alone (250 g/ml for WT G2 and D187N G2 and 100 g/ml for N184K G2 and G167R G2, corresponding to 19 and 8 M, respectively), 8-19 M Nb11 alone, or G2 domains previously pre-incubated for 10 min at room temperature under shaking conditions with equimolar concentration of Nb11 to allow the formation of the complex. Nematodes were then transferred to NGM plates seeded with fresh OP50 E. coli and the pumping rate was scored after 2 and 24 h. Worms were also exposed to Vehicle in the same experimental conditions. Crystal structure of the D187N G2 :Nb11 complex Crystals of the isolated D187N G2 :Nb11 complex readily appeared in different conditions, allowing the collection of two X-ray diffraction datasets of different quality. Particularly, the crystal grown in condition (i) above, belonging to the P2 1 2 1 2 1 space group, diffracted to 1.9 resolution, and the one that appeared in condition (ii), belonging to the P4 1 2 1 2 space group, diffracted to 2.4. The resulting models are hereafter referred to as the orthorhombic and tetragonal structure, respectively ( Figure 2); the complete list of the data collection and refinement statistics is reported in Table 1. Due to the difference in quality of the data, the orthorhombic structure is used to infer the impact of the D187N mutation on the GSN structure (Figure 2), unless otherwise stated. Data collection Space group P 2 1 2 1 2 1 P 4 1 Both the structures obtained confirm that Nb11 binds the G2 domain over an extended area including the 5-loop-2 region (residues 230-234, 238-245) and the loop-4 stretch (residues 193-198) as already observed for WT gelsolin (PDB: 4S10, ). The binding region is opposite from the aberrant cleavage site (residues 168-172), which had previously raised suspicions of a crystallographic artifact. The structures obtained here rule out this hypothesis, since it is unlikely that three different crystal packings (WT G2 :Nb11 belongs to P1 space group) artificially stabilize the same assembly ( Figure 2A). Thus, the 3D structures of G2:Nb11 appear unable to explain how the binding to Nb11 in a distal area could shield G2 from furin proteolysis without additional data. The second remarkable feature of the WT G2 and D187N G2 assemblies is that the G2 structures are almost identical (root mean squared deviation, RMSD, 0.25 over 90 C atoms). Besides, two striking differences were observed: the absence of the coordinated calcium ion, and a shorter stretch of ordered C-terminal segment in D187N G2 (Figure 2A). In the C-terminus of mutated G2, we could only model up to residue 258 and 255 in the orthorhombic and tetragonal structure, respectively (Figure 2A), suggesting that the remaining stretch of the protein is highly flexible and invisible to X-rays (the last resolved amino acid in WT G2 is 261). The disorder prediction algorithm MobiDBlite indeed reports a putative disordered region around residues 220-258 owing to its polyampholitic character (Supplementary Figure S1). Besides the C-terminus, all residues are modelled but a few side chains of the Nb11 chain (namely V2, K65 and L128). The superimposition of the orthorhombic structure of D187N G2 to that of the WT G2 (PDB: 1KCQ), shows no major conformational changes (as is the case for the G167R variant) nor the rearrangement of the hydrogen bond network in the core of the domain in the N184K variant, unlike it was observed for the other G2 mutants ( Figure 2B). Residues G186, D187 and E209 of the calcium-coordinating cluster show remarkable conformational conservation (D259, the fourth residue of the cluster, lies in the unresolved C-terminal stretch). Impact of the D187N mutation on the structure of the G2 domain A large body of evidence indicates that the presence of D187N mutation mainly affects the ability to bind the calcium ion. In WT G2 the calcium binding site is a highly polar cavity delimited by the protein core, the side chain of K166 and the C-terminal tail ( Figure 3A, left). The ion is pentacoordinated by the side-chains of residue D187, E209 and D259 and by the main-chain O atom of G186. The site is open to the solvent on the side opposite to K166, where two ordered water molecules are visible in the WT G2 structure ( Figure 3A, left). In the orthorhombic structure of D187N G2, although the overall geometry of the calcium binding is maintained, some differences are visible. The residue D259 could not be modeled and the presence of a water molecule in its place (bound to the O atom of T257) shows that the residue is extruded from the cavity. Two more water molecules are found overlapping neither with the calcium ion nor with other solvent molecules present in the WT G2 structure. The side-chain of K166 also undergoes small rearrangements: its amino tip becomes more flexible, based on the quality of the electron density, and the interaction with residues 187 and 259 is either lost or weakened. The N187-K166 distance is 4.6, whereas 3.1 separate D187 from K166 in the WT G2 due to a stronger polar interaction ( Figure 3A, middle). This small reorganization of the calcium binding residues, as well as the lack of the coordinated ion, are sufficient to create a small cavity ( Figure 3A, right, computed by PyMOL ), a known source of instability in proteins. Even though this cleft is solventexposed and accessible, the high concentration of its acidic residues might be the force driving the stretching of both D259 residue and the whole C-terminal tail. The same cavity is fully open in the tetragonal structure of D187N G2, where we were able to model only up to residue 255. The electron density for the calcium site is of poor quality (data not shown), the side-chain of K166 is barely visible and no solvent molecule could be modelled. The orthorhombic and tetragonal structures seem to represent two intermediate states toward the domain"s (partial) unfolding. Nb11 binding modulates C-terminal disorder allosterically Based on our structures, one can hypothesize that Nb11 binding induces D187N G2 in a proteolysisresistant conformation, but crystallographic analysis alone is not sufficient to assess whether the flexibility of the D187N G2 C-terminal tail and exposure of the calcium cavity lead to its susceptibility to furin proteolysis. To investigate the impact of the mutation on local kinetics or a possible conformational selection effect by Nb11 binding, we analyzed the domain's dynamics via MD simulations. We simulated the WT G2 and D187N G2 systems in the presence or absence of bound Nb11 ( The most striking result was the fast opening and solvent-exposure of the C-terminus segment, which occurred within the first hundred nanoseconds, in all of the structures of D187N G2 lacking the Ca 2+ ion ( Table 2). In the crystallographic structures of the WT G2 protein, the C-terminal region up until residue 259 lies near the 1-2 hinge loop which hosts the furin cleavage site (R 169 -V-V-R 172 ), indicating a possible steric protection mechanism already suggested by Huff et al.. In consistency with our crystallographic results, MD did not uncover further major "static" structural rearrangements between the WT G2, D187N G2 and D187N G2 :Nb11 in the timescales tested. Local (residue-wise) fluctuations across the G2 residues ( Figure 4A The main molecular events underlying the destabilization induced by the D187N mutation are summarized in Figure 4C. In the absence of Nb11, the fluctuations in D187N G2 lead to the already described flexibility of the C-terminal tail with the increase of its entropy. Then the transient displacement of the 2 helix occurs, followed by the disruption of the hydrophobic core triad composed by W180, F183 and W200 residues (Supplementary Figure S2). Noteworthy, the ConSurf algorithm indicates that F183, belonging to the 0 helix, is strongly conserved in gelsolinlike domains (see Discussion). Even though binding of Nb11 has only a minor impact on the resolved pose of the C-terminal tail, its conformational entropy was reduced compared with D187N G2 alone, thus likely preventing the rearrangement of the 2 helix and the exposure of the core residues. To validate the computational findings, we further compared the amount of disorder obtained from the simulations with the crystallographic data. Although not ideal to investigate protein dynamics, crystallographic data in the 2 resolution range does contain information on the disorder and mobility of the single atoms in the crystal. To this purpose, B factors shown in Figure 4B were extracted from the structures of D187N G2 :Nb11, WT G2 (PDB: 1KCQ) and WT G2 :Nb11 (PDB: 4S10) (the structure of the D187N G2 variant alone is unavailable). B values were averaged between datasets or symmetric molecules (where available) and normalized to zero mean and unit variance in order to obtain a B z-score comparable between models ( Figure 4B). As expected, we observe a sharp decrease of WT G2 and D187N G2 B z-score at the Nb11 binding interface, indicating that this region becomes less dynamic. Stabilization also propagates through the C-terminus and the 2 helix (that is partly involved in the interaction with Nb). The hinge loop formed by amino acid residues 167-170, which hosts the sequence recognized by furin, results very dynamic in both WT G2 and D187N G2 structures (with and without Nb11) suggesting that the presence of the mutation does not directly affect the conformation or the stability of this loop. The MD analysis identified two instability hotspots in the mutated G2 domain: the 0 helix and the stretch comprising 5-2 loop and 2 helix. In the first region we were not able to detect any significant differences between the structure of the WT G2 and that of D187N G2 stabilized by Nb11 (data not shown). As shown in Figure 3B (left panel), the WT G2 5-2 loop is connected to the Cterminal tail and the calcium binding site through a solvent-mediated H-bond network. The structure of the mutant reveals a reorganization of the polar contacts mostly due to a drift of the backbone in the 235-239 stretch and the different conformation of side-chains of residues 185 and 236 ( Figure 3B, right panel). Overall, these observations indicate that the D187N substitution causes a slight loss in connectivity of the G2 domain essentially due to the loss of the coordinated Ca 2+. Major rearrangements observed in the simulations are thus likely prevented by the binding to Nb11, which partly compensates for the loss of the calcium ion and forces the first half of the C terminus of D187N in a WT-like conformation. Nb11 protects all pathogenic GSN variants from aberrant furin proteolysis The ability of Nb11 to bind D187N-mutated GSN and to inhibit its proteolysis by furin has been extensively demonstrated in vitro and in vivo. Recently, we have characterized two novel GSN pathogenic variants reported as responsible for a renal localized amyloidosis, G167R and N184K. Structural and functional analyses revealed that the N184K substitution induces a reorganization of the connection in the core of the G2 domain; contrarily, G167R mutation promotes the dimerization of the protein by a domain swap mechanism. Similarly to D187N, both substitutions impair protein stability and ultimately lead to protein degradation and aggregation. Therefore, we wondered if Nb11 would also be able to bind the variants responsible for the renal disease and protect these proteins against furin proteolysis. The susceptibility to furin proteolysis of full-length WT and the three aforementioned mutants was tested in the presence or the absence of a 6-fold molar excess of Nb11. Full-length activated (i.e. calcium-bound) GSN is a flexible protein prone to unspecific proteolysis, a phenomenon that is more evident for the mutants ( Figure 5, band marked with *). Its susceptibility to furin cleavage was therefore tested over a short incubation time (3 h) at 37 °C. Furin activity produces two fragments, the well-known C68 and one here named N17, which is visible only when proteolysis proceed to a larger extent, as is the case for the G167R variant. Nb11 dramatically reduced the susceptibility to furin of all the tested variants, either abolishing any trace of its activity, or significantly slowing down the process. Nb11 stabilizes the mutated G2 fold The protection exerted by Nb11 on the furin proteolysis cannot be simply explained by steric hindrance. Moreover, our structural and computational analyses pointed at a stability modulation effect. To further elucidate the molecular mechanism underlying the action of the nanobody, we assayed Nb11"s impact on the thermal stability of the G2 variants. Denaturation of the proteins was induced by a linear temperature gradient (from 20°C up to 90°C) and studied by CD spectroscopy at 218 nm (sensitive to -helical content) in the presence of saturating calcium concentration. WT G2 and all the mutated domains showed a sigmoidal increase in ellipticity upon unfolding (Supplementary Figure S3). Contrarily, Nb11 signal decreased over time as the immunoglobulinlike domain lacks -helical content. Interpretation of the melting curves of the complexes is therefore hindered by the opposing behavior of the two proteins. To analyze CD data, we compared the denaturation curve obtained for the G2:Nb11 complex with the arithmetical sum of the experiments performed on the individual subunits of the complex. We hypothesize that, in the case there is no stabilization, the curve of the complex should roughly superimpose to the curve of the sum, because the G2 domain and Nb11 unfold independently. Indeed, this was the behavior observed for the WT G2, in which the binding to Nb11 seems not to have any impact on the protein stability ( Figure 6A). In contrast, all the pathological G2 mutants showed significant differences between the denaturation profile of the sum and that of the experimental complex ( Figure 6A). Figure 6B. Reported values are the average of three independent measurements ± SD, at most. T m for Nb11 alone in the same experimental conditions is 50 ± 1 °C. WT To quantify the stabilizing effect of Nb11, we performed thermofluor experiments of the G2 domains, whose denaturation is achieved in the presence of a fluorogenic probe ( Figure 6B). As reported in Table 3, the T m values for the mutated G2 domains were lower than that of the WT G2 with differences between the T m value of WT G2 and that of the mutated proteins (T m ) ranging from 12.6°C to 17.3°C. These results are similar to those previously reported, measured by CD (see supplementary Table 1). The WT G2 :Nb11 complex unfolds at a lower temperature than the WT G2 alone, suggesting the absence of any stabilization induced by Nb11. On the contrary, mutants" thermal stability significantly benefits from Nb11 binding as indicated by the T m values which dropped to 3.1-4.7 °C (Table 3). In agreement with the structural observations, these data show that Nb11 protects G2 from aberrant proteolysis reverting the destabilization induced by the mutations. It is noteworthy that both T m experimental approaches are insensible to the displacement of the C-terminal tail, because it neither results in a loss of secondary structures nor it leads to the exposure of hydrophobic patches, being the calcium pocket very polar. Nb11 counteracts the proteotoxicity of G2 domains in C. elegans It is well known that the administration to nematodes of a toxic compound, such as a misfolded protein, induces a pharyngeal dysfunction that can be evaluated by counting the number of worm"s pharyngeal contractions, defined as "pumping rate". Therefore, we employed C. elegans assays to determine whether the structural changes and the stabilizing effects induced by Nb11 on the mutated G2 variants can also affect their biological properties. First, we evaluated the ability of WT G2 or mutated G2 to induce a pharyngeal dysfunction in worms. To this end, 250 g/ml of each protein was administered to worms, and the pharyngeal contraction was determined at different times after the treatment. After 2 h the pumping rate of WT G2 -fed worms is significantly reduced compared to those fed vehicle (228.4 ± 1.7 and 217.1 ± 1.6 pumps/min for vehicle-and WT G2 -fed worms, respectively) ( Figure 7A). A greater inhibition was observed in nematodes treated with mutated G2 domains, particularly N184K G2 (177.9 ± 1.8 pumps/min) which is significantly more toxic than G167R G2 and D187N G2 variants (191.6 ± 2.3 and 208.4 ± 3.0 pumps/min, respectively) ( Figure 7A). These outcomes were comparable to those of worms treated with 10 mM hydrogen peroxide, used as positive stress control (183.7 ± 1.6 pumps/min, p<0.0001 vs vehicle, Student"s t-test), indicating that the reduction of pharyngeal contraction induced by the mutated G2 domains is biologically relevant. We also observe that the pharyngeal impairment induced by WT G2 is transient because the pumping rate scored 24 h after the administration was similar to that of vehicle-fed nematodes (233.4 ± 2.3 and 225.8 ± 1.7 pumps/min for vehicle and WT G2, respectively). On the contrary, the mutated G2 domains induced a persistent pharyngeal functional damage, without complete recovery even after 24 h ( Figure 7B). Whereas the pharyngeal dysfunction induced by D187N G2 did not change over time (208.4 ± 3.8 and 211.3 ± 3.5 pumps/min at 2 and 24 h, respectively), those caused by G167R G2 and N184K G2 significantly decreased (Supplementary Figure 4). Trying to establish a relationship between protein toxicity and folding, worms were fed with equimolar concentration of either WT G2 or WT G2. Lacking the 1 strand, WT G2 is unable to properly fold and displays spectroscopy characteristics typical of a natively unfolded protein under physiological conditions. We observed that the unfolded G2 domain (WT G2 ) was significantly more effective in reducing the pharyngeal pumping than the folded one underlining the relevance of the folding status for the toxicity (Supplementary Figure 5). The different toxic potential of the mutated G2 domains is further proven by the experiments evaluating their dose-dependent effects on the pharynx of worms ( Figure 7C-D). IC 50 (half-maximal effect) values calculated 2h after the exposure resulted significantly higher for WT G2 than for mutated G2 and, among these, the higher toxicity was obtained for N184K G2 (Table 4). Similar IC 50 values are calculated after 24 h for G167R G2 and D187N G2 whereas a 4-fold increase is observed for N184K G2 (Table 4). These findings indicate that C. elegans can efficiently recognize the proteotoxic potential of G2 domains, pointing to its use as a rapid and valuable tool to investigate the mechanisms underlying AGel. Also, the different proteotoxic abilities exerted by the various mutated G2 domains suggests that each mutation may drive a specific damage. The effect of Nb11 on the pharyngeal toxicity induced by the G2 domains was then investigated. For these experiments, worms were fed 250 g/ml of WT G2 or D187N G2 (corresponding to 19 M), 100 g/ml of N184K G2 or G167R G2 (corresponding to 8 M), concentrations close to the IC 50 value calculated for the 2h of exposure (Table 3). G2s were administered alone or as complexes with an equimolar concentration of Nb11. Although Nb11 alone caused a significant reduction of the pharyngeal function, both its toxicity as well as those of G2 domains scored 2 h after administration were neutralized when co-administered ( Figure 7E). Noteworthy, the effect of Nb11 on the toxicity induced by the mutated G2 domains were still present 24 h after the treatment (Supplementary Figure 6) as an indication of sustained protective action. These data indicate that the structural and molecular effects induced by Nb11 on the G2 variants can translate into a biologically relevant effect in vivo. Nb11 can bind and chaperone the D187N G2 as well as the G2 domains of the renal variants counteracting their proteotoxic potential. Discussion The current model of the pathological mechanism underlying AGel amyloidosis is mostly based on studies performed on the D187N-mutated protein and experiments conducted in vitro and in vivo on transgenic animals expressing this variant. Results obtained with D187N likely also apply to the later discovered Danish variant (D187Y), although some differences were reported. On the contrary, the mechanism underlying the recently discovered renal disease associated with the N184K and G167R mutations have not been fully elucidated. Interestingly, while the crystallographic structures of isolated G2 domains carrying the N184K or G167R mutation are already available, until now the D187N/Y structural characterization had not been elucidated. We here demonstrated that crystallization of the D187N G2 domain was possible only in complex with a previously developed nanobody, called Nb11. Nb11 tightly binds to gelsolin and protects the D187N variant from aberrant furin proteolysis. In the analysis of the crystal structure, we must consider that the binding of Nb11 somehow biases our model. Indeed, we are observing a proteolysis-resistant species that lost, to some extent, the structural determinants of its proteotoxicity. To elucidate the mechanism of protection exerted by Nb11 it is necessary to understand the pathological mechanism of D187N mutation (and vice versa). Clearly, Nb11 acts as a protective chaperone; however, the molecular mechanism behind such function was as yet unclear, mainly because Nb11 binds G2 in a position distant from the furin cleavage site (Figure 2). Regarding the D187N mutation, a large body of literature is already available, and these studies converged to a general agreement, i.e. that the D187N substitution disrupts calcium binding in G2 and the thermodynamic stability of the mutant is decreased to levels similar to those of the WT protein deprived of calcium 49]. Ultimately the mutation leads to the exposure of an otherwise buried sequence, which is aberrantly cleaved by furin. However, the correlation between calcium binding impairment and susceptibility to proteolysis has been the object of discussion. One hypothesis is that the mutation somehow induces a conformational change of the native state that leads to the exposure of the furin site. Another possibility is that the loss of coordinated calcium increases the population of (partially) unfolded protein, which is generally prone to proteolysis 49]. The partial disorder hypothesis is consistent with the crystallographic structures, the thermodynamic data as well as with the MD results, which in the absence of the coordinated cation show a fast (on a timescale of tens of ns) opening of the C-terminal stretch. Calcium-mediated disorder-to-order induction has been shown, e.g. in sortase, adenylate cyclase toxin, and possibly several others. Interestingly, Kazmirsky and coworkers came to a similar conclusion through a detailed NMR analysis of the D187N variant. In the study, they suggested that the C-terminal tail of the pathogenic variant might be less structured compared to the WT. It might be tempting to explain the increased susceptibility to proteolysis solely based on the flexibility of the C-terminus, which indeed interacts with the hinge loop and exerts some steric protection. However, even the crystallographic structures of the D187N G2 :Nb11 complex reveal a destabilized tail, and the simulations show a similar dynamic behavior of the stretch irrespective of Nb11 binding. Destabilization of the C-terminus might likely be a necessary condition, but it seems not to be sufficient for the efficient proteolytic cleavage. In conclusion, we believe that the destabilization of the C-terminal tail is the direct consequence of the loss of the Ca 2+ ion induced by D187N mutation. Such increased flexibility is the first event that triggers the sequential opening of the gelsolin fold, which results in the exposure of residues of the hydrophobic core. The process is likely reversible and this partially unfolded state of the protein is susceptible to furin proteolysis. In the complex with Nb11, the binding interface, including 0 and 2-loop-5, becomes more rigidly anchored to the proper WT conformation. The latter Nb11stabilized region lies at the base of the disorder-prone C terminus, forming an elbow of sorts. We speculate that Nb11 stabilization reverses, at least in part, the entropy gain due to the abolished coordination of Ca 2+. Even though Nb11 was raised against WT gelsolin, it was shown to bind the D187N variant as well, with a slightly lower affinity. Crystallographic structures of N184K and G167R variants, as isolated G2 as well, are also available. N184K neither impairs calcium binding nor it significantly destabilizes the C-terminal tail. Loss of conformational stability of N184K-mutated G2 comes from the rearrangement of the polar contacts, which the mutated residue is part of, in the core of the domain. As for the D187N/Y case, N184K mutation eventually leads to furin proteolysis. Contrarily, the pathological mechanism underlying the G167R-dependent disease is still to be fully elucidated. An alternative amyloidogenic pathway has in fact been proposed based on the observation that this variant dimerizes via a domain-swap mechanism. At the same time, even the G167R mutant is prone to aberrant proteolysis and shows impaired thermal stability. The WT G2 and D187N-and N184K-mutated variants share a high structural conservation. The Nb11 binding interface of the G167R G2 variant is not affected by its dimerization. As a consequence, it comes as no surprise that Nb11 binds the renal variants with similar efficiency. On the contrary, the protection from proteolysis of the N184K and G167R mutants would have been difficult to predict because the impact of these substitutions on the G2 dynamics as well as the mechanism of destabilization is significantly different. We tested Nb11 protection of the renal variants in standard furin assays and observed indirect inhibition of the protease activity comparable to that of the D187N variant. To further investigate this aspect, we aimed at testing Nb11"s activity on mutated G2 in a more biological context. As neither an animal nor a cell model of renal AGel amyloidosis is currently available, we employed a nematode-based assay already developed and validated by our group and already successfully used to determine the toxicity of different amyloidogenic proteins and investigate the mechanisms underlying their proteotoxic effect 29]. This is based on the knowledge that the rhythmic contraction and relaxation of the C. elegans pharynx, the organ fundamental for the worm"s feeding and survival, is sensitive to molecules that can act as "chemical stressors" such as some proteins induced in stress conditions. We here showed for the first time that all isolated G2, at concentrations similar to those observed as circulating in humans can cause a biologically relevant toxic effect recognized by C. elegans. Whereas WT G2 only induced a transient reduction of the pharyngeal pumping, all the pathological mutants caused an impairment which persisted still after 24 hours, suggesting that these proteins caused a permanent tissue damage. Interestingly, Nb11, which was able to bind and chaperone all the disease-causing mutant forms of GSN and prevent their aberrant proteolysis, completely abolished the proteotoxic effects induced by G2 domains in worms. Although the mechanisms underlying the ability of C. elegans to recognize G2 domain as toxic remains to be elucidated, these findings are consistent with the hypothesis that the toxicity can be ascribed to the partially unfolded status of the proteins and that Nb11 hides the structural determinant of toxicity. The involvement of the folding status in G2 toxicity was further assessed by using a protein totally unfolded due to the truncation of residues 151-167. The toxic effect caused by WT G2 protein on the pharynx of worms was greater and more persistent than that observed with the folded WT G2. Additional studies are required to fully elucidate the mechanisms underlying the toxicity of G2 domains on the C. elegans pharynx. The knowledge of high-resolution determinants of D187N toxicity and the therapeutic action of Nb11 may contribute to the ongoing efforts in the expansion of the currently limited landscape of therapeutic interventions against FAF and other amyloidosis-related diseases. The use of the C. elegans-based assay for the evaluation of the proteotoxic potential of the G2 domains offers unprecedented opportunities to investigate the molecular mechanisms underlying the AGel forms caused by different GSN variants. This model can also be employed for rapidly screen the protective effect of novel or repurposed drugs thus accelerating the identification of an effective therapy against AGel amyloidosis. Conclusions Nb11 works as a pharmacological chaperone (sometimes referred to as pharmacoperone), a concept originally formulated in the context of small chemicals, rather than macromolecules. Such chaperones restore mutated proteins' function or prevent misfolding, either stabilizing the native fold, or assisting the folding process. Although the pharmacoperone concept has been around for a while, only a limited number of successful examples can be found in literature, and very few drugs belonging to this family are available on the market. Nb11 is, in our knowledge, the first case of a pharmacoperone-like nanobody whose efficacy has been proven in vivo. Contrary to other previously developed pharmacological chaperones, which are mutation-specific, Nb11 protects all gelsolin pathological variants identified so far, irrespective of the different pathways or mechanisms leading to their degradation and/or aggregation. Furthermore, disease-causing mutations yield proteins which are at times difficult to express and purify, due to their solubility, instability or toxicity. Our data show that pharmacological chaperones can be developed using the WT protein as a target, aiming at the stabilization of the native-like conformation, thus increasing the number of diseases that can be potentially tackled with an analogous strategy. Wide-spectrum applicability is of pivotal importance in view of the potential application of Nbs in therapy.
|
Time-variant closed-loop interaction between HR and ABP variability signals during syncope The mutual interactions existing between heart rate (HR) and arterial blood pressure (ABP) variability signals are investigated by means of a bivariate, time-variant model. The linear, parametric, closed-loop model, chosen to describe the relationships between HR and ABP spontaneous variability, is updated recursively according to the dynamic variations in the signals. In this way a beat-to-beat description of the interaction of the two signals and a beat-to-beat extraction of the relevant spectral and cross-spectral parameters are obtained. Furthermore, as a result of proper modelisation, a noninvasive measurement of the /spl alpha/-baroceptive gain is extracted on a beat-to-beat basis. The quantification of these parameters is obtained through an automatic spectral decomposition technique for an ARMA model. The parameters achieved from the proposed model are used to investigate episodes of vasovagal syncope. In particular the authors are interested in a quantitative assessment of the changes of the autonomic nervous system (ANS) behavior in the epoch preceding the episode and in the evaluation of ANS role in association with the vasovagal event.<<ETX>>
|
Who is Mike Gabbard?
It's hard not to like Mike Gabbard, once you meet the guy. In June, the city councilman hosted a talk-story meeting at the Wai'anae Public Library. These get-togethers have been monthly rituals for Gabbard since he was elected to represent the Wai'anae-to-'Ewa district in 2002.
By Ronna Bolante
Photo: Courtesy of Mike Gabbard Facebook Page
On this drizzly evening, Gabbard looks every bit the city councilman with aspirations for congressional office. Tan, lean, with silvered hair, he wears a navy blue blazer with an American flag pin fastened to one lapel, tan slacks, polished brown loafers and a kukui nut lei, an accessory he dons regularly on these occasions. He sits on one of a dozen plastic chairs configured into a U-shape in this otherwise empty room.
Tonight’s topic of discussion: Wai‘anae’s ice problem. Gabbard gives an update on PA‘I, People Against Ice, a community group that has organized neighborhood patrols, picketed a local store selling drug paraphernalia and worked with police to identify drug houses.
“This is a good start, but ice is a huge problem,” Gabbard tells them. “Like homelessness-we have 1,500 people without homes on our coast. These problems aren’t gonna be solved overnight.”
Attendees are welcome to talk about other community issues, too. They do. Wai‘anae’s lack of affordable housing. Illegal dumping. Traffic. For two hours, Gabbard listens to their concerns, their solutions (even the not-so-practical ones) and diligently takes notes on a piece of paper propped in his lap. He gives thoughtful and articulate answers. No exaggerations, no unrealistic promises, no impassioned speeches.
This is not the Mike Gabbard most Hawai‘i residents got to know in the late ‘90s. Many remember Gabbard best as the antagonistic leader of the movement to quash same-sex marriage in Hawai‘i. As founder of the Alliance for Traditional Marriage and Values, a political action committee, Gabbard helped wage an expensive media campaign to convince voters that gay marriage would devastate Hawai‘i.
Today, Gabbard’s public persona is much mellower. Of course, for the past two years, Gabbard has only had to deal with property taxes, pot holes and police raises. Pretty tame stuff, compared with the controversy he tackled in the ‘90s.
Others have noticed the contrast, as well. “Before I met Mike, I thought he’d be a different person,” says fellow council member Gary Okino. “I thought this would be an extreme guy who hates homosexuals, but I was flabbergasted, because he’s so personable. I took a liking to him really quickly. I think he’s been unfairly tagged.”
After a single two-year term on the City Council, Gabbard is running for Hawai‘i’s 2nd Congressional District. He faces incumbent Ed Case, a Hilo-born Democrat finishing his first full term in the U.S. House. Case, a self-proclaimed fiscal conservative and social liberal, opposed the ‘98 amendment that would define marriage in Hawai‘i as between a man and woman. He now opposes the Federal Marriage Amendment, which would have the same effect nationally.
It’s a big leap from the Honolulu City Council to Washington. But don’t count Gabbard out of this election, says Ira Rohter, a political science professor at the University of Hawai‘i and co-chair of Hawai‘i’s Green Party.
“I think it’s going to be a surprisingly strong race,” Rohter says. “Although Gabbard is most notorious for his anti-gay activities and campaign, he covers himself by talking about a lot of other issues-education, protecting aquifers, landfills, raising money for the Bruddah Iz statue. One can ask the question, ‘How come he won the council seat in Wai‘anae?’”
Gabbard is one of the most intriguing, if not controversial, local candidates this election year. He’s a man of contradictions.
Most candidates want media attention. But while Gabbard appeared more than accommodating at this Wai‘anae get-together (he even got up to serve cookies to the group), HONOLULU Magazine had a tough time scheduling a meeting, even after he agreed to one.
We’re not the only ones. In May, Gabbard’s Congressional campaign announced that he would only respond to media questions via e-mail. “Mike is extremely busy juggling his campaigning with his service on the City Council as well as his small business and his personal life,” the memo explained. Most people expect public officials to be, well, more public. Gabbard can’t even be reached by phone.
In accordance with his memo, we e-mailed him a list of questions for the profile. Before replying, Gabbard sent several e-mails over two weeks: “What subject matters or allegations or statements about me are you asking me to respond to or are you thinking of publishing or pursuing?”
Hoping to meet Gabbard in person, we attended his two talk-story sessions in June-one in Kapolei, one in Wai‘anae. He left immediately after ending the meetings, saying he had other obligations.
Gabbard has made an art out of being evasive with reporters. It’s understandable that he’s wary of the media. Google “Mike Gabbard,” and you’ll find no shortage of unflattering stories. Then again, it could be he doesn’t want to answer questions he doesn’t like, especially those concerning his ties to a Hare Krishna splinter group that gave rise to a number of political candidates over the past 30 years. Maybe those questions are especially touchy in an election season, when much of his political support comes from Christian conservatives.
Gabbard was born in Samoa in 1948, one of eight children in a military family. The Gabbards relocated to Hawai‘i when he was a child. He received a bachelor’s in English from Sonoma State University and a master’s in community college administration from Oregon State.
In the late ‘70s, he worked as head tennis pro at Kuilima Hyatt Resort (now Turtle Bay Resort). From 1980 to 1983, he was a dean at American Samoa Community College before moving back to Hawai‘i with his family. Gabbard and his wife, Carol, established a small private school in Wahiawä, which closed after five years. The couple home-schooled all their five children. In the late 1980s, the Gabbards, opened the Natural Deli, a vegetarian restaurant within Mö‘ili‘ili’s Down to Earth Natural Food Store. Today, he distributes air and water purifying systems and nutritional supplements and owns a small confection company.
Gabbard became an anti-homosexual activist before the same-sex marriage debate really took hold in Hawai‘i. In the early ‘90s, he founded an educational nonprofit called Stop Promoting Homosexuality and bought airtime at local radio station KGU for a show called Let’s Talk Straight Hawai‘i.
When HONOLULU interviewed Gabbard in 1992, he told the magazine, “Homosexuality is not normal, not healthy, morally and scripturally wrong.” At the time, he also suggested that the repeal of sodomy laws across the country in the ‘60s and the American Psychiatric Association’s decision in the ‘70s that homosexuality was normal and not a mental illness, led directly to the AIDS epidemic of the ‘80s.
Many gays considered the radio show outright gay bashing. Gabbard managed to keep the show until he said on air that, confronted with two equally qualified job applicants, one gay, one straight, he’d take the straight one. Gay rights activists picketed his deli, and Down to Earth eventually bought out Gabbard’s business. The station pulled the plug on his radio program.
That didn’t stop Gabbard. By the time Hawai‘i residents got to vote on a constitutional amendment in 1998, he had become the face and voice of the effort to “save traditional marriage.”
“Marriage between a man and a woman is the foundation of family and therefore civilization itself,” Gabbard tells HONOLULU Magazine, via e-mail. “Marriage is also the foundation of so many other issues and problems we face, be they education, crime, small business, etc.”
During the 1998 campaign, Gabbard gave more dire reasons to bar same-sex marriage. It would normalize homosexuality, a behavior that he argued was no more natural than marrying a house pet. It would give way to legalizing polygamy and incest. It would scare off tourists, except the gay ones, who would flock to the Islands to marry. It would hurt children.
Gabbard wasn’t alone. He aligned himself with conservative groups and churches for various denominations, which donated more than $1 million toward the fight. These are the supporters Gabbard is likely to count on this congressional election, says Rohter.
“I think his win for the Wai‘anae council seat had a lot do with very conservative churches,” says Rohter. “In rural O‘ahu and on the Neighbor Islands, churches are often the only common threads for a lot of communities. Although Gabbard lives on O‘ahu, I think he’s going to extend his support to these churches on the Neighbor Islands.”
As nonprofits, churches cannot endorse candidates or parties. But they can distribute candidate surveys, showing where each candidate stands on certain issues, including same-sex marriage and abortion. The Hawai‘i Christian Coalition, which includes about 100 member churches, publishes such voter guides each election year. The coalition’s Web site, www.hi-christian.com, provides a link to Gabbard’s campaign Web site. Gabbard’s own Web site informs churches what political activities are acceptable for them under federal law.
“There is a lot of quiet support for Gabbard within this community,” says Gary Langley, senior pastor at the Windward Worship Center, a Pentecostal church in Kane‘ohe. “We’re a small church, just about 100 people, but there are the megachurches-New Hope, Word of Life-with thousands of people. In Gabbard’s campaign, I think people hear the same things that they are taught in church.”
Understandably, the public has lumped Gabbard into America’s growing number of conservative politicians. His social views do veer accordingly to the right. But is he Christian right?
Gabbard himself says he is Catholic. He attends Catholic services regularly at a church in his district. He talks about growing up Catholic and how, at age 14, he entered a seminary, intending to become a priest. He changed his mind, he says, because “I wasn’t as spiritually mature as I thought I was.”
Those who’ve worked with Gabbard assume he is Catholic. “We play golf together, and he talks about his Catholic beliefs and God a lot, more than he talks about the issue of same-sex marriage,” says fellow council member Okino, who is Catholic. “I’ve attended mass with him, and he takes communion.”
But Gabbard had strong ties to an obscure Hare Krishna splinter group that, in the late 1970s, fielded several political candidates. The splinter group was founded by a Hawai‘i homegrown guru named Chris Butler. Butler was a disciple of A.C. Bahkitevedanta Swami Prabhupad, who founded the International Society of Krishna Consciousness (ISKCON). ISKCON is the high-visibility sect whose orange robes, shaved heads, public begging and chanting are what most people think of when they hear the term Hare Krishna.
Butler eventually broke away from ISKCON, criticizing the regimen and centralization of ISKCON life. He formed his own organization, which has had several names: Hare Name Society, Identity Institute and the Science of Identity Foundation. What started as a small religious sect on Maui in the 1970s developed a following that, according to some estimates, includes tens of thousands of people all over the world.
Butler’s followers chant, practice vegetarianism and Bhakti yoga and must refrain from intoxicants and “illicit sex,” or all sexual contact except between married couples at the most fertile time of the month. Unlike ISKCON members who beg publicly, Butler’s “other Krishnas” tend to support themselves by creating their own businesses.
Many of Butler’s associates made headlines in the 1976 election when they created a party called Independents for Godly Government. As its name implied, the group insisted on rigorous moral standards for its candidates. They could accept only half their allowed salaries and distribute the other half to the people they represented, accept no gifts from special interests, commit no crimes and abstain from intoxication and illicit sex. The party fielded several serious contenders for office, including Kathy Hoshijo, who took 17 percent of the votes in the race for Congress, and Wayne Nishiki, the current Maui councilman, who won 20 percent in a three-man race for mayor.
The party’s links to Butler and Krishna went unacknowledged until 1977, when Walter Wright of The Honolulu Advertiser did an investigative report on the group, which Hoshijo labeled a “smear attempt.”
In the ‘80s and ‘90s, Butler appeared in a series of locally filmed shows, titled Jagad Guru Speaks, in which he sermonized on spirituality. In one episode, titled “Is God Really Loveable?” Butler mocks the Bible and the Christian interpretation of God, calling them nonsensical. “These Christians don’t know God,” Butler says. His comments summon laughs and nods of agreement from the room full of listeners. Mike and Carol Gabbard are shown sitting just a few feet away from the charismatic guru, laughing along with the audience.
Gabbard’s wife served as secretary/treasurer of the Science of Identity Foundation until 2000, before she successfully ran for a seat on the state Board of Education. Both Gabbard and his wife were listed as teachers at the Science of Identity Foundation in Polk’s City Directory in the early 1990s.
In the late ‘80s and early ‘90s, both Gabbards worked as staffers in the office of then Maui state Sen. Rick Reed. A controversial figure himself, Reed has acknowledged Butler as his “spiritual adviser.” Reed mounted short-lived campaigns for both Congress and the lieutenant governorship in 1986. He then ran for U.S. Senate against Daniel Inouye in 1992, setting off a scandal when he publicized claims that Inouye had sexually molested a Honolulu hairdresser named Lenore Kwock.
All five of Gabbard’s children have Hindu names: Bhakti, Jai, Aryan, Tulsi and Vrindavan (Hinduism is the root of the Hare Krishna religion). The Gabbards’ Natural Deli was housed in Down to Earth, which was then owned and managed by Butler followers.
No one questions Gabbard’s right to believe as he chooses. Some may even applaud him for his religious beliefs. However, some voters may worry about his former ties to a Krishna sect. Especially when members and associates of that group have mounted repeated attempts at high public office.
When HONOLULU asked Gabbard in an e-mail to clarify his former relationship with Butler’s Krishna group, Gabbard’s daughter, state Rep. Tulsi Gabbard Tamayo, sent us an angry e-mail in response. “I smell a skunk,” Tamayo wrote. “It’s clear to me that you’re acting as a conduit for The Honolulu Weekly and other homosexual extremist supporters of Ed Case.”
Gabbard himself insists that he is a victim of religious bigotry, that his opponents have tried to make his religion an issue in this campaign. He maintains that he is Catholic. After nearly dying in a surfing accident at age 17, he says he realized that “my personal relationship with God was my religion. My spiritual path became more personal and less institutional. For the next several decades, I studied and explored every major religious philosophy.”
His “return to active Catholicism” began during the same-sex marriage debate of the 1990s, he says, and, in 2000, he became “a fully active member of the Church.” That same year, Gabbard announced he would run against Neil Abercrombie in the 1st Congressional District but withdrew shortly before the filing deadline.
“I am Catholic, but some would consider me an enigmatic Catholic,” Gabbard reasons, “because I practice and sometimes teach both Christian and yoga meditation techniques and philosophy. … Although I am not a Hindu or Hare Krishna, I find great inspiration and wisdom in the ancient yoga scriptures. Although I’m not a member of the Science of Identity Foundation, I’m eternally thankful to Chris Butler, the founder of SIF, whose teachings of karma yoga (selfless service) and bhakti yoga (devotion to God) have brought me back to my Catholic roots and the fundamental teachings of Christ.”
Mitch Kahle, founder of the Hawai‘i Citizens for the Separation of State and Church, says: “Mike Gabbard has worked hard to distance himself from the Science of Identity Foundation. Most politicians are Christian, and, in general, Hare Krishna is still very much considered a fringe religious group. Being Catholic is better for his political career.”
Because of his efforts as a gay-rights activist, Kahle has encountered Gabbard on several occasions. “Mike Gabbard has done an incredible job for his cause and he’s a great spokesman, but I would be extremely disappointed in the people of Hawai‘i if they sent him to Congress,” Kahle says. “On the council, he’s relatively harmless. They have no power over social programs whatsoever, but in Congress, he can do some real damage.”
For the record, Gabbard appears to be a responsible councilman who has built substantial support in his district. Two of Gabbard’s biggest achievements are environmental. With the support of his constituents, Gabbard successfully opposed the building of a landfill over the Pearl Harbor aquifer and established a related project, dubbed “Ship It Out.” “I traveled to the Mainland at my own expense to study the viability of shipping Hawai‘i’s trash to environmentally friendly landfills on the Mainland,” he says. “Taking the lead in this area has moved Hawai‘i closer to the day when we will no longer be dependent on landfills.”
Gabbard has also worked with the Honolulu Police Department to create a volunteer policing program for abandoned cars and drivers who park illegally in handicapped stalls. The program, which began this summer, should “get more people involved in law enforcement and free up our limited police officers to focus on more serious crimes,” he says.
One of Gabbard’s constituents, Lenny Farm, attests to the councilman’s community involvement. For the past nine years, Farm has organized Kapolei’s volunteer neighborhood patrol, which watches over the area’s three school campuses.
“Not to say that we don’t appreciate what other representatives have done, but council member Gabbard is really the only one who brought what we do to the attention of the council,” Farm says. “He even came out with us a few times at 11 o’clock at night to patrol. He’s really effective, really sincere in what he does.”
Strategically speaking, Gabbard picked the perfect time to run for Congress. This fall, Gabbard faces Case, who’s waging his first reelection campaign to follow a full term. In 2001, Case won a special election to serve out the remainder of the late Patsy Mink’s term in Congress. About 13 percent of the district’s 347,922 voters turned out for that election. In the 2002 election, Case retained his seat with 43 percent of the votes, defeating fellow Democrat Matt Matsunaga. That election, however, drew only 21.9 percent of the district’s registered voters.
“I told Mike that he could do a lot more good on the city council than he can in Congress,” council member Okino says. “But if he’s gonna run against anybody, it’s better that he run against Ed Case after his first term. It would be much more difficult if he waited till after Ed’s second term.”
Case has called Gabbard a “single-issue candidate,” concerned mainly with the issue of same-sex marriage. “He cares only about one thing, and thus far, he has gone to great lengths not to talk about his background, his roots, what he stands for,” says Case. “That’s a dangerous combination in representing the entire 2nd Congressional District. Congress is not kids’ play. We face about a thousand different issues each session. This is the real thing.”
Gabbard hopes voters will remember his anti-same-sex marriage efforts and dismisses speculation that his well-known activism could hurt his campaign.
“I find it quite amusing that some people are so out of touch they think my being on the side of the 70 percent of Hawai‘i’s people on this issue is somehow negative for me,” he says. “They haven’t figured out yet that my opponent is actually the one in trouble on this issue.”
In many pockets, especially on the Big Island, Gabbard’s activist reputation on O‘ahu is still relatively unknown. That could work toward the congressional contender’s advantage. “For many people, he’s an unidentified character,” says Rohter. “All they’ll see is a good-looking, charming guy who can play the guitar.”
|
For Deborah Warrick, the two hyenas at the St. Augustine Wild Reserve are no laughing matter.
Warrick, who runs the seven-acre, non-profit facility that serves as a rescue center for unwanted exotic animals, acquired the two rescued African hyenas last week.
On Monday, the two hyenas, a male and a female about three years old, were becoming acclimated to their new surroundings. True to their nature, they still seemed nervous, hunching down and pacing in their fenced enclosure, ever on the alert to the sounds of the lions, tigers, wolves and an assortment of other wildlife that live in the reserve that's about 10 miles west of downtown St. Augustine.
"They're real shy," she said. "They're getting better, though. I'm pretty good at calming down animals."
Naturally, the first order of business was getting them fed.
"The first day, I sat here with chicken legs and got them to eat," she said. "Then, yesterday, the (St. Johns County) Sheriff's department brought us a roadkill deer, and we cut that in half and gave it to them. They were like two little kids in a candy store. They ate every bit of it - the bones, the teeth, everything, and digested it all. That's what they do."
Warrick has already given them names: Sekani, which is Swahili for "laughter," is the female, and the male is Juba, which is Swahili for "brave."
The pair were captured wild in Africa about 2 1/2 years ago and shipped to the United States, Warrick said. The person who originally purchased them and paid for their transportation to the Port of Tampa never showed up to pick them up.
"They basically lived in their shipping crates for about two months," she said. "A friend of mine who runs a smaller reserve in the Tampa area ended up taking them in and cared for them for two years, but she couldn't continue to do so, so I went down and got them last Thursday."
Warrick said many people obtain an exotic pet only to realize that the animal's wild nature doesn't fit into their life - or their household - as they expected.
"That's where we come in," she said. "We will take in unwanted exotic animals as an alternative to euthanasia. Some of our animals came from abusive homes. Two wolves were rescued when their owner was involved in a fatal auto accident. Many of our animals were confiscated by wildlife agencies from individuals who held these animals without proper state permits, or who starved their animals, maintaining them in inferior conditions."
She said some even come from celebrities, including five Arctic wolves and an African lion that were received some years ago from Michael Jackson after he no longer wanted them at his ranch.
Warrick, who lives in a three-bedroom, ranch-style home on the property, purchased the seven acres in 2000 after relocating to Florida from California. She's worked with exotic animals all of her life, received extensive training at the Los Angeles Zoo and has degrees in biology and holistic nutrition.
She's always loved animals, she said.
"I was raised as a tomboy," she said. "I never played with dolls. I always had spiders and snakes, so this is perfect for me."
Though she has about 25 total volunteers who help out, she's the driving force behind the preserve, which she created and paid for out of her own pocket.
"I'm out here at the crack of dawn every day," she said, stroking the fur of Jade, a female Bengal/Siberian tiger, through the chain link fence of her enclosure. The tiger, purring almost like a house cat, clearly has affection for her.
"We feed them very well, of course," she said. "Some of them are less friendly, but they're all wild animals, so you have to aware of that all the time."
The St. Augustine Wild Reserve survives by offering tours on an appointment-only basis on Wednesdays and Saturdays. The two-hour tours are guided by an experienced wildlife professional, so advanced reservations must be made by phone.
"We draw people from all over the world," Warrick said. "What makes us stand out is that here you can get much closer to the animals than you can at a zoo."
Warrick said one of her missions with the reserve is to dissuade people from getting wild animals as pets.
"Our goal is to educate the public about exotic animal ownership, to prevent future animal abuse," she said. "We also transport various animals to schools, churches and other outreach venues for educational presentations so people can see what these animals are really like."
The St. Augustine Wild Reserve can be reached by phone at (904) 940-0664 or by email at [email protected]. Warrick recommends calling as far in advance as possible to book one of the tours. Donations are $25 per adult and $15 for children of age ten and under. Donations go towards the care of the animals at the reserve.
|
Isoniazid: An Exploratory Review Isoniazid (INH) is one of the most successful tuberculosis medications in the market today. In particular, isoniazid is used as a prophylaxis medication to avoid resurgence of illness in those who have underlying Mycobacterium tuberculosis (MTB) infection. The mode of action of isoniazid is complicated and incorporates a number of distinct aspects in which various biomolecular routes are impacted, including mycolic acid production. Catalase-peroxidase (KatG) activates the prodrug isoniazid and enzymes such as -ketoacyl ACP synthase (KasA) and enoyl acyl carrier protein (ACP) reductase target the active isoniazid products. Various genes in diverse biochemical networks and pathways are involved in the physiological mechanisms of isoniazid resistance. Isoniazid resistance is the most common of all clinical drug-resistant isolates, with incidence in some areas of up to 20 to 30%. In this review article, several existing components that may influence to the complexities of isoniazid function including mechanism of action, resistance mechanisms in MTB, along with their history, different synthetic procedures, uses, dosage forms, side effects, adverse drug reactions, physico-chemical characteristics, ADME properties, contraindications as well as future perspectives are discussed. Studies of pharmacokinetics have found that the cause of the drug mediated hepatotoxicity is possible by metabolism of isoniazid. Because of inter-individual heterogeneity of polymorphism that affect isoniazid metabolism rates, customized medicines may be required in various populations to prevent hepatotoxicity. The isoniazid multidrug combination treatment which would proved to be effective tuberculosis treatment in future. Further exploration is needed for better comprehension of pathogenesis mechanism of Mycobacterium tuberculosis (MTB) and drug resistance studies are required for building up better therapeutics and diagnostic against tuberculosis.
|
Elevators that you saw in the Minority Report are coming. That’s why we love German engineering.
2 years ago, the German engineering company thyssenkrupp developed an awesome innovation: the elevator that doesn’t need any cables. All it needed was magnetic levitation to cycle not just one, but multiple cars through a building’s shaft system. They called this the ‘Multi’, and what makes it more special is that it doesn’t only move up and down, but side to side as well!
Source: Popular Mechanics
Today, the UK architecture firm Weston Williamson is thinking about installing the Multi in one of the world’s most complex urban architectural spaces: The London Underground. thyssenkrupp is currently constructing this elevator in a building in Germany, and this helped convince Weston Williamson director Chris Williamson that this technology is not just a concept.
Source: thyssenkrupp
By utilizing the same maglev technology that was proposed for Elon Musk’s Hyperloop, the Multi would not need any cords, and will be using magnetic coils in the shaft walls to repel the magnetized elevator compartment. Since the car isn’t attached to any cords, moving sideways wouldn’t be a problem
|
Look who's being left behind: educational interpreters and access to education for deaf and hard-of-hearing students. For many deaf and hard-of-hearing students, access to the general education curriculum is provided, in part, by using the services of an educational interpreter. Even with a highly qualified interpreter, full access to the content and social life in a hearing classroom can be challenging, and there are many aspects of the educational placement that can affect success. The skills and knowledge of the educational interpreter are one critical aspect. This study reports results from a study of approximately 2,100 educational interpreters from across the United States. All the interpreters were evaluated using the Educational Interpreters Performance Assessment (EIPA), an evaluation instrument used to assess and certify classroom interpreters (see Schick, Williams, & Bolster, 1999). The results show that approximately 60% of the interpreters evaluated had inadequate skills to provide full access. In addition, educational interpreters who had completed an Interpreter Training Program had EIPA scores only.5 of an EIPA level above those who had not, on average. Demographic data and its relationship with EIPA ratings are explored. In general, the study suggests that many deaf and hard-of-hearing students receive interpreting services that will seriously hinder reasonable access to the classroom curriculum and social interaction.
|
An open-source readout for MKIDs This paper will present the design, implementation, performance analysis of an open source readout system for arrays of microwave kinetic inductance detectors (MKID) for mm/submm astronomy. The readout system will perform frequency domain multiplexed real-time complex microwave transmission measurements in order to monitor the instantaneous resonance frequency and dissipation of superconducting microresonators. Each readout unit will be able to cover up to 550 MHz bandwidth and readout 256 complex frequency channels simultaneously. The digital electronics include the customized DAC, ADC, IF system and the FPGA based signal processing hardware developed by CASPER group.1-7 The entire system is open sourced, and can be customized to meet challenging requirement in many applications: e.g. MKID, MSQUID etc.
|
weight = int(input())
weight = weight - 2
print('YES' if (weight % 2 == 0 and weight != 0) else 'NO')
|
/// Returns sign of left - right
fn cmp_vartime(left: &U256, right: &U256) -> i32 {
use core::cmp::Ordering::*;
// since we're little-endian, need to reverse iterate
for (l, r) in left.iter().rev().zip(right.iter().rev()) {
match l.cmp(r) {
Less => return -1,
Greater => return 1,
Equal => continue,
}
}
0
}
|
Detecting Unipolar and Bipolar Depressive Disorders from Elicited Speech Responses Using Latent Affective Structure Model Mood disorders, including unipolar depression (UD) and bipolar disorder (BD), are reported to be one of the most common mental illnesses in recent years. In diagnostic evaluation on the outpatients with mood disorder, a large portion of BD patients are initially misdiagnosed as having UD. As most previous research focused on long-term monitoring of mood disorders, short-term detection which could be used in early detection and intervention is thus desirable. This work proposes an approach to short-term detection of mood disorder based on the patterns in emotion of elicited speech responses. To the best of our knowledge, there is no database for short-term detection on the discrimination between BD and UD currently. This work collected two databases containing an emotional database (MHMC-EM) collected by the Multimedia Human Machine Communication (MHMC) lab and a mood disorder database (CHI-MEI) collected by the CHI-MEI Medical Center, Taiwan. As the collected CHI-MEI mood disorder database is quite small and emotion annotation is difficult, the MHMC-EM emotional database is selected as a reference database for data adaptation. For the CHI-MEI mood disorder data collection, six eliciting emotional videos are selected and used to elicit the participants emotions. After watching each of the six eliciting emotional video clips, the participants answer the questions raised by the clinician. The speech responses are then used to construct the CHI-MEI mood disorder database. Hierarchical spectral clustering is used to adapt the collected MHMC-EM emotional database to fit the CHI-MEI mood disorder database for dealing with the data bias problem. The adapted MHMC-EM emotional data are then fed to a denoising autoencoder for bottleneck feature extraction. The bottleneck features are used to construct a long short term memory (LSTM)-based emotion detector for generation of emotion profiles from each speech response. The emotion profiles are then clustered into emotion codewords using the K-means algorithm. Finally, a class-specific latent affective structure model (LASM) is proposed to model the structural relationships among the emotion codewords with respect to six emotional videos for mood disorder detection. Leave-one-group-out cross validation scheme was employed for the evaluation of the proposed class-specific LASM-based approaches. Experimental results show that the proposed class-specific LASM-based method achieved an accuracy of 73.33 percent for mood disorder detection, outperforming the classifiers based on SVM and LSTM.
|
<gh_stars>0
/*
* Copyright (c) 2010-2018 Evolveum and contributors
*
* This work is dual-licensed under the Apache License 2.0
* and European Union Public License. See LICENSE file for details.
*/
package com.evolveum.midpoint.gui.impl.prism;
import java.util.List;
import com.evolveum.midpoint.gui.api.prism.ItemWrapper;
import com.evolveum.midpoint.gui.api.prism.PrismContainerWrapper;
import com.evolveum.midpoint.prism.Containerable;
import com.evolveum.midpoint.prism.ItemDefinition;
import com.evolveum.midpoint.prism.PrismContainerDefinition;
import com.evolveum.midpoint.prism.PrismContainerValue;
import com.evolveum.midpoint.prism.Referencable;
import com.evolveum.midpoint.prism.delta.ItemDelta;
import com.evolveum.midpoint.prism.path.ItemName;
import com.evolveum.midpoint.prism.path.ItemPath;
import com.evolveum.midpoint.util.exception.SchemaException;
import com.evolveum.midpoint.web.component.prism.ValueStatus;
import com.evolveum.midpoint.xml.ns._public.common.common_3.VirtualContainerItemSpecificationType;
/**
* @author katka
*
*/
public interface PrismContainerValueWrapper<C extends Containerable> extends PrismValueWrapper<C, PrismContainerValue<C>>{
String getDisplayName();
String getHelpText();
boolean isExpanded();
void setExpanded(boolean expanded);
boolean hasMetadata();
boolean isShowMetadata();
void setShowMetadata(boolean showMetadata);
boolean isSorted();
void setSorted(boolean sorted);
List<PrismContainerDefinition<C>> getChildContainers();
ValueStatus getStatus();
void setStatus(ValueStatus status);
<T extends Containerable> List<PrismContainerWrapper<T>> getContainers();
List<? extends ItemWrapper<?,?,?,?>> getNonContainers();
// PrismContainerWrapper<C> getParent();
List<? extends ItemWrapper<?,?,?,?>> getItems();
// PrismContainerValue<C> getNewValue();
<T extends Containerable> PrismContainerWrapper<T> findContainer(ItemPath path) throws SchemaException;
<X> PrismPropertyWrapper<X> findProperty(ItemPath propertyPath) throws SchemaException;
<R extends Referencable> PrismReferenceWrapper<R> findReference(ItemPath path) throws SchemaException;
<IW extends ItemWrapper> IW findItem(ItemPath path, Class<IW> type) throws SchemaException;
ItemPath getPath();
boolean isSelected();
boolean setSelected(boolean selected); //TODO why return boolean?
boolean isReadOnly();
void setReadOnly(boolean readOnly, boolean recursive);
@Deprecated
boolean hasChanged();
boolean isShowEmpty();
void setShowEmpty(boolean setShowEmpty);
//void sort();
<ID extends ItemDelta> void applyDelta(ID delta) throws SchemaException;
PrismContainerValue<C> getValueToAdd() throws SchemaException;
boolean isHeterogenous();
void setHeterogenous(boolean heterogenous);
void setVirtualContainerItems(List<VirtualContainerItemSpecificationType> virtualItems);
boolean isVirtual();
}
|
Effect of AQP4-RNAi in treating traumatic brain edema: Multi-modal MRI and histopathological changes of early stage edema in a rat model Traumatic brain injury (TBI) is one of the leading causes of mortality and permanent disabilities worldwide. Brain edema following TBI remains to be the predominant cause of mortality and disability in patients worldwide. Previous studies have reported that brain edema is closely associated with aquaporin-4 (AQP4) expression. AQP4 is a water channel protein and mediates water homeostasis in a variety of brain disorders. In the current study, a rat TBI model was established, and the features of brain edema following TBI were assessed using multimodal MRI. The results of the multimodal MRI were useful, reliable and were used to evaluate the extent and the type of brain edema following TBI. Brain edema was also successfully alleviated using an intracerebral injection of AQP4 small interfering (si)RNA. The expression of AQP4 and its role in brain edema were also examined in the present study. The AQP4 siRNA was demonstrated to downregulate AQP4 expression following TBI and reduced brain edema at the early stages of TBI (6 and 12 h). The current study revealed the MRI features of brain edema and the changes in AQP4 expression exhibited following TBI, and the results provide important information that can be used to improve the early diagnosis and treatment of brain edema. Introduction The occurrence of traumatic brain injury (TBI) is increasing and has recently become one of the leading causes of mortality and permanent disability worldwide. In America, TBI contributes to 30% of all deaths associated with head trauma and 3.2 million disabilities each year. The disturbance of water homeostasis in the brain is an important pathological change in TBI, where brain edema following TBI remains to be the predominant cause of mortality and disability among patients admitted to the neurology department. TBI can directly cause brain damage, and the resulting brain edema increases intracranial pressure and can lead to brain ischemia and mortality. In the current study, a non-invasive diffusion-weighted MRI (DWI) was used to monitor brain edema following TBI. The use of DWI allows the identification of the types and characteristics of edema that can develop after TBI. Although numerous studies have investigated brain edema using DWI, the underlying mechanisms and specific time course of this accumulation remain controversial. Edema can be identified using DWI at the early stage of TBI, while the apparent diffusion coefficient (ADC) sequence accurately indicates the extent and range of edema. Multimodal MRI including DWI, T2 weighted image (T2WI), ADC and susceptibility weighted image (SWI) sequences may provide more information and provide a better understanding of brain edema. Aquaporin-4 (AQP4) is a member of the aquaporin family, which acts as a water channel protein and mediates water homeostasis. Among the aquaporin family, AQP4 is the most important type in the central nervous system. Previous studies have indicated that AQP4 serves a key role in the formation and resolution of brain edema. The knockdown of AQP4 has also been indicated to be effective in improving brain disorders that are caused by edema. However, the early stage (<12 h) of brain edema and multi-modal MRI findings following AQP4 RNAi treatment are still unclear. In the current study, the multi-modal MRI and histopathological changes were investigated at the early stage of traumatic brain edema in an in vivo model. The present study aimed to provide an improved understanding of the features of brain edema after TBI. With an improved understanding of brain edema after TBI, AQP4 expression was decreased in the brain using small interfering (si)RNA, and the effectiveness of AQP4 as a potential therapeutic target for brain edema was assessed. Materials and methods Animals and siRNA synthesis. The current study was approved by the Ethics Committee for the First Affiliated Hospital of Hainan Medical University (approval no. 2016054; Hainan, China). All experimental procedures were conducted according to the Guidelines for Animal Experimentation of the First Affiliated Hospital of Hainan Medical University (Hainan, China). A total of 120 male Wistar rats (age, 9-12 weeks; weight, 250-300 g), were purchased from the Experimental Animal Center of the First Affiliated Hospital of Hainan Medical University (Hainan, China). Rats were housed under controlled conditions with a 12 h light/dark cycle, with 21±2C and 60-70% humidity, and allowed free access to a standard dry rat diet and tap water ad libitum. Groups and animal experiments. A total of 120 Wistar rats were divided into four groups (30 rats each) as follows: The control group (control), trauma group (trauma), placebo treatment group (placebo) and the AQP4-RNAi treatment group (RNAi). The animal brain trauma model was established using a methodology previously described by McIntosh et al, using a PinPoint™ Precision Cortical Impactor (Hatteras Instruments, Inc.). Rats were anesthetized using isoflurane (4% for induction and 2% for maintenance). A 1.5 mm drill bit (rotational speed, 4,000 r/min) equipped with a table electric dental engine (cat. no. 307-2B; Shenzhen Ward Life Science and Technology Co., Ltd.) was used to bore a hole into the skull between the anterior and posterior fontanel. A 5 mm-diameter round window was created using a mosquito clamp (cat. no. C5971A; Shenzhen Ward Life Science and Technology Co., Ltd.) In the trauma, placebo and RNAi groups, the bony window was impinged using the impactor to establish moderate right brain trauma. The parameters were as follows: Impinging velocity, 2.5 m/sec; impinging depth, 4 mm; duration, 0.85 sec; diameter of impinging bit, 4 mm. In the control group, an identical opening in the skull was created but no impact was made. Rats received an intracerebroventricular injection 10 min after injury in the placebo and RNAi groups. A total of 10 l AQP4-RNAi (RNAi group) or control RNAi (placebo group) was injected into the lateral ventricle using a 30-gauge needle on a Hamilton syringe at a final concentration of 20 nM. The Entranster™-in vivo was used as the carrier of RNAi (Engreen Biosystem Co, Ltd.). MRI images of the rat brain were captured at 1, 6 and 12 h after injury, following which the rats were immediately sacrificed after MRI imaging to obtain brain tissue samples. The rats were euthanized using CO 2 at an air displacement rate of 20% per min. Western blot analysis. Total protein was extracted using RIPA lysis buffer (Shanghai BestBio Biotechnology Co., Ltd.). Protein levels in tissue homogenates were quantified using a BCA Protein assay kit (Thermo Fisher Scientific, Inc.), and 10 g protein (each sample) was separated by SDS-PAGE (10% gel). Proteins were then transferred onto 0.22-m PVDF membranes and blocked with 5% fat-free milk at room temperature for 2 h. Membranes were subsequently incubated at 4C overnight with primary antibodies against AQP4 (1:1,000; cat. no. ab46182; Abcam) and -actin (1:1,000; cat. no. ab8227; Abcam). Membranes were then washed in Tris-buffered saline containing 0.05% Tween 20 (TBS-T) and incubated with horseradish peroxidase-conjugated anti-rabbit IgG antibodies (1:5,000; cat. no. 7076; CST Biological Reagents Co., Ltd.) for 1 h at room temperature. Membranes were then incubated with enhanced chemiluminescence reagent (ECL Western blotting kit; GE Healthcare Life Sciences). The positive bands were detected using a Bio-Rad Molecular Imager system (Bio-Rad Laboratories, Inc.). Densitometric analysis was performed using Quantity One 1-D software (version 4.6.9; Bio-Rad Laboratories, Inc.), and the target bands were normalized to -actin. Regions of interest (ROIs) for the MRI parameters were subjectively selected based on abnormal MRI signals by two independent researchers (GY and LLF). To ensure accuracy, all ROIs were selected and measured based on histological findings. Rs-T2WI (relative square in the T2WI sequence), rs-SWI and rs-DWI were calculated as follows: The area of abnormal signals of traumatic region/the total area of the traumatized hemisphere x100. The rs-ADC was also calculated as: The ADC value of ROI/the ADC value of the mirror region x100. Pathological observation. After euthanasia, the ventricles of rats were infused with 4% paraformaldehyde and the brains were harvested and fixed with 4% paraformaldehyde for 24 h at room temperature. Coronal sections of the damaged brain regions were prepared at 5-m thick and embedded with paraffin. Haematoxylin and eosin (H&E) staining was performed for each sample at room temperature, and the slices were observed using an optical microscope (magnification, x4) (DMi1; Leica Microsystems GmbH). For coronal sections prepared for immunohistochemical staining, they were first rehydrated in a descending ethanol gradient and then treated with trypsin antigen retrieval buffer (Sigma-Aldrich; Merck KGaA) at 37C for 20 min. Then the sections were blocked with 10% bovine serum albumin (Hyclone; GE Healthcare Life Sciences) at room temperature for 20 min, following which AQP4 expression was detected using mouse monoclonal antibodies at 4C overnight (cat. no. ab128906; 1:200; Abcam) and a horseradish peroxidase-conjugated anti-mouse antibody at room temperature for 3 h (cat. no. KL-F0983R; 1:100; Shanghai Kanglang Biotechnology Co., Ltd.), followed by color development with diaminobenzidine tetrahydrochloride (Dako; Agilent Technologies, Inc.). The slices were subsequently counterstained at room temperature for 1 min with hematoxylin. The results of AQP4 expression were quantified in integrated optical density using the Image-Pro Plus 6.0 software (Media Cybernetics, Inc.). For double labeling immunofluorescence staining, sections were prepared as above, and then incubated with anti-AQP4 For electron microscopy, samples were embedded with Spurr resin at room temperature overnight and sections were treated using lead-uranium double staining. Sections (50 nm) were prepared using a ultramicrotome, following which they were fixed with 2% glutaraldehyde at room temperature for 24 h and then dehydrated with ethanol gradient. Slices were stained with 3% uranium acetate dye solution at room temperature for 30 min, followed by 2% lead citrate for 30 min at room temperature. The ultrastructures of tissue sections were observed under an EX_2000 transmission electron microscope (JEOL, Ltd.). Statistical analysis. All experiments were repeated at least 3 times. The results are expressed as the mean ± standard deviation. Statistical analysis was performed using a one-way ANOVA followed by Duncan's post hoc test using SPSS software (version 24.0; IBM Corp.). P<0.05 was considered to indicate a statistically significant result. AQP4 expression and distribution after brain trauma. The efficacy of siRNA was demonstrated using western blot analysis, and the results indicated that AQP4 expression was downregulated after transfection with siRNA (Fig. S1). Western blot analysis indicated that AQP4 protein expression was significantly increased in the trauma and placebo groups at 6 and 12 h after injury compared with their respective control groups (Fig. 1). AQP4-RNAi injection inhibited the increase of AQP4 expression at 6 and 12 h after injury, as AQP4 expression was significantly decreased in the RNAi group compared with the placebo group at 6 and 12 h (Fig. 1). Immunohistochemical staining also indicated that AQP4 expression was upregulated after injury, with its expression levels being the highest at 12 h post injury. In the RNAi group, the AQP4 expression was significantly suppressed at 6 and 12 h compared with the trauma group, (Fig. 2). The double labeling immunofluorescence staining also indicated the location of the AQP4 protein ( Fig. 3; white arrows). In the control group, a small amount of AQP4 protein was revealed around the gliocytes and endothelial cells. In the trauma group, AQP4 expression was indicated to be isolated around endothelial cells at 1 h after injury and around gliocytes foot processes 6 h after injury. A period of 12 h after injury, AQP4 was observed to be widely expressed around gliocytes and endothelial cells. Early MRI changes after brain trauma. The MRI images indicated that there was no sign of edema in the control group (Fig. 4). However, in the trauma group, rs-DWI and rs-T2WI increased at 12 h post injury, with the expression ratio highest at 12 h. R-ADC was increased and peaked at 6 h, decreased and reached the lowest point at 12 h (Fig. 4). A similar trend was observed in the placebo group (Fig. 4). After treatment with AQP4-RNAi, compared with trauma and placebo groups, T2WI, rs-DWI and rs-SWI were observed to be significantly decreased from 12 h, whilst r-ADC was indicated to be decreased at 6 h (Fig. 4). Edema progression after brain trauma. In the placebo (data not shown) and trauma groups, edema was observed around the vascular endothelia, and mild cytotoxic edema was also indicated in gliocytes at 1 h after injury. Edema continued to increase over time in trauma groups (Fig. 5). In the trauma group, vasogenic and cytotoxic edema was observed at 6 h post injury and reached the highest level at 12 h post injury, and H&E staining revealed vasogenic and cytotoxic edema ( Fig. 5A-a-c). In the RNAi group, the remission of edema was observed at 6 h, and decreased further at 12 h after injury (Fig. 5A-e-f). TEM images indicated these changes in further detail. In the trauma group, discontinuity of endothelia ( Fig. 5B-a; black arrow; blue star, blood vessels), swelling of mitochondria (yellow arrow) and endoplasmic reticulum (white arrow) were revealed at 1 h after injury. At 6 h, chromatin aggregation was observed ( Fig. 5B-b; white arrow), and edema was indicated in the mitochondria (black arrow) and around blood vessels (blue star). The vasogenic and cellular edema were identified at 12 h post injury (Fig. 5B-c; blue star). Endothelial breakage (black arrow) and the destruction at ridges of mitochondria (white arrow) were observed. Compared with the trauma group, the extent of edema in the RNAi group was markedly reduced from 6 h post injury. There was no obvious change in the RNAi group compared with the trauma group at 1 h post injury. However, at 6 h post injury, it was revealed that chromatin aggregation was decreased (Fig. 5B-e; white arrow) and the swelling of mitochondria (black arrow) and blood vessels (blue star) were all decreased. At 12 h, this effect was increased in the RNAi group, as the discontinuity of endothelia ( Fig. 5B-f; black arrow) was alleviated as well as the swelling of mitochondria (black arrow) and blood vessels (blue star). Discussion The pathological changes that follow TBI are complex, and the early stage of brain trauma is a critical period for planning treatment. A report has indicated that during the early stages of brain trauma, the primary site of brain trauma predominantly exhibits cytotoxic edema and the surrounding region is dominated by vasogenic edema. However, the features of brain edema following TBI are yet to be fully determined. The pathological process of TBI contributes to MRI value changes and can also be monitored using MRI. However, the accurate determination of the development and pathological type (e.g. cytotoxic or vasogenic) of brain edema following TBI is difficult based on a single sequence of MRI assessments. Considering the differences between the treatments of cytotoxic and vasogenic brain edema, it is important to distinguish the type of edema prior to the initiation of treatment. The multi-modal MRI allows more information to be gained, and also allows for an increased accuracy of diagnosis. Compared with DWI alone, ADC can obtain a highly accurate diagnosis by reducing the T2 shine effect. The high signal of DWI and ADC indicated vasogenic edema, while the high signal of DWI combined with a low signal of ADC indicated cytotoxic edema. The SWI signal cannot distinguish edema from normal brain tissue. However, the damage area may be clearly visible. T2WI can indicate the extent and range of edema, however, it is only sensitive to vasogenic edema. According to the results of the present study, the multimodal MRI, which composited T2WI, DWI, ADC and DWI sequences, may be much more sensitive and useful in monitoring the extent and range of edema. AQP4 has been previously reported to serve a role in the negative effects of brain edema. Many brain pathologies, including stroke, trauma and hemorrhage, have been associated with the dysfunction of AQP4 and resultant brain edema. However, the function of AQP4 in maintaining water homoeostasis is complex. Tang et al demonstrated that cytotoxic edema and astrocyte apoptosis was reduced due to the attenuation of downregulation of AQP4. Vindedal et al reported that basal brain water content was increased in mice exhibiting a complete loss of AQP4 (global Aqp4-/-mice). Previous research has demonstrated that AQP4-overexpressing mice exhibit an accelerated progression of cytotoxic brain swelling after acute water intoxication, and it was concluded that AQP4 expression could limit the rate of brain water accumulation. In a previous study, RNAi technology was indicated to be effective in downregulating the expression of AQP4 in astrocytes, and consequently reducing ischemia-related brain edema. This treatment has also been revealed to exhibit a beneficial effect on brain edema after long term TBI. The expression of AQP4 has also been reported to be upregulated 24 h after TBI, however in this study, the edema was already severe. To further study the changes in AQP4 expression during edema and seek early intervention methods, AQP4 expression was measured in the current study at the early stage of TBI (<12 h). Our previous research has indicated that the expression of AQP4 exhibited a complex pattern following TBI, with AQP4 decreasing then increasing. These results suggested that the downregulation of AQP4 was a result of vasogenic edema and the upregulation of AQP4 may induce cellular edema. Bias was present during the in vivo experiments as in some MRI images, the placebo group appeared to exhibit worse injury than the trauma group despite the statistical analysis indicating no significant difference between the two groups. To achieve stable transfection of siRNA in vivo and avoid the influence of technical bias, a relatively large sample size was used (120 rats) in the current study. Brain edema was indicated to be significantly reduced at 6 and 12 h and not at 1 h post TBI following treatment with RNAi. These results suggested that at the early stages of TBI (1 h), AQP4 was redistributed around the endothelial cells and caused vasogenic edema rather than upregulating protein expression. At the mid-early stage of TBI (6 to 12 h), the protein expression of AQP4 was upregulated and redistributed on the surface of gliocytes, resulting in the exacerbation of cytotoxic edema. Therefore, the AQP4 RNAi treatment may downregulate the expression of AQP4 and reduce brain edema from 6 to 12 h post TBI. The results of the present study demonstrated that the multimodal MRI was a useful and reliable tool in the evaluation of brain edema following TBI. The AQP4 RNAi treatment reduced brain edema at the early stages of TBI (<12 h). In conclusion, the current study indicated the features, mechanism and radiological evaluation methods of brain edema at early stages of TBI, and provides new evidence for the importance of early intervention during and following TBI.
|
import { MidiFile } from "../src/midi-file";
let fs = require('fs');
let binary: Buffer = fs.readFileSync('./utils/testparse.mid');
let hex = '';
binary.forEach((value) => {
hex += ' ' + (value.toString(16).length === 1 ? 0 + value.toString(16) : value.toString(16));
});
fs.writeFileSync('./utils/testparse.mid.hex', hex, 'binary');
let newFile = MidiFile.fromBytes(binary);
console.log(newFile);
fs.writeFileSync('./utils/testparse.new.mid', newFile.toBytes(), 'binary');
binary = fs.readFileSync('./utils/testparse.new.mid');
hex = '';
binary.forEach((value) => {
hex += ' ' + (value.toString(16).length === 1 ? 0 + value.toString(16) : value.toString(16));
});
fs.writeFileSync('./utils/testparse.new.mid.hex', hex, 'binary');
|
Go home, impostors. Here's the undisputed best.
It's not often that you get to use a mortar and pestle in your food prep, but what may sounds like effort (or fun, depending on how you look at it) is really just a means to a seriously tasty end. From the homemade garlic aioli to the toasted beauty of a provolone blanket, if ever there was a steak sandwich to commit to memory, this is it. Our recipe makes three sandwiches, so plan to share (or, you know, don't).
Make the aioli: With a mortar and pestle, mash garlic with salt until a paste forms. Transfer paste to a small bowl and whisk in olive oil, mayonnaise, and lemon zest, and season with coarse ground pepper.
Make the steak: Brush steak with olive oil, season with salt and pepper, and sear both sides in a cast iron pan over medium-high heat. Cook 3 minutes a side to the desired temperature and remove from heat. Let steak rest 15 minutes before slicing. Slice against the grain in 2-inch sections.
Assemble the sandwich: Lightly butter the sliced roll and toast in a Krups toaster oven until golden. Place skirt steak on the bottom half of roll and place 2 slices of provolone on top.
Put back in toaster oven to melt cheese. Remove from oven and top with arugula and sliced Peppadew peppers. Generously spread the aioli on top half of roll before topping the finished sandwich.
|
<reponame>LeonardisOne/catalyst
/*
* Copyright 2015 the original author or authors.
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
package io.atomix.catalyst.buffer;
import io.atomix.catalyst.util.reference.ReferenceManager;
import io.atomix.catalyst.buffer.util.NativeMemory;
/**
* Native byte buffer implementation.
*
* @author <a href="http://github.com/kuujo"><NAME></a>
*/
public abstract class NativeBuffer extends AbstractBuffer {
protected NativeBuffer(NativeBytes bytes, ReferenceManager<Buffer> referenceManager) {
super(bytes, referenceManager);
}
protected NativeBuffer(NativeBytes bytes, long offset, long initialCapacity, long maxCapacity) {
super(bytes, offset, initialCapacity, maxCapacity, null);
}
@Override
protected void compact(long from, long to, long length) {
NativeMemory memory = ((NativeBytes) bytes).memory;
memory.unsafe().copyMemory(memory.address(from), memory.address(to), length);
memory.unsafe().setMemory(memory.address(from), length, (byte) 0);
}
}
|
Gov. Jerry Brown’s misguided tunnel vision on the Sacramento-San Joaquin River Delta has taken the focus off other valuable water projects California should be implementing.
Unlike the governor’s $17 billion twin-tunnel disaster, Assemblyman Richard Bloom’s AB 2480 would produce additional water for California, improve the state’s environment and help ward off or at least mitigate climate change.
It’s a no-brainer of an idea that should have been prioritized years ago. The bill has passed the Assembly and is currently winding its way through the Senate. The Senate should pass the bill and send it to the governor for his signature.
The Santa Monica Democrat’s legislation is aimed at maintaining the health of California’s watersheds, with a particular focus on five watersheds in the Northern Sierra that account for 80 percent of the state’s water.
Experts say that improvements to the Feather, McCloud, Pit, Trinity and Upper Sacramento watersheds could add an additional 5-20 percent to the state’s water supply. These watersheds already account for the water that 25 million Californians enjoy.
The bill would make the state’s watersheds eligible for water-project grant funding by proclaiming them an essential part of the state’s water infrastructure. The anticipated cost, roughly $2.5-$3 billion, is a fraction of the price tag for the Delta tunnel project, less than the estimated cost of the Sites dam project and far more environmentally sound.
In some areas, fire suppression tactics have allowed forests to become overgrown, hurting their capacity to absorb water. Logging and overgrazing by livestock have created areas in which erosion diminishes optimum conditions.
Bloom anticipates that the funds would be used to preserve and protect private and public forest lands and restore vital meadows.
It’s counterintuitive, but climate change experts believe that as Western states warm, the area where the Northern California watersheds are located will actually become cooler and likely wetter.
The projections give the state a rare opportunity to take advantage of the conditions and make preparations now that will result in additional water supply in later years.
Another important aspect of this is that these five watersheds provide about 80 percent of the water that flows into the San Francisco Bay. It’s essential that the state formally recognize its watersheds as part of our water infrastructure.
California’s lawmakers should pass AB 2480 and work toward crafting a strategy to fully integrate watershed management into the state’s long-term water infrastructure plan. There is much work to be done in this area, and passing this measure should be an important first step.
|
package ox.softeng.metadatacatalogue.api;
public class EnumerationValueApi extends DataModelComponentApi{
protected EnumerationValueApi() { } // Private constructor as it makes no sense to instantiate this!
}
|
/**
* Utility class for working with permissions in OG-liveData
*/
public final class PermissionUtils {
/**
* Name of the permission field in live or snapshot data.
* The value is expected to be a permission string.
*/
public static final String LIVE_DATA_PERMISSION_FIELD = "og:livedata:permission";
/**
* Name of the field used to indicate a permission error.
* The value is expected to be a string error message.
*/
public static final String LIVE_DATA_PERMISSION_DENIED_FIELD = "og:livedata:permission:denied";
/**
* Restricted constructor.
*/
private PermissionUtils() {
}
}
|
declare const _default: {
1: string;
2: string;
11: string;
21: string;
31: string;
32: string;
33: string;
34: string;
35: string;
36: string;
37: string;
};
export default _default;
|
Broadband is a form of telecommunication that employs a wide band of frequencies that allows data to be multiplexed and transmitted concurrently over different frequencies within the band. This allows more data to be transmitted at one time. Broadband technology uses frequencies that typically range from approximately 25 KHz to approximately 1.1 MHz. There are many impediments to establishing broadband communication connections over typical telecommunications networks. A typical telecommunications network supports voice-band communication. The voice-band is the range of frequencies that is generally audible and used for the transmission of speech (i.e., approximately 300 Hz-4000 kHz). A typical telecommunications system is comprised of a central office (“CO”) and a connecting network (local loop). A typical network includes COs that are connected to individual end-users through a main distribution frame (“MDF”). A twisted pair of copper wires typically connects the MDF and the end-users and comprises the local loop. Local loops are generally designed for voice-band communication. Each CO is interconnected through inter-CO network.
The CO contains the necessary switching equipment and the local loop is the intermediate network between the CO and the terminating equipment, commonly referred to as customer premises equipment (“CPE”), of the end-user. CPEs may include terminals, telephones, modems, etc. that are installed at the end-user's premises and connected to the telecommunications system.
A common type of broadband connection is a digital subscriber line (“DSL”). DSL provides high-speed data access (for example, high speed Internet access). The cost is low because DSL works on existing copper telephone wires, obviating the need for costly installation of higher-grade cable.
In a typical telephone network, some local loops will support a broadband connection and some will not. That is, a local loop of a typical telecommunications system may have various characteristics that preclude or impair a DSL or other broadband connection. Typical loop impairments to a broadband connection include a loading coil present on the loop and excessive loop length, as well as cross-talking, bridge-taps, and others.
|
<reponame>umkcdcrg01/ryu_openflow
import gc
import sys
from ryu.services.protocols.bgp.operator.command import Command
from ryu.services.protocols.bgp.operator.command import CommandsResponse
from ryu.services.protocols.bgp.operator.command import STATUS_ERROR
from ryu.services.protocols.bgp.operator.command import STATUS_OK
class Memory(Command):
help_msg = 'show memory information'
command = 'memory'
def __init__(self, *args, **kwargs):
super(Memory, self).__init__(*args, **kwargs)
self.subcommands = {
'summary': self.Summary}
class Summary(Command):
help_msg = 'shows total memory used and how it is getting used'
command = 'summary'
def action(self, params):
count = {}
size = {}
total_size = 0
unreachable = gc.collect()
for obj in gc.get_objects():
inst_name = type(obj).__name__
c = count.get(inst_name, None)
if not c:
count[inst_name] = 0
s = size.get(inst_name, None)
if not s:
size[inst_name] = 0
count[inst_name] += 1
s = sys.getsizeof(obj)
size[inst_name] += s
total_size += s
# Total size in MB
total_size = total_size / 1000000
ret = {
'unreachable': unreachable,
'total': total_size,
'summary': []}
for class_name, s in size.items():
# Calculate size in MB
size_mb = s / 1000000
# We are only interested in class which take-up more than a MB
if size_mb > 0:
ret['summary'].append(
{
'class': class_name,
'instances': count.get(class_name, None),
'size': size_mb
}
)
return CommandsResponse(STATUS_OK, ret)
@classmethod
def cli_resp_formatter(cls, resp):
if resp.status == STATUS_ERROR:
return Command.cli_resp_formatter(resp)
val = resp.value
ret = 'Unreachable objects: {0}\n'.format(
val.get('unreachable', None)
)
ret += 'Total memory used (MB): {0}\n'.format(
val.get('total', None)
)
ret += 'Classes with instances that take-up more than one MB:\n'
ret += '{0:<20s} {1:>16s} {2:>16s}\n'.format(
'Class',
'#Instance',
'Size(MB)'
)
for s in val.get('summary', []):
ret += '{0:<20s} {1:>16d} {2:>16d}\n'.format(
s.get('class', None), s.get('instances', None),
s.get('size', None)
)
return ret
|
The Los Angeles Lakers lost their third consecutive game on Tuesday night when they played against the Indiana Pacers, bringing their record to 1-3 on the season. The team once again tried to overcome a relatively sluggish start by fighting hard down the stretch, but ultimately couldn’t stop Paul George as the Pacers closed out down the stretch.
Despite the result, hosts Harrison Faigen and Anthony Irwin thought the game was another promising sign for the Lakers, who continue to compete and play respectably in these losses. The two discussed what they saw from the team, why Ivica Zubac isn’t playing more, Kobe Bryant’s “funeral,” and Anthony dunking on his dog in the latest episode of Locked on Lakers:
As always, if you enjoy the show, you can find our iTunes channel here (and give us a nice rating if you’re so inclined), or you can listen to the podcast directly through Audioboom below. Lastly, don’t forget to follow Harrison and Anthony on Twitter at @hmfaigen and @AnthonyIrwinLA:
|
X-Ray Emission from the Double Neutron Star Binary B1534+12: Powered by the Pulsar Wind? We report the detection of the double neutron star binary (DNSB) B1534+12 (=J1537+1155) with the Chandra X-Ray Observatory. This DNSB (Porb = 10.1 hr) consists of the millisecond (recycled) pulsar J1537+1155A (PA = 37.9 ms) and a neutron star not detected in the radio. After the remarkable double pulsar binary J0737-3039, it is the only other DNSB detected in X-rays. We measured the flux of (2.2 ± 0.6) 10-15 ergs s-1 cm-2 in the 0.3-6 keV band. The small number of collected counts allows only crude estimates of spectral parameters. The power-law fit yields the photon index = 3.2 ± 0.5 and the unabsorbed 0.2-10 keV luminosity LX ≈ 6 1029 ergs s-1 ≈ 3 10-4A, where A is the spin-down power of J1537+1155A. Alternatively, the spectrum can be fitted by a blackbody model with T ≈ 2.2 MK and the projected emitting area of ~5 103 m2. The distribution of photon arrival times over binary orbital phase shows a deficit of X-ray emission around apastron, which suggests that the emission is caused by interaction of the relativistic wind from J1537+1155A with its neutron star companion. We also reanalyzed the Chandra and XMM-Newton observations of J0737-3039 and found that its X-ray spectrum is similar to the spectrum of B1534+12, and its X-ray luminosity is about the same fraction of A, which suggests similar X-ray emission mechanisms. However, the X-ray emission from J0737-3039 does not show orbital phase dependence. This difference can be explained by the smaller eccentricity of J0737-3039 or a smaller misalignment between the equatorial plane of the millisecond pulsar and the orbital plane of the binary.
|
Probabilistic universal learning network Universal learning network (ULN) is a framework for the modelling and control of nonlinear large-scale complex systems such as physical, social and economical systems. A generalized learning algorithm has been proposed for ULN, which can be used in a unified manner for almost all kinds of networks such as static/dynamic networks, layered/recurrent type networks, time delay neural networks and multibranch networks. But, as the signals transmitted through the ULN should be deterministic, the stochastic signals which are contaminated with noise can not be propagated through the ULN. In this paper, Probabilistic Universal Learning Network (PrULN) is presented, where a new learning algorithm to optimize the criterion function is defined on the stochastic dynamic systems. By using PrULN, the following are expected: the generalization capability of the learning networks will be improved, more sophisticated stochastic control will be obtained than the conventional stochastic control, designing problems for the complex systems such as chaotic systems are expected to develop, whereas now the main research topics for the chaotic systems are only the analysis of the systems.
|
Semiparametric Estimation of Consumer Demand Systems with Micro Data Maximum likelihood and two-step estimators of censored demand systems yield biased and inconsistent parameter estimates when the assumed joint distribution of disturbances is incorrect. This paper proposes a semiparametric estimator that retains the computational advantage of the two-step approach but is immune to distributional misspecification. The key difference between the proposed estimator and the two-step estimator is that the parameters of the binary censoring equations are estimated using a distribution-free single-index model. We implement the proposed estimator using household-level data obtained from the Hainan province in China. specification test lends support to our approach.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.